NEXAFS characterization of DNA components and molecular-orientation of surface-bound DNA oligomers
International Nuclear Information System (INIS)
Samuel, Newton T.; Lee, C.-Y.; Gamble, Lara J.; Fischer, Daniel A.; Castner, David G.
2006-01-01
Single stranded DNA oligomers (ssDNA) immobilized onto solid surfaces forms the basis for several biotechnological applications such as DNA microarrays, affinity separations, and biosensors. Surface structure of Surface-bound oligomers is expected to significantly influence their biological activity and interactions with the environment. In this study near-edge X-ray absorption fine structure spectroscopy (NEXAFS) is used to characterize the components of DNA (nucleobases, nucleotides and nucleosides) and the orientation information of surface-bound ssDNA. The K-edges of carbon, nitrogen and oxygen have spectra with features that are characteristic of the different chemical species present in the nucleobases of DNA. The effect of addition of the DNA sugar and phosphate components on the NEXAFS K-edge spectra was also investigated. The polarization-dependent nitrogen K-edge NEXAFS data show significant changes for different orientations of surface bound ssDNA. These results establish NEXAFS as a powerful technique for chemical and structural characterization of surface-bound DNA oligomers
Bozeman, Trevor C; Nanjunda, Rupesh; Tang, Chenhong; Liu, Yang; Segerman, Zachary J; Zaleski, Paul A; Wilson, W David; Hecht, Sidney M
2012-10-31
Recent studies involving DNAs bound strongly by bleomycins have documented that such DNAs are degraded by the antitumor antibiotic with characteristics different from those observed when studying the cleavage of randomly chosen DNAs in the presence of excess Fe·BLM. In the present study, surface plasmon resonance has been used to characterize the dynamics of BLM B(2) binding to a strongly bound hairpin DNA, to define the effects of Fe(3+), salt, and temperature on BLM-DNA interaction. One strong primary DNA binding site, and at least one much weaker site, were documented. In contrast, more than one strong cleavage site was found, an observation also made for two other hairpin DNAs. Evidence is presented for BLM equilibration between the stronger and weaker binding sites in a way that renders BLM unavailable to other, less strongly bound DNAs. Thus, enhanced binding to a given site does not necessarily result in increased DNA degradation at that site; i.e., for strongly bound DNAs, the facility of DNA cleavage must involve other parameters in addition to the intrinsic rate of C-4' H atom abstraction from DNA sugars.
Hybridization thermodynamics of DNA bound to gold nanoparticles
International Nuclear Information System (INIS)
Lang, Brian
2010-01-01
Isothermal Titration Calorimetry (ITC) was used to study the thermodynamics of hybridization on DNA-functionalized colloidal gold nanoparticles. When compared to the thermodynamics of hybridization of DNA that is free in solution, the differences in the values of the Gibbs free energy of reaction, Δ r G o , the enthalpy, Δ r H o , and entropy, Δ r S o , were small. The change in Δ r G o between the free and bound states was always positive but with statistical significance outside the 95% confidence interval, implying the free DNA is slightly more stable than when in the bound state. Additionally, ITC was also able to reveal information about the binding stoichiometry of the hybridization reactions on the DNA-functionalized gold nanoparticles, and indicates that there is a significant fraction of the DNA on gold nanoparticle surface that is unavailable for DNA hybridization. Furthermore, the fraction of available DNA is dependent on the spacer group on the DNA that is used to span the gold surface from that to the probe DNA.
UV-Visible Spectroscopy-Based Quantification of Unlabeled DNA Bound to Gold Nanoparticles.
Baldock, Brandi L; Hutchison, James E
2016-12-20
DNA-functionalized gold nanoparticles have been increasingly applied as sensitive and selective analytical probes and biosensors. The DNA ligands bound to a nanoparticle dictate its reactivity, making it essential to know the type and number of DNA strands bound to the nanoparticle surface. Existing methods used to determine the number of DNA strands per gold nanoparticle (AuNP) require that the sequences be fluorophore-labeled, which may affect the DNA surface coverage and reactivity of the nanoparticle and/or require specialized equipment and other fluorophore-containing reagents. We report a UV-visible-based method to conveniently and inexpensively determine the number of DNA strands attached to AuNPs of different core sizes. When this method is used in tandem with a fluorescence dye assay, it is possible to determine the ratio of two unlabeled sequences of different lengths bound to AuNPs. Two sizes of citrate-stabilized AuNPs (5 and 12 nm) were functionalized with mixtures of short (5 base) and long (32 base) disulfide-terminated DNA sequences, and the ratios of sequences bound to the AuNPs were determined using the new method. The long DNA sequence was present as a lower proportion of the ligand shell than in the ligand exchange mixture, suggesting it had a lower propensity to bind the AuNPs than the short DNA sequence. The ratio of DNA sequences bound to the AuNPs was not the same for the large and small AuNPs, which suggests that the radius of curvature had a significant influence on the assembly of DNA strands onto the AuNPs.
The subglacial Lake Vostok (East Antarctica) surface snow is Earth-bound DNA (and dust)-free
Bulat, S.; Marie, D.; Bulat, E.; Alekhina, I.; Petit, J.-R.
2012-09-01
came up with only contaminant bacterial phylotypes (mostly of human source). The bioexposure trials showed that even in one day of open exposure the gDNA of rather complex microbial community composition was fatally damaged in terms of long-, mid-range and short-size amplicon generation in PCR. All this testify for very harsh conditions for life to survive the climate conditions of Central East Antarctica which could be considered as a presentday 'zone mortale' or 'polar desert' for known Earthbound microbial life forms. In addition this means that no life seeds are expected to reach subglacial lakes and water reservoirs and establish indigenous lake microbiota during their transit through the thick and aged Antarctic ice sheet upon its bottom melting. In general the subglacial Lake Vostok surface (ice sheet as well) environ represents the unique test area (sterile - in fact Earth-bound DNA-free and clean - in fact Earth-bound dust-free) for advancing extraterrestrial (ET) life detection technologies and searching for ET life indices in AMMs and IDPs.
Twisting, supercoiling and stretching in protein bound DNA
Lam, Pui-Man; Zhen, Yi
2018-04-01
We have calculated theoretical results for the torque and slope of the twisted DNA, with various proteins bound on it, using the Neukirch-Marko model, in the regime where plectonemes exist. We found that the torque in the protein bound DNA decreases compared to that in the bare DNA. This is caused by the decrease in the free energy g(f) , and hence the smaller persistence lengths, in the case of protein bound DNA. We hope our results will encourage experimental investigations of supercoiling in protein bound DNA, which can provide further tests of the Neukirch-Marko model.
Metallization of DNA on silicon surface
International Nuclear Information System (INIS)
Puchkova, Anastasiya Olegovna; Sokolov, Petr; Petrov, Yuri Vladimirovich; Kasyanenko, Nina Anatolievna
2011-01-01
New simple way for silver deoxyribonucleic acid (DNA)-based nanowires preparation on silicon surface was developed. The electrochemical reduction of silver ions fixed on DNA molecule provides the forming of tightly matched zonate silver clusters. Highly homogeneous metallic clusters have a size about 30 nm. So the thickness of nanowires does not exceed 30–50 nm. The surface of n-type silicon monocrystal is the most convenient substrate for this procedure. The comparative analysis of DNA metallization on of n-type silicon with a similar way for nanowires fabrication on p-type silicon, freshly cleaved mica, and glass surface shows the advantage of n-type silicon, which is not only the substrate for DNA fixation but also the source of electrons for silver reduction. Images of bound DNA molecules and fabricated nanowires have been obtained using an atomic force microscope and a scanning ion helium microscope. DNA interaction with silver ions in a solution was examined by the methods of ultraviolet spectroscopy and circular dichroism.
DNA conformation on surfaces measured by fluorescence self-interference.
Moiseev, Lev; Unlü, M Selim; Swan, Anna K; Goldberg, Bennett B; Cantor, Charles R
2006-02-21
The conformation of DNA molecules tethered to the surface of a microarray may significantly affect the efficiency of hybridization. Although a number of methods have been applied to determine the structure of the DNA layer, they are not very sensitive to variations in the shape of DNA molecules. Here we describe the application of an interferometric technique called spectral self-interference fluorescence microscopy to the precise measurement of the average location of a fluorescent label in a DNA layer relative to the surface and thus determine specific information on the conformation of the surface-bound DNA molecules. Using spectral self-interference fluorescence microscopy, we have estimated the shape of coiled single-stranded DNA, the average tilt of double-stranded DNA of different lengths, and the amount of hybridization. The data provide important proofs of concept for the capabilities of novel optical surface analytical methods of the molecular disposition of DNA on surfaces. The determination of DNA conformations on surfaces and hybridization behavior provide information required to move DNA interfacial applications forward and thus impact emerging clinical and biotechnological fields.
Molecular dynamics simulations of DNA-free and DNA-bound TAL effectors.
Directory of Open Access Journals (Sweden)
Hua Wan
Full Text Available TAL (transcriptional activator-like effectors (TALEs are DNA-binding proteins, containing a modular central domain that recognizes specific DNA sequences. Recently, the crystallographic studies of TALEs revealed the structure of DNA-recognition domain. In this article, molecular dynamics (MD simulations are employed to study two crystal structures of an 11.5-repeat TALE, in the presence and absence of DNA, respectively. The simulated results indicate that the specific binding of RVDs (repeat-variable diresidues with DNA leads to the markedly reduced fluctuations of tandem repeats, especially at the two ends. In the DNA-bound TALE system, the base-specific interaction is formed mainly by the residue at position 13 within a TAL repeat. Tandem repeats with weak RVDs are unfavorable for the TALE-DNA binding. These observations are consistent with experimental studies. By using principal component analysis (PCA, the dominant motions are open-close movements between the two ends of the superhelical structure in both DNA-free and DNA-bound TALE systems. The open-close movements are found to be critical for the recognition and binding of TALE-DNA based on the analysis of free energy landscape (FEL. The conformational analysis of DNA indicates that the 5' end of DNA target sequence has more remarkable structural deformability than the other sites. Meanwhile, the conformational change of DNA is likely associated with the specific interaction of TALE-DNA. We further suggest that the arrangement of N-terminal repeats with strong RVDs may help in the design of efficient TALEs. This study provides some new insights into the understanding of the TALE-DNA recognition mechanism.
Curcumin inhibits hepatitis B virus infection by down-regulating cccDNA-bound histone acetylation.
Wei, Zhi-Qiang; Zhang, Yong-Hong; Ke, Chang-Zheng; Chen, Hong-Xia; Ren, Pan; He, Yu-Lin; Hu, Pei; Ma, De-Qiang; Luo, Jie; Meng, Zhong-Ji
2017-09-14
To investigate the potential effect of curcumin on hepatitis B virus (HBV) covalently closed circular DNA (cccDNA) and the underlying mechanism. A HepG2.2.15 cell line stably transfected with HBV was treated with curcumin, and HBV surface antigen (HBsAg) and e antigen (HBeAg) expression levels were assessed by ELISA. Intracellular HBV DNA replication intermediates and cccDNA were detected by Southern blot and real-time PCR, respectively. The acetylation levels of histones H3 and H4 were measured by Western blot. H3/H4-bound cccDNA was detected by chromatin immunoprecipitation (ChIP) assays. The deacetylase inhibitors trichostatin A and sodium butyrate were used to study the mechanism of action for curcumin. Additionally, short interfering RNAs (siRNAs) targeting HBV were tested along with curcumin. Curcumin treatment led to time- and dose-dependent reductions in HBsAg and HBeAg expression and significant reductions in intracellular HBV DNA replication intermediates and HBV cccDNA. After treatment with 20 μmol/L curcumin for 2 d, HBsAg and cccDNA levels in HepG2.2.15 cells were reduced by up to 57.7% ( P curcumin, accompanied by reductions in H3- and H4-bound cccDNA. Furthermore, the deacetylase inhibitors trichostatin A and sodium butyrate could block the effects of curcumin. Additionally, transfection of siRNAs targeting HBV enhanced the inhibitory effects of curcumin. Curcumin inhibits HBV gene replication via down-regulation of cccDNA-bound histone acetylation and has the potential to be developed as a cccDNA-targeting antiviral agent for hepatitis B.
Ancient microbes from halite fluid inclusions: optimized surface sterilization and DNA extraction.
Directory of Open Access Journals (Sweden)
Krithivasan Sankaranarayanan
Full Text Available Fluid inclusions in evaporite minerals (halite, gypsum, etc. potentially preserve genetic records of microbial diversity and changing environmental conditions of Earth's hydrosphere for nearly one billion years. Here we describe a robust protocol for surface sterilization and retrieval of DNA from fluid inclusions in halite that, unlike previously published methods, guarantees removal of potentially contaminating surface-bound DNA. The protocol involves microscopic visualization of cell structures, deliberate surface contamination followed by surface sterilization with acid and bleach washes, and DNA extraction using Amicon centrifugal filters. Methods were verified on halite crystals of four different ages from Saline Valley, California (modern, 36 ka, 64 ka, and 150 ka, with retrieval of algal and archaeal DNA, and characterization of the algal community using ITS1 sequences. The protocol we developed opens up new avenues for study of ancient microbial ecosystems in fluid inclusions, understanding microbial evolution across geological time, and investigating the antiquity of life on earth and other parts of the solar system.
Ancient microbes from halite fluid inclusions: optimized surface sterilization and DNA extraction.
Sankaranarayanan, Krithivasan; Timofeeff, Michael N; Spathis, Rita; Lowenstein, Tim K; Lum, J Koji
2011-01-01
Fluid inclusions in evaporite minerals (halite, gypsum, etc.) potentially preserve genetic records of microbial diversity and changing environmental conditions of Earth's hydrosphere for nearly one billion years. Here we describe a robust protocol for surface sterilization and retrieval of DNA from fluid inclusions in halite that, unlike previously published methods, guarantees removal of potentially contaminating surface-bound DNA. The protocol involves microscopic visualization of cell structures, deliberate surface contamination followed by surface sterilization with acid and bleach washes, and DNA extraction using Amicon centrifugal filters. Methods were verified on halite crystals of four different ages from Saline Valley, California (modern, 36 ka, 64 ka, and 150 ka), with retrieval of algal and archaeal DNA, and characterization of the algal community using ITS1 sequences. The protocol we developed opens up new avenues for study of ancient microbial ecosystems in fluid inclusions, understanding microbial evolution across geological time, and investigating the antiquity of life on earth and other parts of the solar system.
Generalized surface tension bounds in vacuum decay
Masoumi, Ali; Paban, Sonia; Weinberg, Erick J.
2018-02-01
Coleman and De Luccia (CDL) showed that gravitational effects can prevent the decay by bubble nucleation of a Minkowski or AdS false vacuum. In their thin-wall approximation this happens whenever the surface tension in the bubble wall exceeds an upper bound proportional to the difference of the square roots of the true and false vacuum energy densities. Recently it was shown that there is another type of thin-wall regime that differs from that of CDL in that the radius of curvature grows substantially as one moves through the wall. Not only does the CDL derivation of the bound fail in this case, but also its very formulation becomes ambiguous because the surface tension is not well defined. We propose a definition of the surface tension and show that it obeys a bound similar in form to that of the CDL case. We then show that both thin-wall bounds are special cases of a more general bound that is satisfied for all bounce solutions with Minkowski or AdS false vacua. We discuss the limit where the parameters of the theory attain critical values and the bound is saturated. The bounce solution then disappears and a static planar domain wall solution appears in its stead. The scalar field potential then is of the form expected in supergravity, but this is only guaranteed along the trajectory in field space traced out by the bounce.
Regulating DNA Self-assembly by DNA-Surface Interactions.
Liu, Longfei; Li, Yulin; Wang, Yong; Zheng, Jianwei; Mao, Chengde
2017-12-14
DNA self-assembly provides a powerful approach for preparation of nanostructures. It is often studied in bulk solution and involves only DNA-DNA interactions. When confined to surfaces, DNA-surface interactions become an additional, important factor to DNA self-assembly. However, the way in which DNA-surface interactions influence DNA self-assembly is not well studied. In this study, we showed that weak DNA-DNA interactions could be stabilized by DNA-surface interactions to allow large DNA nanostructures to form. In addition, the assembly can be conducted isothermally at room temperature in as little as 5 seconds. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Crystal Structure of a Eukaryotic GEN1 Resolving Enzyme Bound to DNA
Directory of Open Access Journals (Sweden)
Yijin Liu
2015-12-01
Full Text Available We present the crystal structure of the junction-resolving enzyme GEN1 bound to DNA at 2.5 Å resolution. The structure of the GEN1 protein reveals it to have an elaborated FEN-XPG family fold that is modified for its role in four-way junction resolution. The functional unit in the crystal is a monomer of active GEN1 bound to the product of resolution cleavage, with an extensive DNA binding interface for both helical arms. Within the crystal lattice, a GEN1 dimer interface juxtaposes two products, whereby they can be reconnected into a four-way junction, the structure of which agrees with that determined in solution. The reconnection requires some opening of the DNA structure at the center, in agreement with permanganate probing and 2-aminopurine fluorescence. The structure shows that a relaxation of the DNA structure accompanies cleavage, suggesting how second-strand cleavage is accelerated to ensure productive resolution of the junction.
Energy Technology Data Exchange (ETDEWEB)
Kim, Shin Ae; Jang, Sung Min; Kim, Sung June [School of Electrical Engineering and Computer Science, Seoul National University, Seoul 151-742 (Korea, Republic of); Byun, Kyung Min [Department of Biomedical Engineering, Kyung Hee University, Yongin 446-701 (Korea, Republic of); Kim, Kyujung; Kim, Donghyun [Program of Nanomedical Science and Technology, Yonsei University, Seoul 120-749 (Korea, Republic of); Ma, Kyungjae; Oh, Youngjin [School of Electrical and Electronic Engineering, Yonsei University, Seoul 120-749 (Korea, Republic of); Kim, Sung Guk [College of Veterinary Medicine, Cornell University, Ithaca, New York 14853 (United States); Shuler, Michael L, E-mail: kmbyun@khu.ac.kr [Department of Biomedical Engineering, Cornell University, Ithaca, New York 14853 (United States)
2010-09-03
We demonstrated enhanced localized surface plasmon resonance (SPR) biosensing based on subwavelength gold nanoarrays built on a thin gold film. Arrays of nanogratings (1D) and nanoholes (2D) with a period of 200 nm were fabricated by electron-beam lithography and used for the detection of avian influenza DNA hybridization. Experimental results showed that both nanoarrays provided significant sensitivity improvement and, especially, 1D nanogratings exhibited higher SPR signal amplification compared with 2D nanohole arrays. The sensitivity enhancement is associated with changes in surface-limited reaction area and strong interactions between bound molecules and localized plasmon fields. Our approach is expected to improve both the sensitivity and sensing resolution and can be applicable to label-free detection of DNA without amplification by polymerase chain reaction.
Estimation of absorbed dose in cell nuclei due to DNA-bound /sup 3/H
Energy Technology Data Exchange (ETDEWEB)
Saito, M; Ishida, M R; Streffer, C; Molls, M
1985-04-01
The average absorbed dose due to DNA-bound /sup 3/H in a cell nucleus was estimated by a Monte Carlo simulation for a model nucleus which was assumed to be spheroidal. The volume of the cell nucleus was the major dose-determining factor for cell nuclei which have the same DNA content and the same specific activity of DNA. This result was applied to estimating the accumulated dose in the cell nuclei of organs of young mice born from mother mice which ingested /sup 3/H-thymidine with drinking water during pregnancy. The values of dose-modifying factors for the accumulated dose due to DNA-bound /sup 3/H compared to the dose due to an assumed homogenous distribution of /sup 3/H in organ were found to be between about 2 and 6 for the various organs.
Footprinting of Chlorella virus DNA ligase bound at a nick in duplex DNA.
Odell, M; Shuman, S
1999-05-14
The 298-amino acid ATP-dependent DNA ligase of Chlorella virus PBCV-1 is the smallest eukaryotic DNA ligase known. The enzyme has intrinsic specificity for binding to nicked duplex DNA. To delineate the ligase-DNA interface, we have footprinted the enzyme binding site on DNA and the DNA binding site on ligase. The size of the exonuclease III footprint of ligase bound a single nick in duplex DNA is 19-21 nucleotides. The footprint is asymmetric, extending 8-9 nucleotides on the 3'-OH side of the nick and 11-12 nucleotides on the 5'-phosphate side. The 5'-phosphate moiety is essential for the binding of Chlorella virus ligase to nicked DNA. Here we show that the 3'-OH moiety is not required for nick recognition. The Chlorella virus ligase binds to a nicked ligand containing 2',3'-dideoxy and 5'-phosphate termini, but cannot catalyze adenylation of the 5'-end. Hence, the 3'-OH is important for step 2 chemistry even though it is not itself chemically transformed during DNA-adenylate formation. A 2'-OH cannot substitute for the essential 3'-OH in adenylation at a nick or even in strand closure at a preadenylated nick. The protein side of the ligase-DNA interface was probed by limited proteolysis of ligase with trypsin and chymotrypsin in the presence and absence of nicked DNA. Protease accessible sites are clustered within a short segment from amino acids 210-225 located distal to conserved motif V. The ligase is protected from proteolysis by nicked DNA. Protease cleavage of the native enzyme prior to DNA addition results in loss of DNA binding. These results suggest a bipartite domain structure in which the interdomain segment either comprises part of the DNA binding site or undergoes a conformational change upon DNA binding. The domain structure of Chlorella virus ligase inferred from the solution experiments is consistent with the structure of T7 DNA ligase determined by x-ray crystallography.
Effective bounds for Brauer groups of Kummer surfaces over number fields
DEFF Research Database (Denmark)
Cantoral-Farfan, Victoria; Tang, Yunqing; Tanimoto, Sho
2018-01-01
We study effective bounds for Brauer groups of Kummer surfaces associated to the Jacobians of curves of genus 2.......We study effective bounds for Brauer groups of Kummer surfaces associated to the Jacobians of curves of genus 2....
Li, Qin; Cui, Chenchen; Higgins, Daniel A; Li, Jun
2012-09-05
The potential-dependent reorientation dynamics of double-stranded DNA (ds-DNA) attached to planar glassy carbon electrode (GCE) surfaces were investigated. The orientation state of surface-bound ds-DNA was followed by monitoring the fluorescence from a 6-carboxyfluorescein (FAM6) fluorophore covalently linked to the distal end of the DNA. Positive potentials (i.e., +0.2 V vs open circuit potential, OCP) caused the ds-DNA to align parallel to the electrode surface, resulting in strong dipole-electrode quenching of FAM6 fluorescence. Switching of the GCE potential to negative values (i.e., -0.2 V vs OCP) caused the ds-DNA to reorient perpendicular to the electrode surface, with a concomitant increase in FAM6 fluorescence. In addition to the very fast (submilliseconds) dynamics of the initial reorientation process, slow (0.1-0.9 s) relaxation of FAM6 fluorescence to intermediate levels was also observed after potential switching. These dynamics have not been previously described in the literature. They are too slow to be explained by double layer charging, and chronoamperometry data showed no evidence of such effects. Both the amplitude and rate of the dynamics were found to depend upon buffer concentration, and ds-DNA length, demonstrating a dependence on the double layer field. The dynamics are concluded to arise from previously undetected complexities in the mechanism of potential-dependent ds-DNA reorientation. The possible origins of these dynamics are discussed. A better understanding of these dynamics will lead to improved models for potential-dependent ds-DNA reorientation at electrode surfaces and will facilitate the development of advanced electrochemical devices for detection of target DNAs.
Surface-bound states in nanodiamonds
Han, Peng; Antonov, Denis; Wrachtrup, Jörg; Bester, Gabriel
2017-05-01
We show via ab initio calculations and an electrostatic model that the notoriously low, but positive, electron affinity of bulk diamond becomes negative for hydrogen passivated nanodiamonds and argue that this peculiar situation (type-II offset with a vacuum level at nearly midgap) and the three further conditions: (i) a surface dipole with positive charge on the outside layer, (ii) a spherical symmetry, and (iii) a dielectric mismatch at the surface, results in the emergence of a peculiar type of surface state localized just outside the nanodiamond. These states are referred to as "surface-bound states" and have consequently a strong environmental sensitivity. These type of states should exist in any nanostructure with negative electron affinity. We further quantify the band offsets of different type of nanostructures as well as the exciton binding energy and contrast the results with results for "conventional" silicon quantum dots.
Energy Technology Data Exchange (ETDEWEB)
Dolan, Kyle T.; Duguid, Erica M.; He, Chuan (UC)
2011-11-17
SlyA is a master virulence regulator that controls the transcription of numerous genes in Salmonella enterica. We present here crystal structures of SlyA by itself and bound to a high-affinity DNA operator sequence in the slyA gene. SlyA interacts with DNA through direct recognition of a guanine base by Arg-65, as well as interactions between conserved Arg-86 and the minor groove and a large network of non-base-specific contacts with the sugar phosphate backbone. Our structures, together with an unpublished structure of SlyA bound to the small molecule effector salicylate (Protein Data Bank code 3DEU), reveal that, unlike many other MarR family proteins, SlyA dissociates from DNA without large conformational changes when bound to this effector. We propose that SlyA and other MarR global regulators rely more on indirect readout of DNA sequence to exert control over many genes, in contrast to proteins (such as OhrR) that recognize a single operator.
Activation of the DnaK-ClpB Complex is Regulated by the Properties of the Bound Substrate.
Fernández-Higuero, Jose Angel; Aguado, Alejandra; Perales-Calvo, Judit; Moro, Fernando; Muga, Arturo
2018-04-11
The chaperone ClpB in bacteria is responsible for the reactivation of aggregated proteins in collaboration with the DnaK system. Association of these chaperones at the aggregate surface stimulates ATP hydrolysis, which mediates substrate remodeling. However, a question that remains unanswered is whether the bichaperone complex can be selectively activated by substrates that require remodeling. We find that large aggregates or bulky, native-like substrates activates the complex, whereas a smaller, permanently unfolded protein or extended, short peptides fail to stimulate it. Our data also indicate that ClpB interacts differently with DnaK in the presence of aggregates or small peptides, displaying a higher affinity for aggregate-bound DnaK, and that DnaK-ClpB collaboration requires the coupled ATPase-dependent remodeling activities of both chaperones. Complex stimulation is mediated by residues at the β subdomain of DnaK substrate binding domain, which become accessible to the disaggregase when the lid is allosterically detached from the β subdomain. Complex activation also requires an active NBD2 and the integrity of the M domain-ring of ClpB. Disruption of the M-domain ring allows the unproductive stimulation of the DnaK-ClpB complex in solution. The ability of the DnaK-ClpB complex to discrimínate different substrate proteins might allow its activation when client proteins require remodeling.
Antipina, M N; Gaĭnutdinov, R V; Rakhnianskaia, A A; Sergeev-Cherenkov, A N; Tolstikhina, A L; Iurova, T V; Kislov, V V; Khomutov, G B
2003-01-01
The formation of DNA complexes with Langmuir monolayers of the cationic lipid octadecylamine (ODA) and the new amphiphilic polycation poly-4-vinylpyridine with 16% of cetylpyridinium groups (PVP-16) on the surface of an aqueous solution of native DNA of low ionic strength was studied. Topographic images of Langmuir-Blodgett films of DNA/ODA and DNA/PVP-16 complexes applied to micaceous substrates were investigated by the method of atomic force microscopy. It was found that films of the amphiphilic polycation have an ordered planar polycrystalline structure. The morphology of planar DNA complexes with the amphiphilic cation substantially depended on the incubation time and the phase state of the monolayer on the surface of the aqueous DNA solution. Complex structures and individual DNA molecules were observed on the surface of the amphiphilic monolayer. Along with quasi-linear individual bound DNA molecules, characteristic extended net-like structures and quasi-circular toroidal condensed conformations of planar DNA complexes were detected. Mono- and multilayer films of DNA/PVP-16 complexes were used as templates and nanoreactors for the synthesis of inorganic nanostructures via the binding of metal cations from the solution and subsequent generation of the inorganic phase. As a result, ultrathin polymeric composite films with integrated DNA building blocks and quasi-linear arrays of inorganic semiconductor (CdS) and iron oxide nanoparticles and nanowires were obtained. The nanostructures obtained were characterized by scanning probe microscopy and transmission electron microscopy techniques. The methods developed are promising for investigating the mechanisms of structural organization and transformation in DNA and polyelectrolyte complexes at the gas-liquid interface and for the design of new extremely thin highly ordered planar polymeric and composite materials, films, and coatings with controlled ultrastructure for applications in nanoelectronics and
Controlling the surface density of DNA on gold by electrically induced desorption.
Arinaga, Kenji; Rant, Ulrich; Knezević, Jelena; Pringsheim, Erika; Tornow, Marc; Fujita, Shozo; Abstreiter, Gerhard; Yokoyama, Naoki
2007-10-31
We report on a method to control the packing density of sulfur-bound oligonucleotide layers on metal electrodes by electrical means. In a first step, a dense nucleic acid layer is deposited by self-assembly from solution; in a second step, defined fractions of DNA molecules are released from the surface by applying a series of negative voltage cycles. Systematic investigations of the influence of the applied electrode potentials and oligonucleotide length allow us to identify a sharp desorption onset at -0.65 V versus Ag/AgCl, which is independent of the DNA length. Moreover, our results clearly show the pronounced influence of competitive adsorbents in solution on the desorption behavior, which can prevent the re-adsorption of released DNA molecules, thereby enhancing the desorption efficiency. The method is fully bio-compatible and can be employed to improve the functionality of DNA layers. This is demonstrated in hybridization experiments revealing almost perfect yields for electrically "diluted" DNA layers. The proposed control method is extremely beneficial to the field of DNA-based sensors.
Surface electrostatic waves in bounded high temperature superconductors
International Nuclear Information System (INIS)
Averkov, Yu.O.; Yakovenko, V.M.
2008-01-01
The dispersion relations of surface electrostatic waves propagating along the surface of semi bounded layered superconductor and in the slab of layered superconductor are theoretically investigated. An arbitrary inclination of superconductor layers to the interface of a vacuum - crystal and an arbitrary direction of propagation of surface waves in the plane of the interface are taking into account. The possibility of initiation of an absolute instability during the propagation of a non-relativistic plasma stream above the surface of the layered superconductor is shown
Strand breaks in plasmid DNA following positional changes of Auger-electron-emitting radionuclides
International Nuclear Information System (INIS)
Adelstein, S.J.; Kassis, A.I.
1996-01-01
The purpose of our studies is to elucidate the kinetics of DNA strand breaks caused by low-energy Auger electron emitters in close proximity to DNA. Previously we have studied the DNA break yields in plasmids after the decay of indium-111 bound to DNA or free in solution. In this work, we compare the DNA break yields in supercoiled DNA of iodine-125 decaying close to DNA following DNA intercalation, minor-groove binding, or surface binding, and at a distance form DNA. Supercoiled DNA, stored at 4 C to accumulate radiation dose from the decay of 125 I, was then resolved by gel electrophoresis into supercoiled, nicked circular, and linear forms, representing undamaged DNA, single-strand breaks, and double-strand breaks respectively. DNA-intercalated or groove-bound 125 I is more effective than surface-bound radionuclide or 125 I free in solution. The hydroxyl radical scavenger DMSO protects against damage by 125 I free in solution but has minimal effect on damage by groove-bound 125 I. (orig.)
Keyamura, Kenji; Katayama, Tsutomu
2011-08-19
Chromosomal replication is initiated from the replication origin oriC in Escherichia coli by the active ATP-bound form of DnaA protein. The regulatory inactivation of DnaA (RIDA) system, a complex of the ADP-bound Hda and the DNA-loaded replicase clamp, represses extra initiations by facilitating DnaA-bound ATP hydrolysis, yielding the inactive ADP-bound form of DnaA. However, the mechanisms involved in promoting the DnaA-Hda interaction have not been determined except for the involvement of an interaction between the AAA+ domains of the two. This study revealed that DnaA Leu-422 and Pro-423 residues within DnaA domain IV, including a typical DNA-binding HTH motif, are specifically required for RIDA-dependent ATP hydrolysis in vitro and that these residues support efficient interaction with the DNA-loaded clamp·Hda complex and with Hda in vitro. Consistently, substitutions of these residues caused accumulation of ATP-bound DnaA in vivo and oriC-dependent inhibition of cell growth. Leu-422 plays a more important role in these activities than Pro-423. By contrast, neither of these residues is crucial for DNA replication from oriC, although they are highly conserved in DnaA orthologues. Structural analysis of a DnaA·Hda complex model suggested that these residues make contact with residues in the vicinity of the Hda AAA+ sensor I that participates in formation of a nucleotide-interacting surface. Together, the results show that functional DnaA-Hda interactions require a second interaction site within DnaA domain IV in addition to the AAA+ domain and suggest that these interactions are crucial for the formation of RIDA complexes that are active for DnaA-ATP hydrolysis.
Keyamura, Kenji; Katayama, Tsutomu
2011-01-01
Chromosomal replication is initiated from the replication origin oriC in Escherichia coli by the active ATP-bound form of DnaA protein. The regulatory inactivation of DnaA (RIDA) system, a complex of the ADP-bound Hda and the DNA-loaded replicase clamp, represses extra initiations by facilitating DnaA-bound ATP hydrolysis, yielding the inactive ADP-bound form of DnaA. However, the mechanisms involved in promoting the DnaA-Hda interaction have not been determined except for the involvement of an interaction between the AAA+ domains of the two. This study revealed that DnaA Leu-422 and Pro-423 residues within DnaA domain IV, including a typical DNA-binding HTH motif, are specifically required for RIDA-dependent ATP hydrolysis in vitro and that these residues support efficient interaction with the DNA-loaded clamp·Hda complex and with Hda in vitro. Consistently, substitutions of these residues caused accumulation of ATP-bound DnaA in vivo and oriC-dependent inhibition of cell growth. Leu-422 plays a more important role in these activities than Pro-423. By contrast, neither of these residues is crucial for DNA replication from oriC, although they are highly conserved in DnaA orthologues. Structural analysis of a DnaA·Hda complex model suggested that these residues make contact with residues in the vicinity of the Hda AAA+ sensor I that participates in formation of a nucleotide-interacting surface. Together, the results show that functional DnaA-Hda interactions require a second interaction site within DnaA domain IV in addition to the AAA+ domain and suggest that these interactions are crucial for the formation of RIDA complexes that are active for DnaA-ATP hydrolysis. PMID:21708944
HARP preferentially co-purifies with RPA bound to DNA-PK and blocks RPA phosphorylation.
Quan, Jinhua; Yusufzai, Timur
2014-05-01
The HepA-related protein (HARP/SMARCAL1) is an ATP-dependent annealing helicase that is capable of rewinding DNA structures that are stably unwound due to binding of the single-stranded DNA (ssDNA)-binding protein Replication Protein A (RPA). HARP has been implicated in maintaining genome integrity through its role in DNA replication and repair, two processes that generate RPA-coated ssDNA. In addition, mutations in HARP cause a rare disease known as Schimke immuno-osseous dysplasia. In this study, we purified HARP containing complexes with the goal of identifying the predominant factors that stably associate with HARP. We found that HARP preferentially interacts with RPA molecules that are bound to the DNA-dependent protein kinase (DNA-PK). We also found that RPA is phosphorylated by DNA-PK in vitro, while the RPA-HARP complexes are not. Our results suggest that, in addition to its annealing helicase activity, which eliminates the natural binding substrate for RPA, HARP blocks the phosphorylation of RPA by DNA-PK.
International Nuclear Information System (INIS)
Lee, C.; Gamble, L.; Grainger, D.; Castner, D.
2006-01-01
Reliable, direct 'sample-to-answer' capture of nucleic acid targets from complex media would greatly improve existing capabilities of DNA microarrays and biosensors. This goal has proven elusive for many current nucleic acid detection technologies attempting to produce assay results directly from complex real-world samples, including food, tissue, and environmental materials. In this study, we have investigated mixed self-assembled thiolated single-strand DNA (ssDNA) monolayers containing a short thiolated oligo(ethylene glycol) (OEG) surface diluent on gold surfaces to improve the specific capture of DNA targets from complex media. Both surface composition and orientation of these mixed DNA monolayers were characterized with x-ray photoelectron spectroscopy (XPS) and near-edge x-ray absorption fine structure (NEXAFS). XPS results from sequentially adsorbed ssDNA/OEG monolayers on gold indicate that thiolated OEG diluent molecules first incorporate into the thiolated ssDNA monolayer and, upon longer OEG exposures, competitively displace adsorbed ssDNA molecules from the gold surface. NEXAFS polarization dependence results (followed by monitoring the N 1s→π* transition) indicate that adsorbed thiolated ssDNA nucleotide base-ring structures in the mixed ssDNA monolayers are oriented more parallel to the gold surface compared to DNA bases in pure ssDNA monolayers. This supports ssDNA oligomer reorientation towards a more upright position upon OEG mixed adlayer incorporation. DNA target hybridization on mixed ssDNA probe/OEG monolayers was monitored by surface plasmon resonance (SPR). Improvements in specific target capture for these ssDNA probe surfaces due to incorporation of the OEG diluent were demonstrated using two model biosensing assays, DNA target capture from complete bovine serum and from salmon genomic DNA mixtures. SPR results demonstrate that OEG incorporation into the ssDNA adlayer improves surface resistance to both nonspecific DNA and protein
Crystal Structure of the Dimeric Oct6 (Pou3fl) POU Domain Bound to Palindromic MORE DNA
Energy Technology Data Exchange (ETDEWEB)
R Jauch; S Choo; C Ng; P Kolatkar
2011-12-31
POU domains (named after their identification in Pit1, Oct1 unc86) are found in around 15 transcription factors encoded in mammalian genomes many of which feature prominently as key regulators at development bifurcations. For example, the POU III class Octamer binding protein 6 (Oct6) is expressed in embryonic stem cells and during neural development and drives the differentia5tion of myelinated cells in the central and peripheral nervous system. Defects in oct6 expression levels are linked to neurological disorders such as schizophrenia. POU proteins contain a bi-partite DNA binding domain that assembles on various DNA motifs with differentially configured subdomains. Intriguingly, alternative configurations of POU domains on different DNA sites were shown to affect the subsequent recruitment of transcriptional coactivators. Namely, binding of Oct1 to a Palindromic Oct-factor Recognition Element (PORE) was shown to facilitate the recruitment of the OBF1 coactivator whereas More of PORE (MORE) bound Oct1 does not. Moreover, Pit1 was shown to recruit the corepressor N-CoR only when bound to a variant MORE motif with a 2 bp half-site spacing. Therefore, POU proteins are seen as a paradigm for DNA induced allosteric effects on transcription factors modulating their regulatory potential. However, a big unresolved conundrum for the POU class and for most if not all other transcription factor classes is how highly similar proteins regulate different sets of genes causing fundamentally different biological responses. Ultimately, there must be subtle features enabling those factors to engage in contrasting molecular interactions in the cell. Thus, the dissection of the molecular details of the transcription-DNA recognition in general, and the formation of multimeric regulatory complexes, in particular, is highly desirable. To contribute to these efforts they solved the 2.05 {angstrom} crystal structure of Oct6 bound as a symmetrical homodimer to palindromic MORE DNA.
Last stop on the road to repair: structure of E. coli DNA ligase bound to nicked DNA-adenylate.
Nandakumar, Jayakrishnan; Nair, Pravin A; Shuman, Stewart
2007-04-27
NAD(+)-dependent DNA ligases (LigA) are ubiquitous in bacteria and essential for growth. Their distinctive substrate specificity and domain organization vis-a-vis human ATP-dependent ligases make them outstanding targets for anti-infective drug discovery. We report here the 2.3 A crystal structure of Escherichia coli LigA bound to an adenylylated nick, which captures LigA in a state poised for strand closure and reveals the basis for nick recognition. LigA envelopes the DNA within a protein clamp. Large protein domain movements and remodeling of the active site orchestrate progression through the three chemical steps of the ligation reaction. The structure inspires a strategy for inhibitor design.
Scanning a DNA molecule for bound proteins using hybrid magnetic and optical tweezers.
Directory of Open Access Journals (Sweden)
Marijn T J van Loenhout
Full Text Available The functional state of the genome is determined by its interactions with proteins that bind, modify, and move along the DNA. To determine the positions and binding strength of proteins localized on DNA we have developed a combined magnetic and optical tweezers apparatus that allows for both sensitive and label-free detection. A DNA loop, that acts as a scanning probe, is created by looping an optically trapped DNA tether around a DNA molecule that is held with magnetic tweezers. Upon scanning the loop along the λ-DNA molecule, EcoRI proteins were detected with ~17 nm spatial resolution. An offset of 33 ± 5 nm for the detected protein positions was found between back and forwards scans, corresponding to the size of the DNA loop and in agreement with theoretical estimates. At higher applied stretching forces, the scanning loop was able to remove bound proteins from the DNA, showing that the method is in principle also capable of measuring the binding strength of proteins to DNA with a force resolution of 0.1 pN/[Formula: see text]. The use of magnetic tweezers in this assay allows the facile preparation of many single-molecule tethers, which can be scanned one after the other, while it also allows for direct control of the supercoiling state of the DNA molecule, making it uniquely suitable to address the effects of torque on protein-DNA interactions.
Tymoczko, Jakub; Schuhmann, Wolfgang; Gebala, Magdalena
2014-12-24
Surface-confined DNA hybridization reactions are sensitive to the number and identity of DNA capture probes and experimental conditions such as the nature and the ionic strength of the electrolyte solution. When the surface probe density is high or the concentration of bulk ions is much lower than the concentration of ions within the DNA layer, hybridization is significantly slowed down or does not proceed at all. However, high-density DNA monolayers are attractive for designing high-sensitivity DNA sensors. Thus, circumventing sluggish DNA hybridization on such interfaces allows a high surface concentration of target DNA and improved signal/noise ratio. We present potential-assisted hybridization as a strategy in which an external voltage is applied to the ssDNA-modified interface during the hybridization process. Results show that a significant enhancement of hybridization can be achieved using this approach.
International Nuclear Information System (INIS)
Meneghello, Marta; Papadopoulou, Evanthia; Ugo, Paolo; Bartlett, Philip N.
2016-01-01
Interaction with DNA plays an important role in the biological activity of some anticancer drug molecules. In this paper we show that electrochemical surface enhanced Raman spectroscopy at sphere segment void gold electrodes can be used as a highly sensitive technique to measure the redox potential of the anticancer drug mitoxantrone bound to dsDNA. For this system we show that we can follow the redox reaction of the bound molecule and can extract the redox potential for the molecule bound to dsDNA by deconvolution of the SER spectra recorded as a function of electrode potential. We find that mitoxantrone bound to dsDNA undergoes a 2 electron, 1 proton reduction and that the redox potential (-0.87 V vs. Ag/AgCl at pH 7.2) is shifted approximately 0.12 V cathodic of the corresponding value at a glassy carbon electrode. Our results also show that the reduced form of mitoxantrone remains bound to dsDNA and we are able to use the deconvoluted SER spectra of the reduced mitoxantrone as a function of electrode potential to follow the electrochemically driven melting of the dsDNA at more negative potentials.
Oxidation of DNA, proteins and lipids by DOPA, protein-bound DOPA, and related catechol(amine)s
DEFF Research Database (Denmark)
Pattison, David I; Dean, Roger T; Davies, Michael Jonathan
2002-01-01
Incubation of free 3,4-dihydroxyphenylalanine (DOPA), protein-bound DOPA (PB-DOPA) and related catechols with DNA, proteins and lipids has been shown to result in oxidative damage to the target molecule. This article reviews these reactions with particular emphasis on those that occur in the pres......Incubation of free 3,4-dihydroxyphenylalanine (DOPA), protein-bound DOPA (PB-DOPA) and related catechols with DNA, proteins and lipids has been shown to result in oxidative damage to the target molecule. This article reviews these reactions with particular emphasis on those that occur...... in the presence of molecular O(2) and redox-active metal ions (e.g. Fe(3+), Cu(2+), Cr(6+)), which are known to increase the rate of DOPA oxidation. The majority of oxidative damage appears to be mediated by reactive oxygen species (ROS) such as superoxide and HO(.) radicals, though other DOPA oxidation products...
Mechanisms of Surface-Mediated DNA Hybridization
2015-01-01
Single-molecule total internal reflection fluorescence microscopy was employed in conjunction with resonance energy transfer (RET) to observe the dynamic behavior of donor-labeled ssDNA at the interface between aqueous solution and a solid surface decorated with complementary acceptor-labeled ssDNA. At least 100 000 molecular trajectories were determined for both complementary strands and negative control ssDNA. RET was used to identify trajectory segments corresponding to the hybridized state. The vast majority of molecules from solution adsorbed nonspecifically to the surface, where a brief two-dimensional search was performed with a 7% chance of hybridization. Successful hybridization events occurred with a characteristic search time of ∼0.1 s, and unsuccessful searches resulted in desorption from the surface, ultimately repeating the adsorption and search process. Hybridization was reversible, and two distinct modes of melting (i.e., dehybridization) were observed, corresponding to long-lived (∼15 s) and short-lived (∼1.4 s) hybridized time intervals. A strand that melted back onto the surface could rehybridize after a brief search or desorb from the interface. These mechanistic observations provide guidance for technologies that involve DNA interactions in the near-surface region, suggesting a need to design surfaces that both enhance the complex multidimensional search process and stabilize the hybridized state. PMID:24708278
Microarray of DNA probes on carboxylate functional beads surface
Institute of Scientific and Technical Information of China (English)
黄承志; 李原芳; 黄新华; 范美坤
2000-01-01
The microarray of DNA probes with 5’ -NH2 and 5’ -Tex/3’ -NH2 modified terminus on 10 um carboxylate functional beads surface in the presence of 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC) is characterized in the preseni paper. it was found that the microarray capacity of DNA probes on the beads surface depends on the pH of the aqueous solution, the concentra-tion of DNA probe and the total surface area of the beads. On optimal conditions, the minimum distance of 20 mer single-stranded DNA probe microarrayed on beads surface is about 14 nm, while that of 20 mer double-stranded DNA probes is about 27 nm. If the probe length increases from 20 mer to 35 mer, its microarray density decreases correspondingly. Mechanism study shows that the binding mode of DNA probes on the beads surface is nearly parallel to the beads surface.
Microarray of DNA probes on carboxylate functional beads surface
Institute of Scientific and Technical Information of China (English)
无
2000-01-01
The microarray of DNA probes with 5′-NH2 and 5′-Tex/3′-NH2 modified terminus on 10 m m carboxylate functional beads surface in the presence of 1-ethyl-3-(3-dimethylaminopropyl)- carbodiimide (EDC) is characterized in the present paper. It was found that the microarray capacity of DNA probes on the beads surface depends on the pH of the aqueous solution, the concentration of DNA probe and the total surface area of the beads. On optimal conditions, the minimum distance of 20 mer single-stranded DNA probe microarrayed on beads surface is about 14 nm, while that of 20 mer double-stranded DNA probes is about 27 nm. If the probe length increases from 20 mer to 35 mer, its microarray density decreases correspondingly. Mechanism study shows that the binding mode of DNA probes on the beads surface is nearly parallel to the beads surface.
Crystal Structure of a CRISPR RNA-guided Surveillance Complex Bound to a ssDNA Target
Energy Technology Data Exchange (ETDEWEB)
Mulepati, Sabin [Johns Hopkins Univ., Baltimore, MD (United States); Heroux, Annie; Bailey, Scott [Johns Hopkins Univ., Baltimore, MD (United States)
2014-09-19
In prokaryotes, RNA derived from type I and type III CRISPR loci direct large ribonucleoprotein complexes to destroy invading bacteriophage and plasmids. In Escherichia coli, this 405-kilodalton complex is called Cascade. We report the crystal structure of Cascade bound to a single-stranded DNA (ssDNA) target at a resolution of 3.03 angstroms. The structure reveals that the CRISPR RNA and target strands do not form a double helix but instead adopt an underwound ribbon-like structure. This noncanonical structure is facilitated by rotation of every sixth nucleotide out of the RNA-DNA hybrid and is stabilized by the highly interlocked organization of protein subunits. These studies provide insight into both the assembly and the activity of this complex and suggest a mechanism to enforce fidelity of target binding.
Trade-off bounds for the Pareto surface approximation in multi-criteria IMRT planning
International Nuclear Information System (INIS)
Serna, J I; Monz, M; Kuefer, K H; Thieke, C
2009-01-01
One approach to multi-criteria IMRT planning is to automatically calculate a data set of Pareto-optimal plans for a given planning problem in a first phase, and then interactively explore the solution space and decide on the clinically best treatment plan in a second phase. The challenge of computing the plan data set is to ensure that all clinically meaningful plans are covered and that as many clinically irrelevant plans as possible are excluded to keep computation times within reasonable limits. In this work, we focus on the approximation of the clinically relevant part of the Pareto surface, the process that constitutes the first phase. It is possible that two plans on the Pareto surface have a small, clinically insignificant difference in one criterion and a significant difference in another criterion. For such cases, only the plan that is clinically clearly superior should be included into the data set. To achieve this during the Pareto surface approximation, we propose to introduce bounds that restrict the relative quality between plans, the so-called trade-off bounds. We show how to integrate these trade-off bounds into the approximation scheme and study their effects. The proposed scheme is applied to two artificial cases and one clinical case of a paraspinal tumor. For all cases, the quality of the Pareto surface approximation is measured with respect to the number of computed plans, and the range of values occurring in the approximation for different criteria is compared. Through enforcing trade-off bounds, the scheme disregards clinically irrelevant plans during the approximation. Thereby, the number of plans necessary to achieve a good approximation quality can be significantly reduced. Thus, trade-off bounds are an effective tool to focus the planning and to reduce computation time.
Trade-off bounds for the Pareto surface approximation in multi-criteria IMRT planning.
Serna, J I; Monz, M; Küfer, K H; Thieke, C
2009-10-21
One approach to multi-criteria IMRT planning is to automatically calculate a data set of Pareto-optimal plans for a given planning problem in a first phase, and then interactively explore the solution space and decide on the clinically best treatment plan in a second phase. The challenge of computing the plan data set is to ensure that all clinically meaningful plans are covered and that as many clinically irrelevant plans as possible are excluded to keep computation times within reasonable limits. In this work, we focus on the approximation of the clinically relevant part of the Pareto surface, the process that constitutes the first phase. It is possible that two plans on the Pareto surface have a small, clinically insignificant difference in one criterion and a significant difference in another criterion. For such cases, only the plan that is clinically clearly superior should be included into the data set. To achieve this during the Pareto surface approximation, we propose to introduce bounds that restrict the relative quality between plans, the so-called trade-off bounds. We show how to integrate these trade-off bounds into the approximation scheme and study their effects. The proposed scheme is applied to two artificial cases and one clinical case of a paraspinal tumor. For all cases, the quality of the Pareto surface approximation is measured with respect to the number of computed plans, and the range of values occurring in the approximation for different criteria is compared. Through enforcing trade-off bounds, the scheme disregards clinically irrelevant plans during the approximation. Thereby, the number of plans necessary to achieve a good approximation quality can be significantly reduced. Thus, trade-off bounds are an effective tool to focus the planning and to reduce computation time.
Energy Technology Data Exchange (ETDEWEB)
Kobayashi, K.; Usami, N.; Sasaki, I.; Frohlich, H.; Le Sech, C. E-mail: lesech@lcam.u-psud.fr
2003-01-01
Complexes made of DNA and Cyclo-Pt bound to plasmid DNA, were placed in aqueous solution and irradiated with monochromatic X-rays in the range E=8.5-13 keV, including the resonant photoabsorption energy of the L{sub III} shell of the platinum atom. The number of single- and double-strand breaks (ssb and dsb) induced by irradiation on a supercoiled DNA plasmid was measured by the production of circular-nicked and linear forms. In order to disentangle the contribution of the direct effects imparted to ionization, and the indirect effects due to a free radical attack, experiments have been performed in the presence of a small concentration (64 mmol l{sup -1}) of hydroxyl free radical scavenger dimethyl sulfoxide (DMSO). An enhancement of the number of ssb and dsb is observed when the plasmids contain the Pt intercalating molecules. Even when off-resonant X-rays are used, the strand break efficiency remains higher than expected based upon the absorption cross-section, as if the Pt bound to DNA is increasing the yield of strand breaks. A mechanism is suggested, involving photoelectrons generated from the ionization of water which efficiently ionize Pt atoms. This observation may provide an insight to understanding the effects of new radiotherapy protocols, associated chemotherapeutic agents such as cisplatin and ordinary radiotherapy for tumoral treatments.
International Nuclear Information System (INIS)
Krasichkova, Z.I.; Strazhevskaya, N.B.
1984-01-01
The composition of supramolecular DNA (SM DNA)-bound phospholipids (PL) of thymus and liver of intact rats and those 2 min, 2, 6 and 24 h after γ-irradiation (9.7 Gy) was studied. In norm, supramolecular DNA of the thymus was shown to contain 6.7 μg PL/mg DNA, and that of the liver, 6.1 μg PL/mg DNA, the main components of PL being cardiolipin (CL) and phosphatidylethanolamine (PEA). Substantial changes were detected in the PL composition of SM DNA of γ,irradiated rat organs. During the postirradiation period the concentration of PEA and CL in thymus SM DNA changed symbatically and irreversibly decAeased to traces; whereas in SM DNA of the liver, their concentrations changed antibatically and decreased only to a definite level thus maintaining the necessary ''lipid volume''. It was shown that PL were not restored in SM DNA of the radiopesistant liver
Zhang, Xu; Wu, Jiaxi; Du, Fenghe; Xu, Hui; Sun, Lijun; Chen, Zhe; Brautigam, Chad A; Zhang, Xuewu; Chen, Zhijian J
2014-02-13
The presence of DNA in the cytoplasm is a danger signal that triggers immune and inflammatory responses. Cytosolic DNA binds to and activates cyclic GMP-AMP (cGAMP) synthase (cGAS), which produces the second messenger cGAMP. cGAMP binds to the adaptor protein STING and activates a signaling cascade that leads to the production of type I interferons and other cytokines. Here, we report the crystal structures of human cGAS in its apo form, representing its autoinhibited conformation as well as in its cGAMP- and sulfate-bound forms. These structures reveal switch-like conformational changes of an activation loop that result in the rearrangement of the catalytic site. The structure of DNA-bound cGAS reveals a complex composed of dimeric cGAS bound to two molecules of DNA. Functional analyses of cGAS mutants demonstrate that both the protein-protein interface and the two DNA binding surfaces are critical for cGAS activation. These results provide insights into the mechanism of DNA sensing by cGAS. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Xu Zhang
2014-02-01
Full Text Available The presence of DNA in the cytoplasm is a danger signal that triggers immune and inflammatory responses. Cytosolic DNA binds to and activates cyclic GMP-AMP (cGAMP synthase (cGAS, which produces the second messenger cGAMP. cGAMP binds to the adaptor protein STING and activates a signaling cascade that leads to the production of type I interferons and other cytokines. Here, we report the crystal structures of human cGAS in its apo form, representing its autoinhibited conformation as well as in its cGAMP- and sulfate-bound forms. These structures reveal switch-like conformational changes of an activation loop that result in the rearrangement of the catalytic site. The structure of DNA-bound cGAS reveals a complex composed of dimeric cGAS bound to two molecules of DNA. Functional analyses of cGAS mutants demonstrate that both the protein-protein interface and the two DNA binding surfaces are critical for cGAS activation. These results provide insights into the mechanism of DNA sensing by cGAS.
Kim, Sanghyun; Zbaida, David; Elbaum, Michael; Leh, Hervé; Nogues, Claude; Buckle, Malcolm
2015-07-27
VirE2 is the major secreted protein of Agrobacterium tumefaciens in its genetic transformation of plant hosts. It is co-expressed with a small acidic chaperone VirE1, which prevents VirE2 oligomerization. After secretion into the host cell, VirE2 serves functions similar to a viral capsid in protecting the single-stranded transferred DNA en route to the nucleus. Binding of VirE2 to ssDNA is strongly cooperative and depends moreover on protein-protein interactions. In order to isolate the protein-DNA interactions, imaging surface plasmon resonance (SPRi) studies were conducted using surface-immobilized DNA substrates of length comparable to the protein-binding footprint. Binding curves revealed an important influence of substrate rigidity with a notable preference for poly-T sequences and absence of binding to both poly-A and double-stranded DNA fragments. Dissociation at high salt concentration confirmed the electrostatic nature of the interaction. VirE1-VirE2 heterodimers also bound to ssDNA, though by a different mechanism that was insensitive to high salt. Neither VirE2 nor VirE1-VirE2 followed the Langmuir isotherm expected for reversible monomeric binding. The differences reflect the cooperative self-interactions of VirE2 that are suppressed by VirE1. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
International Nuclear Information System (INIS)
Bhanjadeo, Madhabi M.; Nayak, Ashok K.; Subudhi, Umakanta
2017-01-01
DNA based self-assembled nanostructures and DNA origami has proven useful for organizing nanomaterials with firm precision. However, for advanced applications like nanoelectronics and photonics, large-scale organization of self-assembled branched DNA (bDNA) into periodic lattices is desired. In this communication for the first time we report a facile method of self-assembly of Y-shaped bDNA nanostructures on the cationic surface of Aluminum (Al) foil to prepare periodic two dimensional (2D) bDNA lattice. Particularly those Y-shaped bDNA structures having smaller overhangs and unable to self-assemble in solution, they are easily assembled on the surface of Al foil in the absence of ligase. Field emission scanning electron microscopy (FESEM) analysis shows homogenous distribution of two-dimensional bDNA lattices across the Al foil. When the assembled bDNA structures were recovered from the Al foil and electrophoresed in nPAGE only higher order polymeric bDNA structures were observed without a trace of monomeric structures which confirms the stability and high yield of the bDNA lattices. Therefore, this enzyme-free economic and efficient strategy for developing bDNA lattices can be utilized in assembling various nanomaterials for functional molecular components towards development of DNA based self-assembled nanodevices. - Highlights: • Al foil surface-assisted self-assembly of monomeric structures into larger branched DNA lattice. • FESEM study confirms the uniform distribution of two-dimensional bDNA lattice structures across the surface of Al foil. • Enzyme-free and economic strategy to prepare higher order structures from simpler DNA nanostructures have been confirmed by recovery assay. • Use of well proven sequences for the preparation of pure Y-shaped monomeric DNA nanostructure with high yield.
DNA adsorption and desorption on mica surface studied by atomic force microscopy
Energy Technology Data Exchange (ETDEWEB)
Sun Lanlan [State Key Laboratory of Electroanalytical Chemistry, Changchun Institute of Applied Chemistry, Graduate school of the Chinese Academy of Sciences, Chinese Academy of Sciences, Renmin Street 5625, Changchun 130022 (China); Key Laboratory of Excited State Processes, Changchun Institute of Optics, Fine Mechanics and Physics, Chinese Academy of Sciences, 16 East Nan-Hu Road, Open Economic Zone, Changchun 130033 (China); Zhao Dongxu [Key Laboratory of Excited State Processes, Changchun Institute of Optics, Fine Mechanics and Physics, Chinese Academy of Sciences, 16 East Nan-Hu Road, Open Economic Zone, Changchun 130033 (China); Zhang Yue; Xu Fugang [State Key Laboratory of Electroanalytical Chemistry, Changchun Institute of Applied Chemistry, Graduate school of the Chinese Academy of Sciences, Chinese Academy of Sciences, Renmin Street 5625, Changchun 130022 (China); Li Zhuang, E-mail: zli@ciac.jl.cn [State Key Laboratory of Electroanalytical Chemistry, Changchun Institute of Applied Chemistry, Graduate school of the Chinese Academy of Sciences, Chinese Academy of Sciences, Renmin Street 5625, Changchun 130022 (China)
2011-05-15
The adsorption of DNA molecules on mica surface and the following desorption of DNA molecules at ethanol-mica interface were studied using atomic force microscopy. By changing DNA concentration, different morphologies on mica surface have been observed. A very uniform and orderly monolayer of DNA molecules was constructed on the mica surface with a DNA concentration of 30 ng/{mu}L. When the samples were immersed into ethanol for about 15 min, various desorption degree of DNA from mica (0-99%) was achieved. It was found that with the increase of DNA concentration, the desorption degree of DNA from the mica at ethanol-mica interface decreased. And when the uniform and orderly DNA monolayers were formed on the mica surface, almost no DNA molecule desorbed from the mica surface in this process. The results indicated that the uniform and orderly DNA monolayer is one of the most stable DNA structures formed on the mica surface. In addition, we have studied the structure change of DNA molecules after desorbed from the mica surface with atomic force microscopy, and found that the desorption might be ascribed to the ethanol-induced DNA condensation.
DNA adsorption and desorption on mica surface studied by atomic force microscopy
International Nuclear Information System (INIS)
Sun Lanlan; Zhao Dongxu; Zhang Yue; Xu Fugang; Li Zhuang
2011-01-01
The adsorption of DNA molecules on mica surface and the following desorption of DNA molecules at ethanol-mica interface were studied using atomic force microscopy. By changing DNA concentration, different morphologies on mica surface have been observed. A very uniform and orderly monolayer of DNA molecules was constructed on the mica surface with a DNA concentration of 30 ng/μL. When the samples were immersed into ethanol for about 15 min, various desorption degree of DNA from mica (0-99%) was achieved. It was found that with the increase of DNA concentration, the desorption degree of DNA from the mica at ethanol-mica interface decreased. And when the uniform and orderly DNA monolayers were formed on the mica surface, almost no DNA molecule desorbed from the mica surface in this process. The results indicated that the uniform and orderly DNA monolayer is one of the most stable DNA structures formed on the mica surface. In addition, we have studied the structure change of DNA molecules after desorbed from the mica surface with atomic force microscopy, and found that the desorption might be ascribed to the ethanol-induced DNA condensation.
In vivo assessment of a novel dacron surface with covalently bound recombinant hirudin.
Wyers, M C; Phaneuf, M D; Rzucidlo, E M; Contreras, M A; LoGerfo, F W; Quist, W C
1999-01-01
Prosthetic arterial graft surfaces are relatively thrombogenic and fail to heal with a cellular neointima. The goal of this study was to characterize the in vivo antithrombin properties of a novel Dacron surface with covalently linked recombinant hirudin (rHir) implanted in a canine thoracic aorta with high flow and shear rates. rHir was bound to a knitted Dacron patch using crosslinker-modified bovine serum albumin (BSA) as a basecoat protein. BSA was first reacted with the heterobifunctional crosslinker, sulfo-SMCC. This BSA-SMCC complex was then bound to the carboxylic acid groups of hydrolyzed Dacron patches using the carbodiimide crosslinker, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride. Iodinated, Traut's-modified rHir (125I-rHir-SH) was then reacted with the Dacron-BSA-SMCC surface, thereby covalently binding 125I-rHir. Graft segments were washed and sonicated to remove any nonspecifically bound 125I-rHir. Dacron-BSA-SMCC-S-125I-rHir patches (n = 5) and control Dacron-BSA patches (n = 5) were implanted in series in the thoracic aortas of canines. These patches were exposed to nonheparinized, arterial blood flow for 2 hours. Patches were explanted and assessed for 125I-rHir loss. Antithrombin activity of explanted 1-cm2 patch segments was evaluated using a chromogenic assay with 1, 5, 10, 15 units of added thrombin. Light microscopy was performed to qualitatively examine the pseudointima. Two animals were excluded from the study owing to excessive bleeding through the knitted 125I-rHir patch. Comparison of preoperative and postoperative 125I-rHir gamma counts revealed an overall decrease of 20+/-5.4% over the period studied. Explanted 125I-rHir patch segments were able to inhibit 1, 5, and 7 NIHU of thrombin, demonstrating retained antithrombin activity. Gross and microscopic examination of the control and test Dacron surfaces showed marked differences. Dacron surfaces with covalently bound 125I-rHir had no gross thrombus and a thin
Aligned deposition and electrical measurements on single DNA molecules
International Nuclear Information System (INIS)
Eidelshtein, Gennady; Kotlyar, Alexander; Hashemi, Mohtadin; Gurevich, Leonid
2015-01-01
A reliable method of deposition of aligned individual dsDNA molecules on mica, silicon, and micro/nanofabricated circuits is presented. Complexes of biotinylated double stranded poly(dG)–poly(dC) DNA with avidin were prepared and deposited on mica and silicon surfaces in the absence of Mg 2+ ions. Due to its positive charge, the avidin attached to one end of the DNA anchors the complex to negatively charged substrates. Subsequent drying with a directional gas flow yields DNA molecules perfectly aligned on the surface. In the avidin–DNA complex only the avidin moiety is strongly and irreversibly bound to the surface, while the DNA counterpart interacts with the substrates much more weakly and can be lifted from the surface and realigned in any direction. Using this technique, avidin–DNA complexes were deposited across platinum electrodes on a silicon substrate. Electrical measurements on the deposited DNA molecules revealed linear IV-characteristics and exponential dependence on relative humidity. (paper)
An electrochemical study of neutral red-DNA interaction
International Nuclear Information System (INIS)
Heli, H.; Bathaie, S.Z.; Mousavi, M.F.
2005-01-01
Electrochemical methods were used to investigate the interaction of neutral red (NR) with double-stranded calf thymus DNA, in solution as well as using a DNA-modified glassy carbon (GC-DNA) electrode. The results were compared with those obtained from bare glassy carbon (GC) electrode. The formal potential of NR was more positive when GC-DNA electrode was used although the rate of heterogeneous electron transfer is as high as that of using GC electrode. GC-DNA electrode enables preconcentration of NR for chosen times on the electrode surface, despite the fact that the mass transfer effects in the thin DNA layer adsorbed on the surface was still observed using cyclic voltammetry and electrochemical impedance spectroscopy techniques. Parameters, such as the diffusion coefficient of NR, binding site size in base pairs and the ratio of the binding constants for the oxidized and reduced forms of the bound species were obtained. A binding isotherm for NR at GC-DNA electrode was obtained from coulometric titrations and gave an affinity constant equal to 2.76 x 10 4 L mol -1 . From the studies of the interaction in solution, the diffusion coefficient of free and DNA-bound NR, binding constant and binding site size of the DNA-NR complex was also obtained simultaneously by non-linear fitting analysis of voltammetric data
An AP endonuclease 1-DNA polymerase beta complex: theoretical prediction of interacting surfaces.
Directory of Open Access Journals (Sweden)
Alexej Abyzov
2008-04-01
Full Text Available Abasic (AP sites in DNA arise through both endogenous and exogenous mechanisms. Since AP sites can prevent replication and transcription, the cell contains systems for their identification and repair. AP endonuclease (APEX1 cleaves the phosphodiester backbone 5' to the AP site. The cleavage, a key step in the base excision repair pathway, is followed by nucleotide insertion and removal of the downstream deoxyribose moiety, performed most often by DNA polymerase beta (pol-beta. While yeast two-hybrid studies and electrophoretic mobility shift assays provide evidence for interaction of APEX1 and pol-beta, the specifics remain obscure. We describe a theoretical study designed to predict detailed interacting surfaces between APEX1 and pol-beta based on published co-crystal structures of each enzyme bound to DNA. Several potentially interacting complexes were identified by sliding the protein molecules along DNA: two with pol-beta located downstream of APEX1 (3' to the damaged site and three with pol-beta located upstream of APEX1 (5' to the damaged site. Molecular dynamics (MD simulations, ensuring geometrical complementarity of interfaces, enabled us to predict interacting residues and calculate binding energies, which in two cases were sufficient (approximately -10.0 kcal/mol to form a stable complex and in one case a weakly interacting complex. Analysis of interface behavior during MD simulation and visual inspection of interfaces allowed us to conclude that complexes with pol-beta at the 3'-side of APEX1 are those most likely to occur in vivo. Additional multiple sequence analyses of APEX1 and pol-beta in related organisms identified a set of correlated mutations of specific residues at the predicted interfaces. Based on these results, we propose that pol-beta in the open or closed conformation interacts and makes a stable interface with APEX1 bound to a cleaved abasic site on the 3' side. The method described here can be used for analysis in
Solid surface vs. liquid surface: nanoarchitectonics, molecular machines, and DNA origami.
Ariga, Katsuhiko; Mori, Taizo; Nakanishi, Waka; Hill, Jonathan P
2017-09-13
The investigation of molecules and materials at interfaces is critical for the accumulation of new scientific insights and technological advances in the chemical and physical sciences. Immobilization on solid surfaces permits the investigation of different properties of functional molecules or materials with high sensitivity and high spatial resolution. Liquid surfaces also present important media for physicochemical innovation and insight based on their great flexibility and dynamicity, rapid diffusion of molecular components for mixing and rearrangements, as well as drastic spatial variation in the prevailing dielectric environment. Therefore, a comparative discussion of the relative merits of the properties of materials when positioned at solid or liquid surfaces would be informative regarding present-to-future developments of surface-based technologies. In this perspective article, recent research examples of nanoarchitectonics, molecular machines, DNA nanotechnology, and DNA origami are compared with respect to the type of surface used, i.e. solid surfaces vs. liquid surfaces, for future perspectives of interfacial physics and chemistry.
DNA immobilization on polymer-modified Si surface by controlling pH
International Nuclear Information System (INIS)
Demirel, Goekcen Birlik; Caykara, Tuncer
2009-01-01
A novel approach based on polymer-modified Si surface as DNA sensor platforms is presented. The polymer-modified Si surface was prepared by using 3-(methacryloxypropyl)trimethoxysilane [γ-MPS] and poly(acrylamide) [PAAm]. Firstly, a layer of γ-MPS was formed on the hydroxylated silicon surface as a monolayer and then modified with different molecular weight of PAAm to form polymer-modified surface. The polymer-modified Si surface was used for dsDNA immobilization. All steps about formation of layer structure were characterized by ellipsometry, atomic force microscopy (AFM), attenuated total reflectance Fourier transformed infrared (ATR-FTIR), and contact angle (CA) measurements. We found that in this case the amount of dsDNA immobilized onto the surface was dictated by the electrostatic interaction between the substrate surface and the DNA. Our results thus demonstrated that DNA molecules could be immobilized differently onto the polymer-modified support surface via electrostatic interactions.
Yu, Shi; Li, Ming-Hsin; Choi, Seok Ki; Baker, James R; Larson, Ronald G
2013-09-03
The ability of poly(amido amine) (or PAMAM) dendrimers to condense semiflexible dsDNA and penetrate cell membranes gives them great potential in gene therapy and drug delivery but their high positive surface charge makes them cytotoxic. Here, we describe the effects of partial neutralization by acetylation on DNA condensation using light scattering, circular dichroism, and single molecule imaging of dendrimer-DNA complexes combed onto surfaces and tethered to those surfaces under flow. We find that DNA can be condensed by generation-five (G5) dendrimers even when the surface charges are more than 65% neutralized, but that such dendrimers bind negligibly when an end-tethered DNA is stretched in flow. We also find that when fully charged dendrimers are introduced by flow to end-tethered DNA, all DNA molecules become equally highly coated with dendrimers at a rate that becomes very fast at high dendrimer concentration, and that dendrimers remain bound during subsequent flow of dendrimer-free buffer. These results suggest that the presence of dendrimer-free DNA coexisting with dendrimer-bound DNA after bulk mixing of the two in solution may result from diffusion-limited irreversible dendrimer-DNA binding, rather than, or in addition to, the previously proposed cooperative binding mechanism of dendrimers to DNA.
Directory of Open Access Journals (Sweden)
Ronald G. Larson
2013-09-01
Full Text Available The ability of poly(amido amine (or PAMAM dendrimers to condense semiflexible dsDNA and penetrate cell membranes gives them great potential in gene therapy and drug delivery but their high positive surface charge makes them cytotoxic. Here, we describe the effects of partial neutralization by acetylation on DNA condensation using light scattering, circular dichroism, and single molecule imaging of dendrimer-DNA complexes combed onto surfaces and tethered to those surfaces under flow. We find that DNA can be condensed by generation-five (G5 dendrimers even when the surface charges are more than 65% neutralized, but that such dendrimers bind negligibly when an end-tethered DNA is stretched in flow. We also find that when fully charged dendrimers are introduced by flow to end-tethered DNA, all DNA molecules become equally highly coated with dendrimers at a rate that becomes very fast at high dendrimer concentration, and that dendrimers remain bound during subsequent flow of dendrimer-free buffer. These results suggest that the presence of dendrimer-free DNA coexisting with dendrimer-bound DNA after bulk mixing of the two in solution may result from diffusion-limited irreversible dendrimer-DNA binding, rather than, or in addition to, the previously proposed cooperative binding mechanism of dendrimers to DNA.
Biofunctionalization of ZnO nanowires for DNA sensory applications
Energy Technology Data Exchange (ETDEWEB)
Schroeder, Ulrich Christian; Gnauck, Martin; Ronning, Carsten [Institute of Solid State Physics, University of Jena, Max-Wien-Platz 1, D-07743 Jena (Germany); Moeller, Robert; Rudolph, Bettina; Fritzsche, Wolfgang [Institut fuer Photonische Technologien e.V., Albert-Einstein-Strasse 9, D-07745 Jena (Germany)
2011-07-01
In recent years, DNA detecting systems have received a growing interest due to promising fields of application like DNA diagnostics, gene analysis, virus detection or forensic applications. Nanowire-based DNA biosensor allows both miniaturization and easy continuous monitoring of a detection signal by electrical means. The label free detection scheme based on electrochemical changes of the surface potential during immobilization of specific DNA probes was heretofore mainly studied for silicon. In this work a surface decoration process with bifunctional molecules known as silanization was applied to VLS-grown ZnO nanowires which both feature a large sensitivity for surface modification, are biocompatible and easy to synthesize as well. Successfully bound DNA was proved by fluorescence microscopy. Dielectrophoresis (DEP) was chosen and optimized for quickly contacting the ZnO nanowires. Furthermore, electrical signal characterization was performed in preparation for DNA sensory applications.
On the bound states of Schrodinger operators with -interactions on conical surfaces
Czech Academy of Sciences Publication Activity Database
Lotoreichik, Vladimir; Ourmieres-Bonafos, T.
2016-01-01
Roč. 41, č. 6 (2016), s. 999-1028 ISSN 0360-5302 Institutional support: RVO:61389005 Keywords : conical and hyperconical surfaces * delta-interaction * existence of bound states * Schrodinger operator * spectral asymptotics Subject RIV: BE - Theoretical Physics Impact factor: 1.608, year: 2016
Directory of Open Access Journals (Sweden)
Luisina De Tullio
2017-10-01
Full Text Available Srs2 is a super-family 1 helicase that promotes genome stability by dismantling toxic DNA recombination intermediates. However, the mechanisms by which Srs2 remodels or resolves recombination intermediates remain poorly understood. Here, single-molecule imaging is used to visualize Srs2 in real time as it acts on single-stranded DNA (ssDNA bound by protein factors that function in recombination. We demonstrate that Srs2 is highly processive and translocates rapidly (∼170 nt per second in the 3′→5′ direction along ssDNA saturated with replication protein A (RPA. We show that RPA is evicted from DNA during the passage of Srs2. Remarkably, Srs2 also readily removes the recombination mediator Rad52 from RPA-ssDNA and, in doing so, promotes rapid redistribution of both Rad52 and RPA. These findings have important mechanistic implications for understanding how Srs2 and related nucleic acid motor proteins resolve potentially pathogenic nucleoprotein intermediates.
DNA Diagnostics: Optical or by Electronics?
Khan, Hadayat Ullah
2016-01-15
In this paper, we very briefly review DNA biosensors based on optical and electrical detection principles, referring mainly to our past work applying both techniques but here using nearly identical sensor chip surface architectures, i.e., capture probe layers that were prepared based on a pulsed plasma deposition protocol for maleic anhydride and subsequent wet-chemical attachment of the amine-functionalized peptide nucleic acid (PNA) probe oligonucleotides. 15 mer DNA target strands, labeled with Cy5-chromophores that were attached at the 5’ end were used for surface plasmon optical detection and the same target DNA but without label was used in OTFT sensor-based detection where the mere charge density of the bound (hybridized) DNA molecules modulate the source-drain current. The sensing mechanisms and the detection limits of the devices are described in some detail. Both techniques allow for the monitoring of surface hybridization reactions, and offer the capacity to quantitatively discriminate between targets with different degrees of mismatched sequences.
Davis, Brian; Conley, Hiram; Ochoa, Rosie; Hurd, Katie; Linford, Matthew R.; Davis, Robert C.
2008-10-01
Chemical surface patterning at the nanoscale is a critical component of chemically directed assembly of nanoscale devices or sensitive biological molecules onto surfaces. Here we present a scanning probe lithography technique that allows for patterning of aqueous polymers on glass or silicon dioxide surfaces. The surfaces were functionalized by covalently bonding a silane monolayer with a known surface charge to either a glass slide or a silicon wafer. A polymer layer less then 2 nm in thickness was electrostatically bound to the silane layer, passivating the functionalized surface. An Atomic Force Microscope (AFM) probe was used to remove a portion of the polymer layer, exposing the functional silane layer underneath. Employing this method we made chemically active submicron regions. These regions were backfilled with a fluorescent polymer and Lambda-DNA. Chemical differentiation was verified through tapping mode AFM and optical fluorescent microscopy. Lines with a pitch as small as 20nm were observed with AFM height and phase mode data.
Lens-free imaging of magnetic particles in DNA assays.
Colle, Frederik; Vercruysse, Dries; Peeters, Sara; Liu, Chengxun; Stakenborg, Tim; Lagae, Liesbet; Del-Favero, Jurgen
2013-11-07
We present a novel opto-magnetic system for the fast and sensitive detection of nucleic acids. The system is based on a lens-free imaging approach resulting in a compact and cheap optical readout of surface hybridized DNA fragments. In our system magnetic particles are attracted towards the detection surface thereby completing the labeling step in less than 1 min. An optimized surface functionalization combined with magnetic manipulation was used to remove all nonspecifically bound magnetic particles from the detection surface. A lens-free image of the specifically bound magnetic particles on the detection surface was recorded by a CMOS imager. This recorded interference pattern was reconstructed in software, to represent the particle image at the focal distance, using little computational power. As a result we were able to detect DNA concentrations down to 10 pM with single particle sensitivity. The possibility of integrated sample preparation by manipulation of magnetic particles, combined with the cheap and highly compact lens-free detection makes our system an ideal candidate for point-of-care diagnostic applications.
Investigating the dynamics of surface-immobilized DNA nanomachines
Dunn, Katherine E.; Trefzer, Martin A.; Johnson, Steven; Tyrrell, Andy M.
2016-07-01
Surface-immobilization of molecules can have a profound influence on their structure, function and dynamics. Toehold-mediated strand displacement is often used in solution to drive synthetic nanomachines made from DNA, but the effects of surface-immobilization on the mechanism and kinetics of this reaction have not yet been fully elucidated. Here we show that the kinetics of strand displacement in surface-immobilized nanomachines are significantly different to those of the solution phase reaction, and we attribute this to the effects of intermolecular interactions within the DNA layer. We demonstrate that the dynamics of strand displacement can be manipulated by changing strand length, concentration and G/C content. By inserting mismatched bases it is also possible to tune the rates of the constituent displacement processes (toehold-binding and branch migration) independently, and information can be encoded in the time-dependence of the overall reaction. Our findings will facilitate the rational design of surface-immobilized dynamic DNA nanomachines, including computing devices and track-based motors.
Pierre, Valérie C.; Kaiser, Jens T.; Barton, Jacqueline K.
2007-01-01
We report the 1.1-Å resolution crystal structure of a bulky rhodium complex bound to two different DNA sites, mismatched and matched in the oligonucleotide 5′-(dCGGAAATTCCCG)2-3′. At the AC mismatch site, the structure reveals ligand insertion from the minor groove with ejection of both mismatched bases and elucidates how destabilized mispairs in DNA may be recognized. This unique binding mode contrasts with major groove intercalation, observed at a matched site, where doubling of the base pair rise accommodates stacking of the intercalator. Mass spectral analysis reveals different photocleavage products associated with the two binding modes in the crystal, with only products characteristic of mismatch binding in solution. This structure, illustrating two clearly distinct binding modes for a molecule with DNA, provides a rationale for the interrogation and detection of mismatches. PMID:17194756
En route to surface-bound electric field-driven molecular motors.
Jian, Huahua; Tour, James M
2003-06-27
Four caltrop-shaped molecules that might be useful as surface-bound electric field-driven molecular motors have been synthesized. The caltrops are comprised of a pair of electron donor-acceptor arms and a tripod base. The molecular arms are based on a carbazole or oligo(phenylene ethynylene) core with a strong net dipole. The tripod base uses a silicon atom as its core. The legs of the tripod bear sulfur-tipped bonding units, as acetyl-protected benzylic thiols, for bonding to a gold surface. The geometry of the tripod base allows the caltrop to project upward from a metallic surface after self-assembly. Ellipsometric studies show that self-assembled monolayers of the caltrops are formed on Au surfaces with molecular thicknesses consistent with the desired upright-shaft arrangement. As a result, the zwitterionic molecular arms might be controllable when electric fields are applied around the caltrops, thereby constituting field-driven motors.
Strotman, Lindsay N; Lin, Guangyun; Berry, Scott M; Johnson, Eric A; Beebe, David J
2012-09-07
Extraction and purification of DNA is a prerequisite to detection and analytical techniques. While DNA sample preparation methods have improved over the last few decades, current methods are still time consuming and labor intensive. Here we demonstrate a technology termed IFAST (Immiscible Filtration Assisted by Surface Tension), that relies on immiscible phase filtration to reduce the time and effort required to purify DNA. IFAST replaces the multiple wash and centrifugation steps required by traditional DNA sample preparation methods with a single step. To operate, DNA from lysed cells is bound to paramagnetic particles (PMPs) and drawn through an immiscible fluid phase barrier (i.e. oil) by an external handheld magnet. Purified DNA is then eluted from the PMPs. Here, detection of Clostridium botulinum type A (BoNT/A) in food matrices (milk, orange juice), a bioterrorism concern, was used as a model system to establish IFAST's utility in detection assays. Data validated that the DNA purified by IFAST was functional as a qPCR template to amplify the bont/A gene. The sensitivity limit of IFAST was comparable to the commercially available Invitrogen ChargeSwitch® method. Notably, pathogen detection via IFAST required only 8.5 μL of sample and was accomplished in five-fold less time. The simplicity, rapidity and portability of IFAST offer significant advantages when compared to existing DNA sample preparation methods.
Bounds on area and charge for marginally trapped surfaces with a cosmological constant
International Nuclear Information System (INIS)
Simon, Walter
2012-01-01
We sharpen the known inequalities AΛ ≤ 4π(1 - g) (Hayward et al 1994 Phys. Rev. D 49 5080, Woolgar 1999 Class. Quantum Grav. 16 3005) and A ≤ 4πQ 2 (Dain et al 2012 Class. Quantum Grav. 29 035013) between the area A and the electric charge Q of a stable marginally outer-trapped surface (MOTS) of genus g in the presence of a cosmological constant Λ. In particular, instead of requiring stability we include the principal eigenvalue λ of the stability operator. For Λ* Λ+λ > 0, we obtain a lower and an upper bound for Λ*A in terms of Λ*Q 2 , as well as the upper bound Q≤1/(2√(Λ * )) for the charge, which reduces to Q≤1/(2√(Λ)) in the stable case λ ≥ 0. For Λ* < 0, there only remains a lower bound on A. In the spherically symmetric, static, stable case, one of our area inequalities is saturated iff the surface gravity vanishes. We also discuss implications of our inequalities for 'jumps' and mergers of charged MOTS. (fast track communication)
Polarized DNA Ejection from the Herpesvirus Capsid
Newcomb, William W.; Cockrell, Shelley K.; Homa, Fred L.; Brown, Jay C.
2009-01-01
Ejection of DNA from the capsid is an early step in infection by all herpesviruses. Ejection or DNA uncoating occurs after a parental capsid has entered the host cell cytoplasm, migrated to the nucleus and bound to a nuclear pore. DNA exits the capsid through the portal vertex and proceeds by way of the nuclear pore complex into the nucleoplasm where it is transcribed and replicated. Here we describe use of an in vitro uncoating system to determine which genome end exits first from the herpes simplex virus (HSV-1) capsid. Purified DNA-containing capsids were bound to a solid surface and warmed under conditions in which some, but not all, of the DNA was ejected. Restriction endonuclease digestion was then used to identify the genomic origin of the ejected DNA. The results support the view that the S segment end exits the capsid first. Preferential release at the S end demonstrates that herpesvirus DNA uncoating conforms to the paradigm in dsDNA bacteriophage where the last end packaged is the first to be ejected. Release of HSV-1 DNA beginning at the S end causes the first gene to enter the host cell nucleus to be α4, a transcription factor required for expression of early genes. PMID:19631662
On-chip magnetic bead-based DNA melting curve analysis using a magnetoresistive sensor
International Nuclear Information System (INIS)
Rizzi, Giovanni; Østerberg, Frederik W.; Henriksen, Anders D.; Dufva, Martin; Hansen, Mikkel F.
2015-01-01
We present real-time measurements of DNA melting curves in a chip-based system that detects the amount of surface-bound magnetic beads using magnetoresistive magnetic field sensors. The sensors detect the difference between the amount of beads bound to the top and bottom sensor branches of the differential sensor geometry. The sensor surfaces are functionalized with wild type (WT) and mutant type (MT) capture probes, differing by a single base insertion (a single nucleotide polymorphism, SNP). Complementary biotinylated targets in suspension couple streptavidin magnetic beads to the sensor surface. The beads are magnetized by the field arising from the bias current passed through the sensors. We demonstrate the first on-chip measurements of the melting of DNA hybrids upon a ramping of the temperature. This overcomes the limitation of using a single washing condition at constant temperature. Moreover, we demonstrate that a single sensor bridge can be used to genotype a SNP. - Highlights: • We apply magnetoresistive sensors to study solid-surface hybridization kinetics of DNA. • We measure DNA melting profiles for perfectly matching DNA duplexes and for a single base mismatch. • We present a procedure to correct for temperature dependencies of the sensor output. • We reliably extract melting temperatures for the DNA hybrids. • We demonstrate direct measurement of differential binding signal for two probes on a single sensor
The effect of pH and DNA concentration on organic thin-film transistor biosensors
Khan, Hadayat Ullah; Roberts, Mark E.; Johnson, Olasupo B.; Knoll, Wolfgang; Bao, Zhenan
2012-01-01
Organic electronics are beginning to attract more interest for biosensor technology as they provide an amenable interface between biology and electronics. Stable biosensor based on electronic detection platform would represent a significant advancement in technology as costs and analysis time would decrease immensely. Organic materials provide a route toward that goal due to their compatibility with electronic applications and biological molecules. In this report, we detail the effects of experimental parameters, such as pH and concentration, toward the selective detection of DNA via surface-bound peptide nucleic acid (PNA) sequences on organic transistor biosensors. The OTFT biosensors are fabricated with thin-films of the organic semiconductor, 5,5′-bis-(7-dodecyl-9H-fluoren-2-yl)-2,2′-bithiophene (DDFTTF), in which they exhibit a stable mobility of 0.2 cm 2 V -1 s -1 in buffer solutions (phosphate-buffer saline, pH 7.4 or sodium acetate, pH 7). Device performance were optimized to minimize the deleterious effects of pH on gate-bias stress such that the sensitivity toward DNA detection can be improved. In titration experiments, the surface-bound PNA probes were saturated with 50 nM of complementary target DNA, which required a 10-fold increase in concentration of single-base mismatched target DNA to achieve a similar surface saturation. The binding constant of DNA on the surface-bound PNA probes was determined from the concentration-dependent response (titration measurements) of our organic transistor biosensors. © 2011 Elsevier B.V. All rights reserved.
The effect of pH and DNA concentration on organic thin-film transistor biosensors
Khan, Hadayat Ullah
2012-03-01
Organic electronics are beginning to attract more interest for biosensor technology as they provide an amenable interface between biology and electronics. Stable biosensor based on electronic detection platform would represent a significant advancement in technology as costs and analysis time would decrease immensely. Organic materials provide a route toward that goal due to their compatibility with electronic applications and biological molecules. In this report, we detail the effects of experimental parameters, such as pH and concentration, toward the selective detection of DNA via surface-bound peptide nucleic acid (PNA) sequences on organic transistor biosensors. The OTFT biosensors are fabricated with thin-films of the organic semiconductor, 5,5′-bis-(7-dodecyl-9H-fluoren-2-yl)-2,2′-bithiophene (DDFTTF), in which they exhibit a stable mobility of 0.2 cm 2 V -1 s -1 in buffer solutions (phosphate-buffer saline, pH 7.4 or sodium acetate, pH 7). Device performance were optimized to minimize the deleterious effects of pH on gate-bias stress such that the sensitivity toward DNA detection can be improved. In titration experiments, the surface-bound PNA probes were saturated with 50 nM of complementary target DNA, which required a 10-fold increase in concentration of single-base mismatched target DNA to achieve a similar surface saturation. The binding constant of DNA on the surface-bound PNA probes was determined from the concentration-dependent response (titration measurements) of our organic transistor biosensors. © 2011 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Lee, Myoung-Jae [Department of Physics, Hanyang University, Seoul 04763 (Korea, Republic of); Research Institute for Natural Sciences, Hanyang University, Seoul 04763 (Korea, Republic of); Jung, Young-Dae, E-mail: ydjung@hanyang.ac.kr [Department of Applied Physics and Department of Bionanotechnology, Hanyang University, Ansan, Kyunggi-Do 15588 (Korea, Republic of); Department of Electrical and Computer Engineering, MC 0407, University of California, San Diego, 9500 Gilman Drive, La Jolla, CA 92093-0407 (United States)
2017-02-12
High frequency electrostatic wave propagation in a dense and semi-bounded electron quantum plasma is investigated with consideration of the Bohm potential. The dispersion relation for the surface mode of quantum plasma is derived and numerically analyzed. We found that the quantum effect enhances the frequency of the wave especially in the high wave number regime. However, the frequency of surface wave is found to be always lower than that of the bulk wave for the same quantum wave number. The group velocity of the surface wave for various quantum wave number is also obtained. - Highlights: • High frequency electrostatic wave propagation is investigated in a dense semi-bounded quantum plasma. • The dispersion relation for the surface mode of quantum plasma is derived and numerically analyzed. • The quantum effect enhances the frequency of the wave especially in the high wave number regime. • The frequency of surface wave is found to be always lower than that of the bulk wave. • The group velocity of the surface wave for various quantum wave number is also obtained.
Surface-enhanced Raman scattering based nonfluorescent probe for multiplex DNA detection.
Sun, Lan; Yu, Chenxu; Irudayaraj, Joseph
2007-06-01
To provide rapid and accurate detection of DNA markers in a straightforward, inexpensive, and multiplex format, an alternative surface-enhanced Raman scattering based probe was designed and fabricated to covalently attach both DNA probing sequence and nonfluorescent Raman tags to the surface of gold nanoparticles (DNA-AuP-RTag). The intensity of Raman signal of the probes could be controlled through the surface coverage of the nonfluorescent Raman tags (RTags). Detection sensitivity of these probes could be optimized by fine-tuning the amount of DNA molecules and RTags on the probes. Long-term stability of the DNA-AuP-RTag probes was found to be good (over 3 months). Excellent multiplexing capability of the DNA-AuP-RTag scheme was demonstrated by simultaneous identification of up to eight probes in a mixture. Detection of hybridization of single-stranded DNA to its complementary targets was successfully accomplished with a long-term goal to use nonfluorescent RTags in a Raman-based DNA microarray platform.
De Tullio, Luisina; Kaniecki, Kyle; Kwon, Youngho; Crickard, J Brooks; Sung, Patrick; Greene, Eric C
2017-10-17
Srs2 is a super-family 1 helicase that promotes genome stability by dismantling toxic DNA recombination intermediates. However, the mechanisms by which Srs2 remodels or resolves recombination intermediates remain poorly understood. Here, single-molecule imaging is used to visualize Srs2 in real time as it acts on single-stranded DNA (ssDNA) bound by protein factors that function in recombination. We demonstrate that Srs2 is highly processive and translocates rapidly (∼170 nt per second) in the 3'→5' direction along ssDNA saturated with replication protein A (RPA). We show that RPA is evicted from DNA during the passage of Srs2. Remarkably, Srs2 also readily removes the recombination mediator Rad52 from RPA-ssDNA and, in doing so, promotes rapid redistribution of both Rad52 and RPA. These findings have important mechanistic implications for understanding how Srs2 and related nucleic acid motor proteins resolve potentially pathogenic nucleoprotein intermediates. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
A stochastic DNA walker that traverses a microparticle surface
Jung, C.; Allen, P. B.; Ellington, A. D.
2016-02-01
Molecular machines have previously been designed that are propelled by DNAzymes, protein enzymes and strand displacement. These engineered machines typically move along precisely defined one- and two-dimensional tracks. Here, we report a DNA walker that uses hybridization to drive walking on DNA-coated microparticle surfaces. Through purely DNA:DNA hybridization reactions, the nanoscale movements of the walker can lead to the generation of a single-stranded product and the subsequent immobilization of fluorescent labels on the microparticle surface. This suggests that the system could be of use in analytical and diagnostic applications, similar to how strand exchange reactions in solution have been used for transducing and quantifying signals from isothermal molecular amplification assays. The walking behaviour is robust and the walker can take more than 30 continuous steps. The traversal of an unprogrammed, inhomogeneous surface is also due entirely to autonomous decisions made by the walker, behaviour analogous to amorphous chemical reaction network computations, which have been shown to lead to pattern formation.
Analysis of the role of PCNA-DNA contacts during clamp loading
Directory of Open Access Journals (Sweden)
Goedken Eric R
2010-01-01
Full Text Available Abstract Background Sliding clamps, such as Proliferating Cell Nuclear Antigen (PCNA in eukaryotes, are ring-shaped protein complexes that encircle DNA and enable highly processive DNA replication by serving as docking sites for DNA polymerases. In an ATP-dependent reaction, clamp loader complexes, such as the Replication Factor-C (RFC complex in eukaryotes, open the clamp and load it around primer-template DNA. Results We built a model of RFC bound to PCNA and DNA based on existing crystal structures of clamp loaders. This model suggests that DNA would enter the clamp at an angle during clamp loading, thereby interacting with positively charged residues in the center of PCNA. We show that simultaneous mutation of Lys 20, Lys 77, Arg 80, and Arg 149, which interact with DNA in the RFC-PCNA-DNA model, compromises the ability of yeast PCNA to stimulate the DNA-dependent ATPase activity of RFC when the DNA is long enough to extend through the clamp. Fluorescence anisotropy binding experiments show that the inability of the mutant clamp proteins to stimulate RFC ATPase activity is likely caused by reduction in the affinity of the RFC-PCNA complex for DNA. We obtained several crystal forms of yeast PCNA-DNA complexes, measuring X-ray diffraction data to 3.0 Å resolution for one such complex. The resulting electron density maps show that DNA is bound in a tilted orientation relative to PCNA, but makes different contacts than those implicated in clamp loading. Because of apparent partial disorder in the DNA, we restricted refinement of the DNA to a rigid body model. This result contrasts with previous analysis of a bacterial clamp bound to DNA, where the DNA was well resolved. Conclusion Mutational analysis of PCNA suggests that positively charged residues in the center of the clamp create a binding surface that makes contact with DNA. Disruption of this positive surface, which had not previously been implicated in clamp loading function, reduces RFC
Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt V; Ferapontova, Elena E
2010-06-01
A DNA molecular beacon approach was used for the analysis of interactions between DNA and Methylene Blue (MB) as a redox indicator of a hybridization event. DNA hairpin structures of different length and guanine (G) content were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 5'-end. Binding of MB to the folded hairpin DNA was electrochemically studied and compared with binding to the duplex structure formed by hybridization of the hairpin DNA to a complementary DNA strand. Variation of the electrochemical signal from the DNA-MB complex was shown to depend primarily on the DNA length and sequence used: the G-C base pairs were the preferential sites of MB binding in the duplex. For short 20 nts long DNA sequences, the increased electrochemical response from MB bound to the duplex structure was consistent with the increased amount of bound and electrochemically readable MB molecules (i.e. MB molecules that are available for the electron transfer (ET) reaction with the electrode). With longer DNA sequences, the balance between the amounts of the electrochemically readable MB molecules bound to the hairpin DNA and to the hybrid was opposite: a part of the MB molecules bound to the long-sequence DNA duplex seem to be electrochemically mute due to long ET distance. The increasing electrochemical response from MB bound to the short-length DNA hybrid contrasts with the decreasing signal from MB bound to the long-length DNA hybrid and allows an "off"-"on" genosensor development.
Xu, Changgang; Carlsson, Daniel O; Mihranyan, Albert
2016-07-01
The goal of this project was to study the feasibility of using a DNA-immobilized nanocellulose-based immunoadsorbent for possible application in medical apheresis such as systemic lupus erythematosus (SLE) treatment. Calf thymus DNA was bound to high surface area nanocellulose membrane at varying concentrations using UV-irradiation. The DNA-immobilized samples were characterized with scanning electron microscopy, atomic force microscopy, and phosphorus elemental analysis. The anti-ds-DNA IgG binding was tested in vitro using ELISA. The produced sample showed high affinity in vitro to bind anti-ds-DNA-antibodies from mice, as much as 80% of added IgG was bound by the membrane. Furthermore, the binding efficiency was quantitatively dependent on the amount of immobilized DNA onto nanocellulose membrane. The described nanocellulose membranes are interesting immunoadsorbents for continued clinical studies. Copyright © 2016 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Baburajendran, Nithya; Palasingam, Paaventhan; Ng, Calista Keow Leng; Jauch, Ralf; Kolatkar, Prasanna R.
2009-01-01
Crystals of palindromic SBE DNA-bound Smad1 MH1 domain diffracting to 2.7 Å resolution have been obtained. The bone morphogenetic protein (BMP) signalling pathway regulates diverse processes such as cell differentiation, anterior/posterior axis specification, cell growth and the formation of extra-embryonic tissues. The transcription factor Smad1 relays the BMP signal from the cytoplasm to the nucleus, where it binds short DNA-sequence motifs and regulates gene expression. However, how Smad1 selectively targets particular genomic regions is poorly understood. In order to understand the physical basis of the specific interaction of Smad1 with DNA and to contrast it with the highly homologous but functionally distinct Smad3 protein, the DNA-binding Mad-homology 1 (MH1) domain of Smad1 was cocrystallized with a 17-mer palindromic Smad-binding element (SBE). The extensive optimizations of the length, binding-site spacing and terminal sequences of the DNA element in combination with the other crystallization parameters necessary for obtaining diffraction-quality crystals are described here. A 2.7 Å resolution native data set was collected at the National Synchrotron Radiation Research Centre, Taiwan, from crystals grown in a solution containing 0.2 M ammonium tartrate dibasic, 20% PEG 3350, 3% 2-propanol and 10% glycerol. The data set was indexed and merged in space group P222, with unit-cell parameters a = 73.94, b = 77.49, c = 83.78 Å, α = β = γ = 90°. The solvent content in the unit cell is consistent with the presence of two Smad1 MH1 molecules bound to the duplex DNA in the asymmetric unit
Milton, James A.; Patole, Samson; Yin, Huabing; Xiao, Qiang; Brown, Tom; Melvin, Tracy
2013-01-01
Although strategies for the immobilization of DNA oligonucleotides onto surfaces for bioanalytical and top-down bio-inspired nanobiofabrication approaches are well developed, the effect of introducing spacer molecules between the surface and the DNA oligonucleotide for the hybridization of nanoparticle–DNA conjugates has not been previously assessed in a quantitative manner. The hybridization efficiency of DNA oligonucleotides end-labelled with gold nanoparticles (1.4 or 10 nm diameter) with DNA sequences conjugated to silicon surfaces via hexaethylene glycol phosphate diester oligomer spacers (0, 1, 2, 6 oligomers) was found to be independent of spacer length. To quantify both the density of DNA strands attached to the surfaces and hybridization with the surface-attached DNA, new methodologies have been developed. Firstly, a simple approach based on fluorescence has been developed for determination of the immobilization density of DNA oligonucleotides. Secondly, an approach using mass spectrometry has been created to establish (i) the mean number of DNA oligonucleotides attached to the gold nanoparticles and (ii) the hybridization density of nanoparticle–oligonucleotide conjugates with the silicon surface–attached complementary sequence. These methods and results will be useful for application with nanosensors, the self-assembly of nanoelectronic devices and the attachment of nanoparticles to biomolecules for single-molecule biophysical studies. PMID:23361467
ERROR BOUNDS FOR SURFACE AREA ESTIMATORS BASED ON CROFTON’S FORMULA
Directory of Open Access Journals (Sweden)
Markus Kiderlen
2011-05-01
Full Text Available According to Crofton's formula, the surface area S(A of a sufficiently regular compact set A in Rd is proportional to the mean of all total projections pA (u on a linear hyperplane with normal u, uniformly averaged over all unit vectors u. In applications, pA (u is only measured in k directions and the mean is approximated by a finite weighted sum bS(A of the total projections in these directions. The choice of the weights depends on the selected quadrature rule. We define an associated zonotope Z (depending only on the projection directions and the quadrature rule, and show that the relative error bS (A/S (A is bounded from below by the inradius of Z and from above by the circumradius of Z. Applying a strengthened isoperimetric inequality due to Bonnesen, we show that the rectangular quadrature rule does not give the best possible error bounds for d =2. In addition, we derive asymptotic behavior of the error (with increasing k in the planar case. The paper concludes with applications to surface area estimation in design-based digital stereology where we show that the weights due to Bonnesen's inequality are better than the usual weights based on the rectangular rule and almost optimal in the sense that the relative error of the surface area estimator is very close to the minimal error.
On-chip magnetic bead-based DNA melting curve analysis using a magnetoresistive sensor
DEFF Research Database (Denmark)
Rizzi, Giovanni; Østerberg, Frederik Westergaard; Henriksen, Anders Dahl
2014-01-01
We present real-time measurements of DNA melting curves in a chip-based system that detects the amount of surface-bound magnetic beads using magnetoresistive magnetic field sensors. The sensors detect the difference between the amount of beads bound to the top and bottom sensor branches....... The beads are magnetized by the field arising from the bias current passed through the sensors. We demonstrate the first on-chip measurements of the melting of DNA hybrids upon a ramping of the temperature. This overcomes the limitation of using a single washing condition at constant temperature. Moreover...
Switchable DNA interfaces for the highly sensitive detection of label-free DNA targets.
Rant, Ulrich; Arinaga, Kenji; Scherer, Simon; Pringsheim, Erika; Fujita, Shozo; Yokoyama, Naoki; Tornow, Marc; Abstreiter, Gerhard
2007-10-30
We report a method to detect label-free oligonucleotide targets. The conformation of surface-tethered probe nucleic acids is modulated by alternating electric fields, which cause the molecules to extend away from or fold onto the biased surface. Binding (hybridization) of targets to the single-stranded probes results in a pronounced enhancement of the layer-height modulation amplitude, monitored optically in real time. The method features an exceptional detection limit of <3 x 10(8) bound targets per cm(2) sensor area. Single base-pair mismatches in the sequences of DNA complements may readily be identified; moreover, binding kinetics and binding affinities can be determined with high accuracy. When driving the DNA to oscillate at frequencies in the kHz regime, distinct switching kinetics are revealed for single- and double-stranded DNA. Molecular dynamics are used to identify the binding state of molecules according to their characteristic kinetic fingerprints by using a chip-compatible detection format.
Kouno, Takahide; Silvas, Tania V; Hilbert, Brendan J; Shandilya, Shivender M D; Bohn, Markus F; Kelch, Brian A; Royer, William E; Somasundaran, Mohan; Kurt Yilmaz, Nese; Matsuo, Hiroshi; Schiffer, Celia A
2017-04-28
Nucleic acid editing enzymes are essential components of the immune system that lethally mutate viral pathogens and somatically mutate immunoglobulins, and contribute to the diversification and lethality of cancers. Among these enzymes are the seven human APOBEC3 deoxycytidine deaminases, each with unique target sequence specificity and subcellular localization. While the enzymology and biological consequences have been extensively studied, the mechanism by which APOBEC3s recognize and edit DNA remains elusive. Here we present the crystal structure of a complex of a cytidine deaminase with ssDNA bound in the active site at 2.2 Å. This structure not only visualizes the active site poised for catalysis of APOBEC3A, but pinpoints the residues that confer specificity towards CC/TC motifs. The APOBEC3A-ssDNA complex defines the 5'-3' directionality and subtle conformational changes that clench the ssDNA within the binding groove, revealing the architecture and mechanism of ssDNA recognition that is likely conserved among all polynucleotide deaminases, thereby opening the door for the design of mechanistic-based therapeutics.
Park, Jin Ha; Lee, Hyun Suk; Jang, Myung Duk; Han, Sung Wook; Kim, Seog K; Lee, Young-Ae
2018-06-01
The interaction of Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ (DPPZ = dipyrido[3,2-a:2', 3'-c]phenazine, phen = phenanthroline) with a G-quadruplex formed from 5'-G 2 T 2 G 2 TGTG 2 T 2 G 2-3 '(15-mer) was investigated. The well-known enhancement of luminescence intensity (the 'light-switch' effect) was observed for the [Ru(phen) 2 DPPZ] 2+ complexes upon formation of an adduct with the G-quadruplex. The emission intensity of the G-quadruplex-bound Λ-isomer was 3-fold larger than that of the Δ-isomer when bound to the G-quadruplex, which is opposite of the result observed in the case of double stranded DNA (dsDNA); the light switch effect is larger for the dsDNA-bound Δ-isomer. In the job plot of the G-quadruplex with Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ , a major inflection point for the two isomers was observed at x ≈ .65, which suggests a binding stoichiometry of 2:1 for both enantiomers. When the G base at the 8th position was replaced with 6-methyl isoxanthopterin (6MI), a fluorescent guanine analog, the excited energy of 6-MI transferred to bound Δ- or Λ-[Ru(phen) 2 DPPZ] 2+ , which suggests that at least a part of both Ru(II) enantiomers is close to or in contact with the diagonal loop of the G-quadruplex. A luminescence quenching experiment using [Fe(CN) 6 ] 4- for the G-quadruplex-bound Ru(II) complex revealed downward bending curves for both enantiomers in the Stern-Volmer plot, which suggests the presence of Ru(II) complexes that are both accessible and inaccessible to the quencher and may be related to the 2:1 binding stoichiometry.
Miall, Andrew D.
1988-03-01
Three well-exposed outcrops in the Kayenta Formation (Lower Jurassic), near Dove Creek in southwestern Colorado, were studied using lateral profiles, in order to test recent regarding architectural-element analysis and the classification and interpretation of internal bounding surfaces. Examination of bounding surfaces within and between elements in the Kayenta outcrops raises problems in applying the three-fold classification of Allen (1983). Enlarging this classification to a six-fold hierarchy permits the discrimination of surfaces intermediate between Allen's second- and third-order types, corresponding to the upper bounding surfaces of macroforms, and internal erosional "reactivation" surfaces within the macroforms. Examples of the first five types of surface occur in the Kayenta outcrops at Dove Creek. The new classifications is offered as a general solution to the problem of description of complex, three-dimensional fluvial sandstone bodies. The Kayenta Formation at Dove Creek consists of a multistorey sandstone body, including the deposits of lateral- and downstream-accreted macroforms. The storeys show no internal cyclicity, neither within individual elements nor through the overall vertical thickness of the formation. Low paleocurrent variance indicates low sinuosity flow, whereas macroform geometry and orientation suggest low to moderate sinuosity. The many internal minor erosion surfaces draped with mud and followed by intraclast breccias imply frequent rapid stage fluctuation, consistent with variable (seasonal? monsonal? ephemmeral?) flow. The results suggest a fluvial architecture similar to that of the South Saskatchewan River, through with a three-dimensional geometry unlike that interpreted from surface studies of that river.
Sea level: measuring the bounding surfaces of the ocean
Tamisiea, Mark E.; Hughes, Chris W.; Williams, Simon D. P.; Bingley, Richard M.
2014-01-01
The practical need to understand sea level along the coasts, such as for safe navigation given the spatially variable tides, has resulted in tide gauge observations having the distinction of being some of the longest instrumental ocean records. Archives of these records, along with geological constraints, have allowed us to identify the century-scale rise in global sea level. Additional data sources, particularly satellite altimetry missions, have helped us to better identify the rates and causes of sea-level rise and the mechanisms leading to spatial variability in the observed rates. Analysis of all of the data reveals the need for long-term and stable observation systems to assess accurately the regional changes as well as to improve our ability to estimate future changes in sea level. While information from many scientific disciplines is needed to understand sea-level change, this review focuses on contributions from geodesy and the role of the ocean's bounding surfaces: the sea surface and the Earth's crust. PMID:25157196
DEFF Research Database (Denmark)
Regina, Viduthalai R.; Lokanathan, Arcot R.; Modrzynski, Jakub Jan
2014-01-01
Extracellular DNA (eDNA) is an important structural component of biofilms formed by many bacteria, but few reports have focused on its role in initial cell adhesion. The aim of this study was to investigate the role of eDNA in bacterial adhesion to abiotic surfaces, and determine to which extent ...
Modified surface of titanium dioxide nanoparticles-based biosensor for DNA detection
Nadzirah, Sh.; Hashim, U.; Rusop, M.
2018-05-01
A new technique was used to develop a simple and selective picoammeter DNA biosensor for identification of E. coli O157:H7. This biosensor was fabricated from titanium dioxide nanoparticles that was synthesized by sol-gel method and spin-coated on silicon dioxide substrate via spinner. 3-Aminopropyl triethoxy silane (APTES) was used to modify the surface of TiO2. Simple surface modification approach has been applied; which is single dropping of APTES onto the TiO2 nanoparticles surface. Carboxyl modified probe DNA has been bind onto the surface of APTES/TiO2 without any amplifier element. Electrical signal has been used as the indicator to differentiate each step (surface modification of TiO2 and probe DNA immobilization). The I-V measurements indicate extremely low current (pico-ampere) flow through the device which is 2.8138E-10 A for pure TiO2 nanoparticles, 2.8124E-10 A after APTES modification and 3.5949E-10 A after probe DNA immobilization.
Mechanical splitting of microtubules into protofilament bundles by surface-bound kinesin-1.
VanDelinder, Virginia; Adams, Peter G; Bachand, George D
2016-12-21
The fundamental biophysics of gliding microtubule (MT) motility by surface-tethered kinesin-1 motor proteins has been widely studied, as well as applied to capture and transport analytes in bioanalytical microdevices. In these systems, phenomena such as molecular wear and fracture into shorter MTs have been reported due the mechanical forces applied on the MT during transport. In the present work, we show that MTs can be split longitudinally into protofilament bundles (PFBs) by the work performed by surface-bound kinesin motors. We examine the properties of these PFBs using several techniques (e.g., fluorescence microscopy, SEM, AFM), and show that the PFBs continue to be mobile on the surface and display very high curvature compared to MT. Further, higher surface density of kinesin motors and shorter kinesin-surface tethers promote PFB formation, whereas modifying MT with GMPCPP or higher paclitaxel concentrations did not affect PFB formation.
DNA immobilization and detection on cellulose paper using a surface grown cationic polymer via ATRP.
Aied, Ahmed; Zheng, Yu; Pandit, Abhay; Wang, Wenxin
2012-02-01
Cationic polymers with various structures have been widely investigated in the areas of medical diagnostics and molecular biology because of their unique binding properties and capability to interact with biological molecules in complex biological environments. In this work, we report the grafting of a linear cationic polymer from an atom transfer radical polymerization (ATRP) initiator bound to cellulose paper surface. We show successful binding of ATRP initiator onto cellulose paper and grafting of polymer chains from the immobilized initiator with ATRP. The cellulose paper grafted polymer was used in combination with PicoGreen (PG) to demonstrate detection of nucleic acids in the nanogram range in homogeneous solution and in a biological sample (serum). The results showed specific identification of hybridized DNA after addition of PG in both solutions.
Conformation-dependent DNA attraction
Li, Weifeng; Nordenskiöld, Lars; Zhou, Ruhong; Mu, Yuguang
2014-05-01
Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg2+ ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg2+ or Na+, benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg2+ bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription.Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by
Chemo-mechanical pushing of proteins along single-stranded DNA.
Sokoloski, Joshua E; Kozlov, Alexander G; Galletto, Roberto; Lohman, Timothy M
2016-05-31
Single-stranded (ss)DNA binding (SSB) proteins bind with high affinity to ssDNA generated during DNA replication, recombination, and repair; however, these SSBs must eventually be displaced from or reorganized along the ssDNA. One potential mechanism for reorganization is for an ssDNA translocase (ATP-dependent motor) to push the SSB along ssDNA. Here we use single molecule total internal reflection fluorescence microscopy to detect such pushing events. When Cy5-labeled Escherichia coli (Ec) SSB is bound to surface-immobilized 3'-Cy3-labeled ssDNA, a fluctuating FRET signal is observed, consistent with random diffusion of SSB along the ssDNA. Addition of Saccharomyces cerevisiae Pif1, a 5' to 3' ssDNA translocase, results in the appearance of isolated, irregularly spaced saw-tooth FRET spikes only in the presence of ATP. These FRET spikes result from translocase-induced directional (5' to 3') pushing of the SSB toward the 3' ssDNA end, followed by displacement of the SSB from the DNA end. Similar ATP-dependent pushing events, but in the opposite (3' to 5') direction, are observed with EcRep and EcUvrD (both 3' to 5' ssDNA translocases). Simulations indicate that these events reflect active pushing by the translocase. The ability of translocases to chemo-mechanically push heterologous SSB proteins along ssDNA provides a potential mechanism for reorganization and clearance of tightly bound SSBs from ssDNA.
The high-level error bound for shifted surface spline interpolation
Luh, Lin-Tian
2006-01-01
Radial function interpolation of scattered data is a frequently used method for multivariate data fitting. One of the most frequently used radial functions is called shifted surface spline, introduced by Dyn, Levin and Rippa in \\cite{Dy1} for $R^{2}$. Then it's extended to $R^{n}$ for $n\\geq 1$. Many articles have studied its properties, as can be seen in \\cite{Bu,Du,Dy2,Po,Ri,Yo1,Yo2,Yo3,Yo4}. When dealing with this function, the most commonly used error bounds are the one raised by Wu and S...
Radiolysis of DNA-protein complexes
Energy Technology Data Exchange (ETDEWEB)
Begusova, Marie [Department of Radiation Dosimetry, Nuclear Physics Institute, Na Truhlarce 39/64, CZ-18086, Prague 8 (Czech Republic)]. E-mail: begusova@ujf.cas.cz; Gillard, Nathalie [Centre de Biophysique Moleculaire, CNRS, rue Charles-Sadron, F-45071 Orleans Cedex 2 (France); Sy, Denise [Centre de Biophysique Moleculaire, CNRS, rue Charles-Sadron, F-45071 Orleans Cedex 2 (France); Castaing, Bertrand [Centre de Biophysique Moleculaire, CNRS, rue Charles-Sadron, F-45071 Orleans Cedex 2 (France); Charlier, Michel [Centre de Biophysique Moleculaire, CNRS, rue Charles-Sadron, F-45071 Orleans Cedex 2 (France); Spotheim-Maurizot, Melanie [Centre de Biophysique Moleculaire, CNRS, rue Charles-Sadron, F-45071 Orleans Cedex 2 (France)
2005-02-01
We discuss here modifications of DNA and protein radiolysis due to the interaction of these two partners in specific complexes. Experimental patterns of frank strand breaks (FSB) and alkali revealed breaks (ARB) obtained for DNA lac operator bound to the lac repressor and for a DNA containing an abasic site analog bound to the formamidopyrimidine-DNA glycosylase are reported. Experimental data are compared to predicted damage distribution obtained using the theoretical model RADACK.
Radiolysis of DNA-protein complexes
International Nuclear Information System (INIS)
Begusova, Marie; Gillard, Nathalie; Sy, Denise; Castaing, Bertrand; Charlier, Michel; Spotheim-Maurizot, Melanie
2005-01-01
We discuss here modifications of DNA and protein radiolysis due to the interaction of these two partners in specific complexes. Experimental patterns of frank strand breaks (FSB) and alkali revealed breaks (ARB) obtained for DNA lac operator bound to the lac repressor and for a DNA containing an abasic site analog bound to the formamidopyrimidine-DNA glycosylase are reported. Experimental data are compared to predicted damage distribution obtained using the theoretical model RADACK
Conformational elasticity can facilitate TALE-DNA recognition.
Lei, Hongxing; Sun, Jiya; Baldwin, Enoch P; Segal, David J; Duan, Yong
2014-01-01
Sequence-programmable transcription activator-like effector (TALE) proteins have emerged as a highly efficient tool for genome engineering. Recent crystal structures depict a transition between an open unbound solenoid and more compact DNA-bound solenoid formed by the 34 amino acid repeats. How TALEs switch conformation between these two forms without substantial energetic compensation, and how the repeat-variable di-residues (RVDs) discriminate between the cognate base and other bases still remain unclear. Computational analysis on these two aspects of TALE-DNA interaction mechanism has been conducted in order to achieve a better understanding of the energetics. High elasticity was observed in the molecular dynamics simulations of DNA-free TALE structure that started from the bound conformation where it sampled a wide range of conformations including the experimentally determined apo and bound conformations. This elastic feature was also observed in the simulations starting from the apo form which suggests low free energy barrier between the two conformations and small compensation required upon binding. To analyze binding specificity, we performed free energy calculations of various combinations of RVDs and bases using Poisson-Boltzmann surface area (PBSA) and other approaches. The PBSA calculations indicated that the native RVD-base structures had lower binding free energy than mismatched structures for most of the RVDs examined. Our theoretical analyses provided new insight on the dynamics and energetics of TALE-DNA binding mechanism. © 2014 Elsevier Inc. All rights reserved.
Sea level: measuring the bounding surfaces of the ocean.
Tamisiea, Mark E; Hughes, Chris W; Williams, Simon D P; Bingley, Richard M
2014-09-28
The practical need to understand sea level along the coasts, such as for safe navigation given the spatially variable tides, has resulted in tide gauge observations having the distinction of being some of the longest instrumental ocean records. Archives of these records, along with geological constraints, have allowed us to identify the century-scale rise in global sea level. Additional data sources, particularly satellite altimetry missions, have helped us to better identify the rates and causes of sea-level rise and the mechanisms leading to spatial variability in the observed rates. Analysis of all of the data reveals the need for long-term and stable observation systems to assess accurately the regional changes as well as to improve our ability to estimate future changes in sea level. While information from many scientific disciplines is needed to understand sea-level change, this review focuses on contributions from geodesy and the role of the ocean's bounding surfaces: the sea surface and the Earth's crust. © 2014 The Author(s) Published by the Royal Society. All rights reserved.
Bodsgard, Brett R; Clark, Robert W; Ehrbar, Anthony W; Burstyn, Judith N
2009-04-07
A series of silica-bound Cu(ii) triazacyclononane materials was prepared to study the effect of linker length and surface hydrophobicity on the hydrolysis of phosphate esters. The general synthetic approach for these heterogeneous reagents was rhodium-catalyzed hydrosilation between an alkenyl-modified triazacyclononane and hydride-modified silica followed by metallation with a Cu(ii) salt. Elemental analysis confirmed that organic functionalization of the silica gel was successful and provided an estimate of the surface concentration of triazacyclononane. EPR spectra were consistent with square pyramidal Cu(ii), indicating that Cu(ii) ions were bound to the immobilized macrocycles. The hydrolytic efficacies of these heterogeneous reagents were tested with bis(p-nitrophenyl)phosphate (BNPP) and diethyl 4-nitrophenyl phosphate (paraoxon). The agent that performed best was an octyl-linked, propanol-blocked material. This material had the most hydrophilic surface and the most accessible active site, achieving a rate maximum on par with the other materials, but in fewer cycles and without an induction period.
DNA origami as biocompatible surface to match single-molecule and ensemble experiments
Gietl, Andreas; Holzmeister, Phil; Grohmann, Dina; Tinnefeld, Philip
2012-01-01
Single-molecule experiments on immobilized molecules allow unique insights into the dynamics of molecular machines and enzymes as well as their interactions. The immobilization, however, can invoke perturbation to the activity of biomolecules causing incongruities between single molecule and ensemble measurements. Here we introduce the recently developed DNA origami as a platform to transfer ensemble assays to the immobilized single molecule level without changing the nano-environment of the biomolecules. The idea is a stepwise transfer of common functional assays first to the surface of a DNA origami, which can be checked at the ensemble level, and then to the microscope glass slide for single-molecule inquiry using the DNA origami as a transfer platform. We studied the structural flexibility of a DNA Holliday junction and the TATA-binding protein (TBP)-induced bending of DNA both on freely diffusing molecules and attached to the origami structure by fluorescence resonance energy transfer. This resulted in highly congruent data sets demonstrating that the DNA origami does not influence the functionality of the biomolecule. Single-molecule data collected from surface-immobilized biomolecule-loaded DNA origami are in very good agreement with data from solution measurements supporting the fact that the DNA origami can be used as biocompatible surface in many fluorescence-based measurements. PMID:22523083
Magro, Massimiliano; Martinello, Tiziana; Bonaiuto, Emanuela; Gomiero, Chiara; Baratella, Davide; Zoppellaro, Giorgio; Cozza, Giorgio; Patruno, Marco; Zboril, Radek; Vianello, Fabio
2017-11-01
Conversely to common coated iron oxide nanoparticles, novel naked surface active maghemite nanoparticles (SAMNs) can covalently bind DNA. Plasmid (pDNA) harboring the coding gene for GFP was directly chemisorbed onto SAMNs, leading to a novel DNA nanovector (SAMN@pDNA). The spontaneous internalization of SAMN@pDNA into cells was compared with an extensively studied fluorescent SAMN derivative (SAMN@RITC). Moreover, the transfection efficiency of SAMN@pDNA was evaluated and explained by computational model. SAMN@pDNA was prepared and characterized by spectroscopic and computational methods, and molecular dynamic simulation. The size and hydrodynamic properties of SAMN@pDNA and SAMN@RITC were studied by electron transmission microscopy, light scattering and zeta-potential. The two nanomaterials were tested by confocal scanning microscopy on equine peripheral blood-derived mesenchymal stem cells (ePB-MSCs) and GFP expression by SAMN@pDNA was determined. Nanomaterials characterized by similar hydrodynamic properties were successfully internalized and stored into mesenchymal stem cells. Transfection by SAMN@pDNA occurred and GFP expression was higher than lipofectamine procedure, even in the absence of an external magnetic field. A computational model clarified that transfection efficiency can be ascribed to DNA availability inside cells. Direct covalent binding of DNA on naked magnetic nanoparticles led to an extremely robust gene delivery tool. Hydrodynamic and chemical-physical properties of SAMN@pDNA were responsible of the successful uptake by cells and of the efficiency of GFP gene transfection. SAMNs are characterized by colloidal stability, excellent cell uptake, persistence in the host cells, low toxicity and are proposed as novel intelligent DNA nanovectors for efficient cell transfection. Copyright © 2017 Elsevier B.V. All rights reserved.
Single DNA molecules as probes for interrogating silica surfaces after various chemical treatments
International Nuclear Information System (INIS)
Liu Xia; Wu Zhan; Nie Huagui; Liu Ziling; He Yan; Yeung, E.S.
2007-01-01
We examined the adsorption of single YOYO-1-labeled λ-DNA molecules at glass surfaces after treatment with various chemical cleaning methods by using total internal reflection fluorescence microscopy (TIRFM). The characteristics of these surfaces were further assessed using contact angle (CA) measurements and atomic force microscopy (AFM). By recording the real-time dynamic motion of DNA molecules at the liquid/solid interface, subtle differences in adsorption affinities were revealed. The results indicate that the driving force for adsorption of DNA molecules on glass surfaces is mainly hydrophobic interaction. We also found that surface topography plays a role in the adsorption dynamics
International Nuclear Information System (INIS)
Pokotilovskij, Yu.N.
1999-01-01
The motion of a particle in the linear potential bounded by an inclined plane or parabolic surfaces is considered. The quantization of energy and wave functions is obtained numerically by the separation of the variables method
Binding of radiation-induced phenylalanine radicals to DNA
International Nuclear Information System (INIS)
Schans, G.P. van der; Rijn, C.J.S. van; Bleichrodt, J.F.
1975-11-01
When an aqueous solution of double-stranded DNA of bacteriophage PM2 containing phenylalanine and saturated with N 2 O is irradiated with γ-rays, radiation-induced phenylalanine radicals are bound covalently. Under the conditions used about 25 phenylalanine molecules may be bound per lethal hit. Also for single-stranded PM2 DNA, most of the phenylalanine radicals bound are non-lethal. Evidence is presented that in double-stranded DNA an appreciable fraction of the single-strand breaks is induced by phenylalanine radicals. Radiation products of phenylalanine and the phenylalanine bound to the DNA decrease the sensitivity of the DNA to the induction of single-strand breaks. There are indications that the high efficiency of protection by radiation products of phenylalanine is due to their positive charge, which will result in a relatively high concentration of these compounds in the vicinity of the negatively charged DNA molecules
Conformation-dependent DNA attraction.
Li, Weifeng; Nordenskiöld, Lars; Zhou, Ruhong; Mu, Yuguang
2014-06-21
Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg(2+) ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg(2+) or Na(+), benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg(2+) bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription.
Cdc6-Induced Conformational Changes in ORC Bound to Origin DNA Revealed by Cryo-Electron Microscopy
Energy Technology Data Exchange (ETDEWEB)
Sun J.; Li H.; Kawakami, H.; Zech, J.; Speck, C.; Stillman, B.
2012-03-07
The eukaryotic origin recognition complex (ORC) interacts with and remodels origins of DNA replication prior to initiation in S phase. Here, we report a single-particle cryo-EM-derived structure of the supramolecular assembly comprising Saccharomyces cerevisiae ORC, the replication initiation factor Cdc6, and double-stranded ARS1 origin DNA in the presence of ATP{gamma}S. The six subunits of ORC are arranged as Orc1:Orc4:Orc5:Orc2:Orc3, with Orc6 binding to Orc2. Cdc6 binding changes the conformation of ORC, in particular reorienting the Orc1 N-terminal BAH domain. Segmentation of the 3D map of ORC-Cdc6 on DNA and docking with the crystal structure of the homologous archaeal Orc1/Cdc6 protein suggest an origin DNA binding model in which the DNA tracks along the interior surface of the crescent-like ORC. Thus, ORC bends and wraps the DNA. This model is consistent with the observation that binding of a single Cdc6 extends the ORC footprint on origin DNA from both ends.
DNA-modified electrodes fabricated using copper-free click chemistry for enhanced protein detection.
Furst, Ariel L; Hill, Michael G; Barton, Jacqueline K
2013-12-31
A method of DNA monolayer formation has been developed using copper-free click chemistry that yields enhanced surface homogeneity and enables variation in the amount of DNA assembled; extremely low-density DNA monolayers, with as little as 5% of the monolayer being DNA, have been formed. These DNA-modified electrodes (DMEs) were characterized visually, with AFM, and electrochemically, and were found to facilitate DNA-mediated reduction of a distally bound redox probe. These low-density monolayers were found to be more homogeneous than traditional thiol-modified DNA monolayers, with greater helix accessibility through an increased surface area-to-volume ratio. Protein binding efficiency of the transcriptional activator TATA-binding protein (TBP) was also investigated on these surfaces and compared to that on DNA monolayers formed with standard thiol-modified DNA. Our low-density monolayers were found to be extremely sensitive to TBP binding, with a signal decrease in excess of 75% for 150 nM protein. This protein was detectable at 4 nM, on the order of its dissociation constant, with our low-density monolayers. The improved DNA helix accessibility and sensitivity of our low-density DNA monolayers to TBP binding reflects the general utility of this method of DNA monolayer formation for DNA-based electrochemical sensor development.
Hung, Min-Sheng; Ho, Chia-Chin; Chen, Chih-Pin
2016-08-01
This study developed a microfluidic platform for replicating and detecting DNA in real time by integrating a laser and a microfluidic device composed of polydimethylsiloxane. The design of the microchannels consisted of a laser-heating area and a detection area. An infrared laser was used as the heating source for DNA replication, and the laser power was adjusted to heat the solutions directly. In addition, strong biotin-avidin binding was used to capture and detect the replicated products. The biotin on one end was bound to avidin and anchored to the surface of the microchannels, whereas the biotin on the other end was bound to the quantum dots (Qdots). The results showed that the fluorescent intensity of the Qdots bound to the replicated products in the detection area increased with the number of thermal cycles created by the laser. When the number of thermal cycles was ≥10, the fluorescent intensity of the Qdots was directly detectable on the surface of the microchannels. The proposed method is more sensitive than detection methods entailing gel electrophoresis.
International Nuclear Information System (INIS)
Rose, F; Martin, P; Fujita, H; Kawakatsu, H
2006-01-01
Controlled and reproducible combing of λ-phage DNA molecules can be realized in predetermined orientations on highly oriented pyrolitic graphite (HOPG) surfaces. Observations by atomic force microscopy (AFM) show that DNA adsorption onto HOPG surfaces leads to different hierarchical organizations such as balls, networks, films, and fractal structures. HOPG nanosheets (3.5-100 nm thick) were created by simply rubbing a HOPG crystal onto a silicon oxide surface, and then patterned with a focused ion beam (FIB) to fabricate HOPG/Si heterostructures (arrays of silicon micropillars and microtracks decorated on their top surface with HOPG nanosheets). The surface reactivity of HOPG nanosheets toward DNA is found to be the same as of HOPG bulk crystals. Finally, combing is used to attach and suspend bundles of approximately 20-50 DNA molecules between HOPG/Si heterostructures
Microbial interactions chapter: binding and entry of DNA in bacterial transformation
Energy Technology Data Exchange (ETDEWEB)
Lacks, S.A.
1977-01-01
Genetic transformation of bacteria by DNA released from cells of a related strain is discussed. The mechanism by which the giant information-bearing molecules of DNA are transported into the bacterial cell was investigated. It was concluded that the overall process of DNA uptake consists of two main steps, binding of donor DNA to the outside of the cell and entry of the bound DNA into the cell. Each step is discussed in detail. Inasmuch as these phenomena occur at the cell surface, they are related to structures and functions of the cell wall and membrane. In addition, the development of competence, that is the formation of cell surface structures allowing DNA uptake, is examined from both a physiological and evolutionary point of view. Genetic transfer mediated by free DNA is an obvious and important form of cellular interaction. The development of competence involves another, quite distinct system of interaction between bacterial cells. Streptococcus pneumoniae, Bacillus subtilis, and Hemophilus influenzae were used as the test organisms. 259 references.
International Nuclear Information System (INIS)
Dalton, J.P.; Tom, T.D.; Strand, M.
1987-01-01
Spleen cells of mice vaccinated with radiation-attenuated Schistosoma mansoni cercariae were used to produce monoclonal antibodies directed against newly transformed schistosomular surface antigens. One of these monoclonal antibodies recognized a polypeptide of 18 kDa. Binding was measured by radioimmunoassay. This glycoprotein was purified by monoclonal antibody immunoaffinity chromatography and a polyclonal antiserum was prepared against it. Immunofluorescence assays showed that the polyclonal antiserum bound to the surface of newly transformed schistosomula and lung-stage organisms but not to the surface of liver-stage and adult worms. Using this polyclonal antiserum we isolated recombinant clones from an adult worm cDNA expression library constructed in λgt11. Clone 654.2 contained an insert of 0.52 kilobase and hybridized to a 1.2-kilobase mRNA species from adult worms. Most importantly, clone 654.2 produced a fusion protein of 125 kDa that was reactive with sera of vaccinated mice that are capable of transferring resistance. This result encourages future vaccination trials with the fusion protein
Proton surface charge determination in Spodosol horizons with organically bound aluminum
Skyllberg, Ulf; Borggaard, Ole K.
1998-05-01
Net proton surface charge densities were determined in O, E, Bh, and Bs horizons of a sandy till, Spodosol from Denmark, by means of acid-base titration combined with ion adsorption in 0.005 M Ca(NO 3) 2 and independent permanent charge determination. The release of organic anions exceeded the adsorption of NO 3-, resulting in a desorption of anions in all horizons. Data were found to obey the law of balance between surface charges and adsorbed ions only when charges pertaining to Al and organic anions released during the titration experiments were accounted for, in addition to charges pertaining the potential determining ions (PDI) H + and OH - and the index ions Ca 2+ and NO 3-. It was furthermore shown that the point of zero net proton charge (PZNPC) in soils highly depends on the concentration of organically bound Al. Approaches previously used in soils, in which adsorbed Al n+ has been ignored (i.e., considered equivalent to nH + as a PDI), resulted in a PZNPC of 4.1 in the Bs horizon. If instead organically bound Al was accounted for as a counter-ion similar to 3/2Ca 2+, a PZNPC of 2.9 was obtained for the same Bs horizon. Based on PZNPC values estimated by the latter approach, combined with a weak-acid analog, it was shown that organic proton surface charges buffered pH with a similar intensity in the O, E, Bh, and Bs horizons of this study. Because the acidity of Al adsorbed to conjugate bases of soil organic acids is substantially weaker than the acidity of the corresponding protonated form of the organic acids, the point of zero net proton charge (PZNPC) will increase if the concentration of organically adsorbed Al increases at the expense of adsorbed H. This means that PZNPC values determined for soils with unknown concentrations of organically adsorbed Al are highly operational and not very meaningful as references.
Organophosphonate functionalized silicon nanowires for DNA hybridization studies
Energy Technology Data Exchange (ETDEWEB)
Pedone, Daniel; Cattani Scholz, Anna; Birner, Stefan; Abstreiter, Gerhard [WSI, TU Muenchen (Germany); Dubey, Manish; Schwartz, Jeffrey [Princeton University, NJ (United States); Tornow, Marc [IHT, TU Braunschweig (Germany)
2007-07-01
Semiconductor nanowire field effect devices have great appeal for label-free sensing applications due to their sensitivity to surface potential changes that may originate from charged adsorbates. In addition to requiring high sensitivity, suitable passivation and functionalization of the semiconductor surface is obligatory. We have fabricated both freely suspended and oxide-supported silicon nanowires from Silicon-on-Insulator substrates using standard nanopatterning methods (EBL, RIE) and sacrificial oxide layer etching. Subsequent to nanofabrication, the devices were first coated with an hydroxyalkylphosphonate monolayer and then bound via bifunctional linker groups to single stranded DNA or PNA oligonucleotides, respectively. We investigated DNA hybridization on such functionalized nanowires using a difference resistance setup, where subtracting the reference signal from a second wire could be used to exclude most non-specific effects. A net change in surface potential on the order of a few mV could be detected upon addition of the complementary DNA strand. This surface potential change corresponds to the hybridization of about 10{sup 10}cm{sup -2} probe strands according to our model calculations that takes into account the entire hybrid system in electrolyte solution.
International Nuclear Information System (INIS)
Bhattacharya, Madhuchhanda; Basak, Tanmay
2013-01-01
This work presents a theoretical analysis on savings of energy during an endothermic reaction under microwave heating compared to conventional heating and shows the use of metal coated bounding surface to enhance the energy savings in otherwise low saving zones. Main thrust of this work is the quantification of energy savings for various probable microwave heating scenarios that may arise either due to varying reactor dimension (2L) over thin, intermediate and thick regimes or due to varying dielectric properties of the reactor. The analysis considers detailed transport equations in conjunction with Helmholtz equation for microwave propagation within a semiinfinite batch reactor. Simulations show that use of microwave can significantly save energy (as high as 60%) depending on reactor configuration. Simulations also show efficient use of metal coated bounding surface to enhance energy savings for reactors with 2L/λ eff = 0.5n−0.25, where n = 1, 2, 3… and λ eff is wavelength of microwave within the reactor. The enhancement is found to be 2 and 1.5 times at 2L/λ eff = 0.25 and 0.75, respectively. Various regions of efficient use of metal coated bounding surface for different microwave heating scenarios have been identified in a series of master curves. - Highlights: • This work simulates chemical reaction under microwave radiation using detailed model. • Simulations are presented in presence or absence of metal coated bounding surface. • Savings of energy under microwave have been analyzed for various probable scenarios. • Simulations show significant savings of energy under microwave heating. • Simulations show the potential of metal coated bounding surface to further enhance energy savings
Su'etsugu, Masayuki; Harada, Yuji; Keyamura, Kenji; Matsunaga, Chika; Kasho, Kazutoshi; Abe, Yoshito; Ueda, Tadashi; Katayama, Tsutomu
2013-12-01
DnaA activity for replication initiation of the Escherichia coli chromosome is negatively regulated by feedback from the DNA-loaded form of the replicase clamp. In this process, called RIDA (regulatory inactivation of DnaA), ATP-bound DnaA transiently assembles into a complex consisting of Hda and the DNA-clamp, which promotes inter-AAA+ domain association between Hda and DnaA and stimulates hydrolysis of DnaA-bound ATP, producing inactive ADP-DnaA. Using a truncated DnaA mutant, we previously demonstrated that the DnaA N-terminal domain is involved in RIDA. However, the precise role of the N-terminal domain in RIDA has remained largely unclear. Here, we used an in vitro reconstituted system to demonstrate that the Asn-44 residue in the N-terminal domain of DnaA is crucial for RIDA but not for replication initiation. Moreover, an assay termed PDAX (pull-down after cross-linking) revealed an unstable interaction between a DnaA-N44A mutant and Hda. In vivo, this mutant exhibited an increase in the cellular level of ATP-bound DnaA. These results establish a model in which interaction between DnaA Asn-44 and Hda stabilizes the association between the AAA+ domains of DnaA and Hda to facilitate DnaA-ATP hydrolysis during RIDA. © 2013 Society for Applied Microbiology and John Wiley & Sons Ltd.
Radiation-induced DNA damage as a function of DNA hydration
International Nuclear Information System (INIS)
Swarts, S.G.; Miao, L.; Wheeler, K.T.; Sevilla, M.D.; Becker, D.
1995-01-01
Radiation-induced DNA damage is produced from the sum of the radicals generated by the direct ionization of the DNA (direct effect) and by the reactions of the DNA with free radicals formed in the surrounding environment (indirect effect). The indirect effect has been believed to be the predominant contributor to radiation-induced intracellular DNA damage, mainly as the result of reactions of bulk water radicals (e.g., OH·) with DNA. However, recent evidence suggests that DNA damage, derived from the irradiation of water molecules that are tightly bound in the hydration layer, may occur as the result of the transfer of electron-loss centers (e.g. holes) and electrons from these water molecules to the DNA. Since this mechanism for damaging DNA more closely parallels that of the direct effect, the irradiation of these tightly bound water molecules may contribute to a quasi-direct effect. These water molecules comprise a large fraction of the water surrounding intracellular DNA and could account for a significant proportion of intracellular radiation-induced DNA damage. Consequently, the authors have attempted to characterize this quasi-direct effect to determine: (1) the extent of the DNA hydration layer that is involved with this effect, and (2) what influence this effect has on the types and quantities of radiation-induced DNA damage
International Nuclear Information System (INIS)
Schneider, T.; Jahr, N.; Jatschka, J.; Csaki, A.; Stranik, O.; Fritzsche, W.
2013-01-01
The effect of DNA–DNA interaction on the localized surface plasmon resonance of single 80 nm gold nanoparticles is studied. Therefore, both the attachment of the capture DNA strands at the particle surface and the sequence-specific DNA binding (hybridization) of analyte DNA to the immobilized capture DNA is subject of investigations. The influence of substrate attachment chemistry, the packing density of DNA as controlled by an assisting layer of smaller molecules, and the distance as increased by a linker on the LSPR efficiency is investigated. The resulting changes in signal can be related to a higher hybridization efficiency of the analyte DNA to the immobilized capture DNA. The subsequent attachment of additional DNA strands to this system is studied, which allows for a multiple step detection of binding and an elucidation of the resulting resonance shifts. The detection limit was determined for the utilized DNA system by incubation with various concentration of analyte DNA. Although the method allows for a marker-free detection, we show that additional markers such as 20 nm gold particle labels increase the signal and thereby the sensitivity significantly. The study of resonance shift for various DNA lengths revealed that the resonance shift per base is stronger for shorter DNA molecules (20 bases) as compared to longer ones (46 bases).
Directory of Open Access Journals (Sweden)
Koji Hashimoto
2016-05-01
Full Text Available We have developed a novel gene detection method based on the loop-mediated isothermal amplification (LAMP reaction and the DNA dissociation reaction on the same DNA chip surface to achieve a lower detection limit, broader dynamic range and faster detection time than are attainable with a conventional DNA chip. Both FAM- and thiol-labeled DNA probe bound to the complementary sequence accompanying Dabcyl was immobilized on the gold surface via Au/thiol bond. The LAMP reaction was carried out on the DNA probe fixed gold surface. At first, Dabcyl molecules quenched the FAM fluorescence. According to the LAMP reaction, the complementary sequence with Dabcyl was competitively reacted with the amplified targeted sequence. As a result, the FAM fluorescence increased owing to dissociation of the complementary sequence from the DNA probe. The simultaneous reaction of LAMP and DNA chip detection was achieved, and 103 copies of the targeted gene were detected within an hour by measuring fluorescence intensity of the DNA probe. Keywords: Biosensor, DNA chip, Loop-mediated isothermal amplification (LAMP, Fluorescence detection, Gold substrate, Au/thiol bond
Energy Technology Data Exchange (ETDEWEB)
McEwen, Gerald D.; Chen Fan [Biological Engineering Program, Department of Biological and Irrigation Engineering, Utah State University, 4105 Old Main Hill, Logan, UT 84322-4105 (United States); Zhou Anhong, E-mail: Anhong.Zhou@usu.edu [Biological Engineering Program, Department of Biological and Irrigation Engineering, Utah State University, 4105 Old Main Hill, Logan, UT 84322-4105 (United States)
2009-06-08
Fundamental understanding of interfacial electron transfer (ET) among electrolyte/DNA/solid-surface will facilitate the design for electrical detection of DNA molecules. In this report, the electron transfer characteristics of synthetic DNA (sequence from pathogenic Cryptosporidium parvum) self-assembled on a gold surface was electrochemically studied. The effects of immobilization order on the interface ET related parameters such as diffusion coefficient (D{sub 0}), surface coverage ({theta}{sub R}), and monolayer thickness (d{sub i}) were determined by cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). DNA surface density ({Gamma}{sub DNA}) was determined by the integration of the charge of the electro-oxidation current peaks during the initial cyclic voltammetry scans. It was found that the DNA surface densities at different modifications followed the order: {Gamma}{sub DNA} (dsS-DNA/Au) > {Gamma}{sub DNA} (MCH/dsS-DNA/Au) > {Gamma}{sub DNA} (dsS-DNA/MCH/Au). It was also revealed that the electro-oxidation of the DNA modified gold surface would involve the oxidation of nucleotides (guanine and adenine) with a 5.51 electron transfer mechanism and the oxidative desorption of DNA and MCH molecules by a 3 electron transfer mechanism. STM topography and current image analysis indicated that the surface conductivity after each surface modification followed the order: dsS-DNA/Au < MCH/dsS-DNA/Au < oxidized MCH/dsS-DNA/Au < Hoechst/oxidized MCH/dsS-DNA/Au. The results from this study suggested a combination of variations in immobilization order may provide an alternative approach for the optimization of DNA hybridization and the further development for electrical detection of DNA.
Isolate extended state in the DNA molecular transistor with surface interaction
Energy Technology Data Exchange (ETDEWEB)
Wang, Le, E-mail: wang_le917@gs.zzu.edu.cn; Qin, Zhi-Jie
2016-02-01
The field effect characteristic of a DNA molecular device is investigated in a tight binding model with binary disorder and side site correlation. Using the transfer-matrix method and Landauer–Büttiker theory, we find that the system has isolated extended state that is irrespective of the DNA sequence and can be modulated by the gate voltage. When the gate voltage reaches some proper value, the isolated extended state appears at the Fermi level of the system and the long range charge transport is greatly enhanced. We attribute this phenomenon to the combination of the external field, the surface interaction, and the intrinsic disorder of DNA. The result is a generic feature of the nanowire with binary disorder and surface interaction.
International Nuclear Information System (INIS)
Ong, Gaik Lin; Mattes, M. Jules
2000-01-01
Internalization by cells of radiolabeled protein ligands bound to the cell surface is frequently analyzed by extraction of the cells with low pH buffers. This treatment supposedly strips the ligands from the cell surface, and remaining molecules are considered to be internalized. However, we show herein that: (1) low molecular weight catabolic products that are trapped within lysosomes (residualizing radiolabels) are efficiently extracted by low pH buffers, under the same conditions used to remove cell surface-bound material, and (2) low pH treatment lyses the majority of the cells, as shown with both a nonadherent and an adherent cell line, with the release of most of a 51 Cr label. Still, low pH extraction was effective at demonstrating Ab internalization, as has been demonstrated many times. These effects of low pH treatment may be attributed to the fixative properties of these buffers. Regardless of the mechanism, these data must be taken into consideration in interpreting the results of such experiments
cGAS senses long and HMGB/TFAM-bound U-turn DNA by forming protein-DNA ladders.
Andreeva, Liudmila; Hiller, Björn; Kostrewa, Dirk; Lässig, Charlotte; de Oliveira Mann, Carina C; Jan Drexler, David; Maiser, Andreas; Gaidt, Moritz; Leonhardt, Heinrich; Hornung, Veit; Hopfner, Karl-Peter
2017-09-21
Cytosolic DNA arising from intracellular pathogens triggers a powerful innate immune response. It is sensed by cyclic GMP-AMP synthase (cGAS), which elicits the production of type I interferons by generating the second messenger 2'3'-cyclic-GMP-AMP (cGAMP). Endogenous nuclear or mitochondrial DNA can also be sensed by cGAS under certain conditions, resulting in sterile inflammation. The cGAS dimer binds two DNA ligands shorter than 20 base pairs side-by-side, but 20-base-pair DNA fails to activate cGAS in vivo and is a poor activator in vitro. Here we show that cGAS is activated in a strongly DNA length-dependent manner both in vitro and in human cells. We also show that cGAS dimers form ladder-like networks with DNA, leading to cooperative sensing of DNA length: assembly of the pioneering cGAS dimer between two DNA molecules is ineffective; but, once formed, it prearranges the flanking DNA to promote binding of subsequent cGAS dimers. Remarkably, bacterial and mitochondrial nucleoid proteins HU and mitochondrial transcription factor A (TFAM), as well as high-mobility group box 1 protein (HMGB1), can strongly stimulate long DNA sensing by cGAS. U-turns and bends in DNA induced by these proteins pre-structure DNA to nucleate cGAS dimers. Our results suggest a nucleation-cooperativity-based mechanism for sensitive detection of mitochondrial DNA and pathogen genomes, and identify HMGB/TFAM proteins as DNA-structuring host factors. They provide an explanation for the peculiar cGAS dimer structure and suggest that cGAS preferentially binds incomplete nucleoid-like structures or bent DNA.
Zeglis, Brian M.; Pierre, Valérie C.; Kaiser, Jens T.; Barton, Jacqueline K.
2009-01-01
Two crystal structures are determined for Δ-Rh(bpy)2(chrysi)3+ (chrysi = 5,6-chrysenequinone diimine) bound to the oligonucleotide duplex 5′-CGGAAATTACCG-3′ containing two adenosine-adenosine mismatches (italics) through metalloinsertion. Diffraction quality crystals with two different space groups (P3221 and P43212) were obtained under very similar crystallization conditions. In both structures, the bulky rhodium complex inserts into the two mismatched sites from the minor groove side, ejecting the mismatched bases into the major groove. The conformational changes are localized to the mismatched site; the metal complex replaces the mismatched base pair without an increase in base pair rise. The expansive metal complex is accommodated in the duplex by a slight opening in the phosphodiester backbone; all sugars retain a C2′-endo puckering, and flanking base pairs neither stretch nor shear. The structures differ, however, in that in one of the structures, an additional metal complex is bound by intercalation from the major groove at the central 5′-AT-3′ step. We conclude that this additional metal complex is intercalated into this central step because of crystal packing forces. The structures described here of Δ-Rh(bpy)2(chrysi)3+ bound to thermodynamically destabilized AA mismatches share critical features with binding by metalloinsertion in two other oligonucleotides containing different single base mismatches. These results underscore the generality of the metalloinsertion as a new mode of non-covalent binding by small molecules with a DNA duplex. PMID:19374348
BIOPHYSICAL PROPERTIES OF NUCLEIC ACIDS AT SURFACES RELEVANT TO MICROARRAY PERFORMANCE
Rao, Archana N.; Grainger, David W.
2014-01-01
Both clinical and analytical metrics produced by microarray-based assay technology have recognized problems in reproducibility, reliability and analytical sensitivity. These issues are often attributed to poor understanding and control of nucleic acid behaviors and properties at solid-liquid interfaces. Nucleic acid hybridization, central to DNA and RNA microarray formats, depends on the properties and behaviors of single strand (ss) nucleic acids (e.g., probe oligomeric DNA) bound to surface...
Möller, Jens; Lühmann, Tessa; Chabria, Mamta; Hall, Heike; Vogel, Viola
2013-10-07
To clear pathogens from host tissues or biomaterial surfaces, phagocytes have to break the adhesive bacteria-substrate interactions. Here we analysed the mechanobiological process that enables macrophages to lift-off and phagocytose surface-bound Escherichia coli (E. coli). In this opsonin-independent process, macrophage filopodia hold on to the E. coli fimbriae long enough to induce a local protrusion of a lamellipodium. Specific contacts between the macrophage and E. coli are formed via the glycoprotein CD48 on filopodia and the adhesin FimH on type 1 fimbriae (hook). We show that bacterial detachment from surfaces occurrs after a lamellipodium has protruded underneath the bacterium (shovel), thereby breaking the multiple bacterium-surface interactions. After lift-off, the bacterium is engulfed by a phagocytic cup. Force activated catch bonds enable the long-term survival of the filopodium-fimbrium interactions while soluble mannose inhibitors and CD48 antibodies suppress the contact formation and thereby inhibit subsequent E. coli phagocytosis.
Reaction of misonidazole with DNA radicals and its effect on the template activity of DNA
International Nuclear Information System (INIS)
Endoh, Daiji; Kuwabara, Mikinori; Sato, Fumiaki; Yoshii, Giichi.
1985-01-01
After calf thymus DNA was gamma-irradiated in the solid state in vacuo and subsequently dissolved in aqueous solution containing misonidazole (3 mM) under hypoxic condition, the frequency of single-strand breaks and alkali-labile sites in DNA and the amount of misonidazole bound to DNA were measured. The presence of misonidazole converted the precursor radicals, which otherwise results in single-strand breaks, to alkali-labile sites, and the amount of alkali-labile sites increased linearly with increasing radiation dose. The amount of misonidazole bound to DNA also increased linearly with increasing radiation dose. The biological meaning of the changes in the frequency of single-strand breaks and alkali-labile sites by the reaction of misonidazole with DNA radicals and of binding misonidazole with DNA was examined using a model system to measure the template activity of DNA for RNA synthesis in vitro. The conversion of DNA radicals to alkali-labile sites protected the radiation-induced decrease in the template activity of DNA, while the adduct formation of misonidazole had no effect on it. (author)
Controlled enzymatic cutting of DNA molecules adsorbed on surfaces using soft lithography
Auerbach, Alyssa; Budassi, Julia; Shea, Emily; Zhu, Ke; Sokolov, Jonathan
2013-03-01
The enzyme DNase I was applied to adsorbed and aligned DNA molecules (Lamda, 48.5 kilobase pairs (kbp), and T4, 165.6 kbp), stretched linearly on a surface, by stamping with a polydimethylsiloxane (PDMS) grating. The DNAs were cut by the enzyme into separated, micron-sized segments along the length of the molecules at positions determined by the grating dimensions (3-20 microns). Ozone-treated PDMS stamps were coated with DNase I solutions and placed in contact with surface-adsorbed DNA molecules deposited on a 750 polymethylmethacrylate (PMMA) film spun-cast onto a silicon substrate. The stamps were applied under pressure for times up to 15 minutes at 37 C. The cutting was observed by fluorescence microscopy imaging of DNA labeled with YOYO dye. Cutting was found to be efficient despite the steric hindrance due to surface attachment of the molecules. Methods for detaching and separating the cut segments for sequencing applications will be discussed. Supported by NSF-DMR program.
DNA-DNA hybridization determined in micro-wells using covalent attachment of DNA
DEFF Research Database (Denmark)
Christensen, H.; Angen, Øystein; Mutters, R.
2000-01-01
The present study was aimed at reducing the time and labour used to perform DNA-DNA hybridizations for classification of bacteria at the species level. A micro-well-format DNA hybridization method was developed and validated. DNA extractions were performed by a small-scale method and DNA...... was sheared mechanically into fragments of between 400 and 700 bases. The hybridization conditions were calibrated according to DNA similarities obtained by the spectrophotometric method using strains within the family Pasteurellaceae, Optimal conditions were obtained with 300 ng DNA added per well and bound...... by covalent attachment to NucleoLink. Hybridization was performed with 500 ng DNA, 5% (w/w) of which was labelled with photo-activatable biotin (competitive hybridization) for 2.5 h at 65 degrees C in 2 x SSC followed by stringent washing with 2 x SSC at the same temperature. The criteria for acceptance...
International Nuclear Information System (INIS)
Bender, Florian; Tsortos, Achilleas; Papadakis, George; Gizeli, Electra; Roach, Paul; Newton, Michael I; McHale, Glen
2009-01-01
It is known that acoustic sensor devices, if operated in liquid phase, are sensitive not just to the mass of the analyte but also to various other parameters, such as size, shape, charge and elastic constants of the analyte as well as bound and viscously entrained water. This can be used to extract valuable information about a biomolecule, particularly if the acoustic device is combined with another sensor element which is sensitive to the mass or amount of analyte only. The latter is true in good approximation for various optical sensor techniques. This work reports on the development of a combined surface plasmon resonance/surface acoustic wave sensor system which is designed for the investigation of biomolecules such as proteins or DNA. Results for the deposition of neutravidin and DNA are reported
International Nuclear Information System (INIS)
Mauldin, S.K.; Getts, R.C.; Perez, M.L.; DiRienzo, S.; Stamato, T.D.
2003-01-01
Full text: We find that nuclear protein extracts from mammalian cells contain an activity that allows DNA ends to associate with circular pUC18 plasmid DNA. This activity requires the catalytic subunit of DNA-PK (DNA-PKcs) and Ku since it was not observed in mutants lacking Ku or DNA-PKcs but was observed when purified Ku/DNA-PKcs was added to these mutant extracts. Competition experiments between pUC18 and pUC18 plasmids containing various nuclear matrix attachment region (MAR) sequences suggest that DNA ends preferentially associate with plasmids containing MAR DNA sequences. At a 1:5 mass ratio of MAR to pUC18, approximately equal amounts of DNA end binding to the two plasmids were observed, while at a 1:1 ratio no pUC18 end-binding was observed. Calculation of relative binding activities indicates that DNA-end binding activities to MAR sequences was 7 to 21 fold higher than pUC18. Western analysis of proteins bound to pUC18 and MAR plasmids indicates that XRCC4, DNA ligase IV, scaffold attachment factor A, topoisomerase II, and poly(ADP-ribose) polymerase preferentially associate with the MAR plasmid in the absence or presence of DNA ends. In contrast, Ku and DNA-PKcs were found on the MAR plasmid only in the presence of DNA ends. After electroporation of a 32P-labeled DNA probe into human cells and cell fractionation, 87% of the total intercellular radioactivity remained in nuclei after a 0.5M NaCl extraction suggesting the probe was strongly bound in the nucleus. The above observations raise the possibility that DNA-PK targets DNA-ends to a repair and/or DNA damage signaling complex which is assembled on MAR sites in the nucleus
Single helically folded aromatic oligoamides that mimic the charge surface of double-stranded B-DNA
Ziach, Krzysztof; Chollet, Céline; Parissi, Vincent; Prabhakaran, Panchami; Marchivie, Mathieu; Corvaglia, Valentina; Bose, Partha Pratim; Laxmi-Reddy, Katta; Godde, Frédéric; Schmitter, Jean-Marie; Chaignepain, Stéphane; Pourquier, Philippe; Huc, Ivan
2018-05-01
Numerous essential biomolecular processes require the recognition of DNA surface features by proteins. Molecules mimicking these features could potentially act as decoys and interfere with pharmacologically or therapeutically relevant protein-DNA interactions. Although naturally occurring DNA-mimicking proteins have been described, synthetic tunable molecules that mimic the charge surface of double-stranded DNA are not known. Here, we report the design, synthesis and structural characterization of aromatic oligoamides that fold into single helical conformations and display a double helical array of negatively charged residues in positions that match the phosphate moieties in B-DNA. These molecules were able to inhibit several enzymes possessing non-sequence-selective DNA-binding properties, including topoisomerase 1 and HIV-1 integrase, presumably through specific foldamer-protein interactions, whereas sequence-selective enzymes were not inhibited. Such modular and synthetically accessible DNA mimics provide a versatile platform to design novel inhibitors of protein-DNA interactions.
International Nuclear Information System (INIS)
Rouquerol, J.
1964-11-01
This study is concerned with the bound water of several oxides (beryllia, alumina, silica-alumina) at different steps of their dehydration (heating temperatures between 150 and 1100 deg. C). The following techniques have been used simultaneously: Thermal analysis (a new method has been developed), nitrogen adsorption (study of the texture), Diborane hydrolysis (qualitative and quantitative analysis of surface water), Infra-red spectrography (in the absorption range of water), Nuclear magnetic resonance (in the resonance range of protons). Thanks to these different techniques, five kinds of bound water have been observed. Attention is called on the great influence of the thermal treatment conditions on the evolution of the products resulting from the decomposition of alumina α-trihydrate Al(OH) 3 and beryllium α-hydroxide, in the course of the dehydration. Moreover, the author emphasizes the peculiar properties of the two kinds of oxides (alumina and beryllia) prepared through a new method of treatment under low pressure and constant speed of decomposition. Such particular features concern mainly texture, bound water, and consequently, also catalytic activity. (author) [fr
Preferential binding of DNA primase to the nuclear matrix
International Nuclear Information System (INIS)
Wood, S.H.; Collins, J.M.
1986-01-01
Several lines of research have stimulated interest in the nuclear matrix as the subcellular site of DNA replication. The authors have recently reported a relationship between rates of DNA synthesis and the differential binding of polymerase α to the nuclear matrix. They now report the detection of DNA primase bound to the HeLa nuclear matrix. Matrix-bound primase can be measured either indirectly, by the incorporation of [ 32 P] dAMP into an unprimed single-stranded template, or directly, by the incorporation of [ 3 H] AMP into matrix DNA. Characteristics of this system include a requirement for ATP, inhibition by adenosine-5'-0-(3'-thiotriphosphate), a primase inhibitor, and insensitivity to aphidicolin and α-amanitine, inhibitors of polymerase α and RNA polymerase, respectively. Subcellular quantification of primase and polymerase α activity revealed that while a majority of primase activity is bound to the matrix (72%), only 32% of polymerase α activity is matrix-bound. Treatment of the nuclear matrix with β-D-Octylglucoside allowed the solubilization of 54% of primase activity and 39% of polymerase α activity. This data provides further evidence of a structural and functional role for the nuclear matrix in DNA replication. The ability to solubilize matrix-bound replicative enzymes may prove to be an important tool in the elucidation of the spatial organization of DNA replication
Dielectric properties of DNA oligonucleotides on the surface of silicon nanostructures
Energy Technology Data Exchange (ETDEWEB)
Bagraev, N. T., E-mail: bagraev@mail.ioffe.ru [St. Petersburg Polytechnic University (Russian Federation); Chernev, A. L. [Russian Academy of Sciences, St. Petersburg Academic University—Nanotechnology Research and Education Center (Russian Federation); Klyachkin, L. E. [St. Petersburg Polytechnic University (Russian Federation); Malyarenko, A. M. [Russian Academy of Sciences, Ioffe Physical–Technical Institute (Russian Federation); Emel’yanov, A. K.; Dubina, M. V. [Russian Academy of Sciences, St. Petersburg Academic University—Nanotechnology Research and Education Center (Russian Federation)
2016-10-15
Planar silicon nanostructures that are formed as a very narrow silicon quantum well confined by δ barriers heavily doped with boron are used to study the dielectric properties of DNA oligonucleotides deposited onto the surface of the nanostructures. The capacitance characteristics of the silicon nanostructures with oligonucleotides deposited onto their surface are determined by recording the local tunneling current–voltage characteristics by means of scanning tunneling microscopy. The results show the possibility of identifying the local dielectric properties of DNA oligonucleotide segments consisting of repeating G–C pairs. These properties apparently give grounds to correlate the segments with polymer molecules exhibiting the properties of multiferroics.
Lower bounds on Q of some dipole shapes
DEFF Research Database (Denmark)
Kim, Oleksiy S.
2016-01-01
The lower bound on the radiation Q of an arbitrary electrically small antenna shape can be determined by finding the optimal electric current density on the exterior surface of the shape, such that the Q of this current radiating in free space is minimized, and then augmenting it with a magnetic...... current density cancelling the fields inside the shape's surface. The Q of these coupled electric and magnetic currents radiating in free space is the lower bound on Q for the given shape. The approach is exemplified and its general applicability is substantiated by computing the lower bounds...... of spherically capped dipoles and comparing the results to the known bounds of a sphere and a thin cylinder....
Label-free quantitative proteome analysis of the surface-bound salivary pellicle.
Delius, Judith; Trautmann, Simone; Médard, Guillaume; Kuster, Bernhard; Hannig, Matthias; Hofmann, Thomas
2017-04-01
The salivary pellicle, covering natural as well as restored tooth surfaces in the oral cavity as an immobilized protein-rich layer, acts as an important physico-chemical and biological mediator at the tooth-saliva-interface. For the first time, the pellicle's proteome of individual volunteers were analyzed separately on three consecutive days and the relative protein abundance determined by a label-free quantitative nano-LC-MS/MS approach. A total of 72 major proteins were identified in the initial pellicles formed intraorally on dental ceramic specimens already after 3min with high inter-individual and inter-day consistency. In comparison, significant differences in protein abundance were evident between subjects, thus indicating unique individual pellicle profiles. Furthermore, the relative protein abundance in pellicles was compared to the proteome pattern in the corresponding saliva samples of the same individuals to provide first data on significantly enriched and depleted salivary proteins (p <0.05) within the surface-bound salivary pellicle. Our findings reveal the initial adsorption of salivary proteins at the solid-liquid interface to be a rapid, highly selective, and reproducible process leading to the immobilization of a broad range of protective proteins and enzymes on the substratum surface within a few minutes. This provides evidence that the pellicle layer might be physiologically functional even without further maturation. Copyright © 2017 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Lenz, J.; Okenquist, S.A.; LoSardo, J.E.; Hamilton, K.K.; Doetsch, P.W.
1990-01-01
Damage to DNA can have lethal or mutagenic consequences for cells unless it is detected and repaired by cellular proteins. Repair depends on the ability of cellular factors to distinguish the damaged sites. Electrophoretic binding assays were used to identify a factor from the nuclei of mammalian cells that bound to DNA containing apurinic sites. A binding assay based on the use of β-galactosidase fusion proteins was subsequently used to isolate recombinant clones of human cDNAs that encoded apurinic DNA-binding proteins. Two distinct human cDNAs were identified that encoded proteins that bound apurinic DNA preferentially over undamaged, methylated, or UV-irradiated DNA. These approaches may offer a general method for the detection of proteins that recognize various types of DNA damage and for the cloning of genes encoding such proteins
Enzyme-enhanced fluorescence detection of DNA on etched optical fibers.
Niu, Shu-yan; Li, Quan-yi; Ren, Rui; Zhang, Shu-sheng
2009-05-15
A novel DNA biosensor based on enzyme-enhanced fluorescence detection on etched optical fibers was developed. The hybridization complex of DNA probe and biotinylated target was formed on the etched optical fiber, and was then bound with streptavidin labeled horseradish peroxidase (streptavidin-HRP). The target DNA was quantified through the fluorescent detection of bi-p,p'-4-hydroxyphenylacetic acid (DBDA) generated from the substrate 4-hydroxyphenylacetic acid (p-HPA) under the catalysis of HRP, with a detection limit of 1 pM and a linear range from 1.69 pM to 169 pM. It is facile to regenerate this sensor through surface treatment with concentrated urea solution. It was discovered that the sensor can retain 70% of its original activity after three detection-regeneration cycles.
Laaser, Jennifer E.; Skoff, David R.; Ho, Jia-Jung; Joo, Yongho; Serrano, Arnaldo L.; Steinkruger, Jay D.; Gopalan, Padma; Gellman, Samuel H.; Zanni, Martin T.
2014-01-01
Surface-bound polypeptides and proteins are increasingly used to functionalize inorganic interfaces such as electrodes, but their structural characterization is exceedingly difficult with standard technologies. In this paper, we report the first two-dimensional sum-frequency generation (2D SFG) spectra of a peptide monolayer, which is collected by adding a mid-IR pulse shaper to a standard femtosecond SFG spectrometer. On a gold surface, standard FTIR spectroscopy is inconclusive about the peptide structure because of solvation-induced frequency shifts, but the 2D lineshapes, anharmonic shifts, and lifetimes obtained from 2D SFG reveal that the peptide is largely α-helical and upright. Random coil residues are also observed, which do not themselves appear in SFG spectra due to their isotropic structural distribution, but which still absorb infrared light and so can be detected by cross-peaks in 2D SFG spectra. We discuss these results in the context of peptide design. Because of the similar way in which the spectra are collected, these 2D SFG spectra can be directly compared to 2D IR spectra, thereby enabling structural interpretations of surface-bound peptides and biomolecules based on the well-studied structure/2D IR spectra relationships established from soluble proteins. PMID:24372101
DEFF Research Database (Denmark)
Cardenas Gomez, Marite; Wacklin, Hanna; Campbell, Richard A.
2011-01-01
with dodecyltrimethylammonium bromide (DTAB) and hexadecyltrimethylammonium bromide (CTAB) on hydrophobic surfaces, where we show that DNA molecules are located on top of a self-assembled surfactant monolayer, with the thickness of the DNA layer and the surfactant DNA ratio determined by the surface coverage of the underlying...... interfacial structures, a higher concentration in relation to its cmc is required for the more soluble DTAB surfactant with a shorter alkyl chain than for CTAB. Our results suggest that the DNA Molecules Will spontaneously form a relatively dense, thin layer on top of a surfactant monolayer (hydrophobic...... surface) or a layer of admicelles (hydrophilic surface) as long as the surface concentration of surfactant is great enough to ensure a high interfacial-charge density. These findings have implications for bioanalytical and nanotechnology applications, which require the deposition of DNA layers with well...
Hodgson, Murray; Wareing, Andrew
2008-01-01
A combined beam-tracing and transfer-matrix model for predicting steady-state sound-pressure levels in rooms with multilayer bounding surfaces was used to compare the effect of extended- and local-reaction surfaces, and the accuracy of the local-reaction approximation. Three rooms—an office, a corridor and a workshop—with one or more multilayer test surfaces were considered. The test surfaces were a single-glass panel, a double-drywall panel, a carpeted floor, a suspended-acoustical ceiling, a double-steel panel, and glass fibre on a hard backing. Each test surface was modeled as of extended or of local reaction. Sound-pressure levels were predicted and compared to determine the significance of the surface-reaction assumption. The main conclusions were that the difference between modeling a room surface as of extended or of local reaction is not significant when the surface is a single plate or a single layer of material (solid or porous) with a hard backing. The difference is significant when the surface consists of multilayers of solid or porous material and includes a layer of fluid with a large thickness relative to the other layers. The results are partially explained by considering the surface-reflection coefficients at the first-reflection angles.
Protocol for quantitative tracing of surface water with synthetic DNA
Foppen, J. W.; Bogaard, T. A.
2012-04-01
Based on experiments we carried out in 2010 with various synthetic single stranded DNA markers with a size of 80 nucleotides (ssDNA; Foppen et al., 2011), we concluded that ssDNA can be used to carry out spatially distributed multi-tracer experiments in the environment. Main advantages are in principle unlimited amount of tracers, environmental friendly and tracer recovery at very high dilution rates (detection limit is very low). However, when ssDNA was injected in headwater streams, we found that at selected downstream locations, the total mass recovery was less than 100%. The exact reason for low mass recovery was unknown. In order to start identifying the cause of the loss of mass in these surface waters, and to increase our knowledge of the behaviour of synthetic ssDNA in the environment, we examined the effect of laboratory and field protocols working with artificial DNA by performing numerous batch experiments. Then, we carried out several field tests in different headwater streams in the Netherlands and in Luxembourg. The laboratory experiments consisted of a batch of water in a vessel with in the order of 10^10 ssDNA molecules injected into the batch. The total duration of each experiment was 10 hour, and, at regular time intervals, 100 µl samples were collected in a 1.5 ml Eppendorf vial for qPCR analyses. The waters we used ranged from milliQ water to river water with an Electrical Conductivity of around 400 μS/cm. The batch experiments were performed in different vessel types: polyethylene bottles, polypropylene copolymer bottles , and glass bottles. In addition, two filter types were tested: 1 µm pore size glass fibre filters and 0.2 µm pore size cellulose acetate filters. Lastly, stream bed sediment was added to the batch experiments to quantify interaction of the DNA with sediment. For each field experiment around 10^15 ssDNA molecules were injected, and water samples were collected 100 - 600 m downstream of the point of injection. Additionally
International Nuclear Information System (INIS)
Wang Jie; Li Shuping; Zhang Yuzhong
2010-01-01
We outline here the fabrication of a sensitive electrochemical DNA biosensor for the detection of sequence-specific target DNA. Zinc oxide nanowires (ZnONWs) were first immobilized on the surface of a glassy carbon electrode. Multi-walled carbon nanotubes (MWCNTs) with carboxyl groups were then dropped onto the surface of the ZnONWs. Gold nanoparticles (AuNPs) were subsequently introduced to the surface of the MWNTs/ZnONWs by electrochemical deposition. A single-stranded DNA probe with a thiol group at the end (HS-ssDNA) was covalently immobilized on the surface of the AuNPs by forming an Au-S bond. Scanning electron microscopy (SEM) and cyclic voltammetry (CV) were used to investigate the film assembly process. Differential pulse voltammetry (DPV) was used to monitor DNA hybridization by measuring the electrochemical signals of [Ru(NH 3 ) 6 ] 3+ bounding to double-stranded DNA (dsDNA). The incorporation of ZnONWs and MWCNTs in this sensor design significantly enhances the sensitivity and the selectivity. This DNA biosensor can detect the target DNA quantitatively in the range of 1.0 x 10 -13 to 1.0 x 10 -7 M, with a detection limit of 3.5 x 10 -14 M (S/N = 3). In addition, the DNA biosensor exhibits excellent selectivity, even for single-mismatched DNA detection.
Cdc45-induced loading of human RPA onto single-stranded DNA.
Szambowska, Anna; Tessmer, Ingrid; Prus, Piotr; Schlott, Bernhard; Pospiech, Helmut; Grosse, Frank
2017-04-07
Cell division cycle protein 45 (Cdc45) is an essential component of the eukaryotic replicative DNA helicase. We found that human Cdc45 forms a complex with the single-stranded DNA (ssDNA) binding protein RPA. Moreover, it actively loads RPA onto nascent ssDNA. Pull-down assays and surface plasmon resonance studies revealed that Cdc45-bound RPA complexed with ssDNA in the 8-10 nucleotide binding mode, but dissociated when RPA covered a 30-mer. Real-time analysis of RPA-ssDNA binding demonstrated that Cdc45 catalytically loaded RPA onto ssDNA. This placement reaction required physical contacts of Cdc45 with the RPA70A subdomain. Our results imply that Cdc45 controlled stabilization of the 8-nt RPA binding mode, the subsequent RPA transition into 30-mer mode and facilitated an ordered binding to ssDNA. We propose that a Cdc45-mediated loading guarantees a seamless deposition of RPA on newly emerging ssDNA at the nascent replication fork. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Evaluation of Skin Surface as an Alternative Source of Reference DNA Samples: A Pilot Study.
Albujja, Mohammed H; Bin Dukhyil, Abdul Aziz; Chaudhary, Abdul Rauf; Kassab, Ahmed Ch; Refaat, Ahmed M; Babu, Saranya Ramesh; Okla, Mohammad K; Kumar, Sachil
2018-01-01
An acceptable area for collecting DNA reference sample is a part of the forensic DNA analysis development. The aim of this study was to evaluate skin surface cells (SSC) as an alternate source of reference DNA sample. From each volunteer (n = 10), six samples from skin surface areas (forearm and fingertips) and two traditional samples (blood and buccal cells) were collected. Genomic DNA was extracted and quantified then genotyped using standard techniques. The highest DNA concentration of SSC samples was collected using the tape/forearm method of collection (2.1 ng/μL). Cotton swabs moistened with ethanol yielded higher quantities of DNA than swabs moistened with salicylic acid, and it gave the highest percentage of full STR profiles (97%). This study supports the use of SSC as a noninvasive sampling technique and as a extremely useful source of DNA reference samples among certain cultures where the use of buccal swabs can be considered socially unacceptable. © 2017 American Academy of Forensic Sciences.
Eggshell membrane: A natural substrate for immobilization and detection of DNA
Energy Technology Data Exchange (ETDEWEB)
Ray, Preetam Guha; Roy, Somenath, E-mail: sroy@cgcri.res.in
2016-02-01
Chemically modified eggshell membranes (ESM) have been explored as potentially novel platforms for immobilization of oligonucleotides and subsequent detection of target DNA. The fibrous network of the native ESM as well those functionalized with acetic acid or n-butyl acetate has been examined by field-emission scanning electron microscopy (FESEM). The formation of surface functional moieties has been confirmed by Fourier-transform infrared spectroscopy (FTIR). DNA molecules, with an end terminal − NH{sub 2} group (at 5′ end) have been immobilized on the chemically modified ESM surface. The effect of surface modification on the DNA immobilization efficiency has been investigated using fluorescence microscopy and atomic force microscopy (AFM). The above studies concurrently suggest that functionalization of ESM with n-butyl acetate causes a better homogeneity of the DNA probes on the membrane surface. On-chip hybridization of the target DNA with the surface bound capture probes has been performed on the functionalized membranes. It is observed that n-butyl acetate modification of ESM pushes the limit of detection (LOD) of the DNA sensors by at least an order of magnitude compared to the other modification method. - Graphical abstract: Eggshell membranes (ESM) have been chemically modified with acetic acid or n-butyl acetate for immobilization of aminated capture probes and subsequent detection of fluorophore-tagged target DNA molecules. n-Butyl acetate modified ESM exhibits superior homogeneity of capture probe immobilization and lower limit of detection for the target DNA molecules. - Highlights: • Eggshell membranes (ESM) have been explored as potentially novel platforms for immobilization of oligonucleotides. • Compared to native ESM, those modified with acetic acid or n-butyl acetate have shown more efficient loading of DNA probes. • ESM modified with n-butyl acetate pushed the lower limit of detection (LOD) of the sensor down to 10 nM of target DNA
BAF is a cytosolic DNA sensor that leads to exogenous DNA avoiding autophagy.
Kobayashi, Shouhei; Koujin, Takako; Kojidani, Tomoko; Osakada, Hiroko; Mori, Chie; Hiraoka, Yasushi; Haraguchi, Tokuko
2015-06-02
Knowledge of the mechanisms by which a cell detects exogenous DNA is important for controlling pathogen infection, because most pathogens entail the presence of exogenous DNA in the cytosol, as well as for understanding the cell's response to artificially transfected DNA. The cellular response to pathogen invasion has been well studied. However, spatiotemporal information of the cellular response immediately after exogenous double-stranded DNA (dsDNA) appears in the cytosol is lacking, in part because of difficulties in monitoring when exogenous dsDNA enters the cytosol of the cell. We have recently developed a method to monitor endosome breakdown around exogenous materials using transfection reagent-coated polystyrene beads incorporated into living human cells as the objective for microscopic observations. In the present study, using dsDNA-coated polystyrene beads (DNA-beads) incorporated into living cells, we show that barrier-to-autointegration factor (BAF) bound to exogenous dsDNA immediately after its appearance in the cytosol at endosome breakdown. The BAF(+) DNA-beads then assembled a nuclear envelope (NE)-like membrane and avoided autophagy that targeted the remnants of the endosome membranes. Knockdown of BAF caused a significant decrease in the assembly of NE-like membranes and increased the formation of autophagic membranes around the DNA-beads, suggesting that BAF-mediated assembly of NE-like membranes was required for the DNA-beads to evade autophagy. Importantly, BAF-bound beads without dsDNA also assembled NE-like membranes and avoided autophagy. We propose a new role for BAF: remodeling intracellular membranes upon detection of dsDNA in mammalian cells.
Liu, X.; Bassis, J. N.
2015-12-01
With observations showing accelerated mass loss from the Greenland Ice Sheet due to surface melt, the Greenland Ice Sheet is becoming one of the most significant contributors to sea level rise. The contribution of the Greenland Ice Sheet o sea level rise is likely to accelerate in the coming decade and centuries as atmospheric temperatures continue to rise, potentially triggering ever larger surface melt rates. However, at present considerable uncertainty remains in projecting the contribution to sea level of the Greenland Ice Sheet both due to uncertainty in atmospheric forcing and the ice sheet response to climate forcing. Here we seek an upper bound on the contribution of surface melt from the Greenland to sea level rise in the coming century using a surface energy balance model coupled to an englacial model. We use IPCC Representative Concentration Pathways (RCP8.5, RCP6, RCP4.5, RCP2.6) climate scenarios from an ensemble of global climate models in our simulations to project the maximum rate of ice volume loss and related sea-level rise associated with surface melting. To estimate the upper bound, we assume the Greenland Ice Sheet is perpetually covered in thick clouds, which maximize longwave radiation to the ice sheet. We further assume that deposition of black carbon darkens the ice substantially turning it nearly black, substantially reducing its albedo. Although assuming that all melt water not stored in the snow/firn is instantaneously transported off the ice sheet increases mass loss in the short term, refreezing of retained water warms the ice and may lead to more melt in the long term. Hence we examine both assumptions and use the scenario that leads to the most surface melt by 2100. Preliminary models results suggest that under the most aggressive climate forcing, surface melt from the Greenland Ice Sheet contributes ~1 m to sea level by the year 2100. This is a significant contribution and ignores dynamic effects. We also examined a lower bound
Bhuvana, M; Narayanan, J Shankara; Dharuman, V; Teng, W; Hahn, J H; Jayakumar, K
2013-03-15
Immobilization of 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) liposome-gold nano-particle (DOPE-AuNP) nano-composite covalently on 3-mercaptopropionic acid (MPA) on gold surface is demonstrated for the first time for electrochemical label free DNA sensing. Spherical nature of the DOPE on the MPA monolayer is confirmed by the appearance of sigmoidal voltammetric profile, characteristic behavior of linear diffusion, for the MPA-DOPE in presence of [Fe(CN)(6)](3-/4-) and [Ru(NH(3))(6)](3+) redox probes. The DOPE liposome vesicle fusion is prevented by electroless deposition of AuNP on the hydrophilic amine head groups of the DOPE. Immobilization of single stranded DNA (ssDNA) is made via simple gold-thiol linkage for DNA hybridization sensing in the presence of [Fe(CN)(6)](3-/4-). The sensor discriminates the hybridized (complementary target hybridized), un-hybridized (non-complementary target hybridized) and single base mismatch target hybridized surfaces sensitively and selectively without signal amplification. The lowest target DNA concentration detected is 0.1×10(-12)M. Cyclic voltammetry (CV), electrochemical impedance (EIS), differential pulse voltammetry (DPV) and quartz crystal microbalance (QCM) techniques are used for DNA sensing on DOPE-AuNP nano-composite. Transmission Electron Microscopy (TEM), Fourier Transform Infrared Spectroscopy (FTIR), Atomic Force Microscopy (AFM), Dynamic Light Scattering (DLS) and Ultraviolet-Visible (UV) spectroscopic techniques are used to understand the interactions between the DOPE, AuNP and ssDNA. The results indicate the presence of an intact and well defined spherical DOPE-AuNP nano-composite on the gold surface. The method could be applied for fabrication of the surface based liposome-AuNP-DNA composite for cell transfection studies at reduced reagents and costs. Copyright © 2012 Elsevier B.V. All rights reserved.
Single-molecule mechanics of protein-labelled DNA handles
Directory of Open Access Journals (Sweden)
Vivek S. Jadhav
2016-01-01
Full Text Available DNA handles are often used as spacers and linkers in single-molecule experiments to isolate and tether RNAs, proteins, enzymes and ribozymes, amongst other biomolecules, between surface-modified beads for nanomechanical investigations. Custom DNA handles with varying lengths and chemical end-modifications are readily and reliably synthesized en masse, enabling force spectroscopic measurements with well-defined and long-lasting mechanical characteristics under physiological conditions over a large range of applied forces. Although these chemically tagged DNA handles are widely used, their further individual modification with protein receptors is less common and would allow for additional flexibility in grabbing biomolecules for mechanical measurements. In-depth information on reliable protocols for the synthesis of these DNA–protein hybrids and on their mechanical characteristics under varying physiological conditions are lacking in literature. Here, optical tweezers are used to investigate different protein-labelled DNA handles in a microfluidic environment under different physiological conditions. Digoxigenin (DIG-dsDNA-biotin handles of varying sizes (1000, 3034 and 4056 bp were conjugated with streptavidin or neutravidin proteins. The DIG-modified ends of these hybrids were bound to surface-modified polystyrene (anti-DIG beads. Using different physiological buffers, optical force measurements showed consistent mechanical characteristics with long dissociation times. These protein-modified DNA hybrids were also interconnected in situ with other tethered biotinylated DNA molecules. Electron-multiplying CCD (EMCCD imaging control experiments revealed that quantum dot–streptavidin conjugates at the end of DNA handles remain freely accessible. The experiments presented here demonstrate that handles produced with our protein–DNA labelling procedure are excellent candidates for grasping single molecules exposing tags suitable for molecular
Baburajendran, Nithya; Palasingam, Paaventhan; Ng, Calista Keow Leng; Jauch, Ralf; Kolatkar, Prasanna R.
2009-01-01
The bone morphogenetic protein (BMP) signalling pathway regulates diverse processes such as cell differentiation, anterior/posterior axis specification, cell growth and the formation of extra-embryonic tissues. The transcription factor Smad1 relays the BMP signal from the cytoplasm to the nucleus, where it binds short DNA-sequence motifs and regulates gene expression. However, how Smad1 selectively targets particular genomic regions is poorly understood. In order to understand the physical basis of the specific interaction of Smad1 with DNA and to contrast it with the highly homologous but functionally distinct Smad3 protein, the DNA-binding Mad-homology 1 (MH1) domain of Smad1 was cocrystallized with a 17-mer palindromic Smad-binding element (SBE). The extensive optimizations of the length, binding-site spacing and terminal sequences of the DNA element in combination with the other crystallization parameters necessary for obtaining diffraction-quality crystals are described here. A 2.7 Å resolution native data set was collected at the National Synchrotron Radiation Research Centre, Taiwan, from crystals grown in a solution containing 0.2 M ammonium tartrate dibasic, 20% PEG 3350, 3% 2-propanol and 10% glycerol. The data set was indexed and merged in space group P222, with unit-cell parameters a = 73.94, b = 77.49, c = 83.78 Å, α = β = γ = 90°. The solvent content in the unit cell is consistent with the presence of two Smad1 MH1 molecules bound to the duplex DNA in the asymmetric unit. PMID:19923727
Freire-Picos, M A; Landeira-Ameijeiras, V; Mayán, María D
2013-07-01
The correct distribution of nuclear domains is critical for the maintenance of normal cellular processes such as transcription and replication, which are regulated depending on their location and surroundings. The most well-characterized nuclear domain, the nucleolus, is essential for cell survival and metabolism. Alterations in nucleolar structure affect nuclear dynamics; however, how the nucleolus and the rest of the nuclear domains are interconnected is largely unknown. In this report, we demonstrate that RNAP-II is vital for the maintenance of the typical crescent-shaped structure of the nucleolar rDNA repeats and rRNA transcription. When stalled RNAP-II molecules are not bound to the chromatin, the nucleolus loses its typical crescent-shaped structure. However, the RNAP-II interaction with Seh1p, or cryptic transcription by RNAP-II, is not critical for morphological changes. Copyright © 2013 John Wiley & Sons, Ltd.
High Efficiency Acetylcholinesterase Immobilization on DNA Aptamer Modified Surfaces
Directory of Open Access Journals (Sweden)
Orada Chumphukam
2014-04-01
Full Text Available We report here the in vitro selection of DNA aptamers for electric eel acetylcholinesterase (AChE. One selected aptamer sequence (R15/19 has a high affinity towards the enzyme (Kd = 157 ± 42 pM. Characterization of the aptamer showed its binding is not affected by low ionic strength (~20 mM, however significant reduction in affinity occurred at high ionic strength (~1.2 M. In addition, this aptamer does not inhibit the catalytic activity of AChE that we exploit through immobilization of the DNA on a streptavidin-coated surface. Subsequent immobilization of AChE by the aptamer results in a 4-fold higher catalytic activity when compared to adsorption directly on to plastic.
Energy Technology Data Exchange (ETDEWEB)
Hong, Woo-Pyo [Department of Electronics Engineering, Catholic University of Daegu, Hayang, 38430 (Korea, Republic of); Jung, Young-Dae, E-mail: ydjung@hanyang.ac.kr [Department of Applied Physics and Department of Bionanotechnology, Hanyang University, Ansan, Kyunggi-Do 15588 (Korea, Republic of); Department of Physics, Applied Physics, and Astronomy, Rensselaer Polytechnic Institute, 110 8th Street, Troy, NY 12180-3590 (United States)
2016-03-11
The influence of magnetic field and dust rotation on the resonant instability of surface electrostatic-ion-cyclotron wave is kinetically investigated in a semi-bounded warm magnetized dusty plasma. The dispersion relation and the temporal growth rate of the surface electrostatic-ion-cyclotron wave are derived by the specular-reflection boundary condition including the magnetic field and dust rotation effects. It is found that the instability domain decreases with an increase of the rotation frequency of elongated dust grain. It is also found that the dependence of the propagation wave number on the temporal growth rate is more significant for small ion cyclotron frequencies. In addition, it is shown that the scaled growth rate increases with an increase of the strength of magnetic field. The variation of the domain and magnitude of temporal growth rate due to the change of plasma parameters is also discussed. - Highlights: • The resonant instability of surface electrostatic-ion-cyclotron wave is investigated in a semi-bounded magnetized dusty plasma. • The dispersion relation and the temporal growth rate are derived by the specular-reflection condition. • The influence of magnetic field and dust rotation on the resonant instability is discussed.
Bukar, Natalia; Zhao, Sandy Shuo; Charbonneau, David M; Pelletier, Joelle N; Masson, Jean-Francois
2014-05-18
We report that a shorter Debye length and, as a consequence, decreased colloidal stability are required for the molecular interaction of folic acid-modified Au nanoparticles (Au NPs) to occur on a surface-bound receptor, human dihydrofolate reductase (hDHFR). The interaction measured using surface plasmon resonance (SPR) sensing was optimal in a phosphate buffer at pH 6 and ionic strength exceeding 300 mM. Under these conditions, the aggregation constant of the Au NPs was approximately 10(4) M(-1) s(-1) and the Debye length was below 1 nm, on the same length scale as the size of the folate anion (approximately 0.8 nm). Longer Debye lengths led to poorer SPR responses, revealing a reduced affinity of the folic acid-modified Au NPs for hDHFR. While high colloidal stability of Au NPs is desired in most applications, these conditions may hinder molecular interactions due to Debye lengths exceeding the size of the ligand and thus preventing close interactions with the surface-bound molecular receptor.
Narasimhan, Kamesh; Hilbig, Antonia; Udayasuryan, Barath; Jayabal, Sriram; Kolatkar, Prasanna R; Jauch, Ralf
2014-10-01
Pax genes belong to a family of metazoan transcription factors that are known to play a critical role in eye, ear, kidney and neural development. The mammalian Pax family of transcription factors is characterized by a ∼128-amino-acid DNA-binding paired domain that makes sequence-specific contacts with DNA. The diversity in Pax gene activities emerges from complex modes of interaction with enhancer regions and heterodimerization with multiple interaction partners. Based on in vitro optimal binding-site selection studies and enhancer identification assays, it has been suggested that Pax proteins may recognize and bind their target DNA elements with different binding modes/topologies, however this hypothesis has not yet been structurally explored. One of the most extensively studied DNA target elements of the Pax6 paired domain is the eye-lens specific DC5 (δ-crystallin) enhancer element. In order to shed light on Pax6-DC5 DNA interactions, the related paired-domain prototype Pax9 was crystallized with the minimal δ-crystallin DC5 enhancer element and preliminary X-ray diffraction analysis was attempted. A 3.0 Å resolution native data set was collected at the National Synchrotron Light Source (NSLS), Brookhaven from crystals grown in a solution consisting of 10%(w/v) PEG 20K, 20%(v/v) PEG 550 MME, 0.03 M NaNO3, 0.03 M Na2HPO4, 0.03 M NH2SO4, 0.1 M MES/imidazole pH 6.5. The data set was indexed and merged in space group C2221, with unit-cell parameters a = 75.74, b = 165.59, c = 70.14 Å, α = β = γ = 90°. The solvent content in the unit cell is consistent with the presence of one Pax9 paired domain bound to duplex DNA in the asymmetric unit.
Narasimhan, Kamesh; Hilbig, Antonia; Udayasuryan, Barath; Jayabal, Sriram; Kolatkar, Prasanna R.; Jauch, Ralf
2014-01-01
Pax genes belong to a family of metazoan transcription factors that are known to play a critical role in eye, ear, kidney and neural development. The mammalian Pax family of transcription factors is characterized by a ∼128-amino-acid DNA-binding paired domain that makes sequence-specific contacts with DNA. The diversity in Pax gene activities emerges from complex modes of interaction with enhancer regions and heterodimerization with multiple interaction partners. Based on in vitro optimal binding-site selection studies and enhancer identification assays, it has been suggested that Pax proteins may recognize and bind their target DNA elements with different binding modes/topologies, however this hypothesis has not yet been structurally explored. One of the most extensively studied DNA target elements of the Pax6 paired domain is the eye-lens specific DC5 (δ-crystallin) enhancer element. In order to shed light on Pax6–DC5 DNA interactions, the related paired-domain prototype Pax9 was crystallized with the minimal δ-crystallin DC5 enhancer element and preliminary X-ray diffraction analysis was attempted. A 3.0 Å resolution native data set was collected at the National Synchrotron Light Source (NSLS), Brookhaven from crystals grown in a solution consisting of 10%(w/v) PEG 20K, 20%(v/v) PEG 550 MME, 0.03 M NaNO3, 0.03 M Na2HPO4, 0.03 M NH2SO4, 0.1 M MES/imidazole pH 6.5. The data set was indexed and merged in space group C2221, with unit-cell parameters a = 75.74, b = 165.59, c = 70.14 Å, α = β = γ = 90°. The solvent content in the unit cell is consistent with the presence of one Pax9 paired domain bound to duplex DNA in the asymmetric unit. PMID:25286939
International Nuclear Information System (INIS)
Moghaddam, Minoo J; Yang Wenrong; Bojarski, Barbara; Gengenbach, Thomas R; Gao Mei; Zareie, Hadi; McCall, Maxine J
2012-01-01
A facile, two-step method for chemically attaching single-stranded DNA to graphitic surfaces, represented here by carbon nanotubes, is reported. In the first step, an azide-containing compound, N-5-azido-nitrobenzoyloxy succinimide (ANB-NOS), is used to form photo-adducts on the graphitic surfaces in a solid-state photochemical reaction, resulting in active ester groups being oriented for the subsequent reactions. In the second step, pre-synthesized DNA strands bearing a terminal amine group are coupled in an aqueous solution with the active esters on the photo-adducts. The versatility of the method is demonstrated by attaching pre-synthesized DNA to surfaces of carbon nanotubes in two platforms—as vertically-aligned multi-walled carbon nanotubes on a solid support and as tangled single-walled carbon nanotubes in mats. The reaction products at various stages were characterized by x-ray photoelectron spectroscopy. Two different assays were used to check that the DNA strands attached to the carbon nanotubes were able to bind their partner strands with complementary base sequences. The first assay, using partner DNA strands tethered to gold nanoparticles, enabled the sites of DNA attachment to the carbon nanotubes to be identified in TEM images. The second assay, using radioactively labelled partner DNA strands, quantified the density of functional DNA strands attached to the carbon nanotubes. The diversity of potential applications for these DNA-modified carbon-nanotube platforms is exemplified here by the successful use of a DNA-modified single-walled carbon-nanotube mat as an electrode for the specific detection of metal ions. (paper)
Su'etsugu, Masayuki; Takata, Makoto; Kubota, Toshio; Matsuda, Yusaku; Katayama, Tsutomu
2004-06-01
In Escherichia coli, the ATP-DnaA protein initiates chromosomal replication. After the DNA polymerase III holoenzyme is loaded on to DNA, DnaA-bound ATP is hydrolysed in a manner depending on Hda protein and the DNA-loaded form of the DNA polymerase III sliding clamp subunit, which yields ADP-DnaA, an inactivated form for initiation. This regulatory DnaA-inactivation represses extra initiation events. In this study, in vitro replication intermediates and structured DNA mimicking replicational intermediates were first used to identify structural prerequisites in the process of DnaA-ATP hydrolysis. Unlike duplex DNA loaded with sliding clamps, primer RNA-DNA heteroduplexes loaded with clamps were not associated with DnaA-ATP hydrolysis, and duplex DNA provided in trans did not rescue this defect. At least 40-bp duplex DNA is competent for the DnaA-ATP hydrolysis when a single clamp was loaded. The DnaA-ATP hydrolysis was inhibited when ATP-DnaA was tightly bound to a DnaA box-bearing oligonucleotide. These results imply that the DnaA-ATP hydrolysis involves the direct interaction of ATP-DnaA with duplex DNA flanking the sliding clamp. Furthermore, Hda protein formed a stable complex with the sliding clamp. Based on these, we suggest a mechanical basis in the DnaA-inactivation that ATP-DnaA interacts with the Hda-clamp complex with the aid of DNA binding. Copyright Blackwell Publishing Limited
Henderson, Morgan L; Kreuzer, Kenneth N
2015-01-01
Expression of mutant EcoRII methyltransferase protein (M.EcoRII-C186A) in Escherichia coli leads to tightly bound DNA-protein complexes (TBCs), located sporadically on the chromosome rather than in tandem arrays. The mechanisms behind the lethality induced by such sporadic TBCs are not well studied, nor is it clear whether very tight binding but non-covalent complexes are processed in the same way as covalent DNA-protein crosslinks (DPCs). Using 2D gel electrophoresis, we found that TBCs induced by M.EcoRII-C186A block replication forks in vivo. Specific bubble molecules were detected as spots on the 2D gel, only when M.EcoRII-C186A was induced, and a mutation that eliminates a specific EcoRII methylation site led to disappearance of the corresponding spot. We also performed a candidate gene screen for mutants that are hypersensitive to TBCs induced by M.EcoRII-C186A. We found several gene products necessary for protection against these TBCs that are known to also protect against DPCs induced with wild-type M.EcoRII (after 5-azacytidine incorporation): RecA, RecBC, RecG, RuvABC, UvrD, FtsK, XerCD and SsrA (tmRNA). In contrast, the RecFOR pathway and Rep helicase are needed for protection against TBCs but not DPCs induced by M.EcoRII. We propose that stalled fork processing by RecFOR and RecA promotes release of tightly bound (but non-covalent) blocking proteins, perhaps by licensing Rep helicase-driven dissociation of the blocking M.EcoRII-C186A. Our studies also argued against the involvement of several proteins that might be expected to protect against TBCs. We took the opportunity to directly compare the sensitivity of all tested mutants to two quinolone antibiotics, which target bacterial type II topoisomerases and induce a unique form of DPC. We uncovered rep, ftsK and xerCD as novel quinolone hypersensitive mutants, and also obtained evidence against the involvement of a number of functions that might be expected to protect against quinolones.
Directory of Open Access Journals (Sweden)
Morgan L Henderson
Full Text Available Expression of mutant EcoRII methyltransferase protein (M.EcoRII-C186A in Escherichia coli leads to tightly bound DNA-protein complexes (TBCs, located sporadically on the chromosome rather than in tandem arrays. The mechanisms behind the lethality induced by such sporadic TBCs are not well studied, nor is it clear whether very tight binding but non-covalent complexes are processed in the same way as covalent DNA-protein crosslinks (DPCs. Using 2D gel electrophoresis, we found that TBCs induced by M.EcoRII-C186A block replication forks in vivo. Specific bubble molecules were detected as spots on the 2D gel, only when M.EcoRII-C186A was induced, and a mutation that eliminates a specific EcoRII methylation site led to disappearance of the corresponding spot. We also performed a candidate gene screen for mutants that are hypersensitive to TBCs induced by M.EcoRII-C186A. We found several gene products necessary for protection against these TBCs that are known to also protect against DPCs induced with wild-type M.EcoRII (after 5-azacytidine incorporation: RecA, RecBC, RecG, RuvABC, UvrD, FtsK, XerCD and SsrA (tmRNA. In contrast, the RecFOR pathway and Rep helicase are needed for protection against TBCs but not DPCs induced by M.EcoRII. We propose that stalled fork processing by RecFOR and RecA promotes release of tightly bound (but non-covalent blocking proteins, perhaps by licensing Rep helicase-driven dissociation of the blocking M.EcoRII-C186A. Our studies also argued against the involvement of several proteins that might be expected to protect against TBCs. We took the opportunity to directly compare the sensitivity of all tested mutants to two quinolone antibiotics, which target bacterial type II topoisomerases and induce a unique form of DPC. We uncovered rep, ftsK and xerCD as novel quinolone hypersensitive mutants, and also obtained evidence against the involvement of a number of functions that might be expected to protect against quinolones.
BIOPHYSICAL PROPERTIES OF NUCLEIC ACIDS AT SURFACES RELEVANT TO MICROARRAY PERFORMANCE.
Rao, Archana N; Grainger, David W
2014-04-01
Both clinical and analytical metrics produced by microarray-based assay technology have recognized problems in reproducibility, reliability and analytical sensitivity. These issues are often attributed to poor understanding and control of nucleic acid behaviors and properties at solid-liquid interfaces. Nucleic acid hybridization, central to DNA and RNA microarray formats, depends on the properties and behaviors of single strand (ss) nucleic acids (e.g., probe oligomeric DNA) bound to surfaces. ssDNA's persistence length, radius of gyration, electrostatics, conformations on different surfaces and under various assay conditions, its chain flexibility and curvature, charging effects in ionic solutions, and fluorescent labeling all influence its physical chemistry and hybridization under assay conditions. Nucleic acid (e.g., both RNA and DNA) target interactions with immobilized ssDNA strands are highly impacted by these biophysical states. Furthermore, the kinetics, thermodynamics, and enthalpic and entropic contributions to DNA hybridization reflect global probe/target structures and interaction dynamics. Here we review several biophysical issues relevant to oligomeric nucleic acid molecular behaviors at surfaces and their influences on duplex formation that influence microarray assay performance. Correlation of biophysical aspects of single and double-stranded nucleic acids with their complexes in bulk solution is common. Such analysis at surfaces is not commonly reported, despite its importance to microarray assays. We seek to provide further insight into nucleic acid-surface challenges facing microarray diagnostic formats that have hindered their clinical adoption and compromise their research quality and value as genomics tools.
Pal, Sarika; Verma, Alka; Raikwar, S.; Prajapati, Y. K.; Saini, J. P.
2018-05-01
In this paper, graphene-coated black phosphorus at the metal surface for the detection of DNA hybridization event is numerically demonstrated. The strategy consists of placing the sensing medium on top of black phosphorus-graphene-coated SPR which interfaces with phosphate-buffered saline solution carrying single-stranded DNA. Upon hybridization with its complementary DNA, desorption of the nanostructures takes place and thus enables the sensitive detection of the DNA hybridization event. The proposed sensor exhibits a sensitivity (125 ο/RIU), detection accuracy (0.95) and quality factor (13.62 RIU-1) for complementary DNA. In comparison with other reported papers, our suggested sensor provides much better performance. Thus, this label-free DNA detection platform should spur off new interest towards the use of black phosphorus-graphene-coated SPR interfaces.
Discrete persistent-chain model for protein binding on DNA.
Lam, Pui-Man; Zhen, Yi
2011-04-01
We describe and solve a discrete persistent-chain model of protein binding on DNA, involving an extra σ(i) at a site i of the DNA. This variable takes the value 1 or 0, depending on whether or not the site is occupied by a protein. In addition, if the site is occupied by a protein, there is an extra energy cost ɛ. For a small force, we obtain analytic expressions for the force-extension curve and the fraction of bound protein on the DNA. For higher forces, the model can be solved numerically to obtain force-extension curves and the average fraction of bound proteins as a function of applied force. Our model can be used to analyze experimental force-extension curves of protein binding on DNA, and hence deduce the number of bound proteins in the case of nonspecific binding. ©2011 American Physical Society
Carlsson, Nils; Jonsson, Fabian; Wilhelmsson, L. Marcus; Nordé n, Bengt; Å kerman, Bjö rn
2013-01-01
We report that DNA molecules can be intercalated and macroscopically oriented in the aqueous interstitia of a lyotropic lamellar liquid crystal. Using UV-vis linear dichroism and fluorescence spectroscopy we show that double-stranded oligonucleotides (25 base pairs) in the water-octanoate-decanol system remain base-paired in the B conformation and are confined in two dimensions, with the helix axis preferentially parallel to the lipid bilayer surfaces but free to rotate within this plane. The degree of helix confinement and the corresponding 2-D orientation can be improved by decreasing the thickness of the water interstitia via the fraction of water in the ternary mixture. Not surprisingly, the corresponding single-stranded oligonucleotides are not aligned, with their persistence length being short in comparison to the lamellar interstitium thickness. We propose this as a model system for studying interactions of DNA-ligand complexes near a lipid bilayer membrane which we demonstrate by using dye probes that are either covalently attached to one end of the oligonucleotide or reversibly bound by intercalation between the base pairs. Three cationic dyes, all strongly bound by intercalation to DNA when free in solution, are found to not bind to DNA but to prefer the membrane surface. The covalently attached Cy5 also binds to the bilayer while Cy3 tends to end-stack to the oligonucleotide duplex. The orientation of Cy5 parallel to the membrane indicates that electrostatic surface binding predominates over insertion into the hydrophobic interior of the membrane. Anionic and zwitterionic dyes (FAM and ROX) are found to remain randomly oriented in the water between the lipid bilayer surfaces. © The Royal Society of Chemistry.
Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain
2012-10-11
Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.
UV induced DNA-protein cross links in vitro and in vivo
International Nuclear Information System (INIS)
Kornhauser, A.
1976-01-01
The review was not intended to cover all the past year's literature in this field; only selective material published in 1974 and 1975 has been surveyed. Covalent linkage of DNA and RNA to proteins induced by UV is considered, but DNA-membrade attachment, amino acids covalently bound to DNA as functions of growth conditions and protein non-covalently bound to DNA involved in cell regulation are excluded. Studies of DNA-protein cross-links upon UV irradiation in chemical model systems, bacteria and tissue culture systems, and an in vivo mammalian system are all surveyed. (U.K.)
The interaction of MnH(X 7Sigma+) with He: ab initio potential energy surface and bound states.
Turpin, Florence; Halvick, Philippe; Stoecklin, Thierry
2010-06-07
The potential energy surface of the ground state of the He-MnH(X (7)Sigma(+)) van der Waals complex is presented. Within the supermolecular approach of intermolecular energy calculations, a grid of ab initio points was computed at the multireference configuration interaction level using the aug-cc-pVQZ basis set for helium and hydrogen and the relativistic aug-cc-pVQZ-DK basis set for manganese. The potential energy surface was then fitted to a global analytical form which main features are discussed. As a first application of this potential energy surface, we present accurate calculations of bound energy levels of the (3)He-MnH and (4)He-MnH complexes.
The interaction of MnH(X 7Σ+) with He: Ab initio potential energy surface and bound states
Turpin, Florence; Halvick, Philippe; Stoecklin, Thierry
2010-06-01
The potential energy surface of the ground state of the He-MnH(X Σ7+) van der Waals complex is presented. Within the supermolecular approach of intermolecular energy calculations, a grid of ab initio points was computed at the multireference configuration interaction level using the aug-cc-pVQZ basis set for helium and hydrogen and the relativistic aug-cc-pVQZ-DK basis set for manganese. The potential energy surface was then fitted to a global analytical form which main features are discussed. As a first application of this potential energy surface, we present accurate calculations of bound energy levels of the H3e-MnH and H4e-MnH complexes.
Force-extension behavior of DNA in the presence of DNA-bending nucleoid associated proteins
Dahlke, K.; Sing, C. E.
2018-02-01
Interactions between nucleoid associated proteins (NAPs) and DNA affect DNA polymer conformation, leading to phenomena such as concentration dependent force-extension behavior. These effects, in turn, also impact the local binding behavior of the protein, such as high forces causing proteins to unbind, or proteins binding favorably to locally bent DNA. We develop a coarse-grained NAP-DNA simulation model that incorporates both force- and concentration-dependent behaviors, in order to study the interplay between NAP binding and DNA conformation. This model system includes multi-state protein binding and unbinding, motivated by prior work, but is now dependent on the local structure of the DNA, which is related to external forces acting on the DNA strand. We observe the expected qualitative binding behavior, where more proteins are bound at lower forces than at higher forces. Our model also includes NAP-induced DNA bending, which affects DNA elasticity. We see semi-quantitative matching of our simulated force-extension behavior to the reported experimental data. By using a coarse-grained simulation, we are also able to look at non-equilibrium behaviors, such as dynamic extension of a DNA strand. We stretch a DNA strand at different rates and at different NAP concentrations to observe how the time scales of the system (such as pulling time and unbinding time) work in concert. When these time scales are similar, we observe measurable rate-dependent changes in the system, which include the number of proteins bound and the force required to extend the DNA molecule. This suggests that the relative time scales of different dynamic processes play an important role in the behavior of NAP-DNA systems.
Dielectric structures with bound modes for microcavity lasers
Visser, P.M.; Allaart, K.; Lenstra, D.
2002-01-01
Cavity modes of dielectric microsphcres and vertical cavity surface emitting lasers, in spite of their high Q, are never exactly bound, but have a finite width due to leakage at the borders. We propose types of microstructures that sustain three-dimensionally bound modes of the radiation field when
Directory of Open Access Journals (Sweden)
Haifeng eChen
2015-11-01
Full Text Available RNA polymerase catalyzes transcription with a high fidelity. If DNA/RNA mismatch or DNA damage occurs downstream, a backtracked RNA polymerase can proofread this situation. However, the backtracked mechanism is still poorly understood. Here we have performed multiple explicit-solvent molecular dynamics (MD simulations on bound and apo DNA/RNA hybrid to study backtracked recognition. MD simulations at room temperature suggest that specific electrostatic interactions play key roles in the backtracked recognition between the polymerase and DNA/RNA hybrid. Kinetics analysis at high temperature shows that bound and apo DNA/RNA hybrid unfold via a two-state process. Both kinetics and free energy landscape analyses indicate that bound DNA/RNA hybrid folds in the order of DNA/RNA contracting, the tertiary folding and polymerase binding. The predicted Φ-values suggest that C7, G9, dC12, dC15 and dT16 are key bases for the backtracked recognition of DNA/RNA hybrid. The average RMSD values between the bound structures and the corresponding apo ones and Kolmogorov-Smirnov (KS P test analyses indicate that the recognition between DNA/RNA hybrid and polymerase might follow an induced fit mechanism for DNA/RNA hybrid and conformation selection for polymerase. Furthermore, this method could be used to relative studies of specific recognition between nucleic acid and protein.
Site-specific DNA Inversion by Serine Recombinases
2015-01-01
Reversible site-specific DNA inversion reactions are widely distributed in bacteria and their viruses. They control a range of biological reactions that most often involve alterations of molecules on the surface of cells or phage. These programmed DNA rearrangements usually occur at a low frequency, thereby preadapting a small subset of the population to a change in environmental conditions, or in the case of phages, an expanded host range. A dedicated recombinase, sometimes with the aid of additional regulatory or DNA architectural proteins, catalyzes the inversion of DNA. RecA or other components of the general recombination-repair machinery are not involved. This chapter discusses site-specific DNA inversion reactions mediated by the serine recombinase family of enzymes and focuses on the extensively studied serine DNA invertases that are stringently controlled by the Fis-bound enhancer regulatory system. The first section summarizes biological features and general properties of inversion reactions by the Fis/enhancer-dependent serine invertases and the recently described serine DNA invertases in Bacteroides. Mechanistic studies of reactions catalyzed by the Hin and Gin invertases are then discussed in more depth, particularly with regards to recent advances in our understanding of the function of the Fis/enhancer regulatory system, the assembly of the active recombination complex (invertasome) containing the Fis/enhancer, and the process of DNA strand exchange by rotation of synapsed subunit pairs within the invertasome. The role of DNA topological forces that function in concert with the Fis/enhancer controlling element in specifying the overwhelming bias for DNA inversion over deletion and intermolecular recombination is emphasized. PMID:25844275
BIOPHYSICAL PROPERTIES OF NUCLEIC ACIDS AT SURFACES RELEVANT TO MICROARRAY PERFORMANCE
Rao, Archana N.; Grainger, David W.
2014-01-01
Both clinical and analytical metrics produced by microarray-based assay technology have recognized problems in reproducibility, reliability and analytical sensitivity. These issues are often attributed to poor understanding and control of nucleic acid behaviors and properties at solid-liquid interfaces. Nucleic acid hybridization, central to DNA and RNA microarray formats, depends on the properties and behaviors of single strand (ss) nucleic acids (e.g., probe oligomeric DNA) bound to surfaces. ssDNA’s persistence length, radius of gyration, electrostatics, conformations on different surfaces and under various assay conditions, its chain flexibility and curvature, charging effects in ionic solutions, and fluorescent labeling all influence its physical chemistry and hybridization under assay conditions. Nucleic acid (e.g., both RNA and DNA) target interactions with immobilized ssDNA strands are highly impacted by these biophysical states. Furthermore, the kinetics, thermodynamics, and enthalpic and entropic contributions to DNA hybridization reflect global probe/target structures and interaction dynamics. Here we review several biophysical issues relevant to oligomeric nucleic acid molecular behaviors at surfaces and their influences on duplex formation that influence microarray assay performance. Correlation of biophysical aspects of single and double-stranded nucleic acids with their complexes in bulk solution is common. Such analysis at surfaces is not commonly reported, despite its importance to microarray assays. We seek to provide further insight into nucleic acid-surface challenges facing microarray diagnostic formats that have hindered their clinical adoption and compromise their research quality and value as genomics tools. PMID:24765522
Luque-Caballero, Germán; Martín-Molina, Alberto; Sánchez-Treviño, Alda Yadira; Rodríguez-Valverde, Miguel A; Cabrerizo-Vílchez, Miguel A; Maldonado-Valderrama, Julia
2014-04-28
Complexation of DNA with lipids is currently being developed as an alternative to classical vectors based on viruses. Most of the research to date focuses on cationic lipids owing to their spontaneous complexation with DNA. Nonetheless, recent investigations have revealed that cationic lipids induce a large number of adverse effects on DNA delivery. Precisely, the lower cytotoxicity of anionic lipids accounts for their use as a promising alternative. However, the complexation of DNA with anionic lipids (mediated by cations) is still in early stages and is not yet well understood. In order to explore the molecular mechanisms underlying the complexation of anionic lipids and DNA we proposed a combined methodology based on the surface pressure-area isotherms, Gibbs elasticity and Atomic Force Microscopy (AFM). These techniques allow elucidation of the role of the surface pressure in the complexation and visualization of the interfacial aggregates for the first time. We demonstrate that the DNA complexes with negatively charged model monolayers (DPPC/DPPS 4 : 1) only in the presence of Ca(2+), but is expelled at very high surface pressures. Also, according to the Gibbs elasticity plot, the complexation of lipids and DNA implies a whole fluidisation of the monolayer and a completely different phase transition map in the presence of DNA and Ca(2+). AFM imaging allows identification for the first time of specific morphologies associated with different packing densities. At low surface coverage, a branched net like structure is observed whereas at high surface pressure fibers formed of interfacial aggregates appear. In summary, Ca(2+) mediates the interaction between DNA and negatively charged lipids and also the conformation of the ternary system depends on the surface pressure. Such observations are important new generic features of the interaction between DNA and anionic lipids.
Directory of Open Access Journals (Sweden)
Xiaojun Tao
Full Text Available Nanoparticle (NP compositions such as hydrophobicity and surface charge are vital to determine the presence and amount of human serum albumin (HSA binding. The HSA binding influences drug release, biocompatibility, biodistribution, and intercellular trafficking of nanoparticles (NPs. Here, we prepared 2 kinds of nanomaterials to investigate HSA binding and evaluated drug release of HSA-bound NPs. Polysaccharides (pullulan carboxyethylated to provide ionic derivatives were then conjugated to cholesterol groups to obtain cholesterol-modified carboxyethyl pullulan (CHCP. Cholesterol-modified pullulan (CHP conjugate was synthesized with a similar degree of substitution of cholesterol moiety to CHCP. CHCP formed self-aggregated NPs in aqueous solution with a spherical structure and zeta potential of -19.9 ± 0.23 mV, in contrast to -1.21 ± 0.12 mV of CHP NPs. NPs could quench albumin fluorescence intensity with maximum emission intensity gradually decreasing up to a plateau at 9 to 12 h. Binding constants were 1.12 × 10(5 M(-1 and 0.70 × 10(5 M(-1 to CHP and CHCP, respectively, as determined by Stern-Volmer analysis. The complexation between HSA and NPs was a gradual process driven by hydrophobic force and inhibited by NP surface charge and shell-core structure. HSA conformation was altered by NPs with reduction of α-helical content, depending on interaction time and particle surface charges. These NPs could represent a sustained release carrier for mitoxantrone in vitro, and the bound HSA assisted in enhancing sustained drug release.
Sun, Lu
2014-10-16
© 2014 American Chemical Society. Biosensors, in which binding of ligands is detected through changes in the optical or electrochemical properties of a DNA layer confined to the sensor surface, are important tools for investigating DNA interactions. Here, we investigate if conformational changes induced in surface-attached DNA molecules upon ligand binding can be monitored by the quartz crystal microbalance with dissipation (QCM-D) technique. DNA duplexes containing 59-184 base pairs were formed on QCM-D crystals by stepwise assembly of synthetic oligonucleotides of designed base sequences. The DNA films were exposed to the cationic polyamines spermidine and spermine, known to condense DNA molecules in bulk experiments, or to the recombination protein Rad51, known to extend the DNA helix. The binding and dissociation of the ligands to the DNA films were monitored in real time by measurements of the shifts in resonance frequency (Δf) and in dissipation (ΔD). The QCM-D data were analyzed using a Voigt-based model for the viscoelastic properties of polymer films in order to evaluate how the ligands affect thickness and shear viscosity of the DNA layer. Binding of spermine shrinks all DNA layers and increases their viscosity in a reversible fashion, and so does spermidine, but to a smaller extent, in agreement with its lower positive charge. SPR was used to measure the amount of bound polyamines, and when combined with QCM-D, the data indicate that the layer condensation leads to a small release of water from the highly hydrated DNA films. The binding of Rad51 increases the effective layer thickness of a 59bp film, more than expected from the know 50% DNA helix extension. The combined results provide guidelines for a QCM-D biosensor based on ligand-induced structural changes in DNA films. The QCM-D approach provides high discrimination between ligands affecting the thickness and the structural properties of the DNA layer differently. The reversibility of the film
Surface Andreev Bound States and Odd-Frequency Pairing in Topological Superconductor Junctions
Tanaka, Yukio; Tamura, Shun
2018-04-01
In this review, we summarize the achievement of the physics of surface Andreev bound states (SABS) up to now. The route of this activity has started from the physics of SABS of unconventional superconductors where the pair potential has a sign change on the Fermi surface. It has been established that SABS can be regarded as a topological edge state with topological invariant defined in the bulk Hamiltonian. On the other hand, SABS accompanies odd-frequency pairing like spin-triplet s-wave or spin-singlet p-wave. In a spin-triplet superconductor junction, induced odd-frequency pairing can penetrate into a diffusive normal metal (DN) attached to the superconductor. It causes so called anomalous proximity effect where the local density of states of quasiparticle in DN has a zero energy peak. When bulk pairing symmetry is spin-triplet px-wave, the anomalous proximity effect becomes prominent and the zero bias voltage conductance is always quantized independent of the resistance in DN and interface. Finally, we show that the present anomalous proximity effect is realized in an artificial topological superconducting system, where a nanowire with spin-orbit coupling and Zeeman field is put on the conventional spin-singlet s-wave superconductor.
Model for how type I restriction enzymes select cleavage sites in DNA
International Nuclear Information System (INIS)
Studier, F.W.; Bandyopadhyay, P.K.
1988-01-01
Under appropriate conditions, digestion of phage T7 DNA by the type I restriction enzyme EcoK produces an orderly progression of discrete DNA fragments. All details of the fragmentation pattern can be explained on the basis of the known properties of type I enzymes, together with two further assumptions: (i) in the ATP-stimulated translocation reaction, the enzyme bound at the recognition sequence translocates DNA toward itself from both directions simultaneously; and (ii) when translocation causes neighboring enzymes to meet, they cut the DNA between them. The kinetics of digestion at 37 degree C indicates that the rate of translocation of DNA from each side of a bound enzyme is about 200 base pairs per second, and the cuts are completed within 15-25 sec of the time neighboring enzymes meet. The resulting DNA fragments each contain a single recognition site with an enzyme (or subunit) remaining bound to it. At high enzyme concentrations, such fragments can bu further degraded, apparently by cooperation between the specifically bound and excess enzymes. This model is consistent with a substantial body of previous work on the nuclease activity of EcoB and EcoK, and it explains in a simple way how cleavage sites are selected
Spiky gold shells on magnetic particles for DNA biosensors.
Bedford, Erin E; Boujday, Souhir; Pradier, Claire-Marie; Gu, Frank X
2018-05-15
Combined separation and detection of biomolecules has the potential to speed up and improve the sensitivity of disease detection, environmental testing, and biomolecular analysis. In this work, we synthesized magnetic particles coated with spiky nanostructured gold shells and used them to magnetically separate out and detect oligonucleotides using SERS. The distance dependence of the SERS signal was then harnessed to detect DNA hybridization using a Raman label bound to a hairpin probe. The distance of the Raman label from the surface increased upon complementary DNA hybridization, leading to a decrease in signal intensity. This work demonstrates the use of the particles for combined separation and detection of oligonucleotides without the use of an extrinsic tag or secondary hybridization step. Copyright © 2018 Elsevier B.V. All rights reserved.
Ratiometric FRET-based detection of DNA and micro-RNA on the surface using TIRF detection
International Nuclear Information System (INIS)
Matveeva, Evgenia G.; Gryczynski, Zygmunt; Stewart, Donald R.; Gryczynski, Ignacy
2010-01-01
A new FRET-based method for the ratiometric detection of DNA oligomers on a surface using TIRF detection mode is reported. The dual-labeled system consisting of two hybridized oligomers, Cy3oligoY:Cy5oligoX was immobilized on the surface, and the total internal reflection fluorescence (TIRF) was used to detect emission signals from the surface. Two signals, green and red, which originated from the green donor Cy3 and the red acceptor Cy5, have been simultaneously detected. When the target single-stranded complimentary oligomer was present in the solution, this oligomer replaced the Cy3oligoY in the donor:acceptor complex on the surface and the ratio of red-to-green signal was dramatically changed. This detection scheme is generally applicable to the detection of DNA or RNA on a surface.
Method and apparatus for synthesis of arrays of DNA probes
Cerrina, Francesco; Sussman, Michael R.; Blattner, Frederick R.; Singh-Gasson, Sangeet; Green, Roland
2002-04-23
The synthesis of arrays of DNA probes sequences, polypeptides, and the like is carried out using a patterning process on an active surface of a substrate. An image is projected onto the active surface of the substrate utilizing an image former that includes a light source that provides light to a micromirror device comprising an array of electronically addressable micromirrors, each of which can be selectively tilted between one of at least two positions. Projection optics receives the light reflected from the micromirrors along an optical axis and precisely images the micromirrors onto the active surface of the substrate, which may be used to activate the surface of the substrate. The first level of bases may then be applied to the substrate, followed by development steps, and subsequent exposure of the substrate utilizing a different pattern of micromirrors, with further repeats until the elements of a two dimensional array on the substrate surface have an appropriate base bound thereto. The micromirror array can be controlled in conjunction with a DNA synthesizer supplying appropriate reagents to a flow cell containing the active substrate to control the sequencing of images presented by the micromirror array in coordination of the reagents provided to the substrate.
Substrate-Bound Protein Gradients to Study Haptotaxis
Directory of Open Access Journals (Sweden)
Sebastien G. Ricoult
2015-03-01
Full Text Available Cells navigate in response to inhomogeneous distributions of extracellular guidance cues. The cellular and molecular mechanisms underlying migration in response to gradients of chemical cues have been investigated for over a century. Following the introduction of micropipettes and more recently microfluidics for gradient generation, much attention and effort was devoted to study cellular chemotaxis, which is defined as guidance by gradients of chemical cues in solution. Haptotaxis, directional migration in response to gradients of substrate-bound cues, has received comparatively less attention; however it is increasingly clear that in vivo many physiologically relevant guidance proteins – including many secreted cues – are bound to cellular surfaces or incorporated into extracellular matrix and likely function via a haptotactic mechanism. Here, we review the history of haptotaxis. We examine the importance of the reference surface, the surface in contact with the cell that is not covered by the cue, which forms a gradient opposing the gradient of the protein cue and must be considered in experimental designs and interpretation of results. We review and compare microfluidics, contact-printing, light patterning and 3D fabrication to pattern substrate-bound protein gradients in vitro, and focus on their application to study axon guidance. The range of methods to create substrate-bound gradients discussed herein make possible systematic analyses of haptotactic mechanisms. Furthermore, understanding the fundamental mechanisms underlying cell motility will inform bioengineering approaches to program cell navigation and recover lost function.
Recent Development of Nano-Materials Used in DNA Biosensors
Directory of Open Access Journals (Sweden)
Yibin Ying
2009-07-01
Full Text Available As knowledge of the structure and function of nucleic acid molecules has increased, sequence-specific DNA detection has gained increased importance. DNA biosensors based on nucleic acid hybridization have been actively developed because of their specificity, speed, portability, and low cost. Recently, there has been considerable interest in using nano-materials for DNA biosensors. Because of their high surface-to-volume ratios and excellent biological compatibilities, nano-materials could be used to increase the amount of DNA immobilization; moreover, DNA bound to nano-materials can maintain its biological activity. Alternatively, signal amplification by labeling a targeted analyte with nano-materials has also been reported for DNA biosensors in many papers. This review summarizes the applications of various nano-materials for DNA biosensors during past five years. We found that nano-materials of small sizes were advantageous as substrates for DNA attachment or as labels for signal amplification; and use of two or more types of nano-materials in the biosensors could improve their overall quality and to overcome the deficiencies of the individual nano-components. Most current DNA biosensors require the use of polymerase chain reaction (PCR in their protocols. However, further development of nano-materials with smaller size and/or with improved biological and chemical properties would substantially enhance the accuracy, selectivity and sensitivity of DNA biosensors. Thus, DNA biosensors without PCR amplification may become a reality in the foreseeable future.
Normalization constraint for variational bounds on fluid permeability
International Nuclear Information System (INIS)
Berryman, J.G.; Milton, G.W.
1985-01-01
A careful reexamination of the formulation of Prager's original variational principle for viscous flow through porous media has uncovered a subtle error in the normalization constraint on the trial functions. Although a certain surface integral of the true pressure field over the internal surface area always vanishes for isotropic materials, the corresponding surface integral for a given trial pressure field does not necessarily vanish but has nevertheless been previously neglected in the normalization. When this error is corrected, the form of the variational estimate is actually simpler than before and furthermore the resulting bounds have been shown to improve when the constant trial functions are used in either the two-point or three-point bounds
Monoclonal antibodies to DNA modified with cis- or trans-diamminedichloroplatinum(II)
International Nuclear Information System (INIS)
Sundquist, W.I.; Lippard, S.J.; Stollar, B.D.
1987-01-01
Murine monoclonal antibodies that bind selectively to adducts formed on DNA by the antitumor drug cis-diamminedichloroplatinum(II), cis-DDP, or to the chemothrapeutically inactive trans isomer trans-DDP were elicited by immunization with calf thymus DNA modified with either cis- or trans-DDP at ratios of bound platinum per nucleotide, (D/N)/sub b/, of 0.06-0.08. The binding of two monoclonal antibodies to cis-DDP-modified DNA was competitively inhibited in an enzyme-linked immunosorbent assay (ELISA) by 4-6 nM concentrations of cis-DDP bound to DNA. Adducts formed by cis-DDP on other synthetic DNA polymers did not inhibit antibody binding to cis-DDP-DNA. The biologically active compounds [Pt(en)Cl 2 ], [Pt(dach)Cl 2 ], and [Pt(NH 3 ) 2 (cbdca)] (carboplatin) all formed antibody-detectable adducts on DNA, whereas the inactive platinum complexes trans-DDP and [Pt(dien)Cl]Cl (dien, diethylenetriamine) did not. The monoclonal antibodies therefore recognize a bifunctional Pt-DNA adduct with cis stereochemistry in which platinum is coordinated by two adjacent guanines or, to a lesser degree, by adjacent adenine and guanine. A monoclonal antibody raised against trans-DDP-DNA was competitively inhibited in an ELISA by 40 nM trans-DDP bound to DNA. This antibody crossreacted with unmodified, denatured DNA. The recognition of cis- or trans-DDP-modified DNAs by monoclonal antibodies thus parallels the known modes of DNA binding of these compounds and may correlate with their biological activities
cDNA sequence analysis of a 29-kDa cysteine-rich surface antigen of pathogenic Entamoeba histolytica
International Nuclear Information System (INIS)
Torian, B.E.; Stroeher, V.L.; Stamm, W.E.; Flores, B.M.; Hagen, F.S.
1990-01-01
A λgt11 cDNA library was constructed from poly(U)-Spharose-selected Entamoeba histolytica trophozoite RNA in order to clone and identify surface antigens. The library was screened with rabbit polyclonal anti-E. histolytica serum. A 700-base-pair cDNA insert was isolated and the nucleotide sequence was determined. The deduced amino acid sequence of the cDNA revealed a cysteine-rich protein. DNA hybridizations showed that the gene was specific to E. histolytica since the cDNA probe reacted with DNA from four axenic strains of E. histolytica but did not react with DNA from Entamoeba invadens, Acanthamoeba castellanii, or Trichomonas vaginalis. The insert was subcloned into the expression vector pGEX-1 and the protein was expressed as a fusion with the C terminus of glutathione S-transferase. Purified fusion protein was used to generate 22 monoclonal antibodies (mAbs) and a mouse polyclonal antiserum specific for the E. histolytica portion of the fusion protein. A 29-kDa protein was identified as a surface antigen when mAbs were used to immunoprecipitate the antigen from metabolically 35 S-labeled live trophozoites. The surface location of the antigen was corroborated by mAb immunoprecipitation of a 29-kDa protein from surface- 125 I-labeled whole trophozoites as well as by the reaction of mAbs with live trophozoites in an indirect immunofluorescence assay performed at 4 degree C. Immunoblotting with mAbs demonstrated that the antigen was present on four axenic isolates tested. mAbs recognized epitopes on the 29-kDa native antigen on some but not all clinical isolates tested
cDNA sequence analysis of a 29-kDa cysteine-rich surface antigen of pathogenic Entamoeba histolytica
Energy Technology Data Exchange (ETDEWEB)
Torian, B.E.; Stroeher, V.L.; Stamm, W.E. (Univ. of Washington, Seattle (USA)); Flores, B.M. (Louisiana State Univ. Medical Center, New Orleans (USA)); Hagen, F.S. (Zymogenetics Incorporated, Seattle, WA (USA))
1990-08-01
A {lambda}gt11 cDNA library was constructed from poly(U)-Spharose-selected Entamoeba histolytica trophozoite RNA in order to clone and identify surface antigens. The library was screened with rabbit polyclonal anti-E. histolytica serum. A 700-base-pair cDNA insert was isolated and the nucleotide sequence was determined. The deduced amino acid sequence of the cDNA revealed a cysteine-rich protein. DNA hybridizations showed that the gene was specific to E. histolytica since the cDNA probe reacted with DNA from four axenic strains of E. histolytica but did not react with DNA from Entamoeba invadens, Acanthamoeba castellanii, or Trichomonas vaginalis. The insert was subcloned into the expression vector pGEX-1 and the protein was expressed as a fusion with the C terminus of glutathione S-transferase. Purified fusion protein was used to generate 22 monoclonal antibodies (mAbs) and a mouse polyclonal antiserum specific for the E. histolytica portion of the fusion protein. A 29-kDa protein was identified as a surface antigen when mAbs were used to immunoprecipitate the antigen from metabolically {sup 35}S-labeled live trophozoites. The surface location of the antigen was corroborated by mAb immunoprecipitation of a 29-kDa protein from surface-{sup 125}I-labeled whole trophozoites as well as by the reaction of mAbs with live trophozoites in an indirect immunofluorescence assay performed at 4{degree}C. Immunoblotting with mAbs demonstrated that the antigen was present on four axenic isolates tested. mAbs recognized epitopes on the 29-kDa native antigen on some but not all clinical isolates tested.
A structural basis for the regulatory inactivation of DnaA.
Xu, Qingping; McMullan, Daniel; Abdubek, Polat; Astakhova, Tamara; Carlton, Dennis; Chen, Connie; Chiu, Hsiu-Ju; Clayton, Thomas; Das, Debanu; Deller, Marc C; Duan, Lian; Elsliger, Marc-Andre; Feuerhelm, Julie; Hale, Joanna; Han, Gye Won; Jaroszewski, Lukasz; Jin, Kevin K; Johnson, Hope A; Klock, Heath E; Knuth, Mark W; Kozbial, Piotr; Sri Krishna, S; Kumar, Abhinav; Marciano, David; Miller, Mitchell D; Morse, Andrew T; Nigoghossian, Edward; Nopakun, Amanda; Okach, Linda; Oommachen, Silvya; Paulsen, Jessica; Puckett, Christina; Reyes, Ron; Rife, Christopher L; Sefcovic, Natasha; Trame, Christine; van den Bedem, Henry; Weekes, Dana; Hodgson, Keith O; Wooley, John; Deacon, Ashley M; Godzik, Adam; Lesley, Scott A; Wilson, Ian A
2009-01-16
Regulatory inactivation of DnaA is dependent on Hda (homologous to DnaA), a protein homologous to the AAA+ (ATPases associated with diverse cellular activities) ATPase region of the replication initiator DnaA. When bound to the sliding clamp loaded onto duplex DNA, Hda can stimulate the transformation of active DnaA-ATP into inactive DnaA-ADP. The crystal structure of Hda from Shewanella amazonensis SB2B at 1.75 A resolution reveals that Hda resembles typical AAA+ ATPases. The arrangement of the two subdomains in Hda (residues 1-174 and 175-241) differs dramatically from that of DnaA. A CDP molecule anchors the Hda domains in a conformation that promotes dimer formation. The Hda dimer adopts a novel oligomeric assembly for AAA+ proteins in which the arginine finger, crucial for ATP hydrolysis, is fully exposed and available to hydrolyze DnaA-ATP through a typical AAA+ type of mechanism. The sliding clamp binding motifs at the N-terminus of each Hda monomer are partially buried and combine to form an antiparallel beta-sheet at the dimer interface. The inaccessibility of the clamp binding motifs in the CDP-bound structure of Hda suggests that conformational changes are required for Hda to form a functional complex with the clamp. Thus, the CDP-bound Hda dimer likely represents an inactive form of Hda.
White, P C; Munro, C H; Smith, W E
1996-06-01
An in situ surface enhanced resonance Raman scattering (SERRS) procedure is described for the analysis of a reactive dye covalently bound to a single strand of a cotton fibre. This procedure can be completed in 5 h, whereas an alternative enzyme digestion method takes approximately 21 h. These two fibre preparation methods give similar spectra from picogram quantities of dye present on a 2-5 mm length of fibre. The in situ nature of the analysis and the small sample size make this method particularly suitable for forensic applications.
Electronic properties and assambly of DNA-based molecules on gold surfaces
DEFF Research Database (Denmark)
Salvatore, Princia
, highly base specific voltammetric peak in the presence of spermidine ions. A capacitive origin was attributed to this peak, and a novel route to detection of hybridization and base pair mismatches proposed on the basis of the high sensitivity to base pair mismatches showed by such ON-based monolayers...... as widely employed as Au(111) surfaces). In particular, SERS offered a valuable and rapid way ofcharacterising interactions between the DNA-based molecules and the NP surface, with no need for complex sample preparation....
Wallen, Rachel; Gokarn, Nirmal; Bercea, Priscila; Grzincic, Elissa; Bandyopadhyay, Krisanu
2015-06-01
Vertically aligned single-walled carbon nanotube (VASWCNT) assemblies are generated on cysteamine and 2-mercaptoethanol (2-ME)-functionalized gold surfaces through amide bond formation between carboxylic groups generated at the end of acid-shortened single-walled carbon nanotubes (SWCNTs) and amine groups present on the gold surfaces. Atomic force microscopy (AFM) imaging confirms the vertical alignment mode of SWCNT attachment through significant changes in surface roughness compared to bare gold surfaces and the lack of any horizontally aligned SWCNTs present. These SWCNT assemblies are further modified with an amine-terminated single-stranded probe-DNA. Subsequent hybridization of the surface-bound probe-DNA in the presence of complementary strands in solution is followed using impedance measurements in the presence of Fe(CN)6 3-/4- as the redox probe in solution, which show changes in the interfacial electrochemical properties, specifically the charge-transfer resistance, due to hybridization. In addition, hybridization of the probe-DNA is also compared when it is attached directly to the gold surfaces without any intermediary SWCNTs. Contrary to our expectations, impedance measurements show a decrease in charge-transfer resistance with time due to hybridization with 300 nM complementary DNA in solution with the probe-DNA attached to SWCNTs. In contrast, an increase in charge-transfer resistance is observed with time during hybridization when the probe-DNA is attached directly to the gold surfaces. The decrease in charge-transfer resistance during hybridization in the presence of VASWCNTs indicates an enhancement in the electron transfer process of the redox probe at the VASWCNT-modified electrode. The results suggest that VASWCNTs are acting as mediators of electron transfer, which facilitate the charge transfer of the redox probe at the electrode-solution interface.
Tethered particle analysis of supercoiled circular DNA using peptide nucleic acid handles
DEFF Research Database (Denmark)
Norregaard, Kamilla; Andersson, Magnus; Nielsen, Peter Eigil
2014-01-01
This protocol describes how to monitor individual naturally supercoiled circular DNA plasmids bound via peptide nucleic acid (PNA) handles between a bead and a surface. The protocol was developed for single-molecule investigation of the dynamics of supercoiled DNA, and it allows the investigation...... of both the dynamics of the molecule itself and of its interactions with a regulatory protein. Two bis-PNA clamps designed to bind with extremely high affinity to predetermined homopurine sequence sites in supercoiled DNA are prepared: one conjugated with digoxigenin for attachment to an anti......-digoxigenin-coated glass cover slide, and one conjugated with biotin for attachment to a submicron-sized streptavidin-coated polystyrene bead. Plasmids are constructed, purified and incubated with the PNA handles. The dynamics of the construct is analyzed by tracking the tethered bead using video microscopy: less...
Estrogen receptor accessory proteins augment receptor-DNA interaction and DNA bending.
Landel, C C; Potthoff, S J; Nardulli, A M; Kushner, P J; Greene, G L
1997-01-01
Increasing evidence suggests that accessory proteins play an important role in the ability of the estrogen receptor (ER) and other nuclear hormone receptors to modulate transcription when bound to cis-acting hormone response elements in target genes. We have previously shown that four proteins, hsp70, protein disulfide isomerase (PDI) and two unknown proteins (p48 and p45), copurify with ER that has been isolated by site-specific DNA chromatography (BERE) and influence the interaction of ER with DNA in vitro. To better define the nature of these effects, we used filter binding and electrophoretic mobility shift assays to study the ability of these proteins to alter the kinetics of ER-DNA interaction and to influence the ability of ER to bend DNA when bound to an estrogen response element (ERE). The results of both assays indicate that ERE-purified ER, with its four associated proteins (hsp70, PDI, p48, p45), has a greater ability to bind to the vitellogenin A2 ERE than ER purified by estradiol-Sepharose chromatography in the absence (ESeph) or presence (EATP) of ATP, in which p48, p45 (ESeph) and hsp70 (EATP) are removed. Surprisingly, the rates of association and dissociation of ER and ERE were essentially the same for all three mixtures, suggesting that one or more ER-associated proteins, especially p45 and p48, may be required for ER to attain maximum DNA binding activity. In addition, circular permutation and phasing analyses demonstrated that the same ER-associated proteins produced higher order ER-DNA complexes that significantly increased the magnitude of DNA distortion, but did not alter the direction of the ER-induced bend of ERE-containing DNA fragments, which was toward the major groove of the DNA helix. These results suggest that p45 and/or p48 and possibly hsp70, play an important role both in the specific DNA binding and bending activities of ER and thus contribute to the overall stimulation of transcription in target genes that contain cis
Evidence for nuclear internalization of exogenous DNA into mammalian sperm cells
International Nuclear Information System (INIS)
Francolini, M.; Lavitrano, M.; Lamia, C.L.; French, D.; Frati, L.; Cotelli, F.; Spadafora, C.
1993-01-01
Mature sperm cells have the spontaneous capacity to take up exogenous DNA. Such DNA specifically interacts with the subacrosomal segment of the sperm head corresponding to the nuclear area. Part of the sperm-bound foreign DNA is further internalized into nuclei. Using end-labelled plasmid DNA we have found that 15-22% of the total sperm bound DNA is associated with nuclei as determined on isolated nuclei. On the basis of autoradiographic analysis, nuclear permeability to exogenous DNA seems to be a wide phenomenon involving the majority of the sperm nuclei. In fact, the foreign DNA, incubated with sperm cells for different lengths of time, is found in 45% (10 min) to 65% (2 hr) of the sperm nuclei. Ultrastructural autoradiography on thin sections of mammalian spermatozoa, preincubated with end-labelled plasmid DNA, shows that the exogenous DNA is internalized into the nucleus. This conclusion is further supported by ultrastructural autoradiographic analysis on thin sections of nuclei isolated from spermatozoa preincubated with end-labelled DNA
Simple surface modification of poly(dimethylsiloxane) for DNA hybridization
Zhou, Jinwen; Voelcker, Nicolas H.; Ellis, Amanda V.
2010-01-01
Here, we present a simple chemical modification of poly(dimethylsiloxane) (PDMS) by curing a mixture of 2 wt% undecylenic acid (UDA) in PDMS prepolymer on a gold-coated glass slide. This gold slide had been previously pretreated with a self-assembled hydrophilic monolayer of 3-mercaptopropionic acid (MPA). During curing of the UDA∕PDMS prepolymer, the hydrophilic UDA carboxyl moieties diffuses toward the hydrophilic MPA carboxyl moieties on the gold surface. This diffusion of the UDA within the PDMS prepolymer to the surface is a direct result of surface energy minimization. Once completely cured, the PDMS is peeled off the gold substrate, thereby exposing the interfacial carboxyl groups. These groups are then available for subsequent attachment of 5′-amino terminated DNA oligonucleotides via amide linkages. Our results show that the covalently tethered oligonucleotides can successfully capture fluorescein-labeled complementary oligonucleotides via hybridization, which are visualized using fluorescence microscopy. PMID:21264061
Contribution of granule bound starch synthase in kernel modification ...
African Journals Online (AJOL)
The role of gbssI and gbssII genes, encoding granule bound starch synthase enzyme I and II, respectively, in quality protein maize (QPM) were studied at different days after pollination (DAP). Total RNA was used for first strand cDNA synthesis using the ImpromIISriptTM reverse transcriptase. No detectable levels of gbssI ...
International Nuclear Information System (INIS)
Levy, N.J.; Kasper, D.L.
1986-01-01
The role of surface-bound type Ia group B Streptococcus (GBS) capsular polysaccharide in anti-body-independent binding of C1 and activation of the classic component pathway was investigated. In a radiolabeled bacterial-polymorphonuclear leukocyte (PMN) association assay, a measure of bacterial opsonization, preincubation of 3 H-type Ia GBS with purified F(ab') 2 to the organism blocked the association of the bacteria with PMN', and the inhibitory effect was dose dependent. The specificity of F(ab') 2 blocking was shown after adsorption of F(ab') 2 with type Ia polysaccharide-sensitized erythrocytes. Polysaccharide-adsorbed F(ab') 2 had a 70% decrease in ability to block the association of bacteria with PMN. Neuraminidase digestion removed 80% of the terminal sialic acid residues from the native polysaccharide. These neuraminidase-digested organisms had a 72% decrease in binding and transfer of purified C1 compared with non-enzyme-treated organisms. Type Ia capsular polysaccharide bound to sheep erythrocytes promoted classic complement pathway-mediated hemolysis of the cells. The role of C1 inhibitor (INH) in modulation of C1 activation by the organisms was investigated. The possibility existed that the C1 INH could be bound by the bacteria, allowing C1 activation to occur in the fluid phase. The inhibitor was purified from human serum, and its activity was measured before and after incubation with type Ia GBS. The organisms had no effect on C1 INH activity. Thus surface-bound capsular polysacchardie of type Ia GBS mediates C1 binding and classic pathway activation, and this does not involve the C1 INH
Ngo, Huu B; Lovely, Geoffrey A; Phillips, Rob; Chan, David C
2014-01-01
TFAM (transcription factor A, mitochondrial) is a DNA-binding protein that activates transcription at the two major promoters of mitochondrial DNA (mtDNA)--the light strand promoter (LSP) and the heavy strand promoter 1 (HSP1). Equally important, it coats and packages the mitochondrial genome. TFAM has been shown to impose a U-turn on LSP DNA; however, whether this distortion is relevant at other sites is unknown. Here we present crystal structures of TFAM bound to HSP1 and to nonspecific DNA. In both, TFAM similarly distorts the DNA into a U-turn. Yet, TFAM binds to HSP1 in the opposite orientation from LSP explaining why transcription from LSP requires DNA bending, whereas transcription at HSP1 does not. Moreover, the crystal structures reveal dimerization of DNA-bound TFAM. This dimerization is dispensable for DNA bending and transcriptional activation but is important in DNA compaction. We propose that TFAM dimerization enhances mitochondrial DNA compaction by promoting looping of the DNA.
Enhancement of DNA polymerase activity in potato tuber slices
International Nuclear Information System (INIS)
Watanabe, Akira; Imaseki, Hidemasa
1977-01-01
DNA polymerase was extracted from potato (Soleum tuberosum L.) tuber discs and the temporal correlation of its activity change to DNA synthesis in vivo was examined during aging of the discs. Most of the DNA polymerase was recovered as a bound form in the 18,000 x g precipitate. Reaction with the bound-form enzyme was dependent on the presence of four deoxynucleoside triphosphates, Mg 2+ , and a template. ''Activated'' DNA and heat-denatured DNA, but not native DNA, were utilized as templates. The polymerase activity was sensitive to SH reagents. Fresh discs, which do not synthesize DNA in vivo, contained a significant amount of DNA polymerase and its activity increased linearly with time until 48 hr after slicing and became four times that of fresh discs after 72 hr, whereas the activity of DNA synthesis in vivo increased with time and decreased after reaching a maximum at 30 hr. Cycloheximide inhibited the enhancement of polymerase activity. DNA polymerase from aged and fresh discs had identical requirements for deoxynucleotides and a template in their reactions, sensitivity to SH reagent, and affinity to thymidine triphosphate. (auth.)
Interaction of the Sliding Clamp β-Subunit and Hda, a DnaA-Related Protein
Kurz, Mareike; Dalrymple, Brian; Wijffels, Gene; Kongsuwan, Kritaya
2004-01-01
In Escherichia coli, interactions between the replication initiation protein DnaA, the β subunit of DNA polymerase III (the sliding clamp protein), and Hda, the recently identified DnaA-related protein, are required to convert the active ATP-bound form of DnaA to an inactive ADP-bound form through the accelerated hydrolysis of ATP. This rapid hydrolysis of ATP is proposed to be the main mechanism that blocks multiple initiations during cell cycle and acts as a molecular switch from initiation...
A new insight into the interaction of ZnO with calf thymus DNA through surface defects.
Das, Sumita; Chatterjee, Sabyasachi; Pramanik, Srikrishna; Devi, Parukuttyamma Sujatha; Kumar, Gopinatha Suresh
2018-01-01
Experimental evidences on the binding interaction of ZnO and Calf Thymus (CT) DNA using several biophysical techniques are the centre of interest of the present study. The interaction of ZnO with CT DNA has been investigated in detail by absorption spectral study, fluorescence titration, Raman analysis, zeta potential measurement, viscometric experiment along with thermal melting study and microscopic analysis. Steady-state fluorescence study revealed the quenching (48%) of the surface defect related peak intensity of ZnO on interaction with DNA. The optimized concentration of ZnO and DNA to obtain this level of quenching has been found to be 0.049mM and 1.027μM, respectively. Additional fluorescence study with 8-hydroxy-5-quinoline (HQ) as a fluorescence probe for Zn 2+ ruled out the dissolution effect of ZnO under the experimental conditions. DNA conjugation on the surface of ZnO was also supported by Raman study. The quantitative variation in conductivity as well as electrophoretic mobility indicated significant interaction of ZnO with the DNA molecule. Circular dichroism (CD) and viscometry titrations provided clear evidence in support of the conformational retention of the DNA on interaction with ZnO. The binding interaction was found to be predominantly entropy driven in nature. The bio-physical studies presented in this paper exploring ZnO-CT DNA interaction could add a new horizon to understand the interaction between metal oxide and DNA. Copyright © 2017. Published by Elsevier B.V.
DNA binding and unwinding by Hel308 helicase requires dual functions of a winged helix domain.
Northall, Sarah J; Buckley, Ryan; Jones, Nathan; Penedo, J Carlos; Soultanas, Panos; Bolt, Edward L
2017-09-01
Hel308 helicases promote genome stability linked to DNA replication in archaea, and have homologues in metazoans. In the crystal structure of archaeal Hel308 bound to a tailed DNA duplex, core helicase domains encircle single-stranded DNA (ssDNA) in a "ratchet" for directional translocation. A winged helix domain (WHD) is also present, but its function is mysterious. We investigated the WHD in full-length Hel308, identifying that mutations in a solvent exposed α-helix resulted in reduced DNA binding and unwinding activities. When isolated from the rest of Hel308, the WHD protein alone bound to duplex DNA but not ssDNA, and DNA binding by WHD protein was abolished by the same mutations as were analyzed in full-length Hel308. Isolated WHD from a human Hel308 homologue (HelQ) also bound to duplex DNA. By disrupting the interface between the Hel308 WHD and a RecA-like domain, a topology typical of Ski2 helicases, we show that this is crucial for ATPase and helicase activities. The data suggest a model in which the WHD promotes activity of Hel308 directly, through binding to duplex DNA that is distinct from ssDNA binding by core helicase, and indirectly through interaction with the RecA-like domain. We propose how the WHD may contribute to ssDNA translocation, resulting in DNA helicase activity or in removal of other DNA bound proteins by "reeling" ssDNA. Copyright © 2017 Elsevier B.V. All rights reserved.
Rapid outer-surface protein C DNA tattoo vaccination protects against Borrelia afzelii infection.
Wagemakers, A; Mason, L M K; Oei, A; de Wever, B; van der Poll, T; Bins, A D; Hovius, J W R
2014-12-01
Borrelia afzelii is the predominant Borrelia species causing Lyme borreliosis in Europe. Currently there is no human vaccine against Lyme borreliosis, and most research focuses on recombinant protein vaccines against Borrelia burgdorferi sensu stricto. DNA tattooing is a novel vaccination method that can be applied in a rapid vaccination schedule. We vaccinated C3H/HeN mice with B. afzelii strain PKo OspC (outer-surface protein C) using a codon-optimized DNA vaccine tattoo and compared this with recombinant protein vaccination in a 0-2-4 week vaccination schedule. We also assessed protection by DNA tattoo in a 0-3-6 day schedule. DNA tattoo and recombinant OspC vaccination induced comparable total IgG responses, with a lower IgG1/IgG2a ratio after DNA tattoo. Two weeks after syringe-challenge with 5 × 10(5) B. afzelii spirochetes most vaccinated mice had negative B. afzelii tissue DNA loads and all were culture negative. Furthermore, DNA tattoo vaccination in a 0-3-6 day regimen also resulted in negative Borrelia loads and cultures after challenge. To conclude, DNA vaccination by tattoo was fully protective against B. afzelii challenge in mice in a rapid vaccination protocol, and induces a favorable humoral immunity compared to recombinant protein vaccination. Rapid DNA tattoo is a promising vaccination strategy against spirochetes.
Timely binding of IHF and Fis to DARS2 regulates ATP–DnaA production and replication initiation
Kasho, Kazutoshi; Fujimitsu, Kazuyuki; Matoba, Toshihiro; Oshima, Taku; Katayama, Tsutomu
2014-01-01
In Escherichia coli, the ATP-bound form of DnaA (ATP–DnaA) promotes replication initiation. During replication, the bound ATP is hydrolyzed to ADP to yield the ADP-bound form (ADP–DnaA), which is inactive for initiation. The chromosomal site DARS2 facilitates the regeneration of ATP–DnaA by catalyzing nucleotide exchange between free ATP and ADP bound to DnaA. However, the regulatory mechanisms governing this exchange reaction are unclear. Here, using in vitro reconstituted experiments, we show that two nucleoid-associated proteins, IHF and Fis, bind site-specifically to DARS2 to activate coordinately the exchange reaction. The regenerated ATP–DnaA was fully active in replication initiation and underwent DnaA–ATP hydrolysis. ADP–DnaA formed heteromultimeric complexes with IHF and Fis on DARS2, and underwent nucleotide dissociation more efficiently than ATP–DnaA. Consistently, mutant analyses demonstrated that specific binding of IHF and Fis to DARS2 stimulates the formation of ATP–DnaA production, thereby promoting timely initiation. Moreover, we show that IHF–DARS2 binding is temporally regulated during the cell cycle, whereas Fis only binds to DARS2 in exponentially growing cells. These results elucidate the regulation of ATP–DnaA and replication initiation in coordination with the cell cycle and growth phase. PMID:25378325
Timely binding of IHF and Fis to DARS2 regulates ATP-DnaA production and replication initiation.
Kasho, Kazutoshi; Fujimitsu, Kazuyuki; Matoba, Toshihiro; Oshima, Taku; Katayama, Tsutomu
2014-12-01
In Escherichia coli, the ATP-bound form of DnaA (ATP-DnaA) promotes replication initiation. During replication, the bound ATP is hydrolyzed to ADP to yield the ADP-bound form (ADP-DnaA), which is inactive for initiation. The chromosomal site DARS2 facilitates the regeneration of ATP-DnaA by catalyzing nucleotide exchange between free ATP and ADP bound to DnaA. However, the regulatory mechanisms governing this exchange reaction are unclear. Here, using in vitro reconstituted experiments, we show that two nucleoid-associated proteins, IHF and Fis, bind site-specifically to DARS2 to activate coordinately the exchange reaction. The regenerated ATP-DnaA was fully active in replication initiation and underwent DnaA-ATP hydrolysis. ADP-DnaA formed heteromultimeric complexes with IHF and Fis on DARS2, and underwent nucleotide dissociation more efficiently than ATP-DnaA. Consistently, mutant analyses demonstrated that specific binding of IHF and Fis to DARS2 stimulates the formation of ATP-DnaA production, thereby promoting timely initiation. Moreover, we show that IHF-DARS2 binding is temporally regulated during the cell cycle, whereas Fis only binds to DARS2 in exponentially growing cells. These results elucidate the regulation of ATP-DnaA and replication initiation in coordination with the cell cycle and growth phase. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Holland, Joseph G; Geiger, Franz M
2012-06-07
The binding of magnesium ions to surface-bound single-stranded oligonucleotides was studied under aqueous conditions using second harmonic generation (SHG) and atomic force microscopy (AFM). The effect of strand length on the number of Mg(II) ions bound and their free binding energy was examined for 5-, 10-, 15-, and 20-mers of adenine and guanine at pH 7, 298 K, and 10 mM NaCl. The binding free energies for adenine and guanine sequences were calculated to be -32.1(4) and -35.6(2) kJ/mol, respectively, and invariant with strand length. Furthermore, the ion density for adenine oligonucleotides did not change as strand length increased, with an average value of 2(1) ions/strand. In sharp contrast, guanine oligonucleotides displayed a linear relationship between strand length and ion density, suggesting that cooperativity is important. This data gives predictive capabilities for mixed strands of various lengths, which we exploit for 20-mers of adenines and guanines. In addition, the role sequence order plays in strands of hetero-oligonucleotides was examined for 5'-A(10)G(10)-3', 5'-(AG)(10)-3', and 5'-G(10)A(10)-3' (here the -3' end is chemically modified to bind to the surface). Although the free energy of binding is the same for these three strands (averaged to be -33.3(4) kJ/mol), the total ion density increases when several guanine residues are close to the 3' end (and thus close to the solid support substrate). To further understand these results, we analyzed the height profiles of the functionalized surfaces with tapping-mode atomic force microscopy (AFM). When comparing the average surface height profiles of the oligonucleotide surfaces pre- and post- Mg(II) binding, a positive correlation was found between ion density and the subsequent height decrease following Mg(II) binding, which we attribute to reductions in Coulomb repulsion and strand collapse once a critical number of Mg(II) ions are bound to the strand.
Torsional regulation of hRPA-induced unwinding of double-stranded DNA
De Vlaminck, I.; Vidic, I.; Van Loenhout, M.T.J.; Kanaar, R.; Lebbink, J.H.G.; Dekker, C.
2010-01-01
All cellular single-stranded (ss) DNA is rapidly bound and stabilized by single stranded DNA-binding proteins (SSBs). Replication protein A, the main eukaryotic SSB, is able to unwind double-stranded (ds) DNA by binding and stabilizing transiently forming bubbles of ssDNA. Here, we study the
TFIIIC bound DNA elements in nuclear organization and insulation.
Kirkland, Jacob G; Raab, Jesse R; Kamakaka, Rohinton T
2013-01-01
tRNA genes (tDNAs) have been known to have barrier insulator function in budding yeast, Saccharomyces cerevisiae, for over a decade. tDNAs also play a role in genome organization by clustering at sites in the nucleus and both of these functions are dependent on the transcription factor TFIIIC. More recently TFIIIC bound sites devoid of pol III, termed Extra-TFIIIC sites (ETC) have been identified in budding yeast and these sites also function as insulators and affect genome organization. Subsequent studies in Schizosaccharomyces pombe showed that TFIIIC bound sites were insulators and also functioned as Chromosome Organization Clamps (COC); tethering the sites to the nuclear periphery. Very recently studies have moved to mammalian systems where pol III genes and their associated factors have been investigated in both mouse and human cells. Short interspersed nuclear elements (SINEs) that bind TFIIIC, function as insulator elements and tDNAs can also function as both enhancer - blocking and barrier insulators in these organisms. It was also recently shown that tDNAs cluster with other tDNAs and with ETCs but not with pol II transcribed genes. Intriguingly, TFIIIC is often found near pol II transcription start sites and it remains unclear what the consequences of TFIIIC based genomic organization are and what influence pol III factors have on pol II transcribed genes and vice versa. In this review we provide a comprehensive overview of the known data on pol III factors in insulation and genome organization and identify the many open questions that require further investigation. This article is part of a Special Issue entitled: Transcription by Odd Pols. Copyright © 2012 Elsevier B.V. All rights reserved.
Ma, Jin-Liang; Yin, Bin-Cheng; Le, Huynh-Nhu; Ye, Bang-Ce
2015-06-17
We have developed a label-free method for sequence-specific DNA detection based on surface plasmon enhanced energy transfer (SPEET) process between fluorescent DNA/AgNC string and gold nanoparticles (AuNPs). DNA/AgNC string, prepared by a single-stranded DNA template encoded two emitter-nucleation sequences at its termini and an oligo spacer in the middle, was rationally designed to produce bright fluorescence emission. The proposed method takes advantage of two strategies. The first one is the difference in binding properties of single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA) toward AuNPs. The second one is SPEET process between fluorescent DNA/AgNC string and AuNPs, in which fluorescent DNA/AgNC string can be spontaneously adsorbed onto the surface of AuNPs and correspondingly AuNPs serve as "nanoquencher" to quench the fluorescence of DNA/AgNC string. In the presence of target DNA, the sensing probe hybridized with target DNA to form duplex DNA, leading to a salt-induced AuNP aggregation and subsequently weakened SPEET process between fluorescent DNA/AgNC string and AuNPs. A red-to-blue color change of AuNPs and a concomitant fluorescence increase were clearly observed in the sensing system, which had a concentration dependent manner with specific DNA. The proposed method achieved a detection limit of ∼2.5 nM, offering the following merits of simple design, convenient operation, and low experimental cost because of no chemical modification, organic dye, enzymatic reaction, or separation procedure involved.
Ponomaryova, Anastasia A; Rykova, Elena Yu; Cherdyntseva, Nadezda V; Skvortsova, Tatiana E; Dobrodeev, Alexey Yu; Zav'yalov, Alexander A; Bryzgalov, Leonid O; Tuzikov, Sergey A; Vlassov, Valentin V; Laktionov, Pavel P
2013-09-01
To date, aberrant DNA methylation has been shown to be one of the most common and early causes of malignant cell transformation and tumors of different localizations, including lung cancer. Cancer cell-specific methylated DNA has been found in the blood of cancer patients, indicating that cell-free DNA circulating in the blood (cirDNA) is a convenient tumor-associated DNA marker that can be used as a minimally invasive diagnostic test. In the current study, we investigated the methylation status in blood samples of 32 healthy donors and 60 lung cancer patients before and after treatment with neoadjuvant chemotherapy followed by total tumor resection. Using quantitative methylation-specific PCR, we found that the index of methylation (IM), calculated as IM = 100 × [copy number of methylated/(copy number of methylated + unmethylated gene)], for the RASSF1A and RARB2 genes in the cirDNA isolated from blood plasma and cell-surface-bound cirDNA was elevated 2- to 3-fold in lung cancer patients compared with healthy donors. Random forest classification tree model based on these variables combined (RARB2 and RASSF1A IM in both plasma and cell-surface-bound cirDNA) lead to NSCLC patients' and healthy subjects' differentiation with 87% sensitivity and 75% specificity. An association of increased IM values with an advanced stage of non-small-cell lung cancer was found for RARB2 but not for RASSF1A. Chemotherapy and total tumor resection resulted in a significant decrease in the IM for RARB2 and RASSF1A, in both cirDNA fractions, comparable to the IM level of healthy subjects. Importantly, a rise in the IM for RARB2 was detected in patients within the follow-up period, which manifested in disease relapse at 9 months, confirmed with instrumental and pathologic methods. Our data indicate that quantitative analysis of the methylation status of the RARB2 and RASSF1A tumor suppressor genes in both cirDNA fractions is a useful tool for lung cancer diagnostics, evaluation of cancer
Bacterial DNA of Ocean and Land on the Surface of the International Space Station.
Grebennikova, Tatiana
A.V. Syroeshkin2, T.V. Grebennikova1, E.V. Shubralova3, V.A. Shuvalov3, O.S. Tsygankov4, V.B. Lapshin2 1D. I. Ivanovsky Virology Institute, Moscow, Russia 2 Academician E. K. Fedorov Institute of Applied Geophysics, Moscow, Russia 3S.P. Korolev Rocket and Space Corporation «Energia» Korolev, Russia 4Central Research Institute of Machine Building, Korolev, Russia Existence of biological molecules as markers of microorganisms in the space environment has always attracted attention of researchers. There is great attention to the search for extraterrestrial life forms [Nicholson W.L. 2009, Kawaguchi Y. et al 2013], and as well as the coping mechanisms of living organisms in the interplanetary space [Hotchin J. et al 1965, Baranov V.M. 2009, Horneck G. et al 2010]. Experiments on American and Japanese segments of the International Space Station (ISS) over the different nature of resistance during prolonged stay in space were conducted [Scalzi G et al 2012, Wassmann M. et al 2012]. As a result of these experiments confirmed the possibility of preserving the viability of organisms in an open space for a long time. Consequence, became interested in the transfer of living matter from the stratosphere to near-Earth space [Smith D.J. 2013]. We hypothesized that viable forms, or at least, intact DNA can be transferred to the orbit of the ISS with the ascending branch of the global electric circuit. Samples of cosmic dust collected from the surface of the window of the ISS during the exit of an astronaut in space. Samples (washes with material of tampons and tampons) which were in vacuo, were analyzed for the presence of bacterial DNA by nested PCR using primers specific DNA genus Mycobacterium, the DNA of the strain of the genus Bacillus anthracis and DNA encoding the bacterial 16S ribosomal RNA after transportation of the samples to Earth. The results of amplification, followed by sequencing and phylogenetic analysis showed the presence in samples of cosmic dust DNA
Kneuer, C; Sameti, M; Bakowsky, U; Schiestel, T; Schirra, H; Schmidt, H; Lehr, C M
2000-01-01
Diverse polycationic polymers have been used as nonviral transfection agents. Here we report the ability of colloidal silica particles with covalently attached cationic surface modifications to transfect plasmid DNA in vitro and make an attempt to describe the structure of the resulting transfection complexes. In analogy to the terms lipoplex and polyplex, we propose to describe the nanoparticle-DNA complexes by the term "nanoplex". Three batches, Si10E, Si100E, and Si26H, sized between 10 and 100 nm and with zeta potentials ranging from +7 to +31 mV at pH 7.4 were evaluated. The galactosidase expression plasmid DNA pCMVbeta was immobilized on the particle surface and efficiently transfected Cos-1 cells. The transfection activity was accompanied by very low cytotoxicity, with LD(50) values in the milligrams per milliliter range. The most active batch, Si26H, was produced by modification of commercially available silica particles with N-(6-aminohexyl)-3-aminopropyltrimethoxysilane, yielding spherical nanoparticles with a mean diameter of 26 nm and a zeta potential of +31 mV at pH 7.4. Complexes of Si26H and pCMVbeta plasmid DNA formed at w/w ratios of 10 were most effective in promoting transfection of Cos-1 cells in the absence of serum. At this ratio, >90% of the DNA was associated with the particles, yielding nanoplexes with a net negative surface charge. When the transfection medium was supplemented with 10% serum, maximum gene expression was observed at a w/w ratio of 30, at which the resulting particle-DNA complexes possessed a positive surface charge. Transfection was strongly increased in the presence of 100 microM chloroquine in the incubation medium and reached approximately 30% of the efficiency of a 60 kDa polyethylenimine. In contrast to polyethylenimine, no toxicity was observed at the concentrations required. Atomic force microscopy of Si26H-DNA complexes revealed a spaghetti-meatball-like structure. The surface of complexes prepared at a w/w ratio of
Molecular dynamics simulations of the DNA interaction with metallic nanoparticles and TiO2 surfaces
International Nuclear Information System (INIS)
Kholmurodov, Kh.T.; Krasavin, E.A.; Dushanov, E.B.; Hassan, H.K.; Galal, A.; ElHabashy, H.A.; Sweilam, N.H.; Yasuoka, K.
2013-01-01
The understanding of the mechanism of DNA interactions and binding with metallic nanoparticles (NPs) and surfaces represents a great interest in today's medicine applications due to diagnostic and treatment of oncology diseases. Recent experimental and simulation studies involve the DNA interaction with highly localized proton beams or metallic NPs (such as Ag, Au, etc.), aimed at targeted cancer therapy through the injection of metal micro- or nanoparticles into the tumor tissue with consequent local microwave or laser heating. The effects of mutational structure changes in DNA and protein structures could result in destroying of native chemical (hydrogen) bonds or, on the contrary, creating of new bonds that do not normally exist there. The cause of such changes might be the alteration of one or several nucleotides (in DNA) or the substitution of specific amino acid residues (in proteins) that can lead to the essential structural destabilization or unfolding. At the atomic or molecular level, the replacement of one nucleotide by another (in DNA double helices) or replacement of one amino acid residue by another (in proteins) cause essential modifications of the molecular force fields of the environment that break locally important hydrogen bonds underlying the structural stability of the biological molecules. In this work, the molecular dynamics(MD) simulations were performed for four DNA models and the flexibilities of the purine and pyrimidine nucleotides during the interaction process with the metallic NPs and TiO 2 surface were clarified
Directory of Open Access Journals (Sweden)
Brian H. Carrick
2016-03-01
Full Text Available Isolation of endogenous proteins from Saccharomyces cerevisiae has been facilitated by inserting encoding polypeptide affinity tags at the C-termini of chromosomal open reading frames (ORFs using homologous recombination of DNA fragments. Tagged protein isolation is limited by a number of factors, including high cost of affinity resins for bulk isolation and low concentration of ligands on the resin surface, leading to low isolation efficiencies and trapping of contaminants. To address this, we have created a recombinant “CelTag” DNA construct from which PCR fragments can be created to easily tag C-termini of S. cerevisiae ORFs using selection for a nat1 marker. The tag has a C-terminal cellulose binding module to be used in the first affinity step. Microgranular cellulose is very inexpensive and has an effectively continuous ligand on its surface, allowing rapid, highly efficient purification with minimal background. Cellulose-bound proteins are released by specific cleavage of an included site for TEV protease, giving nearly pure product. The tag can be lifted from the recombinant DNA construct either with or without a 13x myc epitope tag between the target ORF and the TEV protease site. Binding of CelTag protein fusions to cellulose is stable to high salt, nonionic detergents, and 1 M urea, allowing stringent washing conditions to remove loosely associated components, as needed, before specific elution. It is anticipated that this reagent could allow isolation of protein complexes from large quantities of yeast extract, including soluble, membrane-bound, or nucleic acid-associated assemblies.
Directory of Open Access Journals (Sweden)
Guihong Wang
Full Text Available Smads, the homologs of Sma and MAD proteins, play a key role in gene expression regulation in the transforming growth factor-β (TGF-β signaling pathway. Recent experimental studies have revealed that Smad4/R-Smad heterodimers bound on DNA are energetically more favorable than homodimeric R-Smad/R-Smad complexes bound on DNA, which indicates that Smad4 might act as binding vehicle to cooperatively assemble with activated R-Smads on DNA in the nucleus. However, the details of interaction mechanism for cooperative recruitment of Smad4 protein to R-Smad proteins on DNA, and allosteric communication between the Smad4-DNA and R-Smad-DNA interfaces via DNA mediating are not yet clear so far.In the present work, we have constructed a series of Smadn+DNA+Smadn (n = 1, 3, 4 models and carried out molecular dynamics simulations, free energy calculations and DNA dynamics analysis for them to study the interaction properties of Smadn (n = 1, 3, 4 with DNA molecule.The results revealed that the binding of Smad4 protein to DNA molecule facilitates energetically the formation of the heteromeric Smad4+DNA+Smad1/3 complex by increasing the affinity of Smad1/3 with DNA molecule. Further investigations through the residue/base motion correlation and DNA dynamics analyses predicted that the binding of Smad4 protein to DNA molecule in the heteromeric Smad4+DNA+Smad1/3 model induces an allosteric communication from the Smad4-DNA interface to Smad1/Smad3-DNA interface via DNA base-pair helical motions, surface conformation changes and new hydrogen bond formations. The present work theoretically explains the mechanism of cooperative recruitment of Smad4 protein to Smad1/3 protein via DNA-mediated indirect readout mode in the nucleus.
Directory of Open Access Journals (Sweden)
Corentin Claeys Bouuaert
2017-05-01
Full Text Available Mlh1-Mlh3 (MutLγ is a mismatch repair factor with a central role in formation of meiotic crossovers, presumably through resolution of double Holliday junctions. MutLγ has DNA-binding, nuclease, and ATPase activities, but how these relate to one another and to in vivo functions are unclear. Here, we combine biochemical and genetic analyses to characterize Saccharomyces cerevisiae MutLγ. Limited proteolysis and atomic force microscopy showed that purified recombinant MutLγ undergoes ATP-driven conformational changes. In vitro, MutLγ displayed separable DNA-binding activities toward Holliday junctions (HJ and, surprisingly, single-stranded DNA (ssDNA, which was not predicted from current models. MutLγ bound DNA cooperatively, could bind multiple substrates simultaneously, and formed higher-order complexes. FeBABE hydroxyl radical footprinting indicated that the DNA-binding interfaces of MutLγ for ssDNA and HJ substrates only partially overlap. Most contacts with HJ substrates were located in the linker regions of MutLγ, whereas ssDNA contacts mapped within linker regions as well as the N-terminal ATPase domains. Using yeast genetic assays for mismatch repair and meiotic recombination, we found that mutations within different DNA-binding surfaces exert separable effects in vivo. For example, mutations within the Mlh1 linker conferred little or no meiotic phenotype but led to mismatch repair deficiency. Interestingly, mutations in the N-terminal domain of Mlh1 caused a stronger meiotic defect than mlh1Δ, suggesting that the mutant proteins retain an activity that interferes with alternative recombination pathways. Furthermore, mlh3Δ caused more chromosome missegregation than mlh1Δ, whereas mlh1Δ but not mlh3Δ partially alleviated meiotic defects of msh5Δ mutants. These findings illustrate functional differences between Mlh1 and Mlh3 during meiosis and suggest that their absence impinges on chromosome segregation not only via reduced
DNA of Dientamoeba fragilis detected within surface-sterilized eggs of Enterobius vermicularis.
Röser, Dennis; Nejsum, Peter; Carlsgart, Anne Josefine; Nielsen, Henrik Vedel; Stensvold, Christen Rune
2013-01-01
With no evidence of a cyst stage, the mode of transmission of Dientamoeba fragilis, an intestinal protozoon of common occurrence and suggested pathogenicity, is incompletely known. Numerous studies have suggested that eggs of intestinal nematodes, primarily Enterobius vermicularis (pinworm), can serve as vectors for D. fragilis, although attempts to culture D. fragilis from pinworm eggs have been unsuccessful and data from epidemiological studies on D. fragilis/pinworm co-infection have been conflicting. The aim of this study was to investigate whether we could detect D. fragilis DNA from pinworm eggs collected from routine diagnostic samples (cellophane tape) and surface-sterilised by hypochlorite. DNA was extracted from individual eggs and tested by PCR using D. fragilis- and E. vermicularis-specific primers; amplicons were sequenced for confirmation. In cellophane tape samples from 64 patients with unknown D. fragilis status we detected D. fragilis DNA in 12/238 (5%) eggs, and in a patient known to harbour D. fragilis we detected D. fragilis DNA in 39/99 (39%) eggs. The finding of D. fragilis DNA within eggs of E. vermicularis strongly supports the hypothesis of D. fragilis-transmission by pinworm and has implications for antimicrobial intervention as well as control and public health measures. Copyright © 2012 Elsevier Inc. All rights reserved.
Mechanisms of DNA Packaging by Large Double-Stranded DNA Viruses
Rao, Venigalla B.; Feiss, Michael
2016-01-01
Translocation of viral double-stranded DNA (dsDNA) into the icosahedral prohead shell is catalyzed by TerL, a motor protein that has ATPase, endonuclease, and translocase activities. TerL, following endonucleolytic cleavage of immature viral DNA concatemer recognized by TerS, assembles into a pentameric ring motor on the prohead’s portal vertex and uses ATP hydrolysis energy for DNA translocation. TerL’s N-terminal ATPase is connected by a hinge to the C-terminal endonuclease. Inchworm models propose that modest domain motions accompanying ATP hydrolysis are amplified, through changes in electrostatic interactions, into larger movements of the C-terminal domain bound to DNA. In phage φ29, four of the five TerL subunits sequentially hydrolyze ATP, each powering translocation of 2.5 bp. After one viral genome is encapsidated, the internal pressure signals termination of packaging and ejection of the motor. Current focus is on the structures of packaging complexes and the dynamics of TerL during DNA packaging, endonuclease regulation, and motor mechanics. PMID:26958920
Quantum Bound to Chaos and the Semiclassical Limit
Kurchan, Jorge
2018-06-01
We discuss the quantum bound on chaos in the context of the free propagation of a particle in an arbitrarily curved surface at low temperatures. The semiclassical calculation of the Lyapunov exponent can be performed in much the same way as the corresponding one for the `Loschmidt echo'. The bound appears here as the impossibility to scatter a wave, by effect of the curvature, over characteristic lengths smaller than the deBroglie wavelength.
The effects of indium-111 decay on pBR322 DNA
International Nuclear Information System (INIS)
Sahu, S.K.; Adelstein, S.J.; Makrigiorgos, G.M.; Baranowska-Kortylewicz, J.
1995-01-01
We have compared the effectiveness in causing DNA strand breaks of 111 In bound to DNA or free in aqueous solution with that of γ rays. Supercoiled DNA from pBR322 plasmid labeled with [ 3 H]thymidine was purified and mixed with 111 InCl 3 in the absence of presence of diethylenetriaminepentaacetic dianhydride (DTPA), a metal chelator which prevents the binding of indium to DNA. The reaction mixtures were stored at 4 degrees C to accumulate radiation dose from the decay of 111 In. The DNA was then resolved by gel electrophoresis into supercoiled, nicked circular and linear forms, representing undamaged DNA, single-strand breaks (SSBs) and double-strand breaks (DSBs), respectively. The D o values of pBR322 DNA exposed to γ radiation from an external 137 Cs source and the decay of 111 In dispersed in solution (+DTPA) are 3.1 ± 0.1 and 2.8 ± 0.1 Gy, respectively. In terms of accumulated 111 In disintegrations cm -3 of plasmid DNA solution, the D o value is 15.3 (± 0.7) x 10 10 disintegrations in the absence of DTPA and 38.2 (± 1.1) x 10 10 disintegrations in its presence. Since only 14.6 ± 5% of the 111 In was bound to DNA in the absence of DTPA, an effective D o for bound 111 In of 3.4 (± 1.1) x 10 10 disintegrations is obtained. The 11-fold (range 9- to 17-fold) increased effectiveness of this Auger electron emitter when in proximity to DNA appears to be due mainly to the higher yield of SSBs. 34 refs., 4 figs., 3 tabs
Inter-DNA Attraction Mediated by Divalent Counterions
International Nuclear Information System (INIS)
Qiu Xiangyun; Andresen, Kurt; Kwok, Lisa W.; Lamb, Jessica S.; Park, Hye Yoon; Pollack, Lois
2007-01-01
Can nonspecifically bound divalent counterions induce attraction between DNA strands? Here, we present experimental evidence demonstrating attraction between short DNA strands mediated by Mg 2+ ions. Solution small angle x-ray scattering data collected as a function of DNA concentration enable model independent extraction of the second virial coefficient. As the [Mg 2+ ] increases, this coefficient turns from positive to negative reflecting the transition from repulsive to attractive inter-DNA interaction. This surprising observation is corroborated by independent light scattering experiments. The dependence of the observed attraction on experimental parameters including DNA length provides valuable clues to its origin
Energy Technology Data Exchange (ETDEWEB)
Li, Xin; Deng, Jinchuan; Yuan, Shuheng; Wang, Juan; Luo, Rifang; Chen, Si [Key Lab. of Advanced Technology for Materials of Education Ministry, Southwest Jiaotong University, Chengdu 610031 (China); School of Material Science and Engineering, Southwest Jiaotong University, Chengdu 610031 (China); Wang, Jin, E-mail: jinxxwang@263.net [Key Lab. of Advanced Technology for Materials of Education Ministry, Southwest Jiaotong University, Chengdu 610031 (China); Huang, Nan [Key Lab. of Advanced Technology for Materials of Education Ministry, Southwest Jiaotong University, Chengdu 610031 (China); School of Material Science and Engineering, Southwest Jiaotong University, Chengdu 610031 (China)
2016-11-15
Highlights: • The dopamine/PEI film with controlled amine density was successfully prepared. • The DNA aptamer was assembled onto the film via electrostatic incorporation. • The A@DPfilmscanspecificallyandeffectivelycaptureEPCs. • The A@DP film can support the survival of ECs, control the hyperplasia of SMCs. • The dynamic/co-culture models are useful for studying cells competitive adhesion. - Abstract: Endothelial progenitor cells (EPCs) are mainly located in bone marrow and circulate, and play a crucial role in repairmen of injury endothelium. One of the most promising strategies of stents designs were considered to make in-situ endothelialization in vivo via EPC-capture biomolecules on a vascular graft to capture EPCs directly from circulatory blood. In this work, an EPC specific aptamer with a 34 bases single strand DNA sequence was conjugated onto the stent surface via dopamine/polyethyleneimine copolymer film as a platform and linker. The assembled density of DNA aptamer could be regulated by controlling dopamine percentage in this copolymer film. X-ray photoelectron spectroscopy (XPS), water contact angle (WCA) and fluorescence test confirmed the successful immobilization of DNA aptamer. To confirm its biofunctionality and cytocompatibility, the capturing cells ability of the aptamer modified surface and the effects on the growth behavior of human umbilical vein endothelial cells (HUVECs), smooth muscle cells (SMCs) were investigated. The aptamer functionalized sample revealed a good EPC-capture ability, and had a cellular friendly feature for both EPC and EC growth, while not stimulated the hyperplasia of SMCs. And, the co-culture experiment of three types of cells confirmed the specificity capturing of EPCs to aptamer modified surface, rather than ECs and SMCs. These data suggested that this aptamer functionalized surface may have a large potentiality for the application of vascular grafts with targeted endothelialization.
International Nuclear Information System (INIS)
Li, Xin; Deng, Jinchuan; Yuan, Shuheng; Wang, Juan; Luo, Rifang; Chen, Si; Wang, Jin; Huang, Nan
2016-01-01
Highlights: • The dopamine/PEI film with controlled amine density was successfully prepared. • The DNA aptamer was assembled onto the film via electrostatic incorporation. • The A@DPfilmscanspecificallyandeffectivelycaptureEPCs. • The A@DP film can support the survival of ECs, control the hyperplasia of SMCs. • The dynamic/co-culture models are useful for studying cells competitive adhesion. - Abstract: Endothelial progenitor cells (EPCs) are mainly located in bone marrow and circulate, and play a crucial role in repairmen of injury endothelium. One of the most promising strategies of stents designs were considered to make in-situ endothelialization in vivo via EPC-capture biomolecules on a vascular graft to capture EPCs directly from circulatory blood. In this work, an EPC specific aptamer with a 34 bases single strand DNA sequence was conjugated onto the stent surface via dopamine/polyethyleneimine copolymer film as a platform and linker. The assembled density of DNA aptamer could be regulated by controlling dopamine percentage in this copolymer film. X-ray photoelectron spectroscopy (XPS), water contact angle (WCA) and fluorescence test confirmed the successful immobilization of DNA aptamer. To confirm its biofunctionality and cytocompatibility, the capturing cells ability of the aptamer modified surface and the effects on the growth behavior of human umbilical vein endothelial cells (HUVECs), smooth muscle cells (SMCs) were investigated. The aptamer functionalized sample revealed a good EPC-capture ability, and had a cellular friendly feature for both EPC and EC growth, while not stimulated the hyperplasia of SMCs. And, the co-culture experiment of three types of cells confirmed the specificity capturing of EPCs to aptamer modified surface, rather than ECs and SMCs. These data suggested that this aptamer functionalized surface may have a large potentiality for the application of vascular grafts with targeted endothelialization.
Exposure of bus and taxi drivers to urban air pollutants as measured by DNA and protein adducts
DEFF Research Database (Denmark)
Hemminki, K.; Zhang, L.F.; Krüger, J.
1994-01-01
Urinary 1-hydroxypyrene, lymphocyte DNA adducts, serum protein-bound PAH and hemoglobin-bound alkene adducts were analysed from 4 groups of non-smoking men: urban and suburban bus drivers, taxi drivers and suburban controls. The only differences between the groups were in DNA adducts between...... suburban bus drivers and controls, and in DNA adduct and plasma protein PAH-adducts between taxi drivers and controls....
Surface-bound phosphatase activity in living hyphae of ectomycorrhizal fungi of Nothofagus obliqua.
Alvarez, Maricel; Godoy, Roberto; Heyser, Wolfgang; Härtel, Steffen
2004-01-01
We determined the location and the activity of surface-bound phosphomonoesterase (SBP) of five ectomycorrhizal (EM) fungi of Nothofagus oblique. EM fungal mycelium of Paxillus involutus, Austropaxillus boletinoides, Descolea antartica, Cenococcum geophilum and Pisolithus tinctorius was grown in media with varying concentrations of dissolved phosphorus. SBP activity was detected at different pH values (3-7) under each growth regimen. SBP activity was assessed using a colorimetric method based on the hydrolysis of p-nitrophenyl phosphate (pNPP) to p-nitrophenol phosphate (pNP) + P. A new technique involving confocal laser-scanning microscopy (LSM) was used to locate and quantify SBP activity on the hyphal surface. EM fungi showed two fundamentally different patterns of SBP activity in relation to varying environmental conditions (P-concentrations and pH). In the cases of D. antartica, A. boletinoides and C. geophilum, changes in SBP activity were induced primarily by changes in the number of SBP-active centers on the hyphae. In the cases of P. tinctorius and P. involutus, the number of SBP-active centers per μm hyphal length changed much less than the intensity of the SBP-active centers on the hyphae. Our findings not only contribute to the discussion about the role of SBP-active centers in EM fungi but also introduce LSM as a valuable method for studying EM fungi.
Cyclic GMP-AMP synthase is activated by double-stranded DNA-induced oligomerization.
Li, Xin; Shu, Chang; Yi, Guanghui; Chaton, Catherine T; Shelton, Catherine L; Diao, Jiasheng; Zuo, Xiaobing; Kao, C Cheng; Herr, Andrew B; Li, Pingwei
2013-12-12
Cyclic GMP-AMP synthase (cGAS) is a cytosolic DNA sensor mediating innate antimicrobial immunity. It catalyzes the synthesis of a noncanonical cyclic dinucleotide, 2',5' cGAMP, that binds to STING and mediates the activation of TBK1 and IRF-3. Activated IRF-3 translocates to the nucleus and initiates the transcription of the IFN-β gene. The structure of mouse cGAS bound to an 18 bp dsDNA revealed that cGAS interacts with dsDNA through two binding sites, forming a 2:2 complex. Enzyme assays and IFN-β reporter assays of cGAS mutants demonstrated that interactions at both DNA binding sites are essential for cGAS activation. Mutagenesis and DNA binding studies showed that the two sites bind dsDNA cooperatively and that site B plays a critical role in DNA binding. The structure of mouse cGAS bound to dsDNA and 2',5' cGAMP provided insight into the catalytic mechanism of cGAS. These results demonstrated that cGAS is activated by dsDNA-induced oligomerization. Copyright © 2013 Elsevier Inc. All rights reserved.
Czech Academy of Sciences Publication Activity Database
Homola, Jiří; Piliarik, Marek; Ladd, J.; Taylor, A.; Shaoyi, J.
2008-01-01
Roč. 80, č. 11 (2008), s. 4231-4236 ISSN 0003-2700 R&D Projects: GA AV ČR KAN200670701 Institutional research plan: CEZ:AV0Z20670512 Keywords : Surface plasmon resonance imaging * DNA-directed immobilization * protein array Subject RIV: JB - Sensors, Measurment, Regulation Impact factor: 5.712, year: 2008
A case study characterizing animal fecal sources in surface water using a mitochondrial DNA marker.
Bucci, John P; Shattuck, Michelle D; Aytur, Semra A; Carey, Richard; McDowell, William H
2017-08-01
Water quality impairment by fecal waste in coastal watersheds is a public health issue. The present study provided evidence for the use of a mitochondrial (mtDNA) marker to detect animal fecal sources in surface water. The accurate identification of fecal pollution is based on the notion that fecal microorganisms preferentially inhabit a host animal's gut environment. In contrast, mtDNA host-specific markers are inherent to eukaryotic host cells, which offers the advantage by detecting DNA from the host rather than its fecal bacteria. The present study focused on sampling water presumably from non-point sources (NPS), which can increase bacterial and nitrogen concentrations to receiving water bodies. Stream sampling sites located within the Piscataqua River Watershed (PRW), New Hampshire, USA, were sampled from a range of sites that experienced nitrogen inputs such as sewer and septic systems and suburban runoff. Three mitochondrial (mtDNA) gene marker assays (human, bovine, and canine) were tested from surface water. Nineteen sites were sampled during an 18-month period. Analyses of the combined single and multiplex assay results showed that the proportion of occurrence was highest for bovine (15.6%; n = 77) compared to canine (5.6%; n = 70) and human (5.7%; n = 107) mtDNA gene markers. For the human mtDNA marker, there was a statistically significant relationship between presence vs. absence and land use (Fisher's test p = 0.0031). This result was evident particularly for rural suburban septic, which showed the highest proportion of presence (19.2%) compared to the urban sewered (3.3%), suburban sewered (0%), and agricultural (0%) as well as forested septic (0%) sites. Although further testing across varied land use is needed, our study provides evidence for using the mtDNA marker in large watersheds.
Patel, Meera J; Bhatia, Lavesh; Yilmaz, Gulden; Biswas-Fiss, Esther E; Biswas, Subhasis B
2017-09-01
DnaA protein is the initiator of genomic DNA replication in prokaryotes. It binds to specific DNA sequences in the origin of DNA replication and unwinds small AT-rich sequences downstream for the assembly of the replisome. The mechanism of activation of DnaA that enables it to bind and organize the origin DNA and leads to replication initiation remains unclear. In this study, we have developed double-labeled fluorescent DnaA probes to analyze conformational states of DnaA protein upon binding DNA, nucleotide, and Soj sporulation protein using Fluorescence Resonance Energy Transfer (FRET). Our studies demonstrate that DnaA protein undergoes large conformational changes upon binding to substrates and there are multiple distinct conformational states that enable it to initiate DNA replication. DnaA protein adopted a relaxed conformation by expanding ~15Å upon binding ATP and DNA to form the ATP·DnaA·DNA complex. Hydrolysis of bound ATP to ADP led to a contraction of DnaA within the complex. The relaxed conformation of DnaA is likely required for the formation of the multi-protein ATP·DnaA·DNA complex. In the initiation of sporulation, Soj binding to DnaA prevented relaxation of its conformation. Soj·ADP appeared to block the activation of DnaA, suggesting a mechanism for Soj·ADP in switching initiation of DNA replication to sporulation. Our studies demonstrate that multiple conformational states of DnaA protein regulate its binding to DNA in the initiation of DNA replication. Copyright © 2017 Elsevier B.V. All rights reserved.
Residual DNA-bound proteins are a source of in vitro transcription inhibitor peptides
International Nuclear Information System (INIS)
Venanzi, F.M.
1989-01-01
Enzymatic breakdown of residual proteins occurs at mild alkaline pH (pH optimum 8.5) as monitored by using radioiodinated, purified genomic DNA from calf thymus. These DNA fibers also possess a differential ability to hydrolyze added exogenous small and linker histones. The results described argue strongly that a putative protease activity, co-purified with DNA, is the source of short chain peptides which inhibit transcription in vitro. Therefore, we propose that RNA repressor peptides must be of higher molecular weight than previously reported
Yang, Teng-Chieh; Maluf, Nasib Karl
2012-02-21
Human adenovirus (Ad) is an icosahedral, double-stranded DNA virus. Viral DNA packaging refers to the process whereby the viral genome becomes encapsulated by the viral particle. In Ad, activation of the DNA packaging reaction requires at least three viral components: the IVa2 and L4-22K proteins and a section of DNA within the viral genome, called the packaging sequence. Previous studies have shown that the IVa2 and L4-22K proteins specifically bind to conserved elements within the packaging sequence and that these interactions are absolutely required for the observation of DNA packaging. However, the equilibrium mechanism for assembly of IVa2 and L4-22K onto the packaging sequence has not been determined. Here we characterize the assembly of the IVa2 and L4-22K proteins onto truncated packaging sequence DNA by analytical sedimentation velocity and equilibrium methods. At limiting concentrations of L4-22K, we observe a species with two IVa2 monomers and one L4-22K monomer bound to the DNA. In this species, the L4-22K monomer is promoting positive cooperative interactions between the two bound IVa2 monomers. As L4-22K levels are increased, we observe a species with one IVa2 monomer and three L4-22K monomers bound to the DNA. To explain this result, we propose a model in which L4-22K self-assembly on the DNA competes with IVa2 for positive heterocooperative interactions, destabilizing binding of the second IVa2 monomer. Thus, we propose that L4-22K levels control the extent of cooperativity observed between adjacently bound IVa2 monomers. We have also determined the hydrodynamic properties of all observed stoichiometric species; we observe that species with three L4-22K monomers bound have more extended conformations than species with a single L4-22K bound. We suggest this might reflect a molecular switch that controls insertion of the viral DNA into the capsid.
Radioimmunological demonstration of DNA specific antibodies
Energy Technology Data Exchange (ETDEWEB)
Falck, P [Akademie der Wissenschaften der DDR, Berlin-Buch. Zentralinstitut fuer Isotopen- und Strahlenforschung
1976-01-01
Using /sup 125/I chemically labelled denatured (d) and native (n) DNA, specifically binding antibodies were demonstrated in the sera of Lupus erythemathodes patients by means of the Farr technique. (NH/sub 4/)/sub 2/SO/sub 4/ was used to separate the immunologically bound /sup 125/I-d-DNA. For /sup 125/I-n-DNA the use of a secondary antiserum for the precipitation of the primary immune complex is advantageous. The influence of antigen concentration upon the binding rate was studied. Titre determinations can be made with the proposed method.
DNA2—An Important Player in DNA Damage Response or Just Another DNA Maintenance Protein?
Directory of Open Access Journals (Sweden)
Elzbieta Pawłowska
2017-07-01
Full Text Available The human DNA2 (DNA replication helicase/nuclease 2 protein is expressed in both the nucleus and mitochondria, where it displays ATPase-dependent nuclease and helicase activities. DNA2 plays an important role in the removing of long flaps in DNA replication and long-patch base excision repair (LP-BER, interacting with the replication protein A (RPA and the flap endonuclease 1 (FEN1. DNA2 can promote the restart of arrested replication fork along with Werner syndrome ATP-dependent helicase (WRN and Bloom syndrome protein (BLM. In mitochondria, DNA2 can facilitate primer removal during strand-displacement replication. DNA2 is involved in DNA double strand (DSB repair, in which it is complexed with BLM, RPA and MRN for DNA strand resection required for homologous recombination repair. DNA2 can be a major protein involved in the repair of complex DNA damage containing a DSB and a 5′ adduct resulting from a chemical group bound to DNA 5′ ends, created by ionizing radiation and several anticancer drugs, including etoposide, mitoxantrone and some anthracyclines. The role of DNA2 in telomere end maintenance and cell cycle regulation suggests its more general role in keeping genomic stability, which is impaired in cancer. Therefore DNA2 can be an attractive target in cancer therapy. This is supported by enhanced expression of DNA2 in many cancer cell lines with oncogene activation and premalignant cells. Therefore, DNA2 can be considered as a potential marker, useful in cancer therapy. DNA2, along with PARP1 inhibition, may be considered as a potential target for inducing synthetic lethality, a concept of killing tumor cells by targeting two essential genes.
International Nuclear Information System (INIS)
Ljungman, M.
1991-01-01
To assess the influence of chromatin structure on the frequency of radiation-induced DNA strand breaks, the alkaline unwinding technique was applied to nuclear and nucleoid monolayers. These chromatin substrates were prepared by treating human fibroblasts grown as monolayers with the nonionic detergent Triton X-100 and varying concentrations of cations. The chromatin structure was modified either by a stepwise removal of DNA-bound proteins by extraction in increasing concentrations of monovalent salt, or by the addition or deletion of mono- and divalent cations to condense or decondense the chromatin, respectively. It was found that the stepwise removal of DNA-bound proteins from the chromatin dramatically increased the frequency of radiation-induced DNA strand breaks. The DNA-bound proteins showed a qualitative difference in their ability to protect the DNA where proteins removed by salt concentrations above 1.0 M exerted the greatest protection. Furthermore, the frequency of radiation-induced DNA strand breaks was found to be 6 times lower in condensed chromatin than in decondensed chromatin and about 80 times lower than in protein-depleted chromatin. It is concluded that the presence of DNA-bound proteins and the folding of the chromatin into higher-order structures protect the DNA against radiation-induced strand breaks
Energy Technology Data Exchange (ETDEWEB)
Lu, Chun-Mei; Wang, Mei; Greulich-Bode, Karin M.; Weier, Jingly F.; Weier, Heinz-Ulli G.
2008-01-28
Several hybridization-based methods used to delineate single copy or repeated DNA sequences in larger genomic intervals take advantage of the increased resolution and sensitivity of free chromatin, i.e., chromatin released from interphase cell nuclei. Quantitative DNA fiber mapping (QDFM) differs from the majority of these methods in that it applies FISH to purified, clonal DNA molecules which have been bound with at least one end to a solid substrate. The DNA molecules are then stretched by the action of a receding meniscus at the water-air interface resulting in DNA molecules stretched homogeneously to about 2.3 kb/{micro}m. When non-isotopically, multicolor-labeled probes are hybridized to these stretched DNA fibers, their respective binding sites are visualized in the fluorescence microscope, their relative distance can be measured and converted into kilobase pairs (kb). The QDFM technique has found useful applications ranging from the detection and delineation of deletions or overlap between linked clones to the construction of high-resolution physical maps to studies of stalled DNA replication and transcription.
Circuit lower bounds in bounded arithmetics
Czech Academy of Sciences Publication Activity Database
Pich, Ján
2015-01-01
Roč. 166, č. 1 (2015), s. 29-45 ISSN 0168-0072 R&D Projects: GA AV ČR IAA100190902 Keywords : bounded arithmetic * circuit lower bounds Subject RIV: BA - General Mathematics Impact factor: 0.582, year: 2015 http://www.sciencedirect.com/science/article/pii/S0168007214000888
Light-Triggered Release of DNA from Plasmon-Resonant Nanoparticles
Huschka, Ryan
Plasmon-resonant nanoparticle complexes show promising potential for lighttriggered, controllable delivery of deoxyribonucleic acids (DNA) for research and therapeutic purposes. For example, the approach of RNA interference (RNAi) . using antisense DNA or RNA oligonucleotides to silence activity of a specific pathogenic gene transcript and reduce expression of the encoded protein . is very useful in dissecting genetic function and holds promise as a molecular therapeutic. Herein, we investigate the mechanism and probe the in vitro therapeutic potential of DNA light-triggered release from plasmonic nanoparticles. First, we investigate the mechanism of light-triggered release by dehybridizing double-stranded (dsDNA) via laser illumination from two types of nanoparticle substrates: gold (Au) nanoshells and Au nanorods. Both light-triggered and thermally induced releases are distinctly observable from nanoshell-based complexes. Surprisingly, no analogous measurable light-triggered release was observable from nanorod-based complexes below the DNA melting temperature. These results suggest that a nonthermal mechanism may play a role in light-triggered DNA release. Second, we demonstrate the in vitro light-triggered release of molecules noncovalently attached within dsDNA bound to the Au nanoshell surface. DAPI (4',6- diamidino-2-phenylindole), a bright blue fluorescent molecule that binds reversibly to double-stranded DNA, was chosen to visualize this intracellular light-induced release process. Illumination through the cell membrane of the nanoshell-dsDNA-DAPI complexes dehybridizes the DNA and releases the DAPI molecules within living cells. The DAPI molecules diffuse to the nucleus and associate with the cell's endogenous DNA. This work could have future applications towards drug delivery of molecules that associate with dsDNA. Finally, we demonstrate an engineered Au nanoshell (AuNS)-based therapeutic oligonucleotide delivery vehicle, designed to release its cargo on
Prepolishing on a CNC platform with bound abrasive contour tools
Schoeffler, Adrienne E.; Gregg, Leslie L.; Schoen, John M.; Fess, Edward M.; Hakiel, Michael; Jacobs, Stephen D.
2003-05-01
Deterministic microgrinding (DMG) of optical glasses and ceramics is the commercial manufacturing process of choice to shape glass surfaces prior to final finishing. This process employs rigid bound matrix diamond tooling resulting in surface roughness values of 3-5μm peak to valley and 100-400nm rms, as well as mid-spatial frequency tool marks that require subsequent removal in secondary finishing steps. The ability to pre-polish optical surfaces within the grinding platform would reduce final finishing process times. Bound abrasive contour wheels containing cerium oxide, alumina or zirconia abrasives were constructed with an epoxy matrix. The effects of abrasive type, composition, and erosion promoters were examined for tool hardness (Shore D), and tested with commercial optical glasses in an Optipro CNC grinding platform. Metrology protocols were developed to examine tool wear and subsequent surface roughness. Work is directed to demonstrating effective material removal, improved surface roughness and cutter mark removal.
Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO
International Nuclear Information System (INIS)
Pal, Subrata; Maiti, Prabal K; Bagchi, Biman
2005-01-01
We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics
Tsai, Li-Chin; Lee, Cheng-Chang; Chen, Chun-Chieh; Lee, James Chun-I; Wang, Sheng-Meng; Huang, Nu-En; Linacre, Adrian; Hsieh, Hsing-Mei
2016-01-01
Fingerprints deposited at crime scene can be a source of DNA. Previous reports on the effects of fingerprint enhancement methods have focused mainly on fingermarks deposited in blood or saliva. Here, we evaluate the effects of fingerprint enhancement methods on fingerprints deposited on porous surfaces. We performed real-time quantification and STR typing, the results of which indicated that two methods (iodine fuming and 1,2-indanedione in ethyl acetate enhancement) had no effect on the quantity of DNA isolated and resultant STR alleles when compared to control samples. DNA quantities and allele numbers were lower for samples enhanced with silver nitrate and 1,2-indanedione in acetic acid when compared to control samples. Based on DNA quantity, quality, and observable stochastic effects, our data indicated that iodine fuming and 1,2-indanedione in ethyl acetate were the preferred options for the enhancement of fingerprints on porous surfaces. © 2015 American Academy of Forensic Sciences.
A novel fluorescent DNA sensor for ultrasensitive detection of Helicobacter pylori.
Liu, Ziping; Su, Xingguang
2017-01-15
In this work, a novel fluorescent DNA sensor for ultrasensitive detection of Helicobacter pylori (H. pylori) DNA was developed. This strategy took advantage of DNA hybridization between single-stranded DNA (ssDNA, which had been designed as an aptamer specific for H. pylori DNA) and the complementary target H. pylori DNA, and the feature that ssDNA bound to graphene oxide (GO) with significantly higher affinity than double-stranded DNA (dsDNA). ssDNA were firstly covalent conjugated with CuInS 2 quantum dots (QDs) by reaction between the carboxy group of QDs and amino group modified ssDNA, forming ssDNA-QDs genosensor. In the absence of the complementary target H. pylori DNA, GO could adsorb ssDNA-QDs DNA sensor and efficiently quench the fluorescence of ssDNA-QDs. While the complementary target H. pylori DNA was introduced, the ssDNA-QDs preferentially bound with the H. pylori DNA. The formation of dsDNA would alter the conformation of ssDNA and disturb the interaction between ssDNA and GO. Thus, the dsDNA-QDs/GO system exhibited a stronger fluorescence emission than that of the ssDNA-QDs/GO system. Under the optimized conditions, a linear correlation was established between the fluorescence intensity ratio I/I 0 and the concentration of H. pylori DNA in the range of 1.25-875pmolL -1 with a detection limit of 0.46pmolL -1 . The proposed method was applied to the determination of H. pylori DNA sequence in milk samples with satisfactory results. Copyright © 2016 Elsevier B.V. All rights reserved.
Wei, Xiangcong; Chen, Zhengbo; Tan, Lulu; Lou, Tianhong; Zhao, Yan
2017-01-03
A series of single-strand oligonucleotides functionalized catalytically active gold nanoparticle (AuNPs) as nonspecific receptors have been designed to build a protein sensing array. We take advantage of the correlation between the catalytic activity and the exposed surface area of AuNPs, i.e., DNA-proteins interactions mask the surface area of AuNPs, leading to poor catalytic performance of AuNPs. As the number of DNA-bound proteins increases, the surfaces of AuNPs become more masked; thus, the time of 4- nitrophenol/NaBH 4 reaction for color change (yellow → colorless) of the solution increases. Taking advantage of three nonspecific SH-labeled DNA sequences (A15, C15, and T15) as array sensing elements and the color-change time (CCT) of the solution as signal readout, colorimetric response patterns can be obtained on the array and identified via linear discriminant analysis (LDA). Eleven proteins have been completely distinguished with 100% accuracy with the naked eye at the 30 nM level. Remarkably, two similar proteins (bovine serum albumin and human serum albumin), two different proteins (bovine serum albumin and concanavalin) at the same concentration, and the mixtures of the two proteins with different molar ratios have been discriminated with 100%. The practicability of this sensor array is further validated by high accuracy (100%) identification of 11 proteins in human serum samples.
Okamoto, Akihiro; Kalathil, Shafeer; Deng, Xiao; Hashimoto, Kazuhito; Nakamura, Ryuhei; Nealson, Kenneth H
2014-07-11
The variety of solid surfaces to and from which microbes can deliver electrons by extracellular electron transport (EET) processes via outer-membrane c-type cytochromes (OM c-Cyts) expands the importance of microbial respiration in natural environments and industrial applications. Here, we demonstrate that the bifurcated EET pathway of OM c-Cyts sustains the diversity of the EET surface in Shewanella oneidensis MR-1 via specific binding with cell-secreted flavin mononucleotide (FMN) and riboflavin (RF). Microbial current production and whole-cell differential pulse voltammetry revealed that RF and FMN enhance EET as bound cofactors in a similar manner. Conversely, FMN and RF were clearly differentiated in the EET enhancement by gene-deletion of OM c-Cyts and the dependency of the electrode potential and pH. These results indicate that RF and FMN have specific binding sites in OM c-Cyts and highlight the potential roles of these flavin-cytochrome complexes in controlling the rate of electron transfer to surfaces with diverse potential and pH.
Kopka, Julieta; Leder, Monika; Jaureguiberry, Stella M; Brem, Gottfried; Boselli, Gabriel O
2011-09-01
Obtaining complete short tandem repeat (STR) profiles from fingerprints containing minimal amounts of DNA, using standard extraction techniques, can be difficult. The aim of this study was to evaluate a new kit, Fingerprint DNA Finder (FDF Kit), recently launched for the extraction of DNA and STR profiling from fingerprints placed on a special device known as Self-Adhesive Security Seal Sticker(®) and other latent fingerprints on forensic evidentiary material like metallic guns. The DNA extraction system is based on a reversal of the silica principle, and all the potential inhibiting substances are retained on the surface of a special adsorbent, while nucleic acids are not bound and remain in solution dramatically improving DNA recovery. DNA yield was quite variable among the samples tested, rendering in most of the cases (>90%) complete STR profiles, free of PCR inhibitors, and devoid of artifacts. Even samples with DNA amount below 100 pg could be successfully analyzed. © 2011 American Academy of Forensic Sciences.
Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.
2013-01-01
The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135
Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I
2013-03-29
The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.
International Nuclear Information System (INIS)
Sasou, Megumi; Sugiyama, Shigeru; Ishida, Takao; Ohtani, Toshio; Miyake, Koji
2009-01-01
Methyltrimethoxysilane (MTMS)-coupled mica substrate is reportedly suitable for fixing and straightening of DNA, but 3-aminopropyltriethoxysilane (APTES)-coupled mica substrate has been found less suitable. On MTMS-coupled mica substrate, the straightness of fixed DNA was sufficient, and the adsorption of contaminants was not observed using fluorescence microscopy and atomic force microscopy. For the APTES-coupled mica substrate, however, aggregated or curved DNA and adsorption of contaminants were observed. To clarify the surface factors that are responsible for this suitability, we analyzed the surface free energies of these substrates using the extended Fowkes theory. In each of the surface free energy components, the dispersion force component in the MTMS-coupled mica substrate was lower than that in the APTES-coupled mica substrate. The ratio of the polar force component on the MTMS-coupled mica substrate was about one order of magnitude on the APTES-coupled mica substrate. In addition, the ratio of the hydrogen-bonding force component for the MTMS-coupled mica substrate was about two times larger than that of the APTES-coupled mica substrate. These results suggest that the polar force and hydrogen-bonding force components are important factors for the fixation and straightening of DNA and that the dispersion force components influence the production and adsorption of contaminants.
Radiation damage to DNA in DNA-protein complexes.
Spotheim-Maurizot, M; Davídková, M
2011-06-03
The most aggressive product of water radiolysis, the hydroxyl (OH) radical, is responsible for the indirect effect of ionizing radiations on DNA in solution and aerobic conditions. According to radiolytic footprinting experiments, the resulting strand breaks and base modifications are inhomogeneously distributed along the DNA molecule irradiated free or bound to ligands (polyamines, thiols, proteins). A Monte-Carlo based model of simulation of the reaction of OH radicals with the macromolecules, called RADACK, allows calculating the relative probability of damage of each nucleotide of DNA irradiated alone or in complexes with proteins. RADACK calculations require the knowledge of the three dimensional structure of DNA and its complexes (determined by X-ray crystallography, NMR spectroscopy or molecular modeling). The confrontation of the calculated values with the results of the radiolytic footprinting experiments together with molecular modeling calculations show that: (1) the extent and location of the lesions are strongly dependent on the structure of DNA, which in turns is modulated by the base sequence and by the binding of proteins and (2) the regions in contact with the protein can be protected against the attack by the hydroxyl radicals via masking of the binding site and by scavenging of the radicals. 2011 Elsevier B.V. All rights reserved.
A versatile non-radioactive assay for DNA methyltransferase activity and DNA binding
Frauer, Carina; Leonhardt, Heinrich
2009-01-01
We present a simple, non-radioactive assay for DNA methyltransferase activity and DNA binding. As most proteins are studied as GFP fusions in living cells, we used a GFP binding nanobody coupled to agarose beads (GFP nanotrap) for rapid one-step purification. Immobilized GFP fusion proteins were subsequently incubated with different fluorescently labeled DNA substrates. The absolute amounts and molar ratios of GFP fusion proteins and bound DNA substrates were determined by fluorescence spectroscopy. In addition to specific DNA binding of GFP fusion proteins, the enzymatic activity of DNA methyltransferases can also be determined by using suicide DNA substrates. These substrates contain the mechanism-based inhibitor 5-aza-dC and lead to irreversible covalent complex formation. We obtained covalent complexes with mammalian DNA methyltransferase 1 (Dnmt1), which were resistant to competition with non-labeled canonical DNA substrates, allowing differentiation between methyltransferase activity and DNA binding. By comparison, the Dnmt1C1229W catalytic site mutant showed DNA-binding activity, but no irreversible covalent complex formation. With this assay, we could also confirm the preference of Dnmt1 for hemimethylated CpG sequences. The rapid optical read-out in a multi-well format and the possibility to test several different substrates in direct competition allow rapid characterization of sequence-specific binding and enzymatic activity. PMID:19129216
Steric Pressure among Membrane-Bound Polymers Opposes Lipid Phase Separation.
Imam, Zachary I; Kenyon, Laura E; Carrillo, Adelita; Espinoza, Isai; Nagib, Fatema; Stachowiak, Jeanne C
2016-04-19
Lipid rafts are thought to be key organizers of membrane-protein complexes in cells. Many proteins that interact with rafts have bulky polymeric components such as intrinsically disordered protein domains and polysaccharide chains. Therefore, understanding the interaction between membrane domains and membrane-bound polymers provides insights into the roles rafts play in cells. Multiple studies have demonstrated that high concentrations of membrane-bound polymeric domains create significant lateral steric pressure at membrane surfaces. Furthermore, our recent work has shown that lateral steric pressure at membrane surfaces opposes the assembly of membrane domains. Building on these findings, here we report that membrane-bound polymers are potent suppressors of membrane phase separation, which can destabilize lipid domains with substantially greater efficiency than globular domains such as membrane-bound proteins. Specifically, we created giant vesicles with a ternary lipid composition, which separated into coexisting liquid ordered and disordered phases. Lipids with saturated tails and poly(ethylene glycol) (PEG) chains conjugated to their head groups were included at increasing molar concentrations. When these lipids were sparse on the membrane surface they partitioned to the liquid ordered phase. However, as they became more concentrated, the fraction of GUVs that were phase-separated decreased dramatically, ultimately yielding a population of homogeneous membrane vesicles. Experiments and physical modeling using compositions of increasing PEG molecular weight and lipid miscibility phase transition temperature demonstrate that longer polymers are the most efficient suppressors of membrane phase separation when the energetic barrier to lipid mixing is low. In contrast, as the miscibility transition temperature increases, longer polymers are more readily driven out of domains by the increased steric pressure. Therefore, the concentration of shorter polymers required
DNA damage, homology-directed repair, and DNA methylation.
Directory of Open Access Journals (Sweden)
Concetta Cuozzo
2007-07-01
Full Text Available To explore the link between DNA damage and gene silencing, we induced a DNA double-strand break in the genome of Hela or mouse embryonic stem (ES cells using I-SceI restriction endonuclease. The I-SceI site lies within one copy of two inactivated tandem repeated green fluorescent protein (GFP genes (DR-GFP. A total of 2%-4% of the cells generated a functional GFP by homology-directed repair (HR and gene conversion. However, approximately 50% of these recombinants expressed GFP poorly. Silencing was rapid and associated with HR and DNA methylation of the recombinant gene, since it was prevented in Hela cells by 5-aza-2'-deoxycytidine. ES cells deficient in DNA methyl transferase 1 yielded as many recombinants as wild-type cells, but most of these recombinants expressed GFP robustly. Half of the HR DNA molecules were de novo methylated, principally downstream to the double-strand break, and half were undermethylated relative to the uncut DNA. Methylation of the repaired gene was independent of the methylation status of the converting template. The methylation pattern of recombinant molecules derived from pools of cells carrying DR-GFP at different loci, or from an individual clone carrying DR-GFP at a single locus, was comparable. ClustalW analysis of the sequenced GFP molecules in Hela and ES cells distinguished recombinant and nonrecombinant DNA solely on the basis of their methylation profile and indicated that HR superimposed novel methylation profiles on top of the old patterns. Chromatin immunoprecipitation and RNA analysis revealed that DNA methyl transferase 1 was bound specifically to HR GFP DNA and that methylation of the repaired segment contributed to the silencing of GFP expression. Taken together, our data support a mechanistic link between HR and DNA methylation and suggest that DNA methylation in eukaryotes marks homologous recombined segments.
Tethered particle analysis of supercoiled circular DNA using peptide nucleic acid handles.
Norregaard, Kamilla; Andersson, Magnus; Nielsen, Peter Eigil; Brown, Stanley; Oddershede, Lene B
2014-09-01
This protocol describes how to monitor individual naturally supercoiled circular DNA plasmids bound via peptide nucleic acid (PNA) handles between a bead and a surface. The protocol was developed for single-molecule investigation of the dynamics of supercoiled DNA, and it allows the investigation of both the dynamics of the molecule itself and of its interactions with a regulatory protein. Two bis-PNA clamps designed to bind with extremely high affinity to predetermined homopurine sequence sites in supercoiled DNA are prepared: one conjugated with digoxigenin for attachment to an anti-digoxigenin-coated glass cover slide, and one conjugated with biotin for attachment to a submicron-sized streptavidin-coated polystyrene bead. Plasmids are constructed, purified and incubated with the PNA handles. The dynamics of the construct is analyzed by tracking the tethered bead using video microscopy: less supercoiling results in more movement, and more supercoiling results in less movement. In contrast to other single-molecule methodologies, the current methodology allows for studying DNA in its naturally supercoiled state with constant linking number and constant writhe. The protocol has potential for use in studying the influence of supercoils on the dynamics of DNA and its associated proteins, e.g., topoisomerase. The procedure takes ~4 weeks.
Energy Technology Data Exchange (ETDEWEB)
Melnik, Eva [Health and Environment Department, Nano Systems, AIT Austrian Institute of Technology GmbH, Donau-City-Strasse 1, 1220 Vienna (Austria); Department of Analytical Chemistry, University of Vienna, Waehringer Strasse 38, 1090 Vienna (Austria); Bruck, Roman [Health and Environment Department, Nano Systems, AIT Austrian Institute of Technology GmbH, Donau-City-Strasse 1, 1220 Vienna (Austria); Hainberger, Rainer, E-mail: rainer.hainberger@ait.ac.at [Health and Environment Department, Nano Systems, AIT Austrian Institute of Technology GmbH, Donau-City-Strasse 1, 1220 Vienna (Austria); Laemmerhofer, Michael, E-mail: michael.laemmerhofer@univie.ac.at [Department of Analytical Chemistry, University of Vienna, Waehringer Strasse 38, 1090 Vienna (Austria)
2011-08-12
Highlights: {yields} We realize a biosensing platform for polyimide evanescent photonic wave sensors. {yields} We show that the surface functionalization via silanisation and biotinylation followed by streptavidin immobilization do not destroy or damage the thin polyimide film. {yields} A highly dense streptavidin layer enables the immobilisation of biotinylated ligands such as biotinylated ssDNA for the selective measurement of DNA hybridization. - Abstract: The process of surface functionalization involving silanization, biotinylation and streptavidin bonding as platform for biospecific ligand immobilization was optimized for thin film polyimide spin-coated silicon wafers, of which the polyimide film serves as a wave guiding layer in evanescent wave photonic biosensors. This type of optical sensors make great demands on the materials involved as well as on the layer properties, such as the optical quality, the layer thickness and the surface roughness. In this work we realized the binding of a 3-mercaptopropyl trimethoxysilane on an oxygen plasma activated polyimide surface followed by subsequent derivatization of the reactive thiol groups with maleimide-PEG{sub 2}-biotin and immobilization of streptavidin. The progress of the functionalization was monitored by using different fluorescence labels for optimization of the chemical derivatization steps. Further, X-ray photoelectron spectroscopy and atomic force microscopy were utilized for the characterization of the modified surface. These established analytical methods allowed to derive information like chemical composition of the surface, surface coverage with immobilized streptavidin, as well as parameters of the surface roughness. The proposed functionalization protocol furnished a surface density of 144 fmol mm{sup -2} streptavidin with good reproducibility (13.9% RSD, n = 10) and without inflicted damage to the surface. This surface modification was applied to polyimide based Mach-Zehnder interferometer
Conformational Analysis of DNA Repair Intermediates by Time-Resolved Fluorescence Spectroscopy
Lin, Su; Horning, David P.; Szostak, Jack W.; Chaput, John C.
2009-01-01
DNA repair enzymes are essential for maintaining the integrity of the DNA sequence. Unfortunately, very little is known about how these enzymes recognize damaged regions along the helix. Structural analysis of cellular repair enzymes bound to DNA reveals that these enzymes are able to recognize DNA in a variety of conformations. However, the prevalence of these deformations in the absence of enzymes remains unclear, as small populations of DNA conformations are often difficult to detect by NM...
Hda, a novel DnaA-related protein, regulates the replication cycle in Escherichia coli.
Kato , J; Katayama, T
2001-08-01
The bacterial DnaA protein binds to the chromosomal origin of replication to trigger a series of initiation reactions, which leads to the loading of DNA polymerase III. In Escherichia coli, once this polymerase initiates DNA synthesis, ATP bound to DnaA is efficiently hydrolyzed to yield the ADP-bound inactivated form. This negative regulation of DnaA, which occurs through interaction with the beta-subunit sliding clamp configuration of the polymerase, functions in the temporal blocking of re-initiation. Here we show that the novel DnaA-related protein, Hda, from E.coli is essential for this regulatory inactivation of DnaA in vitro and in vivo. Our results indicate that the hda gene is required to prevent over-initiation of chromosomal replication and for cell viability. Hda belongs to the chaperone-like ATPase family, AAA(+), as do DnaA and certain eukaryotic proteins essential for the initiation of DNA replication. We propose that the once-per-cell-cycle rule of replication depends on the timely interaction of AAA(+) proteins that comprise the apparatus regulating the activity of the initiator of replication.
DEFF Research Database (Denmark)
Register, JC; Christiansen, Gunna; Griffith, J
1987-01-01
examined by electron microscopy: supertwisted double-stranded (ds) DNA and linear single-stranded (ss) DNA, linear dsDNA and circular ssDNA, and linear dsDNA and colinear ssDNA. Several major observations were: (i) with RecA protein bound to the DNA, plectonemic joints were ultrastructurally...
International Nuclear Information System (INIS)
Cabeca, R; Rodrigues, M; Chu, V; Conde, J P; Prazeres, D M F
2009-01-01
Electric fields generated by single square and sinusoidal voltage pulses with amplitudes below 2 V were used to assist the covalent immobilization of single-stranded, thiolated DNA probes, onto a chemically functionalized SiO 2 surface and to assist the specific hybridization of single-stranded DNA targets with immobilized complementary probes. The single-stranded immobilized DNA probes were either covalently immobilized (chemisorption) or electrostatically adsorbed (physisorption) to a chemically functionalized surface. Comparing the speed of electric field assisted immobilization and hybridization with the corresponding control reactions (without electric field), an increase of several orders of magnitude is observed, with the reaction timescaled down from 1 to 2 h to a range between 100 ns and 1 ms. The influence of the shape of the voltage pulse (square versus sinusoidal) and its duration were studied for both immobilization and hybridization reactions. The results show that pulsed electric fields are a useful tool to achieve temporal and spatial control of surface immobilization and hybridization reactions of DNA.
Mohri, Mehryar; Rostamizadeh, Afshin
2013-01-01
We present a brief survey of existing mistake bounds and introduce novel bounds for the Perceptron or the kernel Perceptron algorithm. Our novel bounds generalize beyond standard margin-loss type bounds, allow for any convex and Lipschitz loss function, and admit a very simple proof.
DNA Topology and the Initiation of Virus DNA Packaging.
Directory of Open Access Journals (Sweden)
Choon Seok Oh
Full Text Available During progeny assembly, viruses selectively package virion genomes from a nucleic acid pool that includes host nucleic acids. For large dsDNA viruses, including tailed bacteriophages and herpesviruses, immature viral DNA is recognized and translocated into a preformed icosahedral shell, the prohead. Recognition involves specific interactions between the viral packaging enzyme, terminase, and viral DNA recognition sites. Generally, viral DNA is recognized by terminase's small subunit (TerS. The large terminase subunit (TerL contains translocation ATPase and endonuclease domains. In phage lambda, TerS binds a sequence repeated three times in cosB, the recognition site. TerS binding to cosB positions TerL to cut the concatemeric DNA at the adjacent nicking site, cosN. TerL introduces staggered nicks in cosN, generating twelve bp cohesive ends. Terminase separates the cohesive ends and remains bound to the cosB-containing end, in a nucleoprotein structure called Complex I. Complex I docks on the prohead's portal vertex and translocation ensues. DNA topology plays a role in the TerSλ-cosBλ interaction. Here we show that a site, I2, located between cosN and cosB, is critically important for an early DNA packaging step. I2 contains a complex static bend. I2 mutations block DNA packaging. I2 mutant DNA is cut by terminase at cosN in vitro, but in vivo, no cos cleavage is detected, nor is there evidence for Complex I. Models for what packaging step might be blocked by I2 mutations are presented.
Resonances and surface waves in bounded plasmas
International Nuclear Information System (INIS)
Bowers, K.J.; Qui, D.W.; Smith, H.B.; Birdsall, C.K.
1999-01-01
Surface waves provide a promising means of creating large, area plasmas. These waves can uniformly distribute the excitation energy and while presenting a small resistance and zero reactance to the driving source. Experimentally and in the simulations, the electron temperature is low (like 1--3 eV) as is the plasma potential (like 10 Te). The use of surface waves experimentally, and now industrially, to sustain large area plasma sources with device size is comparable to free space wavelength have motivated the authors to refine the theories of [1] and [2] to be fully electromagnetic. The wave dispersion predicted by the electromagnetic theory differs from the predictions of the prior theories and the results illuminate limitations of the electrostatic model. The use of surface waves have also motivated them to explore the mechanisms by which surface waves heat the plasma. In the 1d electrostatic simulations high velocity electron bunches are formed in the sheaths and are alternatively accelerated from each sheath into the bulk plasma each RF cycle. They speculate similar mechanisms provide the ionization in surface wave discharges. They also see in these simulations the plasma makes an abrupt transition from capacitively coupled to resistively coupled and the series resonance locks onto the drive frequency; these abrupt transitions resemble mode-jumping seen experimentally in large area sources. Furthermore, the density profile of the plasma tracks the drive frequency while in the resonant mode giving a new mechanism by which the plasma parameters can be controlled. They are currently investigating the effect of the driving electrode shape has on these resonances and conducting 2d simulations of a large area surface wave source to explore the ignition of surface wave devices and how the plasma fills in the device
DNA of Dientamoeba fragilis detected within surface-sterilized eggs of Enterobius vermicularis
DEFF Research Database (Denmark)
Röser, Dennis; Nejsum, Peter; Carlsgart, Anne Josefine
2013-01-01
With no evidence of a cyst stage, the mode of transmission of Dientamoeba fragilis, an intestinal protozoon of common occurrence and suggested pathogenicity, is incompletely known. Numerous studies have suggested that eggs of intestinal nematodes, primarily Enterobius vermicularis (pinworm), can...... serve as vectors for D. fragilis, although attempts to culture D. fragilis from pinworm eggs have been unsuccessful and data from epidemiological studies on D. fragilis/pinworm co-infection have been conflicting. The aim of this study was to investigate whether we could detect D. fragilis DNA from...... pinworm eggs collected from routine diagnostic samples (cellophane tape) and surface-sterilised by hypochlorite. DNA was extracted from individual eggs and tested by PCR using D. fragilis- and E. vermicularis-specific primers; amplicons were sequenced for confirmation. In cellophane tape samples from 64...
Zhang, Xirui; Daaboul, George G.; Spuhler, Philipp S.; Dröge, Peter; Ünlü, M. Selim
2016-03-01
results of other DNA sequences (Table 2S); calculation of dissociation constants (Fig. 3S, 4S; Table 2S); geometric model for quantitation of DNA bending angle induced by specific IHF binding (Fig. 4S); customized flow cell assembly (Fig. 5S); real-time measurement of average fluorophore height change by SSFM (Fig. 6S); summary of binding parameters obtained from additive isotherm model fitting (Table 3S); average surface densities of 10 dsDNA spots and bound IHF at equilibrium (Table 4S); effects of surface densities on the binding and bending of dsDNA (Tables 5S, 6S and Fig. 7S-10S). See DOI: 10.1039/c5nr06785e
Fajardo-Cavazos, Patricia; Schuerger, Andrew; Robles-Martinez, Jose; Douki, Thierry; Nicholson, Wayne
Joint NASA and ESA missions are planned for the next decade to investigate the possibility of present or past life on Mars [1]. Evidence of extraterrestrial life will likely rely on the de-tection of biomarkers, highlighting the importance of preventing forward contamination not only with viable microorganisms, but also with biomolecules that could compromise the valid-ity of life-detection experiments [2-4]. The designation of DNA as a high-priority biomarker makes it necessary to evaluate its persistence in extraterrestrial environments, and the effects of exposure on its biological activity. To accomplish this, we deposited naked DNA, cells and spores of Bacillus subtilis 168 or B. pumilus SAFR-032, or cells of Acinetobacter radioresistens 50v1 onto spacecraft-qualified aluminum coupons. Samples were exposed to a simulated Mars surface environment as described in detail previously [4, 5] for various periods of time, and DNA damage was assessed by a number of measurements. Double-and single-strand breaks were measured by neutral and alkaline agarose gel electrophoresis, and DNA bipyrimidine pho-toproducts were measured by HPLC-mass spectrometry, as described previously [6, 7]. Loss of functionality of DNA to serve as a template for replication by DNA polymerase was measured using a quantitative polymerase chain reaction (qPCR) assay [8]. In all cases, DNA damage was directly correlated with time of exposure to simulated martian solar radiation (UV, visible, and infrared wavelengths). Exposure of samples to Mars surface conditions, but shielded from solar radiation, did not result in appreciable damage over the time periods tested, relative to controls. DNA contained within cells or spores was much less susceptible to damage than was naked DNA. Using the qPCR assay, we found that inactivation of naked DNA or DNA extracted from exposed spores of B. subtilis followed a multiphasic dose-response, and that a fraction of DNA molecules retained functionality after
Chromatin-bound RNA and the neurobiology of psychiatric disease.
Tushir, J S; Akbarian, S
2014-04-04
A large, and still rapidly expanding literature on epigenetic regulation in the nervous system has provided fundamental insights into the dynamic regulation of DNA methylation and post-translational histone modifications in the context of neuronal plasticity in health and disease. Remarkably, however, very little is known about the potential role of chromatin-bound RNAs, including many long non-coding transcripts and various types of small RNAs. Here, we provide an overview on RNA-mediated regulation of chromatin structure and function, with focus on histone lysine methylation and psychiatric disease. Examples of recently discovered chromatin-bound long non-coding RNAs important for neuronal health and function include the brain-derived neurotrophic factor antisense transcript (Bdnf-AS) which regulates expression of the corresponding sense transcript, and LOC389023 which is associated with human-specific histone methylation signatures at the chromosome 2q14.1 neurodevelopmental risk locus by regulating expression of DPP10, an auxillary subunit for voltage-gated K(+) channels. We predict that the exploration of chromatin-bound RNA will significantly advance our current knowledge base in neuroepigenetics and biological psychiatry. Copyright © 2013 IBRO. Published by Elsevier Ltd. All rights reserved.
Hagen, Sebastian; Kate, Peter; Leyssner, Felix; Nandi, Dhananjay; Wolf, Martin; Tegeder, Petra
2008-10-01
Two-photon photoemission spectroscopy is employed to elucidate the electronic structure and the excitation mechanism in the photoinduced isomerization of the molecular switch tetra-tert-butyl-azobenzene (TBA) adsorbed on Au(111). Our results demonstrate that the optical excitation and the mechanism of molecular switching at a metal surface is completely different compared to the corresponding process for the free molecule. In contrast to direct (intramolecular) excitation operative in the isomerization in the liquid phase, the conformational change in the surface-bound TBA is driven by a substrate-mediated charge transfer process. We find that photoexcitation above a threshold hν ≈2.2 eV leads to hole formation in the Au d-band followed by a hole transfer to the highest occupied molecular orbital of TBA. This transiently formed positive ion resonance subsequently results in a conformational change. The photon energy dependent photoisomerization cross section exhibit an unusual shape for a photochemical reaction of an adsorbate on a metal surface. It shows a thresholdlike behavior below hν ≈2.2 eV and above hν ≈4.4 eV. These thresholds correspond to the minimum energy required to create single or multiple hot holes in the Au d-bands, respectively. This study provides important new insights into the use of light to control the structure and function of molecular switches in direct contact with metal electrodes.
International Nuclear Information System (INIS)
Hagen, Sebastian; Kate, Peter; Leyssner, Felix; Nandi, Dhananjay; Wolf, Martin; Tegeder, Petra
2008-01-01
Two-photon photoemission spectroscopy is employed to elucidate the electronic structure and the excitation mechanism in the photoinduced isomerization of the molecular switch tetra-tert-butyl-azobenzene (TBA) adsorbed on Au(111). Our results demonstrate that the optical excitation and the mechanism of molecular switching at a metal surface is completely different compared to the corresponding process for the free molecule. In contrast to direct (intramolecular) excitation operative in the isomerization in the liquid phase, the conformational change in the surface-bound TBA is driven by a substrate-mediated charge transfer process. We find that photoexcitation above a threshold hν≅2.2 eV leads to hole formation in the Au d-band followed by a hole transfer to the highest occupied molecular orbital of TBA. This transiently formed positive ion resonance subsequently results in a conformational change. The photon energy dependent photoisomerization cross section exhibit an unusual shape for a photochemical reaction of an adsorbate on a metal surface. It shows a thresholdlike behavior below hν≅2.2 eV and above hν≅4.4 eV. These thresholds correspond to the minimum energy required to create single or multiple hot holes in the Au d-bands, respectively. This study provides important new insights into the use of light to control the structure and function of molecular switches in direct contact with metal electrodes.
The holographic bound in the scalar-tensor and f(R) gravities
International Nuclear Information System (INIS)
Firouzjaee, J.T.
2013-01-01
The holographic bound has been extended to the different theory of gravities such as scalar-tensor gravity and f(R) gravity according to the Noether charge definition of the entropy for a black hole surface. We have introduced some popular examples of the flat FRW cosmology in order to investigate holographic bound in scalar-tensor and f(R) gravity. Using the holographic bound, we put an additional constraint on scalar-tensor gravity and the f(R) gravity parameters. We also discuss the transformation from Jordan frame to Einstein frame. (orig.)
Sánchez-Villalba, Esther; Arias, María Elena; Zambrano, Fabiola; Loren, Pía; Felmer, Ricardo
2018-02-01
Sperm-mediated gene transfer (SMGT) is a simple, fast, and economical biotechnological tool for producing transgenic animals. However, transgene expression with this technique in bovine embryos is still inefficient due to low uptake and binding of exogenous DNA in spermatozoa. The present study evaluated the effects of sperm membrane destabilization on the binding capacity, location and quantity of bound exogenous DNA in cryopreserved bovine spermatozoa using Triton X-100 (TX-100), lysolecithin (LL) and sodium hydroxide (NaOH). Effects of these treatments were also evaluated by intracytoplasmic sperm injection (ICSI)-SMGT. Results showed that all treatments bound exogenous DNA to spermatozoa including the control. Spermatozoa treated with different membrane destabilizing agents bound the exogenous DNA throughout the head and tail of spermatozoa, compared with the control, in which binding occurred mainly in the post-acrosomal region and tail. The amount of exogenous DNA bound to spermatozoa was much higher for the different sperm treatments than the control (P Exogenous gene expression in embryos was also improved by these treatments. These results demonstrated that sperm membrane destabilization could be a novel strategy in bovine SMGT protocols for the generation of transgenic embryos by ICSI.
Paramagnetic decoration of DNA origami nanostructures by Eu³⁺ coordination.
Opherden, Lars; Oertel, Jana; Barkleit, Astrid; Fahmy, Karim; Keller, Adrian
2014-07-15
The folding of DNA into arbitrary two- and three-dimensional shapes, called DNA origami, represents a powerful tool for the synthesis of functional nanostructures. Here, we present the first approach toward the paramagnetic functionalization of DNA origami nanostructures by utilizing postassembly coordination with Eu(3+) ions. In contrast to the usual formation of toroidal dsDNA condensates in the presence of trivalent cations, planar as well as rod-like DNA origami maintain their shape and monomeric state even under high loading with the trivalent lanthanide. Europium coordination was demonstrated by the change in Eu(3+) luminescence upon binding to the two DNA origami. Their natural circular dichroism in the Mg(2+)- and Eu(3+)-bound state was found to be very similar to that of genomic DNA, evidencing little influence of the DNA origami superstructure on the local chirality of the stacked base pairs. In contrast, the magnetic circular dichroism of the Mg(2+)-bound DNA origami deviates from that of genomic DNA. Furthermore, the lanthanide affects the magnetic properties of DNA in a superstructure-dependent fashion, indicative of the existence of superstructure-specific geometry of Eu(3+) binding sites in the DNA origami that are not formed in genomic DNA. This simple approach lays the foundation for the generation of magneto-responsive DNA origami nanostructures. Such systems do not require covalent modifications and can be used for the magnetic manipulation of DNA nanostructures or for the paramagnetic alignment of molecules in NMR spectroscopy.
Rapid purification of circular DNA by triplex-mediated affinity capture
Ji, H.; Smith, L.M.
1997-01-07
A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support. 3 figs.
Immobilization of proteins onto microbeads using a DNA binding tag for enzymatic assays.
Kojima, Takaaki; Mizoguchi, Takuro; Ota, Eri; Hata, Jumpei; Homma, Keisuke; Zhu, Bo; Hitomi, Kiyotaka; Nakano, Hideo
2016-02-01
A novel DNA-binding protein tag, scCro-tag, which is a single-chain derivative of the bacteriophage lambda Cro repressor, has been developed to immobilize proteins of interest (POI) on a solid support through binding OR consensus DNA (ORC) that is tightly bound by the scCro protein. The scCro-tag successfully bound a transglutaminase 2 (TGase 2) substrate and manganese peroxidase (MnP) to microbeads via scaffolding DNA. The resulting protein-coated microbeads can be utilized for functional analysis of the enzymatic activity using flow cytometry. The quantity of bead-bound proteins can be enhanced by increasing the number of ORCs. In addition, proteins with the scCro-tag that were synthesized using a cell-free protein synthesis system were also immobilized onto the beads, thus indicating that this bead-based system would be applicable to high-throughput analysis of various enzymatic activities. Copyright © 2015 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Pre-polishing on a CNC platform with bound abrasive contour tools
Schoeffer, Adrienne E.
2003-05-01
Deterministic micorgrinding (DMG) of optical glasses and ceramics is the commercial manufacturing process of choice to shape glass surfaces prior to final finishing. This process employs rigid bound matrix diamond tooling resulting in surface roughness values of 3-51.tm peak to valley and 100-400nm rms, as well as mid-spatial frequency tool marks that require subsequent removal in secondary finishing steps. The ability to pre-polish optical surfaces within the grinding platform would reduce final finishing process times. Bound abrasive contour wheels containing cerium oxide, alumina or zirconia abrasives were constructed with an epoxy matrix. The effects of abrasive type, composition, and erosion promoters were examined for tool hardness (Shore D), and tested with commercial optical glasses in an OptiproTM CNC grinding platform. Metrology protocols were developed to examine tool wear and subsequent surface roughness. Work is directed to demonstrating effective material removal, improved surface roughness and cutter mark removal.
Adams, Alice; Lindahl, Tomas; Klein, George
1973-01-01
High-molecular-weight DNA from cell line Raji (derived from Burkitt's lymphoma), which contains 50-60 copies of Epstein-Barr virus DNA per cell, was fractionated in neutral solution by several cycles of CsCl gradient centrifugation in fixed-angle rotors. Under the fractionation conditions used, intact Epstein-Barr virus DNA from virus particles can be separated from the less-dense cellular DNA. In contrast, a large proportion of the intrinsic Epstein-Barr virus DNA component of Raji cells remains associated with cellular DNA, as determined by nucleic acid hybridization. This interaction, which is resistant to Pronase and phenol treatment, is not the result of aggregation. When the molecular weight of Raji DNA is reduced by hydrodynamic shear, the amount of virus DNA associated with cell DNA decreases. However, some virus DNA still remains bound to fragments of cellular DNA after shearing. The association is completely destroyed in alkaline solution. Molecular weight analysis of Raji DNA after denaturation showed that the alkali-induced release of Epstein-Barr virus DNA was specific and not the result of random single-strand breaks. These data indicate that Epstein-Barr virus DNA is linearly integrated into Raji cell DNA by alkali-labile bonds. PMID:4355371
Barut, Burak; Demirbaş, Ümit; Özel, Arzu; Kantekin, Halit
2017-12-01
In this study, novel peripherally tetra 3-morpholinophenol substituted zinc(II) phthalocyanine (4) and its water soluble form quaternized zinc(II) phthalocyanine (ZnQ) were synthesized for the first time. These novel compounds were characterized by a combination of different spectroscopic techniques such as FT-IR, 1 H NMR, 13 C NMR, UV-vis and mass. The DNA binding of ZnQ was investigated using UV-vis absorption titration, competitive ethidium bromide, thermal denaturation and viscosity experiments that the ZnQ bound to CT-DNA via intercalation mode. ZnQ indicated photocleavage activity on supercoiled pBR322 plasmid DNA via formation of singlet oxygen under irradiation at 700nm. Besides, the topoisomerase I inhibitory effect experiments showed that ZnQ inhibited topoisomerase I enzyme in a concentration-dependent manner. The bovine serum albumin (BSA) binding experiments indicated that ZnQ bound to proteins through a static quenching mechanism. All of these results claim that ZnQ has potential agent for photodynamic therapy owing to its nucleic acid interactions and photobiological or photochemical properties. Copyright © 2017 Elsevier B.V. All rights reserved.
Pereira, L A; van der Knaap, J A; van den Boom, V; van den Heuvel, F A; Timmers, H T
2001-11-01
The human RNA polymerase II transcription factor B-TFIID consists of TATA-binding protein (TBP) and the TBP-associated factor (TAF) TAF(II)170 and can rapidly redistribute over promoter DNA. Here we report the identification of human TBP-binding regions in human TAF(II)170. We have defined the TBP interaction domain of TAF(II)170 within three amino-terminal regions: residues 2 to 137, 290 to 381, and 380 to 460. Each region contains a pair of Huntington-elongation-A subunit-Tor repeats and exhibits species-specific interactions with TBP family members. Remarkably, the altered-specificity TBP mutant (TBP(AS)) containing a triple mutation in the concave surface is defective for binding the TAF(II)170 amino-terminal region of residues 1 to 504. Furthermore, within this region the TAF(II)170 residues 290 to 381 can inhibit the interaction between Drosophila TAF(II)230 (residues 2 to 81) and TBP through competition for the concave surface of TBP. Biochemical analyses of TBP binding to the TATA box indicated that TAF(II)170 region 290-381 inhibits TBP-DNA complex formation. Importantly, the TBP(AS) mutant is less sensitive to TAF(II)170 inhibition. Collectively, our results support a mechanism in which TAF(II)170 induces high-mobility DNA binding by TBP through reversible interactions with its concave DNA binding surface.
Camara, Johanna E; Breier, Adam M; Brendler, Therese; Austin, Stuart; Cozzarelli, Nicholas R; Crooke, Elliott
2005-08-01
Initiation of DNA replication from the Escherichia coli chromosomal origin is highly regulated, assuring that replication occurs precisely once per cell cycle. Three mechanisms for regulation of replication initiation have been proposed: titration of free DnaA initiator protein by the datA locus, sequestration of newly replicated origins by SeqA protein and regulatory inactivation of DnaA (RIDA), in which active ATP-DnaA is converted to the inactive ADP-bound form. DNA microarray analyses showed that the level of initiation in rapidly growing cells that lack datA was indistinguishable from that in wild-type cells, and that the absence of SeqA protein caused only a modest increase in initiation, in agreement with flow-cytometry data. In contrast, cells lacking Hda overinitiated replication twofold, implicating RIDA as the predominant mechanism preventing extra initiation events in a cell cycle.
Energy Technology Data Exchange (ETDEWEB)
Roncaratti, L. F., E-mail: lz@fis.unb.br; Leal, L. A.; Silva, G. M. de [Instituto de Física, Universidade de Brasília, 70910 Brasília (Brazil); Pirani, F. [Dipartimento di Chimica, Biologia e Biotecnologie, Università di Perugia, 06123 Perugia (Italy); Aquilanti, V. [Dipartimento di Chimica, Biologia e Biotecnologie, Università di Perugia, 06123 Perugia (Italy); Instituto de Física, Universidade Federal da Bahia, 40210 Salvador (Brazil); Gargano, R. [Instituto de Física, Universidade de Brasília, 70910 Brasília (Brazil); Departments of Chemistry and Physics, University of Florida, Quantum Theory Project, Gainesville, Florida 32611 (United States)
2014-10-07
We consider the analytical representation of the potential energy surfaces of relevance for the intermolecular dynamics of weakly bound complexes of chiral molecules. In this paper we study the H{sub 2}O{sub 2}−Ng (Ng=He, Ne, Ar, Kr, and Xe) systems providing the radial and the angular dependence of the potential energy surface on the relative position of the Ng atom. We accomplish this by introducing an analytical representation which is able to fit the ab initio energies of these complexes in a wide range of geometries. Our analysis sheds light on the role that the enantiomeric forms and the symmetry of the H{sub 2}O{sub 2} molecule play on the resulting barriers and equilibrium geometries. The proposed theoretical framework is useful to study the dynamics of the H{sub 2}O{sub 2} molecule, or other systems involving O–O and S–S bonds, interacting by non-covalent forces with atoms or molecules and to understand how the relative orientation of the O–H bonds changes along collisional events that may lead to a hydrogen bond formation or even to selectivity in chemical reactions.
Electron accommodation dynamics in the DNA base thymine
King, Sarah B.; Stephansen, Anne B.; Yokoi, Yuki; Yandell, Margaret A.; Kunin, Alice; Takayanagi, Toshiyuki; Neumark, Daniel M.
2015-07-01
The dynamics of electron attachment to the DNA base thymine are investigated using femtosecond time-resolved photoelectron imaging of the gas phase iodide-thymine (I-T) complex. An ultraviolet pump pulse ejects an electron from the iodide and prepares an iodine-thymine temporary negative ion that is photodetached with a near-IR probe pulse. The resulting photoelectrons are analyzed with velocity-map imaging. At excitation energies ranging from -120 meV to +90 meV with respect to the vertical detachment energy (VDE) of 4.05 eV for I-T, both the dipole-bound and valence-bound negative ions of thymine are observed. A slightly longer rise time for the valence-bound state than the dipole-bound state suggests that some of the dipole-bound anions convert to valence-bound species. No evidence is seen for a dipole-bound anion of thymine at higher excitation energies, in the range of 0.6 eV above the I-T VDE, which suggests that if the dipole-bound anion acts as a "doorway" to the valence-bound anion, it only does so at excitation energies near the VDE of the complex.
Electron accommodation dynamics in the DNA base thymine
Energy Technology Data Exchange (ETDEWEB)
King, Sarah B.; Yandell, Margaret A.; Kunin, Alice [Department of Chemistry, University of California, Berkeley, California 94720 (United States); Stephansen, Anne B. [Department of Chemistry, University of Copenhagen, Universitetsparken 5, DK-2100 København Ø (Denmark); Yokoi, Yuki; Takayanagi, Toshiyuki [Department of Chemistry, Saitama University, 255 Shimo-Okubo, Sakura-ku, Saitama City, Saitama 338-8570 (Japan); Neumark, Daniel M., E-mail: dneumark@berkeley.edu [Department of Chemistry, University of California, Berkeley, California 94720 (United States); Chemical Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, California 94720 (United States)
2015-07-14
The dynamics of electron attachment to the DNA base thymine are investigated using femtosecond time-resolved photoelectron imaging of the gas phase iodide-thymine (I{sup −}T) complex. An ultraviolet pump pulse ejects an electron from the iodide and prepares an iodine-thymine temporary negative ion that is photodetached with a near-IR probe pulse. The resulting photoelectrons are analyzed with velocity-map imaging. At excitation energies ranging from −120 meV to +90 meV with respect to the vertical detachment energy (VDE) of 4.05 eV for I{sup −}T, both the dipole-bound and valence-bound negative ions of thymine are observed. A slightly longer rise time for the valence-bound state than the dipole-bound state suggests that some of the dipole-bound anions convert to valence-bound species. No evidence is seen for a dipole-bound anion of thymine at higher excitation energies, in the range of 0.6 eV above the I{sup −}T VDE, which suggests that if the dipole-bound anion acts as a “doorway” to the valence-bound anion, it only does so at excitation energies near the VDE of the complex.
Two high-mobility group box domains act together to underwind and kink DNA
Energy Technology Data Exchange (ETDEWEB)
Sánchez-Giraldo, R.; Acosta-Reyes, F. J. [Universitat Politecnica de Catalunya, 08028 Barcelona (Spain); Malarkey, C. S. [University of Colorado School of Medicine, Aurora, CO 80045 (United States); Saperas, N. [Universitat Politecnica de Catalunya, 08028 Barcelona (Spain); Churchill, M. E. A., E-mail: mair.churchill@ucdenver.edu [University of Colorado School of Medicine, Aurora, CO 80045 (United States); Campos, J. L., E-mail: mair.churchill@ucdenver.edu [Universitat Politecnica de Catalunya, 08028 Barcelona (Spain)
2015-06-30
The crystal structure of HMGB1 box A bound to an unmodified AT-rich DNA fragment is reported at a resolution of 2 Å. A new mode of DNA recognition for HMG box proteins is found in which two box A domains bind in an unusual configuration generating a highly kinked DNA structure. High-mobility group protein 1 (HMGB1) is an essential and ubiquitous DNA architectural factor that influences a myriad of cellular processes. HMGB1 contains two DNA-binding domains, box A and box B, which have little sequence specificity but have remarkable abilities to underwind and bend DNA. Although HMGB1 box A is thought to be responsible for the majority of HMGB1–DNA interactions with pre-bent or kinked DNA, little is known about how it recognizes unmodified DNA. Here, the crystal structure of HMGB1 box A bound to an AT-rich DNA fragment is reported at a resolution of 2 Å. Two box A domains of HMGB1 collaborate in an unusual configuration in which the Phe37 residues of both domains stack together and intercalate the same CG base pair, generating highly kinked DNA. This represents a novel mode of DNA recognition for HMGB proteins and reveals a mechanism by which structure-specific HMG boxes kink linear DNA.
Two high-mobility group box domains act together to underwind and kink DNA
International Nuclear Information System (INIS)
Sánchez-Giraldo, R.; Acosta-Reyes, F. J.; Malarkey, C. S.; Saperas, N.; Churchill, M. E. A.; Campos, J. L.
2015-01-01
The crystal structure of HMGB1 box A bound to an unmodified AT-rich DNA fragment is reported at a resolution of 2 Å. A new mode of DNA recognition for HMG box proteins is found in which two box A domains bind in an unusual configuration generating a highly kinked DNA structure. High-mobility group protein 1 (HMGB1) is an essential and ubiquitous DNA architectural factor that influences a myriad of cellular processes. HMGB1 contains two DNA-binding domains, box A and box B, which have little sequence specificity but have remarkable abilities to underwind and bend DNA. Although HMGB1 box A is thought to be responsible for the majority of HMGB1–DNA interactions with pre-bent or kinked DNA, little is known about how it recognizes unmodified DNA. Here, the crystal structure of HMGB1 box A bound to an AT-rich DNA fragment is reported at a resolution of 2 Å. Two box A domains of HMGB1 collaborate in an unusual configuration in which the Phe37 residues of both domains stack together and intercalate the same CG base pair, generating highly kinked DNA. This represents a novel mode of DNA recognition for HMGB proteins and reveals a mechanism by which structure-specific HMG boxes kink linear DNA
Ivanovic, V; Geacintov, N E; Jeffrey, A M; Fu, P P; Harvey, R G; Weinstein, I B
1978-03-01
Fluorescence spectra of DNA isolated from hamster embryo cells incubated with 7,12-dimethylbenz(a)anthracene, or DNA modified in a microsomal system by reaction with this carcinogen or its 7-hydroxymethyl derivative, were compared to various model compounds. The spectra indicate that the DMBA derivative bound to DNA, in all 3 cases, has a 9,10-dimethylanthracene-like chromophore. They also provide the first evidence of the similarity in structure of the DNA-bound products between 7,12-dimethylbenz(a)anthracene and its 7-hydroxymethyl derivative. Our results are consistent with an activation mechanism that involves saturation of the 1,2,3,4-ring positions.
Energy Technology Data Exchange (ETDEWEB)
Wani, A A; Gibson-D' Ambrosio, R E; D' Ambrosio, S M [Ohio State Univ., Columbus (USA). Dept. of Radiology
1984-10-01
The enzyme-linked immunosorbant assay (ELISA) was modified to (1) characterize antibodies raised in rabbits against UV-irradiated single-stranded DNA (UVssDNA) complexed with methylated BSA and (2) directly detect pyrimidine dimers in irradiated DNA. The antisera specifically bound to UVssDNA, UVpoly(dT) and to a limited extent to UVdsDNA and UVpoly(dC). Fifty per cent of the maximum antibody binding was observed at a 1-5000 dilution against UVssDNA. Binding to ssDNA and poly(dT) was observed only at much higher concentrations of antibody, whereas no binding to double stranded DNA (dsDNA) was observed. The extent of binding of the antibody was dependent on the UV dose to DNA and the concentration of antigen immobilized on the plate. The ability of various irradiated molecules, DNA, homopolymers and linkers to act as inhibitors of antibody binding establishes that the antigenic determinants are mainly thymine homodimers with lower affinity for cytosine dimers. Potential usefulness of the antibodies to directly quantitate pyrimidine dimers in cells exposed to UV radiation was determined by indirect immunofluorescence. Flow cytometric analysis of immunostained human lymphocytes irradiated with 254 nm radiation indicated that greater than 50% of the population had significantly higher fluorescent intensity than unirradiated cells.
Muntean, Cristina M; Leopold, Nicolae; Tripon, Carmen; Coste, Ana; Halmagyi, Adela
2015-06-05
In this work the surface-enhanced Raman scattering (SERS) spectra of five genomic DNAs from non-cryopreserved control tomato plants (Lycopersicon esculentum Mill. cultivars Siriana, Darsirius, Kristin, Pontica and Capriciu) respectively, have been analyzed in the wavenumber range 400-1800 cm(-1). Structural changes induced in genomic DNAs upon cryopreservation were discussed in detail for four of the above mentioned tomato cultivars. The surface-enhanced Raman vibrational modes for each of these cases, spectroscopic band assignments and structural interpretations of genomic DNAs are reported. We have found, that DNA isolated from Siriana cultivar leaf tissues suffers the weakest structural changes upon cryogenic storage of tomato shoot apices. On the contrary, genomic DNA extracted from Pontica cultivar is the most responsive system to cryopreservation process. Particularly, both C2'-endo-anti and C3'-endo-anti conformations have been detected. As a general observation, the wavenumber range 1511-1652 cm(-1), being due to dA, dG and dT residues seems to be influenced by cryopreservation process. These changes could reflect unstacking of DNA bases. However, not significant structural changes of genomic DNAs from Siriana, Darsirius and Kristin have been found upon cryopreservation process of tomato cultivars. Based on this work, specific plant DNA-ligand interactions or accurate local structure of DNA in the proximity of a metallic surface, might be further investigated using surface-enhanced Raman spectroscopy. Copyright © 2015 Elsevier B.V. All rights reserved.
Synthesis, Characterization and DNA Binding Activity of a Potential DNA Intercalator
International Nuclear Information System (INIS)
Siti Norain Harun; Yaakob Razak; Haslina Ahmad
2016-01-01
A novel complex, (Ru(dppz) 2 (p-MOPIP)) 2+ (dppz = dipyrido-(3,2-a:20,30-c]phenazine, p-MOPIP = 2-(4-methoxyphenyl) imidazo(4,5-f)(1,10]phenanthroline) has been synthesized and characterized by elemental analysis, 1 H Nuclear Magnetic Resonance spectroscopy, mass spectrometry, Fourier Transform Infrared analysis, Ultra Violet visible and fluorescence spectroscopy. Herein, the complex was designed by adding p-MOPIP as an intercalating ligand and dppz as the ancillary ligand. The DNA binding properties of the complex with Calf Thymus DNA (CT-DNA) were investigated using spectroscopic methods. The UV-visible absorption band observed at 460 nm corresponded to the metal-to-ligand charge transfer (MLCT) while bands at 358 and 281 nm corresponded to intra-ligand (IL) π-π * transitions of the ligand scaffold in p-MOPIP and dppz. The intrinsic binding constant, K b for this complex was 1.67x10 6 M -1 and this suggested that this complex, (Ru(dppz) 2 (p-MOPIP)) 2+ bound to DNA via the intercalative mode. Interestingly, the interaction of this complex with CT-DNA also had a molecular light switch effect. (author)
Directory of Open Access Journals (Sweden)
Jiajia Wang
2018-02-01
Full Text Available A porous silicon microcavity (PSiMC with resonant peak wavelength of 635 nm was fabricated by electrochemical etching. Metal nanoparticles (NPs/PSiMC enhanced fluorescence substrates were prepared by the electrostatic adherence of Au NPs that were distributed in PSiMC. The Au NPs/PSiMC device was used to characterize the target DNA immobilization and hybridization with its complementary DNA sequences marked with Rhodamine red (RRA. Fluorescence enhancement was observed on the Au NPs/PSiMC device substrate; and the minimum detection concentration of DNA ran up to 10 pM. The surface plasmon resonance (SPR of the MC substrate; which is so well-positioned to improve fluorescence enhancement rather the fluorescence enhancement of the high reflection band of the Bragg reflector; would welcome such a highly sensitive in biosensor.
Wang, Jiajia; Jia, Zhenhong
2018-02-23
A porous silicon microcavity (PSiMC) with resonant peak wavelength of 635 nm was fabricated by electrochemical etching. Metal nanoparticles (NPs)/PSiMC enhanced fluorescence substrates were prepared by the electrostatic adherence of Au NPs that were distributed in PSiMC. The Au NPs/PSiMC device was used to characterize the target DNA immobilization and hybridization with its complementary DNA sequences marked with Rhodamine red (RRA). Fluorescence enhancement was observed on the Au NPs/PSiMC device substrate; and the minimum detection concentration of DNA ran up to 10 pM. The surface plasmon resonance (SPR) of the MC substrate; which is so well-positioned to improve fluorescence enhancement rather the fluorescence enhancement of the high reflection band of the Bragg reflector; would welcome such a highly sensitive in biosensor.
Hsiao, Shih-Chia; Francis, Matthew B.; Bertozzi, Carolyn; Mathies, Richard; Chandra, Ravi; Douglas, Erik; Twite, Amy; Toriello, Nicholas; Onoe, Hiroaki
2016-05-03
The present invention provides conjugates of DNA and cells by linking the DNA to a native functional group on the cell surface. The cells can be without cell walls or can have cell walls. The modified cells can be linked to a substrate surface and used in assay or bioreactors.
Hsiao, Shih-Chia; Francis, Matthew B.; Bertozzi, Carolyn; Mathies, Richard; Chandra, Ravi; Douglas, Erik; Twite, Amy; Toriello, Nicholas; Onoe, Hiroaki
2018-05-15
The present invention provides conjugates of DNA and cells by linking the DNA to a native functional group on the cell surface. The cells can be without cell walls or can have cell walls. The modified cells can be linked to a substrate surface and used in assay or bioreactors.
Covalently bound conjugates of albumin and heparin: Synthesis, fractionation and characterization
Hennink, Wim E.; Feijen, Jan; Ebert, Charles D.; Kim, Sung Wan
1983-01-01
Covalently bound conjugates of human serum albumin and heparin were prepared as compounds which could improve the blood-compatibility of polymer surfaces either by preadsorption or by covalent coupling of the conjugates onto blood contacting surfaces. The conjugates (10–16 weight % of heparin) were
Wang, Sheng-Yu; Lee, Alan Yueh-Luen; Lee, Yueh-Luen; Lai, Yi-Hua; Chen, Jeremy J W; Wu, Wen-Lin; Yuann, Jeu-Ming P; Su, Wang-Lin; Chuang, Show-Mei; Hou, Ming-Hon
2012-01-01
The anticancer activity of DNA intercalators is related to their ability to intercalate into the DNA duplex with high affinity, thereby interfering with DNA replication and transcription. Polyamines (spermine in particular) are almost exclusively bound to nucleic acids and are involved in many cellular processes that require nucleic acids. Until now, the effects of polyamines on DNA intercalator activities have remained unclear because intercalation is the most important mechanism employed by DNA-binding drugs. Herein, using actinomycin D (ACTD) as a model, we have attempted to elucidate the effects of spermine on the action of ACTD, including its DNA-binding ability, RNA and DNA polymerase interference, and its role in the transcription and replication inhibition of ACTD within cells. We found that spermine interfered with the binding and stabilization of ACTD to DNA. The presence of increasing concentrations of spermine enhanced the transcriptional and replication activities of RNA and DNA polymerases, respectively, in vitro treated with ActD. Moreover, a decrease in intracellular polyamine concentrations stimulated by methylglyoxal-bis(guanylhydrazone) (MGBG) enhanced the ACTD-induced inhibition of c-myc transcription and DNA replication in several cancer cell lines. The results indicated that spermine attenuates ACTD binding to DNA and its inhibition of transcription and DNA replication both in vitro and within cells. Finally, a synergistic antiproliferative effect of MGBG and ACTD was observed in a cell viability assay. Our findings will be of significant relevance to future developments in combination with cancer therapy by enhancing the anticancer activity of DNA interactors through polyamine depletion.
Directory of Open Access Journals (Sweden)
Sheng-Yu Wang
Full Text Available The anticancer activity of DNA intercalators is related to their ability to intercalate into the DNA duplex with high affinity, thereby interfering with DNA replication and transcription. Polyamines (spermine in particular are almost exclusively bound to nucleic acids and are involved in many cellular processes that require nucleic acids. Until now, the effects of polyamines on DNA intercalator activities have remained unclear because intercalation is the most important mechanism employed by DNA-binding drugs. Herein, using actinomycin D (ACTD as a model, we have attempted to elucidate the effects of spermine on the action of ACTD, including its DNA-binding ability, RNA and DNA polymerase interference, and its role in the transcription and replication inhibition of ACTD within cells. We found that spermine interfered with the binding and stabilization of ACTD to DNA. The presence of increasing concentrations of spermine enhanced the transcriptional and replication activities of RNA and DNA polymerases, respectively, in vitro treated with ActD. Moreover, a decrease in intracellular polyamine concentrations stimulated by methylglyoxal-bis(guanylhydrazone (MGBG enhanced the ACTD-induced inhibition of c-myc transcription and DNA replication in several cancer cell lines. The results indicated that spermine attenuates ACTD binding to DNA and its inhibition of transcription and DNA replication both in vitro and within cells. Finally, a synergistic antiproliferative effect of MGBG and ACTD was observed in a cell viability assay. Our findings will be of significant relevance to future developments in combination with cancer therapy by enhancing the anticancer activity of DNA interactors through polyamine depletion.
DNA binding and aggregation by carbon nanoparticles
International Nuclear Information System (INIS)
An, Hongjie; Liu, Qingdai; Ji, Qiaoli; Jin, Bo
2010-01-01
Significant environmental and health risks due to the increasing applications of engineered nanoparticles in medical and industrial activities have been concerned by many communities. The interactions between nanomaterials and genomes have been poorly studied so far. This study examined interactions of DNA with carbon nanoparticles (CNP) using atomic force microscopy (AFM). We experimentally assessed how CNP affect DNA molecule and bacterial growth of Escherichia coli. We found that CNP were bound to the DNA molecules during the DNA replication in vivo. The results revealed that the interaction of DNA with CNP resulted in DNA molecule binding and aggregation both in vivo and in vitro in a dose-dependent manner, and consequently inhabiting the E. coli growth. While this was a preliminary study, our results showed that this nanoparticle may have a significant impact on genomic activities.
Constructing DNA Barcode Sets Based on Particle Swarm Optimization.
Wang, Bin; Zheng, Xuedong; Zhou, Shihua; Zhou, Changjun; Wei, Xiaopeng; Zhang, Qiang; Wei, Ziqi
2018-01-01
Following the completion of the human genome project, a large amount of high-throughput bio-data was generated. To analyze these data, massively parallel sequencing, namely next-generation sequencing, was rapidly developed. DNA barcodes are used to identify the ownership between sequences and samples when they are attached at the beginning or end of sequencing reads. Constructing DNA barcode sets provides the candidate DNA barcodes for this application. To increase the accuracy of DNA barcode sets, a particle swarm optimization (PSO) algorithm has been modified and used to construct the DNA barcode sets in this paper. Compared with the extant results, some lower bounds of DNA barcode sets are improved. The results show that the proposed algorithm is effective in constructing DNA barcode sets.
Czech Academy of Sciences Publication Activity Database
Schneider, Bohdan; Bozikova, Paulina; Čech, P.; Svozil, D.; Černý, Jiří
2017-01-01
Roč. 8, č. 10 (2017), č. článku 278. ISSN 2073-4425 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0109 Grant - others:GA MŠk(CZ) EF16_013/0001777 Institutional support: RVO:86652036 Keywords : DNA * DNA-protein recognition * transcription factors Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Computer sciences, information science, bioinformathics (hardware development to be 2.2, social aspect to be 5.8) Impact factor: 3.600, year: 2016
Multiplex and high-throughput DNA detection using surface plasmon mediated fluorescence
Mei, Zhong
The overall objective of this research project was to develop a user-friendly and sensitive biosensor for nucleic acid aptamers with multiplexing and high-throughput capability. The sensing was based on the fluorescence signals emitted by the fluorophores coupling with plamonic nanoparticle (gold nanorod) deposited on a patterned substrate. Gold nanorods (GNRs) were synthesized using a binary mixture of hexadecyltrimethylammonium bromide (CTAB) and sodium oleate (NaOL) in seed mediated growth method. Polytetrafluoroethylene (PTFE) printed glass slides were selectively coated with a gold thin-film to define hydrophilic areas for GNR deposition. Due to the wettablity contrast, GNR solution dropped on the slide was induced to assemble exclusively in the hydrophilic spots. By controlling temperature and humidity of the evaporation process, vertically-standing GNR arrays were achieved on the pattered slide. Fluorescence was conjugated to GNR surface via DNA double strand with tunable length. Theoretical simulation predicted a flat layer ( 30 nm thick) of uniform "hot spots" presented on the GNR tips, which could modify the nearby fluorescence. Experimentally, the vertical GNR arrays yielded metallic enhanced fluorescence (MEF) effect, which was dependent on the spectrum overlap and GNR-fluorophore distance. Specifically, the maximum enhancement of Quasar 670 and Alexa 750 was observed when it was coupled with GNR664 (plasmonic wavelength 664 nm) and GNR778 respectively at a distance of 16 nm, while the carboxyfluorescein (FAM) was at maximal intensity when attached to gold nanosphere520. This offers an opportunity for multiplexed DNA sensing. Based on this, we developed a novel GNR mediated fluorescence biosensor for DNA detection. Fluorescence labeled haipin-DNA probes were introduced to designated spots of GNR array with the matching LSPR wavelengths on the substrate. The fluorescence was quenched originally because of Forster resonance energy transfer (FRET) effect
On resonances and bound states of Smilansky Hamiltonian
Czech Academy of Sciences Publication Activity Database
Exner, Pavel; Lotoreichik, Vladimir; Tater, Miloš
2016-01-01
Roč. 7, č. 5 (2016), s. 789-802 ISSN 2220-8054 R&D Projects: GA ČR(CZ) GA14-06818S Institutional support: RVO:61389005 Keywords : Smilansky Hamiltonian * resonances * resonance free region * weak coupling asymptotics * Riemann surface * bound states Subject RIV: BE - Theoretical Physics
Hager, Roland; Burns, Jonathan R; Grydlik, Martyna J; Halilovic, Alma; Haselgrübler, Thomas; Schäffler, Friedrich; Howorka, Stefan
2016-06-01
The biofunctionalization of nanopatterned surfaces with DNA origami nanostructures is an important topic in nanobiotechnology. An unexplored challenge is, however, to co-immobilize proteins with DNA origami at pre-determined substrate sites in high contrast relative to the nontarget areas. The immobilization should, in addition, preferably be achieved on a transparent substrate to allow ultrasensitive optical detection. If successful, specific co-binding would be a step towards stoichiometrically defined arrays with few to individual protein molecules per site. Here, we successfully immobilize with high specificity positively charged avidin proteins and negatively charged DNA origami nanoplates on 100 nm-wide carbon nanoislands while suppressing undesired adsorption to surrounding nontarget areas. The arrays on glass slides achieve unprecedented selectivity factors of up to 4000 and allow ultrasensitive fluorescence read-out. The co-immobilization onto the nanoislands leads to layered biomolecular architectures, which are functional because bound DNA origami influences the number of capturing sites on the nanopatches for other proteins. The novel hybrid DNA origami-protein nanoarrays allow the fabrication of versatile research platforms for applications in biosensing, biophysics, and cell biology, and, in addition, represent an important step towards single-molecule protein arrays. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
International Nuclear Information System (INIS)
Rajapaksa, A.E.; Qi, Aisha; Yeo, L.; Friend, J.
2010-01-01
Full text: The increase in the need for effective delivery of potelll vaccines against infectious diseases, require robust yet straightforward pro duction of encapsulated DNA-laden aerosols. Aerosol delivery of drugs represents the next generation of vaccine delivery where the drug is deposited into the lung, which provides an ideal, non-invasive route. Moreover, several features of D A vaccines make them more attractive than conventional vaccines; thus, DNA vaccines have gained global interest for a variety of applications. However, several limitations such as ineffective cellular uptake and intracellular delivery, and degradation of DNA need to be overcome before clin ical applications. In this study, a novel and scalable engineered technique has been developed to create a biodegradable polymer system, which enables controlled delivery of a well designed DNA vaccine for immuno-therapeutics. Surface Acoustic Wave (SAW) atomisation has been found as useful mechanism for atomising fluid samples for medical and industrial devices. It is a straightforward method for synthesising un-agglomerated biodegradable nanoparti cles (<250 nm) in the absence of organic solvents which would represent a major breakthrough for biopharmaceutical encapsulation and delivery. Nano-scale polymer particles for DNA vaccines deliv ery were obtained through an evaporative process of the initial aerosol created by surface acoustic waves at 8-150 MHz, the final size of which could be controlled by modifying the initial polymer concen tration and solid contents. Thus, SAW atomiser represents a promising alternative for the development of a low power device for producing nano-engineered vaccines with a controlled and narrow size distribution as delivery system for genetic immuno-therapeutics.
Harmonic maps of the bounded symmetric domains
International Nuclear Information System (INIS)
Xin, Y.L.
1994-06-01
A shrinking property of harmonic maps into R IV (2) is proved which is used to classify complete spacelike surfaces of the parallel mean curvature in R 4 2 with a reasonable condition on the Gauss image. Liouville-type theorems of harmonic maps from the higher dimensional bounded symmetric domains are also established. (author). 25 refs
A Polycomb complex remains bound through DNA replication in the absence of other eukaryotic proteins
Lengsfeld, Bettina M.; Berry, Kayla N.; Ghosh, Sharmistha; Takahashi, Masateru; Francis, Nicole J.
2012-01-01
Propagation of chromatin states through DNA replication is central to epigenetic regulation and can involve recruitment of chromatin proteins to replicating chromatin through interactions with replication fork components. Here we show using a fully reconstituted T7 bacteriophage system that eukaryotic proteins are not required to tether the Polycomb complex PRC1 to templates during DNA replication. Instead, DNA binding by PRC1 can withstand passage of a simple replication fork.
A Polycomb complex remains bound through DNA replication in the absence of other eukaryotic proteins
Lengsfeld, Bettina M.
2012-09-17
Propagation of chromatin states through DNA replication is central to epigenetic regulation and can involve recruitment of chromatin proteins to replicating chromatin through interactions with replication fork components. Here we show using a fully reconstituted T7 bacteriophage system that eukaryotic proteins are not required to tether the Polycomb complex PRC1 to templates during DNA replication. Instead, DNA binding by PRC1 can withstand passage of a simple replication fork.
A Novel Low Energy Electron Microscope for DNA Sequencing and Surface Analysis
Mankos, M.; Shadman, K.; Persson, H.H.J.; N’Diaye, A.T.; Schmid, A.K.; Davis, R.W.
2014-01-01
Monochromatic, aberration-corrected, dual-beam low energy electron microscopy (MAD-LEEM) is a novel technique that is directed towards imaging nanostructures and surfaces with sub-nanometer resolution. The technique combines a monochromator, a mirror aberration corrector, an energy filter, and dual beam illumination in a single instrument. The monochromator reduces the energy spread of the illuminating electron beam, which significantly improves spectroscopic and spatial resolution. Simulation results predict that the novel aberration corrector design will eliminate the second rank chromatic and third and fifth order spherical aberrations, thereby improving the resolution into the sub-nanometer regime at landing energies as low as one hundred electron-Volts. The energy filter produces a beam that can extract detailed information about the chemical composition and local electronic states of non-periodic objects such as nanoparticles, interfaces, defects, and macromolecules. The dual flood illumination eliminates charging effects that are generated when a conventional LEEM is used to image insulating specimens. A potential application for MAD-LEEM is in DNA sequencing, which requires high resolution to distinguish the individual bases and high speed to reduce the cost. The MAD-LEEM approach images the DNA with low electron impact energies, which provides nucleobase contrast mechanisms without organometallic labels. Furthermore, the micron-size field of view when combined with imaging on the fly provides long read lengths, thereby reducing the demand on assembling the sequence. Experimental results from bulk specimens with immobilized single-base oligonucleotides demonstrate that base specific contrast is available with reflected, photo-emitted, and Auger electrons. Image contrast simulations of model rectangular features mimicking the individual nucleotides in a DNA strand have been developed to translate measurements of contrast on bulk DNA to the detectability of
A novel low energy electron microscope for DNA sequencing and surface analysis.
Mankos, M; Shadman, K; Persson, H H J; N'Diaye, A T; Schmid, A K; Davis, R W
2014-10-01
Monochromatic, aberration-corrected, dual-beam low energy electron microscopy (MAD-LEEM) is a novel technique that is directed towards imaging nanostructures and surfaces with sub-nanometer resolution. The technique combines a monochromator, a mirror aberration corrector, an energy filter, and dual beam illumination in a single instrument. The monochromator reduces the energy spread of the illuminating electron beam, which significantly improves spectroscopic and spatial resolution. Simulation results predict that the novel aberration corrector design will eliminate the second rank chromatic and third and fifth order spherical aberrations, thereby improving the resolution into the sub-nanometer regime at landing energies as low as one hundred electron-Volts. The energy filter produces a beam that can extract detailed information about the chemical composition and local electronic states of non-periodic objects such as nanoparticles, interfaces, defects, and macromolecules. The dual flood illumination eliminates charging effects that are generated when a conventional LEEM is used to image insulating specimens. A potential application for MAD-LEEM is in DNA sequencing, which requires high resolution to distinguish the individual bases and high speed to reduce the cost. The MAD-LEEM approach images the DNA with low electron impact energies, which provides nucleobase contrast mechanisms without organometallic labels. Furthermore, the micron-size field of view when combined with imaging on the fly provides long read lengths, thereby reducing the demand on assembling the sequence. Experimental results from bulk specimens with immobilized single-base oligonucleotides demonstrate that base specific contrast is available with reflected, photo-emitted, and Auger electrons. Image contrast simulations of model rectangular features mimicking the individual nucleotides in a DNA strand have been developed to translate measurements of contrast on bulk DNA to the detectability of
International Nuclear Information System (INIS)
Kim, Seung Jo; Suh, Dongchul; Park, Sang Eun; Park, Jeong-Sook; Byun, Hyang-Min; Lee, Chan; Lee, Sun Young; Kim, Inho; Oh, Yu-Kyoung
2003-01-01
To increase the potency of DNA vaccines, we constructed genetic fusion vaccines encoding antigen, secretion signal, and/or chemokine RANTES. The DNA vaccines encoding secreted hepatitis B surface antigen (HBsAg) were constructed by inserting HBsAg gene into an expression vector with an endoplasmic reticulum (ER)-targeting secretory signal sequence. The plasmid encoding secretory HBsAg (pER/HBs) was fused to cDNA of RANTES, generating pER/HBs/R. For comparison, HBsAg genes were cloned into pVAX1 vector with no signal sequence (pHBs), and further linked to the N-terminus of RANTES (pHBs/R). Immunofluorescence study showed the cytoplasmic localization of HBsAg protein expressed from pHBs and pHBs/R, but not from pER/HBs and pER/HBs/R at 48 h after transfection. In mice, RANTES-fused DNA vaccines more effectively elicited the levels of HBsAg-specific IgG antibodies than pHBs. All the DNA vaccines induced higher levels of IgG 2a rather than IgG 1 antibodies. Of RANTES-fused vaccines, pER/HBs/R encoding the secreted fusion protein revealed much higher humoral and CD8 + T cell-stimulating responses compared to pHBs/R. These results suggest that the immunogenicity of DNA vaccines could be enhanced by genetic fusion to a secretory signal peptide sequence and RANTES
Rant, Ulrich; Arinaga, Kenji; Tornow, Marc; Kim, Yong Woon; Netz, Roland R; Fujita, Shozo; Yokoyama, Naoki; Abstreiter, Gerhard
2006-05-15
We report on the electrical manipulation of single- and double-stranded oligodeoxynucleotides that are end tethered to gold surfaces in electrolyte solution. The response to alternating repulsive and attractive electric surface fields is studied by time-resolved fluorescence measurements, revealing markedly distinct dynamics for the flexible single-stranded and stiff double-stranded DNA, respectively. Hydrodynamic simulations rationalize this finding and disclose two different kinetic mechanisms: stiff polymers undergo rotation around the anchoring pivot point; flexible polymers, on the other hand, are pulled onto the attracting surface segment by segment.
Lee, Chun-Yue I; Delaney, James C; Kartalou, Maria; Lingaraju, Gondichatnahalli M; Maor-Shoshani, Ayelet; Essigmann, John M; Samson, Leona D
2009-03-10
The human 3-methyladenine DNA glycosylase (AAG) recognizes and excises a broad range of purines damaged by alkylation and oxidative damage, including 3-methyladenine, 7-methylguanine, hypoxanthine (Hx), and 1,N(6)-ethenoadenine (epsilonA). The crystal structures of AAG bound to epsilonA have provided insights into the structural basis for substrate recognition, base excision, and exclusion of normal purines and pyrimidines from its substrate recognition pocket. In this study, we explore the substrate specificity of full-length and truncated Delta80AAG on a library of oligonucleotides containing structurally diverse base modifications. Substrate binding and base excision kinetics of AAG with 13 damaged oligonucleotides were examined. We found that AAG bound to a wide variety of purine and pyrimidine lesions but excised only a few of them. Single-turnover excision kinetics showed that in addition to the well-known epsilonA and Hx substrates, 1-methylguanine (m1G) was also excised efficiently by AAG. Thus, along with epsilonA and ethanoadenine (EA), m1G is another substrate that is shared between AAG and the direct repair protein AlkB. In addition, we found that both the full-length and truncated AAG excised 1,N(2)-ethenoguanine (1,N(2)-epsilonG), albeit weakly, from duplex DNA. Uracil was excised from both single- and double-stranded DNA, but only by full-length AAG, indicating that the N-terminus of AAG may influence glycosylase activity for some substrates. Although AAG has been primarily shown to act on double-stranded DNA, AAG excised both epsilonA and Hx from single-stranded DNA, suggesting the possible significance of repair of these frequent lesions in single-stranded DNA transiently generated during replication and transcription.
Tate, Stephen James
2013-10-01
In the 1960s, the technique of using cluster expansion bounds in order to achieve bounds on the virial expansion was developed by Lebowitz and Penrose (J. Math. Phys. 5:841, 1964) and Ruelle (Statistical Mechanics: Rigorous Results. Benjamin, Elmsford, 1969). This technique is generalised to more recent cluster expansion bounds by Poghosyan and Ueltschi (J. Math. Phys. 50:053509, 2009), which are related to the work of Procacci (J. Stat. Phys. 129:171, 2007) and the tree-graph identity, detailed by Brydges (Phénomènes Critiques, Systèmes Aléatoires, Théories de Jauge. Les Houches 1984, pp. 129-183, 1986). The bounds achieved by Lebowitz and Penrose can also be sharpened by doing the actual optimisation and achieving expressions in terms of the Lambert W-function. The different bound from the cluster expansion shows some improvements for bounds on the convergence of the virial expansion in the case of positive potentials, which are allowed to have a hard core.
DNA ligase III is involved in a DNA-PK independent pathway of NHEJ in human cells
International Nuclear Information System (INIS)
Wang, H.; Perrault, A.R.; Qin, W.; Wang, H.; Iliakis, G.
2003-01-01
Full text: Double strand breaks (DSB) induced by ionizing radiation (IR) and other cytotoxic agents in the genome of higher eukaryotes are thought to be repaired either by homologous recombination repair (HRR), or non-homologous endjoining (NHEJ). We previously reported the operation of two components of NHEJ in vivo: a DNA-PK dependent component that operates with fast kinetics (D-NHEJ), and a DNA-PK independent component that acts as a backup (basic or B-NHEJ) and operates with kinetics an order of magnitude slower. To gain further insight into the mechanisms of B-NHEJ, we investigated DNA endjoining in extracts 180BR, a human cell line deficient in DNA ligase IV, using an in vitro plasmid-based DNA endjoining assay. An anti DNA ligase III antibody inhibited almost completely DNA endjoining activity in these extracts. On the other hand, an anti DNA ligase I antibody had no measurable effect in DNA endjoining activity. Immunodepletion of DNA ligase III from 180BR cell extracts abolished the DNA endjoining activity, which could be restored by addition of purified human DNA ligase IIIb. Full-length DNA ligase III bound to double stranded DNA and stimulated DNA endjoining in both intermolecular and intramolecular ligation. Furthermore, fractionation of HeLa cell extracts demonstrated the presence of an activity stimulating the function of DNA ligase III. Based on these observations we propose that DNA ligase III is the ligase operating in B-NHEJ
Study of microtip-based extraction and purification of DNA from human samples for portable devices
Fotouhi, Gareth
recovery of DNA to 45% efficiency. Furthermore, the 225°C-cured PEI-coated microtips recover more DNA than gold-coated microtips when the surface is washed. Heat-cured (225°C) PEI-coated microtips are used for the recovery of human genomic DNA from whole blood. A washing protocol is developed to remove inhibiting particles bound to the PEI-coated microtip surface after DNA extraction. From 1.25 muL of whole blood, an average of 1.83 ng of human genomic DNA is captured, purified, and released using a 225°C-cured PEI-coated microtip in less than 30 minutes. The extracted DNA is profiled by short tandem repeat analysis (STR). For forensic and medical applications, genomic DNA is extracted from dried samples using heat-cured PEI-coated microtips that are integrated into an automated device. DNA extraction from dried samples is critical for forensics. The use of dried samples in the medical field is increasing because dried samples are convenient for storage, biosafety, and contamination. The main challenge is the time required to properly extract DNA in a purified form. Typically, a 1 hour incubation period is required to complete this process. Overnight incubation is sometimes necessary. To address this challenge, a pre-extraction washing step is investigated to remove inhibiting particles from dried blood spots (DBS) before DNA is released from dried form into solution for microtip extraction. The developed protocol is expanded to extract DNA from a variety of dried samples including nasal swabs, buccal swabs, and other forensic samples. In comparison to a commercial kit, the microtip-based extraction reduced the processing time from 1.5 hours to 30 minutes or less with an equivalent concentration of extracted DNA from dried blood spots. The developed assay will benefit genetic studies on newborn screening, forensic investigation, and POC diagnostics.
Colloidal silica films for high-capacity DNA arrays
Glazer, Marc Irving
The human genome project has greatly expanded the amount of genetic information available to researchers, but before this vast new source of data can be fully utilized, techniques for rapid, large-scale analysis of DNA and RNA must continue to develop. DNA arrays have emerged as a powerful new technology for analyzing genomic samples in a highly parallel format. The detection sensitivity of these arrays is dependent on the quantity and density of immobilized probe molecules. We have investigated substrates with a porous, "three-dimensional" surface layer as a means of increasing the surface area available for the synthesis of oligonucleotide probes, thereby increasing the number of available probes and the amount of detectable bound target. Porous colloidal silica films were created by two techniques. In the first approach, films were deposited by spin-coating silica colloid suspensions onto flat glass substrates, with the pores being formed by the natural voids between the solid particles (typically 23nm pores, 35% porosity). In the second approach, latex particles were co-deposited with the silica and then pyrolyzed, creating films with larger pores (36 nm), higher porosity (65%), and higher surface area. For 0.3 mum films, enhancements of eight to ten-fold and 12- to 14-fold were achieved with the pure silica films and the films "templated" with polymer latex, respectively. In gene expression assays for up to 7,000 genes using complex biological samples, the high-capacity films provided enhanced signals and performed equivalently or better than planar glass on all other functional measures, confirming that colloidal silica films are a promising platform for high-capacity DNA arrays. We have also investigated the kinetics of hybridization on planar glass and high-capacity substrates. Adsorption on planar arrays is similar to ideal Langmuir-type adsorption, although with an "overshoot" at high solution concentration. Hybridization on high-capacity films is
Upper bounds on superpartner masses from upper bounds on the Higgs boson mass.
Cabrera, M E; Casas, J A; Delgado, A
2012-01-13
The LHC is putting bounds on the Higgs boson mass. In this Letter we use those bounds to constrain the minimal supersymmetric standard model (MSSM) parameter space using the fact that, in supersymmetry, the Higgs mass is a function of the masses of sparticles, and therefore an upper bound on the Higgs mass translates into an upper bound for the masses for superpartners. We show that, although current bounds do not constrain the MSSM parameter space from above, once the Higgs mass bound improves big regions of this parameter space will be excluded, putting upper bounds on supersymmetry (SUSY) masses. On the other hand, for the case of split-SUSY we show that, for moderate or large tanβ, the present bounds on the Higgs mass imply that the common mass for scalars cannot be greater than 10(11) GeV. We show how these bounds will evolve as LHC continues to improve the limits on the Higgs mass.
International Nuclear Information System (INIS)
Taylor, R.P.; Horgan, C.; Hooper, M.; Burge, J.
1985-01-01
Soluble antibody/ 3 H-double-stranded PM2 DNA (dsDNA) immune complexes were briefly opsonized with complement and then allowed to bind to human erythrocytes (via complement receptors). The cells were washed and subsequently a volume of autologous blood in a variety of media was added, and the release of the bound immune complexes from the erythrocytes was studied as a function of temperature and time. After 1-2 h, the majority of the bound immune complexes were not released into the serum during blood clotting at either 37 degrees C or room temperature, but there was a considerably greater release of the immune complexes into the plasma of blood that was anticoagulated with EDTA. Similar results were obtained using various conditions of opsonization and also using complexes that contained lower molecular weight dsDNA. Thus, the kinetics of release of these antibody/dsDNA immune complexes differed substantially from the kinetics of release of antibody/bovine serum albumin complexes that was reported by others. Studies using the solution phase C1q immune complex binding assay confirmed that in approximately half of the SLE samples that were positive for immune complexes, there was a significantly higher level of detectable immune complexes in plasma vs. serum. Freshly drawn erythrocytes from some SLE patients exhibiting this plasma/serum discrepancy had IgG antigen on their surface that was released by incubation in EDTA plasma. Thus, the higher levels of immune complexes observed in EDTA plasma vs. serum using the C1q assay may often reflect the existence of immune complexes circulating in vivo bound to erythrocytes
DEFF Research Database (Denmark)
Emiris, Ioannis Z.; Mourrain, Bernard; Tsigaridas, Elias
2010-01-01
) resultant by means of mixed volume, as well as recent advances on aggregate root bounds for univariate polynomials, and are applicable to arbitrary positive dimensional systems. We improve upon Canny's gap theorem [7] by a factor of O(dn-1), where d bounds the degree of the polynomials, and n is the number...... bound on the number of steps that subdivision-based algorithms perform in order to isolate all real roots of a polynomial system. This leads to the first complexity bound of Milne's algorithm [22] in 2D....
Bounds and maximum principles for the solution of the linear transport equation
International Nuclear Information System (INIS)
Larsen, E.W.
1981-01-01
Pointwise bounds are derived for the solution of time-independent linear transport problems with surface sources in convex spatial domains. Under specified conditions, upper bounds are derived which, as a function of position, decrease with distance from the boundary. Also, sufficient conditions are obtained for the existence of maximum and minimum principles, and a counterexample is given which shows that such principles do not always exist
A novel constraint for thermodynamically designing DNA sequences.
Directory of Open Access Journals (Sweden)
Qiang Zhang
Full Text Available Biotechnological and biomolecular advances have introduced novel uses for DNA such as DNA computing, storage, and encryption. For these applications, DNA sequence design requires maximal desired (and minimal undesired hybridizations, which are the product of a single new DNA strand from 2 single DNA strands. Here, we propose a novel constraint to design DNA sequences based on thermodynamic properties. Existing constraints for DNA design are based on the Hamming distance, a constraint that does not address the thermodynamic properties of the DNA sequence. Using a unique, improved genetic algorithm, we designed DNA sequence sets which satisfy different distance constraints and employ a free energy gap based on a minimum free energy (MFE to gauge DNA sequences based on set thermodynamic properties. When compared to the best constraints of the Hamming distance, our method yielded better thermodynamic qualities. We then used our improved genetic algorithm to obtain lower-bound DNA sequence sets. Here, we discuss the effects of novel constraint parameters on the free energy gap.
Fragile DNA Repair Mechanism Reduces Ageing in Multicellular Model
DEFF Research Database (Denmark)
Bendtsen, Kristian Moss; Juul, Jeppe Søgaard; Trusina, Ala
2012-01-01
increases the amount of unrepaired DNA damage. Despite this vicious circle, we ask, can cells maintain a high DNA repair capacity for some time or is repair capacity bound to continuously decline with age? We here present a simple mathematical model for ageing in multicellular systems where cells subjected...... to DNA damage can undergo full repair, go apoptotic, or accumulate mutations thus reducing DNA repair capacity. Our model predicts that at the tissue level repair rate does not continuously decline with age, but instead has a characteristic extended period of high and non-declining DNA repair capacity......DNA damages, as well as mutations, increase with age. It is believed that these result from increased genotoxic stress and decreased capacity for DNA repair. The two causes are not independent, DNA damage can, for example, through mutations, compromise the capacity for DNA repair, which in turn...
Energy Technology Data Exchange (ETDEWEB)
Zheng, Rui [School of Mathematics and Information Science, North China University of Water Resources and Electric Power, Zhengzhou (China); Key Laboratory of Magnetic Resonance in Biological Systems, State Key Laboratory of Magnetic Resonance and Atomic and Molecular Physics, Wuhan Centre for Magnetic Resonance, Wuhan Institute of Physics and Mathematics, Chinese Academy of Sciences, Wuhan (China); Li, Song, E-mail: lsong@yangtzeu.edu.cn [School of Physics and Optoelectronic Engineering, Yangtze University, Jingzhou (China); Chen, Shan-Jun; Chen, Yan [School of Physics and Optoelectronic Engineering, Yangtze University, Jingzhou (China); Zheng, Li-Min [Key Laboratory of Magnetic Resonance in Biological Systems, State Key Laboratory of Magnetic Resonance and Atomic and Molecular Physics, Wuhan Centre for Magnetic Resonance, Wuhan Institute of Physics and Mathematics, Chinese Academy of Sciences, Wuhan (China)
2015-09-08
Highlights: • A two-dimensional potential for Ar–BrCl is constructed at the CCSD(T) level. • The PES is characterized by three minima and two saddle points between them. • Bound state calculations were carried out for the complex. - Abstract: The intermolecular potential energy surface (PES) of the ground electronic state for the Ar–BrCl dimer is constructed at the CCSD(T) level with the aug-cc-pVQZ basis set and mid-bond functions. The PES is characterized by three minima and two saddle points. The global minimum corresponding to a collinear Ar–BrCl configuration, which has been observed experimentally, is located at R = 4.10 Å and θ = 2.5° with a well depth of −285.207 cm{sup −1}. A nearly T-shaped structure and an anti-linear Ar–ClBr geometry is also predicted. The bound state calculations are preformed to study intermolecular vibrational modes, rotational levels and average structures for the complex. Our transition frequencies, spectroscopic constants and average structures for all isotopomers of the collinear isomer agree well with experimental data. We have also provided pure rotational transitional frequencies for both nearly T-shaped and anti-linear isomers. These results are significant for further experimental investigations of the Ar–BrCl dimer.
Measurement of anti-double-stranded DNA antibodies in major immunoglobulin classes
Energy Technology Data Exchange (ETDEWEB)
Aotsuka, S; Okawa, M; Ikebe, K; Yokohari, R [Division of Clinical Immunology, Clinical Research Institute, National Medical Center Hospital, Shinjuku-ku, Tokyo, Japan
1979-07-10
A solid-phase radioimmunoassay for quantitating anti-double-stranded deoxyribonucleic acid antibodies (anti-dsDNA) in IgG, IgM and IgA classes has been devised. A distinct feature of the method is an application of polystyrene tubes coated with poly-L-lysine, through which dsDNA could be bound firmly to a solid phase. Studies on patients sera as well as normal sera revealed that anti-dsDNA was not qualitatively but quantitatively characteristic of systematic lupus erythematosus (SLE) and that IgG anti-dsDNA levels correlated well with the disease activity.
International Nuclear Information System (INIS)
Diabate, S.; Strack, S.
1993-01-01
Tritium released into the environment may be incorporated into organic matter. Organically bound tritium in that case will show retention times in organisms that are considerably longer than those of tritiated water which has significant consequences on dose estimates. This article reviews the most important processes of organically bound tritium production and transport through food networks. Metabolic reactions in plant and animal organisms with tritiated water as a reaction partner are of great importance in this respect. The most important production process, in quantitative terms, is photosynthesis in green plants. The translocation of organically bound tritium from the leaves to edible parts of crop plants should be considered in models of organically bound tritium behavior. Organically bound tritium enters the human body on several pathways, either from the primary producers (vegetable food) or at a higher tropic level (animal food). Animal experiments have shown that the dose due to ingestion of organically bound tritium can be up to twice as high as a comparable intake of tritiated water in gaseous or liquid form. In the environment, organically bound tritium in plants and animals is often found to have higher specific tritium concentrations than tissue water. This is not due to some tritium enrichment effects but to the fact that no equilibrium conditions are reached under natural conditions. 66 refs
End-specific strategies of attachment of long double stranded DNA onto gold-coated nanofiber arrays
International Nuclear Information System (INIS)
Peckys, Diana B; De Jonge, Niels; Simpson, Michael L; McKnight, Timothy E
2008-01-01
We report the effective and site-specific binding of long double stranded (ds)DNA to high aspect ratio carbon nanofiber arrays. The carbon nanofibers were first coated with a thin gold layer to provide anchorage for two controllable binding methods. One method was based on the direct binding of thiol end-labeled dsDNA. The second and enhanced method used amine end-labeled dsDNA bound with crosslinkers to a carboxyl-terminated self-assembled monolayer. The bound dsDNA was first visualized with a fluorescent, dsDNA-intercalating dye. The specific binding onto the carbon nanofiber was verified by a high resolution detection method using scanning electron microscopy in combination with the binding of neutravidin-coated fluorescent microspheres to the immobilized and biotinylated dsDNA. Functional activity of thiol end-labeled dsDNA on gold-coated nanofiber arrays was verified with a transcriptional assay, whereby Chinese hamster lung cells (V79) were impaled upon the DNA-modified nanofibers and scored for transgene expression of the tethered template. Thiol end-labeled dsDNA demonstrated significantly higher expression levels than nanofibers prepared with control dsDNA that lacked a gold-binding end-label. Employing these site-specific and robust techniques of immobilization of dsDNA onto nanodevices can be of advantage for the study of DNA/protein interactions and for gene delivery applications.
Physical Uncertainty Bounds (PUB)
Energy Technology Data Exchange (ETDEWEB)
Vaughan, Diane Elizabeth [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Preston, Dean L. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)
2015-03-19
This paper introduces and motivates the need for a new methodology for determining upper bounds on the uncertainties in simulations of engineered systems due to limited fidelity in the composite continuum-level physics models needed to simulate the systems. We show that traditional uncertainty quantification methods provide, at best, a lower bound on this uncertainty. We propose to obtain bounds on the simulation uncertainties by first determining bounds on the physical quantities or processes relevant to system performance. By bounding these physics processes, as opposed to carrying out statistical analyses of the parameter sets of specific physics models or simply switching out the available physics models, one can obtain upper bounds on the uncertainties in simulated quantities of interest.
Steger, Doris; Berry, David; Haider, Susanne; Horn, Matthias; Wagner, Michael; Stocker, Roman; Loy, Alexander
2011-01-01
The hybridization of nucleic acid targets with surface-immobilized probes is a widely used assay for the parallel detection of multiple targets in medical and biological research. Despite its widespread application, DNA microarray technology still suffers from several biases and lack of reproducibility, stemming in part from an incomplete understanding of the processes governing surface hybridization. In particular, non-random spatial variations within individual microarray hybridizations are often observed, but the mechanisms underpinning this positional bias remain incompletely explained. This study identifies and rationalizes a systematic spatial bias in the intensity of surface hybridization, characterized by markedly increased signal intensity of spots located at the boundaries of the spotted areas of the microarray slide. Combining observations from a simplified single-probe block array format with predictions from a mathematical model, the mechanism responsible for this bias is found to be a position-dependent variation in lateral diffusion of target molecules. Numerical simulations reveal a strong influence of microarray well geometry on the spatial bias. Reciprocal adjustment of the size of the microarray hybridization chamber to the area of surface-bound probes is a simple and effective measure to minimize or eliminate the diffusion-based bias, resulting in increased uniformity and accuracy of quantitative DNA microarray hybridization.
Ma, Chu Jian; Gibb, Bryan; Kwon, YoungHo; Sung, Patrick; Greene, Eric C
2017-01-25
Homologous recombination (HR) is a crucial pathway for double-stranded DNA break (DSB) repair. During the early stages of HR, the newly generated DSB ends are processed to yield long single-stranded DNA (ssDNA) overhangs, which are quickly bound by replication protein A (RPA). RPA is then replaced by the DNA recombinase Rad51, which forms extended helical filaments on the ssDNA. The resulting nucleoprotein filament, known as the presynaptic complex, is responsible for pairing the ssDNA with homologous double-stranded DNA (dsDNA), which serves as the template to guide DSB repair. Here, we use single-molecule imaging to visualize the interplay between human RPA (hRPA) and human RAD51 during presynaptic complex assembly and disassembly. We demonstrate that ssDNA-bound hRPA can undergo facilitated exchange, enabling hRPA to undergo rapid exchange between free and ssDNA-bound states only when free hRPA is present in solution. Our results also indicate that the presence of free hRPA inhibits RAD51 filament nucleation, but has a lesser impact upon filament elongation. This finding suggests that hRPA exerts important regulatory influence over RAD51 and may in turn affect the properties of the assembled RAD51 filament. These experiments provide an important basis for further investigations into the regulation of human presynaptic complex assembly. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
MHJ_0461 is a multifunctional leucine aminopeptidase on the surface of Mycoplasma hyopneumoniae.
Jarocki, Veronica M; Santos, Jerran; Tacchi, Jessica L; Raymond, Benjamin B A; Deutscher, Ania T; Jenkins, Cheryl; Padula, Matthew P; Djordjevic, Steven P
2015-01-01
Aminopeptidases are part of the arsenal of virulence factors produced by bacterial pathogens that inactivate host immune peptides. Mycoplasma hyopneumoniae is a genome-reduced pathogen of swine that lacks the genetic repertoire to synthesize amino acids and relies on the host for availability of amino acids for growth. M. hyopneumoniae recruits plasmin(ogen) onto its cell surface via the P97 and P102 adhesins and the glutamyl aminopeptidase MHJ_0125. Plasmin plays an important role in regulating the inflammatory response in the lungs of pigs infected with M. hyopneumoniae. We show that recombinant MHJ_0461 (rMHJ_0461) functions as a leucine aminopeptidase (LAP) with broad substrate specificity for leucine, alanine, phenylalanine, methionine and arginine and that MHJ_0461 resides on the surface of M. hyopneumoniae. rMHJ_0461 also binds heparin, plasminogen and foreign DNA. Plasminogen bound to rMHJ_0461 was readily converted to plasmin in the presence of tPA. Computational modelling identified putative DNA and heparin-binding motifs on solvent-exposed sites around a large pore on the LAP hexamer. We conclude that MHJ_0461 is a LAP that moonlights as a multifunctional adhesin on the cell surface of M. hyopneumoniae.
Science, truth, and forensic cultures: the exceptional legal status of DNA evidence.
Lynch, Michael
2013-03-01
Many epistemological terms, such as investigation, inquiry, argument, evidence, and fact were established in law well before being associated with science. However, while legal proof remained qualified by standards of 'moral certainty', scientific proof attained a reputation for objectivity. Although most forms of legal evidence (including expert evidence) continue to be treated as fallible 'opinions' rather than objective 'facts', forensic DNA evidence increasingly is being granted an exceptional factual status. It did not always enjoy such status. Two decades ago, the scientific status of forensic DNA evidence was challenged in the scientific literature and in courts of law, but by the late 1990s it was being granted exceptional legal status. This paper reviews the ascendancy of DNA profiling, and argues that its widely-heralded objective status is bound up with systems of administrative accountability. The 'administrative objectivity' of DNA evidence rests upon observable and reportable bureaucratic rules, records, recording devices, protocols, and architectural arrangements. By highlighting administrative sources of objectivity, this paper suggests that DNA evidence remains bound within the context of ordinary organisational and practical routines, and is not a transcendent source of 'truth' in the criminal justice system. Copyright © 2012. Published by Elsevier Ltd.
Directory of Open Access Journals (Sweden)
Felipe Merino
2015-06-01
Full Text Available Highly specific transcriptional regulation depends on the cooperative association of transcription factors into enhanceosomes. Usually, their DNA-binding cooperativity originates from either direct interactions or DNA-mediated allostery. Here, we performed unbiased molecular simulations followed by simulations of protein-DNA unbinding and free energy profiling to study the cooperative DNA recognition by OCT4 and SOX2, key components of enhanceosomes in pluripotent cells. We found that SOX2 influences the orientation and dynamics of the DNA-bound configuration of OCT4. In addition SOX2 modifies the unbinding free energy profiles of both DNA-binding domains of OCT4, the POU specific and POU homeodomain, despite interacting directly only with the first. Thus, we demonstrate that the OCT4-SOX2 cooperativity is modulated by an interplay between protein-protein interactions and DNA-mediated allostery. Further, we estimated the change in OCT4-DNA binding free energy due to the cooperativity with SOX2, observed a good agreement with experimental measurements, and found that SOX2 affects the relative DNA-binding strength of the two OCT4 domains. Based on these findings, we propose that available interaction partners in different biological contexts modulate the DNA exploration routes of multi-domain transcription factors such as OCT4. We consider the OCT4-SOX2 cooperativity as a paradigm of how specificity of transcriptional regulation is achieved through concerted modulation of protein-DNA recognition by different types of interactions.
An RNA polymerase II-and AGO4-associated protein acts in RNA-directed DNA methylation
Gao, Zhihuan; Liu, Hai-Liang; Daxinger, Lucia; Pontes, Olga; He, Xinjian; Qian, Weiqiang; Lin, Huixin; Xie, Mingtang; Lorkovic, Zdravko J.; Zhang, ShouDong; Miki, Daisuke; Zhan, Xianqiang; Pontier, Dominique; Lagrange, Thierry; Jin, Hailing; Matzke, Antonius J.; Matzke, Marjori; Pikaard, Craig S.; Zhu, Jian-Kang
2010-01-01
DNA methylation is an important epigenetic mark in many eukaryotes. In plants, 24-nucleotide small interfering RNAs (siRNAs) bound to the effector protein, Argonaute 4 (AGO4), can direct de novo DNA methylation by the methyltransferase DRM2 (refs 2
Pulse radiolysis studies on DNA-Binding radioprotectors
International Nuclear Information System (INIS)
Anderson, R.F.
1996-01-01
Full text: Hoechst 33342 and newly-synthesised analogues exhibit radioprotective activity in cultured cells and in vivo, as described in accompanying abstracts. These minor groove binding ligands bind at discreet sites in DNA, characterised by 3 to 4 consecutive AT base pairs, and DNA sequencing studies have shown focussed radioprotection at these binding sites. There is evidence that the bound ligands also confer more 'global' protection including the intervening DNA between the binding sites. The observed focussed radioprotection could be explained by H-atom donation from the ligand to radiation-induced carbon-centred deoxyribosyl radicals, but this mechanism is unlikely to account for the global radioprotection. We now report pulse radiolysis studies on another possible mechanism, namely reduction of transient radiation-induced oxidising species on DNA by the ligand, which is consistent with the report of reduction of G + by TMPD. Oxidation of deoxyguanosine (dG) by Br 2 - , produced by radiolysis of Br- in N 2 0-saturated solutions, in the presence of Hoechst 33342 results in the appearance of a transient ligand species which is kinetically resolvable from that obtained from direct oxidation of Hoechst 33342 by Br 2 - . A plot of reaction rate versus ligand concentration indicates that the rate constant for reduction of G + is approximately 3 x 10 8 dm 3 M -1 sec -1 . Similar experiments with DNA, rather than dG, also revealed a transient species corresponding to oxidation of the ligand, but the absolute rate of oxidation was considerably slower for the DNA-bound ligand compared to that for oxidation of the free ligand by G+. These results are clearly consistent with the proposed mechanism of radioprotection by Hoechst 33342 and its analogues, moreover, pulse radiolysis may provide a very useful endpoint for screening new analogues, as a preliminary to radiobiological evaluation
Sensitive Fluorescent Sensor for Recognition of HIV-1 dsDNA by Using Glucose Oxidase and Triplex DNA
Directory of Open Access Journals (Sweden)
Yubin Li
2018-01-01
Full Text Available A sensitive fluorescent sensor for sequence-specific recognition of double-stranded DNA (dsDNA was developed on the surface of silver-coated glass slide (SCGS. Oligonucleotide-1 (Oligo-1 was designed to assemble on the surface of SCGS and act as capture DNA, and oligonucleotide-2 (Oligo-2 was designed as signal DNA. Upon addition of target HIV-1 dsDNA (Oligo-3•Oligo-4, signal DNA could bind on the surface of silver-coated glass because of the formation of C•GoC in parallel triplex DNA structure. Biotin-labeled glucose oxidase (biotin-GOx could bind to signal DNA through the specific interaction of biotin-streptavidin, thereby GOx was attached to the surface of SCGS, which was dependent on the concentration of target HIV-1 dsDNA. GOx could catalyze the oxidation of glucose and yield H2O2, and the HPPA can be oxidized into a fluorescent product in the presence of HRP. Therefore, the concentration of target HIV-1 dsDNA could be estimated with fluorescence intensity. Under the optimum conditions, the fluorescence intensity was proportional to the concentration of target HIV-1 dsDNA over the range of 10 pM to 1000 pM, the detection limit was 3 pM. Moreover, the sensor had good sequence selectivity and practicability and might be applied for the diagnosis of HIV disease in the future.
Domain structure of a NHEJ DNA repair ligase from Mycobacterium tuberculosis.
Pitcher, Robert S; Tonkin, Louise M; Green, Andrew J; Doherty, Aidan J
2005-08-19
A prokaryotic non-homologous end-joining (NHEJ) system for the repair of DNA double-strand breaks (DSBs), composed of a Ku homodimer (Mt-Ku) and a multidomain multifunctional ATP-dependent DNA ligase (Mt-Lig), has been described recently in Mycobacterium tuberculosis. Mt-Lig exhibits polymerase and nuclease activity in addition to DNA ligation activity. These functions were ascribed to putative polymerase, nuclease and ligase domains that together constitute a monomeric protein. Here, the separate polymerase, nuclease and ligase domains of Mt-Lig were cloned individually, over-expressed and the soluble proteins purified to homogeneity. The polymerase domain demonstrated DNA-dependent RNA primase activity, catalysing the synthesis of unprimed oligoribonucleotides on single-stranded DNA templates. The polymerase domain can also extend DNA in a template-dependent manner. This activity was eliminated when the catalytic aspartate residues were replaced with alanine. The ligase domain catalysed the sealing of nicked double-stranded DNA designed to mimic a DSB, consistent with the role of Mt-Lig in NHEJ. Deletion of the active-site lysine residue prevented the formation of an adenylated ligase complex and consequently thwarted ligation. The nuclease domain did not function independently as a 3'-5' exonuclease. DNA-binding assays revealed that both the polymerase and ligase domains bind DNA in vitro, the latter with considerably higher affinity. Mt-Ku directly stimulated the polymerase and nuclease activities of Mt-Lig. The polymerase domain bound Mt-Ku in vitro, suggesting it may recruit Mt-Lig to Ku-bound DNA in vivo. Consistent with these data, Mt-Ku stimulated the primer extension activity of the polymerase domain, suggestive of a functional interaction relevant to NHEJ-mediated DSB repair processes.
An upper bound solution for the spread extrusion of elliptical sections
International Nuclear Information System (INIS)
Abrinia, K.; Makaremi, M.
2007-01-01
The three dimensional problem of extrusion of elliptical sections with side material flow or spread has been formulated using the upper bound theory. The shape of the die for such a process is such that it could allow the material to flow sideways as well as in the forward direction. When flat faced dies are used a deforming region is developed with dead metal zones. Therefore this deforming region has been represented in the formulation based on the definitions of streamlines and stream surfaces. A generalized kinematically admissible velocity field was then derived for this formulation and strain rate components obtained for the upper bound solution. The general formulation for the deforming region and the velocity and strain rate fields allow for the optimization of the upper bound solution so that the nearest geometry of the deforming region and dead metal zone to the actual one was obtained.Using this geometry a die with similar surfaces to those of the dead metal zone is designed having converging and diverging surfaces to lead the material flow. The analysis was also carried out for this die and results were obtained showing a reduction in the extrusion pressure compared to the flat faced die. Effects of reduction of area, shape complexity, spread ratio and friction on the extrusion process were also investigated
Arinaga, K; Rant, U; Tornow, M; Fujita, S; Abstreiter, G; Yokoyama, N
2006-06-20
We study the coadsorption of mercaptohexanol onto preimmobilized oligonucleotide layers on gold. Monitoring the position of the DNA relative to the surface by optical means directly shows the mercaptohexanol-induced desorption of DNA and the reorientation of surface-tethered strands in situ and in real time. By simultaneously recording the electrochemical electrode potential, we are able to demonstrate that changes in the layer conformation are predominantly of electrostatic origin and can be reversed by applying external bias to the substrate.
Watkins, Herschel M.; Vallée-Bélisle, Alexis; Ricci, Francesco; Makarov, Dmitrii E.; Plaxco, Kevin W.
2012-01-01
Surface-tethered biomolecules play key roles in many biological processes and biotechnologies. However, while the physical consequences of such surface attachment have seen significant theoretical study, to date this issue has seen relatively little experimental investigation. In response we present here a quantitative experimental and theoretical study of the extent to which attachment to a charged –but otherwise apparently inert– surface alters the folding free energy of a simple biomolecule. Specifically, we have measured the folding free energy of a DNA stem loop both in solution and when site-specifically attached to a negatively charged, hydroxyl-alkane-coated gold surface. We find that, whereas surface attachment is destabilizing at low ionic strength it becomes stabilizing at ionic strengths above ~130 mM. This behavior presumably reflects two competing mechanisms: excluded volume effects, which stabilize the folded conformation by reducing the entropy of the unfolded state, and electrostatics, which, at lower ionic strengths, destabilizes the more compact folded state via repulsion from the negatively charged surface. To test this hypothesis we have employed existing theories of the electrostatics of surface-bound polyelectrolytes and the entropy of surface-bound polymers to model both effects. Despite lacking any fitted parameters, these theoretical models quantitatively fit our experimental results, suggesting that, for this system, current knowledge of both surface electrostatics and excluded volume effects is reasonably complete and accurate. PMID:22239220
Directory of Open Access Journals (Sweden)
Masudur Rahman
2016-10-01
Full Text Available Although there is a long history of the study of the interaction of DNA with carbon surfaces, limited information exists regarding the interaction of complex DNA-based nanostructures with the important material graphite, which is closely related to graphene. In view of the capacity of DNA to direct the assembly of proteins and optical and electronic nanoparticles, the potential for combining DNA-based materials with graphite, which is an ultra-flat, conductive carbon substrate, requires evaluation. A series of imaging studies utilizing Atomic Force Microscopy has been applied in order to provide a unified picture of this important interaction of structured DNA and graphite. For the test structure examined, we observe a rapid destabilization of the complex DNA origami structure, consistent with a strong interaction of single-stranded DNA with the carbon surface. This destabilizing interaction can be obscured by an intentional or unintentional primary intervening layer of single-stranded DNA. Because the interaction of origami with graphite is not completely dissociative, and because the frustrated, expanded structure is relatively stable over time in solution, it is demonstrated that organized structures of pairs of the model protein streptavidin can be produced on carbon surfaces using DNA origami as the directing material.
Rahman, Masudur; Neff, David; Green, Nathaniel; Norton, Michael L.
2016-01-01
Although there is a long history of the study of the interaction of DNA with carbon surfaces, limited information exists regarding the interaction of complex DNA-based nanostructures with the important material graphite, which is closely related to graphene. In view of the capacity of DNA to direct the assembly of proteins and optical and electronic nanoparticles, the potential for combining DNA-based materials with graphite, which is an ultra-flat, conductive carbon substrate, requires evaluation. A series of imaging studies utilizing Atomic Force Microscopy has been applied in order to provide a unified picture of this important interaction of structured DNA and graphite. For the test structure examined, we observe a rapid destabilization of the complex DNA origami structure, consistent with a strong interaction of single-stranded DNA with the carbon surface. This destabilizing interaction can be obscured by an intentional or unintentional primary intervening layer of single-stranded DNA. Because the interaction of origami with graphite is not completely dissociative, and because the frustrated, expanded structure is relatively stable over time in solution, it is demonstrated that organized structures of pairs of the model protein streptavidin can be produced on carbon surfaces using DNA origami as the directing material. PMID:28335324
International Nuclear Information System (INIS)
Chen, Kai; Roberts, Gareth A.; Stephanou, Augoustinos S.; Cooper, Laurie P.; White, John H.; Dryden, David T.F.
2010-01-01
Research highlights: → Successful fusion of GFP to M.EcoKI DNA methyltransferase. → GFP located at C-terminal of sequence specificity subunit does not later enzyme activity. → FRET confirms structural model of M.EcoKI bound to DNA. -- Abstract: We describe the fusion of enhanced green fluorescent protein to the C-terminus of the HsdS DNA sequence-specificity subunit of the Type I DNA modification methyltransferase M.EcoKI. The fusion expresses well in vivo and assembles with the two HsdM modification subunits. The fusion protein functions as a sequence-specific DNA methyltransferase protecting DNA against digestion by the EcoKI restriction endonuclease. The purified enzyme shows Foerster resonance energy transfer to fluorescently-labelled DNA duplexes containing the target sequence and to fluorescently-labelled ocr protein, a DNA mimic that binds to the M.EcoKI enzyme. Distances determined from the energy transfer experiments corroborate the structural model of M.EcoKI.
Radiation damage to DNA-binding proteins
International Nuclear Information System (INIS)
Culard, G.; Eon, S.; DeVuyst, G.; Charlier, M.; Spotheim-Maurizot, M.
2003-01-01
The DNA-binding properties of proteins are strongly affected upon irradiation. The tetrameric lactose repressor (a dimer of dimers) losses its ability to bind operator DNA as soon as at least two damages per protomer of each dimer occur. The monomeric MC1 protein losses its ability to bind DNA in two steps : i) at low doses only the specific binding is abolished, whereas the non-specific one is still possible; ii) at high doses all binding vanishes. Moreover, the DNA bending induced by MC1 binding is less pronounced for a protein that underwent the low dose irradiation. When the entire DNA-protein complexes are irradiated, the observed disruption of the complexes is mainly due to the damage of the proteins and not to that of DNA. The doses necessary for complex disruption are higher than those inactivating the free protein. This difference, larger for MC1 than for lactose repressor, is due to the protection of the protein by the bound DNA. The oxidation of the protein side chains that are accessible to the radiation-induced hydroxyl radicals seems to represent the inactivating damage
Dna2 nuclease-helicase structure, mechanism and regulation by Rpa.
Zhou, Chun; Pourmal, Sergei; Pavletich, Nikola P
2015-11-02
The Dna2 nuclease-helicase maintains genomic integrity by processing DNA double-strand breaks, Okazaki fragments and stalled replication forks. Dna2 requires ssDNA ends, and is dependent on the ssDNA-binding protein Rpa, which controls cleavage polarity. Here we present the 2.3 Å structure of intact mouse Dna2 bound to a 15-nucleotide ssDNA. The nuclease active site is embedded in a long, narrow tunnel through which the DNA has to thread. The helicase domain is required for DNA binding but not threading. We also present the structure of a flexibly-tethered Dna2-Rpa interaction that recruits Dna2 to Rpa-coated DNA. We establish that a second Dna2-Rpa interaction is mutually exclusive with Rpa-DNA interactions and mediates the displacement of Rpa from ssDNA. This interaction occurs at the nuclease tunnel entrance and the 5' end of the Rpa-DNA complex. Hence, it only displaces Rpa from the 5' but not 3' end, explaining how Rpa regulates cleavage polarity.
Gorodetsky, Alon A.; Buzzeo, Marisa C.
2009-01-01
The base pair stack of DNA has been demonstrated as a medium for long range charge transport chemistry both in solution and at DNA-modified surfaces. This chemistry is exquisitely sensitive to structural perturbations in the base pair stack as occur with lesions, single base mismatches, and protein binding. We have exploited this sensitivity for the development of reliable electrochemical assays based on DNA charge transport at self-assembled DNA monolayers. Here we discuss the characteristic features, applications, and advantages of DNA-mediated electrochemistry. PMID:18980370
Energy Technology Data Exchange (ETDEWEB)
Wang, Jen-Yeu; Sarker, Altaf Hossain; Cooper, Priscilla K.; Volkert, Michael R.
2004-02-01
Human positive cofactor 4 (PC4) is a transcriptional coactivator with a highly conserved single-strand DNA (ssDNA) binding domain of unknown function. We identified PC4 as a suppressor of the oxidative mutator phenotype of the Escherichia coli fpg mutY mutant and demonstrate that this suppression requires its ssDNA binding activity. Yeast mutants lacking their PC4 ortholog Sub1 are sensitive to hydrogen peroxide and exhibit spontaneous and peroxide induced hypermutability. PC4 expression suppresses the peroxide sensitivity of the yeast sub l{Delta} mutant, suggesting that the human protein has a similar function. A role for yeast and human proteins in DNA repair is suggested by the demonstration that Sub1 acts in a peroxide-resistance pathway involving Rad2 and by the physical interaction of PC4 with the human Rad2 homolog XPG. We show XPG recruits PC4 to a bubble-containing DNA substrate with resulting displacement of XPG and formation of a PC4-DNA complex. We discuss the possible requirement for PC4 in either global or transcription-coupled repair of oxidative DNA damage to mediate the release of XPG bound to its substrate.
International Nuclear Information System (INIS)
Iwanaga, Kentaro; Sueoka, Naoko; Sato, Akemi; Hayashi, Shinichiro; Sueoka, Eisaburo
2005-01-01
Heterogeneous nuclear ribonucleoprotein B1, an RNA binding protein, is overexpressed from the early stage of lung cancers; it is evident even in bronchial dysplasia, a premalignant lesion. We evaluated the proteins bound with hnRNP B1 and found that hnRNP B1 interacted with DNA-dependent protein kinase (DNA-PK) complex, and recombinant hnRNP B1 protein dose-dependently inhibited DNA-PK activity in vitro. To test the effect of hnRNP B1 on DNA repair, we performed comet assay after irradiation, using normal human bronchial epithelial (HBE) cells treated with siRNA for hnRNP A2/B1: reduction of hnRNP B1 treated with siRNA for hnRNP A2/B1 induced faster DNA repair in normal HBE cells. Considering these results, we assume that overexpression of hnRNP B1 occurring in the early stage of carcinogenesis inhibits DNA-PK activity, resulting in subsequent accumulation of erroneous rejoining of DNA double-strand breaks, causing tumor progression
Khan, M Nuruzzaman; Tjong, Vinalia; Chilkoti, Ashutosh; Zharnikov, Michael
2013-08-29
We used a combination of synchrotron-based X-ray photoelectron spectroscopy (XPS) and angle-resolved near-edge X-ray absorption fine structure (NEXAFS) spectroscopy to study the chemical integrity, purity, and possible internal alignment of single-strand (ss) adenine deoxynucleotide (poly(A)) DNA brushes. The brushes were synthesized by surface-initiated enzymatic polymerization (SIEP) on a 25-mer of adenine self-assembled monolayer (SAM) on gold (A25-SH), wherein the terminal 3'-OH of the A25-SH serve as the initiation sites for SIEP of poly(A). XPS and NEXAFS spectra of poly(A) brushes were found to be almost identical to those of A25-SH initiator, with no unambiguous traces of contamination. Apart from the well-defined chemical integrity and contamination-free character, the brushes were found to have a high degree of orientational order, with an upright orientation of individual strands, despite their large thickness up to ~55 nm, that corresponds to a chain length of at least several hundred nucleotides for individual ssDNA molecules. The orientational order exhibited by these poly(A) DNA brushes, mediated presumably by base stacking, was found to be independent of the brush thickness as long as the packing density was high enough. The well-defined character and orientational ordering of the ssDNA brushes make them a potentially promising system for different applications.
Energy Technology Data Exchange (ETDEWEB)
Green, Nathaniel S.; Norton, Michael L., E-mail: norton@marshall.edu
2015-01-01
Highlights: • The interaction of DNA, including DNA nanostructures, and graphene is reviewed. • Comparison of DNA graphene field-effect transistor (GFET) with other detection methods. • Discussion of challenges present in the detection mechanism of GFETs. • Use of DNA aptamer GFET sensors for the detection of small molecules and proteins. - Abstract: Graphene field-effect transistors (GFET) have emerged as powerful detection platforms enabled by the advent of chemical vapor deposition (CVD) production of the unique atomically thin 2D material on a large scale. DNA aptamers, short target-specific oligonucleotides, are excellent sensor moieties for GFETs due to their strong affinity to graphene, relatively short chain-length, selectivity, and a high degree of analyte variability. However, the interaction between DNA and graphene is not fully understood, leading to questions about the structure of surface-bound DNA, including the morphology of DNA nanostructures and the nature of the electronic response seen from analyte binding. This review critically evaluates recent insights into the nature of the DNA graphene interaction and its affect on sensor viability for DNA, small molecules, and proteins with respect to previously established sensing methods. We first discuss the sorption of DNA to graphene to introduce the interactions and forces acting in DNA based GFET devices and how these forces can potentially affect the performance of increasingly popular DNA aptamers and even future DNA nanostructures as sensor substrates. Next, we discuss the novel use of GFETs to detect DNA and the underlying electronic phenomena that are typically used as benchmarks for characterizing the analyte response of these devices. Finally, we address the use of DNA aptamers to increase the selectivity of GFET sensors for small molecules and proteins and compare them with other, state of the art, detection methods.
2013-03-26
...; Comment Request; Upward Bound and Upward Bound Math Science Annual Performance Report AGENCY: The Office... considered public records. Title of Collection: Upward Bound and Upward Bound Math Science Annual Performance...) and Upward Bound Math and Science (UBMS) Programs. The Department is requesting a new APR because of...
Universal bounds on current fluctuations.
Pietzonka, Patrick; Barato, Andre C; Seifert, Udo
2016-05-01
For current fluctuations in nonequilibrium steady states of Markovian processes, we derive four different universal bounds valid beyond the Gaussian regime. Different variants of these bounds apply to either the entropy change or any individual current, e.g., the rate of substrate consumption in a chemical reaction or the electron current in an electronic device. The bounds vary with respect to their degree of universality and tightness. A universal parabolic bound on the generating function of an arbitrary current depends solely on the average entropy production. A second, stronger bound requires knowledge both of the thermodynamic forces that drive the system and of the topology of the network of states. These two bounds are conjectures based on extensive numerics. An exponential bound that depends only on the average entropy production and the average number of transitions per time is rigorously proved. This bound has no obvious relation to the parabolic bound but it is typically tighter further away from equilibrium. An asymptotic bound that depends on the specific transition rates and becomes tight for large fluctuations is also derived. This bound allows for the prediction of the asymptotic growth of the generating function. Even though our results are restricted to networks with a finite number of states, we show that the parabolic bound is also valid for three paradigmatic examples of driven diffusive systems for which the generating function can be calculated using the additivity principle. Our bounds provide a general class of constraints for nonequilibrium systems.
Kneuer, C; Sameti, M; Bakowsky, U; Schiestel, T; Schirra, H
2000-01-01
Diverse polycationic polymers have been used as nonviral transfection agents. Here we report the ability of colloidal silica particles with covalently attached cationic surface modifications to transfect plasmid DNA in vitro and make an attempt to describe the structure of the resulting transfection
Mechanochemical regulations of RPA's binding to ssDNA
Chen, Jin; Le, Shimin; Basu, Anindita; Chazin, Walter J.; Yan, Jie
2015-03-01
Replication protein A (RPA) is a ubiquitous eukaryotic single-stranded DNA (ssDNA) binding protein that serves to protect ssDNA from degradation and annealing, and as a template for recruitment of many downstream factors in virtually all DNA transactions in cell. During many of these transactions, DNA is tethered and is likely subject to force. Previous studies of RPA's binding behavior on ssDNA were conducted in the absence of force; therefore the RPA-ssDNA conformations regulated by force remain unclear. Here, using a combination of atomic force microscopy imaging and mechanical manipulation of single ssDNA tethers, we show that force mediates a switch of the RPA bound ssDNA from amorphous aggregation to a much more regular extended conformation. Further, we found an interesting non-monotonic dependence of the binding affinity on monovalent salt concentration in the presence of force. In addition, we discovered that zinc in micromolar concentrations drives ssDNA to a unique, highly stiff and more compact state. These results provide new mechanochemical insights into the influences and the mechanisms of action of RPA on large single ssDNA.
DNA Electrochemistry with Tethered Methylene Blue
Pheeney, Catrina G.
2012-01-01
Methylene blue (MB′), covalently attached to DNA through a flexible C12 alkyl linker, provides a sensitive redox reporter in DNA electrochemistry measurements. Tethered, intercalated MB′ is reduced through DNA-mediated charge transport; the incorporation of a single base mismatch at position 3, 10, or 14 of a 17-mer causes an attenuation of the signal to 62 ± 3% of the well-matched DNA, irrespective of position in the duplex. The redox signal intensity for MB′–DNA is found to be least 3-fold larger than that of Nile blue (NB)–DNA, indicating that MB′ is even more strongly coupled to the π-stack. The signal attenuation due to an intervening mismatch does, however, depend on DNA film density and the backfilling agent used to passivate the surface. These results highlight two mechanisms for reduction of MB′ on the DNA-modified electrode: reduction mediated by the DNA base pair stack and direct surface reduction of MB′ at the electrode. These two mechanisms are distinguished by their rates of electron transfer that differ by 20-fold. The extent of direct reduction at the surface can be controlled by assembly and buffer conditions. PMID:22512327
Quivers of Bound Path Algebras and Bound Path Coalgebras
Directory of Open Access Journals (Sweden)
Dr. Intan Muchtadi
2010-09-01
Full Text Available bras and coalgebras can be represented as quiver (directed graph, and from quiver we can construct algebras and coalgebras called path algebras and path coalgebras. In this paper we show that the quiver of a bound path coalgebra (resp. algebra is the dual quiver of its bound path algebra (resp. coalgebra.
Directory of Open Access Journals (Sweden)
Janet L Smith
2015-05-01
Full Text Available DnaA, the replication initiation protein in bacteria, is an AAA+ ATPase that binds and hydrolyzes ATP and exists in a heterogeneous population of ATP-DnaA and ADP-DnaA. DnaA binds cooperatively to the origin of replication and several other chromosomal regions, and functions as a transcription factor at some of these regions. We determined the binding properties of Bacillus subtilis DnaA to genomic DNA in vitro at single nucleotide resolution using in vitro DNA affinity purification and deep sequencing (IDAP-Seq. We used these data to identify 269 binding regions, refine the consensus sequence of the DnaA binding site, and compare the relative affinity of binding regions for ATP-DnaA and ADP-DnaA. Most sites had a slightly higher affinity for ATP-DnaA than ADP-DnaA, but a few had a strong preference for binding ATP-DnaA. Of the 269 sites, only the eight strongest binding ones have been observed to bind DnaA in vivo, suggesting that other cellular factors or the amount of available DnaA in vivo restricts DnaA binding to these additional sites. Conversely, we found several chromosomal regions that were bound by DnaA in vivo but not in vitro, and that the nucleoid-associated protein Rok was required for binding in vivo. Our in vitro characterization of the inherent ability of DnaA to bind the genome at single nucleotide resolution provides a backdrop for interpreting data on in vivo binding and regulation of DnaA, and is an approach that should be adaptable to many other DNA binding proteins.
Archaeal RNA polymerase arrests transcription at DNA lesions.
Gehring, Alexandra M; Santangelo, Thomas J
2017-01-01
Transcription elongation is not uniform and transcription is often hindered by protein-bound factors or DNA lesions that limit translocation and impair catalysis. Despite the high degree of sequence and structural homology of the multi-subunit RNA polymerases (RNAP), substantial differences in response to DNA lesions have been reported. Archaea encode only a single RNAP with striking structural conservation with eukaryotic RNAP II (Pol II). Here, we demonstrate that the archaeal RNAP from Thermococcus kodakarensis is sensitive to a variety of DNA lesions that pause and arrest RNAP at or adjacent to the site of DNA damage. DNA damage only halts elongation when present in the template strand, and the damage often results in RNAP arresting such that the lesion would be encapsulated with the transcription elongation complex. The strand-specific halt to archaeal transcription elongation on modified templates is supportive of RNAP recognizing DNA damage and potentially initiating DNA repair through a process akin to the well-described transcription-coupled DNA repair (TCR) pathways in Bacteria and Eukarya.
Combined Triplex/Duplex Invasion of Double-Stranded DNA by "Tail-Clamp" Peptide Nucleic Acid
DEFF Research Database (Denmark)
Bentin, Thomas; Larsen, H. J.; Nielsen, Peter E.
2003-01-01
as determined by T-m measurements. Binding to double-stranded (ds) DNA occurred by combined triplex and duplex invasion as analyzed by permanganate probing. Furthermore, C-50 measurements revealed that tail-clamp PNAs consistently bound the dsDNA target more efficiently, and kinetics experiments revealed...
International Nuclear Information System (INIS)
Meerman, J.H.; Smith, T.R.; Pearson, P.G.; Meier, G.P.; Nelson, S.D.
1989-01-01
The interaction of the mutagen 2-bromoacrolein (2BA) with DNA and thymidine was studied in vitro by reaction of [3-3H]2BA with thymidine, RNA, single-stranded DNA, and double-stranded DNA in phosphate buffer (pH 7.4). After purification of the nucleic acids, they were incubated at alkaline pH to convert any (hydroxybromo)propano(deoxy)-guanosine adducts to their dihydroxy analogues. After acid or enzymatic hydrolysis, the hydrolysates were analyzed by reversed-phase high-performance liquid chromatography. At a concentration of 1.6 mM, the fraction of 2BA that became covalently bound to DNA was 2.3% of the amount added. Only 3% of the radioactivity bound to DNA after extensive purification could be accounted for as cyclic 1,N2-(6,7-dihydroxy)-propanoguanine adducts. More 2BA became covalently bound to single-stranded DNA and RNA as compared with double-stranded DNA. However, high-performance liquid chromatographic analyses showed that formation of cyclic 1,N2-(6,7-dihydroxy)propanoguanine adducts was also a minor reaction with these macromolecules. Because these data showed that other type(s) of reaction(s) are more important in the reaction of 2BA with nucleic acids, we have investigated the reaction of 2BA with other nucleosides. It was found that 2BA reacted well with thymidine in vitro, and the major product was identified by 500 MHz 1H and 75.43 MHz 13C nuclear magnetic resonance and thermospray mass spectrometry as 3-(2-bromo-3-oxopropyl)thymidine. This adduct was unstable and decomposed upon storage. After enzymatic hydrolysis of [3H]2BA-modified double-stranded DNA and subsequent analysis of the hydrolysate by high-performance liquid chromatography, 22% of the covalently bound radioactivity to DNA coeluted with decomposition products of the 3-(bromooxypropyl)thymidine adduct
Finite translation surfaces with maximal number of translations
Schlage-Puchta, Jan-Christoph; Weitze-Schmithuesen, Gabriela
2013-01-01
The natural automorphism group of a translation surface is its group of translations. For finite translation surfaces of genus g > 1 the order of this group is naturally bounded in terms of g due to a Riemann-Hurwitz formula argument. In analogy with classical Hurwitz surfaces, we call surfaces which achieve the maximal bound Hurwitz translation surfaces. We study for which g there exist Hurwitz translation surfaces of genus g.
International Nuclear Information System (INIS)
Berger, N.A.
1985-01-01
Poly(ADP-ribose) polymerase is a chromatin-bound enzyme which, on activation by DNA strand breaks, catalyzes the successive transfer of ADP-ribose units from NAD to nuclear proteins. Poly(ADP-ribose) synthesis is stimulated by DNA strand breaks, and the polymer may alter the structure and/or function of chromosomal proteins to facilitate the DNA repair process. Inhibitors of Poly(ADP-ribose) polymerase or deficiencies of the substrate, NAD, lead to retardation of the DNA repair process. When DNA strand breaks are extensive or when breaks fail to be repaired, the stimulus for activation of Poly(ADP-ribose) persists and the activated enzyme is capable of totaly consuming cellular pools of NAD. Depletion of NAD and consequent lowering of cellular ATP pools, due to activation of Poly(ADP-ribose) polymerase, may account for rapid cell death before DNA repair takes place and before the genetic effects of DNA damage become manifest
Counterion effects on nano-confined metal–drug–DNA complexes
Directory of Open Access Journals (Sweden)
Nupur Biswas
2016-01-01
Full Text Available We have explored morphology of DNA molecules bound with Cu complexes of piroxicam (a non-steroidal anti-inflammatory drug molecules under one-dimensional confinement of thin films and have studied the effect of counterions present in a buffer. X-ray reflectivity at and away from the Cu K absorption edge and atomic force microscopy studies reveal that confinement segregates the drug molecules preferentially in a top layer of the DNA film, and counterions enhance this segregation.
The persistence of human DNA in soil following surface decomposition.
Emmons, Alexandra L; DeBruyn, Jennifer M; Mundorff, Amy Z; Cobaugh, Kelly L; Cabana, Graciela S
2017-09-01
Though recent decades have seen a marked increase in research concerning the impact of human decomposition on the grave soil environment, the fate of human DNA in grave soil has been relatively understudied. With the purpose of supplementing the growing body of literature in forensic soil taphonomy, this study assessed the relative persistence of human DNA in soil over the course of decomposition. Endpoint PCR was used to assess the presence or absence of human nuclear and mitochondrial DNA, while qPCR was used to evaluate the quantity of human DNA recovered from the soil beneath four cadavers at the University of Tennessee's Anthropology Research Facility (ARF). Human nuclear DNA from the soil was largely unrecoverable, while human mitochondrial DNA was detectable in the soil throughout all decomposition stages. Mitochondrial DNA copy abundances were not significantly different between decomposition stages and were not significantly correlated to soil edaphic parameters tested. There was, however, a significant positive correlation between mitochondrial DNA copy abundances and the human associated bacteria, Bacteroides, as estimated by 16S rRNA gene abundances. These results show that human mitochondrial DNA can persist in grave soil and be consistently detected throughout decomposition. Copyright © 2017 The Chartered Society of Forensic Sciences. Published by Elsevier B.V. All rights reserved.
DNA biosensor by self-assembly of carbon nanotubes and DNA to detect riboflavin
Energy Technology Data Exchange (ETDEWEB)
Li Jing [College of Chemistry and Chemical Engineering. Chongqing University, ChongQing, 400044 (China); Zhang Yunhuai, E-mail: xp2031@163.com [College of Chemistry and Chemical Engineering. Chongqing University, ChongQing, 400044 (China); Yang Tongyi [School of Life Science. NanJing University, Nanjing, 210093 (China); Zhang Huai [Liming Research Institute of Chemical Industry, LuoYang, 471001 (China); Yang Yixuan [State Key Laboratory of Chemical Resource Engineering. Beijing University of Chemical Technology, Beijing 100029 (China); Xiao Peng [College of Mathematics and Physics, Chongqing University, Chongqing 400044 (China)
2009-10-15
The fabrication of biosensors via self-assembly of single-walled carbon nanotubes (SWNTs) and DNA on a platinum electrode was presented in this paper. The carboxylic SWNTs were assembled on an amine-modified platinum electrode surface and followed by the assembly of NH{sub 2}-DNA with the carboxyl-amine coupling. The decorated surface was characterized by Field Emission Electron Microscopy (FEG-SEM) and electrochemical experiments, which showed that the reaction of DNA-SWNTs biosensor was quasi-reversible. The mechanism of DNA and riboflavin (VB{sub 2}) was studied by cyclic voltammetry and UV-Vis spectroscopy. The fabricated SWNTs-reinforced biosensor exhibits high sensitivity and low detection limit for the tested VB{sub 2} compared to the reported methods.
A Role for the Host DNA Damage Response in Hepatitis B Virus cccDNA Formation—and Beyond?
Directory of Open Access Journals (Sweden)
Sabrina Schreiner
2017-05-01
Full Text Available Chronic hepatitis B virus (HBV infection puts more than 250 million people at a greatly increased risk to develop end-stage liver disease. Like all hepadnaviruses, HBV replicates via protein-primed reverse transcription of a pregenomic (pg RNA, yielding an unusually structured, viral polymerase-linked relaxed-circular (RC DNA as genome in infectious particles. Upon infection, RC-DNA is converted into nuclear covalently closed circular (ccc DNA. Associating with cellular proteins into an episomal minichromosome, cccDNA acts as template for new viral RNAs, ensuring formation of progeny virions. Hence, cccDNA represents the viral persistence reservoir that is not directly targeted by current anti-HBV therapeutics. Eliminating cccDNA will thus be at the heart of a cure for chronic hepatitis B. The low production of HBV cccDNA in most experimental models and the associated problems in reliable cccDNA quantitation have long hampered a deeper understanding of cccDNA molecular biology. Recent advancements including cccDNA-dependent cell culture systems have begun to identify select host DNA repair enzymes that HBV usurps for RC-DNA to cccDNA conversion. While this list is bound to grow, it may represent just one facet of a broader interaction with the cellular DNA damage response (DDR, a network of pathways that sense and repair aberrant DNA structures and in the process profoundly affect the cell cycle, up to inducing cell death if repair fails. Given the divergent interactions between other viruses and the DDR it will be intriguing to see how HBV copes with this multipronged host system.
DNA and chromosome breaks induced by 123I-estrogen in CHO cells
International Nuclear Information System (INIS)
Schwartz, J.L.
1997-01-01
The effects of the Auger electron-emitting isotope I-123, covalently bound to estrogen, on DNA single- and double-strand breakage and on chromosome breakage was determined in estrogen positive Chinese hamster ovary (CHO-ER) cells. Exposure to the 123 I-estrogen induced both single- and double-strand breaks with a ratio of single- to double-strand breaks of 2.2. The corresponding ratio with 60 Co gamma rays was 15.6. The dose-response was biphasic suggesting that either receptor sites are saturated at high does, or that there is a nonrandom distribution of breaks induced by the 123 I-estrogen. The 123 I-estrogen treatment induced chromosome aberrations with an efficiency of about 1 aberration for each 1,000 disintegrations per cell. This corresponds to the mean lethal dose of 123 I-estrogen for these cells suggesting that the lethal event induced by the Auger electron emitter bound to estrogen is a chromosome aberration. Most of the chromosome-type aberrations were dicentrics and rings, suggesting that 123 I-estrogen-induced chromosome breaks are rejoined. The F-ratio, the ratio of dicentrics to centric rings, was 5.8 ± 1.7, which is similar to that seen with high LET radiations. Their results suggest that I-123 bound to estrogen is an efficient clastogenic agent, that the cytotoxic damage produced by I-123 bound to estrogen is very like high LET-induced damage, and the I-123 in the estrogen-receptor-DNA complex is probably in close proximity to the sugar-phosphate backbone of the DNA
Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process
Reshetnikov, Roman V.; Sponer, Jiri; Rassokhina, Olga I.; Kopylov, Alexei M.; Tsvetkov, Philipp O.; Makarov, Alexander A.; Golovin, Andrey V.
2011-01-01
A combination of explicit solvent molecular dynamics simulation (30 simulations reaching 4 µs in total), hybrid quantum mechanics/molecular mechanics approach and isothermal titration calorimetry was used to investigate the atomistic picture of ion binding to 15-mer thrombin-binding quadruplex DNA (G-DNA) aptamer. Binding of ions to G-DNA is complex multiple pathway process, which is strongly affected by the type of the cation. The individual ion-binding events are substantially modulated by the connecting loops of the aptamer, which play several roles. They stabilize the molecule during time periods when the bound ions are not present, they modulate the route of the ion into the stem and they also stabilize the internal ions by closing the gates through which the ions enter the quadruplex. Using our extensive simulations, we for the first time observed full spontaneous exchange of internal cation between quadruplex molecule and bulk solvent at atomistic resolution. The simulation suggests that expulsion of the internally bound ion is correlated with initial binding of the incoming ion. The incoming ion then readily replaces the bound ion while minimizing any destabilization of the solute molecule during the exchange. PMID:21893589
Ghosh, Sharmistha; Marintcheva, Boriana; Takahashi, Masateru; Richardson, Charles C
2009-10-30
Single-stranded DNA-binding protein (gp2.5), encoded by gene 2.5 of bacteriophage T7, plays an essential role in DNA replication. Not only does it remove impediments of secondary structure in the DNA, it also modulates the activities of the other replication proteins. The acidic C-terminal tail of gp2.5, bearing a C-terminal phenylalanine, physically and functionally interacts with the helicase and DNA polymerase. Deletion of the phenylalanine or substitution with a nonaromatic amino acid gives rise to a dominant lethal phenotype, and the altered gp2.5 has reduced affinity for T7 DNA polymerase. Suppressors of the dominant lethal phenotype have led to the identification of mutations in gene 5 that encodes the T7 DNA polymerase. The altered residues in the polymerase are solvent-exposed and lie in regions that are adjacent to the bound DNA. gp2.5 lacking the C-terminal phenylalanine has a lower affinity for gp5-thioredoxin relative to the wild-type gp2.5, and this affinity is partially restored by the suppressor mutations in DNA polymerase. gp2.5 enables T7 DNA polymerase to catalyze strand displacement DNA synthesis at a nick in DNA. The resulting 5'-single-stranded DNA tail provides a loading site for T7 DNA helicase. gp2.5 lacking the C-terminal phenylalanine does not support this event with wild-type DNA polymerase but does to a limited extent with T7 DNA polymerase harboring the suppressor mutations.
Ghosh, Sharmistha; Marintcheva, Boriana; Takahashi, Masateru; Richardson, Charles C.
2009-01-01
Single-stranded DNA-binding protein (gp2.5), encoded by gene 2.5 of bacteriophage T7, plays an essential role in DNA replication. Not only does it remove impediments of secondary structure in the DNA, it also modulates the activities of the other replication proteins. The acidic C-terminal tail of gp2.5, bearing a C-terminal phenylalanine, physically and functionally interacts with the helicase and DNA polymerase. Deletion of the phenylalanine or substitution with a nonaromatic amino acid gives rise to a dominant lethal phenotype, and the altered gp2.5 has reduced affinity for T7 DNA polymerase. Suppressors of the dominant lethal phenotype have led to the identification of mutations in gene 5 that encodes the T7 DNA polymerase. The altered residues in the polymerase are solvent-exposed and lie in regions that are adjacent to the bound DNA. gp2.5 lacking the C-terminal phenylalanine has a lower affinity for gp5-thioredoxin relative to the wild-type gp2.5, and this affinity is partially restored by the suppressor mutations in DNA polymerase. gp2.5 enables T7 DNA polymerase to catalyze strand displacement DNA synthesis at a nick in DNA. The resulting 5′-single-stranded DNA tail provides a loading site for T7 DNA helicase. gp2.5 lacking the C-terminal phenylalanine does not support this event with wild-type DNA polymerase but does to a limited extent with T7 DNA polymerase harboring the suppressor mutations. PMID:19726688
A model for the mechanism of strand passage by DNA gyrase
DEFF Research Database (Denmark)
Kampranis, S C; Bates, A D; Maxwell, A
1999-01-01
this mechanism by probing the topology of the bound DNA segment at distinct steps of the catalytic cycle. We propose a model in which gyrase captures a contiguous DNA segment with high probability, irrespective of the superhelical density of the DNA substrate, setting up an equilibrium of the transported segment......The mechanism of type II DNA topoisomerases involves the formation of an enzyme-operated gate in one double-stranded DNA segment and the passage of another segment through this gate. DNA gyrase is the only type II topoisomerase able to introduce negative supercoils into DNA, a feature that requires...... the enzyme to dictate the directionality of strand passage. Although it is known that this is a consequence of the characteristic wrapping of DNA by gyrase, the detailed mechanism by which the transported DNA segment is captured and directed through the DNA gate is largely unknown. We have addressed...
Effect of serotonin on the yield of UV-induced thymine dimers in DNA
International Nuclear Information System (INIS)
Frajkin, G.Ya.; Strakhovskaya, M.G.; Ivanova, Eh.V.
1985-01-01
Using fluorescence method serotonin interaction with DNA is studied and bond constant Ksub(c)=4.2x10 4 M -1 is defined. It is shown that bound serotonin reduces yield of UV-induced thymine dimers. Value of efficient distance of protective serotonin effect constituting part of DNA chain of 4 base pairs, is determined
A novel low energy electron microscope for DNA sequencing and surface analysis
Energy Technology Data Exchange (ETDEWEB)
Mankos, M., E-mail: marian@electronoptica.com [Electron Optica Inc., 1000 Elwell Court #110, Palo Alto, CA 94303 (United States); Shadman, K. [Electron Optica Inc., 1000 Elwell Court #110, Palo Alto, CA 94303 (United States); Persson, H.H.J. [Stanford Genome Technology Center, Stanford University School of Medicine, 855 California Avenue, Palo Alto, CA 94304 (United States); N’Diaye, A.T. [Electron Optica Inc., 1000 Elwell Court #110, Palo Alto, CA 94303 (United States); NCEM, Lawrence Berkeley National Laboratory, 1 Cyclotron Road, Berkeley, CA 94720 (United States); Schmid, A.K. [NCEM, Lawrence Berkeley National Laboratory, 1 Cyclotron Road, Berkeley, CA 94720 (United States); Davis, R.W. [Stanford Genome Technology Center, Stanford University School of Medicine, 855 California Avenue, Palo Alto, CA 94304 (United States)
2014-10-15
Monochromatic, aberration-corrected, dual-beam low energy electron microscopy (MAD-LEEM) is a novel technique that is directed towards imaging nanostructures and surfaces with sub-nanometer resolution. The technique combines a monochromator, a mirror aberration corrector, an energy filter, and dual beam illumination in a single instrument. The monochromator reduces the energy spread of the illuminating electron beam, which significantly improves spectroscopic and spatial resolution. Simulation results predict that the novel aberration corrector design will eliminate the second rank chromatic and third and fifth order spherical aberrations, thereby improving the resolution into the sub-nanometer regime at landing energies as low as one hundred electron-Volts. The energy filter produces a beam that can extract detailed information about the chemical composition and local electronic states of non-periodic objects such as nanoparticles, interfaces, defects, and macromolecules. The dual flood illumination eliminates charging effects that are generated when a conventional LEEM is used to image insulating specimens. A potential application for MAD-LEEM is in DNA sequencing, which requires high resolution to distinguish the individual bases and high speed to reduce the cost. The MAD-LEEM approach images the DNA with low electron impact energies, which provides nucleobase contrast mechanisms without organometallic labels. Furthermore, the micron-size field of view when combined with imaging on the fly provides long read lengths, thereby reducing the demand on assembling the sequence. Experimental results from bulk specimens with immobilized single-base oligonucleotides demonstrate that base specific contrast is available with reflected, photo-emitted, and Auger electrons. Image contrast simulations of model rectangular features mimicking the individual nucleotides in a DNA strand have been developed to translate measurements of contrast on bulk DNA to the detectability of
Characterization and expression patterns of a membrane-bound trehalase from Spodoptera exigua
Directory of Open Access Journals (Sweden)
Xu Weihua
2008-05-01
Full Text Available Abstract Background The chitin biosynthesis pathway starts with trehalose in insects and the main functions of trehalases are hydrolysis of trehalose to glucose. Although insects possess two types, soluble trehalase (Tre-1 and membrane-bound trehalase (Tre-2, very little is known about Tre-2 and the difference in function between Tre-1 and Tre-2. Results To gain an insight into trehalase functions in insects, we investigated a putative membrane-bound trehalase from Spodoptera exigua (SeTre-2 cloned from the fat body. The deduced amino acid sequence of SeTre-2 contains 645 residues and has a predicted molecular weight of ~74 kDa and pI of 6.01. Alignment of SeTre-2 with other insect trehalases showed that it contains two trehalase signature motifs and a putative transmembrane domain, which is an important characteristic of Tre-2. Comparison of the genomic DNA and cDNA sequences demonstrated that SeTre-2 comprises 13 exons and 12 introns. Southern blot analysis revealed that S. exigua has two trehalase genes and that SeTre-2 is a single-copy gene. Northern blot analyses showed that the SeTre-2 transcript is expressed not only in the midgut, as previously reported for Bombyx mori, but also in the fat body and Malpighian tubules, although expression patterns differed between the midgut and fat body. SeTre-2 transcripts were detected in the midgut of feeding stage larvae, but not in pupae, whereas SeTre-2 mRNA was detected in the fat body of fifth instar larvae and pupae. Conclusion These findings provide new data on the tissue distribution, expression patterns and potential function of membrane-bound trehalase. The results suggest that the SeTre-2 gene may have different functions in the midgut and fat body.
Electrons on the surface of liquid helium
International Nuclear Information System (INIS)
Lambert, D.K.
1979-05-01
Spectroscopic techniques were used to study transitions of electrons between bound states in the potential well near a helium surface. The charge density distribution of electrons on the surface was independently obtained from electrical measurements. From the measurements, information was obtained both about the interaction of the bound state electrons with the surface of liquid helium and about local disorder in the positions of electrons on the surface
Beaumont, P C; Parsons, B J; Navaratnam, S; Phillips, G O; Allen, J C
1980-07-29
The effect of DNA on both the fluorescence emission spectra and yields and lifetimes of the triplet stae of psoralen and 8-methoxypsoralen in aqueous solution has been determined. The changes in the fluorescence spectra are similar in nature for both of these furocoumarins and are attributed to binding of the drug to DNA. The yield of the 8-methoxypsoralen triplet state when bound to DNA was found to be similar, if not identical, to that measured in the absence of DNA. This contrasts sharply with data obtained for psoralen from which it is concluded that either the yield of bound psoralen triplet states is very low, if not zero, or that the lifetime of such species is less than 50 ns. The relevance of this data to the molecular basis of skin photosensitisation by furocoumarins is discussed.
Directory of Open Access Journals (Sweden)
Bruno Correia
Full Text Available Latency-associated nuclear antigen (LANA mediates γ2-herpesvirus genome persistence and regulates transcription. We describe the crystal structure of the murine gammaherpesvirus-68 LANA C-terminal domain at 2.2 Å resolution. The structure reveals an alpha-beta fold that assembles as a dimer, reminiscent of Epstein-Barr virus EBNA1. A predicted DNA binding surface is present and opposite this interface is a positive electrostatic patch. Targeted DNA recognition substitutions eliminated DNA binding, while certain charged patch mutations reduced bromodomain protein, BRD4, binding. Virus containing LANA abolished for DNA binding was incapable of viable latent infection in mice. Virus with mutations at the charged patch periphery exhibited substantial deficiency in expansion of latent infection, while central region substitutions had little effect. This deficiency was independent of BRD4. These results elucidate the LANA DNA binding domain structure and reveal a unique charged region that exerts a critical role in viral latent infection, likely acting through a host cell protein(s.
Towards DNA-Based Programmable Matter
2012-02-28
thiolated ssDNA was first immobilized onto the gold...surface. The surface was then passivated with mercaptohexanol. Subsequently, another complementary thiolated ...right). Approach 3: DNA-‐mediated interaction between polymer -‐coated surfaces We also tried
Wei, Yan; Qu, Mei-Hua; Wang, Xing-Sheng; Chen, Lan; Wang, Dong-Liang; Liu, Ying; Hua, Qian; He, Rong-Qiao
2008-07-02
Tau, an important microtubule associated protein, has been found to bind to DNA, and to be localized in the nuclei of both neurons and some non-neuronal cells. Here, using electrophoretic mobility shifting assay (EMSA) in the presence of DNA with different chain-lengths, we observed that tau protein favored binding to a 13 bp or a longer polynucleotide. The results from atomic force microscopy also showed that tau protein preferred a 13 bp polynucleotide to a 12 bp or shorter polynucleotide. In a competitive assay, a minor groove binder distamycin A was able to replace the bound tau from the DNA double helix, indicating that tau protein binds to the minor groove. Tau protein was able to protect the double-strand from digestion in the presence of DNase I that was bound to the minor groove. On the other hand, a major groove binder methyl green as a negative competitor exhibited little effect on the retardation of tau-DNA complex in EMSA. This further indicates the DNA minor groove as the binding site for tau protein. EMSA with truncated tau proteins showed that both the proline-rich domain (PRD) and the microtubule-binding domain (MTBD) contributed to the interaction with DNA; that is to say, both PRD and MTBD bound to the minor groove of DNA and bent the double-strand, as observed by electron microscopy. To investigate whether tau protein is able to prevent DNA from the impairment by hydroxyl free radical, the chemiluminescence emitted by the phen-Cu/H(2)O(2)/ascorbate was measured. The emission intensity of the luminescence was markedly decreased when tau protein was present, suggesting a significant protection of DNA from the damage in the presence of hydroxyl free radical.
Ionic effects on the temperature-force phase diagram of DNA.
Amnuanpol, Sitichoke
2017-12-01
Double-stranded DNA (dsDNA) undergoes a structural transition to single-stranded DNA (ssDNA) in many biologically important processes such as replication and transcription. This strand separation arises in response either to thermal fluctuations or to external forces. The roles of ions are twofold, shortening the range of the interstrand potential and renormalizing the DNA elastic modulus. The dsDNA-to-ssDNA transition is studied on the basis that dsDNA is regarded as a bound state while ssDNA is regarded as an unbound state. The ground state energy of DNA is obtained by mapping the statistical mechanics problem to the imaginary time quantum mechanics problem. In the temperature-force phase diagram the critical force F c (T) increases logarithmically with the Na + concentration in the range from 32 to 110 mM. Discussing this logarithmic dependence of F c (T) within the framework of polyelectrolyte theory, it inevitably suggests a constraint on the difference between the interstrand separation and the length per unit charge during the dsDNA-to-ssDNA transition.
International Nuclear Information System (INIS)
Inoue, J.; Ohtaka, K.
2004-01-01
We study virtual bound states in photonics, which are a vectorial extension of electron virtual bound states. The condition for these states is derived. It is found that the Mie resonant state which satisfies the condition that the size parameter is less than the angular momentum should be interpreted as a photon virtual bound state. In order to confirm the validity of the concept, we compare the photonic density of states, the width of which represents the lifetime of the photon virtual bound states, with numerical results
Liang, Hao; Zhang, Xiao-Bing; Lv, Yifan; Gong, Liang; Wang, Ruowen; Zhu, Xiaoyan; Yang, Ronghua; Tan, Weihong
2014-06-17
CONSPECTUS: DNA performs a vital function as a carrier of genetic code, but in the field of nanotechnology, DNA molecules can catalyze chemical reactions in the cell, that is, DNAzymes, or bind with target-specific ligands, that is, aptamers. These functional DNAs with different modifications have been developed for sensing, imaging, and therapeutic systems. Thus, functional DNAs hold great promise for future applications in nanotechnology and bioanalysis. However, these functional DNAs face challenges, especially in the field of biomedicine. For example, functional DNAs typically require the use of cationic transfection reagents to realize cellular uptake. Such reagents enter the cells, increasing the difficulty of performing bioassays in vivo and potentially damaging the cell's nucleus. To address this obstacle, nanomaterials, such as metallic, carbon, silica, or magnetic materials, have been utilized as DNA carriers or assistants. In this Account, we describe selected examples of functional DNA-containing nanomaterials and their applications from our recent research and those of others. As models, we have chosen to highlight DNA/nanomaterial complexes consisting of gold nanoparticles, graphene oxides, and aptamer-micelles, and we illustrate the potential of such complexes in biosensing, imaging, and medical diagnostics. Under proper conditions, multiple ligand-receptor interactions, decreased steric hindrance, and increased surface roughness can be achieved from a high density of DNA that is bound to the surface of nanomaterials, resulting in a higher affinity for complementary DNA and other targets. In addition, this high density of DNA causes a high local salt concentration and negative charge density, which can prevent DNA degradation. For example, DNAzymes assembled on gold nanoparticles can effectively catalyze chemical reactions even in living cells. And it has been confirmed that DNA-nanomaterial complexes can enter cells more easily than free single
International Nuclear Information System (INIS)
Tyshetskiy, Yu.; Kompaneets, R.; Vladimirov, S. V.
2012-01-01
Surface plasmon polaritons (SPPs) in a semi-bounded degenerate plasma (e.g., a metal) are studied using the quasiclassical mean-field kinetic model, taking into account the spatial dispersion of the plasma (due to quantum degeneracy of electrons) and electron-ion (electron-lattice, for metals) collisions. SPP dispersion and damping are obtained in both retarded (ω/k z ∼c) and non-retarded (ω/k z ≪c) regions, as well as in between. It is shown that the plasma spatial dispersion significantly affects the properties of SPPs, especially at short wavelengths (less than the collisionless skin depth, λ ≲ c/ω pe ). Namely, the collisionless (Landau) damping of SPPs (due to spatial dispersion) is comparable to the purely collisional (Ohmic) damping (due to electron-lattice collisions) in a wide range of SPP wavelengths, e.g., from λ∼20 nm to λ∼0.8 nm for SPP in gold at T = 293 K and from λ∼400 nm to λ∼0.7 nm for SPPs in gold at T = 100 K. The spatial dispersion is also shown to affect, in a qualitative way, the dispersion of SPPs at short wavelengths λ ≲ c/ω pe .
DEFF Research Database (Denmark)
Gottschalk, Sanne; Ifrah, Dan; Lerche, Sandra
2013-01-01
the growth of S. aureus without ATP leakage. Instead, LP5 bound DNA and inhibited macromolecular synthesis. The binding to DNA also led to inhibition of DNA gyrase and topoisomerase IV and caused induction of the SOS response. CONCLUSIONS: Our data demonstrate that LP5 may have a dual mode of action against...
A Selective G-Quadruplex DNA-Stabilizing Ligand Based on a Cyclic Naphthalene Diimide Derivative
Directory of Open Access Journals (Sweden)
Md. Monirul Islam
2015-06-01
Full Text Available A cyclic naphthalene diimide (cyclic NDI, 1, carrying a benzene moiety as linker chain, was synthesized and its interaction with G-quadruplex DNAs of a-core and a-coreTT as a human telomeric DNA, c-kit and c-myc as DNA sequence at promoter region, or thrombin-binding aptamer (TBA studied based on UV-VIS and circular dichroism (CD spectroscopic techniques, thermal melting temperature measurement, and FRET-melting assay. The circular dichroism spectra showed that 1 induced the formation of different types of G-quadruplex DNA structure. Compound 1 bound to these G-quadruplexes with affinities in the range of 106–107 M−1 order and a 2:1 stoichiometry. Compound 1 showed 270-fold higher selectivity for a-core than dsDNA with a preferable a-core binding than a-coreTT, c-kit, c-myc and TBA in the presence of K+, which is supported by thermal melting studies. The FRET-melting assay also showed that 1 bound preferentially to human telomeric DNA. Compound 1 showed potent inhibition against telomerase activity with an IC50 value of 0.9 μM and preferable binding to G-quadruplexes DNA than our previously published cyclic NDI derivative 3 carrying a benzene moiety as longer linker chain.
Authentication of forensic DNA samples.
Frumkin, Dan; Wasserstrom, Adam; Davidson, Ariane; Grafit, Arnon
2010-02-01
Over the past twenty years, DNA analysis has revolutionized forensic science, and has become a dominant tool in law enforcement. Today, DNA evidence is key to the conviction or exoneration of suspects of various types of crime, from theft to rape and murder. However, the disturbing possibility that DNA evidence can be faked has been overlooked. It turns out that standard molecular biology techniques such as PCR, molecular cloning, and recently developed whole genome amplification (WGA), enable anyone with basic equipment and know-how to produce practically unlimited amounts of in vitro synthesized (artificial) DNA with any desired genetic profile. This artificial DNA can then be applied to surfaces of objects or incorporated into genuine human tissues and planted in crime scenes. Here we show that the current forensic procedure fails to distinguish between such samples of blood, saliva, and touched surfaces with artificial DNA, and corresponding samples with in vivo generated (natural) DNA. Furthermore, genotyping of both artificial and natural samples with Profiler Plus((R)) yielded full profiles with no anomalies. In order to effectively deal with this problem, we developed an authentication assay, which distinguishes between natural and artificial DNA based on methylation analysis of a set of genomic loci: in natural DNA, some loci are methylated and others are unmethylated, while in artificial DNA all loci are unmethylated. The assay was tested on natural and artificial samples of blood, saliva, and touched surfaces, with complete success. Adopting an authentication assay for casework samples as part of the forensic procedure is necessary for maintaining the high credibility of DNA evidence in the judiciary system.
Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.
Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant
2017-11-28
Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.
Symmetry Parameter Constraints from a Lower Bound on Neutron-matter Energy
Energy Technology Data Exchange (ETDEWEB)
Tews, Ingo [Institute for Nuclear Theory, University of Washington, Seattle, WA 98195-1550 (United States); Lattimer, James M. [Department of Physics and Astronomy, Stony Brook University, Stony Brook, NY 11794-3800 (United States); Ohnishi, Akira [Yukawa Institute for Theoretical Physics, Kyoto University, Kyoto 606-8502 (Japan); Kolomeitsev, Evgeni E., E-mail: itews@uw.edu, E-mail: james.lattimer@stonybrook.edu, E-mail: ohnishi@yukawa.kyoto-u.ac.jp, E-mail: e.kolomeitsev@gsi.de [Faculty of Natural Sciences, Matej Bel University, Tajovskeho 40, SK-97401 Banska Bystrica (Slovakia)
2017-10-20
We propose the existence of a lower bound on the energy of pure neutron matter (PNM) on the basis of unitary-gas considerations. We discuss its justification from experimental studies of cold atoms as well as from theoretical studies of neutron matter. We demonstrate that this bound results in limits to the density-dependent symmetry energy, which is the difference between the energies of symmetric nuclear matter and PNM. In particular, this bound leads to a lower limit to the volume symmetry energy parameter S {sub 0}. In addition, for assumed values of S {sub 0} above this minimum, this bound implies both upper and lower limits to the symmetry energy slope parameter L , which describes the lowest-order density dependence of the symmetry energy. A lower bound on neutron-matter incompressibility is also obtained. These bounds are found to be consistent with both recent calculations of the energies of PNM and constraints from nuclear experiments. Our results are significant because several equations of state that are currently used in astrophysical simulations of supernovae and neutron star mergers, as well as in nuclear physics simulations of heavy-ion collisions, have symmetry energy parameters that violate these bounds. Furthermore, below the nuclear saturation density, the bound on neutron-matter energies leads to a lower limit to the density-dependent symmetry energy, which leads to upper limits to the nuclear surface symmetry parameter and the neutron-star crust–core boundary. We also obtain a lower limit to the neutron-skin thicknesses of neutron-rich nuclei. Above the nuclear saturation density, the bound on neutron-matter energies also leads to an upper limit to the symmetry energy, with implications for neutron-star cooling via the direct Urca process.
International Nuclear Information System (INIS)
Bower, Joseph F.; Green, Thomas D.; Ross, Ted M.
2004-01-01
DNA vaccines expressing the envelope (Env) of the human immunodeficiency virus type 1 (HIV-1) have been relatively ineffective at generating high-titer, long-lasting, neutralizing antibodies in a variety of animal models. In this study, DNA vaccines were constructed to express a fusion protein of the soluble human CD4 (sCD4) and the gp120 subunit of the HIV-1 envelope. To enhance the immunogenicity of the expressed fusion protein, three copies of the murine C3d (mC3d 3 ) were added to the carboxyl terminus of the complex. Monoclonal antibodies that recognize CD4-induced epitopes on gp120 efficiently bound to sCD4-gp120 or sCD4-gp120-mC3d 3 . In addition, both sCD4-gp120 and sCD4-gp120-mC3d 3 bound to cells expressing appropriate coreceptors in the absence of cell surface hCD4. Mice (BALB/c) vaccinated with DNA vaccines expressing either gp120-mC3d 3 or sCD4-gp120-mC3d 3 elicited antibodies that neutralized homologous virus infection. However, the use of sCD4-gp120-mC3d 3 -DNA elicited the highest titers of neutralizing antibodies that persisted after depletion of anti-hCD4 antibodies. Interestingly, only mice vaccinated with DNA expressing sCD4-gp120-mC3d 3 had antibodies that elicited cross-protective neutralizing antibodies. The fusion of sCD4 to the HIV-1 envelope exposes neutralizing epitopes that elicit broad protective immunity when the fusion complex is coupled with the molecular adjuvant, C3d
Matsson, L
2001-12-01
A nonstationary interaction that controlsDNA replication and the cell cycle isderived from many-body physics in achemically open T cell. The model predictsa long range force F'(ξ) =- (κ/2) ξ(1 - ξ)(2 - ξ)between thepre-replication complexes (pre-RCs) boundby the origins in DNA, ξ = ϕ/N being the relativedisplacement of pre-RCs, ϕ the number of pre-RCs, N the number of replicons to be replicated,and κ the compressibilitymodulus in the lattice of pre-RCs whichbehaves dynamically like an elasticallybraced string. Initiation of DNAreplication is induced at the thresholdϕ = N by a switch ofsign of F''(ξ), fromattraction (-) and assembly in the G(1) phase (0force at ϕ = 2N, from repulsion inS phase back to attraction in G(2), when all primed replicons havebeen duplicated once. F'(0) = 0corresponds to a resting cell in theabsence of driving force at ϕ= 0. The model thus ensures that the DNAcontent in G(2) cells is exactlytwice that of G(1) cells. The switch of interaction at the R-point, at which N pre-RCs have been assembled, starts the release of Rb protein thus also explaining the shift in the Rb phosphorylation from mitogen-dependent cyclinD to mitogen-independent cyclin E.Shape,slope and scale of the response curvesderived agree well with experimental datafrom dividing T cells and polymerising MTs,the variable length of which is due to anonlinear dependence of the growthamplitude on the initial concentrations oftubulin dimers and guanosine-tri-phosphate(GTP). The model also explains the dynamic instabilityin growing MTs.
Decrease DNA contamination in the laboratories
DEFF Research Database (Denmark)
Kampmann, Marie-Louise; Børsting, Claus; Morling, Niels
2017-01-01
In this study, we tested various approaches to remove DNA from hard laboratory surfaces. We contaminated clean surfaces with four different concentrations of massively parallel sequencing libraries. The DNA was dried and left for 45 min and for 24 h, respectively, before any treatment. The surfaces.......9–1.8% hypochlorite in order to eliminate laboratory contamination and simultaneously minimise any poisonous gases....
Heffler, Michael A; Walters, Ryan D; Kugel, Jennifer F
2012-01-01
An undergraduate biochemistry laboratory experiment is described that will teach students the practical and theoretical considerations for measuring the equilibrium dissociation constant (K(D) ) for a protein/DNA interaction using electrophoretic mobility shift assays (EMSAs). An EMSA monitors the migration of DNA through a native gel; the DNA migrates more slowly when bound to a protein. To determine a K(D) the amount of unbound and protein-bound DNA in the gel is measured as the protein concentration increases. By performing this experiment, students will be introduced to making affinity measurements and gain experience in performing quantitative EMSAs. The experiment describes measuring the K(D) for the interaction between the chimeric protein GAL4-p53 and its DNA recognition site; however, the techniques are adaptable to other DNA binding proteins. In addition, the basic experiment described can be easily expanded to include additional inquiry-driven experimentation. © 2012 by The International Union of Biochemistry and Molecular Biology. Copyright © 2012 Wiley Periodicals, Inc.
Curvature bound from gravitational catalysis
Gies, Holger; Martini, Riccardo
2018-04-01
We determine bounds on the curvature of local patches of spacetime from the requirement of intact long-range chiral symmetry. The bounds arise from a scale-dependent analysis of gravitational catalysis and its influence on the effective potential for the chiral order parameter, as induced by fermionic fluctuations on a curved spacetime with local hyperbolic properties. The bound is expressed in terms of the local curvature scalar measured in units of a gauge-invariant coarse-graining scale. We argue that any effective field theory of quantum gravity obeying this curvature bound is safe from chiral symmetry breaking through gravitational catalysis and thus compatible with the simultaneous existence of chiral fermions in the low-energy spectrum. With increasing number of dimensions, the curvature bound in terms of the hyperbolic scale parameter becomes stronger. Applying the curvature bound to the asymptotic safety scenario for quantum gravity in four spacetime dimensions translates into bounds on the matter content of particle physics models.
Prospect of bioflavonoid fisetin as a quadruplex DNA ligand: a biophysical approach.
Directory of Open Access Journals (Sweden)
Bidisha Sengupta
Full Text Available Quadruplex (G4 forming sequences in telomeric DNA and c-myc promoter regions of human DNA are associated with tumorogenesis. Ligands that can facilitate or stabilize the formation and increase the stabilization of G4 can prevent tumor cell proliferation and have been regarded as potential anti-cancer drugs. In the present study, steady state and time-resolved fluorescence measurements provide important structural and dynamical insights into the free and bound states of the therapeutically potent plant flavonoid fisetin (3,3',4',7-tetrahydroxyflavone in a G4 DNA matrix. The excited state intra-molecular proton transfer (ESPT of fisetin plays an important role in observing and understanding the binding of fisetin with the G4 DNA. Differential absorption spectra, thermal melting, and circular dichroism spectroscopic studies provide evidences for the formation of G4 DNA and size exclusion chromatography (SEC proves the binding and 1∶1 stoichiometry of fisetin in the DNA matrix. Comparative analysis of binding in the presence of EtBr proves that fisetin favors binding at the face of the G-quartet, mostly along the diagonal loop. Time resolved fluorescence anisotropy decay analysis indicates the increase in the restrictions in motion from the free to bound fisetin. We have also investigated the fingerprints of the binding of fisetin in the antiparallel quadruplex using Raman spectroscopy. Preliminary results indicate fisetin to be a prospective candidate as a G4 ligand.
Prospect of Bioflavonoid Fisetin as a Quadruplex DNA Ligand: A Biophysical Approach
Sengupta, Bidisha; Pahari, Biswapathik; Blackmon, Laura; Sengupta, Pradeep K.
2013-01-01
Quadruplex (G4) forming sequences in telomeric DNA and c-myc promoter regions of human DNA are associated with tumorogenesis. Ligands that can facilitate or stabilize the formation and increase the stabilization of G4 can prevent tumor cell proliferation and have been regarded as potential anti-cancer drugs. In the present study, steady state and time-resolved fluorescence measurements provide important structural and dynamical insights into the free and bound states of the therapeutically potent plant flavonoid fisetin (3,3′,4′,7-tetrahydroxyflavone) in a G4 DNA matrix. The excited state intra-molecular proton transfer (ESPT) of fisetin plays an important role in observing and understanding the binding of fisetin with the G4 DNA. Differential absorption spectra, thermal melting, and circular dichroism spectroscopic studies provide evidences for the formation of G4 DNA and size exclusion chromatography (SEC) proves the binding and 1∶1 stoichiometry of fisetin in the DNA matrix. Comparative analysis of binding in the presence of EtBr proves that fisetin favors binding at the face of the G-quartet, mostly along the diagonal loop. Time resolved fluorescence anisotropy decay analysis indicates the increase in the restrictions in motion from the free to bound fisetin. We have also investigated the fingerprints of the binding of fisetin in the antiparallel quadruplex using Raman spectroscopy. Preliminary results indicate fisetin to be a prospective candidate as a G4 ligand. PMID:23785423
Building high-coverage monolayers of covalently bound magnetic nanoparticles
Energy Technology Data Exchange (ETDEWEB)
Williams, Mackenzie G.; Teplyakov, Andrew V., E-mail: andrewt@udel.edu
2016-12-01
Graphical abstract: - Highlights: • A method for forming a layer of covalently bound nanoparticles is offered. • A nearly perfect monolayer of covalently bound magnetic nanoparticles was formed on gold. • Spectroscopic techniques confirmed covalent binding by the “click” reaction. • The influence of the functionalization scheme on surface coverage was investigated. - Abstract: This work presents an approach for producing a high-coverage single monolayer of magnetic nanoparticles using “click chemistry” between complementarily functionalized nanoparticles and a flat substrate. This method highlights essential aspects of the functionalization scheme for substrate surface and nanoparticles to produce exceptionally high surface coverage without sacrificing selectivity or control over the layer produced. The deposition of one single layer of magnetic particles without agglomeration, over a large area, with a nearly 100% coverage is confirmed by electron microscopy. Spectroscopic techniques, supplemented by computational predictions, are used to interrogate the chemistry of the attachment and to confirm covalent binding, rather than attachment through self-assembly or weak van der Waals bonding. Density functional theory calculations for the surface intermediate of this copper-catalyzed process provide mechanistic insight into the effects of the functionalization scheme on surface coverage. Based on this analysis, it appears that steric limitations of the intermediate structure affect nanoparticle coverage on a flat solid substrate; however, this can be overcome by designing a functionalization scheme in such a way that the copper-based intermediate is formed on the spherical nanoparticles instead. This observation can be carried over to other approaches for creating highly controlled single- or multilayered nanostructures of a wide range of materials to result in high coverage and possibly, conformal filling.
Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process.
Reshetnikov, Roman V; Sponer, Jiri; Rassokhina, Olga I; Kopylov, Alexei M; Tsvetkov, Philipp O; Makarov, Alexander A; Golovin, Andrey V
2011-12-01
A combination of explicit solvent molecular dynamics simulation (30 simulations reaching 4 µs in total), hybrid quantum mechanics/molecular mechanics approach and isothermal titration calorimetry was used to investigate the atomistic picture of ion binding to 15-mer thrombin-binding quadruplex DNA (G-DNA) aptamer. Binding of ions to G-DNA is complex multiple pathway process, which is strongly affected by the type of the cation. The individual ion-binding events are substantially modulated by the connecting loops of the aptamer, which play several roles. They stabilize the molecule during time periods when the bound ions are not present, they modulate the route of the ion into the stem and they also stabilize the internal ions by closing the gates through which the ions enter the quadruplex. Using our extensive simulations, we for the first time observed full spontaneous exchange of internal cation between quadruplex molecule and bulk solvent at atomistic resolution. The simulation suggests that expulsion of the internally bound ion is correlated with initial binding of the incoming ion. The incoming ion then readily replaces the bound ion while minimizing any destabilization of the solute molecule during the exchange. © The Author(s) 2011. Published by Oxford University Press.
The role of proteins and metal ions in the protection of chromatin DNA at fast neutrons action
International Nuclear Information System (INIS)
Radu, L.; Preoteasa, V.; Radulescu, I.; Constantinescu, B.
1997-01-01
The role of chromatin proteins and of some ions on the fast neutrons actions on chromatin DNA from rat Walker tumors was analysed. The DNA in chromatin is effectively protected against fast neutrons actions by DNA bound proteins and specially by histones, because of the limited accessibility of the condensed chromatin DNA to hydroxyl radicals and of the scavenging of radicals by the chromatin proteins. The ions utilised protect chromatin DNA against the damage produced ed by fast neutrons, through the induction of structural DNA changes with a less accessibility to OH radicals. (authors)
International Nuclear Information System (INIS)
Toki, Hiroshi; Yamazaki, Toshimitsu
1989-01-01
The standard method of pionic atom formation does not produce deeply bound pionic atoms. A study is made on the properties of deeply bound pionic atom states by using the standard pion-nucleus optical potential. Another study is made to estimate the cross sections of the formation of ls pionic atom states by various methods. The pion-nucleus optical potential is determined by weakly bound pionic atom states and pion nucleus scattering. Although this potential may not be valid for deeply bound pionic atoms, it should provide some hint on binding energies and level widths of deeply bound states. The width of the ls state comes out to be 0.3 MeV and is well separated from the rest. The charge dependence of the ls state is investigated. The binding energies and the widths increase linearly with Z azbove a Z of 30. The report then discusses various methods to populate deeply bound pionic atoms. In particular, 'pion exchange' reactions are proposed. (n, pπ) reaction is discussed first. The cross section is calculated by assuming the in- and out-going nucleons on-shell and the produced pion in (n1) pionic atom states. Then, (n, dπ - ) cross sections are estimated. (p, 2 Heπ - ) reaction would have cross sections similar to the cross section of (n, dπ - ) reaction. In conclusion, it seems best to do (n, p) experiment on heavy nuclei for deeply bound pionic atom. (Nogami, K.)
Akbari, Fahimeh; Foroutan, Masumeh
2018-02-14
In this study, the water droplet behaviour of four different types of single-strand DNA with homogeneous base sequence on a graphene substrate during evaporation of the droplet was investigated using molecular dynamics (MD) simulation. The simulation results indicated that the evaporation depended on the DNA sequence. The observed changes can be divided into four parts: (i) vaporization mode, (ii) evaporation flux, (iii) mechanism of single-strand placement on the surface, and (iv) consideration of remaining single strands after evaporation. Our simulation observations indicated different evaporation modes for thymine biodroplets as compared to those for other biodroplets. The evaporation of the thymine biodroplets occurred with an increase in the contact angle, while that of the other biodroplets occur in a constant contact angle mode. Moreover, thymine biodroplets generate the lowest contact line compared to other single strands, and it is always placed far away from the centre of the droplets during evaporation. Investigating variations in the evaporation flux shows that thymine has the highest evaporation flux and guanine has the lowest. Moreover, during initial evaporation, the flux of evaporation increases at the triple point of the biodroplets containing thymine single strands, while it decreases in the other biodroplets. The following observation was obtained from the study of the placement of single strands on the substrate: guanine and thymine interacted slower than other single strands during evaporation with graphene, adenine single strand had a higher folding during evaporation, and guanine single strand showed the lowest end-to-end distance. The investigation of single-strand DNA after evaporation shows that adenine produces the most stable structure at the end of evaporation. In addition, cytosine is the most stretched single-strand DNA due to its lack of internal π-π stacking and hydrogen bonding. Therefore, cytosine single strand is more
Song, Luna; Zhang, Yonghua; Li, Junling; Gao, Qiang; Qi, Honglan; Zhang, Chengxiao
2016-04-01
An enzyme-free signal amplification-based assay for DNA detection was developed using fluorescent hairpin DNA probes coupled with hybridization chain reaction (HCR). The hairpin DNAs were designed to contain abasic sites in the stem moiety. Non-covalent labeling of the hairpin DNAs was achieved when a fluorescent ligand was bound to the abasic sites through hydrogen bonding with the orphan cytosine present on the complementary strand, accompanied by quench of ligand fluorescence. As a result, the resultant probes, the complex formed between the hairpin DNA and ligand, showed almost no fluorescence. Upon hybridization with target DNA, the probe underwent a dehybridization of the stem moiety containing an abasic site. The release of ligand from the abasic site to the solution resulted in an effective fluorescent enhancement, which can be used as a signal. Compared with a sensing system without HCR, a 20-fold increase in the sensitivity was achieved using the sensing system with HCR. The fluorescent intensity of the sensing system increased with the increase in target DNA concentration from 0.5 nM to 100 nM. A single mismatched target ss-DNA could be effectively discriminated from complementary target DNA. Genotyping of a G/C single-nucleotide polymorphism of polymerase chain reaction (PCR) products was successfully demonstrated with the sensing system. Therefore, integrating HCR strategy with non-covalent labeling of fluorescent hairpin DNA probes provides a sensitive and cost-effective DNA assay. © The Author(s) 2016.
Control of DNA hybridization by photoswitchable molecular glue.
Dohno, Chikara; Nakatani, Kazuhiko
2011-12-01
Hybridization of DNA is one of the most intriguing events in molecular recognition and is essential for living matter to inherit life beyond generations. In addition to the function of DNA as genetic material, DNA hybridization is a key to control the function of DNA-based materials in nanoscience. Since the hybridization of two single stranded DNAs is a thermodynamically favorable process, dissociation of the once formed DNA duplex is normally unattainable under isothermal conditions. As the progress of DNA-based nanoscience, methodology to control the DNA hybridization process has become increasingly important. Besides many reports using the chemically modified DNA for the regulation of hybridization, we focused our attention on the use of a small ligand as the molecular glue for the DNA. In 2001, we reported the first designed molecule that strongly and specifically bound to the mismatched base pairs in double stranded DNA. Further studies on the mismatch binding molecules provided us a key discovery of a novel mode of the binding of a mismatch binding ligand that induced the base flipping. With these findings we proposed the concept of molecular glue for DNA for the unidirectional control of DNA hybridization and, eventually photoswitchable molecular glue for DNA, which enabled the bidirectional control of hybridization under photoirradiation. In this tutorial review, we describe in detail how we integrated the mismatch binding ligand into photoswitchable molecular glue for DNA, and the application and perspective in DNA-based nanoscience.
Cyclic GMP-AMP Synthase is Activated by Double-stranded DNA-Induced Oligomerization
Li, Xin; Shu, Chang; Yi, Guanghui; Chaton, Catherine T.; Shelton, Catherine L.; Diao, Jiasheng; Zuo, Xiaobing; Kao, C Cheng; Herr, Andrew B.; Li, Pingwei
2013-01-01
Cyclic GMP-AMP synthase (cGAS) is a cytosolic DNA sensor mediating innate antimicrobial immunity. It catalyzes the synthesis of a noncanonical cyclic dinucleotide 2′,5′ cGAMP that binds to STING and mediates the activation of TBK1 and IRF-3. Activated IRF-3 translocates to the nucleus and initiates the transcription of the IFN-β gene. The structure of mouse cGAS bound to an 18 bp dsDNA revealed that cGAS interacts with dsDNA through two binding sites, forming a 2:2 complex. Enzyme assays and ...
The Motion Of A Deformable Body In - Bounded Fluid
International Nuclear Information System (INIS)
Galpert, A.R.; Miloh, T.
1998-01-01
The Hamiltonian formalism for the motion of a deformable body in an inviscid irrotational fluid is generalized for the case of the motion in a bounded fluid. We found that the presence of the boundaries in a liquid leads to the chaotization of the body's motion. The ('memory' effect connected with a free surface boundary condition is also accounted for
Energy required to pinch a DNA plectoneme
Barde, Céline; Destainville, Nicolas; Manghi, Manoel
2018-03-01
DNA supercoiling plays an important role from a biological point of view. One of its consequences at the supramolecular level is the formation of DNA superhelices named plectonemes. Normally separated by a distance on the order of 10 nm, the two opposite double strands of a DNA plectoneme must be brought closer if a protein or protein complex implicated in genetic regulation is to be bound simultaneously to both strands, as if the plectoneme was locally pinched. We propose an analytic calculation of the energetic barrier, of elastic nature, required to bring closer the two loci situated on the opposed double strands. We examine how this energy barrier scales with the DNA supercoiling. For physically relevant values of elastic parameters and of supercoiling density, we show that the energy barrier is in the kBT range under physiological conditions, thus demonstrating that the limiting step to loci encounter is more likely the preceding plectoneme slithering bringing the two loci side by side.
Proteins mediating DNA loops effectively block transcription.
Vörös, Zsuzsanna; Yan, Yan; Kovari, Daniel T; Finzi, Laura; Dunlap, David
2017-07-01
Loops are ubiquitous topological elements formed when proteins simultaneously bind to two noncontiguous DNA sites. While a loop-mediating protein may regulate initiation at a promoter, the presence of the protein at the other site may be an obstacle for RNA polymerases (RNAP) transcribing a different gene. To test whether a DNA loop alters the extent to which a protein blocks transcription, the lac repressor (LacI) was used. The outcome of in vitro transcription along templates containing two LacI operators separated by 400 bp in the presence of LacI concentrations that produced both looped and unlooped molecules was visualized with scanning force microscopy (SFM). An analysis of transcription elongation complexes, moving for 60 s at an average of 10 nt/s on unlooped DNA templates, revealed that they more often surpassed LacI bound to the lower affinity O2 operator than to the highest affinity Os operator. However, this difference was abrogated in looped DNA molecules where LacI became a strong roadblock independently of the affinity of the operator. Recordings of transcription elongation complexes, using magnetic tweezers, confirmed that they halted for several minutes upon encountering a LacI bound to a single operator. The average pause lifetime is compatible with RNAP waiting for LacI dissociation, however, the LacI open conformation visualized in the SFM images also suggests that LacI could straddle RNAP to let it pass. Independently of the mechanism by which RNAP bypasses the LacI roadblock, the data indicate that an obstacle with looped topology more effectively interferes with transcription. © 2017 The Authors Protein Science published by Wiley Periodicals, Inc. on behalf of The Protein Society.
Bounding species distribution models
Directory of Open Access Journals (Sweden)
Thomas J. STOHLGREN, Catherine S. JARNEVICH, Wayne E. ESAIAS,Jeffrey T. MORISETTE
2011-10-01
Full Text Available Species distribution models are increasing in popularity for mapping suitable habitat for species of management concern. Many investigators now recognize that extrapolations of these models with geographic information systems (GIS might be sensitive to the environmental bounds of the data used in their development, yet there is no recommended best practice for “clamping” model extrapolations. We relied on two commonly used modeling approaches: classification and regression tree (CART and maximum entropy (Maxent models, and we tested a simple alteration of the model extrapolations, bounding extrapolations to the maximum and minimum values of primary environmental predictors, to provide a more realistic map of suitable habitat of hybridized Africanized honey bees in the southwestern United States. Findings suggest that multiple models of bounding, and the most conservative bounding of species distribution models, like those presented here, should probably replace the unbounded or loosely bounded techniques currently used [Current Zoology 57 (5: 642–647, 2011].
Bounding Species Distribution Models
Stohlgren, Thomas J.; Jarnevich, Cahterine S.; Morisette, Jeffrey T.; Esaias, Wayne E.
2011-01-01
Species distribution models are increasing in popularity for mapping suitable habitat for species of management concern. Many investigators now recognize that extrapolations of these models with geographic information systems (GIS) might be sensitive to the environmental bounds of the data used in their development, yet there is no recommended best practice for "clamping" model extrapolations. We relied on two commonly used modeling approaches: classification and regression tree (CART) and maximum entropy (Maxent) models, and we tested a simple alteration of the model extrapolations, bounding extrapolations to the maximum and minimum values of primary environmental predictors, to provide a more realistic map of suitable habitat of hybridized Africanized honey bees in the southwestern United States. Findings suggest that multiple models of bounding, and the most conservative bounding of species distribution models, like those presented here, should probably replace the unbounded or loosely bounded techniques currently used [Current Zoology 57 (5): 642-647, 2011].
Directory of Open Access Journals (Sweden)
Jahwarhar Izuan Abdul Rashid
2017-11-01
Full Text Available In recent years, electrochemical deoxyribonucleic acid (DNA sensor has recently emerged as promising alternative clinical diagnostic devices especially for infectious disease by exploiting DNA recognition events and converting them into an electrochemical signal. This is because the existing DNA diagnostic method possesses certain drawbacks such as time-consuming, expensive, laborious, low selectivity and sensitivity. DNA immobilization strategies and mechanism of electrochemical detection are two the most important aspects that should be considered before developing highly selective and sensitive electrochemical DNA sensor. Here, we focus on some recent strategies for DNA probes immobilization on the surface of electrochemical transducer such as adsorption, covalent bonding and Avidin/Streptavidin-Biotin interaction on the electrode surface for specific interaction with its complementary DNA target. A numerous approach for DNA hybridization detection based electrochemical technique that frequently used including direct DNA electrochemical detection and label based electrochemical (redox-active indicator, enzyme label and nanoparticles were also discussed in aiming to provide general guide for the design of electrochemical DNA sensor. We also discussed the challenges and suggestions to improve the application of electrochemical DNA sensor at point-care setting. Keywords: Electrochemical DNA sensor, DNA immobilization, DNA hybridization, Electrochemical mechanism
Kobayashi, M.; AB, E.; Bonvin, A.M.J.J.; Siegal, G.
2010-01-01
BRCA1 C-terminal domain (BRCT)-containing proteins are found widely throughout the animal and bacteria kingdoms where they are exclusively involved in cell cycle regulation and DNA metabolism. Whereas most BRCT domains are involved in protein-protein interactions, a small subset has bona fide DNA
Sequence-specific DNA binding by MYC/MAX to low-affinity non-E-box motifs.
Directory of Open Access Journals (Sweden)
Michael Allevato
Full Text Available The MYC oncoprotein regulates transcription of a large fraction of the genome as an obligatory heterodimer with the transcription factor MAX. The MYC:MAX heterodimer and MAX:MAX homodimer (hereafter MYC/MAX bind Enhancer box (E-box DNA elements (CANNTG and have the greatest affinity for the canonical MYC E-box (CME CACGTG. However, MYC:MAX also recognizes E-box variants and was reported to bind DNA in a "non-specific" fashion in vitro and in vivo. Here, in order to identify potential additional non-canonical binding sites for MYC/MAX, we employed high throughput in vitro protein-binding microarrays, along with electrophoretic mobility-shift assays and bioinformatic analyses of MYC-bound genomic loci in vivo. We identified all hexameric motifs preferentially bound by MYC/MAX in vitro, which include the low-affinity non-E-box sequence AACGTT, and found that the vast majority (87% of MYC-bound genomic sites in a human B cell line contain at least one of the top 21 motifs bound by MYC:MAX in vitro. We further show that high MYC/MAX concentrations are needed for specific binding to the low-affinity sequence AACGTT in vitro and that elevated MYC levels in vivo more markedly increase the occupancy of AACGTT sites relative to CME sites, especially at distal intergenic and intragenic loci. Hence, MYC binds diverse DNA motifs with a broad range of affinities in a sequence-specific and dose-dependent manner, suggesting that MYC overexpression has more selective effects on the tumor transcriptome than previously thought.
Studies of interaction between two alkaloids and double helix DNA
International Nuclear Information System (INIS)
Sun, Yantao; Peng, Tingting; Zhao, Lei; Jiang, Dayu; Cui, Yuncheng
2014-01-01
This article presents the study on the interaction of two alkaloids (matrine and evodiamine) and hs-DNA by absorption, fluorescence, circular dichroism (CD), DNA melting and viscosity experiments. The spectroscopic studies suggested that two alkaloids can bind to DNA through an intercalative mode. The viscosity measurement and thermal denaturation also indicated that two alkaloids can intercalate to DNA. The binding constants (K A ) and the number of binding sites (n) were determined. At the same time, some significant thermodynamic parameters of the binding of the alkaloids to DNA were obtained. Competitive binding studies revealed that alkaloids had an effect on ethidium bromide (EB) bound DNA. In addition, it was also proved that the fluorescence quenching was influenced by ionic strength. - Highlights: • Interaction between two alkaloids and DNA is studied by spectral methods. • The binding constant and the binding sites between two alkaloids and DNA are obtained. • There are a classical intercalative mode between alkaloids and DNA. • The binding of matrine with DNA is weaker than that of evodiamine. • It is important for us to understand the alkaloids–DNA interactions at a molecular level
DNA hydration studied by neutron fiber diffraction
Energy Technology Data Exchange (ETDEWEB)
Fuller, W.; Forsyth, V.T.; Mahendrasingam, A.; Langan, P.; Pigram, W.J. [Keele Univ. (United Kingdom)] [and others
1994-12-31
The development of neutron high angle fiber diffraction to investigate the location of water around the deoxyribonucleic acid (DNA) double-helix is described. The power of the technique is illustrated by its application to the D and A conformations of DNA using the single crystal diffractometer, D19, at the Institute Laue-Langevin, Grenoble and the time of flight diffractometer, SXD, at the Rutherford Appleton ISIS Spallation Neutron Source. These studies show the existence of bound water closely associated with the DNA. The patterns of hydration in these two DNA conformations are quite distinct and are compared to those observed in X-ray single crystal studies of two-stranded oligodeoxynucleotides. Information on the location of water around the DNA double-helix from the neutron fiber diffraction studies is combined with that on the location of alkali metal cations from complementary X-ray high angle fiber diffraction studies at the Daresbury Laboratory SRS using synchrotron radiation. These analyses emphasize the importance of viewing DNA, water and ions as a single system with specific interactions between the three components and provide a basis for understanding the effect of changes in the concentration of water and ions in inducing conformations] transitions in the DNA double-helix.
DNA hydration studied by neutron fiber diffraction
International Nuclear Information System (INIS)
Fuller, W.; Forsyth, V.T.; Mahendrasingam, A.; Langan, P.; Pigram, W.J.
1994-01-01
The development of neutron high angle fiber diffraction to investigate the location of water around the deoxyribonucleic acid (DNA) double-helix is described. The power of the technique is illustrated by its application to the D and A conformations of DNA using the single crystal diffractometer, D19, at the Institute Laue-Langevin, Grenoble and the time of flight diffractometer, SXD, at the Rutherford Appleton ISIS Spallation Neutron Source. These studies show the existence of bound water closely associated with the DNA. The patterns of hydration in these two DNA conformations are quite distinct and are compared to those observed in X-ray single crystal studies of two-stranded oligodeoxynucleotides. Information on the location of water around the DNA double-helix from the neutron fiber diffraction studies is combined with that on the location of alkali metal cations from complementary X-ray high angle fiber diffraction studies at the Daresbury Laboratory SRS using synchrotron radiation. These analyses emphasize the importance of viewing DNA, water and ions as a single system with specific interactions between the three components and provide a basis for understanding the effect of changes in the concentration of water and ions in inducing conformations] transitions in the DNA double-helix
Chemical cleavage reactions of DNA on solid support: application in mutation detection
Directory of Open Access Journals (Sweden)
Cotton Richard GH
2003-05-01
Full Text Available Abstract Background The conventional solution-phase Chemical Cleavage of Mismatch (CCM method is time-consuming, as the protocol requires purification of DNA after each reaction step. This paper describes a new version of CCM to overcome this problem by immobilizing DNA on silica solid supports. Results DNA test samples were loaded on to silica beads and the DNA bound to the solid supports underwent chemical modification reactions with KMnO4 (potassium permanganate and hydroxylamine in 3M TEAC (tetraethylammonium chloride solution. The resulting modified DNA was then simultaneously cleaved by piperidine and removed from the solid supports to afford DNA fragments without the requirement of DNA purification between reaction steps. Conclusions The new solid-phase version of CCM is a fast, cost-effective and sensitive method for detection of mismatches and mutations.
Probing the Structure of DNA Aptamers with a Classic Heterocycle.
Directory of Open Access Journals (Sweden)
G. Reid Bishop
2004-02-01
Full Text Available DNA aptamers are synthetic, single-stranded DNA oligonucleotides selectedby SELEX methods for their binding with specific ligands. Here we present ethidiumbinding results for three related DNA aptamers (PDB code: 1OLD, 1DB6, and 2ARGthat bind L-argininamide (L-Arm. The ligand bound form of each aptamer's structurehas been reported and each are found to be composed primarily of two domainsconsisting of a stem helical region and a loop domain that forms a binding pocket for thecognate ligand. Previous thermodynamic experiments demonstrated that the DNAaptamer 1OLD undergoes a large conformational ordering upon binding to L-Arm. Herewe extend those linkage binding studies by examining the binding of the heterocyclicintercalator ethidium to each of the three aptamers by fluorescence and absorptionspectrophotometric titrations. Our results reveal that ethidium binds to each aptamer with∆Go's in the range of -8.7 to -9.4 kcal/mol. The stoichiometry of binding is 2:1 for eachaptamer and is quantitatively diminished in the presence of L-Arm as is the overallfluorescence intensity of ethidium. Together, these results demonstrate that a portion ofthe bound ethidium is excluded from the aptamer in the presence of a saturating amountof L-Arm. These results demonstrate the utility of ethidium and related compounds forthe probing of non-conventional DNA structures and reveal an interesting fundamentalthermodynamic linkage in DNA aptamers. Results are discussed in the context of thethermodynamic stability and structure of each of the aptamers examined.
The binding of the primary water of hydration to nucleosides, CsDNA and potassium hyaluronate
Lukan, A. M.; Cavanaugh, D.; Whitson, K. B.; Marlowe, R. L.; Lee, S. A.; Anthony, L.; Rupprecht, A.; Mohan, V.
1998-03-01
Differential scanning calorimetry (DSC) has been used to study the eight nucleosides, CsDNA and KHA hydrated at 59% relative humidity. Thermograms were measured between 25 and 180 ^oC for scan rates of 1, 2, 5, 10 and 20 K/min. A broad endothermic transition (due to the desorption of the water) near 80 ^oC was observed for all runs. The average enthalpy of desorption per water molecule was evaluated from the area under the peak. A Kissinger analysis of these data yielded the net activation energy for desorption. Both parameters were very similar for the two biopolymers. Rayleigh scattering of Mossbauer radiation (RSMR) data(G. Albanese et al. ) Hyperfine Int. 95, 97 (1995) were analyzed via a simple harmonic oscillator model to evaluate the effective force constant of the water bound to the biopolymer. This analysis suggests that the effective force constant of water bound to HA is much larger (about 5 times) than for water bound to DNA.
Martins, Diogo; Wei, Xi; Levicky, Rastislav; Song, Yong-Ak
2016-04-05
We describe a microfluidic concentration device to accelerate the surface hybridization reaction between DNA and morpholinos (MOs) for enhanced detection. The microfluidic concentrator comprises a single polydimethylsiloxane (PDMS) microchannel onto which an ion-selective layer of conductive polymer poly(3,4-ethylenedioxythiophene)-poly(styrenesulfonate) ( PSS) was directly printed and then reversibly surface bonded onto a morpholino microarray for hybridization. Using this electrokinetic trapping concentrator, we could achieve a maximum concentration factor of ∼800 for DNA and a limit of detection of 10 nM within 15 min. In terms of the detection speed, it enabled faster hybridization by around 10-fold when compared to conventional diffusion-based hybridization. A significant advantage of our approach is that the fabrication of the microfluidic concentrator is completely decoupled from the microarray; by eliminating the need to deposit an ion-selective layer on the microarray surface prior to device integration, interfacing between both modules, the PDMS chip for electrokinetic concentration and the substrate for DNA sensing are easier and applicable to any microarray platform. Furthermore, this fabrication strategy facilitates a multiplexing of concentrators. We have demonstrated the proof-of-concept for multiplexing by building a device with 5 parallel concentrators connected to a single inlet/outlet and applying it to parallel concentration and hybridization. Such device yielded similar concentration and hybridization efficiency compared to that of a single-channel device without adding any complexity to the fabrication and setup. These results demonstrate that our concentrator concept can be applied to the development of a highly multiplexed concentrator-enhanced microarray detection system for either genetic analysis or other diagnostic assays.
Labeling schemes for bounded degree graphs
DEFF Research Database (Denmark)
Adjiashvili, David; Rotbart, Noy Galil
2014-01-01
We investigate adjacency labeling schemes for graphs of bounded degree Δ = O(1). In particular, we present an optimal (up to an additive constant) log n + O(1) adjacency labeling scheme for bounded degree trees. The latter scheme is derived from a labeling scheme for bounded degree outerplanar...... graphs. Our results complement a similar bound recently obtained for bounded depth trees [Fraigniaud and Korman, SODA 2010], and may provide new insights for closing the long standing gap for adjacency in trees [Alstrup and Rauhe, FOCS 2002]. We also provide improved labeling schemes for bounded degree...
DNA synapsis through transient tetramerization triggers cleavage by Ecl18kI restriction enzyme
Zaremba, M.; Lyubchenko, Y.L.; Laurens, N.; van den Broek, B.; Wuite, G.J.L.; Siksnys, V.
2010-01-01
To cut DNA at their target sites, restriction enzymes assemble into different oligomeric structures. The Ecl18kI endonuclease in the crystal is arranged as a tetramer made of two dimers each bound to a DNA copy. However, free in solution Ecl18kI is a dimer. To find out whether the Ecl18kI dimer or
Energy Technology Data Exchange (ETDEWEB)
Jang, Yoon Jung; Kim, Raeyeong; Chitrapriya, Nataraj; Kim, Seog K.; Bae, Inho [Yeungnam Univ., Gyeongsan (Korea, Republic of)
2013-10-15
Direction of intercalation to DNA of the planar dipyrido[3,2-a:2',3'-c]phenazine ligands (dppz) of a bis-Ru(II) complex namely, [Ru(1,10-phenanthroline){sub 2}dipyrido[3,2-a:2',3'-c]phenazine]{sup 2+} linkered by a 1,3-bis(4-pyridyl)propane, was investigated by probing the behavior of 4',6-diamidino-2-phenylindole (DAPI) that bound deep in the minor groove. Bis-intercalation of DPPZ resulted in a little blue shift and hyperchromism in DAPI absorption band, and a large decrease in DAPI fluorescence intensity which accompanied by an increase in the dppz emission intensity. Diminishing the intensity of the positive induced circular dichroism (CD) and linear dichroism (LD) were also observed. These spectral changes indicated that insertion of dppz ligand caused the change of the binding mode of DAPI, which probably moved to the exterior of DNA from the minor groove and interacted with the phospghate groups of DNA by electrostatic interaction. At the surface of DNA, DAPI binds at the phosphate groups of DNA by electrostatic attraction. Consequently, this observation indicated that the dppz ligand intercalated from the minor groove.
Environmental DNA reflects spatial and temporal jellyfish distribution.
Directory of Open Access Journals (Sweden)
Toshifumi Minamoto
Full Text Available Recent development of environmental DNA (eDNA analysis allows us to survey underwater macro-organisms easily and cost effectively; however, there have been no reports on eDNA detection or quantification for jellyfish. Here we present the first report on an eDNA analysis of marine jellyfish using Japanese sea nettle (Chrysaora pacifica as a model species by combining a tank experiment with spatial and temporal distribution surveys. We performed a tank experiment monitoring eDNA concentrations over a range of time intervals after the introduction of jellyfish, and quantified the eDNA concentrations by quantitative real-time PCR. The eDNA concentrations peaked twice, at 1 and 8 h after the beginning of the experiment, and became stable within 48 h. The estimated release rates of the eDNA in jellyfish were higher than the rates previously reported in fishes. A spatial survey was conducted in June 2014 in Maizuru Bay, Kyoto, in which eDNA was collected from surface water and sea floor water samples at 47 sites while jellyfish near surface water were counted on board by eye. The distribution of eDNA in the bay corresponded with the distribution of jellyfish inferred by visual observation, and the eDNA concentration in the bay was ~13 times higher on the sea floor than on the surface. The temporal survey was conducted from March to November 2014, in which jellyfish were counted by eye every morning while eDNA was collected from surface and sea floor water at three sampling points along a pier once a month. The temporal fluctuation pattern of the eDNA concentrations and the numbers of observed individuals were well correlated. We conclude that an eDNA approach is applicable for jellyfish species in the ocean.
Riber, Leise; Olsson, Jan A; Jensen, Rasmus B; Skovgaard, Ole; Dasgupta, Santanu; Marinus, Martin G; Løbner-Olesen, Anders
2006-08-01
Initiation of DNA replication in Eschericia coli requires the ATP-bound form of the DnaA protein. The conversion of DnaA-ATP to DnaA-ADP is facilitated by a complex of DnaA, Hda (homologous to DnaA), and DNA-loaded beta-clamp proteins in a process termed RIDA (regulatory inactivation of DnaA). Hda-deficient cells initiate replication at each origin mainly once per cell cycle, and the rare reinitiation events never coincide with the end of the origin sequestration period. Therefore, RIDA is not the predominant mechanism to prevent immediate reinitiation from oriC. The cellular level of Hda correlated directly with dnaA gene expression such that Hda deficiency led to reduced dnaA gene expression, and overproduction of Hda led to DnaA overproduction. Hda-deficient cells were very sensitive to variations in the cellular level of DnaA, and DnaA overproduction led to uncontrolled initiation of replication from oriC, causing severe growth retardation or cell death. Based on these observations, we propose that both RIDA and dnaA gene autoregulation are required as homeostatic mechanisms to ensure that initiation of replication occurs at the same time relative to cell mass in each cell cycle.
Looping and clustering model for the organization of protein-DNA complexes on the bacterial genome
Walter, Jean-Charles; Walliser, Nils-Ole; David, Gabriel; Dorignac, Jérôme; Geniet, Frédéric; Palmeri, John; Parmeggiani, Andrea; Wingreen, Ned S.; Broedersz, Chase P.
2018-03-01
The bacterial genome is organized by a variety of associated proteins inside a structure called the nucleoid. These proteins can form complexes on DNA that play a central role in various biological processes, including chromosome segregation. A prominent example is the large ParB-DNA complex, which forms an essential component of the segregation machinery in many bacteria. ChIP-Seq experiments show that ParB proteins localize around centromere-like parS sites on the DNA to which ParB binds specifically, and spreads from there over large sections of the chromosome. Recent theoretical and experimental studies suggest that DNA-bound ParB proteins can interact with each other to condense into a coherent 3D complex on the DNA. However, the structural organization of this protein-DNA complex remains unclear, and a predictive quantitative theory for the distribution of ParB proteins on DNA is lacking. Here, we propose the looping and clustering model, which employs a statistical physics approach to describe protein-DNA complexes. The looping and clustering model accounts for the extrusion of DNA loops from a cluster of interacting DNA-bound proteins that is organized around a single high-affinity binding site. Conceptually, the structure of the protein-DNA complex is determined by a competition between attractive protein interactions and loop closure entropy of this protein-DNA cluster on the one hand, and the positional entropy for placing loops within the cluster on the other. Indeed, we show that the protein interaction strength determines the ‘tightness’ of the loopy protein-DNA complex. Thus, our model provides a theoretical framework for quantitatively computing the binding profiles of ParB-like proteins around a cognate (parS) binding site.
Chemical modifications and reactions in DNA nanostructures
DEFF Research Database (Denmark)
Gothelf, Kurt Vesterager
2017-01-01
such as hydrocarbons or steroids have been introduced to change the surface properties of DNA origami structures, either to protect the DNA nanostructure or to dock it into membranes and other hydrophobic surfaces. DNA nanostructures have also been used to control covalent chemical reactions. This article provides......DNA nanotechnology has the power to form self-assembled and well-defined nanostructures, such as DNA origami, where the relative positions of each atom are known with subnanometer precision. Our ability to synthesize oligonucleotides with chemical modifications in almost any desired position...... provides rich opportunity to incorporate molecules, biomolecules, and a variety of nanomaterials in specific positions on DNA nanostructures. Several standard modifications for oligonucleotides are available commercially, such as dyes, biotin, and chemical handles, and such modified oligonucleotides can...
Multiple DNA binding proteins contribute to timing of chromosome replication in E. coli
DEFF Research Database (Denmark)
Riber, Leise; Frimodt-Møller, Jakob; Charbon, Godefroid
2016-01-01
Chromosome replication in Escherichia coli is initiated from a single origin, oriC. Initiation involves a number of DNA binding proteins, but only DnaA is essential and specific for the initiation process. DnaA is an AAA+ protein that binds both ATP and ADP with similar high affinities. Dna...... replication is initiated, or the time window in which all origins present in a single cell are initiated, i.e. initiation synchrony, or both. Overall, these DNA binding proteins modulate the initiation frequency from oriC by: (i) binding directly to oriC to affect DnaA binding, (ii) altering the DNA topology...... in or around oriC, (iii) altering the nucleotide bound status of DnaA by interacting with non-coding chromosomal sequences, distant from oriC, that are important for DnaA activity. Thus, although DnaA is the key protein for initiation of replication, other DNA-binding proteins act not only on ori...
Surface sensitivity of nuclear-knock-out form factors
International Nuclear Information System (INIS)
Fratamico, G.
1984-01-01
A numerical calculation has been performed to investigate the sensitivity of nuclear-knock-out form factors to nuclear-surface behaviour of bound-state wave functions. The result of our investigation suggests that one can extract the bound-state behaviour at the surface from experimental information on nuclear-knock-out form factors
DNA binding properties of the small cascade subunit Csa5.
Directory of Open Access Journals (Sweden)
Michael Daume
Full Text Available CRISPR-Cas systems provide immunity against viral attacks in archaeal and bacterial cells. Type I systems employ a Cas protein complex termed Cascade, which utilizes small CRISPR RNAs to detect and degrade the exogenic DNA. A small sequence motif, the PAM, marks the foreign substrates. Previously, a recombinant type I-A Cascade complex from the archaeon Thermoproteus tenax was shown to target and degrade DNA in vitro, dependent on a native PAM sequence. Here, we present the biochemical analysis of the small subunit, Csa5, of this Cascade complex. T. tenax Csa5 preferentially bound ssDNA and mutants that showed decreased ssDNA-binding and reduced Cascade-mediated DNA cleavage were identified. Csa5 oligomerization prevented DNA binding. Specific recognition of the PAM sequence was not observed. Phylogenetic analyses identified Csa5 as a universal member of type I-A systems and revealed three distinct groups. A potential role of Csa5 in R-loop stabilization is discussed.
Characterization of antibodies specific for UV-damaged DNA by ELISA
Energy Technology Data Exchange (ETDEWEB)
Eggset, G; Volden, G; Krokan, H
1987-04-01
The specificity of affinity purified antibodies raised against UV-irradiated DNA was examined using an enzyme-linked immunosorbent assay. DNA irradiated with UV doses higher than needed for saturation with pyrimidine dimers bound increasing amounts of antibody. Photosensitized DNA, containing high amounts of pyrimidine dimers, showed very poor binding of antibody. When UV-irradiated DNA was given a second dose of 340-nm UV light, the binding of antibodies was inhibited. Taken together, this indicates a major specificity for (6-4)-photoproducts, which are photochemically reversed by UV light in the 340-nm region. The antibodies also showed little but detectable binding to pyrimidine glycols produced in DNA by oxidation with OsO/sub 4/. Previously, we have used these antibodies for the detection of UV-induced DNA damage and its repair in human skin in vivo. These findings indicate that (6-4)-photoproducts, considered highly mutagenic, are repaired in human skin.
Characterization of antibodies specific for UV-damaged DNA by ELISA
International Nuclear Information System (INIS)
Eggset, G.; Volden, G.; Krokan, H.; Norsk Hydro Research Centre, Porsgrunn
1987-01-01
The specificity of affinity purified antibodies raised against UV-irradiated DNA was examined using an enzyme-linked immunosorbent assay. DNA irradiated with UV doses higher than needed for saturation with pyrimidine dimers bound increasing amounts of antibody. Photosensitized DNA, containing high amounts of pyrimidine dimers, showed very poor binding of antibody. When UV-irradiated DNA was given a second dose of 340-nm UV light, the binding of antibodies was inhibited. Taken together, this indicates a major specificity for (6-4)-photoproducts, which are photochemically reversed by UV light in the 340-nm region. The antibodies also showed little but detectable binding to pyrimidine glycols produced in DNA by oxidation with OsO 4 . Previously, we have used these antibodies for the detection of UV-induced DNA damage and its repair in human skin in vivo. These findings indicate that (6-4)-photoproducts, considered highly mutagenic, are repaired in human skin. (author)
International Nuclear Information System (INIS)
Jacob, L.; Lety, M.A.; Choquette, D.; Viard, J.P.; Jacob, F.; Louvard, D.; Bach, J.F.
1987-01-01
Antibodies against a cell-surface protein, cross-reactive with double-stranded DNA, were detected in the serum of 25 patients with active human systemic lupus erythematosus (SLE), defined on the basis of the revised American Rheumatism Association classification. Among these sera, two did not display anti-DNA antibodies, as shown by Farr assay, solid-phase radioimmunoassay, and Crithidia luciliae test. Five other SLE patients were consecutively studied in active and remission states. Antibodies against the protein were detected in the serum of the 5 SLE patients when they were in active phase but not in the serum of the same patients in inactive phase of the disease. The anti-protein antibodies were not found in the serum of 10 inactive SLE patients or in the sera of 10 normal human controls, 10 patients with rheumatoid arthritis, 5 patients with scleroderma, and 4 patients with primary sicca syndrome. Taken together, these results strongly suggest that antibodies against this cell-surface protein could provide a better diagnosis marker and activity index than anti-DNA antibodies in SLE
DEFF Research Database (Denmark)
Guðnason, Haukur; Dufva, Hans Martin; Bang, Dang Duong
2008-01-01
be linked by UV light irradiation onto a plain, unmodified glass surface. Probes immobilized onto unmodified glass microscope slides performed similarly to probes bound to commercial amino-silane-coated slides and had comparable detection limits. The TC-tagged probes linked to unmodified glass did not show...... any significant decrease in hybridization performance after a 20 min incubation in water at 100 degrees C prior to rehybridization, indicating a covalent bond between the TC tag and unmodified glass. The probes were used in thermal minisequencing cycling reactions. Furthermore, the TC tag improved...
Directory of Open Access Journals (Sweden)
Hali Bordelon
2011-01-01
Full Text Available Poly(D,L-lactide-co-glycolide- (PLGA-chitosan nanoparticles are becoming an increasingly common choice for the delivery of nucleic acids to cells for various genetic manipulation techniques. These particles are biocompatible, with tunable size and surface properties, possessing an overall positive charge that promotes complex formation with negatively charged nucleic acids. This study examines properties of the PLGA-chitosan nanoparticle/plasmid DNA complex after formation. Specifically, the study aims to determine the optimal ratio of plasmid DNA:nanoparticles for nucleic acid delivery purposes and to elucidate the location of the pDNA within these complexes. Such characterization will be necessary for the adoption of these formulations in a clinical setting. The ability of PLGA-chitosan nanoparticles to form complexes with pDNA was evaluated by using the fluorescent intercalating due OliGreen to label free plasmid DNA. By monitoring the fluorescence at different plasmid: nanoparticle ratios, the ideal plasmid:nanoparticle ration for complete complexation of plasmid was determined to be 1:50. Surface-Enhanced Raman Spectroscopy and gel digest studies suggested that even at these optimal complexation ratios, a portion of the plasmid DNA was located on the outer complex surface. This knowledge will facilitate future investigations into the functionality of the system in vitro and in vivo.
Hüntelmann, Bettina; Staab, Julia; Herrmann-Lingen, Christoph; Meyer, Thomas
2014-01-01
Binding to specific palindromic sequences termed gamma-activated sites (GAS) is a hallmark of gene activation by members of the STAT (signal transducer and activator of transcription) family of cytokine-inducible transcription factors. However, the precise molecular mechanisms involved in the signal-dependent finding of target genes by STAT dimers have not yet been very well studied. In this study, we have characterized a sequence motif in the STAT1 linker domain which is highly conserved among the seven human STAT proteins and includes surface-exposed residues in close proximity to the bound DNA. Using site-directed mutagenesis, we have demonstrated that a lysine residue in position 567 of the full-length molecule is required for GAS recognition. The substitution of alanine for this residue completely abolished both binding to high-affinity GAS elements and transcriptional activation of endogenous target genes in cells stimulated with interferon-γ (IFNγ), while the time course of transient nuclear accumulation and tyrosine phosphorylation were virtually unchanged. In contrast, two glutamic acid residues (E559 and E563) on each monomer are important for the dissociation of dimeric STAT1 from DNA and, when mutated to alanine, result in elevated levels of tyrosine-phosphorylated STAT1 as well as prolonged IFNγ-stimulated nuclear accumulation. In conclusion, our data indicate that the kinetics of signal-dependent GAS binding is determined by an array of glutamic acid residues located at the interior surface of the STAT1 dimer. These negatively charged residues appear to align the long axis of the STAT1 dimer in a position perpendicular to the DNA, thereby facilitating the interaction between lysine 567 and the phosphodiester backbone of a bound GAS element, which is a prerequisite for transient gene induction.
Zinc fingers, zinc clusters, and zinc twists in DNA-binding protein domains
International Nuclear Information System (INIS)
Vallee, B.L.; Auld, D.S.; Coleman, J.E.
1991-01-01
The authors recognize three distinct motifs of DNA-binding zinc proteins: (i) zinc fingers, (ii) zinc clusters, and (iii) zinc twists. Until very recently, x-ray crystallographic or NMR three-dimensional structure analyses of DNA-binding zinc proteins have not been available to serve as standards of reference for the zinc binding sites of these families of proteins. Those of the DNA-binding domains of the fungal transcription factor GAL4 and the rat glucocorticoid receptor are the first to have been determined. Both proteins contain two zinc binding sites, and in both, cysteine residues are the sole zinc ligands. In GAL4, two zinc atoms are bound to six cysteine residues which form a zinc cluster akin to that of metallothionein; the distance between the two zinc atoms of GAL4 is ∼3.5 angstrom. In the glucocorticoid receptor, each zinc atom is bound to four cysteine residues; the interatomic zinc-zinc distance is ∼13 angstrom, and in this instance, a zinc twist is represented by a helical DNA recognition site located between the two zinc atoms. Zinc clusters and zinc twists are here recognized as two distinctive motifs in DNA-binding proteins containing multiple zinc atoms. For native zinc fingers, structural data do not exist as yet; consequently, the interatomic distances between zinc atoms are not known. As further structural data become available, the structural and functional significance of these different motifs in their binding to DNA and other proteins participating in the transmission of the genetic message will become apparent
Cross-linking and relaxation of supercoiled DNA by psoralen and light
International Nuclear Information System (INIS)
Yoakum, G.H.; Cole, R.S.
1978-01-01
Photoreaction of 4,5',8-trimethylpsoralen with superhelical ColE1 and ColE1amp DNA was studied. Changes in mobilities in agarose gels, formation of interstrand cross-links, and DNA strand breaks were determined. Psoralen and light treatment removed negative superhelical turns, and extensive treatments failed to produce positive superhelical turns in covalently closed plasmid DNA. The rate of relaxation of superhelical turns by psoralen photobinding appeared to be directly proportional to the number of superhelical turns remaining. A unique reaction mechanism is presented to explain these results. By this interpretation the initial rate of psoralen photobinding to superhelical DNA was estimated to be 3 times that for linear DNA, and the ratio of cross-linking to monofunctional adducts appears to be dependent on the superhelical conformation of the DNA. The estimated ratio of psoralen molecules bound to DNA strand breaks was 1.7 . 10 4 :1, and 70% of this breakage is caused by the light alone. (Auth.)
International Nuclear Information System (INIS)
Tezuka, Hirokazu.
1984-10-01
Scattering of a particle by bound nucleons is discussed. Effects of nucleons that are bound in a nucleus are taken as a structure function. The way how to calculate the structure function is given. (author)
Directory of Open Access Journals (Sweden)
Morroll Shaun
2009-08-01
Full Text Available Abstract Background The high intracellular salt concentration required to maintain a halophilic lifestyle poses challenges to haloarchaeal proteins that must stay soluble, stable and functional in this extreme environment. Proliferating cell nuclear antigen (PCNA is a fundamental protein involved in maintaining genome integrity, with roles in both DNA replication and repair. To investigate the halophilic adaptation of such a key protein we have crystallised and solved the structure of Haloferax volcanii PCNA (HvPCNA to a resolution of 2.0 Å. Results The overall architecture of HvPCNA is very similar to other known PCNAs, which are highly structurally conserved. Three commonly observed adaptations in halophilic proteins are higher surface acidity, bound ions and increased numbers of intermolecular ion pairs (in oligomeric proteins. HvPCNA possesses the former two adaptations but not the latter, despite functioning as a homotrimer. Strikingly, the positive surface charge considered key to PCNA's role as a sliding clamp is dramatically reduced in the halophilic protein. Instead, bound cations within the solvation shell of HvPCNA may permit sliding along negatively charged DNA by reducing electrostatic repulsion effects. Conclusion The extent to which individual proteins adapt to halophilic conditions varies, presumably due to their diverse characteristics and roles within the cell. The number of ion pairs observed in the HvPCNA monomer-monomer interface was unexpectedly low. This may reflect the fact that the trimer is intrinsically stable over a wide range of salt concentrations and therefore additional modifications for trimer maintenance in high salt conditions are not required. Halophilic proteins frequently bind anions and cations and in HvPCNA cation binding may compensate for the remarkable reduction in positive charge in the pore region, to facilitate functional interactions with DNA. In this way, HvPCNA may harness its environment as
Winter, Jody A; Christofi, Panayiotis; Morroll, Shaun; Bunting, Karen A
2009-01-01
Background The high intracellular salt concentration required to maintain a halophilic lifestyle poses challenges to haloarchaeal proteins that must stay soluble, stable and functional in this extreme environment. Proliferating cell nuclear antigen (PCNA) is a fundamental protein involved in maintaining genome integrity, with roles in both DNA replication and repair. To investigate the halophilic adaptation of such a key protein we have crystallised and solved the structure of Haloferax volcanii PCNA (HvPCNA) to a resolution of 2.0 Å. Results The overall architecture of HvPCNA is very similar to other known PCNAs, which are highly structurally conserved. Three commonly observed adaptations in halophilic proteins are higher surface acidity, bound ions and increased numbers of intermolecular ion pairs (in oligomeric proteins). HvPCNA possesses the former two adaptations but not the latter, despite functioning as a homotrimer. Strikingly, the positive surface charge considered key to PCNA's role as a sliding clamp is dramatically reduced in the halophilic protein. Instead, bound cations within the solvation shell of HvPCNA may permit sliding along negatively charged DNA by reducing electrostatic repulsion effects. Conclusion The extent to which individual proteins adapt to halophilic conditions varies, presumably due to their diverse characteristics and roles within the cell. The number of ion pairs observed in the HvPCNA monomer-monomer interface was unexpectedly low. This may reflect the fact that the trimer is intrinsically stable over a wide range of salt concentrations and therefore additional modifications for trimer maintenance in high salt conditions are not required. Halophilic proteins frequently bind anions and cations and in HvPCNA cation binding may compensate for the remarkable reduction in positive charge in the pore region, to facilitate functional interactions with DNA. In this way, HvPCNA may harness its environment as opposed to simply surviving in
Direct immobilization and hybridization of DNA on group III nitride semiconductors
Energy Technology Data Exchange (ETDEWEB)
Xu Xiaobin; Jindal, Vibhu; Shahedipour-Sandvik, Fatemeh; Bergkvist, Magnus [College of Nanoscale Science and Engineering, University at Albany (SUNY), 255 Fuller Road, Albany, NY 12203 (United States); Cady, Nathaniel C. [College of Nanoscale Science and Engineering, University at Albany (SUNY), 255 Fuller Road, Albany, NY 12203 (United States)], E-mail: ncady@uamail.albany.edu
2009-03-15
A key concern for group III-nitride high electron mobility transistor (HEMT) biosensors is the anchoring of specific capture molecules onto the gate surface. To this end, a direct immobilization strategy was developed to attach single-stranded DNA (ssDNA) to AlGaN surfaces using simple printing techniques without the need for cross-linking agents or complex surface pre-functionalization procedures. Immobilized DNA molecules were stably attached to the AlGaN surfaces and were able to withstand a range of pH and ionic strength conditions. The biological activity of surface-immobilized probe DNA was also retained, as demonstrated by sequence-specific hybridization experiments. Probe hybridization with target ssDNA could be detected by PicoGreen fluorescent dye labeling with a minimum detection limit of 2 nM. These experiments demonstrate a simple and effective immobilization approach for attaching nucleic acids to AlGaN surfaces which can further be used for the development of HEMT-based DNA biosensors.
Targeting of a chimeric human histone fusion mRNA to membrane-bound polysomes in HeLa cells
International Nuclear Information System (INIS)
Zambetti, G.; Stein, J.; Stein, G.
1987-01-01
The subcellular location of histone mRNA-containing polysomes may play a key role in the posttranscriptional events that mediate histone mRNA turnover following inhibition of DNA synthesis. Previously, it has been shown that histone mRNA is found primarily on free polysomes that are associated with the cytoskeleton. The authors report here the construction of an Escherichia coli pBR322 β-lactamase signal peptide-human H3 histone fusion gene. The fusion transcript is targeted to membrane-bound polysomes and remains stable following interruption of DNA replication. Relocating mRNA within the cell may provide a procedure for studying the posttranscriptional regulation of gene expression
Bounds for Asian basket options
Deelstra, Griselda; Diallo, Ibrahima; Vanmaele, Michèle
2008-09-01
In this paper we propose pricing bounds for European-style discrete arithmetic Asian basket options in a Black and Scholes framework. We start from methods used for basket options and Asian options. First, we use the general approach for deriving upper and lower bounds for stop-loss premia of sums of non-independent random variables as in Kaas et al. [Upper and lower bounds for sums of random variables, Insurance Math. Econom. 27 (2000) 151-168] or Dhaene et al. [The concept of comonotonicity in actuarial science and finance: theory, Insurance Math. Econom. 31(1) (2002) 3-33]. We generalize the methods in Deelstra et al. [Pricing of arithmetic basket options by conditioning, Insurance Math. Econom. 34 (2004) 55-57] and Vanmaele et al. [Bounds for the price of discrete sampled arithmetic Asian options, J. Comput. Appl. Math. 185(1) (2006) 51-90]. Afterwards we show how to derive an analytical closed-form expression for a lower bound in the non-comonotonic case. Finally, we derive upper bounds for Asian basket options by applying techniques as in Thompson [Fast narrow bounds on the value of Asian options, Working Paper, University of Cambridge, 1999] and Lord [Partially exact and bounded approximations for arithmetic Asian options, J. Comput. Finance 10 (2) (2006) 1-52]. Numerical results are included and on the basis of our numerical tests, we explain which method we recommend depending on moneyness and time-to-maturity.
Structural basis for sequence-specific recognition of DNA by TAL effectors
Deng, Dong
2012-01-05
TAL (transcription activator-like) effectors, secreted by phytopathogenic bacteria, recognize host DNA sequences through a central domain of tandem repeats. Each repeat comprises 33 to 35 conserved amino acids and targets a specific base pair by using two hypervariable residues [known as repeat variable diresidues (RVDs)] at positions 12 and 13. Here, we report the crystal structures of an 11.5-repeat TAL effector in both DNA-free and DNA-bound states. Each TAL repeat comprises two helices connected by a short RVD-containing loop. The 11.5 repeats form a right-handed, superhelical structure that tracks along the sense strand of DNA duplex, with RVDs contacting the major groove. The 12th residue stabilizes the RVD loop, whereas the 13th residue makes a base-specific contact. Understanding DNA recognition by TAL effectors may facilitate rational design of DNA-binding proteins with biotechnological applications.
Lingaraju, Gondichatnahalli M; Davis, C Ainsley; Setser, Jeremy W; Samson, Leona D; Drennan, Catherine L
2011-04-15
Reactive oxygen and nitrogen species, generated by neutrophils and macrophages in chronically inflamed tissues, readily damage DNA, producing a variety of potentially genotoxic etheno base lesions; such inflammation-related DNA damage is now known to contribute to carcinogenesis. Although the human alkyladenine DNA glycosylase (AAG) can specifically bind DNA containing either 1,N(6)-ethenoadenine (εA) lesions or 3,N(4)-ethenocytosine (εC) lesions, it can only excise εA lesions. AAG binds very tightly to DNA containing εC lesions, forming an abortive protein-DNA complex; such binding not only shields εC from repair by other enzymes but also inhibits AAG from acting on other DNA lesions. To understand the structural basis for inhibition, we have characterized the binding of AAG to DNA containing εC lesions and have solved a crystal structure of AAG bound to a DNA duplex containing the εC lesion. This study provides the first structure of a DNA glycosylase in complex with an inhibitory base lesion that is induced endogenously and that is also induced upon exposure to environmental agents such as vinyl chloride. We identify the primary cause of inhibition as a failure to activate the nucleotide base as an efficient leaving group and demonstrate that the higher binding affinity of AAG for εC versus εA is achieved through formation of an additional hydrogen bond between Asn-169 in the active site pocket and the O(2) of εC. This structure provides the basis for the design of AAG inhibitors currently being sought as an adjuvant for cancer chemotherapy.
"DNA Origami Traffic Lights" with a Split Aptamer Sensor for a Bicolor Fluorescence Readout.
Walter, Heidi-Kristin; Bauer, Jens; Steinmeyer, Jeannine; Kuzuya, Akinori; Niemeyer, Christof M; Wagenknecht, Hans-Achim
2017-04-12
A split aptamer for adenosine triphosphate (ATP) was embedded as a recognition unit into two levers of a nanomechanical DNA origami construct by extension and modification of selected staple strands. An additional optical module in the stem of the split aptamer comprised two different cyanine-styryl dyes that underwent an energy transfer from green (donor) to red (acceptor) emission if two ATP molecules were bound as target molecule to the recognition module and thereby brought the dyes in close proximity. As a result, the ATP as a target triggered the DNA origami shape transition and yielded a fluorescence color change from green to red as readout. Conventional atomic force microscopy (AFM) images confirmed the topology change from the open form of the DNA origami in the absence of ATP into the closed form in the presence of the target molecule. The obtained closed/open ratios in the absence and presence of target molecules tracked well with the fluorescence color ratios and thereby validated the bicolor fluorescence readout. The correct positioning of the split aptamer as the functional unit farthest away from the fulcrum of the DNA origami was crucial for the aptasensing by fluorescence readout. The fluorescence color change allowed additionally to follow the topology change of the DNA origami aptasensor in real time in solution. The concepts of fluorescence energy transfer for bicolor readout in a split aptamer in solution, and AFM on surfaces, were successfully combined in a single DNA origami construct to obtain a bimodal readout. These results are important for future custom DNA devices for chemical-biological and bioanalytical purposes because they are not only working as simple aptamers but are also visible by AFM on the single-molecule level.
Market access through bound tariffs
DEFF Research Database (Denmark)
Sala, Davide; Yalcin, Erdal; Schröder, Philipp
2010-01-01
on the risk that exporters face in destination markets. The present paper formalizes the underlying interaction of risk, fixed export costs and firms' market entry decisions based on techniques known from the real options literature; doing so we highlight the important role of bound tariffs at the extensive...... margin of trade. We find that bound tariffs are more effective with higher risk destination markets, that a large binding overhang may still command substantial market access, and that reductions in bound tariffs generate effective market access even when bound rates are above current and longterm...
Market Access through Bound Tariffs
DEFF Research Database (Denmark)
Sala, Davide; Schröder, Philipp J.H.; Yalcin, Erdal
on the risk that exporters face in destination markets. The present paper formalizes the underlying interaction of risk, fixed export costs and firms' market entry decisions based on techniques known from the real options literature; doing so we highlight the important role of bound tariffs at the extensive...... margin of trade. We find that bound tariffs are more effective with higher risk destination markets, that a large binding overhang may still command substantial market access, and that reductions in bound tariffs generate effective market access even when bound rates are above current and long...
Asymmetric Arginine dimethylation of Epstein-Barr virus nuclear antigen 2 promotes DNA targeting
International Nuclear Information System (INIS)
Gross, Henrik; Barth, Stephanie; Palermo, Richard D.; Mamiani, Alfredo; Hennard, Christine; Zimber-Strobl, Ursula; West, Michelle J.; Kremmer, Elisabeth; Graesser, Friedrich A.
2010-01-01
The Epstein-Barr virus (EBV) growth-transforms B-lymphocytes. The virus-encoded nuclear antigen 2 (EBNA2) is essential for transformation and activates gene expression by association with DNA-bound transcription factors such as RBPJκ (CSL/CBF1). We have previously shown that EBNA2 contains symmetrically dimethylated Arginine (sDMA) residues. Deletion of the RG-repeat results in a reduced ability of the virus to immortalise B-cells. We now show that the RG repeat also contains asymmetrically dimethylated Arginines (aDMA) but neither non-methylated (NMA) Arginines nor citrulline residues. We demonstrate that only aDMA-containing EBNA2 is found in a complex with DNA-bound RBPJκ in vitro and preferentially associates with the EBNA2-responsive EBV C, LMP1 and LMP2A promoters in vivo. Inhibition of methylation in EBV-infected cells results in reduced expression of the EBNA2-regulated viral gene LMP1, providing additional evidence that methylation is a prerequisite for DNA-binding by EBNA2 via association with the transcription factor RBPJκ.
Architecture of the 99 bp DNA-six-protein regulatory complex of the lambda att site.
Sun, Xingmin; Mierke, Dale F; Biswas, Tapan; Lee, Sang Yeol; Landy, Arthur; Radman-Livaja, Marta
2006-11-17
The highly directional and tightly regulated recombination reaction used to site-specifically excise the bacteriophage lambda chromosome out of its E. coli host chromosome requires the binding of six sequence-specific proteins to a 99 bp segment of the phage att site. To gain structural insights into this recombination pathway, we measured 27 FRET distances between eight points on the 99 bp regulatory DNA bound with all six proteins. Triangulation of these distances using a metric matrix distance-geometry algorithm provided coordinates for these eight points. The resulting path for the protein-bound regulatory DNA, which fits well with the genetics, biochemistry, and X-ray crystal structures describing the individual proteins and their interactions with DNA, provides a new structural perspective into the molecular mechanism and regulation of the recombination reaction and illustrates a design by which different families of higher-order complexes can be assembled from different numbers and combinations of the same few proteins.
Energy Technology Data Exchange (ETDEWEB)
Wang Zheng; Wang Guliang; Yang Jun; Guo Lei; Yu Yingnian
2003-07-25
Alkylating agent N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) induces cellular stress leading to chromosomal aberrations, mutations and cell death. Previous reports from our laboratory have shown that low concentration of MNNG induces untargeted mutation (UTM), which occurs on intact DNA in mammalian cells through changes in gene expression profile. It also causes the activation of cAMP-protein kinase A (PKA) and up-regulation of POL-{beta}, which is demonstrated to play a role in DNA repair system. In order to find out the possible initial signal involved in UTM, we try to investigate whether the activation of PKA-CREB signal pathway is closely related to DNA damage. Our data shows that the treatment of low concentration MNNG (0.2 {mu}M) activates PKA-CREB pathway in a comparable level both in a nuclear and enucleated cell system. And similar to the cell response caused by UV, the clustering of cell surface receptors of epidermal growth factor (EGF) and tumor necrosis factor {alpha} (TNF{alpha}) was also observed in cells exposed to MNNG. It was further demonstrated that the clustering of the surface receptors is independent of the genomic DNA damage, as this phenomenon was also observed in enucleated cells. These observations indicate that the initiation of signal cascades induced by low concentration of MNNG might be associated with its interaction with cell surface receptors and/or direct activation of related signal proteins but not its DNA damaging property.
International Nuclear Information System (INIS)
Orzalesi, C.A.
1979-01-01
In relativistic quantum theory, bound states generate forces in the crossed channel; such forces can affect the binding and self-consistent solutions should be sought for the bound-state problem. The author investigates how self-consistency can be achieved by successive approximations, in a simple scalar model and with successive relativistic eikonal approximations (EAs). Within the generalized ladder approximation, some exact properties of the resulting ''first generation'' bound states are discussed. The binding energies in this approximation are rather small even for rather large values of the primary coupling constant. The coupling of the constituent particles to the first-generation reggeon is determined by a suitable EA and a new generalized ladder amplitude is constructed with rungs given either by the primary gluons or by the first-generation reggeons. The resulting new (second-generation) bound states are found in a reggeized EA. The size of the corrections to the binding energies due to the rebinding effects is surprisingly large. The procedure is then iterated, so as to find - again in an EA - the third-generation bound states. The procedure is found to be self-consistent already at this stage: the third-generation bound states coincide with those of second generation, and no further rebinding takes place in the higher iterations of the approximation method. Features - good and bad - of the model are discussed, as well as the possible relevance of rebinding mechanisms in hadron dynamics. (author)
Ford, K G; Neidle, S
1995-06-01
The interactions of several porphyrins with a 74 base-pair DNA sequence have been examined by footprinting and chemical protection methods. Tetra-(4-N-methyl-(pyridyl)) porphyrin (TMPy), two of its metal complexes and tetra-(4-trimethylanilinium) porphyrin (TMAP) bind to closely similar AT-rich sequences. The three TMPy ligands produce modest changes in DNA structure and base accessibility on binding, in contrast to the large-scale conformational changes observed with TMAP. Molecular modelling studies have been performed on TMPy and TMAP bound in the AT-rich minor groove of an oligonucleotide. These have shown that significant structural change is needed to accommodate the bulky trimethyl substituent groups of TMAP, in contrast to the facile minor groove fit of TMPy.
DNA interaction studies of sesamol (3,4-methylenedioxyphenol) food additive.
Kashanian, Soheila; Tahmasian Ghobadi, Ameneh; Roshanfekr, Hamideh; Shariati, Zohreh
2013-02-01
The interaction of native calf thymus DNA (CT-DNA) with sesamol (3,4-methylenedioxyphenol) in Tris-HCl buffer at neutral pH 7.4 was monitored by absorption spectrophotometry, viscometry and spectrofluorometry. It is found that sesamol molecules could interact with DNA outside and/or groove binding modes, as are evidenced by: hyperchromism in UV absorption band, very slow decrease in specific viscosity of DNA, and small increase in the fluorescence of methylene blue (MB)-DNA solutions in the presence of increasing amounts of sesamol, which indicates that it is able to partially release the bound MB. Furthermore, the enthalpy and entropy of the reaction between sesamol and CT-DNA showed that the reaction is enthalpy-favored and entropy-disfavored (ΔH = -174.08 kJ mol(-1); ΔS = -532.92 J mol(-1) K(-1)). The binding constant was determined using absorption measurement and found to be 2.7 × 10(4) M(-1); its magnitude suggests that sesamol interacts to DNA with a high affinity.
The earthworm gastrointestinal effect on the release of organic bound residues in soils
Du, J. H.
2018-03-01
Earthworm activities promote the release of bound residues and the digestive activities of earthworms contribute to the process. Earthworm digestive effects on bound residues can be divided into physical and chemical effects. Physical effects include gastrointestinal abrasion and mixing. The abrasion of soil and litter residues in earthworm gizzards and intestine can grind the food into fine particles, which increase the contact surface with microbial and promote the desorption of bound residues. Chemical effects are attributed to the secreted surfactant substances and digestive enzymes. The surfactants, especially at levels that lead to micellization, can enhance the desorption process of the organic contaminants that sored in the soil. The enzymes in earthworm digestive tracts can decompose the humus in soil, which may promote the release of organic residues that bind with humus.
Label-Free Potentiometry for Detecting DNA Hybridization Using Peptide Nucleic Acid and DNA Probes
Goda, Tatsuro; Singi, Ankit Balram; Maeda, Yasuhiro; Matsumoto, Akira; Torimura, Masaki; Aoki, Hiroshi; Miyahara, Yuji
2013-01-01
Peptide nucleic acid (PNA) has outstanding affinity over DNA for complementary nucleic acid sequences by forming a PNA-DNA heterodimer upon hybridization via Watson-Crick base-pairing. To verify whether PNA probes on an electrode surface enhance sensitivity for potentiometric DNA detection or not, we conducted a comparative study on the hybridization of PNA and DNA probes on the surface of a 10-channel gold electrodes microarray. Changes in the charge density as a result of hybridization at the solution/electrode interface on the self-assembled monolayer (SAM)-formed microelectrodes were directly transformed into potentiometric signals using a high input impedance electrometer. The charge readout allows label-free, reagent-less, and multi-parallel detection of target oligonucleotides without any optical assistance. The differences in the probe lengths between 15- to 22-mer dramatically influenced on the sensitivity of the PNA and DNA sensors. Molecular type of the capturing probe did not affect the degree of potential shift. Theoretical model for charged rod-like duplex using the Gouy-Chapman equation indicates the dominant effect of electrostatic attractive forces between anionic DNA and underlying electrode at the electrolyte/electrode interface in the potentiometry. PMID:23435052
Label-Free Potentiometry for Detecting DNA Hybridization Using Peptide Nucleic Acid and DNA Probes
Directory of Open Access Journals (Sweden)
Yuji Miyahara
2013-02-01
Full Text Available Peptide nucleic acid (PNA has outstanding affinity over DNA for complementary nucleic acid sequences by forming a PNA-DNA heterodimer upon hybridization via Watson-Crick base-pairing. To verify whether PNA probes on an electrode surface enhance sensitivity for potentiometric DNA detection or not, we conducted a comparative study on the hybridization of PNA and DNA probes on the surface of a 10-channel gold electrodes microarray. Changes in the charge density as a result of hybridization at the solution/electrode interface on the self-assembled monolayer (SAM-formed microelectrodes were directly transformed into potentiometric signals using a high input impedance electrometer. The charge readout allows label-free, reagent-less, and multi-parallel detection of target oligonucleotides without any optical assistance. The differences in the probe lengths between 15- to 22-mer dramatically influenced on the sensitivity of the PNA and DNA sensors. Molecular type of the capturing probe did not affect the degree of potential shift. Theoretical model for charged rod-like duplex using the Gouy-Chapman equation indicates the dominant effect of electrostatic attractive forces between anionic DNA and underlying electrode at the electrolyte/electrode interface in the potentiometry.
Samai, Poulami; Shuman, Stewart
2011-01-01
Chlorella virus DNA ligase (ChVLig) has pluripotent biological activity and an intrinsic nick-sensing function. ChVLig consists of three structural modules that envelop nicked DNA as a C-shaped protein clamp: a nucleotidyltransferase (NTase) domain and an OB domain (these two are common to all DNA ligases) as well as a distinctive β-hairpin latch module. The NTase domain, which performs the chemical steps of ligation, binds the major groove flanking the nick and the minor groove on the 3′-OH side of the nick. Here we performed a structure-guided mutational analysis of the NTase domain, surveying the effects of 35 mutations in 19 residues on ChVLig activity in vivo and in vitro, including biochemical tests of the composite nick sealing reaction and of the three component steps of the ligation pathway (ligase adenylylation, DNA adenylylation, and phosphodiester synthesis). The results highlight (i) key contacts by Thr-84 and Lys-173 to the template DNA strand phosphates at the outer margins of the DNA ligase footprint; (ii) essential contacts of Ser-41, Arg-42, Met-83, and Phe-75 with the 3′-OH strand at the nick; (iii) Arg-176 phosphate contacts at the nick and with ATP during ligase adenylylation; (iv) the role of Phe-44 in forming the protein clamp around the nicked DNA substrate; and (v) the importance of adenine-binding residue Phe-98 in all three steps of ligation. Kinetic analysis of single-turnover nick sealing by ChVLig-AMP underscored the importance of Phe-75-mediated distortion of the nick 3′-OH nucleoside in the catalysis of DNA 5′-adenylylation (step 2) and phosphodiester synthesis (step 3). Induced fit of the nicked DNA into a distorted conformation when bound within the ligase clamp may account for the nick-sensing capacity of ChVLig. PMID:21335605
Samai, Poulami; Shuman, Stewart
2011-04-15
Chlorella virus DNA ligase (ChVLig) has pluripotent biological activity and an intrinsic nick-sensing function. ChVLig consists of three structural modules that envelop nicked DNA as a C-shaped protein clamp: a nucleotidyltransferase (NTase) domain and an OB domain (these two are common to all DNA ligases) as well as a distinctive β-hairpin latch module. The NTase domain, which performs the chemical steps of ligation, binds the major groove flanking the nick and the minor groove on the 3'-OH side of the nick. Here we performed a structure-guided mutational analysis of the NTase domain, surveying the effects of 35 mutations in 19 residues on ChVLig activity in vivo and in vitro, including biochemical tests of the composite nick sealing reaction and of the three component steps of the ligation pathway (ligase adenylylation, DNA adenylylation, and phosphodiester synthesis). The results highlight (i) key contacts by Thr-84 and Lys-173 to the template DNA strand phosphates at the outer margins of the DNA ligase footprint; (ii) essential contacts of Ser-41, Arg-42, Met-83, and Phe-75 with the 3'-OH strand at the nick; (iii) Arg-176 phosphate contacts at the nick and with ATP during ligase adenylylation; (iv) the role of Phe-44 in forming the protein clamp around the nicked DNA substrate; and (v) the importance of adenine-binding residue Phe-98 in all three steps of ligation. Kinetic analysis of single-turnover nick sealing by ChVLig-AMP underscored the importance of Phe-75-mediated distortion of the nick 3'-OH nucleoside in the catalysis of DNA 5'-adenylylation (step 2) and phosphodiester synthesis (step 3). Induced fit of the nicked DNA into a distorted conformation when bound within the ligase clamp may account for the nick-sensing capacity of ChVLig.
Wieczorek, Anna; Downey, Christopher D; Dallmann, H Garry; McHenry, Charles S
2010-09-17
The DnaX complex (DnaX(3)δδ'χ psi) within the Escherichia coli DNA polymerase III holoenzyme serves to load the dimeric sliding clamp processivity factor, β(2), onto DNA. The complex contains three DnaX subunits, which occur in two forms: τ and the shorter γ, produced by translational frameshifting. Ten forms of E. coli DnaX complex containing all possible combinations of wild-type or a Walker A motif K51E variant τ or γ have been reconstituted and rigorously purified. DnaX complexes containing three DnaX K51E subunits do not bind ATP. Comparison of their ability to support formation of initiation complexes, as measured by processive replication by the DNA polymerase III holoenzyme, indicates a minimal requirement for one ATP-binding DnaX subunit. DnaX complexes containing two mutant DnaX subunits support DNA synthesis at about two-thirds the level of their wild-type counterparts. β(2) binding (determined functionally) is diminished 12-30-fold for DnaX complexes containing two K51E subunits, suggesting that multiple ATPs must be bound to place the DnaX complex into a conformation with maximal affinity for β(2). DNA synthesis activity can be restored by increased concentrations of β(2). In contrast, severe defects in ATP hydrolysis are observed upon introduction of a single K51E DnaX subunit. Thus, ATP binding, hydrolysis, and the ability to form initiation complexes are not tightly coupled. These results suggest that although ATP hydrolysis likely enhances β(2) loading, it is not absolutely required in a mechanistic sense for formation of functional initiation complexes.
Recognition of thymine in DNA bulges by a Zn(II) macrocyclic complex.
del Mundo, Imee Marie A; Fountain, Matthew A; Morrow, Janet R
2011-08-14
A Zn(II) macrocyclic complex with appended quinoline is a bifunctional recognition agent that uses both the Zn(II) center and the pendent aromatic group to bind to thymine in bulges with good selectivity over DNA containing G, C or A bulges. Spectroscopic studies show that the stem containing the bulge stays largely intact in a DNA hairpin with the Zn(II) complex bound to the thymine bulge. This journal is © The Royal Society of Chemistry 2011
Expression, purification, and DNA-binding activity of the Herbaspirillum seropedicae RecX protein.
Galvão, Carolina W; Pedrosa, Fábio O; Souza, Emanuel M; Yates, M Geoffrey; Chubatsu, Leda S; Steffens, Maria Berenice R
2004-06-01
The Herbaspirillum seropedicae RecX protein participates in the SOS response: a process in which the RecA protein plays a central role. The RecX protein of the H. seropedicae, fused to a His-tag sequence (RecX His-tagged), was over-expressed in Escherichia coli and purified by metal-affinity chromatography to yield a highly purified and active protein. DNA band-shift assays showed that the RecX His-tagged protein bound to both circular and linear double-stranded DNA and also to circular single-stranded DNA. The apparent affinity of RecX for DNA decreased in the presence of Mg(2+) ions. The ability of RecX to bind DNA may be relevant to its function in the SOS response.
International Nuclear Information System (INIS)
Hah, S S; Stivers, K M; Vere White, R; Henderson, P T
2005-01-01
Cisplatin and carboplatin are platinum-based drugs that are widely used in cancer chemotherapy. The cytotoxicity of these drugs is mediated by platinum-DNA monoadducts and intra- and interstrand diadducts, which are formed following uptake of the drug into the nucleus of cells. The pharmacodynamics of carboplatin display fewer side effects than for cisplatin, albeit with less potency, which may be due to differences in rates of DNA adduct formation. We report the use of accelerator mass spectrometry (AMS), a sensitive detection method often used for radiocarbon quantitation, to measure both the kinetics of [ 14 C]carboplatin-DNA adduct formation with genomic DNA and drug uptake and DNA binding in T24 human bladder cancer cells. Only carboplatin-DNA monoadducts contain radiocarbon in the platinated DNA, which allowed for calculation of kinetic rates and concentrations within the system. The percent of radiocarbon bound to salmon sperm DNA in the form of monoadducts was measured by AMS over 24 h. Knowledge of both the starting concentration of the parent carboplatin and the concentration of radiocarbon in the DNA at a variety of time points allowed calculation of the rates of Pt-DNA monoadduct formation and conversion to toxic cross-links. Importantly, the rate of carboplatin-DNA monoadduct formation was approximately 100-fold slower than that reported for the more potent cisplatin analogue, which may explain the lower toxicity of carboplatin. T24 human bladder cancer cells were incubated with a subpharmacological dose of [ 14 C]carboplatin, and the rate of accumulation of radiocarbon in the cells and nuclear DNA was measured by AMS. The lowest concentration of radiocarbon measured was approximately 1 amol/10 (micro)g of DNA. This sensitivity may allow the method to be used for clinical applications
Energy Technology Data Exchange (ETDEWEB)
Hah, S S; Stivers, K M; Vere White, R; Henderson, P T
2005-12-29
Cisplatin and carboplatin are platinum-based drugs that are widely used in cancer chemotherapy. The cytotoxicity of these drugs is mediated by platinum-DNA monoadducts and intra- and interstrand diadducts, which are formed following uptake of the drug into the nucleus of cells. The pharmacodynamics of carboplatin display fewer side effects than for cisplatin, albeit with less potency, which may be due to differences in rates of DNA adduct formation. We report the use of accelerator mass spectrometry (AMS), a sensitive detection method often used for radiocarbon quantitation, to measure both the kinetics of [{sup 14}C]carboplatin-DNA adduct formation with genomic DNA and drug uptake and DNA binding in T24 human bladder cancer cells. Only carboplatin-DNA monoadducts contain radiocarbon in the platinated DNA, which allowed for calculation of kinetic rates and concentrations within the system. The percent of radiocarbon bound to salmon sperm DNA in the form of monoadducts was measured by AMS over 24 h. Knowledge of both the starting concentration of the parent carboplatin and the concentration of radiocarbon in the DNA at a variety of time points allowed calculation of the rates of Pt-DNA monoadduct formation and conversion to toxic cross-links. Importantly, the rate of carboplatin-DNA monoadduct formation was approximately 100-fold slower than that reported for the more potent cisplatin analogue, which may explain the lower toxicity of carboplatin. T24 human bladder cancer cells were incubated with a subpharmacological dose of [{sup 14}C]carboplatin, and the rate of accumulation of radiocarbon in the cells and nuclear DNA was measured by AMS. The lowest concentration of radiocarbon measured was approximately 1 amol/10 {micro}g of DNA. This sensitivity may allow the method to be used for clinical applications.
In vitro evaluation of biodegradable microspheres with surface-bound ligands.
Keegan, Mark E; Royce, Sara M; Fahmy, Tarek; Saltzman, W Mark
2006-02-21
Protein ligands were conjugated to the surface of biodegradable microspheres. These microsphere-ligand conjugates were then used in two in vitro model systems to evaluate the effect of conjugated ligands on microsphere behavior. Microsphere retention in agarose columns was increased by ligands on the microsphere surface specific for receptors on the agarose matrix. In another experiment, conjugating the lectin Ulex europaeus agglutinin 1 to the microsphere surface increased microsphere adhesion to Caco-2 monolayers compared to control microspheres. This increase in microsphere adhesion was negated by co-administration of l-fucose, indicating that the increase in adhesion is due to specific interaction of the ligand with carbohydrate receptors on the cell surface. These results demonstrate that the ligands conjugated to the microspheres maintain their receptor binding activity and are present on the microsphere surface at a density sufficient to target the microspheres to both monolayers and three-dimensional matrices bearing complementary receptors.
Specificity and function of Archaeal DNA replication initiator proteins
DEFF Research Database (Denmark)
Samson, Rachel Y.; Xu, Yanqun; Gadelha, Catarina
2013-01-01
Chromosomes with multiple DNA replication origins are a hallmark of Eukaryotes and some Archaea. All eukaryal nuclear replication origins are defined by the origin recognition complex (ORC) that recruits the replicative helicase MCM(2-7) via Cdc6 and Cdt1. We find that the three origins...... to investigate the role of ATP binding and hydrolysis in initiator function in vivo and in vitro. We find that the ATP-bound form of Orc1-1 is proficient for replication and implicates hydrolysis of ATP in downregulation of origin activity. Finally, we reveal that ATP and DNA binding by Orc1-1 remodels...
The ATPases of cohesin interface with regulators to modulate cohesin-mediated DNA tethering
Çamdere, Gamze; Guacci, Vincent; Stricklin, Jeremiah; Koshland, Douglas
2015-01-01
Cohesin tethers together regions of DNA, thereby mediating higher order chromatin organization that is critical for sister chromatid cohesion, DNA repair and transcriptional regulation. Cohesin contains a heterodimeric ATP-binding Cassette (ABC) ATPase comprised of Smc1 and Smc3 ATPase active sites. These ATPases are required for cohesin to bind DNA. Cohesin’s DNA binding activity is also promoted by the Eco1 acetyltransferase and inhibited by Wpl1. Recently we showed that after cohesin stably binds DNA, a second step is required for DNA tethering. This second step is also controlled by Eco1 acetylation. Here, we use genetic and biochemical analyses to show that this second DNA tethering step is regulated by cohesin ATPase. Furthermore, our results also suggest that Eco1 promotes cohesion by modulating the ATPase cycle of DNA-bound cohesin in a state that is permissive for DNA tethering and refractory to Wpl1 inhibition. DOI: http://dx.doi.org/10.7554/eLife.11315.001 PMID:26583750
Biggar, Kyle K; Storey, Kenneth B
2018-01-01
In many cases, the DNA-binding activity of a transcription factor does not change, while its transcriptional activity is greatly influenced by the make-up of bound proteins. In this study, we assessed the protein composition and DNA-binding ability of the E2F transcription factor complex to provide insight into cell cycle control in an anoxia tolerant turtle through the use of a modified ELISA protocol. This modification also permits the use of custom DNA probes that are tailored to a specific DNA binding region, introducing the ability to design capture probes for non-model organisms. Through the use of EMSA and ELISA DNA binding assays, we have successfully determined the in vitro DNA binding activity and complex dynamics of the Rb/E2F cell cycle regulatory mechanisms in an anoxic turtle, Trachemys scripta elegans . Repressive cell cycle proteins (E2F4, Rb, HDAC4 and Suv39H1) were found to significantly increase at E2F DNA-binding sites upon anoxic exposure in anoxic turtle liver. The lack of p130 involvement in the E2F DNA-bound complex indicates that anoxic turtle liver may maintain G 1 arrest for the duration of stress survival.
Directory of Open Access Journals (Sweden)
Kyle K. Biggar
2018-05-01
Full Text Available In many cases, the DNA-binding activity of a transcription factor does not change, while its transcriptional activity is greatly influenced by the make-up of bound proteins. In this study, we assessed the protein composition and DNA-binding ability of the E2F transcription factor complex to provide insight into cell cycle control in an anoxia tolerant turtle through the use of a modified ELISA protocol. This modification also permits the use of custom DNA probes that are tailored to a specific DNA binding region, introducing the ability to design capture probes for non-model organisms. Through the use of EMSA and ELISA DNA binding assays, we have successfully determined the in vitro DNA binding activity and complex dynamics of the Rb/E2F cell cycle regulatory mechanisms in an anoxic turtle, Trachemys scripta elegans. Repressive cell cycle proteins (E2F4, Rb, HDAC4 and Suv39H1 were found to significantly increase at E2F DNA-binding sites upon anoxic exposure in anoxic turtle liver. The lack of p130 involvement in the E2F DNA-bound complex indicates that anoxic turtle liver may maintain G1 arrest for the duration of stress survival.
Electrokinetic acceleration of DNA hybridization in microsystems.
Lei, Kin Fong; Wang, Yun-Hsiang; Chen, Huai-Yi; Sun, Jia-Hong; Cheng, Ji-Yen
2015-06-01
In this work, electrokinetic acceleration of DNA hybridization was investigated by different combinations of frequencies and amplitudes of actuating electric signals. Because the frequencies from low to high can induce different kinds of electrokinetic forces, i.e., electroosmotic to electrothermal forces, this work provides an in-depth investigation of electrokinetic enhanced hybridization. Concentric circular Cr/Au microelectrodes of 350 µm in diameter were fabricated on a glass substrate and probe DNA was immobilized on the electrode surface. Target DNA labeled with fluorescent dyes suspending in solution was then applied to the electrode. Different electrokinetic forces were induced by the application of different electric signals to the circular microelectrodes. Local microfluidic vortexes were generated to increase the collision efficiency between the target DNA suspending in solution and probe DNA immobilized on the electrode surface. DNA hybridization on the electrode surface could be accelerated by the electrokinetic forces. The level of hybridization was represented by the fluorescent signal intensity ratio. Results revealed that such 5-min dynamic hybridization increased 4.5 fold of signal intensity ratio as compared to a 1-h static hybridization. Moreover, dynamic hybridization was found to have better differentiation ability between specific and non-specific target DNA. This study provides a strategy to accelerate DNA hybridization in microsystems. Copyright © 2015 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Matt S Conover
2011-02-01
Full Text Available Bacteria form complex and highly elaborate surface adherent communities known as biofilms which are held together by a self-produced extracellular matrix. We have previously shown that by adopting a biofilm mode of existence in vivo, the gram negative bacterial pathogens Bordetella bronchiseptica and Bordetella pertussis are able to efficiently colonize and persist in the mammalian respiratory tract. In general, the bacterial biofilm matrix includes polysaccharides, proteins and extracellular DNA (eDNA. In this report, we investigated the function of DNA in Bordetella biofilm development. We show that DNA is a significant component of Bordetella biofilm matrix. Addition of DNase I at the initiation of biofilm growth inhibited biofilm formation. Treatment of pre-established mature biofilms formed under both static and flow conditions with DNase I led to a disruption of the biofilm biomass. We next investigated whether eDNA played a role in biofilms formed in the mouse respiratory tract. DNase I treatment of nasal biofilms caused considerable dissolution of the biofilm biomass. In conclusion, these results suggest that eDNA is a crucial structural matrix component of both in vitro and in vivo formed Bordetella biofilms. This is the first evidence for the ability of DNase I to disrupt bacterial biofilms formed on host organs.
An enzyme-catalyzed multistep DNA refolding mechanism in hairpin telomere formation.
Directory of Open Access Journals (Sweden)
Ke Shi
Full Text Available Hairpin telomeres of bacterial linear chromosomes are generated by a DNA cutting-rejoining enzyme protelomerase. Protelomerase resolves a concatenated dimer of chromosomes as the last step of chromosome replication, converting a palindromic DNA sequence at the junctions between chromosomes into covalently closed hairpins. The mechanism by which protelomerase transforms a duplex DNA substrate into the hairpin telomeres remains largely unknown. We report here a series of crystal structures of the protelomerase TelA bound to DNA that represent distinct stages along the reaction pathway. The structures suggest that TelA converts a linear duplex substrate into hairpin turns via a transient strand-refolding intermediate that involves DNA-base flipping and wobble base-pairs. The extremely compact di-nucleotide hairpin structure of the product is fully stabilized by TelA prior to strand ligation, which drives the reaction to completion. The enzyme-catalyzed, multistep strand refolding is a novel mechanism in DNA rearrangement reactions.
Structure of a preternary complex involving a prokaryotic NHEJ DNA polymerase.
Brissett, Nigel C; Martin, Maria J; Pitcher, Robert S; Bianchi, Julie; Juarez, Raquel; Green, Andrew J; Fox, Gavin C; Blanco, Luis; Doherty, Aidan J
2011-01-21
In many prokaryotes, a specific DNA primase/polymerase (PolDom) is required for nonhomologous end joining (NHEJ) repair of DNA double-strand breaks (DSBs). Here, we report the crystal structure of a catalytically active conformation of Mycobacterium tuberculosis PolDom, consisting of a polymerase bound to a DNA end with a 3' overhang, two metal ions, and an incoming nucleotide but, significantly, lacking a primer strand. This structure represents a polymerase:DNA complex in a preternary intermediate state. This polymerase complex occurs in solution, stabilizing the enzyme on DNA ends and promoting nucleotide extension of short incoming termini. We also demonstrate that the invariant Arg(220), contained in a conserved loop (loop 2), plays an essential role in catalysis by regulating binding of a second metal ion in the active site. We propose that this NHEJ intermediate facilitates extension reactions involving critically short or noncomplementary DNA ends, thus promoting break repair and minimizing sequence loss during DSB repair. Copyright © 2011 Elsevier Inc. All rights reserved.
Development of DNA biosensor based on TiO2 nanoparticles
Nadzirah, Sh.; Hashim, U.; Rusop, M.
2018-05-01
A novel technique of DNA hybridization on the TiO2 nanoparticles film was developed by dropping a single droplet of target DNA onto the surface of TiO2 for the study of various concentrations of target DNA. The surface of TiO2 nanoparticle film was functionalized with APTES and covalently immobilized with 1 µM probe DNA on the silanized TiO2 nanoparticles surface. The effect of silanization, immobilization and hybridization were quantitatively measured by the output current signal obtained using a picoammeter. The 1 µM target DNA was found to be the most effective target towards the 1 µM probe DNA as the output current signal was within range; while the output current signal of the 10 µM target DNA was observed to beyond the range of the probe DNA control due to the excessive concentration as compared to the probe DNA. This approach has several advantages such as rapid, simple, low cost, and sensitive current signal during detection of different target DNA concentrations.
[Construction of Lactobacillus rhamnosus GG particles surface display system].
Su, Runyu; Nie, Boyao; Yuan, Shengling; Tao, Haoxia; Liu, Chunjie; Yang, Bailiang; Wang, Yanchun
2017-01-25
To describe a novel particles surface display system which is consisted of gram-positive enhancer matrix (GEM) particles and anchor proteins for bacteria-like particles vaccines, we treated Lactobacillus rhamnosus GG bacteria with 10% heated-TCA for preparing GEM particles, and then identified the harvested GEM particles by electron microscopy, RT-PCR and SDS-PAGE. Meanwhile, Escherichia coli was induced to express hybrid proteins PA3-EGFP and P60-EGFP, and GEM particles were incubated with them. Then binding of anchor proteins were determined by Western blotting, transmission electron microscopy, fluorescence microscopy and spectrofluorometry. GEM particles preserved original size and shape, and proteins and DNA contents of GEM particles were released substantially. The two anchor proteins both had efficiently immobilized on the surface of GEM. GEM particles that were bounded by anchor proteins were brushy. The fluorescence of GEM particles anchoring PA3 was slightly brighter than P60, but the difference was not significant (P>0.05). GEM particles prepared from L. rhamnosus GG have a good binding efficiency with anchor proteins PA3-EGFP and P60-EGFP. Therefore, this novel foreign protein surface display system could be used for bacteria-like particle vaccines.
Metabolism of organically bound tritium
International Nuclear Information System (INIS)
Travis, C.C.
1984-01-01
The classic methodology for estimating dose to man from environmental tritium ignores the fact that organically bound tritium in foodstuffs may be directly assimilated in the bound compartment of tissues without previous oxidation. We propose a four-compartment model consisting of a free body water compartment, two organic compartments, and a small, rapidly metabolizing compartment. The utility of this model lies in the ability to input organically bound tritium in foodstuffs directly into the organic compartments of the model. We found that organically bound tritium in foodstuffs can increase cumulative total body dose by a factor of 1.7 to 4.5 times the free body water dose alone, depending on the bound-to-loose ratio of tritium in the diet. Model predictions are compared with empirical measurements of tritium in human urine and tissue samples, and appear to be in close agreement. 10 references, 4 figures, 3 tables
Structural and Molecular Basis for Coordination in a Viral DNA Packaging Motor
Directory of Open Access Journals (Sweden)
Huzhang Mao
2016-03-01
Full Text Available Ring NTPases are a class of ubiquitous molecular motors involved in basic biological partitioning processes. dsDNA viruses encode ring ATPases that translocate their genomes to near-crystalline densities within pre-assembled viral capsids. Here, X-ray crystallography, cryoEM, and biochemical analyses of the dsDNA packaging motor in bacteriophage phi29 show how individual subunits are arranged in a pentameric ATPase ring and suggest how their activities are coordinated to translocate dsDNA. The resulting pseudo-atomic structure of the motor and accompanying functional analyses show how ATP is bound in the ATPase active site; identify two DNA contacts, including a potential DNA translocating loop; demonstrate that a trans-acting arginine finger is involved in coordinating hydrolysis around the ring; and suggest a functional coupling between the arginine finger and the DNA translocating loop. The ability to visualize the motor in action illuminates how the different motor components interact with each other and with their DNA substrate.
Ground-truthing the Foraminifera-bound Nitrogen Isotope Paleo-proxy in the Modern Sargasso Sea
Smart, S.; Ren, H. A.; Fawcett, S. E.; Conte, M. H.; Rafter, P. A.; Ellis, K. K.; Weigand, M. A.; Sigman, D. M.
2016-02-01
We present the nitrogen isotope ratios (δ15N) of planktonic foraminifera, a type of calcifying zooplankton, collected from surface ocean net tows, moored sediment traps and core-top sediments at the Bermuda Atlantic Time-series Study site in the Sargasso Sea between 2009 and 2013. Consistent with previous measurements from low-latitude core-top sediments, the annually averaged δ15N of organic matter bound within the shells of euphotic zone-dwelling foraminifera approximates that of thermocline nitrate, the dominant source of new nitrogen to Sargasso Sea surface waters. Based on net tow collections in the upper 200 m of the water column, we observe no systematic difference between the biomass δ15N and shell-bound δ15N of a given foraminifera species. For multiple species, the δ15N of net tow-collected upper ocean shells is lower than shells from sediment traps (by 0.5-2.1‰) and lower than shells from seafloor sediments (by 0.5-1.4‰). We are currently investigating whether these differences reflect actual processes affecting shell-bound δ15N or instead relate to the different time periods over which the three sample types integrate. The foraminiferal biomass δ15N time-series from the surface Sargasso Sea exhibits significant seasonal variations, with the lowest values in fall and the highest values in spring. The roles of hydrography, biogeochemistry, and ecosystem dynamics in driving these seasonal variations will be discussed. These data from the modern subtropical ocean form part of a greater effort to ground-truth the use of foram-bound δ15N to reconstruct past nutrient conditions, not only as a recorder of the isotopic composition of nitrogen supply in oligotrophic environments but also as a recorder of the degree of nitrate consumption in high-latitude regions such as the Southern Ocean.
Schulz, Marc Daniel; Dusuel, Sébastien; Vidal, Julien
2016-11-01
We discuss the emergence of bound states in the low-energy spectrum of the string-net Hamiltonian in the presence of a string tension. In the ladder geometry, we show that a single bound state arises either for a finite tension or in the zero-tension limit depending on the theory considered. In the latter case, we perturbatively compute the binding energy as a function of the total quantum dimension. We also address this issue in the honeycomb lattice where the number of bound states in the topological phase depends on the total quantum dimension. Finally, the internal structure of these bound states is analyzed in the zero-tension limit.
Biofunctionalization of zinc oxide nanowires for DNA sensory applications
Directory of Open Access Journals (Sweden)
Rudolph Bettina
2011-01-01
Full Text Available Abstract We report on the biofunctionalization of zinc oxide nanowires for the attachment of DNA target molecules on the nanowire surface. With the organosilane glycidyloxypropyltrimethoxysilane acting as a bifunctional linker, amino-modified capture molecule oligonucleotides have been immobilized on the nanowire surface. The dye-marked DNA molecules were detected via fluorescence microscopy, and our results reveal a successful attachment of DNA capture molecules onto the nanowire surface. The electrical field effect induced by the negatively charged attached DNA molecules should be able to control the electrical properties of the nanowires and gives way to a ZnO nanowire-based biosensing device.
Interaction of nogalamycin and analogs with DNA and other biopolymers
Energy Technology Data Exchange (ETDEWEB)
Krueger, W C [Univ. of Minnesota, Minneapolis; Pschigoda, L M; Schpok, S L.F.; Moscowitz, A.; McGovren, J P; Neta, P; Merritt, M V; Li, L H
1981-01-01
The interaction with calf thymus DNA of the anthracycline antibiotics, nogalamycin and its analogs, was studied by electronic absorption, circular dichroism (CD), thermal denaturation, solvent partition and pulse radiolysis techniques. The Scatchard, thermal denaturation (..delta..T/sub m/), difference circular dichroism (..delta..CD) and solvent partition binding parameters gave the same order of relative binding on a given lot of DNA, but some parameters were DNA-lot-dependent. In general, molecules containing the sugar moiety nogalose at C-7 or those having the natural or dis stereochemistry of nogalamycin at C-7 bound more strongly to DNA than did the molecules lacking nogalose or those with the opposite configuration at C-7 (con stereochemistry). This stereochemical-binding correlation differs from that found for adriamycin which has the con stereochemistry, but which binds strongly to DNA. Scatchard binding parameters could not be obtained from the pulse radiolysis or solvent partition techniques because of solubility difficulties.
Bounding approaches to system identification
Norton, John; Piet-Lahanier, Hélène; Walter, Éric
1996-01-01
In response to the growing interest in bounding error approaches, the editors of this volume offer the first collection of papers to describe advances in techniques and applications of bounding of the parameters, or state variables, of uncertain dynamical systems. Contributors explore the application of the bounding approach as an alternative to the probabilistic analysis of such systems, relating its importance to robust control-system design.
Fenyk, Stepan; Dixon, Christopher H.; Gittens, William H.; Townsend, Philip D.; Sharples, Gary J.; Pålsson, Lars-Olof; Takken, Frank L. W.; Cann, Martin J.
2016-01-01
Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. PMID:26601946
Fenyk, Stepan; Dixon, Christopher H; Gittens, William H; Townsend, Philip D; Sharples, Gary J; Pålsson, Lars-Olof; Takken, Frank L W; Cann, Martin J
2016-01-15
Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
DNA Length Modulates the Affinity of Fragments of Genomic DNA for the Nuclear Matrix In Vitro.
García-Vilchis, David; Aranda-Anzaldo, Armando
2017-12-01
Classical observations have shown that during the interphase the chromosomal DNA of metazoans is organized in supercoiled loops attached to a compartment known as the nuclear matrix (NM). Fragments of chromosomal DNA able to bind the isolated NM in vitro are known as matrix associated/attachment/addressed regions or MARs. No specific consensus sequence or motif has been found that may constitute a universal, defining feature of MARs. On the other hand, high-salt resistant DNA-NM interactions in situ define true DNA loop anchorage regions or LARs, that might correspond to a subset of the potential MARs but are not necessarily identical to MARs characterized in vitro, since there are several examples of MARs able to bind the NM in vitro but which are not actually bound to the NM in situ. In the present work we assayed the capacity of two LARs, as well as of shorter fragments within such LARs, for binding to the NM in vitro. Paradoxically the isolated (≈2 kb) LARs cannot bind to the NM in vitro while their shorter (≈300 pb) sub-fragments and other non-related but equally short DNA fragments, bind to the NM in a high-salt resistant fashion. Our results suggest that the ability of a given DNA fragment for binding to the NM in vitro primarily depends on the length of the fragment, suggesting that binding to the NM is modulated by the local topology of the DNA fragment in suspension that it is known to depend on the DNA length. J. Cell. Biochem. 118: 4487-4497, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
DNA Photo Lithography with Cinnamate-based Photo-Bio-Nano-Glue
Feng, Lang; Li, Minfeng; Romulus, Joy; Sha, Ruojie; Royer, John; Wu, Kun-Ta; Xu, Qin; Seeman, Nadrian; Weck, Marcus; Chaikin, Paul
2013-03-01
We present a technique to make patterned functional surfaces, using a cinnamate photo cross-linker and photolithography. We have designed and modified a complementary set of single DNA strands to incorporate a pair of opposing cinnamate molecules. On exposure to 360nm UV, the cinnamate makes a highly specific covalent bond permanently linking only the complementary strands containing the cinnamates. We have studied this specific and efficient crosslinking with cinnamate-containing DNA in solution and on particles. UV addressability allows us to pattern surfaces functionally. The entire surface is coated with a DNA sequence A incorporating cinnamate. DNA strands A'B with one end containing a complementary cinnamated sequence A' attached to another sequence B, are then hybridized to the surface. UV photolithography is used to bind the A'B strand in a specific pattern. The system is heated and the unbound DNA is washed away. The pattern is then observed by thermo-reversibly hybridizing either fluorescently dyed B' strands complementary to B, or colloids coated with B' strands. Our techniques can be used to reversibly and/or permanently bind, via DNA linkers, an assortment of molecules, proteins and nanostructures. Potential applications range from advanced self-assembly, such as templated self-replication schemes recently reported, to designed physical and chemical patterns, to high-resolution multi-functional DNA surfaces for genetic detection or DNA computing.
Binding of anthracene to cellular macromolecules in the presence of light. [DNA, HSA
Energy Technology Data Exchange (ETDEWEB)
Sinha, B K; Chignell, C F [National Inst. of Environmental Health Sciences, Research Triangle Park, NC (USA)
1983-01-01
Ultraviolet radiation (> 295 nm) induced covalent binding of anthracene to DNA which increased with time and was not affected by oxygen. Irradiation in the presence of anthracene induced nicking of Col E/sub 1/ circular DNA and decreased the thermal denaturation temperature of calf thymus DNA. These effects were oxygen dependent, and were decreased by GMP. Irradiation of anthracene and human serum albumin resulted in covalent binding of the hydrocarbon to the protein accompanied by crosslinking of the protein. Protein crosslinking decreased under anaerobic conditions. Irradiation of anthracene bound to liposomes induced lipid peroxidation which was not affected by superoxide dismutase or catalase.
Directory of Open Access Journals (Sweden)
Jacobberger James W
2010-04-01
Full Text Available Abstract Background Cytometric measurements of DNA content and chromatin-bound Mcm2 have demonstrated bimodal patterns of expression in G1. These patterns, the replication licensing function of Mcm proteins, and a correlation between Mcm loading and cell cycle commitment for cells re-entering the cell cycle, led us to test the idea that cells expressing a defined high level of chromatin-bound Mcm6 in G1 are committed - i.e., past the G1 restriction point. We developed a cell-based assay for tightly-bound PCNA (PCNA* and Mcm6 (Mcm6*, DNA content, and a mitotic marker to clearly define G1, S, G2, and M phases of the cell cycle. hTERT-BJ1, hTERT-RPE-1, and Molt4 cells were extracted with Triton X-100 followed by methanol fixation, stained with antibodies and DAPI, then measured by cytometry. Results Bivariate analysis of cytometric data demonstrated complex patterns with distinct clustering for all combinations of the 4 variables. In G1, cells clustered in two groups characterized by low and high Mcm6* expression. Serum starvation and release experiments showed that residence in the high group was in late G1, just prior to S phase. Kinetic experiments, employing serum withdrawal, and stathmokinetic analysis with aphidicolin, mimosine or nocodazole demonstrated that cells with high levels of Mcm6* cycled with the committed phases of the cell cycle (S, G2, and M. Conclusions A multivariate assay for Mcm6*, PCNA*, DNA content, and a mitotic marker provides analysis capable of estimating the fraction of pre and post-restriction point G1 cells and supports the idea that there are at least two states in G1 defined by levels of chromatin bound Mcm proteins.
Dixit, Aparna Banerjee; Ray, Krishanu; Black, Lindsay W
2012-12-11
Viral genome packaging into capsids is powered by high-force-generating motor proteins. In the presence of all packaging components, ATP-powered translocation in vitro expels all detectable tightly bound YOYO-1 dye from packaged short dsDNA substrates and removes all aminoacridine dye from packaged genomic DNA in vivo. In contrast, in the absence of packaging, the purified T4 packaging ATPase alone can only remove up to ∼1/3 of DNA-bound intercalating YOYO-1 dye molecules in the presence of ATP or ATP-γ-S. In sufficient concentration, intercalating dyes arrest packaging, but rare terminase mutations confer resistance. These distant mutations are highly interdependent in acquiring function and resistance and likely mark motor contact points with the translocating DNA. In stalled Y-DNAs, FRET has shown a decrease in distance from the phage T4 terminase C terminus to portal consistent with a linear motor, and in the Y-stem DNA compression between closely positioned dye pairs. Taken together with prior FRET studies of conformational changes in stalled Y-DNAs, removal of intercalating compounds by the packaging motor demonstrates conformational change in DNA during normal translocation at low packaging resistance and supports a proposed linear "DNA crunching" or torsional compression motor mechanism involving a transient grip-and-release structural change in B form DNA.
DNA based radiological dosimetry technology
International Nuclear Information System (INIS)
Diaz Quijada, Gerardo A.; Roy, Emmanuel; Veres, Teodor; Dumoulin, Michel M.; Vachon, Caroline; Blagoeva, Rosita; Pierre, Martin
2008-01-01
Full text: The purpose of this project is to develop a personal and wearable dosimeter using a highly-innovative approach based on the specific recognition of DNA damage with a polymer hybrid. Our biosensor will be sensitive to breaks in nucleic acid macromolecules and relevant to mixed-field radiation. The dosimeter proposed will be small, field deployable and will sense damages for all radiation types at the DNA level. The generalized concept for the novel-based radiological dosimeter: 1) Single or double stranded oligonucleotide is immobilized on surface; 2) Single stranded has higher cross-section for fragmentation; 3) Double stranded is more biological relevant; 4) Radiation induces fragmentation; 5) Ultra-sensitive detection of fragments provides radiation dose. Successful efforts have been made towards a proof-of-concept personal wearable DNA-based dosimeter that is appropriate for mixed-field radiation. The covalent immobilization of oligonucleotides on large areas of plastic surfaces has been demonstrated and corroborated spectroscopically. The surface concentration of DNA was determined to be 8 x 1010 molecules/cm 2 from a Ce(IV) catalyzed hydrolysis study of a fluorescently labelled oligonucleotide. Current efforts are being directed at studying radiation induced fragmentation of DNA followed by its ultra-sensitive detection via a novel method. In addition, proof-of-concept wearable personal devices and a detection platform are presently being fabricated. (author)
Bounded Intention Planning Revisited
Sievers Silvan; Wehrle Martin; Helmert Malte
2014-01-01
Bounded intention planning provides a pruning technique for optimal planning that has been proposed several years ago. In addition partial order reduction techniques based on stubborn sets have recently been investigated for this purpose. In this paper we revisit bounded intention planning in the view of stubborn sets.
Bounded Gaussian process regression
DEFF Research Database (Denmark)
Jensen, Bjørn Sand; Nielsen, Jens Brehm; Larsen, Jan
2013-01-01
We extend the Gaussian process (GP) framework for bounded regression by introducing two bounded likelihood functions that model the noise on the dependent variable explicitly. This is fundamentally different from the implicit noise assumption in the previously suggested warped GP framework. We...... with the proposed explicit noise-model extension....
A symmetric Roos bound for linear codes
Duursma, I.M.; Pellikaan, G.R.
2006-01-01
The van Lint–Wilson AB-method yields a short proof of the Roos bound for the minimum distance of a cyclic code. We use the AB-method to obtain a different bound for the weights of a linear code. In contrast to the Roos bound, the role of the codes A and B in our bound is symmetric. We use the bound
Detailed determination of the fusion nuclear radius in reactions involving weakly bound projectiles
International Nuclear Information System (INIS)
Gomez Camacho, A.; Aguilera, E. F.; Quiroz, E. M.
2007-01-01
A detailed determination of the fusion radius parameter is performed within the Distorted Wave Born Approximation for reactions involving weakly bound projectiles. Specifically, a simultaneous X 2- analysis of elastic and fusion cross section data is done using a Woods-Saxon potential with volume and surface parts. The volume part is assumed to be responsible for fusion reactions while the surface part for all other direct reactions. It is proved that in order to fit fusion data, particularly for energies below the Coulomb barrier where fusion is enhanced, it is necessary to have a value of around 1.4 fm for the fusion radial parameter of the fusion potential (W F ). This value is much higher than that frequently used in Barrier Penetration models (1.0 fm). The calculations are performed for reactions involving the weakly bound projectile 9 Be with several medium mass targets. (Author)
Yousaf, Nasim; Gould, David
2017-01-01
Confirming the binding of a transcription factor with a particular DNA sequence may be important in characterizing interactions with a synthetic promoter. Electrophoretic mobility shift assay is a powerful approach to demonstrate the specific DNA sequence that is bound by a transcription factor and also to confirm the specific transcription factor involved in the interaction. In this chapter we describe a method we have successfully used to demonstrate interactions of endogenous transcription factors with sequences derived from endogenous and synthetic promoters.
DEFF Research Database (Denmark)
Damgård, Ivan Bjerre; Faust, Sebastian; Mukherjee, Pratyay
2013-01-01
Related key attacks (RKAs) are powerful cryptanalytic attacks where an adversary can change the secret key and observe the effect of such changes at the output. The state of the art in RKA security protects against an a-priori unbounded number of certain algebraic induced key relations, e.......g., affine functions or polynomials of bounded degree. In this work, we show that it is possible to go beyond the algebraic barrier and achieve security against arbitrary key relations, by restricting the number of tampering queries the adversary is allowed to ask for. The latter restriction is necessary......-protocols (including the Okamoto scheme, for instance) are secure even if the adversary can arbitrarily tamper with the prover’s state a bounded number of times and obtain some bounded amount of leakage. Interestingly, for the Okamoto scheme we can allow also independent tampering with the public parameters. We show...
Molecular recognition in complexes of TRF proteins with telomeric DNA.
Directory of Open Access Journals (Sweden)
Miłosz Wieczór
Full Text Available Telomeres are specialized nucleoprotein assemblies that protect the ends of linear chromosomes. In humans and many other species, telomeres consist of tandem TTAGGG repeats bound by a protein complex known as shelterin that remodels telomeric DNA into a protective loop structure and regulates telomere homeostasis. Shelterin recognizes telomeric repeats through its two major components known as Telomere Repeat-Binding Factors, TRF1 and TRF2. These two homologous proteins are therefore essential for the formation and normal function of telomeres. Indeed, TRF1 and TRF2 are implicated in a plethora of different cellular functions and their depletion leads to telomere dysfunction with chromosomal fusions, followed by apoptotic cell death. More specifically, it was found that TRF1 acts as a negative regulator of telomere length, and TRF2 is involved in stabilizing the loop structure. Consequently, these proteins are of great interest, not only because of their key role in telomere maintenance and stability, but also as potential drug targets. In the current study, we investigated the molecular basis of telomeric sequence recognition by TRF1 and TRF2 and their DNA binding mechanism. We used molecular dynamics (MD to calculate the free energy profiles for binding of TRFs to telomeric DNA. We found that the predicted binding free energies were in good agreement with experimental data. Further, different molecular determinants of binding, such as binding enthalpies and entropies, the hydrogen bonding pattern and changes in surface area, were analyzed to decompose and examine the overall binding free energies at the structural level. With this approach, we were able to draw conclusions regarding the consecutive stages of sequence-specific association, and propose a novel aspartate-dependent mechanism of sequence recognition. Finally, our work demonstrates the applicability of computational MD-based methods to studying protein-DNA interactions.
P2-16: Dual-Bound Model and the Role of Time Bound in Perceptual Decision Making
Directory of Open Access Journals (Sweden)
Daeseob Lim
2012-10-01
Full Text Available The diffusion model (DM encapsulates the dynamics of perceptual decision within a ‘diffusion field’ that is defined by a basis with sensory-evidence (SE and time vectors. At the core of the DM, it assumes that a decision is not made until an evidence particle drifts in the diffusion field and eventually hits one of the two pre-fixed bounds defined in the SE axis. This assumption dictates when and which choice is made by referring to when and which bound will be hit by the evidence particle. What if urgency pressures the decision system to make a choice even when the evidence particle has yet hit the SE bound? Previous modeling attempts at coping with time pressure, despite differences in detail, all manipulated the coordinate of SE bounds. Here, we offer a novel solution by adopting another bound on the time axis. This ‘dual-bound’ model (DBM posits that decisions can also be made when the evidence particle hits a time bound, which is determined on a trial-by-trial basis by a ‘perceived time interval’ – how long the system can stay in the ‘diffusion’ field. The classic single-bound model (SBM exhibited systematic errors in predicting both the reaction time distributions and the time-varying bias in choice. Those errors were not corrected by previously proposed variants of the SBM until the time bound was introduced. The validity of the DBM was further supported by the strong across-individual correlation between observed precision of interval timing and the predicted trial-by-trial variability of the time bound.
Smith, Rachel M.; Marshall, Jacqueline J. T.; Jacklin, Alistair J.; Retter, Susan E.; Halford, Stephen E.; Sobott, Frank
2013-01-01
Type IIB restriction-modification systems, such as BcgI, feature a single protein with both endonuclease and methyltransferase activities. Type IIB nucleases require two recognition sites and cut both strands on both sides of their unmodified sites. BcgI cuts all eight target phosphodiester bonds before dissociation. The BcgI protein contains A and B polypeptides in a 2:1 ratio: A has one catalytic centre for each activity; B recognizes the DNA. We show here that BcgI is organized as A2B protomers, with B at its centre, but that these protomers self-associate to assemblies containing several A2B units. Moreover, like the well known FokI nuclease, BcgI bound to its site has to recruit additional protomers before it can cut DNA. DNA-bound BcgI can alternatively be activated by excess A subunits, much like the activation of FokI by its catalytic domain. Eight A subunits, each with one centre for nuclease activity, are presumably needed to cut the eight bonds cleaved by BcgI. Its nuclease reaction may thus involve two A2B units, each bound to a recognition site, with two more A2B units bridging the complexes by protein–protein interactions between the nuclease domains. PMID:23147005
Lämmerhardt, Nico; Merzsch, Stephan; Ledig, Johannes; Bora, Achyut; Waag, Andreas; Tornow, Marc; Mischnick, Petra
2013-07-02
The huge and intelligent processing power of three-dimensional (3D) biological "processors" like the human brain with clock speeds of only 0.1 kHz is an extremely fascinating property, which is based on a massively parallel interconnect strategy. Artificial silicon microprocessors are 7 orders of magnitude faster. Nevertheless, they do not show any indication of intelligent processing power, mostly due to their very limited interconnectivity. Massively parallel interconnectivity can only be realized in three dimensions. Three-dimensional artificial processors would therefore be at the root of fabricating artificially intelligent systems. A first step in this direction would be the self-assembly of silicon based building blocks into 3D structures. We report on the self-assembly of such building blocks by molecular recognition, and on the electrical characterization of the formed assemblies. First, planar silicon substrates were functionalized with self-assembling monolayers of 3-aminopropyltrimethoxysilane for coupling of oligonucleotides (single stranded DNA) with glutaric aldehyde. The oligonucleotide immobilization was confirmed and quantified by hybridization with fluorescence-labeled complementary oligonucleotides. After the individual processing steps, the samples were analyzed by contact angle measurements, ellipsometry, atomic force microscopy, and fluorescence microscopy. Patterned DNA-functionalized layers were fabricated by microcontact printing (μCP) and photolithography. Silicon microcubes of 3 μm edge length as model objects for first 3D self-assembly experiments were fabricated out of silicon-on-insulator (SOI) wafers by a combination of reactive ion etching (RIE) and selective wet etching. The microcubes were then surface-functionalized using the same protocol as on planar substrates, and their self-assembly was demonstrated both on patterned silicon surfaces (88% correctly placed cubes), and to cube aggregates by complementary DNA
Directory of Open Access Journals (Sweden)
Marina V. Atzingen
2014-01-01
Full Text Available Leptospirosis is an important global disease of human and veterinary concern. Caused by pathogenic Leptospira, the illness was recently classified as an emerging infectious disease. Currently available veterinarian vaccines do not induce long-term protection against infection and do not provide cross-protective immunity. Several studies have suggested the use of DnaK as an antigen in vaccine formulation, due to an exceptional degree of immunogenicity. We focused on four surface proteins: rLIC10368 (Lsa21, rLIC10494, rLIC12690 (Lp95, and rLIC12730, previously shown to be involved in host-pathogen interactions. Our goal was to evaluate the immunogenicity of the proteins genetically fused with DnaK in animal model. The chosen genes were amplified by PCR methodology and cloned into pAE, an E. coli vector. The recombinant proteins were expressed alone or in fusion with DnaK at the N-terminus. Our results demonstrate that leptospiral proteins fused with DnaK have elicited an enhanced immune response in mice when compared to the effect promoted by the individual proteins. The boosted immune effect was demonstrated by the production of total IgG, lymphocyte proliferation, and significant amounts of IL-10 in supernatant of splenocyte cell cultures. We believe that this approach could be employed in vaccines to enhance presentation of antigens of Leptospira to professional immune cells.
Multimedia transport of particle-bound organics: benzo(a)pyrene test case
Energy Technology Data Exchange (ETDEWEB)
Ryan, P A; Cohen, Y
1986-01-01
A screening multimedia-compartmental (MCM) modeling approach is presented for predicting the distribution of particle-bound pollutants within an environment consisting of the atmosphere, surface water, and surface soil compartments. An MCM model was used to simulate the dynamic distribution of Benzo(a)Pyrene (B(a)P) for a study region located in southeast Ohio. The model incorporates theoretical estimates of the dry deposition velocity and a new semi-empirical model for rain scavenging of B(a)P. The predicted concentrations of B(a)P compared favorably with available field data.
Origin of DNA-Induced Circular Dichroism in a Minor-Groove Binder.
Holmgaard List, Nanna; Knoops, Jérémie; Rubio-Magnieto, Jenifer; Idé, Julien; Beljonne, David; Norman, Patrick; Surin, Mathieu; Linares, Mathieu
2017-10-25
Induced circular dichroism (ICD) of DNA-binding ligands is well known to be strongly influenced by the specific mode of binding, but the relative importance of the possible mechanisms has remained undetermined. With a combination of molecular dynamics simulations, CD response calculations, and experiments on an AT-sequence, we show that the ICD of minor-groove-bound 4',6-diamidino-2-phenylindole (DAPI) originates from an intricate interplay between the chiral imprint of DNA, off-resonant excitonic coupling to nucleobases, charge-transfer, and resonant excitonic coupling between DAPIs. The significant contributions from charge-transfer and the chiral imprint to the ICD demonstrate the inadequacy of a standard Frenkel exciton theory of the DAPI-DNA interactions.