WorldWideScience

Sample records for surface bound dna

  1. NEXAFS characterization of DNA components and molecular-orientation of surface-bound DNA oligomers

    International Nuclear Information System (INIS)

    Samuel, Newton T.; Lee, C.-Y.; Gamble, Lara J.; Fischer, Daniel A.; Castner, David G.

    2006-01-01

    Single stranded DNA oligomers (ssDNA) immobilized onto solid surfaces forms the basis for several biotechnological applications such as DNA microarrays, affinity separations, and biosensors. Surface structure of Surface-bound oligomers is expected to significantly influence their biological activity and interactions with the environment. In this study near-edge X-ray absorption fine structure spectroscopy (NEXAFS) is used to characterize the components of DNA (nucleobases, nucleotides and nucleosides) and the orientation information of surface-bound ssDNA. The K-edges of carbon, nitrogen and oxygen have spectra with features that are characteristic of the different chemical species present in the nucleobases of DNA. The effect of addition of the DNA sugar and phosphate components on the NEXAFS K-edge spectra was also investigated. The polarization-dependent nitrogen K-edge NEXAFS data show significant changes for different orientations of surface bound ssDNA. These results establish NEXAFS as a powerful technique for chemical and structural characterization of surface-bound DNA oligomers

  2. The subglacial Lake Vostok (East Antarctica) surface snow is Earth-bound DNA (and dust)-free

    Science.gov (United States)

    Bulat, S.; Marie, D.; Bulat, E.; Alekhina, I.; Petit, J.-R.

    2012-09-01

    came up with only contaminant bacterial phylotypes (mostly of human source). The bioexposure trials showed that even in one day of open exposure the gDNA of rather complex microbial community composition was fatally damaged in terms of long-, mid-range and short-size amplicon generation in PCR. All this testify for very harsh conditions for life to survive the climate conditions of Central East Antarctica which could be considered as a presentday 'zone mortale' or 'polar desert' for known Earthbound microbial life forms. In addition this means that no life seeds are expected to reach subglacial lakes and water reservoirs and establish indigenous lake microbiota during their transit through the thick and aged Antarctic ice sheet upon its bottom melting. In general the subglacial Lake Vostok surface (ice sheet as well) environ represents the unique test area (sterile - in fact Earth-bound DNA-free and clean - in fact Earth-bound dust-free) for advancing extraterrestrial (ET) life detection technologies and searching for ET life indices in AMMs and IDPs.

  3. Hybridization thermodynamics of DNA bound to gold nanoparticles

    International Nuclear Information System (INIS)

    Lang, Brian

    2010-01-01

    Isothermal Titration Calorimetry (ITC) was used to study the thermodynamics of hybridization on DNA-functionalized colloidal gold nanoparticles. When compared to the thermodynamics of hybridization of DNA that is free in solution, the differences in the values of the Gibbs free energy of reaction, Δ r G o , the enthalpy, Δ r H o , and entropy, Δ r S o , were small. The change in Δ r G o between the free and bound states was always positive but with statistical significance outside the 95% confidence interval, implying the free DNA is slightly more stable than when in the bound state. Additionally, ITC was also able to reveal information about the binding stoichiometry of the hybridization reactions on the DNA-functionalized gold nanoparticles, and indicates that there is a significant fraction of the DNA on gold nanoparticle surface that is unavailable for DNA hybridization. Furthermore, the fraction of available DNA is dependent on the spacer group on the DNA that is used to span the gold surface from that to the probe DNA.

  4. Dynamics of bleomycin interaction with a strongly bound hairpin DNA substrate, and implications for cleavage of the bound DNA.

    Science.gov (United States)

    Bozeman, Trevor C; Nanjunda, Rupesh; Tang, Chenhong; Liu, Yang; Segerman, Zachary J; Zaleski, Paul A; Wilson, W David; Hecht, Sidney M

    2012-10-31

    Recent studies involving DNAs bound strongly by bleomycins have documented that such DNAs are degraded by the antitumor antibiotic with characteristics different from those observed when studying the cleavage of randomly chosen DNAs in the presence of excess Fe·BLM. In the present study, surface plasmon resonance has been used to characterize the dynamics of BLM B(2) binding to a strongly bound hairpin DNA, to define the effects of Fe(3+), salt, and temperature on BLM-DNA interaction. One strong primary DNA binding site, and at least one much weaker site, were documented. In contrast, more than one strong cleavage site was found, an observation also made for two other hairpin DNAs. Evidence is presented for BLM equilibration between the stronger and weaker binding sites in a way that renders BLM unavailable to other, less strongly bound DNAs. Thus, enhanced binding to a given site does not necessarily result in increased DNA degradation at that site; i.e., for strongly bound DNAs, the facility of DNA cleavage must involve other parameters in addition to the intrinsic rate of C-4' H atom abstraction from DNA sugars.

  5. Twisting, supercoiling and stretching in protein bound DNA

    Science.gov (United States)

    Lam, Pui-Man; Zhen, Yi

    2018-04-01

    We have calculated theoretical results for the torque and slope of the twisted DNA, with various proteins bound on it, using the Neukirch-Marko model, in the regime where plectonemes exist. We found that the torque in the protein bound DNA decreases compared to that in the bare DNA. This is caused by the decrease in the free energy g(f) , and hence the smaller persistence lengths, in the case of protein bound DNA. We hope our results will encourage experimental investigations of supercoiling in protein bound DNA, which can provide further tests of the Neukirch-Marko model.

  6. Generalized surface tension bounds in vacuum decay

    Science.gov (United States)

    Masoumi, Ali; Paban, Sonia; Weinberg, Erick J.

    2018-02-01

    Coleman and De Luccia (CDL) showed that gravitational effects can prevent the decay by bubble nucleation of a Minkowski or AdS false vacuum. In their thin-wall approximation this happens whenever the surface tension in the bubble wall exceeds an upper bound proportional to the difference of the square roots of the true and false vacuum energy densities. Recently it was shown that there is another type of thin-wall regime that differs from that of CDL in that the radius of curvature grows substantially as one moves through the wall. Not only does the CDL derivation of the bound fail in this case, but also its very formulation becomes ambiguous because the surface tension is not well defined. We propose a definition of the surface tension and show that it obeys a bound similar in form to that of the CDL case. We then show that both thin-wall bounds are special cases of a more general bound that is satisfied for all bounce solutions with Minkowski or AdS false vacua. We discuss the limit where the parameters of the theory attain critical values and the bound is saturated. The bounce solution then disappears and a static planar domain wall solution appears in its stead. The scalar field potential then is of the form expected in supergravity, but this is only guaranteed along the trajectory in field space traced out by the bounce.

  7. Surface-bound states in nanodiamonds

    Science.gov (United States)

    Han, Peng; Antonov, Denis; Wrachtrup, Jörg; Bester, Gabriel

    2017-05-01

    We show via ab initio calculations and an electrostatic model that the notoriously low, but positive, electron affinity of bulk diamond becomes negative for hydrogen passivated nanodiamonds and argue that this peculiar situation (type-II offset with a vacuum level at nearly midgap) and the three further conditions: (i) a surface dipole with positive charge on the outside layer, (ii) a spherical symmetry, and (iii) a dielectric mismatch at the surface, results in the emergence of a peculiar type of surface state localized just outside the nanodiamond. These states are referred to as "surface-bound states" and have consequently a strong environmental sensitivity. These type of states should exist in any nanostructure with negative electron affinity. We further quantify the band offsets of different type of nanostructures as well as the exciton binding energy and contrast the results with results for "conventional" silicon quantum dots.

  8. UV-Visible Spectroscopy-Based Quantification of Unlabeled DNA Bound to Gold Nanoparticles.

    Science.gov (United States)

    Baldock, Brandi L; Hutchison, James E

    2016-12-20

    DNA-functionalized gold nanoparticles have been increasingly applied as sensitive and selective analytical probes and biosensors. The DNA ligands bound to a nanoparticle dictate its reactivity, making it essential to know the type and number of DNA strands bound to the nanoparticle surface. Existing methods used to determine the number of DNA strands per gold nanoparticle (AuNP) require that the sequences be fluorophore-labeled, which may affect the DNA surface coverage and reactivity of the nanoparticle and/or require specialized equipment and other fluorophore-containing reagents. We report a UV-visible-based method to conveniently and inexpensively determine the number of DNA strands attached to AuNPs of different core sizes. When this method is used in tandem with a fluorescence dye assay, it is possible to determine the ratio of two unlabeled sequences of different lengths bound to AuNPs. Two sizes of citrate-stabilized AuNPs (5 and 12 nm) were functionalized with mixtures of short (5 base) and long (32 base) disulfide-terminated DNA sequences, and the ratios of sequences bound to the AuNPs were determined using the new method. The long DNA sequence was present as a lower proportion of the ligand shell than in the ligand exchange mixture, suggesting it had a lower propensity to bind the AuNPs than the short DNA sequence. The ratio of DNA sequences bound to the AuNPs was not the same for the large and small AuNPs, which suggests that the radius of curvature had a significant influence on the assembly of DNA strands onto the AuNPs.

  9. Curcumin inhibits hepatitis B virus infection by down-regulating cccDNA-bound histone acetylation.

    Science.gov (United States)

    Wei, Zhi-Qiang; Zhang, Yong-Hong; Ke, Chang-Zheng; Chen, Hong-Xia; Ren, Pan; He, Yu-Lin; Hu, Pei; Ma, De-Qiang; Luo, Jie; Meng, Zhong-Ji

    2017-09-14

    To investigate the potential effect of curcumin on hepatitis B virus (HBV) covalently closed circular DNA (cccDNA) and the underlying mechanism. A HepG2.2.15 cell line stably transfected with HBV was treated with curcumin, and HBV surface antigen (HBsAg) and e antigen (HBeAg) expression levels were assessed by ELISA. Intracellular HBV DNA replication intermediates and cccDNA were detected by Southern blot and real-time PCR, respectively. The acetylation levels of histones H3 and H4 were measured by Western blot. H3/H4-bound cccDNA was detected by chromatin immunoprecipitation (ChIP) assays. The deacetylase inhibitors trichostatin A and sodium butyrate were used to study the mechanism of action for curcumin. Additionally, short interfering RNAs (siRNAs) targeting HBV were tested along with curcumin. Curcumin treatment led to time- and dose-dependent reductions in HBsAg and HBeAg expression and significant reductions in intracellular HBV DNA replication intermediates and HBV cccDNA. After treatment with 20 μmol/L curcumin for 2 d, HBsAg and cccDNA levels in HepG2.2.15 cells were reduced by up to 57.7% ( P curcumin, accompanied by reductions in H3- and H4-bound cccDNA. Furthermore, the deacetylase inhibitors trichostatin A and sodium butyrate could block the effects of curcumin. Additionally, transfection of siRNAs targeting HBV enhanced the inhibitory effects of curcumin. Curcumin inhibits HBV gene replication via down-regulation of cccDNA-bound histone acetylation and has the potential to be developed as a cccDNA-targeting antiviral agent for hepatitis B.

  10. Molecular dynamics simulations of DNA-free and DNA-bound TAL effectors.

    Directory of Open Access Journals (Sweden)

    Hua Wan

    Full Text Available TAL (transcriptional activator-like effectors (TALEs are DNA-binding proteins, containing a modular central domain that recognizes specific DNA sequences. Recently, the crystallographic studies of TALEs revealed the structure of DNA-recognition domain. In this article, molecular dynamics (MD simulations are employed to study two crystal structures of an 11.5-repeat TALE, in the presence and absence of DNA, respectively. The simulated results indicate that the specific binding of RVDs (repeat-variable diresidues with DNA leads to the markedly reduced fluctuations of tandem repeats, especially at the two ends. In the DNA-bound TALE system, the base-specific interaction is formed mainly by the residue at position 13 within a TAL repeat. Tandem repeats with weak RVDs are unfavorable for the TALE-DNA binding. These observations are consistent with experimental studies. By using principal component analysis (PCA, the dominant motions are open-close movements between the two ends of the superhelical structure in both DNA-free and DNA-bound TALE systems. The open-close movements are found to be critical for the recognition and binding of TALE-DNA based on the analysis of free energy landscape (FEL. The conformational analysis of DNA indicates that the 5' end of DNA target sequence has more remarkable structural deformability than the other sites. Meanwhile, the conformational change of DNA is likely associated with the specific interaction of TALE-DNA. We further suggest that the arrangement of N-terminal repeats with strong RVDs may help in the design of efficient TALEs. This study provides some new insights into the understanding of the TALE-DNA recognition mechanism.

  11. Metallization of DNA on silicon surface

    International Nuclear Information System (INIS)

    Puchkova, Anastasiya Olegovna; Sokolov, Petr; Petrov, Yuri Vladimirovich; Kasyanenko, Nina Anatolievna

    2011-01-01

    New simple way for silver deoxyribonucleic acid (DNA)-based nanowires preparation on silicon surface was developed. The electrochemical reduction of silver ions fixed on DNA molecule provides the forming of tightly matched zonate silver clusters. Highly homogeneous metallic clusters have a size about 30 nm. So the thickness of nanowires does not exceed 30–50 nm. The surface of n-type silicon monocrystal is the most convenient substrate for this procedure. The comparative analysis of DNA metallization on of n-type silicon with a similar way for nanowires fabrication on p-type silicon, freshly cleaved mica, and glass surface shows the advantage of n-type silicon, which is not only the substrate for DNA fixation but also the source of electrons for silver reduction. Images of bound DNA molecules and fabricated nanowires have been obtained using an atomic force microscope and a scanning ion helium microscope. DNA interaction with silver ions in a solution was examined by the methods of ultraviolet spectroscopy and circular dichroism.

  12. Resonances and surface waves in bounded plasmas

    International Nuclear Information System (INIS)

    Bowers, K.J.; Qui, D.W.; Smith, H.B.; Birdsall, C.K.

    1999-01-01

    Surface waves provide a promising means of creating large, area plasmas. These waves can uniformly distribute the excitation energy and while presenting a small resistance and zero reactance to the driving source. Experimentally and in the simulations, the electron temperature is low (like 1--3 eV) as is the plasma potential (like 10 Te). The use of surface waves experimentally, and now industrially, to sustain large area plasma sources with device size is comparable to free space wavelength have motivated the authors to refine the theories of [1] and [2] to be fully electromagnetic. The wave dispersion predicted by the electromagnetic theory differs from the predictions of the prior theories and the results illuminate limitations of the electrostatic model. The use of surface waves have also motivated them to explore the mechanisms by which surface waves heat the plasma. In the 1d electrostatic simulations high velocity electron bunches are formed in the sheaths and are alternatively accelerated from each sheath into the bulk plasma each RF cycle. They speculate similar mechanisms provide the ionization in surface wave discharges. They also see in these simulations the plasma makes an abrupt transition from capacitively coupled to resistively coupled and the series resonance locks onto the drive frequency; these abrupt transitions resemble mode-jumping seen experimentally in large area sources. Furthermore, the density profile of the plasma tracks the drive frequency while in the resonant mode giving a new mechanism by which the plasma parameters can be controlled. They are currently investigating the effect of the driving electrode shape has on these resonances and conducting 2d simulations of a large area surface wave source to explore the ignition of surface wave devices and how the plasma fills in the device

  13. Footprinting of Chlorella virus DNA ligase bound at a nick in duplex DNA.

    Science.gov (United States)

    Odell, M; Shuman, S

    1999-05-14

    The 298-amino acid ATP-dependent DNA ligase of Chlorella virus PBCV-1 is the smallest eukaryotic DNA ligase known. The enzyme has intrinsic specificity for binding to nicked duplex DNA. To delineate the ligase-DNA interface, we have footprinted the enzyme binding site on DNA and the DNA binding site on ligase. The size of the exonuclease III footprint of ligase bound a single nick in duplex DNA is 19-21 nucleotides. The footprint is asymmetric, extending 8-9 nucleotides on the 3'-OH side of the nick and 11-12 nucleotides on the 5'-phosphate side. The 5'-phosphate moiety is essential for the binding of Chlorella virus ligase to nicked DNA. Here we show that the 3'-OH moiety is not required for nick recognition. The Chlorella virus ligase binds to a nicked ligand containing 2',3'-dideoxy and 5'-phosphate termini, but cannot catalyze adenylation of the 5'-end. Hence, the 3'-OH is important for step 2 chemistry even though it is not itself chemically transformed during DNA-adenylate formation. A 2'-OH cannot substitute for the essential 3'-OH in adenylation at a nick or even in strand closure at a preadenylated nick. The protein side of the ligase-DNA interface was probed by limited proteolysis of ligase with trypsin and chymotrypsin in the presence and absence of nicked DNA. Protease accessible sites are clustered within a short segment from amino acids 210-225 located distal to conserved motif V. The ligase is protected from proteolysis by nicked DNA. Protease cleavage of the native enzyme prior to DNA addition results in loss of DNA binding. These results suggest a bipartite domain structure in which the interdomain segment either comprises part of the DNA binding site or undergoes a conformational change upon DNA binding. The domain structure of Chlorella virus ligase inferred from the solution experiments is consistent with the structure of T7 DNA ligase determined by x-ray crystallography.

  14. Regulating DNA Self-assembly by DNA-Surface Interactions.

    Science.gov (United States)

    Liu, Longfei; Li, Yulin; Wang, Yong; Zheng, Jianwei; Mao, Chengde

    2017-12-14

    DNA self-assembly provides a powerful approach for preparation of nanostructures. It is often studied in bulk solution and involves only DNA-DNA interactions. When confined to surfaces, DNA-surface interactions become an additional, important factor to DNA self-assembly. However, the way in which DNA-surface interactions influence DNA self-assembly is not well studied. In this study, we showed that weak DNA-DNA interactions could be stabilized by DNA-surface interactions to allow large DNA nanostructures to form. In addition, the assembly can be conducted isothermally at room temperature in as little as 5 seconds. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Surface electrostatic waves in bounded high temperature superconductors

    International Nuclear Information System (INIS)

    Averkov, Yu.O.; Yakovenko, V.M.

    2008-01-01

    The dispersion relations of surface electrostatic waves propagating along the surface of semi bounded layered superconductor and in the slab of layered superconductor are theoretically investigated. An arbitrary inclination of superconductor layers to the interface of a vacuum - crystal and an arbitrary direction of propagation of surface waves in the plane of the interface are taking into account. The possibility of initiation of an absolute instability during the propagation of a non-relativistic plasma stream above the surface of the layered superconductor is shown

  16. DNA conformation on surfaces measured by fluorescence self-interference.

    Science.gov (United States)

    Moiseev, Lev; Unlü, M Selim; Swan, Anna K; Goldberg, Bennett B; Cantor, Charles R

    2006-02-21

    The conformation of DNA molecules tethered to the surface of a microarray may significantly affect the efficiency of hybridization. Although a number of methods have been applied to determine the structure of the DNA layer, they are not very sensitive to variations in the shape of DNA molecules. Here we describe the application of an interferometric technique called spectral self-interference fluorescence microscopy to the precise measurement of the average location of a fluorescent label in a DNA layer relative to the surface and thus determine specific information on the conformation of the surface-bound DNA molecules. Using spectral self-interference fluorescence microscopy, we have estimated the shape of coiled single-stranded DNA, the average tilt of double-stranded DNA of different lengths, and the amount of hybridization. The data provide important proofs of concept for the capabilities of novel optical surface analytical methods of the molecular disposition of DNA on surfaces. The determination of DNA conformations on surfaces and hybridization behavior provide information required to move DNA interfacial applications forward and thus impact emerging clinical and biotechnological fields.

  17. Effective bounds for Brauer groups of Kummer surfaces over number fields

    DEFF Research Database (Denmark)

    Cantoral-Farfan, Victoria; Tang, Yunqing; Tanimoto, Sho

    2018-01-01

    We study effective bounds for Brauer groups of Kummer surfaces associated to the Jacobians of curves of genus 2.......We study effective bounds for Brauer groups of Kummer surfaces associated to the Jacobians of curves of genus 2....

  18. TFIIIC bound DNA elements in nuclear organization and insulation.

    Science.gov (United States)

    Kirkland, Jacob G; Raab, Jesse R; Kamakaka, Rohinton T

    2013-01-01

    tRNA genes (tDNAs) have been known to have barrier insulator function in budding yeast, Saccharomyces cerevisiae, for over a decade. tDNAs also play a role in genome organization by clustering at sites in the nucleus and both of these functions are dependent on the transcription factor TFIIIC. More recently TFIIIC bound sites devoid of pol III, termed Extra-TFIIIC sites (ETC) have been identified in budding yeast and these sites also function as insulators and affect genome organization. Subsequent studies in Schizosaccharomyces pombe showed that TFIIIC bound sites were insulators and also functioned as Chromosome Organization Clamps (COC); tethering the sites to the nuclear periphery. Very recently studies have moved to mammalian systems where pol III genes and their associated factors have been investigated in both mouse and human cells. Short interspersed nuclear elements (SINEs) that bind TFIIIC, function as insulator elements and tDNAs can also function as both enhancer - blocking and barrier insulators in these organisms. It was also recently shown that tDNAs cluster with other tDNAs and with ETCs but not with pol II transcribed genes. Intriguingly, TFIIIC is often found near pol II transcription start sites and it remains unclear what the consequences of TFIIIC based genomic organization are and what influence pol III factors have on pol II transcribed genes and vice versa. In this review we provide a comprehensive overview of the known data on pol III factors in insulation and genome organization and identify the many open questions that require further investigation. This article is part of a Special Issue entitled: Transcription by Odd Pols. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Estimation of absorbed dose in cell nuclei due to DNA-bound /sup 3/H

    Energy Technology Data Exchange (ETDEWEB)

    Saito, M; Ishida, M R; Streffer, C; Molls, M

    1985-04-01

    The average absorbed dose due to DNA-bound /sup 3/H in a cell nucleus was estimated by a Monte Carlo simulation for a model nucleus which was assumed to be spheroidal. The volume of the cell nucleus was the major dose-determining factor for cell nuclei which have the same DNA content and the same specific activity of DNA. This result was applied to estimating the accumulated dose in the cell nuclei of organs of young mice born from mother mice which ingested /sup 3/H-thymidine with drinking water during pregnancy. The values of dose-modifying factors for the accumulated dose due to DNA-bound /sup 3/H compared to the dose due to an assumed homogenous distribution of /sup 3/H in organ were found to be between about 2 and 6 for the various organs.

  20. Sea level: measuring the bounding surfaces of the ocean

    Science.gov (United States)

    Tamisiea, Mark E.; Hughes, Chris W.; Williams, Simon D. P.; Bingley, Richard M.

    2014-01-01

    The practical need to understand sea level along the coasts, such as for safe navigation given the spatially variable tides, has resulted in tide gauge observations having the distinction of being some of the longest instrumental ocean records. Archives of these records, along with geological constraints, have allowed us to identify the century-scale rise in global sea level. Additional data sources, particularly satellite altimetry missions, have helped us to better identify the rates and causes of sea-level rise and the mechanisms leading to spatial variability in the observed rates. Analysis of all of the data reveals the need for long-term and stable observation systems to assess accurately the regional changes as well as to improve our ability to estimate future changes in sea level. While information from many scientific disciplines is needed to understand sea-level change, this review focuses on contributions from geodesy and the role of the ocean's bounding surfaces: the sea surface and the Earth's crust. PMID:25157196

  1. Sea level: measuring the bounding surfaces of the ocean.

    Science.gov (United States)

    Tamisiea, Mark E; Hughes, Chris W; Williams, Simon D P; Bingley, Richard M

    2014-09-28

    The practical need to understand sea level along the coasts, such as for safe navigation given the spatially variable tides, has resulted in tide gauge observations having the distinction of being some of the longest instrumental ocean records. Archives of these records, along with geological constraints, have allowed us to identify the century-scale rise in global sea level. Additional data sources, particularly satellite altimetry missions, have helped us to better identify the rates and causes of sea-level rise and the mechanisms leading to spatial variability in the observed rates. Analysis of all of the data reveals the need for long-term and stable observation systems to assess accurately the regional changes as well as to improve our ability to estimate future changes in sea level. While information from many scientific disciplines is needed to understand sea-level change, this review focuses on contributions from geodesy and the role of the ocean's bounding surfaces: the sea surface and the Earth's crust. © 2014 The Author(s) Published by the Royal Society. All rights reserved.

  2. Activation of the DnaK-ClpB Complex is Regulated by the Properties of the Bound Substrate.

    Science.gov (United States)

    Fernández-Higuero, Jose Angel; Aguado, Alejandra; Perales-Calvo, Judit; Moro, Fernando; Muga, Arturo

    2018-04-11

    The chaperone ClpB in bacteria is responsible for the reactivation of aggregated proteins in collaboration with the DnaK system. Association of these chaperones at the aggregate surface stimulates ATP hydrolysis, which mediates substrate remodeling. However, a question that remains unanswered is whether the bichaperone complex can be selectively activated by substrates that require remodeling. We find that large aggregates or bulky, native-like substrates activates the complex, whereas a smaller, permanently unfolded protein or extended, short peptides fail to stimulate it. Our data also indicate that ClpB interacts differently with DnaK in the presence of aggregates or small peptides, displaying a higher affinity for aggregate-bound DnaK, and that DnaK-ClpB collaboration requires the coupled ATPase-dependent remodeling activities of both chaperones. Complex stimulation is mediated by residues at the β subdomain of DnaK substrate binding domain, which become accessible to the disaggregase when the lid is allosterically detached from the β subdomain. Complex activation also requires an active NBD2 and the integrity of the M domain-ring of ClpB. Disruption of the M-domain ring allows the unproductive stimulation of the DnaK-ClpB complex in solution. The ability of the DnaK-ClpB complex to discrimínate different substrate proteins might allow its activation when client proteins require remodeling.

  3. Scanning a DNA molecule for bound proteins using hybrid magnetic and optical tweezers.

    Directory of Open Access Journals (Sweden)

    Marijn T J van Loenhout

    Full Text Available The functional state of the genome is determined by its interactions with proteins that bind, modify, and move along the DNA. To determine the positions and binding strength of proteins localized on DNA we have developed a combined magnetic and optical tweezers apparatus that allows for both sensitive and label-free detection. A DNA loop, that acts as a scanning probe, is created by looping an optically trapped DNA tether around a DNA molecule that is held with magnetic tweezers. Upon scanning the loop along the λ-DNA molecule, EcoRI proteins were detected with ~17 nm spatial resolution. An offset of 33 ± 5 nm for the detected protein positions was found between back and forwards scans, corresponding to the size of the DNA loop and in agreement with theoretical estimates. At higher applied stretching forces, the scanning loop was able to remove bound proteins from the DNA, showing that the method is in principle also capable of measuring the binding strength of proteins to DNA with a force resolution of 0.1 pN/[Formula: see text]. The use of magnetic tweezers in this assay allows the facile preparation of many single-molecule tethers, which can be scanned one after the other, while it also allows for direct control of the supercoiling state of the DNA molecule, making it uniquely suitable to address the effects of torque on protein-DNA interactions.

  4. HARP preferentially co-purifies with RPA bound to DNA-PK and blocks RPA phosphorylation.

    Science.gov (United States)

    Quan, Jinhua; Yusufzai, Timur

    2014-05-01

    The HepA-related protein (HARP/SMARCAL1) is an ATP-dependent annealing helicase that is capable of rewinding DNA structures that are stably unwound due to binding of the single-stranded DNA (ssDNA)-binding protein Replication Protein A (RPA). HARP has been implicated in maintaining genome integrity through its role in DNA replication and repair, two processes that generate RPA-coated ssDNA. In addition, mutations in HARP cause a rare disease known as Schimke immuno-osseous dysplasia. In this study, we purified HARP containing complexes with the goal of identifying the predominant factors that stably associate with HARP. We found that HARP preferentially interacts with RPA molecules that are bound to the DNA-dependent protein kinase (DNA-PK). We also found that RPA is phosphorylated by DNA-PK in vitro, while the RPA-HARP complexes are not. Our results suggest that, in addition to its annealing helicase activity, which eliminates the natural binding substrate for RPA, HARP blocks the phosphorylation of RPA by DNA-PK.

  5. Crystal Structure of a Eukaryotic GEN1 Resolving Enzyme Bound to DNA

    Directory of Open Access Journals (Sweden)

    Yijin Liu

    2015-12-01

    Full Text Available We present the crystal structure of the junction-resolving enzyme GEN1 bound to DNA at 2.5 Å resolution. The structure of the GEN1 protein reveals it to have an elaborated FEN-XPG family fold that is modified for its role in four-way junction resolution. The functional unit in the crystal is a monomer of active GEN1 bound to the product of resolution cleavage, with an extensive DNA binding interface for both helical arms. Within the crystal lattice, a GEN1 dimer interface juxtaposes two products, whereby they can be reconnected into a four-way junction, the structure of which agrees with that determined in solution. The reconnection requires some opening of the DNA structure at the center, in agreement with permanganate probing and 2-aminopurine fluorescence. The structure shows that a relaxation of the DNA structure accompanies cleavage, suggesting how second-strand cleavage is accelerated to ensure productive resolution of the junction.

  6. Covalently bound DNA on naked iron oxide nanoparticles: Intelligent colloidal nano-vector for cell transfection.

    Science.gov (United States)

    Magro, Massimiliano; Martinello, Tiziana; Bonaiuto, Emanuela; Gomiero, Chiara; Baratella, Davide; Zoppellaro, Giorgio; Cozza, Giorgio; Patruno, Marco; Zboril, Radek; Vianello, Fabio

    2017-11-01

    Conversely to common coated iron oxide nanoparticles, novel naked surface active maghemite nanoparticles (SAMNs) can covalently bind DNA. Plasmid (pDNA) harboring the coding gene for GFP was directly chemisorbed onto SAMNs, leading to a novel DNA nanovector (SAMN@pDNA). The spontaneous internalization of SAMN@pDNA into cells was compared with an extensively studied fluorescent SAMN derivative (SAMN@RITC). Moreover, the transfection efficiency of SAMN@pDNA was evaluated and explained by computational model. SAMN@pDNA was prepared and characterized by spectroscopic and computational methods, and molecular dynamic simulation. The size and hydrodynamic properties of SAMN@pDNA and SAMN@RITC were studied by electron transmission microscopy, light scattering and zeta-potential. The two nanomaterials were tested by confocal scanning microscopy on equine peripheral blood-derived mesenchymal stem cells (ePB-MSCs) and GFP expression by SAMN@pDNA was determined. Nanomaterials characterized by similar hydrodynamic properties were successfully internalized and stored into mesenchymal stem cells. Transfection by SAMN@pDNA occurred and GFP expression was higher than lipofectamine procedure, even in the absence of an external magnetic field. A computational model clarified that transfection efficiency can be ascribed to DNA availability inside cells. Direct covalent binding of DNA on naked magnetic nanoparticles led to an extremely robust gene delivery tool. Hydrodynamic and chemical-physical properties of SAMN@pDNA were responsible of the successful uptake by cells and of the efficiency of GFP gene transfection. SAMNs are characterized by colloidal stability, excellent cell uptake, persistence in the host cells, low toxicity and are proposed as novel intelligent DNA nanovectors for efficient cell transfection. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Last stop on the road to repair: structure of E. coli DNA ligase bound to nicked DNA-adenylate.

    Science.gov (United States)

    Nandakumar, Jayakrishnan; Nair, Pravin A; Shuman, Stewart

    2007-04-27

    NAD(+)-dependent DNA ligases (LigA) are ubiquitous in bacteria and essential for growth. Their distinctive substrate specificity and domain organization vis-a-vis human ATP-dependent ligases make them outstanding targets for anti-infective drug discovery. We report here the 2.3 A crystal structure of Escherichia coli LigA bound to an adenylylated nick, which captures LigA in a state poised for strand closure and reveals the basis for nick recognition. LigA envelopes the DNA within a protein clamp. Large protein domain movements and remodeling of the active site orchestrate progression through the three chemical steps of the ligation reaction. The structure inspires a strategy for inhibitor design.

  8. Mechanisms of Surface-Mediated DNA Hybridization

    Science.gov (United States)

    2015-01-01

    Single-molecule total internal reflection fluorescence microscopy was employed in conjunction with resonance energy transfer (RET) to observe the dynamic behavior of donor-labeled ssDNA at the interface between aqueous solution and a solid surface decorated with complementary acceptor-labeled ssDNA. At least 100 000 molecular trajectories were determined for both complementary strands and negative control ssDNA. RET was used to identify trajectory segments corresponding to the hybridized state. The vast majority of molecules from solution adsorbed nonspecifically to the surface, where a brief two-dimensional search was performed with a 7% chance of hybridization. Successful hybridization events occurred with a characteristic search time of ∼0.1 s, and unsuccessful searches resulted in desorption from the surface, ultimately repeating the adsorption and search process. Hybridization was reversible, and two distinct modes of melting (i.e., dehybridization) were observed, corresponding to long-lived (∼15 s) and short-lived (∼1.4 s) hybridized time intervals. A strand that melted back onto the surface could rehybridize after a brief search or desorb from the interface. These mechanistic observations provide guidance for technologies that involve DNA interactions in the near-surface region, suggesting a need to design surfaces that both enhance the complex multidimensional search process and stabilize the hybridized state. PMID:24708278

  9. On quantum motion of particle in linear potential bounded by perfectly reflecting plane and parabolic surfaces

    International Nuclear Information System (INIS)

    Pokotilovskij, Yu.N.

    1999-01-01

    The motion of a particle in the linear potential bounded by an inclined plane or parabolic surfaces is considered. The quantization of energy and wave functions is obtained numerically by the separation of the variables method

  10. DNA Replication and Cell Cycle Progression Regulatedby Long Range Interaction between Protein Complexes bound to DNA.

    Science.gov (United States)

    Matsson, L

    2001-12-01

    A nonstationary interaction that controlsDNA replication and the cell cycle isderived from many-body physics in achemically open T cell. The model predictsa long range force F'(ξ) =- (κ/2) ξ(1 - ξ)(2 - ξ)between thepre-replication complexes (pre-RCs) boundby the origins in DNA, ξ = ϕ/N being the relativedisplacement of pre-RCs, ϕ the number of pre-RCs, N the number of replicons to be replicated,and κ the compressibilitymodulus in the lattice of pre-RCs whichbehaves dynamically like an elasticallybraced string. Initiation of DNAreplication is induced at the thresholdϕ = N by a switch ofsign of F''(ξ), fromattraction (-) and assembly in the G(1) phase (0force at ϕ = 2N, from repulsion inS phase back to attraction in G(2), when all primed replicons havebeen duplicated once. F'(0) = 0corresponds to a resting cell in theabsence of driving force at ϕ= 0. The model thus ensures that the DNAcontent in G(2) cells is exactlytwice that of G(1) cells. The switch of interaction at the R-point, at which N pre-RCs have been assembled, starts the release of Rb protein thus also explaining the shift in the Rb phosphorylation from mitogen-dependent cyclinD to mitogen-independent cyclin E.Shape,slope and scale of the response curvesderived agree well with experimental datafrom dividing T cells and polymerising MTs,the variable length of which is due to anonlinear dependence of the growthamplitude on the initial concentrations oftubulin dimers and guanosine-tri-phosphate(GTP). The model also explains the dynamic instabilityin growing MTs.

  11. A change in the composition of supramolecular DNA-bound phospholipids in thymus and liver of gamma-irradiated rats

    International Nuclear Information System (INIS)

    Krasichkova, Z.I.; Strazhevskaya, N.B.

    1984-01-01

    The composition of supramolecular DNA (SM DNA)-bound phospholipids (PL) of thymus and liver of intact rats and those 2 min, 2, 6 and 24 h after γ-irradiation (9.7 Gy) was studied. In norm, supramolecular DNA of the thymus was shown to contain 6.7 μg PL/mg DNA, and that of the liver, 6.1 μg PL/mg DNA, the main components of PL being cardiolipin (CL) and phosphatidylethanolamine (PEA). Substantial changes were detected in the PL composition of SM DNA of γ,irradiated rat organs. During the postirradiation period the concentration of PEA and CL in thymus SM DNA changed symbatically and irreversibly decAeased to traces; whereas in SM DNA of the liver, their concentrations changed antibatically and decreased only to a definite level thus maintaining the necessary ''lipid volume''. It was shown that PL were not restored in SM DNA of the radiopesistant liver

  12. Protein sequences bound to mineral surfaces persist into deep time

    DEFF Research Database (Denmark)

    Demarchi, Beatrice; Hall, Shaun; Roncal-Herrero, Teresa

    2016-01-01

    of Laetoli (3.8 Ma) and Olduvai Gorge (1.3 Ma) in Tanzania. By tracking protein diagenesis back in time we find consistent patterns of preservation, demonstrating authenticity of the surviving sequences. Molecular dynamics simulations of struthiocalcin-1 and -2, the dominant proteins within the eggshell......, reveal that distinct domains bind to the mineral surface. It is the domain with the strongest calculated binding energy to the calcite surface that is selectively preserved. Thermal age calculations demonstrate that the Laetoli and Olduvai peptides are 50 times older than any previously authenticated...

  13. Surface-bound microgels - From physicochemical properties to biomedical applications

    DEFF Research Database (Denmark)

    Nyström, Lina; Malmsten, Martin

    2016-01-01

    Microgels offer robust and facile approaches for surface modification, as well as opportunities to introduce biological functionality by loading such structures with bioactive agents, e.g., in the context of drug delivery, functional biomaterials, and biosensors. As such, they provide a versatile...... and covalent grafting in dilute systems, to directed self-assembly, multilayer structures, and composites, as well as loading an release of drugs and other cargo molecules into/from such systems, and biomedical applications of these....

  14. Backscattering of projectile-bound electrons from solid surfaces

    International Nuclear Information System (INIS)

    Tobisch, M.; Schosnig, M.; Kroneberger, K.; Kuzel, M.; Maier, R.; Jung, M.; Fiedler, C.; Rothard, H.; Clouvas, A.; Suarez, S.; Groeneveld, K.O.

    1994-01-01

    The contribution of projectile ionization (PI) to secondary electron emission is studied by collision of H 2 + and H 3 + ions (400 keV/u and 700 keV/u) with carbon, copper and gold targets (600 A). The measured doubly differential intensity distribution shows a peak of lost projectile electrons near - v p . We describe the subtraction of the contribution of target ionization (TI), and compare the remaining electron intensities with a BEA calculation. For solids we observe a strong energy shift of the electron loss peak, which is compared with the influence of electron transport and binding energy. Furthermore, the low energy tail of the electron loss peak indicates the simultaneous occurrence of PI and TI. Finally we discuss the influence of surface conditions and the dependence of the observation angles on the measured electron intensities. (orig.)

  15. Ancient microbes from halite fluid inclusions: optimized surface sterilization and DNA extraction.

    Science.gov (United States)

    Sankaranarayanan, Krithivasan; Timofeeff, Michael N; Spathis, Rita; Lowenstein, Tim K; Lum, J Koji

    2011-01-01

    Fluid inclusions in evaporite minerals (halite, gypsum, etc.) potentially preserve genetic records of microbial diversity and changing environmental conditions of Earth's hydrosphere for nearly one billion years. Here we describe a robust protocol for surface sterilization and retrieval of DNA from fluid inclusions in halite that, unlike previously published methods, guarantees removal of potentially contaminating surface-bound DNA. The protocol involves microscopic visualization of cell structures, deliberate surface contamination followed by surface sterilization with acid and bleach washes, and DNA extraction using Amicon centrifugal filters. Methods were verified on halite crystals of four different ages from Saline Valley, California (modern, 36 ka, 64 ka, and 150 ka), with retrieval of algal and archaeal DNA, and characterization of the algal community using ITS1 sequences. The protocol we developed opens up new avenues for study of ancient microbial ecosystems in fluid inclusions, understanding microbial evolution across geological time, and investigating the antiquity of life on earth and other parts of the solar system.

  16. On the bound states of Schrodinger operators with -interactions on conical surfaces

    Czech Academy of Sciences Publication Activity Database

    Lotoreichik, Vladimir; Ourmieres-Bonafos, T.

    2016-01-01

    Roč. 41, č. 6 (2016), s. 999-1028 ISSN 0360-5302 Institutional support: RVO:61389005 Keywords : conical and hyperconical surfaces * delta-interaction * existence of bound states * Schrodinger operator * spectral asymptotics Subject RIV: BE - Theoretical Physics Impact factor: 1.608, year: 2016

  17. Trade-off bounds for the Pareto surface approximation in multi-criteria IMRT planning

    International Nuclear Information System (INIS)

    Serna, J I; Monz, M; Kuefer, K H; Thieke, C

    2009-01-01

    One approach to multi-criteria IMRT planning is to automatically calculate a data set of Pareto-optimal plans for a given planning problem in a first phase, and then interactively explore the solution space and decide on the clinically best treatment plan in a second phase. The challenge of computing the plan data set is to ensure that all clinically meaningful plans are covered and that as many clinically irrelevant plans as possible are excluded to keep computation times within reasonable limits. In this work, we focus on the approximation of the clinically relevant part of the Pareto surface, the process that constitutes the first phase. It is possible that two plans on the Pareto surface have a small, clinically insignificant difference in one criterion and a significant difference in another criterion. For such cases, only the plan that is clinically clearly superior should be included into the data set. To achieve this during the Pareto surface approximation, we propose to introduce bounds that restrict the relative quality between plans, the so-called trade-off bounds. We show how to integrate these trade-off bounds into the approximation scheme and study their effects. The proposed scheme is applied to two artificial cases and one clinical case of a paraspinal tumor. For all cases, the quality of the Pareto surface approximation is measured with respect to the number of computed plans, and the range of values occurring in the approximation for different criteria is compared. Through enforcing trade-off bounds, the scheme disregards clinically irrelevant plans during the approximation. Thereby, the number of plans necessary to achieve a good approximation quality can be significantly reduced. Thus, trade-off bounds are an effective tool to focus the planning and to reduce computation time.

  18. Trade-off bounds for the Pareto surface approximation in multi-criteria IMRT planning.

    Science.gov (United States)

    Serna, J I; Monz, M; Küfer, K H; Thieke, C

    2009-10-21

    One approach to multi-criteria IMRT planning is to automatically calculate a data set of Pareto-optimal plans for a given planning problem in a first phase, and then interactively explore the solution space and decide on the clinically best treatment plan in a second phase. The challenge of computing the plan data set is to ensure that all clinically meaningful plans are covered and that as many clinically irrelevant plans as possible are excluded to keep computation times within reasonable limits. In this work, we focus on the approximation of the clinically relevant part of the Pareto surface, the process that constitutes the first phase. It is possible that two plans on the Pareto surface have a small, clinically insignificant difference in one criterion and a significant difference in another criterion. For such cases, only the plan that is clinically clearly superior should be included into the data set. To achieve this during the Pareto surface approximation, we propose to introduce bounds that restrict the relative quality between plans, the so-called trade-off bounds. We show how to integrate these trade-off bounds into the approximation scheme and study their effects. The proposed scheme is applied to two artificial cases and one clinical case of a paraspinal tumor. For all cases, the quality of the Pareto surface approximation is measured with respect to the number of computed plans, and the range of values occurring in the approximation for different criteria is compared. Through enforcing trade-off bounds, the scheme disregards clinically irrelevant plans during the approximation. Thereby, the number of plans necessary to achieve a good approximation quality can be significantly reduced. Thus, trade-off bounds are an effective tool to focus the planning and to reduce computation time.

  19. Crystal Structures of SlyA Protein, a Master Virulence Regulator of Salmonella, in Free and DNA-bound States

    Energy Technology Data Exchange (ETDEWEB)

    Dolan, Kyle T.; Duguid, Erica M.; He, Chuan (UC)

    2011-11-17

    SlyA is a master virulence regulator that controls the transcription of numerous genes in Salmonella enterica. We present here crystal structures of SlyA by itself and bound to a high-affinity DNA operator sequence in the slyA gene. SlyA interacts with DNA through direct recognition of a guanine base by Arg-65, as well as interactions between conserved Arg-86 and the minor groove and a large network of non-base-specific contacts with the sugar phosphate backbone. Our structures, together with an unpublished structure of SlyA bound to the small molecule effector salicylate (Protein Data Bank code 3DEU), reveal that, unlike many other MarR family proteins, SlyA dissociates from DNA without large conformational changes when bound to this effector. We propose that SlyA and other MarR global regulators rely more on indirect readout of DNA sequence to exert control over many genes, in contrast to proteins (such as OhrR) that recognize a single operator.

  20. Microarray of DNA probes on carboxylate functional beads surface

    Institute of Scientific and Technical Information of China (English)

    黄承志; 李原芳; 黄新华; 范美坤

    2000-01-01

    The microarray of DNA probes with 5’ -NH2 and 5’ -Tex/3’ -NH2 modified terminus on 10 um carboxylate functional beads surface in the presence of 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC) is characterized in the preseni paper. it was found that the microarray capacity of DNA probes on the beads surface depends on the pH of the aqueous solution, the concentra-tion of DNA probe and the total surface area of the beads. On optimal conditions, the minimum distance of 20 mer single-stranded DNA probe microarrayed on beads surface is about 14 nm, while that of 20 mer double-stranded DNA probes is about 27 nm. If the probe length increases from 20 mer to 35 mer, its microarray density decreases correspondingly. Mechanism study shows that the binding mode of DNA probes on the beads surface is nearly parallel to the beads surface.

  1. Microarray of DNA probes on carboxylate functional beads surface

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    The microarray of DNA probes with 5′-NH2 and 5′-Tex/3′-NH2 modified terminus on 10 m m carboxylate functional beads surface in the presence of 1-ethyl-3-(3-dimethylaminopropyl)- carbodiimide (EDC) is characterized in the present paper. It was found that the microarray capacity of DNA probes on the beads surface depends on the pH of the aqueous solution, the concentration of DNA probe and the total surface area of the beads. On optimal conditions, the minimum distance of 20 mer single-stranded DNA probe microarrayed on beads surface is about 14 nm, while that of 20 mer double-stranded DNA probes is about 27 nm. If the probe length increases from 20 mer to 35 mer, its microarray density decreases correspondingly. Mechanism study shows that the binding mode of DNA probes on the beads surface is nearly parallel to the beads surface.

  2. [DNA complexes, formed on aqueous phase surfaces: new planar polymeric and composite nanostructures].

    Science.gov (United States)

    Antipina, M N; Gaĭnutdinov, R V; Rakhnianskaia, A A; Sergeev-Cherenkov, A N; Tolstikhina, A L; Iurova, T V; Kislov, V V; Khomutov, G B

    2003-01-01

    The formation of DNA complexes with Langmuir monolayers of the cationic lipid octadecylamine (ODA) and the new amphiphilic polycation poly-4-vinylpyridine with 16% of cetylpyridinium groups (PVP-16) on the surface of an aqueous solution of native DNA of low ionic strength was studied. Topographic images of Langmuir-Blodgett films of DNA/ODA and DNA/PVP-16 complexes applied to micaceous substrates were investigated by the method of atomic force microscopy. It was found that films of the amphiphilic polycation have an ordered planar polycrystalline structure. The morphology of planar DNA complexes with the amphiphilic cation substantially depended on the incubation time and the phase state of the monolayer on the surface of the aqueous DNA solution. Complex structures and individual DNA molecules were observed on the surface of the amphiphilic monolayer. Along with quasi-linear individual bound DNA molecules, characteristic extended net-like structures and quasi-circular toroidal condensed conformations of planar DNA complexes were detected. Mono- and multilayer films of DNA/PVP-16 complexes were used as templates and nanoreactors for the synthesis of inorganic nanostructures via the binding of metal cations from the solution and subsequent generation of the inorganic phase. As a result, ultrathin polymeric composite films with integrated DNA building blocks and quasi-linear arrays of inorganic semiconductor (CdS) and iron oxide nanoparticles and nanowires were obtained. The nanostructures obtained were characterized by scanning probe microscopy and transmission electron microscopy techniques. The methods developed are promising for investigating the mechanisms of structural organization and transformation in DNA and polyelectrolyte complexes at the gas-liquid interface and for the design of new extremely thin highly ordered planar polymeric and composite materials, films, and coatings with controlled ultrastructure for applications in nanoelectronics and

  3. Crystal Structure of the Dimeric Oct6 (Pou3fl) POU Domain Bound to Palindromic MORE DNA

    Energy Technology Data Exchange (ETDEWEB)

    R Jauch; S Choo; C Ng; P Kolatkar

    2011-12-31

    POU domains (named after their identification in Pit1, Oct1 unc86) are found in around 15 transcription factors encoded in mammalian genomes many of which feature prominently as key regulators at development bifurcations. For example, the POU III class Octamer binding protein 6 (Oct6) is expressed in embryonic stem cells and during neural development and drives the differentia5tion of myelinated cells in the central and peripheral nervous system. Defects in oct6 expression levels are linked to neurological disorders such as schizophrenia. POU proteins contain a bi-partite DNA binding domain that assembles on various DNA motifs with differentially configured subdomains. Intriguingly, alternative configurations of POU domains on different DNA sites were shown to affect the subsequent recruitment of transcriptional coactivators. Namely, binding of Oct1 to a Palindromic Oct-factor Recognition Element (PORE) was shown to facilitate the recruitment of the OBF1 coactivator whereas More of PORE (MORE) bound Oct1 does not. Moreover, Pit1 was shown to recruit the corepressor N-CoR only when bound to a variant MORE motif with a 2 bp half-site spacing. Therefore, POU proteins are seen as a paradigm for DNA induced allosteric effects on transcription factors modulating their regulatory potential. However, a big unresolved conundrum for the POU class and for most if not all other transcription factor classes is how highly similar proteins regulate different sets of genes causing fundamentally different biological responses. Ultimately, there must be subtle features enabling those factors to engage in contrasting molecular interactions in the cell. Thus, the dissection of the molecular details of the transcription-DNA recognition in general, and the formation of multimeric regulatory complexes, in particular, is highly desirable. To contribute to these efforts they solved the 2.05 {angstrom} crystal structure of Oct6 bound as a symmetrical homodimer to palindromic MORE DNA.

  4. Oxidation of DNA, proteins and lipids by DOPA, protein-bound DOPA, and related catechol(amine)s

    DEFF Research Database (Denmark)

    Pattison, David I; Dean, Roger T; Davies, Michael Jonathan

    2002-01-01

    Incubation of free 3,4-dihydroxyphenylalanine (DOPA), protein-bound DOPA (PB-DOPA) and related catechols with DNA, proteins and lipids has been shown to result in oxidative damage to the target molecule. This article reviews these reactions with particular emphasis on those that occur in the pres......Incubation of free 3,4-dihydroxyphenylalanine (DOPA), protein-bound DOPA (PB-DOPA) and related catechols with DNA, proteins and lipids has been shown to result in oxidative damage to the target molecule. This article reviews these reactions with particular emphasis on those that occur...... in the presence of molecular O(2) and redox-active metal ions (e.g. Fe(3+), Cu(2+), Cr(6+)), which are known to increase the rate of DOPA oxidation. The majority of oxidative damage appears to be mediated by reactive oxygen species (ROS) such as superoxide and HO(.) radicals, though other DOPA oxidation products...

  5. Mixed DNA/Oligo(ethylene glycol) Functionalized Gold Surface Improve DNA Hybridization in Complex Media

    International Nuclear Information System (INIS)

    Lee, C.; Gamble, L.; Grainger, D.; Castner, D.

    2006-01-01

    Reliable, direct 'sample-to-answer' capture of nucleic acid targets from complex media would greatly improve existing capabilities of DNA microarrays and biosensors. This goal has proven elusive for many current nucleic acid detection technologies attempting to produce assay results directly from complex real-world samples, including food, tissue, and environmental materials. In this study, we have investigated mixed self-assembled thiolated single-strand DNA (ssDNA) monolayers containing a short thiolated oligo(ethylene glycol) (OEG) surface diluent on gold surfaces to improve the specific capture of DNA targets from complex media. Both surface composition and orientation of these mixed DNA monolayers were characterized with x-ray photoelectron spectroscopy (XPS) and near-edge x-ray absorption fine structure (NEXAFS). XPS results from sequentially adsorbed ssDNA/OEG monolayers on gold indicate that thiolated OEG diluent molecules first incorporate into the thiolated ssDNA monolayer and, upon longer OEG exposures, competitively displace adsorbed ssDNA molecules from the gold surface. NEXAFS polarization dependence results (followed by monitoring the N 1s→π* transition) indicate that adsorbed thiolated ssDNA nucleotide base-ring structures in the mixed ssDNA monolayers are oriented more parallel to the gold surface compared to DNA bases in pure ssDNA monolayers. This supports ssDNA oligomer reorientation towards a more upright position upon OEG mixed adlayer incorporation. DNA target hybridization on mixed ssDNA probe/OEG monolayers was monitored by surface plasmon resonance (SPR). Improvements in specific target capture for these ssDNA probe surfaces due to incorporation of the OEG diluent were demonstrated using two model biosensing assays, DNA target capture from complete bovine serum and from salmon genomic DNA mixtures. SPR results demonstrate that OEG incorporation into the ssDNA adlayer improves surface resistance to both nonspecific DNA and protein

  6. cGAS senses long and HMGB/TFAM-bound U-turn DNA by forming protein-DNA ladders.

    Science.gov (United States)

    Andreeva, Liudmila; Hiller, Björn; Kostrewa, Dirk; Lässig, Charlotte; de Oliveira Mann, Carina C; Jan Drexler, David; Maiser, Andreas; Gaidt, Moritz; Leonhardt, Heinrich; Hornung, Veit; Hopfner, Karl-Peter

    2017-09-21

    Cytosolic DNA arising from intracellular pathogens triggers a powerful innate immune response. It is sensed by cyclic GMP-AMP synthase (cGAS), which elicits the production of type I interferons by generating the second messenger 2'3'-cyclic-GMP-AMP (cGAMP). Endogenous nuclear or mitochondrial DNA can also be sensed by cGAS under certain conditions, resulting in sterile inflammation. The cGAS dimer binds two DNA ligands shorter than 20 base pairs side-by-side, but 20-base-pair DNA fails to activate cGAS in vivo and is a poor activator in vitro. Here we show that cGAS is activated in a strongly DNA length-dependent manner both in vitro and in human cells. We also show that cGAS dimers form ladder-like networks with DNA, leading to cooperative sensing of DNA length: assembly of the pioneering cGAS dimer between two DNA molecules is ineffective; but, once formed, it prearranges the flanking DNA to promote binding of subsequent cGAS dimers. Remarkably, bacterial and mitochondrial nucleoid proteins HU and mitochondrial transcription factor A (TFAM), as well as high-mobility group box 1 protein (HMGB1), can strongly stimulate long DNA sensing by cGAS. U-turns and bends in DNA induced by these proteins pre-structure DNA to nucleate cGAS dimers. Our results suggest a nucleation-cooperativity-based mechanism for sensitive detection of mitochondrial DNA and pathogen genomes, and identify HMGB/TFAM proteins as DNA-structuring host factors. They provide an explanation for the peculiar cGAS dimer structure and suggest that cGAS preferentially binds incomplete nucleoid-like structures or bent DNA.

  7. Electrical potential-assisted DNA hybridization. How to mitigate electrostatics for surface DNA hybridization.

    Science.gov (United States)

    Tymoczko, Jakub; Schuhmann, Wolfgang; Gebala, Magdalena

    2014-12-24

    Surface-confined DNA hybridization reactions are sensitive to the number and identity of DNA capture probes and experimental conditions such as the nature and the ionic strength of the electrolyte solution. When the surface probe density is high or the concentration of bulk ions is much lower than the concentration of ions within the DNA layer, hybridization is significantly slowed down or does not proceed at all. However, high-density DNA monolayers are attractive for designing high-sensitivity DNA sensors. Thus, circumventing sluggish DNA hybridization on such interfaces allows a high surface concentration of target DNA and improved signal/noise ratio. We present potential-assisted hybridization as a strategy in which an external voltage is applied to the ssDNA-modified interface during the hybridization process. Results show that a significant enhancement of hybridization can be achieved using this approach.

  8. Bohm potential effect on the propagation of electrostatic surface wave in semi-bounded quantum plasmas

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Myoung-Jae [Department of Physics, Hanyang University, Seoul 04763 (Korea, Republic of); Research Institute for Natural Sciences, Hanyang University, Seoul 04763 (Korea, Republic of); Jung, Young-Dae, E-mail: ydjung@hanyang.ac.kr [Department of Applied Physics and Department of Bionanotechnology, Hanyang University, Ansan, Kyunggi-Do 15588 (Korea, Republic of); Department of Electrical and Computer Engineering, MC 0407, University of California, San Diego, 9500 Gilman Drive, La Jolla, CA 92093-0407 (United States)

    2017-02-12

    High frequency electrostatic wave propagation in a dense and semi-bounded electron quantum plasma is investigated with consideration of the Bohm potential. The dispersion relation for the surface mode of quantum plasma is derived and numerically analyzed. We found that the quantum effect enhances the frequency of the wave especially in the high wave number regime. However, the frequency of surface wave is found to be always lower than that of the bulk wave for the same quantum wave number. The group velocity of the surface wave for various quantum wave number is also obtained. - Highlights: • High frequency electrostatic wave propagation is investigated in a dense semi-bounded quantum plasma. • The dispersion relation for the surface mode of quantum plasma is derived and numerically analyzed. • The quantum effect enhances the frequency of the wave especially in the high wave number regime. • The frequency of surface wave is found to be always lower than that of the bulk wave. • The group velocity of the surface wave for various quantum wave number is also obtained.

  9. In vivo assessment of a novel dacron surface with covalently bound recombinant hirudin.

    Science.gov (United States)

    Wyers, M C; Phaneuf, M D; Rzucidlo, E M; Contreras, M A; LoGerfo, F W; Quist, W C

    1999-01-01

    Prosthetic arterial graft surfaces are relatively thrombogenic and fail to heal with a cellular neointima. The goal of this study was to characterize the in vivo antithrombin properties of a novel Dacron surface with covalently linked recombinant hirudin (rHir) implanted in a canine thoracic aorta with high flow and shear rates. rHir was bound to a knitted Dacron patch using crosslinker-modified bovine serum albumin (BSA) as a basecoat protein. BSA was first reacted with the heterobifunctional crosslinker, sulfo-SMCC. This BSA-SMCC complex was then bound to the carboxylic acid groups of hydrolyzed Dacron patches using the carbodiimide crosslinker, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride. Iodinated, Traut's-modified rHir (125I-rHir-SH) was then reacted with the Dacron-BSA-SMCC surface, thereby covalently binding 125I-rHir. Graft segments were washed and sonicated to remove any nonspecifically bound 125I-rHir. Dacron-BSA-SMCC-S-125I-rHir patches (n = 5) and control Dacron-BSA patches (n = 5) were implanted in series in the thoracic aortas of canines. These patches were exposed to nonheparinized, arterial blood flow for 2 hours. Patches were explanted and assessed for 125I-rHir loss. Antithrombin activity of explanted 1-cm2 patch segments was evaluated using a chromogenic assay with 1, 5, 10, 15 units of added thrombin. Light microscopy was performed to qualitatively examine the pseudointima. Two animals were excluded from the study owing to excessive bleeding through the knitted 125I-rHir patch. Comparison of preoperative and postoperative 125I-rHir gamma counts revealed an overall decrease of 20+/-5.4% over the period studied. Explanted 125I-rHir patch segments were able to inhibit 1, 5, and 7 NIHU of thrombin, demonstrating retained antithrombin activity. Gross and microscopic examination of the control and test Dacron surfaces showed marked differences. Dacron surfaces with covalently bound 125I-rHir had no gross thrombus and a thin

  10. Mechanical splitting of microtubules into protofilament bundles by surface-bound kinesin-1.

    Science.gov (United States)

    VanDelinder, Virginia; Adams, Peter G; Bachand, George D

    2016-12-21

    The fundamental biophysics of gliding microtubule (MT) motility by surface-tethered kinesin-1 motor proteins has been widely studied, as well as applied to capture and transport analytes in bioanalytical microdevices. In these systems, phenomena such as molecular wear and fracture into shorter MTs have been reported due the mechanical forces applied on the MT during transport. In the present work, we show that MTs can be split longitudinally into protofilament bundles (PFBs) by the work performed by surface-bound kinesin motors. We examine the properties of these PFBs using several techniques (e.g., fluorescence microscopy, SEM, AFM), and show that the PFBs continue to be mobile on the surface and display very high curvature compared to MT. Further, higher surface density of kinesin motors and shorter kinesin-surface tethers promote PFB formation, whereas modifying MT with GMPCPP or higher paclitaxel concentrations did not affect PFB formation.

  11. Fluorescence quenching studies of potential-dependent DNA reorientation dynamics at glassy carbon electrode surfaces.

    Science.gov (United States)

    Li, Qin; Cui, Chenchen; Higgins, Daniel A; Li, Jun

    2012-09-05

    The potential-dependent reorientation dynamics of double-stranded DNA (ds-DNA) attached to planar glassy carbon electrode (GCE) surfaces were investigated. The orientation state of surface-bound ds-DNA was followed by monitoring the fluorescence from a 6-carboxyfluorescein (FAM6) fluorophore covalently linked to the distal end of the DNA. Positive potentials (i.e., +0.2 V vs open circuit potential, OCP) caused the ds-DNA to align parallel to the electrode surface, resulting in strong dipole-electrode quenching of FAM6 fluorescence. Switching of the GCE potential to negative values (i.e., -0.2 V vs OCP) caused the ds-DNA to reorient perpendicular to the electrode surface, with a concomitant increase in FAM6 fluorescence. In addition to the very fast (submilliseconds) dynamics of the initial reorientation process, slow (0.1-0.9 s) relaxation of FAM6 fluorescence to intermediate levels was also observed after potential switching. These dynamics have not been previously described in the literature. They are too slow to be explained by double layer charging, and chronoamperometry data showed no evidence of such effects. Both the amplitude and rate of the dynamics were found to depend upon buffer concentration, and ds-DNA length, demonstrating a dependence on the double layer field. The dynamics are concluded to arise from previously undetected complexities in the mechanism of potential-dependent ds-DNA reorientation. The possible origins of these dynamics are discussed. A better understanding of these dynamics will lead to improved models for potential-dependent ds-DNA reorientation at electrode surfaces and will facilitate the development of advanced electrochemical devices for detection of target DNAs.

  12. Study of Auger effect in DNA when bound to molecules containing platinum. A possible application to hadrontherapy

    Energy Technology Data Exchange (ETDEWEB)

    Kobayashi, K.; Usami, N.; Sasaki, I.; Frohlich, H.; Le Sech, C. E-mail: lesech@lcam.u-psud.fr

    2003-01-01

    Complexes made of DNA and Cyclo-Pt bound to plasmid DNA, were placed in aqueous solution and irradiated with monochromatic X-rays in the range E=8.5-13 keV, including the resonant photoabsorption energy of the L{sub III} shell of the platinum atom. The number of single- and double-strand breaks (ssb and dsb) induced by irradiation on a supercoiled DNA plasmid was measured by the production of circular-nicked and linear forms. In order to disentangle the contribution of the direct effects imparted to ionization, and the indirect effects due to a free radical attack, experiments have been performed in the presence of a small concentration (64 mmol l{sup -1}) of hydroxyl free radical scavenger dimethyl sulfoxide (DMSO). An enhancement of the number of ssb and dsb is observed when the plasmids contain the Pt intercalating molecules. Even when off-resonant X-rays are used, the strand break efficiency remains higher than expected based upon the absorption cross-section, as if the Pt bound to DNA is increasing the yield of strand breaks. A mechanism is suggested, involving photoelectrons generated from the ionization of water which efficiently ionize Pt atoms. This observation may provide an insight to understanding the effects of new radiotherapy protocols, associated chemotherapeutic agents such as cisplatin and ordinary radiotherapy for tumoral treatments.

  13. Bounds on area and charge for marginally trapped surfaces with a cosmological constant

    International Nuclear Information System (INIS)

    Simon, Walter

    2012-01-01

    We sharpen the known inequalities AΛ ≤ 4π(1 - g) (Hayward et al 1994 Phys. Rev. D 49 5080, Woolgar 1999 Class. Quantum Grav. 16 3005) and A ≤ 4πQ 2 (Dain et al 2012 Class. Quantum Grav. 29 035013) between the area A and the electric charge Q of a stable marginally outer-trapped surface (MOTS) of genus g in the presence of a cosmological constant Λ. In particular, instead of requiring stability we include the principal eigenvalue λ of the stability operator. For Λ* Λ+λ > 0, we obtain a lower and an upper bound for Λ*A in terms of Λ*Q 2 , as well as the upper bound Q≤1/(2√(Λ * )) for the charge, which reduces to Q≤1/(2√(Λ)) in the stable case λ ≥ 0. For Λ* < 0, there only remains a lower bound on A. In the spherically symmetric, static, stable case, one of our area inequalities is saturated iff the surface gravity vanishes. We also discuss implications of our inequalities for 'jumps' and mergers of charged MOTS. (fast track communication)

  14. En route to surface-bound electric field-driven molecular motors.

    Science.gov (United States)

    Jian, Huahua; Tour, James M

    2003-06-27

    Four caltrop-shaped molecules that might be useful as surface-bound electric field-driven molecular motors have been synthesized. The caltrops are comprised of a pair of electron donor-acceptor arms and a tripod base. The molecular arms are based on a carbazole or oligo(phenylene ethynylene) core with a strong net dipole. The tripod base uses a silicon atom as its core. The legs of the tripod bear sulfur-tipped bonding units, as acetyl-protected benzylic thiols, for bonding to a gold surface. The geometry of the tripod base allows the caltrop to project upward from a metallic surface after self-assembly. Ellipsometric studies show that self-assembled monolayers of the caltrops are formed on Au surfaces with molecular thicknesses consistent with the desired upright-shaft arrangement. As a result, the zwitterionic molecular arms might be controllable when electric fields are applied around the caltrops, thereby constituting field-driven motors.

  15. Crystal Structure of a CRISPR RNA-guided Surveillance Complex Bound to a ssDNA Target

    Energy Technology Data Exchange (ETDEWEB)

    Mulepati, Sabin [Johns Hopkins Univ., Baltimore, MD (United States); Heroux, Annie; Bailey, Scott [Johns Hopkins Univ., Baltimore, MD (United States)

    2014-09-19

    In prokaryotes, RNA derived from type I and type III CRISPR loci direct large ribonucleoprotein complexes to destroy invading bacteriophage and plasmids. In Escherichia coli, this 405-kilodalton complex is called Cascade. We report the crystal structure of Cascade bound to a single-stranded DNA (ssDNA) target at a resolution of 3.03 angstroms. The structure reveals that the CRISPR RNA and target strands do not form a double helix but instead adopt an underwound ribbon-like structure. This noncanonical structure is facilitated by rotation of every sixth nucleotide out of the RNA-DNA hybrid and is stabilized by the highly interlocked organization of protein subunits. These studies provide insight into both the assembly and the activity of this complex and suggest a mechanism to enforce fidelity of target binding.

  16. Insights into finding a mismatch through the structure of a mispaired DNA bound by a rhodium intercalator

    Science.gov (United States)

    Pierre, Valérie C.; Kaiser, Jens T.; Barton, Jacqueline K.

    2007-01-01

    We report the 1.1-Å resolution crystal structure of a bulky rhodium complex bound to two different DNA sites, mismatched and matched in the oligonucleotide 5′-(dCGGAAATTCCCG)2-3′. At the AC mismatch site, the structure reveals ligand insertion from the minor groove with ejection of both mismatched bases and elucidates how destabilized mispairs in DNA may be recognized. This unique binding mode contrasts with major groove intercalation, observed at a matched site, where doubling of the base pair rise accommodates stacking of the intercalator. Mass spectral analysis reveals different photocleavage products associated with the two binding modes in the crystal, with only products characteristic of mismatch binding in solution. This structure, illustrating two clearly distinct binding modes for a molecule with DNA, provides a rationale for the interrogation and detection of mismatches. PMID:17194756

  17. A Polycomb complex remains bound through DNA replication in the absence of other eukaryotic proteins

    KAUST Repository

    Lengsfeld, Bettina M.; Berry, Kayla N.; Ghosh, Sharmistha; Takahashi, Masateru; Francis, Nicole J.

    2012-01-01

    Propagation of chromatin states through DNA replication is central to epigenetic regulation and can involve recruitment of chromatin proteins to replicating chromatin through interactions with replication fork components. Here we show using a fully reconstituted T7 bacteriophage system that eukaryotic proteins are not required to tether the Polycomb complex PRC1 to templates during DNA replication. Instead, DNA binding by PRC1 can withstand passage of a simple replication fork.

  18. A Polycomb complex remains bound through DNA replication in the absence of other eukaryotic proteins

    KAUST Repository

    Lengsfeld, Bettina M.

    2012-09-17

    Propagation of chromatin states through DNA replication is central to epigenetic regulation and can involve recruitment of chromatin proteins to replicating chromatin through interactions with replication fork components. Here we show using a fully reconstituted T7 bacteriophage system that eukaryotic proteins are not required to tether the Polycomb complex PRC1 to templates during DNA replication. Instead, DNA binding by PRC1 can withstand passage of a simple replication fork.

  19. Surface-enhanced localized surface plasmon resonance biosensing of avian influenza DNA hybridization using subwavelength metallic nanoarrays

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Shin Ae; Jang, Sung Min; Kim, Sung June [School of Electrical Engineering and Computer Science, Seoul National University, Seoul 151-742 (Korea, Republic of); Byun, Kyung Min [Department of Biomedical Engineering, Kyung Hee University, Yongin 446-701 (Korea, Republic of); Kim, Kyujung; Kim, Donghyun [Program of Nanomedical Science and Technology, Yonsei University, Seoul 120-749 (Korea, Republic of); Ma, Kyungjae; Oh, Youngjin [School of Electrical and Electronic Engineering, Yonsei University, Seoul 120-749 (Korea, Republic of); Kim, Sung Guk [College of Veterinary Medicine, Cornell University, Ithaca, New York 14853 (United States); Shuler, Michael L, E-mail: kmbyun@khu.ac.kr [Department of Biomedical Engineering, Cornell University, Ithaca, New York 14853 (United States)

    2010-09-03

    We demonstrated enhanced localized surface plasmon resonance (SPR) biosensing based on subwavelength gold nanoarrays built on a thin gold film. Arrays of nanogratings (1D) and nanoholes (2D) with a period of 200 nm were fabricated by electron-beam lithography and used for the detection of avian influenza DNA hybridization. Experimental results showed that both nanoarrays provided significant sensitivity improvement and, especially, 1D nanogratings exhibited higher SPR signal amplification compared with 2D nanohole arrays. The sensitivity enhancement is associated with changes in surface-limited reaction area and strong interactions between bound molecules and localized plasmon fields. Our approach is expected to improve both the sensitivity and sensing resolution and can be applicable to label-free detection of DNA without amplification by polymerase chain reaction.

  20. ERROR BOUNDS FOR SURFACE AREA ESTIMATORS BASED ON CROFTON’S FORMULA

    Directory of Open Access Journals (Sweden)

    Markus Kiderlen

    2011-05-01

    Full Text Available According to Crofton's formula, the surface area S(A of a sufficiently regular compact set A in Rd is proportional to the mean of all total projections pA (u on a linear hyperplane with normal u, uniformly averaged over all unit vectors u. In applications, pA (u is only measured in k directions and the mean is approximated by a finite weighted sum bS(A of the total projections in these directions. The choice of the weights depends on the selected quadrature rule. We define an associated zonotope Z (depending only on the projection directions and the quadrature rule, and show that the relative error bS (A/S (A is bounded from below by the inradius of Z and from above by the circumradius of Z. Applying a strengthened isoperimetric inequality due to Bonnesen, we show that the rectangular quadrature rule does not give the best possible error bounds for d =2. In addition, we derive asymptotic behavior of the error (with increasing k in the planar case. The paper concludes with applications to surface area estimation in design-based digital stereology where we show that the weights due to Bonnesen's inequality are better than the usual weights based on the rectangular rule and almost optimal in the sense that the relative error of the surface area estimator is very close to the minimal error.

  1. In situ surface enhanced resonance Raman scattering analysis of a reactive dye covalently bound to cotton.

    Science.gov (United States)

    White, P C; Munro, C H; Smith, W E

    1996-06-01

    An in situ surface enhanced resonance Raman scattering (SERRS) procedure is described for the analysis of a reactive dye covalently bound to a single strand of a cotton fibre. This procedure can be completed in 5 h, whereas an alternative enzyme digestion method takes approximately 21 h. These two fibre preparation methods give similar spectra from picogram quantities of dye present on a 2-5 mm length of fibre. The in situ nature of the analysis and the small sample size make this method particularly suitable for forensic applications.

  2. The high-level error bound for shifted surface spline interpolation

    OpenAIRE

    Luh, Lin-Tian

    2006-01-01

    Radial function interpolation of scattered data is a frequently used method for multivariate data fitting. One of the most frequently used radial functions is called shifted surface spline, introduced by Dyn, Levin and Rippa in \\cite{Dy1} for $R^{2}$. Then it's extended to $R^{n}$ for $n\\geq 1$. Many articles have studied its properties, as can be seen in \\cite{Bu,Du,Dy2,Po,Ri,Yo1,Yo2,Yo3,Yo4}. When dealing with this function, the most commonly used error bounds are the one raised by Wu and S...

  3. Crystal structure of APOBEC3A bound to single-stranded DNA reveals structural basis for cytidine deamination and specificity.

    Science.gov (United States)

    Kouno, Takahide; Silvas, Tania V; Hilbert, Brendan J; Shandilya, Shivender M D; Bohn, Markus F; Kelch, Brian A; Royer, William E; Somasundaran, Mohan; Kurt Yilmaz, Nese; Matsuo, Hiroshi; Schiffer, Celia A

    2017-04-28

    Nucleic acid editing enzymes are essential components of the immune system that lethally mutate viral pathogens and somatically mutate immunoglobulins, and contribute to the diversification and lethality of cancers. Among these enzymes are the seven human APOBEC3 deoxycytidine deaminases, each with unique target sequence specificity and subcellular localization. While the enzymology and biological consequences have been extensively studied, the mechanism by which APOBEC3s recognize and edit DNA remains elusive. Here we present the crystal structure of a complex of a cytidine deaminase with ssDNA bound in the active site at 2.2 Å. This structure not only visualizes the active site poised for catalysis of APOBEC3A, but pinpoints the residues that confer specificity towards CC/TC motifs. The APOBEC3A-ssDNA complex defines the 5'-3' directionality and subtle conformational changes that clench the ssDNA within the binding groove, revealing the architecture and mechanism of ssDNA recognition that is likely conserved among all polynucleotide deaminases, thereby opening the door for the design of mechanistic-based therapeutics.

  4. Residual DNA-bound proteins are a source of in vitro transcription inhibitor peptides

    International Nuclear Information System (INIS)

    Venanzi, F.M.

    1989-01-01

    Enzymatic breakdown of residual proteins occurs at mild alkaline pH (pH optimum 8.5) as monitored by using radioiodinated, purified genomic DNA from calf thymus. These DNA fibers also possess a differential ability to hydrolyze added exogenous small and linker histones. The results described argue strongly that a putative protease activity, co-purified with DNA, is the source of short chain peptides which inhibit transcription in vitro. Therefore, we propose that RNA repressor peptides must be of higher molecular weight than previously reported

  5. A DNA Structural Alphabet Distinguishes Structural Features of DNA Bound to Regulatory Proteins and in the Nucleosome Core Particle

    Czech Academy of Sciences Publication Activity Database

    Schneider, Bohdan; Bozikova, Paulina; Čech, P.; Svozil, D.; Černý, Jiří

    2017-01-01

    Roč. 8, č. 10 (2017), č. článku 278. ISSN 2073-4425 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0109 Grant - others:GA MŠk(CZ) EF16_013/0001777 Institutional support: RVO:86652036 Keywords : DNA * DNA-protein recognition * transcription factors Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Computer sciences, information science, bioinformathics (hardware development to be 2.2, social aspect to be 5.8) Impact factor: 3.600, year: 2016

  6. A Bulky Rhodium Complex Bound to an Adenosine-Adenosine DNA Mismatch: General Architecture of the Metalloinsertion Binding Mode†

    Science.gov (United States)

    Zeglis, Brian M.; Pierre, Valérie C.; Kaiser, Jens T.; Barton, Jacqueline K.

    2009-01-01

    Two crystal structures are determined for Δ-Rh(bpy)2(chrysi)3+ (chrysi = 5,6-chrysenequinone diimine) bound to the oligonucleotide duplex 5′-CGGAAATTACCG-3′ containing two adenosine-adenosine mismatches (italics) through metalloinsertion. Diffraction quality crystals with two different space groups (P3221 and P43212) were obtained under very similar crystallization conditions. In both structures, the bulky rhodium complex inserts into the two mismatched sites from the minor groove side, ejecting the mismatched bases into the major groove. The conformational changes are localized to the mismatched site; the metal complex replaces the mismatched base pair without an increase in base pair rise. The expansive metal complex is accommodated in the duplex by a slight opening in the phosphodiester backbone; all sugars retain a C2′-endo puckering, and flanking base pairs neither stretch nor shear. The structures differ, however, in that in one of the structures, an additional metal complex is bound by intercalation from the major groove at the central 5′-AT-3′ step. We conclude that this additional metal complex is intercalated into this central step because of crystal packing forces. The structures described here of Δ-Rh(bpy)2(chrysi)3+ bound to thermodynamically destabilized AA mismatches share critical features with binding by metalloinsertion in two other oligonucleotides containing different single base mismatches. These results underscore the generality of the metalloinsertion as a new mode of non-covalent binding by small molecules with a DNA duplex. PMID:19374348

  7. Surface physicochemistry and ionic strength affects eDNA's role in bacterial adhesion to abiotic surfaces

    DEFF Research Database (Denmark)

    Regina, Viduthalai R.; Lokanathan, Arcot R.; Modrzynski, Jakub Jan

    2014-01-01

    Extracellular DNA (eDNA) is an important structural component of biofilms formed by many bacteria, but few reports have focused on its role in initial cell adhesion. The aim of this study was to investigate the role of eDNA in bacterial adhesion to abiotic surfaces, and determine to which extent ...

  8. Ancient microbes from halite fluid inclusions: optimized surface sterilization and DNA extraction.

    Directory of Open Access Journals (Sweden)

    Krithivasan Sankaranarayanan

    Full Text Available Fluid inclusions in evaporite minerals (halite, gypsum, etc. potentially preserve genetic records of microbial diversity and changing environmental conditions of Earth's hydrosphere for nearly one billion years. Here we describe a robust protocol for surface sterilization and retrieval of DNA from fluid inclusions in halite that, unlike previously published methods, guarantees removal of potentially contaminating surface-bound DNA. The protocol involves microscopic visualization of cell structures, deliberate surface contamination followed by surface sterilization with acid and bleach washes, and DNA extraction using Amicon centrifugal filters. Methods were verified on halite crystals of four different ages from Saline Valley, California (modern, 36 ka, 64 ka, and 150 ka, with retrieval of algal and archaeal DNA, and characterization of the algal community using ITS1 sequences. The protocol we developed opens up new avenues for study of ancient microbial ecosystems in fluid inclusions, understanding microbial evolution across geological time, and investigating the antiquity of life on earth and other parts of the solar system.

  9. Proton surface charge determination in Spodosol horizons with organically bound aluminum

    Science.gov (United States)

    Skyllberg, Ulf; Borggaard, Ole K.

    1998-05-01

    Net proton surface charge densities were determined in O, E, Bh, and Bs horizons of a sandy till, Spodosol from Denmark, by means of acid-base titration combined with ion adsorption in 0.005 M Ca(NO 3) 2 and independent permanent charge determination. The release of organic anions exceeded the adsorption of NO 3-, resulting in a desorption of anions in all horizons. Data were found to obey the law of balance between surface charges and adsorbed ions only when charges pertaining to Al and organic anions released during the titration experiments were accounted for, in addition to charges pertaining the potential determining ions (PDI) H + and OH - and the index ions Ca 2+ and NO 3-. It was furthermore shown that the point of zero net proton charge (PZNPC) in soils highly depends on the concentration of organically bound Al. Approaches previously used in soils, in which adsorbed Al n+ has been ignored (i.e., considered equivalent to nH + as a PDI), resulted in a PZNPC of 4.1 in the Bs horizon. If instead organically bound Al was accounted for as a counter-ion similar to 3/2Ca 2+, a PZNPC of 2.9 was obtained for the same Bs horizon. Based on PZNPC values estimated by the latter approach, combined with a weak-acid analog, it was shown that organic proton surface charges buffered pH with a similar intensity in the O, E, Bh, and Bs horizons of this study. Because the acidity of Al adsorbed to conjugate bases of soil organic acids is substantially weaker than the acidity of the corresponding protonated form of the organic acids, the point of zero net proton charge (PZNPC) will increase if the concentration of organically adsorbed Al increases at the expense of adsorbed H. This means that PZNPC values determined for soils with unknown concentrations of organically adsorbed Al are highly operational and not very meaningful as references.

  10. Cdc6-Induced Conformational Changes in ORC Bound to Origin DNA Revealed by Cryo-Electron Microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Sun J.; Li H.; Kawakami, H.; Zech, J.; Speck, C.; Stillman, B.

    2012-03-07

    The eukaryotic origin recognition complex (ORC) interacts with and remodels origins of DNA replication prior to initiation in S phase. Here, we report a single-particle cryo-EM-derived structure of the supramolecular assembly comprising Saccharomyces cerevisiae ORC, the replication initiation factor Cdc6, and double-stranded ARS1 origin DNA in the presence of ATP{gamma}S. The six subunits of ORC are arranged as Orc1:Orc4:Orc5:Orc2:Orc3, with Orc6 binding to Orc2. Cdc6 binding changes the conformation of ORC, in particular reorienting the Orc1 N-terminal BAH domain. Segmentation of the 3D map of ORC-Cdc6 on DNA and docking with the crystal structure of the homologous archaeal Orc1/Cdc6 protein suggest an origin DNA binding model in which the DNA tracks along the interior surface of the crescent-like ORC. Thus, ORC bends and wraps the DNA. This model is consistent with the observation that binding of a single Cdc6 extends the ORC footprint on origin DNA from both ends.

  11. Controlling the surface density of DNA on gold by electrically induced desorption.

    Science.gov (United States)

    Arinaga, Kenji; Rant, Ulrich; Knezević, Jelena; Pringsheim, Erika; Tornow, Marc; Fujita, Shozo; Abstreiter, Gerhard; Yokoyama, Naoki

    2007-10-31

    We report on a method to control the packing density of sulfur-bound oligonucleotide layers on metal electrodes by electrical means. In a first step, a dense nucleic acid layer is deposited by self-assembly from solution; in a second step, defined fractions of DNA molecules are released from the surface by applying a series of negative voltage cycles. Systematic investigations of the influence of the applied electrode potentials and oligonucleotide length allow us to identify a sharp desorption onset at -0.65 V versus Ag/AgCl, which is independent of the DNA length. Moreover, our results clearly show the pronounced influence of competitive adsorbents in solution on the desorption behavior, which can prevent the re-adsorption of released DNA molecules, thereby enhancing the desorption efficiency. The method is fully bio-compatible and can be employed to improve the functionality of DNA layers. This is demonstrated in hybridization experiments revealing almost perfect yields for electrically "diluted" DNA layers. The proposed control method is extremely beneficial to the field of DNA-based sensors.

  12. Label-free quantitative proteome analysis of the surface-bound salivary pellicle.

    Science.gov (United States)

    Delius, Judith; Trautmann, Simone; Médard, Guillaume; Kuster, Bernhard; Hannig, Matthias; Hofmann, Thomas

    2017-04-01

    The salivary pellicle, covering natural as well as restored tooth surfaces in the oral cavity as an immobilized protein-rich layer, acts as an important physico-chemical and biological mediator at the tooth-saliva-interface. For the first time, the pellicle's proteome of individual volunteers were analyzed separately on three consecutive days and the relative protein abundance determined by a label-free quantitative nano-LC-MS/MS approach. A total of 72 major proteins were identified in the initial pellicles formed intraorally on dental ceramic specimens already after 3min with high inter-individual and inter-day consistency. In comparison, significant differences in protein abundance were evident between subjects, thus indicating unique individual pellicle profiles. Furthermore, the relative protein abundance in pellicles was compared to the proteome pattern in the corresponding saliva samples of the same individuals to provide first data on significantly enriched and depleted salivary proteins (p <0.05) within the surface-bound salivary pellicle. Our findings reveal the initial adsorption of salivary proteins at the solid-liquid interface to be a rapid, highly selective, and reproducible process leading to the immobilization of a broad range of protective proteins and enzymes on the substratum surface within a few minutes. This provides evidence that the pellicle layer might be physiologically functional even without further maturation. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Stalled RNAP-II molecules bound to non-coding rDNA spacers are required for normal nucleolus architecture.

    Science.gov (United States)

    Freire-Picos, M A; Landeira-Ameijeiras, V; Mayán, María D

    2013-07-01

    The correct distribution of nuclear domains is critical for the maintenance of normal cellular processes such as transcription and replication, which are regulated depending on their location and surroundings. The most well-characterized nuclear domain, the nucleolus, is essential for cell survival and metabolism. Alterations in nucleolar structure affect nuclear dynamics; however, how the nucleolus and the rest of the nuclear domains are interconnected is largely unknown. In this report, we demonstrate that RNAP-II is vital for the maintenance of the typical crescent-shaped structure of the nucleolar rDNA repeats and rRNA transcription. When stalled RNAP-II molecules are not bound to the chromatin, the nucleolus loses its typical crescent-shaped structure. However, the RNAP-II interaction with Seh1p, or cryptic transcription by RNAP-II, is not critical for morphological changes. Copyright © 2013 John Wiley & Sons, Ltd.

  14. Surface Andreev Bound States and Odd-Frequency Pairing in Topological Superconductor Junctions

    Science.gov (United States)

    Tanaka, Yukio; Tamura, Shun

    2018-04-01

    In this review, we summarize the achievement of the physics of surface Andreev bound states (SABS) up to now. The route of this activity has started from the physics of SABS of unconventional superconductors where the pair potential has a sign change on the Fermi surface. It has been established that SABS can be regarded as a topological edge state with topological invariant defined in the bulk Hamiltonian. On the other hand, SABS accompanies odd-frequency pairing like spin-triplet s-wave or spin-singlet p-wave. In a spin-triplet superconductor junction, induced odd-frequency pairing can penetrate into a diffusive normal metal (DN) attached to the superconductor. It causes so called anomalous proximity effect where the local density of states of quasiparticle in DN has a zero energy peak. When bulk pairing symmetry is spin-triplet px-wave, the anomalous proximity effect becomes prominent and the zero bias voltage conductance is always quantized independent of the resistance in DN and interface. Finally, we show that the present anomalous proximity effect is realized in an artificial topological superconducting system, where a nanowire with spin-orbit coupling and Zeeman field is put on the conventional spin-singlet s-wave superconductor.

  15. Surface-bound phosphatase activity in living hyphae of ectomycorrhizal fungi of Nothofagus obliqua.

    Science.gov (United States)

    Alvarez, Maricel; Godoy, Roberto; Heyser, Wolfgang; Härtel, Steffen

    2004-01-01

    We determined the location and the activity of surface-bound phosphomonoesterase (SBP) of five ectomycorrhizal (EM) fungi of Nothofagus oblique. EM fungal mycelium of Paxillus involutus, Austropaxillus boletinoides, Descolea antartica, Cenococcum geophilum and Pisolithus tinctorius was grown in media with varying concentrations of dissolved phosphorus. SBP activity was detected at different pH values (3-7) under each growth regimen. SBP activity was assessed using a colorimetric method based on the hydrolysis of p-nitrophenyl phosphate (pNPP) to p-nitrophenol phosphate (pNP) + P. A new technique involving confocal laser-scanning microscopy (LSM) was used to locate and quantify SBP activity on the hyphal surface. EM fungi showed two fundamentally different patterns of SBP activity in relation to varying environmental conditions (P-concentrations and pH). In the cases of D. antartica, A. boletinoides and C. geophilum, changes in SBP activity were induced primarily by changes in the number of SBP-active centers on the hyphae. In the cases of P. tinctorius and P. involutus, the number of SBP-active centers per μm hyphal length changed much less than the intensity of the SBP-active centers on the hyphae. Our findings not only contribute to the discussion about the role of SBP-active centers in EM fungi but also introduce LSM as a valuable method for studying EM fungi.

  16. Architectural elements and bounding surfaces in fluvial deposits: anatomy of the Kayenta formation (lower jurassic), Southwest Colorado

    Science.gov (United States)

    Miall, Andrew D.

    1988-03-01

    Three well-exposed outcrops in the Kayenta Formation (Lower Jurassic), near Dove Creek in southwestern Colorado, were studied using lateral profiles, in order to test recent regarding architectural-element analysis and the classification and interpretation of internal bounding surfaces. Examination of bounding surfaces within and between elements in the Kayenta outcrops raises problems in applying the three-fold classification of Allen (1983). Enlarging this classification to a six-fold hierarchy permits the discrimination of surfaces intermediate between Allen's second- and third-order types, corresponding to the upper bounding surfaces of macroforms, and internal erosional "reactivation" surfaces within the macroforms. Examples of the first five types of surface occur in the Kayenta outcrops at Dove Creek. The new classifications is offered as a general solution to the problem of description of complex, three-dimensional fluvial sandstone bodies. The Kayenta Formation at Dove Creek consists of a multistorey sandstone body, including the deposits of lateral- and downstream-accreted macroforms. The storeys show no internal cyclicity, neither within individual elements nor through the overall vertical thickness of the formation. Low paleocurrent variance indicates low sinuosity flow, whereas macroform geometry and orientation suggest low to moderate sinuosity. The many internal minor erosion surfaces draped with mud and followed by intraclast breccias imply frequent rapid stage fluctuation, consistent with variable (seasonal? monsonal? ephemmeral?) flow. The results suggest a fluvial architecture similar to that of the South Saskatchewan River, through with a three-dimensional geometry unlike that interpreted from surface studies of that river.

  17. Surface plasmon polaritons in a semi-bounded degenerate plasma: Role of spatial dispersion and collisions

    International Nuclear Information System (INIS)

    Tyshetskiy, Yu.; Kompaneets, R.; Vladimirov, S. V.

    2012-01-01

    Surface plasmon polaritons (SPPs) in a semi-bounded degenerate plasma (e.g., a metal) are studied using the quasiclassical mean-field kinetic model, taking into account the spatial dispersion of the plasma (due to quantum degeneracy of electrons) and electron-ion (electron-lattice, for metals) collisions. SPP dispersion and damping are obtained in both retarded (ω/k z ∼c) and non-retarded (ω/k z ≪c) regions, as well as in between. It is shown that the plasma spatial dispersion significantly affects the properties of SPPs, especially at short wavelengths (less than the collisionless skin depth, λ ≲ c/ω pe ). Namely, the collisionless (Landau) damping of SPPs (due to spatial dispersion) is comparable to the purely collisional (Ohmic) damping (due to electron-lattice collisions) in a wide range of SPP wavelengths, e.g., from λ∼20 nm to λ∼0.8 nm for SPP in gold at T = 293 K and from λ∼400 nm to λ∼0.7 nm for SPPs in gold at T = 100 K. The spatial dispersion is also shown to affect, in a qualitative way, the dispersion of SPPs at short wavelengths λ ≲ c/ω pe .

  18. Protocol for quantitative tracing of surface water with synthetic DNA

    Science.gov (United States)

    Foppen, J. W.; Bogaard, T. A.

    2012-04-01

    Based on experiments we carried out in 2010 with various synthetic single stranded DNA markers with a size of 80 nucleotides (ssDNA; Foppen et al., 2011), we concluded that ssDNA can be used to carry out spatially distributed multi-tracer experiments in the environment. Main advantages are in principle unlimited amount of tracers, environmental friendly and tracer recovery at very high dilution rates (detection limit is very low). However, when ssDNA was injected in headwater streams, we found that at selected downstream locations, the total mass recovery was less than 100%. The exact reason for low mass recovery was unknown. In order to start identifying the cause of the loss of mass in these surface waters, and to increase our knowledge of the behaviour of synthetic ssDNA in the environment, we examined the effect of laboratory and field protocols working with artificial DNA by performing numerous batch experiments. Then, we carried out several field tests in different headwater streams in the Netherlands and in Luxembourg. The laboratory experiments consisted of a batch of water in a vessel with in the order of 10^10 ssDNA molecules injected into the batch. The total duration of each experiment was 10 hour, and, at regular time intervals, 100 µl samples were collected in a 1.5 ml Eppendorf vial for qPCR analyses. The waters we used ranged from milliQ water to river water with an Electrical Conductivity of around 400 μS/cm. The batch experiments were performed in different vessel types: polyethylene bottles, polypropylene copolymer bottles , and glass bottles. In addition, two filter types were tested: 1 µm pore size glass fibre filters and 0.2 µm pore size cellulose acetate filters. Lastly, stream bed sediment was added to the batch experiments to quantify interaction of the DNA with sediment. For each field experiment around 10^15 ssDNA molecules were injected, and water samples were collected 100 - 600 m downstream of the point of injection. Additionally

  19. Functions that Protect Escherichia coli from Tightly Bound DNA-Protein Complexes Created by Mutant EcoRII Methyltransferase.

    Science.gov (United States)

    Henderson, Morgan L; Kreuzer, Kenneth N

    2015-01-01

    Expression of mutant EcoRII methyltransferase protein (M.EcoRII-C186A) in Escherichia coli leads to tightly bound DNA-protein complexes (TBCs), located sporadically on the chromosome rather than in tandem arrays. The mechanisms behind the lethality induced by such sporadic TBCs are not well studied, nor is it clear whether very tight binding but non-covalent complexes are processed in the same way as covalent DNA-protein crosslinks (DPCs). Using 2D gel electrophoresis, we found that TBCs induced by M.EcoRII-C186A block replication forks in vivo. Specific bubble molecules were detected as spots on the 2D gel, only when M.EcoRII-C186A was induced, and a mutation that eliminates a specific EcoRII methylation site led to disappearance of the corresponding spot. We also performed a candidate gene screen for mutants that are hypersensitive to TBCs induced by M.EcoRII-C186A. We found several gene products necessary for protection against these TBCs that are known to also protect against DPCs induced with wild-type M.EcoRII (after 5-azacytidine incorporation): RecA, RecBC, RecG, RuvABC, UvrD, FtsK, XerCD and SsrA (tmRNA). In contrast, the RecFOR pathway and Rep helicase are needed for protection against TBCs but not DPCs induced by M.EcoRII. We propose that stalled fork processing by RecFOR and RecA promotes release of tightly bound (but non-covalent) blocking proteins, perhaps by licensing Rep helicase-driven dissociation of the blocking M.EcoRII-C186A. Our studies also argued against the involvement of several proteins that might be expected to protect against TBCs. We took the opportunity to directly compare the sensitivity of all tested mutants to two quinolone antibiotics, which target bacterial type II topoisomerases and induce a unique form of DPC. We uncovered rep, ftsK and xerCD as novel quinolone hypersensitive mutants, and also obtained evidence against the involvement of a number of functions that might be expected to protect against quinolones.

  20. Functions that Protect Escherichia coli from Tightly Bound DNA-Protein Complexes Created by Mutant EcoRII Methyltransferase.

    Directory of Open Access Journals (Sweden)

    Morgan L Henderson

    Full Text Available Expression of mutant EcoRII methyltransferase protein (M.EcoRII-C186A in Escherichia coli leads to tightly bound DNA-protein complexes (TBCs, located sporadically on the chromosome rather than in tandem arrays. The mechanisms behind the lethality induced by such sporadic TBCs are not well studied, nor is it clear whether very tight binding but non-covalent complexes are processed in the same way as covalent DNA-protein crosslinks (DPCs. Using 2D gel electrophoresis, we found that TBCs induced by M.EcoRII-C186A block replication forks in vivo. Specific bubble molecules were detected as spots on the 2D gel, only when M.EcoRII-C186A was induced, and a mutation that eliminates a specific EcoRII methylation site led to disappearance of the corresponding spot. We also performed a candidate gene screen for mutants that are hypersensitive to TBCs induced by M.EcoRII-C186A. We found several gene products necessary for protection against these TBCs that are known to also protect against DPCs induced with wild-type M.EcoRII (after 5-azacytidine incorporation: RecA, RecBC, RecG, RuvABC, UvrD, FtsK, XerCD and SsrA (tmRNA. In contrast, the RecFOR pathway and Rep helicase are needed for protection against TBCs but not DPCs induced by M.EcoRII. We propose that stalled fork processing by RecFOR and RecA promotes release of tightly bound (but non-covalent blocking proteins, perhaps by licensing Rep helicase-driven dissociation of the blocking M.EcoRII-C186A. Our studies also argued against the involvement of several proteins that might be expected to protect against TBCs. We took the opportunity to directly compare the sensitivity of all tested mutants to two quinolone antibiotics, which target bacterial type II topoisomerases and induce a unique form of DPC. We uncovered rep, ftsK and xerCD as novel quinolone hypersensitive mutants, and also obtained evidence against the involvement of a number of functions that might be expected to protect against quinolones.

  1. A stochastic DNA walker that traverses a microparticle surface

    Science.gov (United States)

    Jung, C.; Allen, P. B.; Ellington, A. D.

    2016-02-01

    Molecular machines have previously been designed that are propelled by DNAzymes, protein enzymes and strand displacement. These engineered machines typically move along precisely defined one- and two-dimensional tracks. Here, we report a DNA walker that uses hybridization to drive walking on DNA-coated microparticle surfaces. Through purely DNA:DNA hybridization reactions, the nanoscale movements of the walker can lead to the generation of a single-stranded product and the subsequent immobilization of fluorescent labels on the microparticle surface. This suggests that the system could be of use in analytical and diagnostic applications, similar to how strand exchange reactions in solution have been used for transducing and quantifying signals from isothermal molecular amplification assays. The walking behaviour is robust and the walker can take more than 30 continuous steps. The traversal of an unprogrammed, inhomogeneous surface is also due entirely to autonomous decisions made by the walker, behaviour analogous to amorphous chemical reaction network computations, which have been shown to lead to pattern formation.

  2. Investigating the dynamics of surface-immobilized DNA nanomachines

    Science.gov (United States)

    Dunn, Katherine E.; Trefzer, Martin A.; Johnson, Steven; Tyrrell, Andy M.

    2016-07-01

    Surface-immobilization of molecules can have a profound influence on their structure, function and dynamics. Toehold-mediated strand displacement is often used in solution to drive synthetic nanomachines made from DNA, but the effects of surface-immobilization on the mechanism and kinetics of this reaction have not yet been fully elucidated. Here we show that the kinetics of strand displacement in surface-immobilized nanomachines are significantly different to those of the solution phase reaction, and we attribute this to the effects of intermolecular interactions within the DNA layer. We demonstrate that the dynamics of strand displacement can be manipulated by changing strand length, concentration and G/C content. By inserting mismatched bases it is also possible to tune the rates of the constituent displacement processes (toehold-binding and branch migration) independently, and information can be encoded in the time-dependence of the overall reaction. Our findings will facilitate the rational design of surface-immobilized dynamic DNA nanomachines, including computing devices and track-based motors.

  3. Solid surface vs. liquid surface: nanoarchitectonics, molecular machines, and DNA origami.

    Science.gov (United States)

    Ariga, Katsuhiko; Mori, Taizo; Nakanishi, Waka; Hill, Jonathan P

    2017-09-13

    The investigation of molecules and materials at interfaces is critical for the accumulation of new scientific insights and technological advances in the chemical and physical sciences. Immobilization on solid surfaces permits the investigation of different properties of functional molecules or materials with high sensitivity and high spatial resolution. Liquid surfaces also present important media for physicochemical innovation and insight based on their great flexibility and dynamicity, rapid diffusion of molecular components for mixing and rearrangements, as well as drastic spatial variation in the prevailing dielectric environment. Therefore, a comparative discussion of the relative merits of the properties of materials when positioned at solid or liquid surfaces would be informative regarding present-to-future developments of surface-based technologies. In this perspective article, recent research examples of nanoarchitectonics, molecular machines, DNA nanotechnology, and DNA origami are compared with respect to the type of surface used, i.e. solid surfaces vs. liquid surfaces, for future perspectives of interfacial physics and chemistry.

  4. Facile and rapid DNA extraction and purification from food matrices using IFAST (immiscible filtration assisted by surface tension).

    Science.gov (United States)

    Strotman, Lindsay N; Lin, Guangyun; Berry, Scott M; Johnson, Eric A; Beebe, David J

    2012-09-07

    Extraction and purification of DNA is a prerequisite to detection and analytical techniques. While DNA sample preparation methods have improved over the last few decades, current methods are still time consuming and labor intensive. Here we demonstrate a technology termed IFAST (Immiscible Filtration Assisted by Surface Tension), that relies on immiscible phase filtration to reduce the time and effort required to purify DNA. IFAST replaces the multiple wash and centrifugation steps required by traditional DNA sample preparation methods with a single step. To operate, DNA from lysed cells is bound to paramagnetic particles (PMPs) and drawn through an immiscible fluid phase barrier (i.e. oil) by an external handheld magnet. Purified DNA is then eluted from the PMPs. Here, detection of Clostridium botulinum type A (BoNT/A) in food matrices (milk, orange juice), a bioterrorism concern, was used as a model system to establish IFAST's utility in detection assays. Data validated that the DNA purified by IFAST was functional as a qPCR template to amplify the bont/A gene. The sensitivity limit of IFAST was comparable to the commercially available Invitrogen ChargeSwitch® method. Notably, pathogen detection via IFAST required only 8.5 μL of sample and was accomplished in five-fold less time. The simplicity, rapidity and portability of IFAST offer significant advantages when compared to existing DNA sample preparation methods.

  5. Trans and surface membrane bound zervamicin IIB: 13C-MAOSS-NMR at high spinning speed

    International Nuclear Information System (INIS)

    Raap, J.; Hollander, J.; Ovchinnikova, T. V.; Swischeva, N. V.; Skladnev, D.; Kiihne, S.

    2006-01-01

    Interactions between 15 N-labelled peptides or proteins and lipids can be investigated using membranes aligned on a thin polymer film, which is rolled into a cylinder and inserted into the MAS-NMR rotor. This can be spun at high speed, which is often useful at high field strengths. Unfortunately, substrate films like commercially available polycarbonate or PEEK produce severe overlap with peptide and protein signals in 13 C-MAOSS NMR spectra. We show that a simple house hold foil support allows clear observation of the carbonyl, aromatic and C α signals of peptides and proteins as well as the ester carbonyl and choline signals of phosphocholine lipids. The utility of the new substrate is validated in applications to the membrane active peptide zervamicin IIB. The stability and macroscopic ordering of thin PC10 bilayers was compared with that of thicker POPC bilayers, both supported on the household foil. Sidebands in the 31 P-spectra showed a high degree of alignment of both the supported POPC and PC10 lipid molecules. Compared with POPC, the PC10 lipids are slightly more disordered, most likely due to the increased mobilities of the shorter lipid molecules. This mobility prevents PC10 from forming stable vesicles for MAS studies. The 13 C-peptide peaks were selectively detected in a 13 C-detected 1 H-spin diffusion experiment. Qualitative analysis of build-up curves obtained for different mixing times allowed the transmembrane peptide in PC10 to be distinguished from the surface bound topology in POPC. The 13 C-MAOSS results thus independently confirms previous findings from 15 N spectroscopy [Bechinger, B., Skladnev, D.A., Ogrel, A., Li, X., Rogozhkina, E.V., Ovchinnikova, T.V., O'Neil, J.D.J. and Raap, J. (2001) Biochemistry, 40, 9428-9437]. In summary, application of house hold foil opens the possibility of measuring high resolution 13 C-NMR spectra of peptides and proteins in well ordered membranes, which are required to determine the secondary and

  6. Nanoshaving and Nanografting of Water Soluble Polymers on Glass and Silicon Dioxide Surfaces with Applications to DNA Localization

    Science.gov (United States)

    Davis, Brian; Conley, Hiram; Ochoa, Rosie; Hurd, Katie; Linford, Matthew R.; Davis, Robert C.

    2008-10-01

    Chemical surface patterning at the nanoscale is a critical component of chemically directed assembly of nanoscale devices or sensitive biological molecules onto surfaces. Here we present a scanning probe lithography technique that allows for patterning of aqueous polymers on glass or silicon dioxide surfaces. The surfaces were functionalized by covalently bonding a silane monolayer with a known surface charge to either a glass slide or a silicon wafer. A polymer layer less then 2 nm in thickness was electrostatically bound to the silane layer, passivating the functionalized surface. An Atomic Force Microscope (AFM) probe was used to remove a portion of the polymer layer, exposing the functional silane layer underneath. Employing this method we made chemically active submicron regions. These regions were backfilled with a fluorescent polymer and Lambda-DNA. Chemical differentiation was verified through tapping mode AFM and optical fluorescent microscopy. Lines with a pitch as small as 20nm were observed with AFM height and phase mode data.

  7. Surface-assisted DNA self-assembly: An enzyme-free strategy towards formation of branched DNA lattice

    International Nuclear Information System (INIS)

    Bhanjadeo, Madhabi M.; Nayak, Ashok K.; Subudhi, Umakanta

    2017-01-01

    DNA based self-assembled nanostructures and DNA origami has proven useful for organizing nanomaterials with firm precision. However, for advanced applications like nanoelectronics and photonics, large-scale organization of self-assembled branched DNA (bDNA) into periodic lattices is desired. In this communication for the first time we report a facile method of self-assembly of Y-shaped bDNA nanostructures on the cationic surface of Aluminum (Al) foil to prepare periodic two dimensional (2D) bDNA lattice. Particularly those Y-shaped bDNA structures having smaller overhangs and unable to self-assemble in solution, they are easily assembled on the surface of Al foil in the absence of ligase. Field emission scanning electron microscopy (FESEM) analysis shows homogenous distribution of two-dimensional bDNA lattices across the Al foil. When the assembled bDNA structures were recovered from the Al foil and electrophoresed in nPAGE only higher order polymeric bDNA structures were observed without a trace of monomeric structures which confirms the stability and high yield of the bDNA lattices. Therefore, this enzyme-free economic and efficient strategy for developing bDNA lattices can be utilized in assembling various nanomaterials for functional molecular components towards development of DNA based self-assembled nanodevices. - Highlights: • Al foil surface-assisted self-assembly of monomeric structures into larger branched DNA lattice. • FESEM study confirms the uniform distribution of two-dimensional bDNA lattice structures across the surface of Al foil. • Enzyme-free and economic strategy to prepare higher order structures from simpler DNA nanostructures have been confirmed by recovery assay. • Use of well proven sequences for the preparation of pure Y-shaped monomeric DNA nanostructure with high yield.

  8. DNA immobilization and detection on cellulose paper using a surface grown cationic polymer via ATRP.

    Science.gov (United States)

    Aied, Ahmed; Zheng, Yu; Pandit, Abhay; Wang, Wenxin

    2012-02-01

    Cationic polymers with various structures have been widely investigated in the areas of medical diagnostics and molecular biology because of their unique binding properties and capability to interact with biological molecules in complex biological environments. In this work, we report the grafting of a linear cationic polymer from an atom transfer radical polymerization (ATRP) initiator bound to cellulose paper surface. We show successful binding of ATRP initiator onto cellulose paper and grafting of polymer chains from the immobilized initiator with ATRP. The cellulose paper grafted polymer was used in combination with PicoGreen (PG) to demonstrate detection of nucleic acids in the nanogram range in homogeneous solution and in a biological sample (serum). The results showed specific identification of hybridized DNA after addition of PG in both solutions.

  9. Surface plasmon resonance imaging reveals multiple binding modes of Agrobacterium transformation mediator VirE2 to ssDNA.

    Science.gov (United States)

    Kim, Sanghyun; Zbaida, David; Elbaum, Michael; Leh, Hervé; Nogues, Claude; Buckle, Malcolm

    2015-07-27

    VirE2 is the major secreted protein of Agrobacterium tumefaciens in its genetic transformation of plant hosts. It is co-expressed with a small acidic chaperone VirE1, which prevents VirE2 oligomerization. After secretion into the host cell, VirE2 serves functions similar to a viral capsid in protecting the single-stranded transferred DNA en route to the nucleus. Binding of VirE2 to ssDNA is strongly cooperative and depends moreover on protein-protein interactions. In order to isolate the protein-DNA interactions, imaging surface plasmon resonance (SPRi) studies were conducted using surface-immobilized DNA substrates of length comparable to the protein-binding footprint. Binding curves revealed an important influence of substrate rigidity with a notable preference for poly-T sequences and absence of binding to both poly-A and double-stranded DNA fragments. Dissociation at high salt concentration confirmed the electrostatic nature of the interaction. VirE1-VirE2 heterodimers also bound to ssDNA, though by a different mechanism that was insensitive to high salt. Neither VirE2 nor VirE1-VirE2 followed the Langmuir isotherm expected for reversible monomeric binding. The differences reflect the cooperative self-interactions of VirE2 that are suppressed by VirE1. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Simple surface modification of poly(dimethylsiloxane) for DNA hybridization

    Science.gov (United States)

    Zhou, Jinwen; Voelcker, Nicolas H.; Ellis, Amanda V.

    2010-01-01

    Here, we present a simple chemical modification of poly(dimethylsiloxane) (PDMS) by curing a mixture of 2 wt% undecylenic acid (UDA) in PDMS prepolymer on a gold-coated glass slide. This gold slide had been previously pretreated with a self-assembled hydrophilic monolayer of 3-mercaptopropionic acid (MPA). During curing of the UDA∕PDMS prepolymer, the hydrophilic UDA carboxyl moieties diffuses toward the hydrophilic MPA carboxyl moieties on the gold surface. This diffusion of the UDA within the PDMS prepolymer to the surface is a direct result of surface energy minimization. Once completely cured, the PDMS is peeled off the gold substrate, thereby exposing the interfacial carboxyl groups. These groups are then available for subsequent attachment of 5′-amino terminated DNA oligonucleotides via amide linkages. Our results show that the covalently tethered oligonucleotides can successfully capture fluorescein-labeled complementary oligonucleotides via hybridization, which are visualized using fluorescence microscopy. PMID:21264061

  11. High Efficiency Acetylcholinesterase Immobilization on DNA Aptamer Modified Surfaces

    Directory of Open Access Journals (Sweden)

    Orada Chumphukam

    2014-04-01

    Full Text Available We report here the in vitro selection of DNA aptamers for electric eel acetylcholinesterase (AChE. One selected aptamer sequence (R15/19 has a high affinity towards the enzyme (Kd = 157 ± 42 pM. Characterization of the aptamer showed its binding is not affected by low ionic strength (~20 mM, however significant reduction in affinity occurred at high ionic strength (~1.2 M. In addition, this aptamer does not inhibit the catalytic activity of AChE that we exploit through immobilization of the DNA on a streptavidin-coated surface. Subsequent immobilization of AChE by the aptamer results in a 4-fold higher catalytic activity when compared to adsorption directly on to plastic.

  12. Comparisons of predicted steady-state levels in rooms with extended- and local-reaction bounding surfaces

    Science.gov (United States)

    Hodgson, Murray; Wareing, Andrew

    2008-01-01

    A combined beam-tracing and transfer-matrix model for predicting steady-state sound-pressure levels in rooms with multilayer bounding surfaces was used to compare the effect of extended- and local-reaction surfaces, and the accuracy of the local-reaction approximation. Three rooms—an office, a corridor and a workshop—with one or more multilayer test surfaces were considered. The test surfaces were a single-glass panel, a double-drywall panel, a carpeted floor, a suspended-acoustical ceiling, a double-steel panel, and glass fibre on a hard backing. Each test surface was modeled as of extended or of local reaction. Sound-pressure levels were predicted and compared to determine the significance of the surface-reaction assumption. The main conclusions were that the difference between modeling a room surface as of extended or of local reaction is not significant when the surface is a single plate or a single layer of material (solid or porous) with a hard backing. The difference is significant when the surface consists of multilayers of solid or porous material and includes a layer of fluid with a large thickness relative to the other layers. The results are partially explained by considering the surface-reflection coefficients at the first-reflection angles.

  13. An AP endonuclease 1-DNA polymerase beta complex: theoretical prediction of interacting surfaces.

    Directory of Open Access Journals (Sweden)

    Alexej Abyzov

    2008-04-01

    Full Text Available Abasic (AP sites in DNA arise through both endogenous and exogenous mechanisms. Since AP sites can prevent replication and transcription, the cell contains systems for their identification and repair. AP endonuclease (APEX1 cleaves the phosphodiester backbone 5' to the AP site. The cleavage, a key step in the base excision repair pathway, is followed by nucleotide insertion and removal of the downstream deoxyribose moiety, performed most often by DNA polymerase beta (pol-beta. While yeast two-hybrid studies and electrophoretic mobility shift assays provide evidence for interaction of APEX1 and pol-beta, the specifics remain obscure. We describe a theoretical study designed to predict detailed interacting surfaces between APEX1 and pol-beta based on published co-crystal structures of each enzyme bound to DNA. Several potentially interacting complexes were identified by sliding the protein molecules along DNA: two with pol-beta located downstream of APEX1 (3' to the damaged site and three with pol-beta located upstream of APEX1 (5' to the damaged site. Molecular dynamics (MD simulations, ensuring geometrical complementarity of interfaces, enabled us to predict interacting residues and calculate binding energies, which in two cases were sufficient (approximately -10.0 kcal/mol to form a stable complex and in one case a weakly interacting complex. Analysis of interface behavior during MD simulation and visual inspection of interfaces allowed us to conclude that complexes with pol-beta at the 3'-side of APEX1 are those most likely to occur in vivo. Additional multiple sequence analyses of APEX1 and pol-beta in related organisms identified a set of correlated mutations of specific residues at the predicted interfaces. Based on these results, we propose that pol-beta in the open or closed conformation interacts and makes a stable interface with APEX1 bound to a cleaved abasic site on the 3' side. The method described here can be used for analysis in

  14. DNA adsorption and desorption on mica surface studied by atomic force microscopy

    International Nuclear Information System (INIS)

    Sun Lanlan; Zhao Dongxu; Zhang Yue; Xu Fugang; Li Zhuang

    2011-01-01

    The adsorption of DNA molecules on mica surface and the following desorption of DNA molecules at ethanol-mica interface were studied using atomic force microscopy. By changing DNA concentration, different morphologies on mica surface have been observed. A very uniform and orderly monolayer of DNA molecules was constructed on the mica surface with a DNA concentration of 30 ng/μL. When the samples were immersed into ethanol for about 15 min, various desorption degree of DNA from mica (0-99%) was achieved. It was found that with the increase of DNA concentration, the desorption degree of DNA from the mica at ethanol-mica interface decreased. And when the uniform and orderly DNA monolayers were formed on the mica surface, almost no DNA molecule desorbed from the mica surface in this process. The results indicated that the uniform and orderly DNA monolayer is one of the most stable DNA structures formed on the mica surface. In addition, we have studied the structure change of DNA molecules after desorbed from the mica surface with atomic force microscopy, and found that the desorption might be ascribed to the ethanol-induced DNA condensation.

  15. DNA adsorption and desorption on mica surface studied by atomic force microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Sun Lanlan [State Key Laboratory of Electroanalytical Chemistry, Changchun Institute of Applied Chemistry, Graduate school of the Chinese Academy of Sciences, Chinese Academy of Sciences, Renmin Street 5625, Changchun 130022 (China); Key Laboratory of Excited State Processes, Changchun Institute of Optics, Fine Mechanics and Physics, Chinese Academy of Sciences, 16 East Nan-Hu Road, Open Economic Zone, Changchun 130033 (China); Zhao Dongxu [Key Laboratory of Excited State Processes, Changchun Institute of Optics, Fine Mechanics and Physics, Chinese Academy of Sciences, 16 East Nan-Hu Road, Open Economic Zone, Changchun 130033 (China); Zhang Yue; Xu Fugang [State Key Laboratory of Electroanalytical Chemistry, Changchun Institute of Applied Chemistry, Graduate school of the Chinese Academy of Sciences, Chinese Academy of Sciences, Renmin Street 5625, Changchun 130022 (China); Li Zhuang, E-mail: zli@ciac.jl.cn [State Key Laboratory of Electroanalytical Chemistry, Changchun Institute of Applied Chemistry, Graduate school of the Chinese Academy of Sciences, Chinese Academy of Sciences, Renmin Street 5625, Changchun 130022 (China)

    2011-05-15

    The adsorption of DNA molecules on mica surface and the following desorption of DNA molecules at ethanol-mica interface were studied using atomic force microscopy. By changing DNA concentration, different morphologies on mica surface have been observed. A very uniform and orderly monolayer of DNA molecules was constructed on the mica surface with a DNA concentration of 30 ng/{mu}L. When the samples were immersed into ethanol for about 15 min, various desorption degree of DNA from mica (0-99%) was achieved. It was found that with the increase of DNA concentration, the desorption degree of DNA from the mica at ethanol-mica interface decreased. And when the uniform and orderly DNA monolayers were formed on the mica surface, almost no DNA molecule desorbed from the mica surface in this process. The results indicated that the uniform and orderly DNA monolayer is one of the most stable DNA structures formed on the mica surface. In addition, we have studied the structure change of DNA molecules after desorbed from the mica surface with atomic force microscopy, and found that the desorption might be ascribed to the ethanol-induced DNA condensation.

  16. The interaction of MnH(X 7Sigma+) with He: ab initio potential energy surface and bound states.

    Science.gov (United States)

    Turpin, Florence; Halvick, Philippe; Stoecklin, Thierry

    2010-06-07

    The potential energy surface of the ground state of the He-MnH(X (7)Sigma(+)) van der Waals complex is presented. Within the supermolecular approach of intermolecular energy calculations, a grid of ab initio points was computed at the multireference configuration interaction level using the aug-cc-pVQZ basis set for helium and hydrogen and the relativistic aug-cc-pVQZ-DK basis set for manganese. The potential energy surface was then fitted to a global analytical form which main features are discussed. As a first application of this potential energy surface, we present accurate calculations of bound energy levels of the (3)He-MnH and (4)He-MnH complexes.

  17. The interaction of MnH(X 7Σ+) with He: Ab initio potential energy surface and bound states

    Science.gov (United States)

    Turpin, Florence; Halvick, Philippe; Stoecklin, Thierry

    2010-06-01

    The potential energy surface of the ground state of the He-MnH(X Σ7+) van der Waals complex is presented. Within the supermolecular approach of intermolecular energy calculations, a grid of ab initio points was computed at the multireference configuration interaction level using the aug-cc-pVQZ basis set for helium and hydrogen and the relativistic aug-cc-pVQZ-DK basis set for manganese. The potential energy surface was then fitted to a global analytical form which main features are discussed. As a first application of this potential energy surface, we present accurate calculations of bound energy levels of the H3e-MnH and H4e-MnH complexes.

  18. Study on the bound water of several high specific surface-area oxides (beryllia, alumina, silica-alumina)

    International Nuclear Information System (INIS)

    Rouquerol, J.

    1964-11-01

    This study is concerned with the bound water of several oxides (beryllia, alumina, silica-alumina) at different steps of their dehydration (heating temperatures between 150 and 1100 deg. C). The following techniques have been used simultaneously: Thermal analysis (a new method has been developed), nitrogen adsorption (study of the texture), Diborane hydrolysis (qualitative and quantitative analysis of surface water), Infra-red spectrography (in the absorption range of water), Nuclear magnetic resonance (in the resonance range of protons). Thanks to these different techniques, five kinds of bound water have been observed. Attention is called on the great influence of the thermal treatment conditions on the evolution of the products resulting from the decomposition of alumina α-trihydrate Al(OH) 3 and beryllium α-hydroxide, in the course of the dehydration. Moreover, the author emphasizes the peculiar properties of the two kinds of oxides (alumina and beryllia) prepared through a new method of treatment under low pressure and constant speed of decomposition. Such particular features concern mainly texture, bound water, and consequently, also catalytic activity. (author) [fr

  19. Silica-bound copper(II)triazacyclononane as a phosphate esterase: effect of linker length and surface hydrophobicity.

    Science.gov (United States)

    Bodsgard, Brett R; Clark, Robert W; Ehrbar, Anthony W; Burstyn, Judith N

    2009-04-07

    A series of silica-bound Cu(ii) triazacyclononane materials was prepared to study the effect of linker length and surface hydrophobicity on the hydrolysis of phosphate esters. The general synthetic approach for these heterogeneous reagents was rhodium-catalyzed hydrosilation between an alkenyl-modified triazacyclononane and hydride-modified silica followed by metallation with a Cu(ii) salt. Elemental analysis confirmed that organic functionalization of the silica gel was successful and provided an estimate of the surface concentration of triazacyclononane. EPR spectra were consistent with square pyramidal Cu(ii), indicating that Cu(ii) ions were bound to the immobilized macrocycles. The hydrolytic efficacies of these heterogeneous reagents were tested with bis(p-nitrophenyl)phosphate (BNPP) and diethyl 4-nitrophenyl phosphate (paraoxon). The agent that performed best was an octyl-linked, propanol-blocked material. This material had the most hydrophilic surface and the most accessible active site, achieving a rate maximum on par with the other materials, but in fewer cycles and without an induction period.

  20. Limitations in the use of low pH extraction to distinguish internalized from cell surface-bound radiolabeled antibody

    International Nuclear Information System (INIS)

    Ong, Gaik Lin; Mattes, M. Jules

    2000-01-01

    Internalization by cells of radiolabeled protein ligands bound to the cell surface is frequently analyzed by extraction of the cells with low pH buffers. This treatment supposedly strips the ligands from the cell surface, and remaining molecules are considered to be internalized. However, we show herein that: (1) low molecular weight catabolic products that are trapped within lysosomes (residualizing radiolabels) are efficiently extracted by low pH buffers, under the same conditions used to remove cell surface-bound material, and (2) low pH treatment lyses the majority of the cells, as shown with both a nonadherent and an adherent cell line, with the release of most of a 51 Cr label. Still, low pH extraction was effective at demonstrating Ab internalization, as has been demonstrated many times. These effects of low pH treatment may be attributed to the fixative properties of these buffers. Regardless of the mechanism, these data must be taken into consideration in interpreting the results of such experiments

  1. Two-dimensional sum-frequency generation (2D SFG) reveals structure and dynamics of a surface-bound peptide

    Science.gov (United States)

    Laaser, Jennifer E.; Skoff, David R.; Ho, Jia-Jung; Joo, Yongho; Serrano, Arnaldo L.; Steinkruger, Jay D.; Gopalan, Padma; Gellman, Samuel H.; Zanni, Martin T.

    2014-01-01

    Surface-bound polypeptides and proteins are increasingly used to functionalize inorganic interfaces such as electrodes, but their structural characterization is exceedingly difficult with standard technologies. In this paper, we report the first two-dimensional sum-frequency generation (2D SFG) spectra of a peptide monolayer, which is collected by adding a mid-IR pulse shaper to a standard femtosecond SFG spectrometer. On a gold surface, standard FTIR spectroscopy is inconclusive about the peptide structure because of solvation-induced frequency shifts, but the 2D lineshapes, anharmonic shifts, and lifetimes obtained from 2D SFG reveal that the peptide is largely α-helical and upright. Random coil residues are also observed, which do not themselves appear in SFG spectra due to their isotropic structural distribution, but which still absorb infrared light and so can be detected by cross-peaks in 2D SFG spectra. We discuss these results in the context of peptide design. Because of the similar way in which the spectra are collected, these 2D SFG spectra can be directly compared to 2D IR spectra, thereby enabling structural interpretations of surface-bound peptides and biomolecules based on the well-studied structure/2D IR spectra relationships established from soluble proteins. PMID:24372101

  2. Crystal optimization and preliminary diffraction data analysis of the Smad1 MH1 domain bound to a palindromic SBE DNA element

    International Nuclear Information System (INIS)

    Baburajendran, Nithya; Palasingam, Paaventhan; Ng, Calista Keow Leng; Jauch, Ralf; Kolatkar, Prasanna R.

    2009-01-01

    Crystals of palindromic SBE DNA-bound Smad1 MH1 domain diffracting to 2.7 Å resolution have been obtained. The bone morphogenetic protein (BMP) signalling pathway regulates diverse processes such as cell differentiation, anterior/posterior axis specification, cell growth and the formation of extra-embryonic tissues. The transcription factor Smad1 relays the BMP signal from the cytoplasm to the nucleus, where it binds short DNA-sequence motifs and regulates gene expression. However, how Smad1 selectively targets particular genomic regions is poorly understood. In order to understand the physical basis of the specific interaction of Smad1 with DNA and to contrast it with the highly homologous but functionally distinct Smad3 protein, the DNA-binding Mad-homology 1 (MH1) domain of Smad1 was cocrystallized with a 17-mer palindromic Smad-binding element (SBE). The extensive optimizations of the length, binding-site spacing and terminal sequences of the DNA element in combination with the other crystallization parameters necessary for obtaining diffraction-quality crystals are described here. A 2.7 Å resolution native data set was collected at the National Synchrotron Radiation Research Centre, Taiwan, from crystals grown in a solution containing 0.2 M ammonium tartrate dibasic, 20% PEG 3350, 3% 2-propanol and 10% glycerol. The data set was indexed and merged in space group P222, with unit-cell parameters a = 73.94, b = 77.49, c = 83.78 Å, α = β = γ = 90°. The solvent content in the unit cell is consistent with the presence of two Smad1 MH1 molecules bound to the duplex DNA in the asymmetric unit

  3. How much can Greenland melt? An upper bound on mass loss from the Greenland Ice Sheet through surface melting

    Science.gov (United States)

    Liu, X.; Bassis, J. N.

    2015-12-01

    With observations showing accelerated mass loss from the Greenland Ice Sheet due to surface melt, the Greenland Ice Sheet is becoming one of the most significant contributors to sea level rise. The contribution of the Greenland Ice Sheet o sea level rise is likely to accelerate in the coming decade and centuries as atmospheric temperatures continue to rise, potentially triggering ever larger surface melt rates. However, at present considerable uncertainty remains in projecting the contribution to sea level of the Greenland Ice Sheet both due to uncertainty in atmospheric forcing and the ice sheet response to climate forcing. Here we seek an upper bound on the contribution of surface melt from the Greenland to sea level rise in the coming century using a surface energy balance model coupled to an englacial model. We use IPCC Representative Concentration Pathways (RCP8.5, RCP6, RCP4.5, RCP2.6) climate scenarios from an ensemble of global climate models in our simulations to project the maximum rate of ice volume loss and related sea-level rise associated with surface melting. To estimate the upper bound, we assume the Greenland Ice Sheet is perpetually covered in thick clouds, which maximize longwave radiation to the ice sheet. We further assume that deposition of black carbon darkens the ice substantially turning it nearly black, substantially reducing its albedo. Although assuming that all melt water not stored in the snow/firn is instantaneously transported off the ice sheet increases mass loss in the short term, refreezing of retained water warms the ice and may lead to more melt in the long term. Hence we examine both assumptions and use the scenario that leads to the most surface melt by 2100. Preliminary models results suggest that under the most aggressive climate forcing, surface melt from the Greenland Ice Sheet contributes ~1 m to sea level by the year 2100. This is a significant contribution and ignores dynamic effects. We also examined a lower bound

  4. Yeast Srs2 Helicase Promotes Redistribution of Single-Stranded DNA-Bound RPA and Rad52 in Homologous Recombination Regulation

    Directory of Open Access Journals (Sweden)

    Luisina De Tullio

    2017-10-01

    Full Text Available Srs2 is a super-family 1 helicase that promotes genome stability by dismantling toxic DNA recombination intermediates. However, the mechanisms by which Srs2 remodels or resolves recombination intermediates remain poorly understood. Here, single-molecule imaging is used to visualize Srs2 in real time as it acts on single-stranded DNA (ssDNA bound by protein factors that function in recombination. We demonstrate that Srs2 is highly processive and translocates rapidly (∼170 nt per second in the 3′→5′ direction along ssDNA saturated with replication protein A (RPA. We show that RPA is evicted from DNA during the passage of Srs2. Remarkably, Srs2 also readily removes the recombination mediator Rad52 from RPA-ssDNA and, in doing so, promotes rapid redistribution of both Rad52 and RPA. These findings have important mechanistic implications for understanding how Srs2 and related nucleic acid motor proteins resolve potentially pathogenic nucleoprotein intermediates.

  5. Yeast Srs2 Helicase Promotes Redistribution of Single-Stranded DNA-Bound RPA and Rad52 in Homologous Recombination Regulation.

    Science.gov (United States)

    De Tullio, Luisina; Kaniecki, Kyle; Kwon, Youngho; Crickard, J Brooks; Sung, Patrick; Greene, Eric C

    2017-10-17

    Srs2 is a super-family 1 helicase that promotes genome stability by dismantling toxic DNA recombination intermediates. However, the mechanisms by which Srs2 remodels or resolves recombination intermediates remain poorly understood. Here, single-molecule imaging is used to visualize Srs2 in real time as it acts on single-stranded DNA (ssDNA) bound by protein factors that function in recombination. We demonstrate that Srs2 is highly processive and translocates rapidly (∼170 nt per second) in the 3'→5' direction along ssDNA saturated with replication protein A (RPA). We show that RPA is evicted from DNA during the passage of Srs2. Remarkably, Srs2 also readily removes the recombination mediator Rad52 from RPA-ssDNA and, in doing so, promotes rapid redistribution of both Rad52 and RPA. These findings have important mechanistic implications for understanding how Srs2 and related nucleic acid motor proteins resolve potentially pathogenic nucleoprotein intermediates. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  6. In vitro evaluation of biodegradable microspheres with surface-bound ligands.

    Science.gov (United States)

    Keegan, Mark E; Royce, Sara M; Fahmy, Tarek; Saltzman, W Mark

    2006-02-21

    Protein ligands were conjugated to the surface of biodegradable microspheres. These microsphere-ligand conjugates were then used in two in vitro model systems to evaluate the effect of conjugated ligands on microsphere behavior. Microsphere retention in agarose columns was increased by ligands on the microsphere surface specific for receptors on the agarose matrix. In another experiment, conjugating the lectin Ulex europaeus agglutinin 1 to the microsphere surface increased microsphere adhesion to Caco-2 monolayers compared to control microspheres. This increase in microsphere adhesion was negated by co-administration of l-fucose, indicating that the increase in adhesion is due to specific interaction of the ligand with carbohydrate receptors on the cell surface. These results demonstrate that the ligands conjugated to the microspheres maintain their receptor binding activity and are present on the microsphere surface at a density sufficient to target the microspheres to both monolayers and three-dimensional matrices bearing complementary receptors.

  7. DNA immobilization on polymer-modified Si surface by controlling pH

    International Nuclear Information System (INIS)

    Demirel, Goekcen Birlik; Caykara, Tuncer

    2009-01-01

    A novel approach based on polymer-modified Si surface as DNA sensor platforms is presented. The polymer-modified Si surface was prepared by using 3-(methacryloxypropyl)trimethoxysilane [γ-MPS] and poly(acrylamide) [PAAm]. Firstly, a layer of γ-MPS was formed on the hydroxylated silicon surface as a monolayer and then modified with different molecular weight of PAAm to form polymer-modified surface. The polymer-modified Si surface was used for dsDNA immobilization. All steps about formation of layer structure were characterized by ellipsometry, atomic force microscopy (AFM), attenuated total reflectance Fourier transformed infrared (ATR-FTIR), and contact angle (CA) measurements. We found that in this case the amount of dsDNA immobilized onto the surface was dictated by the electrostatic interaction between the substrate surface and the DNA. Our results thus demonstrated that DNA molecules could be immobilized differently onto the polymer-modified support surface via electrostatic interactions.

  8. Surface-Bound Ligands Modulate Chemoselectivity and Activity of a Bimetallic Nanoparticle Catalyst

    KAUST Repository

    Vu, Khanh B.

    2015-04-03

    "Naked" metal nanoparticles (NPs) are thermodynamically and kinetically unstable in solution. Ligands, surfactants, or polymers, which adsorb at a particle\\'s surface, can be used to stabilize NPs; however, such a mode of stabilization is undesirable for catalytic applications because the adsorbates block the surface active sites. The catalytic activity and the stability of NPs are usually inversely correlated. Here, we describe an example of a bimetallic (PtFe) NP catalyst stabilized by carboxylate surface ligands that bind preferentially to one of the metals (Fe). NPs stabilized by fluorous ligands were found to be remarkably competent in catalyzing the hydrogenation of cinnamaldehyde; NPs stabilized by hydrocarbon ligands were significantly less active. The chain length of the fluorous ligands played a key role in determining the chemoselectivity of the FePt NP catalysts. (Chemical Presented). © 2015 American Chemical Society.

  9. Probing the adsorption mechanism in thiamazole bound to the silver surface with Surface-enhanced Raman Scattering and DFT

    Science.gov (United States)

    Biswas, Nandita; Thomas, Susy; Sarkar, Anjana; Mukherjee, Tulsi; Kapoor, Sudhir

    2009-09-01

    Surface-enhanced Raman scattering (SERS) of thiamazole have been investigated in aqueous solution. Thiamazole is an important anti-thyroid drug that is used in the treatment of hyperthyroidism (over activity of the thyroid gland). Due to its medicinal importance, the surface adsorption properties of thiamazole have been studied. The experimental Raman and SERS data are supported with DFT calculations using B3LYP functional with LANL2DZ basis set. From the SERS spectra as well as theoretical calculations, it has been inferred that thiamazole is chemisorbed to the silver surface directly through the sulphur atom and the ring N atom, with a tilted orientation.

  10. Major membrane surface proteins of Mycoplasma hyopneumoniae selectively modified by covalently bound lipid

    International Nuclear Information System (INIS)

    Wise, K.S.; Kim, M.F.

    1987-01-01

    Surface protein antigens of Mycoplasma hyopneumoniae were identified by direct antibody-surface binding or by radioimmunoprecipitation of surface 125 I-labeled proteins with a series of monoclonal antibodies (MAbs). Radioimmunoprecipitation of TX-114-phase proteins from cells labeled with [ 35 S] methionine, 14 C-amino acids, or [ 3 H] palmitic acid showed that proteins p65, p50, and p44 were abundant and (with one other hydrophobic protein, p60) were selectively labeled with lipid. Alkaline hydroxylamine treatment of labeled proteins indicated linkage of lipids by amide or stable O-linked ester bonds. Proteins p65, p50, and p44 were highly immunogenic in the natural host as measured by immunoblots of TX-114-phase proteins with antisera from swine inoculated with whole organisms. These proteins were antigenically and structurally unrelated, since hyperimmune mouse antibodies to individual gel-purified proteins were monospecific and gave distinct proteolytic epitope maps. Intraspecies size variants of one surface antigen of M. hyopneumoniae were revealed by a MAb to p70 (defined in strain J, ATCC 25934), which recognized a large p73 component on strain VPP11 (ATCC 25617). In addition, MAb to internal, aqueous-phase protein p82 of strain J failed to bind an analogous antigen in strain VPP11

  11. Surface wave instability in bounded magnetized plasma with inhomogeneous particle stream

    Energy Technology Data Exchange (ETDEWEB)

    Jovanovic, D.; Vukovic, S. (Belgrade Univ. (Yugoslavia). Inst. za Fiziku)

    1981-02-01

    The instability of surface wave modes in a semi infinite magnetoactive plasma with a non-homogeneous particle stream is studied. The existence of two possible mechanisms for the development of the instability: induced anomalous Doppler effect and induced Cherenkov effect is demonstrated. Related growth-rates and stability criteria are calculated.

  12. Surface wave instability in bounded magnetized plasma with inhomogeneous particle stream

    International Nuclear Information System (INIS)

    Jovanovic, D.; Vukovic, S.

    1981-01-01

    The instability of surface wave modes in a semi infinite magnetoactive plasma with a non-homogeneous particle stream is studied. The existence of two possible mechanisms for the development of the instability: induced anomalous Doppler effect and induced Cherenkov effect is demonstrated. Related growth-rates and stability criteria are calculated. (author)

  13. Major membrane surface proteins of Mycoplasma hyopneumoniae selectively modified by covalently bound lipid

    Energy Technology Data Exchange (ETDEWEB)

    Wise K.S.; Kim, M.F.

    1987-12-01

    Surface protein antigens of Mycoplasma hyopneumoniae were identified by direct antibody-surface binding or by radioimmunoprecipitation of surface /sup 125/I-labeled proteins with a series of monoclonal antibodies (MAbs). Radioimmunoprecipitation of TX-114-phase proteins from cells labeled with (/sup 35/S) methionine, /sup 14/C-amino acids, or (/sup 3/H) palmitic acid showed that proteins p65, p50, and p44 were abundant and (with one other hydrophobic protein, p60) were selectively labeled with lipid. Alkaline hydroxylamine treatment of labeled proteins indicated linkage of lipids by amide or stable O-linked ester bonds. Proteins p65, p50, and p44 were highly immunogenic in the natural host as measured by immunoblots of TX-114-phase proteins with antisera from swine inoculated with whole organisms. These proteins were antigenically and structurally unrelated, since hyperimmune mouse antibodies to individual gel-purified proteins were monospecific and gave distinct proteolytic epitope maps. Intraspecies size variants of one surface antigen of M. hyopneumoniae were revealed by a MAb to p70 (defined in strain J, ATCC 25934), which recognized a large p73 component on strain VPP11 (ATCC 25617). In addition, MAb to internal, aqueous-phase protein p82 of strain J failed to bind an analogous antigen in strain VPP11.

  14. Structure of the DNA-bound BRCA1 C-terminal region from human replication factor C p140 and model of the protein-DNA complex

    NARCIS (Netherlands)

    Kobayashi, M.; AB, E.; Bonvin, A.M.J.J.; Siegal, G.

    2010-01-01

    BRCA1 C-terminal domain (BRCT)-containing proteins are found widely throughout the animal and bacteria kingdoms where they are exclusively involved in cell cycle regulation and DNA metabolism. Whereas most BRCT domains are involved in protein-protein interactions, a small subset has bona fide DNA

  15. Effect of pullulan nanoparticle surface charges on HSA complexation and drug release behavior of HSA-bound nanoparticles.

    Directory of Open Access Journals (Sweden)

    Xiaojun Tao

    Full Text Available Nanoparticle (NP compositions such as hydrophobicity and surface charge are vital to determine the presence and amount of human serum albumin (HSA binding. The HSA binding influences drug release, biocompatibility, biodistribution, and intercellular trafficking of nanoparticles (NPs. Here, we prepared 2 kinds of nanomaterials to investigate HSA binding and evaluated drug release of HSA-bound NPs. Polysaccharides (pullulan carboxyethylated to provide ionic derivatives were then conjugated to cholesterol groups to obtain cholesterol-modified carboxyethyl pullulan (CHCP. Cholesterol-modified pullulan (CHP conjugate was synthesized with a similar degree of substitution of cholesterol moiety to CHCP. CHCP formed self-aggregated NPs in aqueous solution with a spherical structure and zeta potential of -19.9 ± 0.23 mV, in contrast to -1.21 ± 0.12 mV of CHP NPs. NPs could quench albumin fluorescence intensity with maximum emission intensity gradually decreasing up to a plateau at 9 to 12 h. Binding constants were 1.12 × 10(5 M(-1 and 0.70 × 10(5 M(-1 to CHP and CHCP, respectively, as determined by Stern-Volmer analysis. The complexation between HSA and NPs was a gradual process driven by hydrophobic force and inhibited by NP surface charge and shell-core structure. HSA conformation was altered by NPs with reduction of α-helical content, depending on interaction time and particle surface charges. These NPs could represent a sustained release carrier for mitoxantrone in vitro, and the bound HSA assisted in enhancing sustained drug release.

  16. In vitro Blood Compatibility of Polyethylene Terephthalate with Covalently Bounded Hirudin on Surface

    Institute of Scientific and Technical Information of China (English)

    LI Fang; WANG Jin; HUANG San

    2011-01-01

    Polyethylene terephthalate (PET,Dacron) was modified by surface immobilization of hirudin with glutaraldehyde(GA) as coupling reagent to improve the blood compatibility.Hirudin-immobilizcd PETs were characterized by X-ray photoelectron spectroscopy (XPS) and contact angle measurements.The blood compatibility of the PETs was evaluated by platelet adhesion evaluation and fibrinogen conformational change measurements in vitro.The results showed the decrease of platelet adhesion and activation on hirudinimmobilized PET with increasing of glutaraldehyde concentration.Fibrinogen experiment showed that fibrinogen adherence and conformational changes of PET-HRD were less than those of untreated PET,which made the materials difficult to form thrombus.The proper reason of blood compatibility improvement was low interface tension between hirudin-immobilized PETs and blood,as well as blood proteins,and low ratio of dispersive/polar component of the surface energy(γsd/γsp) and high hydrophilicity.

  17. Macrophages lift off surface-bound bacteria using a filopodium-lamellipodium hook-and-shovel mechanism.

    Science.gov (United States)

    Möller, Jens; Lühmann, Tessa; Chabria, Mamta; Hall, Heike; Vogel, Viola

    2013-10-07

    To clear pathogens from host tissues or biomaterial surfaces, phagocytes have to break the adhesive bacteria-substrate interactions. Here we analysed the mechanobiological process that enables macrophages to lift-off and phagocytose surface-bound Escherichia coli (E. coli). In this opsonin-independent process, macrophage filopodia hold on to the E. coli fimbriae long enough to induce a local protrusion of a lamellipodium. Specific contacts between the macrophage and E. coli are formed via the glycoprotein CD48 on filopodia and the adhesin FimH on type 1 fimbriae (hook). We show that bacterial detachment from surfaces occurrs after a lamellipodium has protruded underneath the bacterium (shovel), thereby breaking the multiple bacterium-surface interactions. After lift-off, the bacterium is engulfed by a phagocytic cup. Force activated catch bonds enable the long-term survival of the filopodium-fimbrium interactions while soluble mannose inhibitors and CD48 antibodies suppress the contact formation and thereby inhibit subsequent E. coli phagocytosis.

  18. Temporal and mechanistic tracking of cellular uptake dynamics with novel surface fluorophore-bound nanodiamonds.

    Science.gov (United States)

    Schrand, Amanda M; Lin, Jonathan B; Hens, Suzanne Ciftan; Hussain, Saber M

    2011-02-01

    Nanoparticles (NPs) offer promise for a multitude of biological applications including cellular probes at the bio-interface for targeted delivery of anticancer substances, Raman and fluorescent-based imaging and directed cell growth. Nanodiamonds (NDs), in particular, have several advantages compared to other carbon-based nanomaterials - including a rich surface chemistry useful for chemical conjugation, high biocompatibility with little reactive oxygen species (ROS) generation, physical and chemical stability that affords sterilization, high surface area to volume ratio, transparency and a high index of refraction. The visualization of ND internalization into cells is possible via photoluminescence, which is produced by direct dye conjugation or high energy irradiation that creates nitrogen vacancy centers. Here, we explore the kinetics and mechanisms involved in the intracellular uptake and localization of novel, highly-stable, fluorophore-conjugated NDs. Examination in a neuronal cell line (N2A) shows ND localization to early endosomes and lysosomes with eventual release into the cytoplasm. The addition of endocytosis and exocytosis inhibitors allows for diminished uptake and increased accumulation, respectively, which further corroborates cellular behavior in response to NDs. Ultimately, the ability of the NDs to travel throughout cellular compartments of varying pH without degradation of the surface-conjugated fluorophore or alteration of cell viability over extended periods of time is promising for their use in biomedical applications as stable, biocompatible, fluorescent probes.

  19. Surface-Bound Intermediates in Low-Temperature Methanol Synthesis on Copper. Participants and Spectators

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Yong; Mei, Donghai; Peden, Charles HF; Campbell, Charles T.; Mims, Charles A.

    2015-11-03

    The reactivity of surface adsorbed species present on copper catalysts during methanol synthesis at low temperatures was studied by simultaneous infrared spectroscopy (IR) and mass spectroscopy (MS) measurements during “titration” (transient surface reaction) experiments with isotopic tracing. The results show that adsorbed formate is a major bystander species present on the surface under steady-state methanol synthesis reaction conditions, but it cannot be converted to methanol by reaction with pure H2, nor with H2 plus added water. Formate-containing surface adlayers for these experiments were produced during steady state catalysis in (a) H2:CO2 (with substantial formate coverage) and (b) moist H2:CO (with no IR visible formate species). Both these reaction conditions produce methanol at steady state with relatively high rates. Adlayers containing formate were also produced by (c) formic acid adsorption. Various "titration" gases were used to probe these adlayers at modest temperatures (T = 410-450K) and 6 bar total pressure. Methanol gas (up to ~1% monolayer equivalent) was produced in "titration" from the H2:CO2 catalytic adlayers by H2 plus water, but not by dry hydrogen. The decay in the formate IR features accelerated in the presence of added water vapor. The H2:CO:H2O catalytic adlayer produced similar methanol titration yields in H2 plus water but showed no surface formate features in IR (less than 0.2% monolayer coverage). Finally, formate from formic acid chemisorption produced no methanol under any titration conditions. Even under (H2:CO2) catalytic reaction conditions, isotope tracing showed that pre-adsorbed formate from formic acid did not contribute to the methanol produced. Although non-formate intermediates exist during low temperature methanol synthesis on copper which can be converted to methanol gas

  20. Theoretical investigation of potential energy surface and bound states for the van der Waals complex Ar–BrCl dimer

    Energy Technology Data Exchange (ETDEWEB)

    Zheng, Rui [School of Mathematics and Information Science, North China University of Water Resources and Electric Power, Zhengzhou (China); Key Laboratory of Magnetic Resonance in Biological Systems, State Key Laboratory of Magnetic Resonance and Atomic and Molecular Physics, Wuhan Centre for Magnetic Resonance, Wuhan Institute of Physics and Mathematics, Chinese Academy of Sciences, Wuhan (China); Li, Song, E-mail: lsong@yangtzeu.edu.cn [School of Physics and Optoelectronic Engineering, Yangtze University, Jingzhou (China); Chen, Shan-Jun; Chen, Yan [School of Physics and Optoelectronic Engineering, Yangtze University, Jingzhou (China); Zheng, Li-Min [Key Laboratory of Magnetic Resonance in Biological Systems, State Key Laboratory of Magnetic Resonance and Atomic and Molecular Physics, Wuhan Centre for Magnetic Resonance, Wuhan Institute of Physics and Mathematics, Chinese Academy of Sciences, Wuhan (China)

    2015-09-08

    Highlights: • A two-dimensional potential for Ar–BrCl is constructed at the CCSD(T) level. • The PES is characterized by three minima and two saddle points between them. • Bound state calculations were carried out for the complex. - Abstract: The intermolecular potential energy surface (PES) of the ground electronic state for the Ar–BrCl dimer is constructed at the CCSD(T) level with the aug-cc-pVQZ basis set and mid-bond functions. The PES is characterized by three minima and two saddle points. The global minimum corresponding to a collinear Ar–BrCl configuration, which has been observed experimentally, is located at R = 4.10 Å and θ = 2.5° with a well depth of −285.207 cm{sup −1}. A nearly T-shaped structure and an anti-linear Ar–ClBr geometry is also predicted. The bound state calculations are preformed to study intermolecular vibrational modes, rotational levels and average structures for the complex. Our transition frequencies, spectroscopic constants and average structures for all isotopomers of the collinear isomer agree well with experimental data. We have also provided pure rotational transitional frequencies for both nearly T-shaped and anti-linear isomers. These results are significant for further experimental investigations of the Ar–BrCl dimer.

  1. Nonaqueous electrocatalytic water oxidation by a surface-bound Ru(bda)(L)₂ complex.

    Science.gov (United States)

    Sheridan, Matthew V; Sherman, Benjamin D; Wee, Kyung-Ryang; Marquard, Seth L; Gold, Alexander S; Meyer, Thomas J

    2016-04-21

    The rate of electrocatalytic water oxidation by the heterogeneous water oxidation catalyst [Ru(bda)(4-O(CH2)3P(O3H2)2-pyr)2], , (pyr = pyridine; bda = 2,2'-bipyridine-6,6'-dicarboxylate) on metal oxide surfaces is greatly enhanced relative to water as the solvent. In these experiments with propylene carbonate (PC) as the nonaqueous solvent, water is the limiting reagent. Mechanistic studies point to atom proton transfer (APT) as the rate limiting step in water oxidation catalysis.

  2. Excitation mechanism in the photoisomerization of a surface-bound azobenzene derivative: Role of the metallic substrate

    Science.gov (United States)

    Hagen, Sebastian; Kate, Peter; Leyssner, Felix; Nandi, Dhananjay; Wolf, Martin; Tegeder, Petra

    2008-10-01

    Two-photon photoemission spectroscopy is employed to elucidate the electronic structure and the excitation mechanism in the photoinduced isomerization of the molecular switch tetra-tert-butyl-azobenzene (TBA) adsorbed on Au(111). Our results demonstrate that the optical excitation and the mechanism of molecular switching at a metal surface is completely different compared to the corresponding process for the free molecule. In contrast to direct (intramolecular) excitation operative in the isomerization in the liquid phase, the conformational change in the surface-bound TBA is driven by a substrate-mediated charge transfer process. We find that photoexcitation above a threshold hν ≈2.2 eV leads to hole formation in the Au d-band followed by a hole transfer to the highest occupied molecular orbital of TBA. This transiently formed positive ion resonance subsequently results in a conformational change. The photon energy dependent photoisomerization cross section exhibit an unusual shape for a photochemical reaction of an adsorbate on a metal surface. It shows a thresholdlike behavior below hν ≈2.2 eV and above hν ≈4.4 eV. These thresholds correspond to the minimum energy required to create single or multiple hot holes in the Au d-bands, respectively. This study provides important new insights into the use of light to control the structure and function of molecular switches in direct contact with metal electrodes.

  3. Excitation mechanism in the photoisomerization of a surface-bound azobenzene derivative: Role of the metallic substrate

    International Nuclear Information System (INIS)

    Hagen, Sebastian; Kate, Peter; Leyssner, Felix; Nandi, Dhananjay; Wolf, Martin; Tegeder, Petra

    2008-01-01

    Two-photon photoemission spectroscopy is employed to elucidate the electronic structure and the excitation mechanism in the photoinduced isomerization of the molecular switch tetra-tert-butyl-azobenzene (TBA) adsorbed on Au(111). Our results demonstrate that the optical excitation and the mechanism of molecular switching at a metal surface is completely different compared to the corresponding process for the free molecule. In contrast to direct (intramolecular) excitation operative in the isomerization in the liquid phase, the conformational change in the surface-bound TBA is driven by a substrate-mediated charge transfer process. We find that photoexcitation above a threshold hν≅2.2 eV leads to hole formation in the Au d-band followed by a hole transfer to the highest occupied molecular orbital of TBA. This transiently formed positive ion resonance subsequently results in a conformational change. The photon energy dependent photoisomerization cross section exhibit an unusual shape for a photochemical reaction of an adsorbate on a metal surface. It shows a thresholdlike behavior below hν≅2.2 eV and above hν≅4.4 eV. These thresholds correspond to the minimum energy required to create single or multiple hot holes in the Au d-bands, respectively. This study provides important new insights into the use of light to control the structure and function of molecular switches in direct contact with metal electrodes.

  4. On-Demand Final State Control of a Surface-Bound Bistable Single Molecule Switch.

    Science.gov (United States)

    Garrido Torres, José A; Simpson, Grant J; Adams, Christopher J; Früchtl, Herbert A; Schaub, Renald

    2018-04-12

    Modern electronic devices perform their defined action because of the complete reliability of their individual active components (transistors, switches, diodes, and so forth). For instance, to encode basic computer units (bits) an electrical switch can be used. The reliability of the switch ensures that the desired outcome (the component's final state, 0 or 1) can be selected with certainty. No practical data storage device would otherwise exist. This reliability criterion will necessarily need to hold true for future molecular electronics to have the opportunity to emerge as a viable miniaturization alternative to our current silicon-based technology. Molecular electronics target the use of single-molecules to perform the actions of individual electronic components. On-demand final state control over a bistable unimolecular component has therefore been one of the main challenges in the past decade (1-5) but has yet to be achieved. In this Letter, we demonstrate how control of the final state of a surface-supported bistable single molecule switch can be realized. On the basis of the observations and deductions presented here, we further suggest an alternative strategy to achieve final state control in unimolecular bistable switches.

  5. Investigating ozone-induced decomposition of surface-bound permethrin for conditions in aircraft cabins.

    Science.gov (United States)

    Coleman, B K; Wells, J R; Nazaroff, W W

    2010-02-01

    The reaction of ozone with permethrin can potentially form phosgene. Published evidence on ozone levels and permethrin surface concentrations in aircraft cabins indicated that significant phosgene formation might occur in this setting. A derivatization technique was developed to detect phosgene with a lower limit of detection of 2 ppb. Chamber experiments were conducted with permethrin-coated materials (glass, carpet, seat fabric, and plastic) exposed to ozone under cabin-relevant conditions (150 ppb O(3), 4.5/h air exchange rate, means of material-balance modeling indicates that the upper limit on the phosgene level in aircraft cabins resulting from this chemistry is approximately 1 microg/m(3) or approximately 0.3 ppb. It was thus determined that phosgene formation, if it occurs in aircraft cabins, is not likely to exceed relevant, health-based phosgene exposure guidelines. Phosgene formation from ozone-initiated oxidation of permethrin in the aircraft cabin environment, if it occurs, is estimated to generate levels below the California Office of Environmental Health Hazard Assessment acute reference exposure level of 4 microg/m(3) or approximately 1 ppb.

  6. N-(2-chloroethyl)-N-nitrosoureas covalently bound to nonionic and monocationic lexitropsin dipeptides. Synthesis, DNA affinity binding characteristics, and reactions with 32P-end-labeled DNA

    International Nuclear Information System (INIS)

    Church, K.M.; Wurdeman, R.L.; Zhang, Yi; Chen, Faxian; Gold, B.

    1990-01-01

    The synthesis and characterization of a series of compounds that contain an N-alkyl-N-nitrosourea functionality linked to DNA minor groove binding bi- and tripeptides (lexitropsins or information-reading peptides) based on methylpyrrole-2-carboxamide subunits are described. The lexitropsins (lex) synthesized have either a 3-(dimethylamino)propyl or propyl substituent on the carboxyl terminus. The preferred DNA affinity binding sequences of these compounds were footprinted in 32 P-end-labeled restriction fragments with methidiumpropyl-EDTA·Fe(II), and in common with other structural analogues, e.g., distamycin and netropsin, these nitrosoureas recognize A-T-rich runs. The affinity binding of the compound with the dimethylamino terminus, which is ionized at near-neutral pH, appeared stronger than that observed for the neutral dipeptide. The sequence specificity for DNA alkylation by (2-chloroethyl)nitrosourea-lex dipeptides (Cl-ENU-lex), with neutral and charged carboxyl termini, using 32 P-end-labeled restriction fragments, was determined by the conversion of the adducted sites into single-strand breaks by sequential heating at neutral pH and exposure to base. The DNA cleavage sites were visualized by polyacrylamide gel electrophoresis and autoradiography. Linking the Cl-ENU moiety to minor groove binders is a viable strategy to qualitatively and quantitatively control the delivery and release of the ultimate DNA alkylating agent in a sequence-dependent fashion

  7. Localized surface plasmon resonance (LSPR) study of DNA hybridization at single nanoparticle transducers

    International Nuclear Information System (INIS)

    Schneider, T.; Jahr, N.; Jatschka, J.; Csaki, A.; Stranik, O.; Fritzsche, W.

    2013-01-01

    The effect of DNA–DNA interaction on the localized surface plasmon resonance of single 80 nm gold nanoparticles is studied. Therefore, both the attachment of the capture DNA strands at the particle surface and the sequence-specific DNA binding (hybridization) of analyte DNA to the immobilized capture DNA is subject of investigations. The influence of substrate attachment chemistry, the packing density of DNA as controlled by an assisting layer of smaller molecules, and the distance as increased by a linker on the LSPR efficiency is investigated. The resulting changes in signal can be related to a higher hybridization efficiency of the analyte DNA to the immobilized capture DNA. The subsequent attachment of additional DNA strands to this system is studied, which allows for a multiple step detection of binding and an elucidation of the resulting resonance shifts. The detection limit was determined for the utilized DNA system by incubation with various concentration of analyte DNA. Although the method allows for a marker-free detection, we show that additional markers such as 20 nm gold particle labels increase the signal and thereby the sensitivity significantly. The study of resonance shift for various DNA lengths revealed that the resonance shift per base is stronger for shorter DNA molecules (20 bases) as compared to longer ones (46 bases).

  8. Crystal optimization and preliminary diffraction data analysis of the Smad1 MH1 domain bound to a palindromic SBE DNA element

    Science.gov (United States)

    Baburajendran, Nithya; Palasingam, Paaventhan; Ng, Calista Keow Leng; Jauch, Ralf; Kolatkar, Prasanna R.

    2009-01-01

    The bone morphogenetic protein (BMP) signalling pathway regulates diverse processes such as cell differentiation, anterior/posterior axis specification, cell growth and the formation of extra-embryonic tissues. The transcription factor Smad1 relays the BMP signal from the cytoplasm to the nucleus, where it binds short DNA-sequence motifs and regulates gene expression. However, how Smad1 selectively targets particular genomic regions is poorly understood. In order to understand the physical basis of the specific interaction of Smad1 with DNA and to contrast it with the highly homologous but functionally distinct Smad3 protein, the DNA-binding Mad-homology 1 (MH1) domain of Smad1 was cocrystallized with a 17-mer palindromic Smad-binding element (SBE). The extensive optimizations of the length, binding-site spacing and terminal sequences of the DNA element in combination with the other crystallization parameters necessary for obtaining diffraction-quality crystals are described here. A 2.7 Å resolution native data set was collected at the National Synchrotron Radiation Research Centre, Taiwan, from crystals grown in a solution containing 0.2 M ammonium tartrate dibasic, 20% PEG 3350, 3% 2-­propanol and 10% glycerol. The data set was indexed and merged in space group P222, with unit-cell parameters a = 73.94, b = 77.49, c = 83.78 Å, α = β = γ = 90°. The solvent content in the unit cell is consistent with the presence of two Smad1 MH1 molecules bound to the duplex DNA in the asymmetric unit. PMID:19923727

  9. The persistence of human DNA in soil following surface decomposition.

    Science.gov (United States)

    Emmons, Alexandra L; DeBruyn, Jennifer M; Mundorff, Amy Z; Cobaugh, Kelly L; Cabana, Graciela S

    2017-09-01

    Though recent decades have seen a marked increase in research concerning the impact of human decomposition on the grave soil environment, the fate of human DNA in grave soil has been relatively understudied. With the purpose of supplementing the growing body of literature in forensic soil taphonomy, this study assessed the relative persistence of human DNA in soil over the course of decomposition. Endpoint PCR was used to assess the presence or absence of human nuclear and mitochondrial DNA, while qPCR was used to evaluate the quantity of human DNA recovered from the soil beneath four cadavers at the University of Tennessee's Anthropology Research Facility (ARF). Human nuclear DNA from the soil was largely unrecoverable, while human mitochondrial DNA was detectable in the soil throughout all decomposition stages. Mitochondrial DNA copy abundances were not significantly different between decomposition stages and were not significantly correlated to soil edaphic parameters tested. There was, however, a significant positive correlation between mitochondrial DNA copy abundances and the human associated bacteria, Bacteroides, as estimated by 16S rRNA gene abundances. These results show that human mitochondrial DNA can persist in grave soil and be consistently detected throughout decomposition. Copyright © 2017 The Chartered Society of Forensic Sciences. Published by Elsevier B.V. All rights reserved.

  10. A pilot test of methods for determination of trace metals bound to colloids in surface waters

    Energy Technology Data Exchange (ETDEWEB)

    Nilsson, Kersti (Geosigma AB (Sweden))

    2011-01-15

    Two methods have been tested for the determination of trace metals associated with colloid species in surface waters, using test water from Eckarfjaerden (PFM000070) in Forsmark; 1) fractionation (ultra filtration) using special membrane filters with cut-offs of 1 kD and 5 kD and 2) filtration using a system of standard membrane filters with varying pore sizes connected in series. Both methods were somewhat modified compared to previous methods for colloid determination in groundwater within the site investigations at Forsmark and Laxemar (PLU). The results show that, in general, the largest amounts of metals associated with a colloid phase were recovered in the fraction between 1kD and 5 kD which indicates that the metal ions are associated with low molecular weight organic acids. Similar amounts were recovered on the filters in the filtration experiment. A minor part of the colloidal phase metals was recovered in the fraction larger than 5 kD i.e. metal ions associated with larger organic acids or colloidal size clay minerals. The metals present preferably as colloids in the fractionation experiment were: iron, thorium, cerium, uranium, neodymium, titanium, zirconium and yttrium. The filtering experiment showed larger parts of titanium and aluminum in the colloid phase than the fractionation experiment while the iron and cerium portions were equal and the uranium, yttrium and neodymium portions were lower. The results from the fractionation test showed that the dissolved parts were large for barium, manganese, strontium and rubidium. In the filtration test, uranium, yttrium and rubidium, were also present mainly as dissolved ions. The detection limit for filter analysis of thorium was high, and the part of thorium present as colloids was determined to <50%. Issues and methodological problems: - Severe contamination caused interpretation difficulties for several metal ions, especially chromium, nickel and zinc. - Both methods are time consuming and difficult to

  11. Chirality of weakly bound complexes: The potential energy surfaces for the hydrogen-peroxide−noble-gas interactions

    Energy Technology Data Exchange (ETDEWEB)

    Roncaratti, L. F., E-mail: lz@fis.unb.br; Leal, L. A.; Silva, G. M. de [Instituto de Física, Universidade de Brasília, 70910 Brasília (Brazil); Pirani, F. [Dipartimento di Chimica, Biologia e Biotecnologie, Università di Perugia, 06123 Perugia (Italy); Aquilanti, V. [Dipartimento di Chimica, Biologia e Biotecnologie, Università di Perugia, 06123 Perugia (Italy); Instituto de Física, Universidade Federal da Bahia, 40210 Salvador (Brazil); Gargano, R. [Instituto de Física, Universidade de Brasília, 70910 Brasília (Brazil); Departments of Chemistry and Physics, University of Florida, Quantum Theory Project, Gainesville, Florida 32611 (United States)

    2014-10-07

    We consider the analytical representation of the potential energy surfaces of relevance for the intermolecular dynamics of weakly bound complexes of chiral molecules. In this paper we study the H{sub 2}O{sub 2}−Ng (Ng=He, Ne, Ar, Kr, and Xe) systems providing the radial and the angular dependence of the potential energy surface on the relative position of the Ng atom. We accomplish this by introducing an analytical representation which is able to fit the ab initio energies of these complexes in a wide range of geometries. Our analysis sheds light on the role that the enantiomeric forms and the symmetry of the H{sub 2}O{sub 2} molecule play on the resulting barriers and equilibrium geometries. The proposed theoretical framework is useful to study the dynamics of the H{sub 2}O{sub 2} molecule, or other systems involving O–O and S–S bonds, interacting by non-covalent forces with atoms or molecules and to understand how the relative orientation of the O–H bonds changes along collisional events that may lead to a hydrogen bond formation or even to selectivity in chemical reactions.

  12. Single DNA molecules as probes for interrogating silica surfaces after various chemical treatments

    International Nuclear Information System (INIS)

    Liu Xia; Wu Zhan; Nie Huagui; Liu Ziling; He Yan; Yeung, E.S.

    2007-01-01

    We examined the adsorption of single YOYO-1-labeled λ-DNA molecules at glass surfaces after treatment with various chemical cleaning methods by using total internal reflection fluorescence microscopy (TIRFM). The characteristics of these surfaces were further assessed using contact angle (CA) measurements and atomic force microscopy (AFM). By recording the real-time dynamic motion of DNA molecules at the liquid/solid interface, subtle differences in adsorption affinities were revealed. The results indicate that the driving force for adsorption of DNA molecules on glass surfaces is mainly hydrophobic interaction. We also found that surface topography plays a role in the adsorption dynamics

  13. Next-Generation Sequencing of Genomic DNA Fragments Bound to a Transcription Factor in Vitro Reveals Its Regulatory Potential

    Directory of Open Access Journals (Sweden)

    Yukio Kurihara

    2014-12-01

    Full Text Available Several transcription factors (TFs coordinate to regulate expression of specific genes at the transcriptional level. In Arabidopsis thaliana it is estimated that approximately 10% of all genes encode TFs or TF-like proteins. It is important to identify target genes that are directly regulated by TFs in order to understand the complete picture of a plant’s transcriptome profile. Here, we investigate the role of the LONG HYPOCOTYL5 (HY5 transcription factor that acts as a regulator of photomorphogenesis. We used an in vitro genomic DNA binding assay coupled with immunoprecipitation and next-generation sequencing (gDB-seq instead of the in vivo chromatin immunoprecipitation (ChIP-based methods. The results demonstrate that the HY5-binding motif predicted here was similar to the motif reported previously and that in vitro HY5-binding loci largely overlapped with the HY5-targeted candidate genes identified in previous ChIP-chip analysis. By combining these results with microarray analysis, we identified hundreds of HY5-binding genes that were differentially expressed in hy5. We also observed delayed induction of some transcripts of HY5-binding genes in hy5 mutants in response to blue-light exposure after dark treatment. Thus, an in vitro gDNA-binding assay coupled with sequencing is a convenient and powerful method to bridge the gap between identifying TF binding potential and establishing function.

  14. Crystallization and preliminary X-ray diffraction analysis of the Pax9 paired domain bound to a DC5 enhancer DNA element.

    Science.gov (United States)

    Narasimhan, Kamesh; Hilbig, Antonia; Udayasuryan, Barath; Jayabal, Sriram; Kolatkar, Prasanna R; Jauch, Ralf

    2014-10-01

    Pax genes belong to a family of metazoan transcription factors that are known to play a critical role in eye, ear, kidney and neural development. The mammalian Pax family of transcription factors is characterized by a ∼128-amino-acid DNA-binding paired domain that makes sequence-specific contacts with DNA. The diversity in Pax gene activities emerges from complex modes of interaction with enhancer regions and heterodimerization with multiple interaction partners. Based on in vitro optimal binding-site selection studies and enhancer identification assays, it has been suggested that Pax proteins may recognize and bind their target DNA elements with different binding modes/topologies, however this hypothesis has not yet been structurally explored. One of the most extensively studied DNA target elements of the Pax6 paired domain is the eye-lens specific DC5 (δ-crystallin) enhancer element. In order to shed light on Pax6-DC5 DNA interactions, the related paired-domain prototype Pax9 was crystallized with the minimal δ-crystallin DC5 enhancer element and preliminary X-ray diffraction analysis was attempted. A 3.0 Å resolution native data set was collected at the National Synchrotron Light Source (NSLS), Brookhaven from crystals grown in a solution consisting of 10%(w/v) PEG 20K, 20%(v/v) PEG 550 MME, 0.03 M NaNO3, 0.03 M Na2HPO4, 0.03 M NH2SO4, 0.1 M MES/imidazole pH 6.5. The data set was indexed and merged in space group C2221, with unit-cell parameters a = 75.74, b = 165.59, c = 70.14 Å, α = β = γ = 90°. The solvent content in the unit cell is consistent with the presence of one Pax9 paired domain bound to duplex DNA in the asymmetric unit.

  15. Crystallization and preliminary X-ray diffraction analysis of the Pax9 paired domain bound to a DC5 enhancer DNA element

    Science.gov (United States)

    Narasimhan, Kamesh; Hilbig, Antonia; Udayasuryan, Barath; Jayabal, Sriram; Kolatkar, Prasanna R.; Jauch, Ralf

    2014-01-01

    Pax genes belong to a family of metazoan transcription factors that are known to play a critical role in eye, ear, kidney and neural development. The mammalian Pax family of transcription factors is characterized by a ∼128-amino-acid DNA-binding paired domain that makes sequence-specific contacts with DNA. The diversity in Pax gene activities emerges from complex modes of interaction with enhancer regions and heterodimerization with multiple interaction partners. Based on in vitro optimal binding-site selection studies and enhancer identification assays, it has been suggested that Pax proteins may recognize and bind their target DNA elements with different binding modes/topologies, however this hypothesis has not yet been structurally explored. One of the most extensively studied DNA target elements of the Pax6 paired domain is the eye-lens specific DC5 (δ-crystallin) enhancer element. In order to shed light on Pax6–DC5 DNA interactions, the related paired-domain prototype Pax9 was crystallized with the minimal δ-crystallin DC5 enhancer element and preliminary X-ray diffraction analysis was attempted. A 3.0 Å resolution native data set was collected at the National Synchrotron Light Source (NSLS), Brookhaven from crystals grown in a solution consisting of 10%(w/v) PEG 20K, 20%(v/v) PEG 550 MME, 0.03 M NaNO3, 0.03 M Na2HPO4, 0.03 M NH2SO4, 0.1 M MES/imidazole pH 6.5. The data set was indexed and merged in space group C2221, with unit-cell parameters a = 75.74, b = 165.59, c = 70.14 Å, α = β = γ = 90°. The solvent content in the unit cell is consistent with the presence of one Pax9 paired domain bound to duplex DNA in the asymmetric unit. PMID:25286939

  16. Bound state potential energy surface construction: ab initio zero-point energies and vibrationally averaged rotational constants.

    Science.gov (United States)

    Bettens, Ryan P A

    2003-01-15

    Collins' method of interpolating a potential energy surface (PES) from quantum chemical calculations for reactive systems (Jordan, M. J. T.; Thompson, K. C.; Collins, M. A. J. Chem. Phys. 1995, 102, 5647. Thompson, K. C.; Jordan, M. J. T.; Collins, M. A. J. Chem. Phys. 1998, 108, 8302. Bettens, R. P. A.; Collins, M. A. J. Chem. Phys. 1999, 111, 816) has been applied to a bound state problem. The interpolation method has been combined for the first time with quantum diffusion Monte Carlo calculations to obtain an accurate ground state zero-point energy, the vibrationally average rotational constants, and the vibrationally averaged internal coordinates. In particular, the system studied was fluoromethane using a composite method approximating the QCISD(T)/6-311++G(2df,2p) level of theory. The approach adopted in this work (a) is fully automated, (b) is fully ab initio, (c) includes all nine nuclear degrees of freedom, (d) requires no assumption of the functional form of the PES, (e) possesses the full symmetry of the system, (f) does not involve fitting any parameters of any kind, and (g) is generally applicable to any system amenable to quantum chemical calculations and Collins' interpolation method. The calculated zero-point energy agrees to within 0.2% of its current best estimate. A0 and B0 are within 0.9 and 0.3%, respectively, of experiment.

  17. A theoretical study on the use of microwaves in reducing energy consumption for an endothermic reaction: Role of metal coated bounding surface

    International Nuclear Information System (INIS)

    Bhattacharya, Madhuchhanda; Basak, Tanmay

    2013-01-01

    This work presents a theoretical analysis on savings of energy during an endothermic reaction under microwave heating compared to conventional heating and shows the use of metal coated bounding surface to enhance the energy savings in otherwise low saving zones. Main thrust of this work is the quantification of energy savings for various probable microwave heating scenarios that may arise either due to varying reactor dimension (2L) over thin, intermediate and thick regimes or due to varying dielectric properties of the reactor. The analysis considers detailed transport equations in conjunction with Helmholtz equation for microwave propagation within a semiinfinite batch reactor. Simulations show that use of microwave can significantly save energy (as high as 60%) depending on reactor configuration. Simulations also show efficient use of metal coated bounding surface to enhance energy savings for reactors with 2L/λ eff = 0.5n−0.25, where n = 1, 2, 3… and λ eff is wavelength of microwave within the reactor. The enhancement is found to be 2 and 1.5 times at 2L/λ eff = 0.25 and 0.75, respectively. Various regions of efficient use of metal coated bounding surface for different microwave heating scenarios have been identified in a series of master curves. - Highlights: • This work simulates chemical reaction under microwave radiation using detailed model. • Simulations are presented in presence or absence of metal coated bounding surface. • Savings of energy under microwave have been analyzed for various probable scenarios. • Simulations show significant savings of energy under microwave heating. • Simulations show the potential of metal coated bounding surface to further enhance energy savings

  18. Immobilization, hybridization, and oxidation of synthetic DNA on gold surface: Electron transfer investigated by electrochemistry and scanning tunneling microscopy

    Energy Technology Data Exchange (ETDEWEB)

    McEwen, Gerald D.; Chen Fan [Biological Engineering Program, Department of Biological and Irrigation Engineering, Utah State University, 4105 Old Main Hill, Logan, UT 84322-4105 (United States); Zhou Anhong, E-mail: Anhong.Zhou@usu.edu [Biological Engineering Program, Department of Biological and Irrigation Engineering, Utah State University, 4105 Old Main Hill, Logan, UT 84322-4105 (United States)

    2009-06-08

    Fundamental understanding of interfacial electron transfer (ET) among electrolyte/DNA/solid-surface will facilitate the design for electrical detection of DNA molecules. In this report, the electron transfer characteristics of synthetic DNA (sequence from pathogenic Cryptosporidium parvum) self-assembled on a gold surface was electrochemically studied. The effects of immobilization order on the interface ET related parameters such as diffusion coefficient (D{sub 0}), surface coverage ({theta}{sub R}), and monolayer thickness (d{sub i}) were determined by cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). DNA surface density ({Gamma}{sub DNA}) was determined by the integration of the charge of the electro-oxidation current peaks during the initial cyclic voltammetry scans. It was found that the DNA surface densities at different modifications followed the order: {Gamma}{sub DNA} (dsS-DNA/Au) > {Gamma}{sub DNA} (MCH/dsS-DNA/Au) > {Gamma}{sub DNA} (dsS-DNA/MCH/Au). It was also revealed that the electro-oxidation of the DNA modified gold surface would involve the oxidation of nucleotides (guanine and adenine) with a 5.51 electron transfer mechanism and the oxidative desorption of DNA and MCH molecules by a 3 electron transfer mechanism. STM topography and current image analysis indicated that the surface conductivity after each surface modification followed the order: dsS-DNA/Au < MCH/dsS-DNA/Au < oxidized MCH/dsS-DNA/Au < Hoechst/oxidized MCH/dsS-DNA/Au. The results from this study suggested a combination of variations in immobilization order may provide an alternative approach for the optimization of DNA hybridization and the further development for electrical detection of DNA.

  19. Surface-enhanced Raman scattering based nonfluorescent probe for multiplex DNA detection.

    Science.gov (United States)

    Sun, Lan; Yu, Chenxu; Irudayaraj, Joseph

    2007-06-01

    To provide rapid and accurate detection of DNA markers in a straightforward, inexpensive, and multiplex format, an alternative surface-enhanced Raman scattering based probe was designed and fabricated to covalently attach both DNA probing sequence and nonfluorescent Raman tags to the surface of gold nanoparticles (DNA-AuP-RTag). The intensity of Raman signal of the probes could be controlled through the surface coverage of the nonfluorescent Raman tags (RTags). Detection sensitivity of these probes could be optimized by fine-tuning the amount of DNA molecules and RTags on the probes. Long-term stability of the DNA-AuP-RTag probes was found to be good (over 3 months). Excellent multiplexing capability of the DNA-AuP-RTag scheme was demonstrated by simultaneous identification of up to eight probes in a mixture. Detection of hybridization of single-stranded DNA to its complementary targets was successfully accomplished with a long-term goal to use nonfluorescent RTags in a Raman-based DNA microarray platform.

  20. DNA origami as biocompatible surface to match single-molecule and ensemble experiments

    Science.gov (United States)

    Gietl, Andreas; Holzmeister, Phil; Grohmann, Dina; Tinnefeld, Philip

    2012-01-01

    Single-molecule experiments on immobilized molecules allow unique insights into the dynamics of molecular machines and enzymes as well as their interactions. The immobilization, however, can invoke perturbation to the activity of biomolecules causing incongruities between single molecule and ensemble measurements. Here we introduce the recently developed DNA origami as a platform to transfer ensemble assays to the immobilized single molecule level without changing the nano-environment of the biomolecules. The idea is a stepwise transfer of common functional assays first to the surface of a DNA origami, which can be checked at the ensemble level, and then to the microscope glass slide for single-molecule inquiry using the DNA origami as a transfer platform. We studied the structural flexibility of a DNA Holliday junction and the TATA-binding protein (TBP)-induced bending of DNA both on freely diffusing molecules and attached to the origami structure by fluorescence resonance energy transfer. This resulted in highly congruent data sets demonstrating that the DNA origami does not influence the functionality of the biomolecule. Single-molecule data collected from surface-immobilized biomolecule-loaded DNA origami are in very good agreement with data from solution measurements supporting the fact that the DNA origami can be used as biocompatible surface in many fluorescence-based measurements. PMID:22523083

  1. Electron Transfer Mediator Effects in Water Oxidation Catalysis by Solution and Surface-Bound Ruthenium Bpy-Dicarboxylate Complexes

    Energy Technology Data Exchange (ETDEWEB)

    Sheridan, Matthew V.; Sherman, Benjamin D.; Marquard, Seth L.; Fang, Zhen; Ashford, Dennis L.; Wee, Kyung-Ryang; Gold, Alexander S.; Alibabaei, Leila; Rudd, Jennifer A.; Coggins, Michael K.; Meyer, Thomas J.

    2015-11-12

    Electrocatalytic water oxidation by the catalyst, ruthenium 2,2'-bipyridine-6,6'-dicarboxylate (bda) bis-isoquinoline (isoq), [Ru(bda)(isoq)2], 1, was investigated at metal oxide electrodes surface-derivatized with electron transfer (ET) mediators. At indium-doped tin oxide (ITO) in pH 7.2 in H2PO4–/HPO42– buffers in 0.5 M NaClO4 with added acetonitrile (MeCN), the catalytic activity of 1 is enhanced by the surface-bound redox mediators [Ru (4,4'-PO3H2-bpy)(4,4'-R-bpy)2]2+ (RuPbpyR22+, R = Br, H, Me, or OMe, bpy = 2,2'-bipyridine). Rate-limiting ET between the Ru3+ form of the mediator and the RuIV(O) form in the [RuV/IV(O)]+/0 couple of 1 is observed at relatively high concentrations of HPO42– buffer base under conditions where O···O bond formation is facilitated by atom-proton transfer (APT). For the solution [Ru(bpy)3]3+/2+ mediator couple and 1 as the catalyst, catalytic currents vary systematically with the concentration of mediator and the HPO42– buffer base concentration. Electron transfer mediation of water oxidation catalysis was also investigated on nanoparticle TiO2 electrodes co-loaded with catalyst [Ru(bda)(py-4-O(CH2)3-PO3H2)2], 2, (py = pyridine) and RuPbpyR22+ (R = H, Me, or OMe) with an interplay between rate-limiting catalyst oxidation and rate-limiting O···O bond formation by APT. Lastly, the co-loaded assembly RuPbpyR22+ + 2 has been investigated in a dye-sensitized photoelectrosynthesis cell for water splitting.

  2. Detection of DNA hybridization using graphene-coated black phosphorus surface plasmon resonance sensor

    Science.gov (United States)

    Pal, Sarika; Verma, Alka; Raikwar, S.; Prajapati, Y. K.; Saini, J. P.

    2018-05-01

    In this paper, graphene-coated black phosphorus at the metal surface for the detection of DNA hybridization event is numerically demonstrated. The strategy consists of placing the sensing medium on top of black phosphorus-graphene-coated SPR which interfaces with phosphate-buffered saline solution carrying single-stranded DNA. Upon hybridization with its complementary DNA, desorption of the nanostructures takes place and thus enables the sensitive detection of the DNA hybridization event. The proposed sensor exhibits a sensitivity (125 ο/RIU), detection accuracy (0.95) and quality factor (13.62 RIU-1) for complementary DNA. In comparison with other reported papers, our suggested sensor provides much better performance. Thus, this label-free DNA detection platform should spur off new interest towards the use of black phosphorus-graphene-coated SPR interfaces.

  3. Mechanism of action of pefloxacin on surface morphology, DNA ...

    African Journals Online (AJOL)

    work-group

    2011-11-16

    Nov 16, 2011 ... Morphological alterations on the cell surface of the K. aerogenes was shown by scanning electron microscopy ... against Gram-negative bacteria involved in UTI, the ..... chromosome: possibility of two levels of action. Proc.

  4. Rapid outer-surface protein C DNA tattoo vaccination protects against Borrelia afzelii infection.

    Science.gov (United States)

    Wagemakers, A; Mason, L M K; Oei, A; de Wever, B; van der Poll, T; Bins, A D; Hovius, J W R

    2014-12-01

    Borrelia afzelii is the predominant Borrelia species causing Lyme borreliosis in Europe. Currently there is no human vaccine against Lyme borreliosis, and most research focuses on recombinant protein vaccines against Borrelia burgdorferi sensu stricto. DNA tattooing is a novel vaccination method that can be applied in a rapid vaccination schedule. We vaccinated C3H/HeN mice with B. afzelii strain PKo OspC (outer-surface protein C) using a codon-optimized DNA vaccine tattoo and compared this with recombinant protein vaccination in a 0-2-4 week vaccination schedule. We also assessed protection by DNA tattoo in a 0-3-6 day schedule. DNA tattoo and recombinant OspC vaccination induced comparable total IgG responses, with a lower IgG1/IgG2a ratio after DNA tattoo. Two weeks after syringe-challenge with 5 × 10(5) B. afzelii spirochetes most vaccinated mice had negative B. afzelii tissue DNA loads and all were culture negative. Furthermore, DNA tattoo vaccination in a 0-3-6 day regimen also resulted in negative Borrelia loads and cultures after challenge. To conclude, DNA vaccination by tattoo was fully protective against B. afzelii challenge in mice in a rapid vaccination protocol, and induces a favorable humoral immunity compared to recombinant protein vaccination. Rapid DNA tattoo is a promising vaccination strategy against spirochetes.

  5. Hybrid surface platform for the simultaneous detection of proteins and DNA using a surface plasmon resonance (SPR) imaging sensor

    Czech Academy of Sciences Publication Activity Database

    Homola, Jiří; Piliarik, Marek; Ladd, J.; Taylor, A.; Shaoyi, J.

    2008-01-01

    Roč. 80, č. 11 (2008), s. 4231-4236 ISSN 0003-2700 R&D Projects: GA AV ČR KAN200670701 Institutional research plan: CEZ:AV0Z20670512 Keywords : Surface plasmon resonance imaging * DNA-directed immobilization * protein array Subject RIV: JB - Sensors, Measurment, Regulation Impact factor: 5.712, year: 2008

  6. Cloning of a cDNA encoding a surface antigen of Schistosoma mansoni schistosomula recognized by sera of vassinated mice

    International Nuclear Information System (INIS)

    Dalton, J.P.; Tom, T.D.; Strand, M.

    1987-01-01

    Spleen cells of mice vaccinated with radiation-attenuated Schistosoma mansoni cercariae were used to produce monoclonal antibodies directed against newly transformed schistosomular surface antigens. One of these monoclonal antibodies recognized a polypeptide of 18 kDa. Binding was measured by radioimmunoassay. This glycoprotein was purified by monoclonal antibody immunoaffinity chromatography and a polyclonal antiserum was prepared against it. Immunofluorescence assays showed that the polyclonal antiserum bound to the surface of newly transformed schistosomula and lung-stage organisms but not to the surface of liver-stage and adult worms. Using this polyclonal antiserum we isolated recombinant clones from an adult worm cDNA expression library constructed in λgt11. Clone 654.2 contained an insert of 0.52 kilobase and hybridized to a 1.2-kilobase mRNA species from adult worms. Most importantly, clone 654.2 produced a fusion protein of 125 kDa that was reactive with sera of vaccinated mice that are capable of transferring resistance. This result encourages future vaccination trials with the fusion protein

  7. Evaluation of Skin Surface as an Alternative Source of Reference DNA Samples: A Pilot Study.

    Science.gov (United States)

    Albujja, Mohammed H; Bin Dukhyil, Abdul Aziz; Chaudhary, Abdul Rauf; Kassab, Ahmed Ch; Refaat, Ahmed M; Babu, Saranya Ramesh; Okla, Mohammad K; Kumar, Sachil

    2018-01-01

    An acceptable area for collecting DNA reference sample is a part of the forensic DNA analysis development. The aim of this study was to evaluate skin surface cells (SSC) as an alternate source of reference DNA sample. From each volunteer (n = 10), six samples from skin surface areas (forearm and fingertips) and two traditional samples (blood and buccal cells) were collected. Genomic DNA was extracted and quantified then genotyped using standard techniques. The highest DNA concentration of SSC samples was collected using the tape/forearm method of collection (2.1 ng/μL). Cotton swabs moistened with ethanol yielded higher quantities of DNA than swabs moistened with salicylic acid, and it gave the highest percentage of full STR profiles (97%). This study supports the use of SSC as a noninvasive sampling technique and as a extremely useful source of DNA reference samples among certain cultures where the use of buccal swabs can be considered socially unacceptable. © 2017 American Academy of Forensic Sciences.

  8. Efficient self-assembly of DNA-functionalized fluorophores and gold nanoparticles with DNA functionalized silicon surfaces: the effect of oligomer spacers

    Science.gov (United States)

    Milton, James A.; Patole, Samson; Yin, Huabing; Xiao, Qiang; Brown, Tom; Melvin, Tracy

    2013-01-01

    Although strategies for the immobilization of DNA oligonucleotides onto surfaces for bioanalytical and top-down bio-inspired nanobiofabrication approaches are well developed, the effect of introducing spacer molecules between the surface and the DNA oligonucleotide for the hybridization of nanoparticle–DNA conjugates has not been previously assessed in a quantitative manner. The hybridization efficiency of DNA oligonucleotides end-labelled with gold nanoparticles (1.4 or 10 nm diameter) with DNA sequences conjugated to silicon surfaces via hexaethylene glycol phosphate diester oligomer spacers (0, 1, 2, 6 oligomers) was found to be independent of spacer length. To quantify both the density of DNA strands attached to the surfaces and hybridization with the surface-attached DNA, new methodologies have been developed. Firstly, a simple approach based on fluorescence has been developed for determination of the immobilization density of DNA oligonucleotides. Secondly, an approach using mass spectrometry has been created to establish (i) the mean number of DNA oligonucleotides attached to the gold nanoparticles and (ii) the hybridization density of nanoparticle–oligonucleotide conjugates with the silicon surface–attached complementary sequence. These methods and results will be useful for application with nanosensors, the self-assembly of nanoelectronic devices and the attachment of nanoparticles to biomolecules for single-molecule biophysical studies. PMID:23361467

  9. Dielectric properties of DNA oligonucleotides on the surface of silicon nanostructures

    Energy Technology Data Exchange (ETDEWEB)

    Bagraev, N. T., E-mail: bagraev@mail.ioffe.ru [St. Petersburg Polytechnic University (Russian Federation); Chernev, A. L. [Russian Academy of Sciences, St. Petersburg Academic University—Nanotechnology Research and Education Center (Russian Federation); Klyachkin, L. E. [St. Petersburg Polytechnic University (Russian Federation); Malyarenko, A. M. [Russian Academy of Sciences, Ioffe Physical–Technical Institute (Russian Federation); Emel’yanov, A. K.; Dubina, M. V. [Russian Academy of Sciences, St. Petersburg Academic University—Nanotechnology Research and Education Center (Russian Federation)

    2016-10-15

    Planar silicon nanostructures that are formed as a very narrow silicon quantum well confined by δ barriers heavily doped with boron are used to study the dielectric properties of DNA oligonucleotides deposited onto the surface of the nanostructures. The capacitance characteristics of the silicon nanostructures with oligonucleotides deposited onto their surface are determined by recording the local tunneling current–voltage characteristics by means of scanning tunneling microscopy. The results show the possibility of identifying the local dielectric properties of DNA oligonucleotide segments consisting of repeating G–C pairs. These properties apparently give grounds to correlate the segments with polymer molecules exhibiting the properties of multiferroics.

  10. Modified surface of titanium dioxide nanoparticles-based biosensor for DNA detection

    Science.gov (United States)

    Nadzirah, Sh.; Hashim, U.; Rusop, M.

    2018-05-01

    A new technique was used to develop a simple and selective picoammeter DNA biosensor for identification of E. coli O157:H7. This biosensor was fabricated from titanium dioxide nanoparticles that was synthesized by sol-gel method and spin-coated on silicon dioxide substrate via spinner. 3-Aminopropyl triethoxy silane (APTES) was used to modify the surface of TiO2. Simple surface modification approach has been applied; which is single dropping of APTES onto the TiO2 nanoparticles surface. Carboxyl modified probe DNA has been bind onto the surface of APTES/TiO2 without any amplifier element. Electrical signal has been used as the indicator to differentiate each step (surface modification of TiO2 and probe DNA immobilization). The I-V measurements indicate extremely low current (pico-ampere) flow through the device which is 2.8138E-10 A for pure TiO2 nanoparticles, 2.8124E-10 A after APTES modification and 3.5949E-10 A after probe DNA immobilization.

  11. Molecular dynamics simulations of the DNA interaction with metallic nanoparticles and TiO2 surfaces

    International Nuclear Information System (INIS)

    Kholmurodov, Kh.T.; Krasavin, E.A.; Dushanov, E.B.; Hassan, H.K.; Galal, A.; ElHabashy, H.A.; Sweilam, N.H.; Yasuoka, K.

    2013-01-01

    The understanding of the mechanism of DNA interactions and binding with metallic nanoparticles (NPs) and surfaces represents a great interest in today's medicine applications due to diagnostic and treatment of oncology diseases. Recent experimental and simulation studies involve the DNA interaction with highly localized proton beams or metallic NPs (such as Ag, Au, etc.), aimed at targeted cancer therapy through the injection of metal micro- or nanoparticles into the tumor tissue with consequent local microwave or laser heating. The effects of mutational structure changes in DNA and protein structures could result in destroying of native chemical (hydrogen) bonds or, on the contrary, creating of new bonds that do not normally exist there. The cause of such changes might be the alteration of one or several nucleotides (in DNA) or the substitution of specific amino acid residues (in proteins) that can lead to the essential structural destabilization or unfolding. At the atomic or molecular level, the replacement of one nucleotide by another (in DNA double helices) or replacement of one amino acid residue by another (in proteins) cause essential modifications of the molecular force fields of the environment that break locally important hydrogen bonds underlying the structural stability of the biological molecules. In this work, the molecular dynamics(MD) simulations were performed for four DNA models and the flexibilities of the purine and pyrimidine nucleotides during the interaction process with the metallic NPs and TiO 2 surface were clarified

  12. Surface-bound capsular polysaccharide of type Ia group B Streptococcus mediates C1 binding and activation of the classic complement pathway

    International Nuclear Information System (INIS)

    Levy, N.J.; Kasper, D.L.

    1986-01-01

    The role of surface-bound type Ia group B Streptococcus (GBS) capsular polysaccharide in anti-body-independent binding of C1 and activation of the classic component pathway was investigated. In a radiolabeled bacterial-polymorphonuclear leukocyte (PMN) association assay, a measure of bacterial opsonization, preincubation of 3 H-type Ia GBS with purified F(ab') 2 to the organism blocked the association of the bacteria with PMN', and the inhibitory effect was dose dependent. The specificity of F(ab') 2 blocking was shown after adsorption of F(ab') 2 with type Ia polysaccharide-sensitized erythrocytes. Polysaccharide-adsorbed F(ab') 2 had a 70% decrease in ability to block the association of bacteria with PMN. Neuraminidase digestion removed 80% of the terminal sialic acid residues from the native polysaccharide. These neuraminidase-digested organisms had a 72% decrease in binding and transfer of purified C1 compared with non-enzyme-treated organisms. Type Ia capsular polysaccharide bound to sheep erythrocytes promoted classic complement pathway-mediated hemolysis of the cells. The role of C1 inhibitor (INH) in modulation of C1 activation by the organisms was investigated. The possibility existed that the C1 INH could be bound by the bacteria, allowing C1 activation to occur in the fluid phase. The inhibitor was purified from human serum, and its activity was measured before and after incubation with type Ia GBS. The organisms had no effect on C1 INH activity. Thus surface-bound capsular polysacchardie of type Ia GBS mediates C1 binding and classic pathway activation, and this does not involve the C1 INH

  13. Enantioselective light switch effect of Δ- and Λ-[Ru(phenanthroline)2 dipyrido[3,2-a:2', 3'-c]phenazine]2+ bound to G-quadruplex DNA.

    Science.gov (United States)

    Park, Jin Ha; Lee, Hyun Suk; Jang, Myung Duk; Han, Sung Wook; Kim, Seog K; Lee, Young-Ae

    2018-06-01

    The interaction of Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ (DPPZ = dipyrido[3,2-a:2', 3'-c]phenazine, phen = phenanthroline) with a G-quadruplex formed from 5'-G 2 T 2 G 2 TGTG 2 T 2 G 2-3 '(15-mer) was investigated. The well-known enhancement of luminescence intensity (the 'light-switch' effect) was observed for the [Ru(phen) 2 DPPZ] 2+ complexes upon formation of an adduct with the G-quadruplex. The emission intensity of the G-quadruplex-bound Λ-isomer was 3-fold larger than that of the Δ-isomer when bound to the G-quadruplex, which is opposite of the result observed in the case of double stranded DNA (dsDNA); the light switch effect is larger for the dsDNA-bound Δ-isomer. In the job plot of the G-quadruplex with Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ , a major inflection point for the two isomers was observed at x ≈ .65, which suggests a binding stoichiometry of 2:1 for both enantiomers. When the G base at the 8th position was replaced with 6-methyl isoxanthopterin (6MI), a fluorescent guanine analog, the excited energy of 6-MI transferred to bound Δ- or Λ-[Ru(phen) 2 DPPZ] 2+ , which suggests that at least a part of both Ru(II) enantiomers is close to or in contact with the diagonal loop of the G-quadruplex. A luminescence quenching experiment using [Fe(CN) 6 ] 4- for the G-quadruplex-bound Ru(II) complex revealed downward bending curves for both enantiomers in the Stern-Volmer plot, which suggests the presence of Ru(II) complexes that are both accessible and inaccessible to the quencher and may be related to the 2:1 binding stoichiometry.

  14. Adsorption and combing of DNA on HOPG surfaces of bulk crystals and nanosheets: application to the bridging of DNA between HOPG/Si heterostructures

    International Nuclear Information System (INIS)

    Rose, F; Martin, P; Fujita, H; Kawakatsu, H

    2006-01-01

    Controlled and reproducible combing of λ-phage DNA molecules can be realized in predetermined orientations on highly oriented pyrolitic graphite (HOPG) surfaces. Observations by atomic force microscopy (AFM) show that DNA adsorption onto HOPG surfaces leads to different hierarchical organizations such as balls, networks, films, and fractal structures. HOPG nanosheets (3.5-100 nm thick) were created by simply rubbing a HOPG crystal onto a silicon oxide surface, and then patterned with a focused ion beam (FIB) to fabricate HOPG/Si heterostructures (arrays of silicon micropillars and microtracks decorated on their top surface with HOPG nanosheets). The surface reactivity of HOPG nanosheets toward DNA is found to be the same as of HOPG bulk crystals. Finally, combing is used to attach and suspend bundles of approximately 20-50 DNA molecules between HOPG/Si heterostructures

  15. Isolate extended state in the DNA molecular transistor with surface interaction

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Le, E-mail: wang_le917@gs.zzu.edu.cn; Qin, Zhi-Jie

    2016-02-01

    The field effect characteristic of a DNA molecular device is investigated in a tight binding model with binary disorder and side site correlation. Using the transfer-matrix method and Landauer–Büttiker theory, we find that the system has isolated extended state that is irrespective of the DNA sequence and can be modulated by the gate voltage. When the gate voltage reaches some proper value, the isolated extended state appears at the Fermi level of the system and the long range charge transport is greatly enhanced. We attribute this phenomenon to the combination of the external field, the surface interaction, and the intrinsic disorder of DNA. The result is a generic feature of the nanowire with binary disorder and surface interaction.

  16. Single helically folded aromatic oligoamides that mimic the charge surface of double-stranded B-DNA

    Science.gov (United States)

    Ziach, Krzysztof; Chollet, Céline; Parissi, Vincent; Prabhakaran, Panchami; Marchivie, Mathieu; Corvaglia, Valentina; Bose, Partha Pratim; Laxmi-Reddy, Katta; Godde, Frédéric; Schmitter, Jean-Marie; Chaignepain, Stéphane; Pourquier, Philippe; Huc, Ivan

    2018-05-01

    Numerous essential biomolecular processes require the recognition of DNA surface features by proteins. Molecules mimicking these features could potentially act as decoys and interfere with pharmacologically or therapeutically relevant protein-DNA interactions. Although naturally occurring DNA-mimicking proteins have been described, synthetic tunable molecules that mimic the charge surface of double-stranded DNA are not known. Here, we report the design, synthesis and structural characterization of aromatic oligoamides that fold into single helical conformations and display a double helical array of negatively charged residues in positions that match the phosphate moieties in B-DNA. These molecules were able to inhibit several enzymes possessing non-sequence-selective DNA-binding properties, including topoisomerase 1 and HIV-1 integrase, presumably through specific foldamer-protein interactions, whereas sequence-selective enzymes were not inhibited. Such modular and synthetically accessible DNA mimics provide a versatile platform to design novel inhibitors of protein-DNA interactions.

  17. Characteristics of the resonant instability of surface electrostatic-ion-cyclotron waves in a semi-bounded warm magnetized dusty plasma

    Energy Technology Data Exchange (ETDEWEB)

    Hong, Woo-Pyo [Department of Electronics Engineering, Catholic University of Daegu, Hayang, 38430 (Korea, Republic of); Jung, Young-Dae, E-mail: ydjung@hanyang.ac.kr [Department of Applied Physics and Department of Bionanotechnology, Hanyang University, Ansan, Kyunggi-Do 15588 (Korea, Republic of); Department of Physics, Applied Physics, and Astronomy, Rensselaer Polytechnic Institute, 110 8th Street, Troy, NY 12180-3590 (United States)

    2016-03-11

    The influence of magnetic field and dust rotation on the resonant instability of surface electrostatic-ion-cyclotron wave is kinetically investigated in a semi-bounded warm magnetized dusty plasma. The dispersion relation and the temporal growth rate of the surface electrostatic-ion-cyclotron wave are derived by the specular-reflection boundary condition including the magnetic field and dust rotation effects. It is found that the instability domain decreases with an increase of the rotation frequency of elongated dust grain. It is also found that the dependence of the propagation wave number on the temporal growth rate is more significant for small ion cyclotron frequencies. In addition, it is shown that the scaled growth rate increases with an increase of the strength of magnetic field. The variation of the domain and magnitude of temporal growth rate due to the change of plasma parameters is also discussed. - Highlights: • The resonant instability of surface electrostatic-ion-cyclotron wave is investigated in a semi-bounded magnetized dusty plasma. • The dispersion relation and the temporal growth rate are derived by the specular-reflection condition. • The influence of magnetic field and dust rotation on the resonant instability is discussed.

  18. Influence of the Debye length on the interaction of a small molecule-modified Au nanoparticle with a surface-bound bioreceptor.

    Science.gov (United States)

    Bukar, Natalia; Zhao, Sandy Shuo; Charbonneau, David M; Pelletier, Joelle N; Masson, Jean-Francois

    2014-05-18

    We report that a shorter Debye length and, as a consequence, decreased colloidal stability are required for the molecular interaction of folic acid-modified Au nanoparticles (Au NPs) to occur on a surface-bound receptor, human dihydrofolate reductase (hDHFR). The interaction measured using surface plasmon resonance (SPR) sensing was optimal in a phosphate buffer at pH 6 and ionic strength exceeding 300 mM. Under these conditions, the aggregation constant of the Au NPs was approximately 10(4) M(-1) s(-1) and the Debye length was below 1 nm, on the same length scale as the size of the folate anion (approximately 0.8 nm). Longer Debye lengths led to poorer SPR responses, revealing a reduced affinity of the folic acid-modified Au NPs for hDHFR. While high colloidal stability of Au NPs is desired in most applications, these conditions may hinder molecular interactions due to Debye lengths exceeding the size of the ligand and thus preventing close interactions with the surface-bound molecular receptor.

  19. A case study characterizing animal fecal sources in surface water using a mitochondrial DNA marker.

    Science.gov (United States)

    Bucci, John P; Shattuck, Michelle D; Aytur, Semra A; Carey, Richard; McDowell, William H

    2017-08-01

    Water quality impairment by fecal waste in coastal watersheds is a public health issue. The present study provided evidence for the use of a mitochondrial (mtDNA) marker to detect animal fecal sources in surface water. The accurate identification of fecal pollution is based on the notion that fecal microorganisms preferentially inhabit a host animal's gut environment. In contrast, mtDNA host-specific markers are inherent to eukaryotic host cells, which offers the advantage by detecting DNA from the host rather than its fecal bacteria. The present study focused on sampling water presumably from non-point sources (NPS), which can increase bacterial and nitrogen concentrations to receiving water bodies. Stream sampling sites located within the Piscataqua River Watershed (PRW), New Hampshire, USA, were sampled from a range of sites that experienced nitrogen inputs such as sewer and septic systems and suburban runoff. Three mitochondrial (mtDNA) gene marker assays (human, bovine, and canine) were tested from surface water. Nineteen sites were sampled during an 18-month period. Analyses of the combined single and multiplex assay results showed that the proportion of occurrence was highest for bovine (15.6%; n = 77) compared to canine (5.6%; n = 70) and human (5.7%; n = 107) mtDNA gene markers. For the human mtDNA marker, there was a statistically significant relationship between presence vs. absence and land use (Fisher's test p = 0.0031). This result was evident particularly for rural suburban septic, which showed the highest proportion of presence (19.2%) compared to the urban sewered (3.3%), suburban sewered (0%), and agricultural (0%) as well as forested septic (0%) sites. Although further testing across varied land use is needed, our study provides evidence for using the mtDNA marker in large watersheds.

  20. Enhanced immunogenicity of DNA fusion vaccine encoding secreted hepatitis B surface antigen and chemokine RANTES

    International Nuclear Information System (INIS)

    Kim, Seung Jo; Suh, Dongchul; Park, Sang Eun; Park, Jeong-Sook; Byun, Hyang-Min; Lee, Chan; Lee, Sun Young; Kim, Inho; Oh, Yu-Kyoung

    2003-01-01

    To increase the potency of DNA vaccines, we constructed genetic fusion vaccines encoding antigen, secretion signal, and/or chemokine RANTES. The DNA vaccines encoding secreted hepatitis B surface antigen (HBsAg) were constructed by inserting HBsAg gene into an expression vector with an endoplasmic reticulum (ER)-targeting secretory signal sequence. The plasmid encoding secretory HBsAg (pER/HBs) was fused to cDNA of RANTES, generating pER/HBs/R. For comparison, HBsAg genes were cloned into pVAX1 vector with no signal sequence (pHBs), and further linked to the N-terminus of RANTES (pHBs/R). Immunofluorescence study showed the cytoplasmic localization of HBsAg protein expressed from pHBs and pHBs/R, but not from pER/HBs and pER/HBs/R at 48 h after transfection. In mice, RANTES-fused DNA vaccines more effectively elicited the levels of HBsAg-specific IgG antibodies than pHBs. All the DNA vaccines induced higher levels of IgG 2a rather than IgG 1 antibodies. Of RANTES-fused vaccines, pER/HBs/R encoding the secreted fusion protein revealed much higher humoral and CD8 + T cell-stimulating responses compared to pHBs/R. These results suggest that the immunogenicity of DNA vaccines could be enhanced by genetic fusion to a secretory signal peptide sequence and RANTES

  1. Bacterial DNA of Ocean and Land on the Surface of the International Space Station.

    Science.gov (United States)

    Grebennikova, Tatiana

    A.V. Syroeshkin2, T.V. Grebennikova1, E.V. Shubralova3, V.A. Shuvalov3, O.S. Tsygankov4, V.B. Lapshin2 1D. I. Ivanovsky Virology Institute, Moscow, Russia 2 Academician E. K. Fedorov Institute of Applied Geophysics, Moscow, Russia 3S.P. Korolev Rocket and Space Corporation «Energia» Korolev, Russia 4Central Research Institute of Machine Building, Korolev, Russia Existence of biological molecules as markers of microorganisms in the space environment has always attracted attention of researchers. There is great attention to the search for extraterrestrial life forms [Nicholson W.L. 2009, Kawaguchi Y. et al 2013], and as well as the coping mechanisms of living organisms in the interplanetary space [Hotchin J. et al 1965, Baranov V.M. 2009, Horneck G. et al 2010]. Experiments on American and Japanese segments of the International Space Station (ISS) over the different nature of resistance during prolonged stay in space were conducted [Scalzi G et al 2012, Wassmann M. et al 2012]. As a result of these experiments confirmed the possibility of preserving the viability of organisms in an open space for a long time. Consequence, became interested in the transfer of living matter from the stratosphere to near-Earth space [Smith D.J. 2013]. We hypothesized that viable forms, or at least, intact DNA can be transferred to the orbit of the ISS with the ascending branch of the global electric circuit. Samples of cosmic dust collected from the surface of the window of the ISS during the exit of an astronaut in space. Samples (washes with material of tampons and tampons) which were in vacuo, were analyzed for the presence of bacterial DNA by nested PCR using primers specific DNA genus Mycobacterium, the DNA of the strain of the genus Bacillus anthracis and DNA encoding the bacterial 16S ribosomal RNA after transportation of the samples to Earth. The results of amplification, followed by sequencing and phylogenetic analysis showed the presence in samples of cosmic dust DNA

  2. Structure of DNA-Cationic Surfactant Complexes at Hydrophobically Modified and Hydrophilic Silica Surfaces as Revealed by Neutron Reflectometry

    DEFF Research Database (Denmark)

    Cardenas Gomez, Marite; Wacklin, Hanna; Campbell, Richard A.

    2011-01-01

    with dodecyltrimethylammonium bromide (DTAB) and hexadecyltrimethylammonium bromide (CTAB) on hydrophobic surfaces, where we show that DNA molecules are located on top of a self-assembled surfactant monolayer, with the thickness of the DNA layer and the surfactant DNA ratio determined by the surface coverage of the underlying...... interfacial structures, a higher concentration in relation to its cmc is required for the more soluble DTAB surfactant with a shorter alkyl chain than for CTAB. Our results suggest that the DNA Molecules Will spontaneously form a relatively dense, thin layer on top of a surfactant monolayer (hydrophobic...... surface) or a layer of admicelles (hydrophilic surface) as long as the surface concentration of surfactant is great enough to ensure a high interfacial-charge density. These findings have implications for bioanalytical and nanotechnology applications, which require the deposition of DNA layers with well...

  3. Importance of length and sequence order on magnesium binding to surface-bound oligonucleotides studied by second harmonic generation and atomic force microscopy.

    Science.gov (United States)

    Holland, Joseph G; Geiger, Franz M

    2012-06-07

    The binding of magnesium ions to surface-bound single-stranded oligonucleotides was studied under aqueous conditions using second harmonic generation (SHG) and atomic force microscopy (AFM). The effect of strand length on the number of Mg(II) ions bound and their free binding energy was examined for 5-, 10-, 15-, and 20-mers of adenine and guanine at pH 7, 298 K, and 10 mM NaCl. The binding free energies for adenine and guanine sequences were calculated to be -32.1(4) and -35.6(2) kJ/mol, respectively, and invariant with strand length. Furthermore, the ion density for adenine oligonucleotides did not change as strand length increased, with an average value of 2(1) ions/strand. In sharp contrast, guanine oligonucleotides displayed a linear relationship between strand length and ion density, suggesting that cooperativity is important. This data gives predictive capabilities for mixed strands of various lengths, which we exploit for 20-mers of adenines and guanines. In addition, the role sequence order plays in strands of hetero-oligonucleotides was examined for 5'-A(10)G(10)-3', 5'-(AG)(10)-3', and 5'-G(10)A(10)-3' (here the -3' end is chemically modified to bind to the surface). Although the free energy of binding is the same for these three strands (averaged to be -33.3(4) kJ/mol), the total ion density increases when several guanine residues are close to the 3' end (and thus close to the solid support substrate). To further understand these results, we analyzed the height profiles of the functionalized surfaces with tapping-mode atomic force microscopy (AFM). When comparing the average surface height profiles of the oligonucleotide surfaces pre- and post- Mg(II) binding, a positive correlation was found between ion density and the subsequent height decrease following Mg(II) binding, which we attribute to reductions in Coulomb repulsion and strand collapse once a critical number of Mg(II) ions are bound to the strand.

  4. A Polymethyl Methacrylate-Based Acrylic Dental Resin Surface Bound with a Photoreactive Polymer Inhibits Accumulation of Bacterial Plaque.

    Science.gov (United States)

    Fukunishi, Miya; Inoue, Yuuki; Morisaki, Hirobumi; Kuwata, Hirotaka; Ishihara, Kazuhiko; Baba, Kazuyoshi

    The aim of this study was to examine the ability of a poly(2-methacryloyloxyethyl phosphorylcholine-co-n-butylmethacrylate-co-2-methacryloyloxyethyloxy-p-azidobenzoate) (PMBPAz) coating on polymethyl methacrylate (PMMA)-based dental resin to inhibit bacterial plaque formation, as well as the polymer's durability against water soaking and chemical exposure. Successful application of PMBPAz on PMMA surfaces was confirmed by x-ray photoelectron spectroscopy (XPS) and measuring the static air contact angle in water. The anti-adhesive effects to bacterial plaque were evaluated using Streptococcus mutans biofilm formation assay. The mechanical and chemical durabilities of the PMBPAz coating on the PMMA surfaces were examined using soaking and immersion tests, respectively. XPS signals for phosphorus and nitrogen atoms and hydrophilic status on PMMA surfaces treated with PMBPAz were observed, indicating the presence of the polymer on the substrates. The treated PMMA surfaces showed significant inhibition of S mutans biofilm formation compared to untreated surfaces. The PMBPAz coating was preserved after water soaking and chemical exposure. In addition, water soaking did not decrease the ability of treated PMMA to inhibit biofilm formation compared to treated PMMA specimens not subjected to water soaking. This study suggests that PMBPAz coating may represent a useful modification to PMMA surfaces for inhibiting denture plaque accumulation.

  5. Metal Nanoparticles/Porous Silicon Microcavity Enhanced Surface Plasmon Resonance Fluorescence for the Detection of DNA

    Directory of Open Access Journals (Sweden)

    Jiajia Wang

    2018-02-01

    Full Text Available A porous silicon microcavity (PSiMC with resonant peak wavelength of 635 nm was fabricated by electrochemical etching. Metal nanoparticles (NPs/PSiMC enhanced fluorescence substrates were prepared by the electrostatic adherence of Au NPs that were distributed in PSiMC. The Au NPs/PSiMC device was used to characterize the target DNA immobilization and hybridization with its complementary DNA sequences marked with Rhodamine red (RRA. Fluorescence enhancement was observed on the Au NPs/PSiMC device substrate; and the minimum detection concentration of DNA ran up to 10 pM. The surface plasmon resonance (SPR of the MC substrate; which is so well-positioned to improve fluorescence enhancement rather the fluorescence enhancement of the high reflection band of the Bragg reflector; would welcome such a highly sensitive in biosensor.

  6. Metal Nanoparticles/Porous Silicon Microcavity Enhanced Surface Plasmon Resonance Fluorescence for the Detection of DNA.

    Science.gov (United States)

    Wang, Jiajia; Jia, Zhenhong

    2018-02-23

    A porous silicon microcavity (PSiMC) with resonant peak wavelength of 635 nm was fabricated by electrochemical etching. Metal nanoparticles (NPs)/PSiMC enhanced fluorescence substrates were prepared by the electrostatic adherence of Au NPs that were distributed in PSiMC. The Au NPs/PSiMC device was used to characterize the target DNA immobilization and hybridization with its complementary DNA sequences marked with Rhodamine red (RRA). Fluorescence enhancement was observed on the Au NPs/PSiMC device substrate; and the minimum detection concentration of DNA ran up to 10 pM. The surface plasmon resonance (SPR) of the MC substrate; which is so well-positioned to improve fluorescence enhancement rather the fluorescence enhancement of the high reflection band of the Bragg reflector; would welcome such a highly sensitive in biosensor.

  7. Topics in bound-state dynamical processes: semiclassical eigenvalues, reactive scattering kernels and gas-surface scattering models

    International Nuclear Information System (INIS)

    Adams, J.E.

    1979-05-01

    The difficulty of applying the WKB approximation to problems involving arbitrary potentials has been confronted. Recent work has produced a convenient expression for the potential correction term. However, this approach does not yield a unique correction term and hence cannot be used to construct the proper modification. An attempt is made to overcome the uniqueness difficulties by imposing a criterion which permits identification of the correct modification. Sections of this work are: semiclassical eigenvalues for potentials defined on a finite interval; reactive scattering exchange kernels; a unified model for elastic and inelastic scattering from a solid surface; and selective absorption on a solid surface

  8. DNA of Dientamoeba fragilis detected within surface-sterilized eggs of Enterobius vermicularis.

    Science.gov (United States)

    Röser, Dennis; Nejsum, Peter; Carlsgart, Anne Josefine; Nielsen, Henrik Vedel; Stensvold, Christen Rune

    2013-01-01

    With no evidence of a cyst stage, the mode of transmission of Dientamoeba fragilis, an intestinal protozoon of common occurrence and suggested pathogenicity, is incompletely known. Numerous studies have suggested that eggs of intestinal nematodes, primarily Enterobius vermicularis (pinworm), can serve as vectors for D. fragilis, although attempts to culture D. fragilis from pinworm eggs have been unsuccessful and data from epidemiological studies on D. fragilis/pinworm co-infection have been conflicting. The aim of this study was to investigate whether we could detect D. fragilis DNA from pinworm eggs collected from routine diagnostic samples (cellophane tape) and surface-sterilised by hypochlorite. DNA was extracted from individual eggs and tested by PCR using D. fragilis- and E. vermicularis-specific primers; amplicons were sequenced for confirmation. In cellophane tape samples from 64 patients with unknown D. fragilis status we detected D. fragilis DNA in 12/238 (5%) eggs, and in a patient known to harbour D. fragilis we detected D. fragilis DNA in 39/99 (39%) eggs. The finding of D. fragilis DNA within eggs of E. vermicularis strongly supports the hypothesis of D. fragilis-transmission by pinworm and has implications for antimicrobial intervention as well as control and public health measures. Copyright © 2012 Elsevier Inc. All rights reserved.

  9. Controlled amino-functionalization by electrochemical reduction of bromo and nitro azobenzene layers bound to Si(111) surfaces

    NARCIS (Netherlands)

    Ullien, D.; Thüne, P.C.; Jager, W.F.; Sudhölter, E.J.R.; De Smet, L.C.P.M.

    2014-01-01

    4-Nitrobenzenediazonium (4-NBD) and 4-bromobenzenediazonium (4-BBD) salts were grafted electrochemically onto H-terminated, p-doped silicon (Si) surfaces. Atomic force microscopy (AFM) and ellipsometry experiments clearly showed layer thicknesses of 2–7 nm, which indicate multilayer formation.

  10. Acid-base properties and the chemical imaging of surface-bound functional groups studied with scanning force microscopy

    NARCIS (Netherlands)

    van der Vegte, E.W.; Hadziioannou, G

    1997-01-01

    In this paper we present a scanning force microscopy (SFM) study on electrostatic and hydrogen-bonding interactions between chemically modified SFM probes and surface functional groups. pH-dependent adhesion force measurements in aqueous media between various ionizable functional groups showed a

  11. On the lipid head group hydration of floating surface monolayers bound to self-assembled molecular protein layers

    DEFF Research Database (Denmark)

    Lösche, M.; Erdelen, C.; Rump, E.

    1994-01-01

    kept at low surface pressure before protein adsorption. The introduction of dipole moments at the interface by the admixture of phospholipids or the application of lateral pressure on the lipid monolayer before protein adsorption were found to impose an extension of the spacer moieties. The biotin...

  12. Photogeneration of singlet oxygen by the phenothiazine derivatives covalently bound to the surface-modified glassy carbon

    Energy Technology Data Exchange (ETDEWEB)

    Blacha-Grzechnik, Agata, E-mail: agata.blacha@polsl.pl [Faculty of Chemistry, Silesian University of Technology, Strzody 9, 44-100 Gliwice (Poland); Piwowar, Katarzyna; Krukiewicz, Katarzyna [Faculty of Chemistry, Silesian University of Technology, Strzody 9, 44-100 Gliwice (Poland); Koscielniak, Piotr; Szuber, Jacek [Institute of Electronics, Silesian University of Technology, Akademicka 16, 44-100 Gliwice (Poland); Zak, Jerzy K. [Faculty of Chemistry, Silesian University of Technology, Strzody 9, 44-100 Gliwice (Poland)

    2016-05-15

    Highlights: • The selected group of four NH{sub 2}-derivatives of phenothiazine was grafted to Glassy Carbon (GC) surface. • The grafted phenothiazines are able to generate {sup 1}O{sub 2} when activated by the radiation. • Such modified solid surfaces may find their application in the wastewater treatment. - Abstract: The selected group of four amine-derivatives of phenothiazine was covalently grafted to the glassy carbon surface in the four-step procedure consisting of the electrochemical reduction of the diazonium salt followed by the electrochemical and chemical post-modification steps. The proposed strategy involves the bonding of linker molecule to which the photosensitizer is attached. The synthesized organic layers were characterized by means of cyclic voltammetry, XPS and Raman Spectroscopy. It was shown that the phenothiazines immobilized via proposed strategy retain their photochemical properties and are able to generate {sup 1}O{sub 2} when activated by the laser radiation. The effectiveness of in situ singlet oxygen generation by those new solid photoactive materials was determined by means of UVVis spectroscopy. The reported, covalently modified solid surfaces may find their application as the singlet oxygen photogenerators in the fine chemicals’ synthesis or in the wastewater treatment.

  13. Fabrication of endothelial progenitor cell capture surface via DNA aptamer modifying dopamine/polyethyleneimine copolymer film

    Energy Technology Data Exchange (ETDEWEB)

    Li, Xin; Deng, Jinchuan; Yuan, Shuheng; Wang, Juan; Luo, Rifang; Chen, Si [Key Lab. of Advanced Technology for Materials of Education Ministry, Southwest Jiaotong University, Chengdu 610031 (China); School of Material Science and Engineering, Southwest Jiaotong University, Chengdu 610031 (China); Wang, Jin, E-mail: jinxxwang@263.net [Key Lab. of Advanced Technology for Materials of Education Ministry, Southwest Jiaotong University, Chengdu 610031 (China); Huang, Nan [Key Lab. of Advanced Technology for Materials of Education Ministry, Southwest Jiaotong University, Chengdu 610031 (China); School of Material Science and Engineering, Southwest Jiaotong University, Chengdu 610031 (China)

    2016-11-15

    Highlights: • The dopamine/PEI film with controlled amine density was successfully prepared. • The DNA aptamer was assembled onto the film via electrostatic incorporation. • The A@DPfilmscanspecificallyandeffectivelycaptureEPCs. • The A@DP film can support the survival of ECs, control the hyperplasia of SMCs. • The dynamic/co-culture models are useful for studying cells competitive adhesion. - Abstract: Endothelial progenitor cells (EPCs) are mainly located in bone marrow and circulate, and play a crucial role in repairmen of injury endothelium. One of the most promising strategies of stents designs were considered to make in-situ endothelialization in vivo via EPC-capture biomolecules on a vascular graft to capture EPCs directly from circulatory blood. In this work, an EPC specific aptamer with a 34 bases single strand DNA sequence was conjugated onto the stent surface via dopamine/polyethyleneimine copolymer film as a platform and linker. The assembled density of DNA aptamer could be regulated by controlling dopamine percentage in this copolymer film. X-ray photoelectron spectroscopy (XPS), water contact angle (WCA) and fluorescence test confirmed the successful immobilization of DNA aptamer. To confirm its biofunctionality and cytocompatibility, the capturing cells ability of the aptamer modified surface and the effects on the growth behavior of human umbilical vein endothelial cells (HUVECs), smooth muscle cells (SMCs) were investigated. The aptamer functionalized sample revealed a good EPC-capture ability, and had a cellular friendly feature for both EPC and EC growth, while not stimulated the hyperplasia of SMCs. And, the co-culture experiment of three types of cells confirmed the specificity capturing of EPCs to aptamer modified surface, rather than ECs and SMCs. These data suggested that this aptamer functionalized surface may have a large potentiality for the application of vascular grafts with targeted endothelialization.

  14. Fabrication of endothelial progenitor cell capture surface via DNA aptamer modifying dopamine/polyethyleneimine copolymer film

    International Nuclear Information System (INIS)

    Li, Xin; Deng, Jinchuan; Yuan, Shuheng; Wang, Juan; Luo, Rifang; Chen, Si; Wang, Jin; Huang, Nan

    2016-01-01

    Highlights: • The dopamine/PEI film with controlled amine density was successfully prepared. • The DNA aptamer was assembled onto the film via electrostatic incorporation. • The A@DPfilmscanspecificallyandeffectivelycaptureEPCs. • The A@DP film can support the survival of ECs, control the hyperplasia of SMCs. • The dynamic/co-culture models are useful for studying cells competitive adhesion. - Abstract: Endothelial progenitor cells (EPCs) are mainly located in bone marrow and circulate, and play a crucial role in repairmen of injury endothelium. One of the most promising strategies of stents designs were considered to make in-situ endothelialization in vivo via EPC-capture biomolecules on a vascular graft to capture EPCs directly from circulatory blood. In this work, an EPC specific aptamer with a 34 bases single strand DNA sequence was conjugated onto the stent surface via dopamine/polyethyleneimine copolymer film as a platform and linker. The assembled density of DNA aptamer could be regulated by controlling dopamine percentage in this copolymer film. X-ray photoelectron spectroscopy (XPS), water contact angle (WCA) and fluorescence test confirmed the successful immobilization of DNA aptamer. To confirm its biofunctionality and cytocompatibility, the capturing cells ability of the aptamer modified surface and the effects on the growth behavior of human umbilical vein endothelial cells (HUVECs), smooth muscle cells (SMCs) were investigated. The aptamer functionalized sample revealed a good EPC-capture ability, and had a cellular friendly feature for both EPC and EC growth, while not stimulated the hyperplasia of SMCs. And, the co-culture experiment of three types of cells confirmed the specificity capturing of EPCs to aptamer modified surface, rather than ECs and SMCs. These data suggested that this aptamer functionalized surface may have a large potentiality for the application of vascular grafts with targeted endothelialization.

  15. Controlled enzymatic cutting of DNA molecules adsorbed on surfaces using soft lithography

    Science.gov (United States)

    Auerbach, Alyssa; Budassi, Julia; Shea, Emily; Zhu, Ke; Sokolov, Jonathan

    2013-03-01

    The enzyme DNase I was applied to adsorbed and aligned DNA molecules (Lamda, 48.5 kilobase pairs (kbp), and T4, 165.6 kbp), stretched linearly on a surface, by stamping with a polydimethylsiloxane (PDMS) grating. The DNAs were cut by the enzyme into separated, micron-sized segments along the length of the molecules at positions determined by the grating dimensions (3-20 microns). Ozone-treated PDMS stamps were coated with DNase I solutions and placed in contact with surface-adsorbed DNA molecules deposited on a 750 polymethylmethacrylate (PMMA) film spun-cast onto a silicon substrate. The stamps were applied under pressure for times up to 15 minutes at 37 C. The cutting was observed by fluorescence microscopy imaging of DNA labeled with YOYO dye. Cutting was found to be efficient despite the steric hindrance due to surface attachment of the molecules. Methods for detaching and separating the cut segments for sequencing applications will be discussed. Supported by NSF-DMR program.

  16. Electronic properties and assambly of DNA-based molecules on gold surfaces

    DEFF Research Database (Denmark)

    Salvatore, Princia

    , highly base specific voltammetric peak in the presence of spermidine ions. A capacitive origin was attributed to this peak, and a novel route to detection of hybridization and base pair mismatches proposed on the basis of the high sensitivity to base pair mismatches showed by such ON-based monolayers...... as widely employed as Au(111) surfaces). In particular, SERS offered a valuable and rapid way ofcharacterising interactions between the DNA-based molecules and the NP surface, with no need for complex sample preparation....

  17. Symmetry conditions of a nodal superconductor for generating robust flat-band Andreev bound states at its dirty surface

    Science.gov (United States)

    Ikegaya, Satoshi; Kobayashi, Shingo; Asano, Yasuhiro

    2018-05-01

    We discuss the symmetry property of a nodal superconductor that hosts robust flat-band zero-energy states at its surface under potential disorder. Such robust zero-energy states are known to induce the anomalous proximity effect in a dirty normal metal attached to a superconductor. A recent study has shown that a topological index NZES describes the number of zero-energy states at the dirty surface of a p -wave superconductor. We generalize the theory to clarify the conditions required for a superconductor that enables NZES≠0 . Our results show that NZES≠0 is realized in a topological material that belongs to either the BDI or CII class. We also present two realistic Hamiltonians that result in NZES≠0 .

  18. DnaA protein DNA-binding domain binds to Hda protein to promote inter-AAA+ domain interaction involved in regulatory inactivation of DnaA.

    Science.gov (United States)

    Keyamura, Kenji; Katayama, Tsutomu

    2011-08-19

    Chromosomal replication is initiated from the replication origin oriC in Escherichia coli by the active ATP-bound form of DnaA protein. The regulatory inactivation of DnaA (RIDA) system, a complex of the ADP-bound Hda and the DNA-loaded replicase clamp, represses extra initiations by facilitating DnaA-bound ATP hydrolysis, yielding the inactive ADP-bound form of DnaA. However, the mechanisms involved in promoting the DnaA-Hda interaction have not been determined except for the involvement of an interaction between the AAA+ domains of the two. This study revealed that DnaA Leu-422 and Pro-423 residues within DnaA domain IV, including a typical DNA-binding HTH motif, are specifically required for RIDA-dependent ATP hydrolysis in vitro and that these residues support efficient interaction with the DNA-loaded clamp·Hda complex and with Hda in vitro. Consistently, substitutions of these residues caused accumulation of ATP-bound DnaA in vivo and oriC-dependent inhibition of cell growth. Leu-422 plays a more important role in these activities than Pro-423. By contrast, neither of these residues is crucial for DNA replication from oriC, although they are highly conserved in DnaA orthologues. Structural analysis of a DnaA·Hda complex model suggested that these residues make contact with residues in the vicinity of the Hda AAA+ sensor I that participates in formation of a nucleotide-interacting surface. Together, the results show that functional DnaA-Hda interactions require a second interaction site within DnaA domain IV in addition to the AAA+ domain and suggest that these interactions are crucial for the formation of RIDA complexes that are active for DnaA-ATP hydrolysis.

  19. DnaA Protein DNA-binding Domain Binds to Hda Protein to Promote Inter-AAA+ Domain Interaction Involved in Regulatory Inactivation of DnaA*

    Science.gov (United States)

    Keyamura, Kenji; Katayama, Tsutomu

    2011-01-01

    Chromosomal replication is initiated from the replication origin oriC in Escherichia coli by the active ATP-bound form of DnaA protein. The regulatory inactivation of DnaA (RIDA) system, a complex of the ADP-bound Hda and the DNA-loaded replicase clamp, represses extra initiations by facilitating DnaA-bound ATP hydrolysis, yielding the inactive ADP-bound form of DnaA. However, the mechanisms involved in promoting the DnaA-Hda interaction have not been determined except for the involvement of an interaction between the AAA+ domains of the two. This study revealed that DnaA Leu-422 and Pro-423 residues within DnaA domain IV, including a typical DNA-binding HTH motif, are specifically required for RIDA-dependent ATP hydrolysis in vitro and that these residues support efficient interaction with the DNA-loaded clamp·Hda complex and with Hda in vitro. Consistently, substitutions of these residues caused accumulation of ATP-bound DnaA in vivo and oriC-dependent inhibition of cell growth. Leu-422 plays a more important role in these activities than Pro-423. By contrast, neither of these residues is crucial for DNA replication from oriC, although they are highly conserved in DnaA orthologues. Structural analysis of a DnaA·Hda complex model suggested that these residues make contact with residues in the vicinity of the Hda AAA+ sensor I that participates in formation of a nucleotide-interacting surface. Together, the results show that functional DnaA-Hda interactions require a second interaction site within DnaA domain IV in addition to the AAA+ domain and suggest that these interactions are crucial for the formation of RIDA complexes that are active for DnaA-ATP hydrolysis. PMID:21708944

  20. A portable pulmonary delivery system for nano engineered DNA vaccines driven by surface acoustic wave devices

    International Nuclear Information System (INIS)

    Rajapaksa, A.E.; Qi, Aisha; Yeo, L.; Friend, J.

    2010-01-01

    Full text: The increase in the need for effective delivery of potelll vaccines against infectious diseases, require robust yet straightforward pro duction of encapsulated DNA-laden aerosols. Aerosol delivery of drugs represents the next generation of vaccine delivery where the drug is deposited into the lung, which provides an ideal, non-invasive route. Moreover, several features of D A vaccines make them more attractive than conventional vaccines; thus, DNA vaccines have gained global interest for a variety of applications. However, several limitations such as ineffective cellular uptake and intracellular delivery, and degradation of DNA need to be overcome before clin ical applications. In this study, a novel and scalable engineered technique has been developed to create a biodegradable polymer system, which enables controlled delivery of a well designed DNA vaccine for immuno-therapeutics. Surface Acoustic Wave (SAW) atomisation has been found as useful mechanism for atomising fluid samples for medical and industrial devices. It is a straightforward method for synthesising un-agglomerated biodegradable nanoparti cles (<250 nm) in the absence of organic solvents which would represent a major breakthrough for biopharmaceutical encapsulation and delivery. Nano-scale polymer particles for DNA vaccines deliv ery were obtained through an evaporative process of the initial aerosol created by surface acoustic waves at 8-150 MHz, the final size of which could be controlled by modifying the initial polymer concen tration and solid contents. Thus, SAW atomiser represents a promising alternative for the development of a low power device for producing nano-engineered vaccines with a controlled and narrow size distribution as delivery system for genetic immuno-therapeutics.

  1. Spectroscopic study of a DNA brush synthesized in situ by surface initiated enzymatic polymerization.

    Science.gov (United States)

    Khan, M Nuruzzaman; Tjong, Vinalia; Chilkoti, Ashutosh; Zharnikov, Michael

    2013-08-29

    We used a combination of synchrotron-based X-ray photoelectron spectroscopy (XPS) and angle-resolved near-edge X-ray absorption fine structure (NEXAFS) spectroscopy to study the chemical integrity, purity, and possible internal alignment of single-strand (ss) adenine deoxynucleotide (poly(A)) DNA brushes. The brushes were synthesized by surface-initiated enzymatic polymerization (SIEP) on a 25-mer of adenine self-assembled monolayer (SAM) on gold (A25-SH), wherein the terminal 3'-OH of the A25-SH serve as the initiation sites for SIEP of poly(A). XPS and NEXAFS spectra of poly(A) brushes were found to be almost identical to those of A25-SH initiator, with no unambiguous traces of contamination. Apart from the well-defined chemical integrity and contamination-free character, the brushes were found to have a high degree of orientational order, with an upright orientation of individual strands, despite their large thickness up to ~55 nm, that corresponds to a chain length of at least several hundred nucleotides for individual ssDNA molecules. The orientational order exhibited by these poly(A) DNA brushes, mediated presumably by base stacking, was found to be independent of the brush thickness as long as the packing density was high enough. The well-defined character and orientational ordering of the ssDNA brushes make them a potentially promising system for different applications.

  2. Cell-secreted flavins bound to membrane cytochromes dictate electron transfer reactions to surfaces with diverse charge and pH.

    Science.gov (United States)

    Okamoto, Akihiro; Kalathil, Shafeer; Deng, Xiao; Hashimoto, Kazuhito; Nakamura, Ryuhei; Nealson, Kenneth H

    2014-07-11

    The variety of solid surfaces to and from which microbes can deliver electrons by extracellular electron transport (EET) processes via outer-membrane c-type cytochromes (OM c-Cyts) expands the importance of microbial respiration in natural environments and industrial applications. Here, we demonstrate that the bifurcated EET pathway of OM c-Cyts sustains the diversity of the EET surface in Shewanella oneidensis MR-1 via specific binding with cell-secreted flavin mononucleotide (FMN) and riboflavin (RF). Microbial current production and whole-cell differential pulse voltammetry revealed that RF and FMN enhance EET as bound cofactors in a similar manner. Conversely, FMN and RF were clearly differentiated in the EET enhancement by gene-deletion of OM c-Cyts and the dependency of the electrode potential and pH. These results indicate that RF and FMN have specific binding sites in OM c-Cyts and highlight the potential roles of these flavin-cytochrome complexes in controlling the rate of electron transfer to surfaces with diverse potential and pH.

  3. Using AFM to probe the complexation of DNA with anionic lipids mediated by Ca(2+): the role of surface pressure.

    Science.gov (United States)

    Luque-Caballero, Germán; Martín-Molina, Alberto; Sánchez-Treviño, Alda Yadira; Rodríguez-Valverde, Miguel A; Cabrerizo-Vílchez, Miguel A; Maldonado-Valderrama, Julia

    2014-04-28

    Complexation of DNA with lipids is currently being developed as an alternative to classical vectors based on viruses. Most of the research to date focuses on cationic lipids owing to their spontaneous complexation with DNA. Nonetheless, recent investigations have revealed that cationic lipids induce a large number of adverse effects on DNA delivery. Precisely, the lower cytotoxicity of anionic lipids accounts for their use as a promising alternative. However, the complexation of DNA with anionic lipids (mediated by cations) is still in early stages and is not yet well understood. In order to explore the molecular mechanisms underlying the complexation of anionic lipids and DNA we proposed a combined methodology based on the surface pressure-area isotherms, Gibbs elasticity and Atomic Force Microscopy (AFM). These techniques allow elucidation of the role of the surface pressure in the complexation and visualization of the interfacial aggregates for the first time. We demonstrate that the DNA complexes with negatively charged model monolayers (DPPC/DPPS 4 : 1) only in the presence of Ca(2+), but is expelled at very high surface pressures. Also, according to the Gibbs elasticity plot, the complexation of lipids and DNA implies a whole fluidisation of the monolayer and a completely different phase transition map in the presence of DNA and Ca(2+). AFM imaging allows identification for the first time of specific morphologies associated with different packing densities. At low surface coverage, a branched net like structure is observed whereas at high surface pressure fibers formed of interfacial aggregates appear. In summary, Ca(2+) mediates the interaction between DNA and negatively charged lipids and also the conformation of the ternary system depends on the surface pressure. Such observations are important new generic features of the interaction between DNA and anionic lipids.

  4. DNA of Dientamoeba fragilis detected within surface-sterilized eggs of Enterobius vermicularis

    DEFF Research Database (Denmark)

    Röser, Dennis; Nejsum, Peter; Carlsgart, Anne Josefine

    2013-01-01

    With no evidence of a cyst stage, the mode of transmission of Dientamoeba fragilis, an intestinal protozoon of common occurrence and suggested pathogenicity, is incompletely known. Numerous studies have suggested that eggs of intestinal nematodes, primarily Enterobius vermicularis (pinworm), can...... serve as vectors for D. fragilis, although attempts to culture D. fragilis from pinworm eggs have been unsuccessful and data from epidemiological studies on D. fragilis/pinworm co-infection have been conflicting. The aim of this study was to investigate whether we could detect D. fragilis DNA from...... pinworm eggs collected from routine diagnostic samples (cellophane tape) and surface-sterilised by hypochlorite. DNA was extracted from individual eggs and tested by PCR using D. fragilis- and E. vermicularis-specific primers; amplicons were sequenced for confirmation. In cellophane tape samples from 64...

  5. A Novel Low Energy Electron Microscope for DNA Sequencing and Surface Analysis

    Science.gov (United States)

    Mankos, M.; Shadman, K.; Persson, H.H.J.; N’Diaye, A.T.; Schmid, A.K.; Davis, R.W.

    2014-01-01

    Monochromatic, aberration-corrected, dual-beam low energy electron microscopy (MAD-LEEM) is a novel technique that is directed towards imaging nanostructures and surfaces with sub-nanometer resolution. The technique combines a monochromator, a mirror aberration corrector, an energy filter, and dual beam illumination in a single instrument. The monochromator reduces the energy spread of the illuminating electron beam, which significantly improves spectroscopic and spatial resolution. Simulation results predict that the novel aberration corrector design will eliminate the second rank chromatic and third and fifth order spherical aberrations, thereby improving the resolution into the sub-nanometer regime at landing energies as low as one hundred electron-Volts. The energy filter produces a beam that can extract detailed information about the chemical composition and local electronic states of non-periodic objects such as nanoparticles, interfaces, defects, and macromolecules. The dual flood illumination eliminates charging effects that are generated when a conventional LEEM is used to image insulating specimens. A potential application for MAD-LEEM is in DNA sequencing, which requires high resolution to distinguish the individual bases and high speed to reduce the cost. The MAD-LEEM approach images the DNA with low electron impact energies, which provides nucleobase contrast mechanisms without organometallic labels. Furthermore, the micron-size field of view when combined with imaging on the fly provides long read lengths, thereby reducing the demand on assembling the sequence. Experimental results from bulk specimens with immobilized single-base oligonucleotides demonstrate that base specific contrast is available with reflected, photo-emitted, and Auger electrons. Image contrast simulations of model rectangular features mimicking the individual nucleotides in a DNA strand have been developed to translate measurements of contrast on bulk DNA to the detectability of

  6. A novel low energy electron microscope for DNA sequencing and surface analysis.

    Science.gov (United States)

    Mankos, M; Shadman, K; Persson, H H J; N'Diaye, A T; Schmid, A K; Davis, R W

    2014-10-01

    Monochromatic, aberration-corrected, dual-beam low energy electron microscopy (MAD-LEEM) is a novel technique that is directed towards imaging nanostructures and surfaces with sub-nanometer resolution. The technique combines a monochromator, a mirror aberration corrector, an energy filter, and dual beam illumination in a single instrument. The monochromator reduces the energy spread of the illuminating electron beam, which significantly improves spectroscopic and spatial resolution. Simulation results predict that the novel aberration corrector design will eliminate the second rank chromatic and third and fifth order spherical aberrations, thereby improving the resolution into the sub-nanometer regime at landing energies as low as one hundred electron-Volts. The energy filter produces a beam that can extract detailed information about the chemical composition and local electronic states of non-periodic objects such as nanoparticles, interfaces, defects, and macromolecules. The dual flood illumination eliminates charging effects that are generated when a conventional LEEM is used to image insulating specimens. A potential application for MAD-LEEM is in DNA sequencing, which requires high resolution to distinguish the individual bases and high speed to reduce the cost. The MAD-LEEM approach images the DNA with low electron impact energies, which provides nucleobase contrast mechanisms without organometallic labels. Furthermore, the micron-size field of view when combined with imaging on the fly provides long read lengths, thereby reducing the demand on assembling the sequence. Experimental results from bulk specimens with immobilized single-base oligonucleotides demonstrate that base specific contrast is available with reflected, photo-emitted, and Auger electrons. Image contrast simulations of model rectangular features mimicking the individual nucleotides in a DNA strand have been developed to translate measurements of contrast on bulk DNA to the detectability of

  7. Bacterial surface-displayed GII.4 human norovirus capsid proteins bound to surface of Romaine lettuce through HBGA-like molecules

    Science.gov (United States)

    Human Noroviruses (HuNoVs) are the main cause of nonbacterial gastroenteritis. Contaminated produce is a main vehicle for dissemination of HuNoVs. In this study, we used an ice nucleation protein (INP) mediated surface display system to present the protruding domain of GII.4 HuNoV capsid protein (G...

  8. Real-time sensing of surface-bound fibrinogen and fibrin interactions using spectroscopy of guided modes in optical waveguide structures, surface plasmon resonance, and monoclonal antibodies

    Czech Academy of Sciences Publication Activity Database

    Dyr, J. E.; Tichý, Ivo; Jiroušková, M.; Tobiška, Petr; Slavík, Radan; Homola, Jiří; Suttnar, J.

    1998-01-01

    Roč. 9, č. 7 (1998), s. 675 ISSN 0957-5235 R&D Projects: GA ČR GA303/96/1358 Institutional research plan: CEZ:AV0Z2067918 Keywords : surface plasmons * biosensors * biomedical engineering Subject RIV: CE - Biochemistry

  9. DNA secondary structures are associated with recombination in major Plasmodium falciparum variable surface antigen gene families

    DEFF Research Database (Denmark)

    Sander, Adam F.; Lavstsen, Thomas; Rask, Thomas Salhøj

    2014-01-01

    falciparum-erythrocyte membrane protein 1 class on the infected erythrocyte surface. Recombination clearly generates var diversity, but the nature and control of the genetic exchanges involved remain unclear. By experimental and bioinformatic identification of recombination events and genome...... of recombination during DNA replication in P. falciparum sexual stages, and that these DSS-regulated genetic exchanges generate functional and diverse P. falciparum adhesion antigens. DSS-induced recombination may represent a common mechanism for optimizing the evolvability of virulence gene families in pathogens....

  10. Increased sensitivity of UV-repair-deficient human cells to DNA bound platinum products which unlike thymine dimers are not recognised by an endonuclease extracted from Micrococcus luteus

    Energy Technology Data Exchange (ETDEWEB)

    Fraval, H N.A.; Rawlings, C J; Roberts, J J [Institute of Cancer Research, Royal Cancer Hospital, Pollards Wood Research Station, Chalfont St. Giles, Bucks, UK

    1978-07-01

    The response of human cells in culture to cis platinum (II) diammine dichloride (cis Pt(II)) induced DNA damage has been studied. The survival data, measured as a function of cis Pt(II) dose were similar in a normal cell line (Human foetal lung) compared to a UV-sensitive, thymine dimer excision repair-deficient cell line (Xeroderma pigmentatosum). However, there was a marked difference between the two cell lines when binding to DNA was plotted against dose of cis Pt(II) given for 1 h. When these findings were expressed as cell survival versus binding to DNA, a 4.1-fold difference between the slopes of the survival curves for the two cell lines was obtained. These findings are consistent with the notion that normal cells are able to excise cis Pt(II) induced damage from their genome and thus increase their ability to survive as compared to excision deficient cells. An endonuclease preparation from Micrococcus luteus is able to recognise UV damage in DNA, but did not recognise cis Pt(II) induced damage. These results possibly indicate differences in the pathways of repair of damage caused by the two agents.

  11. Crystal structure of a Fanconi anemia-associated nuclease homolog bound to 5' flap DNA: basis of interstrand cross-link repair by FAN1

    Energy Technology Data Exchange (ETDEWEB)

    Gwon, Gwang Hyeon; Kim, Youngran; Liu, Yaqi; Watson, Adam T.; Jo, Aera; Etheridge, Thomas J.; Yuan, Fenghua; Zhang, Yanbin; Kim, YoungChang; Carr, Anthony M.; Cho, Yunje

    2014-10-15

    Fanconi anemia (FA) is an autosomal recessive genetic disorder caused by defects in any of 15 FA genes responsible for processing DNA interstrand cross-links (ICLs). The ultimate outcome of the FA pathway is resolution of cross-links, which requires structure-selective nucleases. FA-associated nuclease 1 (FAN1) is believed to be recruited to lesions by a monoubiquitinated FANCI–FANCD2 (ID) complex and participates in ICL repair. Here, we determined the crystal structure of Pseudomonas aeruginosa FAN1 (PaFAN1) lacking the UBZ (ubiquitin-binding zinc) domain in complex with 5' flap DNA. All four domains of the right-hand-shaped PaFAN1 are involved in DNA recognition, with each domain playing a specific role in bending DNA at the nick. The six-helix bundle that binds the junction connects to the catalytic viral replication and repair (VRR) nuclease (VRR nuc) domain, enabling FAN1 to incise the scissile phosphate a few bases distant from the junction. The six-helix bundle also inhibits the cleavage of intact Holliday junctions. PaFAN1 shares several conserved features with other flap structure-selective nucleases despite structural differences. A clamping motion of the domains around the wedge helix, which acts as a pivot, facilitates nucleolytic cleavage. The PaFAN1 structure provides insights into how archaeal Holliday junction resolvases evolved to incise 5' flap substrates and how FAN1 integrates with the FA complex to participate in ICL repair.

  12. A novel low energy electron microscope for DNA sequencing and surface analysis

    Energy Technology Data Exchange (ETDEWEB)

    Mankos, M., E-mail: marian@electronoptica.com [Electron Optica Inc., 1000 Elwell Court #110, Palo Alto, CA 94303 (United States); Shadman, K. [Electron Optica Inc., 1000 Elwell Court #110, Palo Alto, CA 94303 (United States); Persson, H.H.J. [Stanford Genome Technology Center, Stanford University School of Medicine, 855 California Avenue, Palo Alto, CA 94304 (United States); N’Diaye, A.T. [Electron Optica Inc., 1000 Elwell Court #110, Palo Alto, CA 94303 (United States); NCEM, Lawrence Berkeley National Laboratory, 1 Cyclotron Road, Berkeley, CA 94720 (United States); Schmid, A.K. [NCEM, Lawrence Berkeley National Laboratory, 1 Cyclotron Road, Berkeley, CA 94720 (United States); Davis, R.W. [Stanford Genome Technology Center, Stanford University School of Medicine, 855 California Avenue, Palo Alto, CA 94304 (United States)

    2014-10-15

    Monochromatic, aberration-corrected, dual-beam low energy electron microscopy (MAD-LEEM) is a novel technique that is directed towards imaging nanostructures and surfaces with sub-nanometer resolution. The technique combines a monochromator, a mirror aberration corrector, an energy filter, and dual beam illumination in a single instrument. The monochromator reduces the energy spread of the illuminating electron beam, which significantly improves spectroscopic and spatial resolution. Simulation results predict that the novel aberration corrector design will eliminate the second rank chromatic and third and fifth order spherical aberrations, thereby improving the resolution into the sub-nanometer regime at landing energies as low as one hundred electron-Volts. The energy filter produces a beam that can extract detailed information about the chemical composition and local electronic states of non-periodic objects such as nanoparticles, interfaces, defects, and macromolecules. The dual flood illumination eliminates charging effects that are generated when a conventional LEEM is used to image insulating specimens. A potential application for MAD-LEEM is in DNA sequencing, which requires high resolution to distinguish the individual bases and high speed to reduce the cost. The MAD-LEEM approach images the DNA with low electron impact energies, which provides nucleobase contrast mechanisms without organometallic labels. Furthermore, the micron-size field of view when combined with imaging on the fly provides long read lengths, thereby reducing the demand on assembling the sequence. Experimental results from bulk specimens with immobilized single-base oligonucleotides demonstrate that base specific contrast is available with reflected, photo-emitted, and Auger electrons. Image contrast simulations of model rectangular features mimicking the individual nucleotides in a DNA strand have been developed to translate measurements of contrast on bulk DNA to the detectability of

  13. Molecular investigation of evaporation of biodroplets containing single-strand DNA on graphene surface.

    Science.gov (United States)

    Akbari, Fahimeh; Foroutan, Masumeh

    2018-02-14

    In this study, the water droplet behaviour of four different types of single-strand DNA with homogeneous base sequence on a graphene substrate during evaporation of the droplet was investigated using molecular dynamics (MD) simulation. The simulation results indicated that the evaporation depended on the DNA sequence. The observed changes can be divided into four parts: (i) vaporization mode, (ii) evaporation flux, (iii) mechanism of single-strand placement on the surface, and (iv) consideration of remaining single strands after evaporation. Our simulation observations indicated different evaporation modes for thymine biodroplets as compared to those for other biodroplets. The evaporation of the thymine biodroplets occurred with an increase in the contact angle, while that of the other biodroplets occur in a constant contact angle mode. Moreover, thymine biodroplets generate the lowest contact line compared to other single strands, and it is always placed far away from the centre of the droplets during evaporation. Investigating variations in the evaporation flux shows that thymine has the highest evaporation flux and guanine has the lowest. Moreover, during initial evaporation, the flux of evaporation increases at the triple point of the biodroplets containing thymine single strands, while it decreases in the other biodroplets. The following observation was obtained from the study of the placement of single strands on the substrate: guanine and thymine interacted slower than other single strands during evaporation with graphene, adenine single strand had a higher folding during evaporation, and guanine single strand showed the lowest end-to-end distance. The investigation of single-strand DNA after evaporation shows that adenine produces the most stable structure at the end of evaporation. In addition, cytosine is the most stretched single-strand DNA due to its lack of internal π-π stacking and hydrogen bonding. Therefore, cytosine single strand is more

  14. Cell surface-bound TIMP3 induces apoptosis in mesenchymal Cal78 cells through ligand-independent activation of death receptor signaling and blockade of survival pathways.

    Directory of Open Access Journals (Sweden)

    Christina Koers-Wunrau

    Full Text Available BACKGROUND: The matrix metalloproteinases (MMPs and their endogenous regulators, the tissue inhibitor of metalloproteinases (TIMPs 1-4 are responsible for the physiological remodeling of the extracellular matrix (ECM. Among all TIMPs, TIMP3 appears to play a unique role since TIMP3 is a secreted protein and, unlike the other TIMP family members, is tightly bound to the ECM. Moreover TIMP3 has been shown to be able to induce apoptotic cell death. As little is known about the underlying mechanisms, we set out to investigate the pro-apoptotic effect of TIMP3 in human mesenchymal cells. METHODOLOGY/PRINCIPAL FINDINGS: Lentiviral overexpression of TIMP3 in mesenchymal cells led to a strong dose-dependent induction of ligand-independent apoptosis as reflected by a five-fold increase in caspase 3 and 7 activity compared to control (pLenti6/V5-GW/lacZ or uninfected cells, whereas exogenous TIMP3 failed to induce apoptosis. Concordantly, increased cleavage of death substrate PARP and the caspases 3 and 7 was observed in TIMP3 overexpressing cultures. Notably, activation of caspase-8 but not caspase-9 was observed in TIMP3-overexpressing cells, indicating a death receptor-dependent mechanism. Moreover, overexpression of TIMP3 led to a further induction of apoptosis after stimulation with TNF-alpha, FasL and TRAIL. Most interestingly, TIMP3-overexpression was associated with a decrease in phosphorylation of cRaf, extracellular signal-regulated protein kinase (Erk1/2, ribosomal S6 kinase (RSK1 and Akt and serum deprivation of TIMP3-overexpressing cells resulted in a distinct enhancement of apoptosis, pointing to an impaired signaling of serum-derived survival factors. Finally, heparinase treatment of heparan sulfate proteoglycans led to the release of TIMP3 from the surface of overexpressing cells and to a significant decrease in apoptosis indicating that the binding of TIMP3 is necessary for apoptosis induction. CONCLUSION: The results demonstrate that

  15. Azide photochemistry for facile modification of graphitic surfaces: preparation of DNA-coated carbon nanotubes for biosensing

    International Nuclear Information System (INIS)

    Moghaddam, Minoo J; Yang Wenrong; Bojarski, Barbara; Gengenbach, Thomas R; Gao Mei; Zareie, Hadi; McCall, Maxine J

    2012-01-01

    A facile, two-step method for chemically attaching single-stranded DNA to graphitic surfaces, represented here by carbon nanotubes, is reported. In the first step, an azide-containing compound, N-5-azido-nitrobenzoyloxy succinimide (ANB-NOS), is used to form photo-adducts on the graphitic surfaces in a solid-state photochemical reaction, resulting in active ester groups being oriented for the subsequent reactions. In the second step, pre-synthesized DNA strands bearing a terminal amine group are coupled in an aqueous solution with the active esters on the photo-adducts. The versatility of the method is demonstrated by attaching pre-synthesized DNA to surfaces of carbon nanotubes in two platforms—as vertically-aligned multi-walled carbon nanotubes on a solid support and as tangled single-walled carbon nanotubes in mats. The reaction products at various stages were characterized by x-ray photoelectron spectroscopy. Two different assays were used to check that the DNA strands attached to the carbon nanotubes were able to bind their partner strands with complementary base sequences. The first assay, using partner DNA strands tethered to gold nanoparticles, enabled the sites of DNA attachment to the carbon nanotubes to be identified in TEM images. The second assay, using radioactively labelled partner DNA strands, quantified the density of functional DNA strands attached to the carbon nanotubes. The diversity of potential applications for these DNA-modified carbon-nanotube platforms is exemplified here by the successful use of a DNA-modified single-walled carbon-nanotube mat as an electrode for the specific detection of metal ions. (paper)

  16. A silica nanoparticle-based sensor for selective fluorescent detection of homocysteine via interaction differences between thiols and particle-surface-bound polymers

    International Nuclear Information System (INIS)

    Yu Changmin; Zeng Fang; Luo Ming; Wu Shuizhu

    2012-01-01

    Biothiols play crucial roles in maintaining biological systems; among them, homocysteine (Hcy) has received increasing attention since elevated levels of Hcy have been implicated as an independent risk factor for cardiovascular disease. Hence, the selective detection of this specific biothiol, which is a disease-associated biomarker, is very important. In this paper, we demonstrate a new mesoporous silica nanoparticle-based sensor for selective detection of homocysteine from biothiols and other common amino acids. In this fluorescent sensing system, an anthracene nitroolefin compound was placed inside the mesopores of mesoporous silica nanoparticles (MSNs) and used as a probe for thiols. The hydrophilic polyethylene glycol (PEG 5000) molecules were covalently bound to the MSN surface and used as a selective barrier for Hcy detection via different interactions between biothiols and the PEG polymer chains. The sensor can discriminate Hcy from the two low-molecular mass biothiols (GSH and Cys) and other common amino acids in totally aqueous media as well as in serum, with a detection limit of 0.1 μM. This strategy may offer an approach for designing other MSN-based sensing systems by using polymers as diffusion regulators in sensing assays for other analytes. (paper)

  17. Multiplex and high-throughput DNA detection using surface plasmon mediated fluorescence

    Science.gov (United States)

    Mei, Zhong

    The overall objective of this research project was to develop a user-friendly and sensitive biosensor for nucleic acid aptamers with multiplexing and high-throughput capability. The sensing was based on the fluorescence signals emitted by the fluorophores coupling with plamonic nanoparticle (gold nanorod) deposited on a patterned substrate. Gold nanorods (GNRs) were synthesized using a binary mixture of hexadecyltrimethylammonium bromide (CTAB) and sodium oleate (NaOL) in seed mediated growth method. Polytetrafluoroethylene (PTFE) printed glass slides were selectively coated with a gold thin-film to define hydrophilic areas for GNR deposition. Due to the wettablity contrast, GNR solution dropped on the slide was induced to assemble exclusively in the hydrophilic spots. By controlling temperature and humidity of the evaporation process, vertically-standing GNR arrays were achieved on the pattered slide. Fluorescence was conjugated to GNR surface via DNA double strand with tunable length. Theoretical simulation predicted a flat layer ( 30 nm thick) of uniform "hot spots" presented on the GNR tips, which could modify the nearby fluorescence. Experimentally, the vertical GNR arrays yielded metallic enhanced fluorescence (MEF) effect, which was dependent on the spectrum overlap and GNR-fluorophore distance. Specifically, the maximum enhancement of Quasar 670 and Alexa 750 was observed when it was coupled with GNR664 (plasmonic wavelength 664 nm) and GNR778 respectively at a distance of 16 nm, while the carboxyfluorescein (FAM) was at maximal intensity when attached to gold nanosphere520. This offers an opportunity for multiplexed DNA sensing. Based on this, we developed a novel GNR mediated fluorescence biosensor for DNA detection. Fluorescence labeled haipin-DNA probes were introduced to designated spots of GNR array with the matching LSPR wavelengths on the substrate. The fluorescence was quenched originally because of Forster resonance energy transfer (FRET) effect

  18. The Influence of Selected Fingerprint Enhancement Techniques on Forensic DNA Typing of Epithelial Cells Deposited on Porous Surfaces.

    Science.gov (United States)

    Tsai, Li-Chin; Lee, Cheng-Chang; Chen, Chun-Chieh; Lee, James Chun-I; Wang, Sheng-Meng; Huang, Nu-En; Linacre, Adrian; Hsieh, Hsing-Mei

    2016-01-01

    Fingerprints deposited at crime scene can be a source of DNA. Previous reports on the effects of fingerprint enhancement methods have focused mainly on fingermarks deposited in blood or saliva. Here, we evaluate the effects of fingerprint enhancement methods on fingerprints deposited on porous surfaces. We performed real-time quantification and STR typing, the results of which indicated that two methods (iodine fuming and 1,2-indanedione in ethyl acetate enhancement) had no effect on the quantity of DNA isolated and resultant STR alleles when compared to control samples. DNA quantities and allele numbers were lower for samples enhanced with silver nitrate and 1,2-indanedione in acetic acid when compared to control samples. Based on DNA quantity, quality, and observable stochastic effects, our data indicated that iodine fuming and 1,2-indanedione in ethyl acetate were the preferred options for the enhancement of fingerprints on porous surfaces. © 2015 American Academy of Forensic Sciences.

  19. Using Electrochemical SERS to Measure the Redox Potential of Drug Molecules Bound to dsDNA—a Study of Mitoxantrone

    International Nuclear Information System (INIS)

    Meneghello, Marta; Papadopoulou, Evanthia; Ugo, Paolo; Bartlett, Philip N.

    2016-01-01

    Interaction with DNA plays an important role in the biological activity of some anticancer drug molecules. In this paper we show that electrochemical surface enhanced Raman spectroscopy at sphere segment void gold electrodes can be used as a highly sensitive technique to measure the redox potential of the anticancer drug mitoxantrone bound to dsDNA. For this system we show that we can follow the redox reaction of the bound molecule and can extract the redox potential for the molecule bound to dsDNA by deconvolution of the SER spectra recorded as a function of electrode potential. We find that mitoxantrone bound to dsDNA undergoes a 2 electron, 1 proton reduction and that the redox potential (-0.87 V vs. Ag/AgCl at pH 7.2) is shifted approximately 0.12 V cathodic of the corresponding value at a glassy carbon electrode. Our results also show that the reduced form of mitoxantrone remains bound to dsDNA and we are able to use the deconvoluted SER spectra of the reduced mitoxantrone as a function of electrode potential to follow the electrochemically driven melting of the dsDNA at more negative potentials.

  20. Strand breaks in plasmid DNA following positional changes of Auger-electron-emitting radionuclides

    International Nuclear Information System (INIS)

    Adelstein, S.J.; Kassis, A.I.

    1996-01-01

    The purpose of our studies is to elucidate the kinetics of DNA strand breaks caused by low-energy Auger electron emitters in close proximity to DNA. Previously we have studied the DNA break yields in plasmids after the decay of indium-111 bound to DNA or free in solution. In this work, we compare the DNA break yields in supercoiled DNA of iodine-125 decaying close to DNA following DNA intercalation, minor-groove binding, or surface binding, and at a distance form DNA. Supercoiled DNA, stored at 4 C to accumulate radiation dose from the decay of 125 I, was then resolved by gel electrophoresis into supercoiled, nicked circular, and linear forms, representing undamaged DNA, single-strand breaks, and double-strand breaks respectively. DNA-intercalated or groove-bound 125 I is more effective than surface-bound radionuclide or 125 I free in solution. The hydroxyl radical scavenger DMSO protects against damage by 125 I free in solution but has minimal effect on damage by groove-bound 125 I. (orig.)

  1. Gold surface supported spherical liposome-gold nano-particle nano-composite for label free DNA sensing.

    Science.gov (United States)

    Bhuvana, M; Narayanan, J Shankara; Dharuman, V; Teng, W; Hahn, J H; Jayakumar, K

    2013-03-15

    Immobilization of 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) liposome-gold nano-particle (DOPE-AuNP) nano-composite covalently on 3-mercaptopropionic acid (MPA) on gold surface is demonstrated for the first time for electrochemical label free DNA sensing. Spherical nature of the DOPE on the MPA monolayer is confirmed by the appearance of sigmoidal voltammetric profile, characteristic behavior of linear diffusion, for the MPA-DOPE in presence of [Fe(CN)(6)](3-/4-) and [Ru(NH(3))(6)](3+) redox probes. The DOPE liposome vesicle fusion is prevented by electroless deposition of AuNP on the hydrophilic amine head groups of the DOPE. Immobilization of single stranded DNA (ssDNA) is made via simple gold-thiol linkage for DNA hybridization sensing in the presence of [Fe(CN)(6)](3-/4-). The sensor discriminates the hybridized (complementary target hybridized), un-hybridized (non-complementary target hybridized) and single base mismatch target hybridized surfaces sensitively and selectively without signal amplification. The lowest target DNA concentration detected is 0.1×10(-12)M. Cyclic voltammetry (CV), electrochemical impedance (EIS), differential pulse voltammetry (DPV) and quartz crystal microbalance (QCM) techniques are used for DNA sensing on DOPE-AuNP nano-composite. Transmission Electron Microscopy (TEM), Fourier Transform Infrared Spectroscopy (FTIR), Atomic Force Microscopy (AFM), Dynamic Light Scattering (DLS) and Ultraviolet-Visible (UV) spectroscopic techniques are used to understand the interactions between the DOPE, AuNP and ssDNA. The results indicate the presence of an intact and well defined spherical DOPE-AuNP nano-composite on the gold surface. The method could be applied for fabrication of the surface based liposome-AuNP-DNA composite for cell transfection studies at reduced reagents and costs. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. Ratiometric FRET-based detection of DNA and micro-RNA on the surface using TIRF detection

    International Nuclear Information System (INIS)

    Matveeva, Evgenia G.; Gryczynski, Zygmunt; Stewart, Donald R.; Gryczynski, Ignacy

    2010-01-01

    A new FRET-based method for the ratiometric detection of DNA oligomers on a surface using TIRF detection mode is reported. The dual-labeled system consisting of two hybridized oligomers, Cy3oligoY:Cy5oligoX was immobilized on the surface, and the total internal reflection fluorescence (TIRF) was used to detect emission signals from the surface. Two signals, green and red, which originated from the green donor Cy3 and the red acceptor Cy5, have been simultaneously detected. When the target single-stranded complimentary oligomer was present in the solution, this oligomer replaced the Cy3oligoY in the donor:acceptor complex on the surface and the ratio of red-to-green signal was dramatically changed. This detection scheme is generally applicable to the detection of DNA or RNA on a surface.

  3. Conformation-dependent DNA attraction

    Science.gov (United States)

    Li, Weifeng; Nordenskiöld, Lars; Zhou, Ruhong; Mu, Yuguang

    2014-05-01

    Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg2+ ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg2+ or Na+, benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg2+ bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription.Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by

  4. Study on the bound water of several high specific surface-area oxides (beryllia, alumina, silica-alumina); Etude de l'eau de constitution de plusieurs oxydes a grande surface specifique (glucine, alumine, silice-alumine)

    Energy Technology Data Exchange (ETDEWEB)

    Rouquerol, J. [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1964-11-01

    This study is concerned with the bound water of several oxides (beryllia, alumina, silica-alumina) at different steps of their dehydration (heating temperatures between 150 and 1100 deg. C). The following techniques have been used simultaneously: Thermal analysis (a new method has been developed), nitrogen adsorption (study of the texture), Diborane hydrolysis (qualitative and quantitative analysis of surface water), Infra-red spectrography (in the absorption range of water), Nuclear magnetic resonance (in the resonance range of protons). Thanks to these different techniques, five kinds of bound water have been observed. Attention is called on the great influence of the thermal treatment conditions on the evolution of the products resulting from the decomposition of alumina {alpha}-trihydrate Al(OH){sub 3} and beryllium {alpha}-hydroxide, in the course of the dehydration. Moreover, the author emphasizes the peculiar properties of the two kinds of oxides (alumina and beryllia) prepared through a new method of treatment under low pressure and constant speed of decomposition. Such particular features concern mainly texture, bound water, and consequently, also catalytic activity. (author) [French] Ce travail porte sur l'eau de constitution de plusieurs oxydes (glucine, alumine, silice-alumine) aux differents degres de leur deshydratation (temperatures de traitement comprises entre 150 et 1100 deg. C). Cette etude met simultanement en oeuvre: l'analyse thermique (proposition d'une nouvelle methode), l'adsorption d'azote (etude de texture), l'hydrolyse du diborane (analyse qualitative et quantitative de l'eau de surface), la spectrographie infra-rouge (dans le domaine d'absorption de l'eau), la resonance magnetique nucleaire (dans le domaine de resonance des protons). A l'aide de ces differentes techniques, cinq formes d'eau de constitution ont ete observees. L'attention est attiree sur la tres grande influence

  5. Study on the bound water of several high specific surface-area oxides (beryllia, alumina, silica-alumina); Etude de l'eau de constitution de plusieurs oxydes a grande surface specifique (glucine, alumine, silice-alumine)

    Energy Technology Data Exchange (ETDEWEB)

    Rouquerol, J [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1964-11-01

    This study is concerned with the bound water of several oxides (beryllia, alumina, silica-alumina) at different steps of their dehydration (heating temperatures between 150 and 1100 deg. C). The following techniques have been used simultaneously: Thermal analysis (a new method has been developed), nitrogen adsorption (study of the texture), Diborane hydrolysis (qualitative and quantitative analysis of surface water), Infra-red spectrography (in the absorption range of water), Nuclear magnetic resonance (in the resonance range of protons). Thanks to these different techniques, five kinds of bound water have been observed. Attention is called on the great influence of the thermal treatment conditions on the evolution of the products resulting from the decomposition of alumina {alpha}-trihydrate Al(OH){sub 3} and beryllium {alpha}-hydroxide, in the course of the dehydration. Moreover, the author emphasizes the peculiar properties of the two kinds of oxides (alumina and beryllia) prepared through a new method of treatment under low pressure and constant speed of decomposition. Such particular features concern mainly texture, bound water, and consequently, also catalytic activity. (author) [French] Ce travail porte sur l'eau de constitution de plusieurs oxydes (glucine, alumine, silice-alumine) aux differents degres de leur deshydratation (temperatures de traitement comprises entre 150 et 1100 deg. C). Cette etude met simultanement en oeuvre: l'analyse thermique (proposition d'une nouvelle methode), l'adsorption d'azote (etude de texture), l'hydrolyse du diborane (analyse qualitative et quantitative de l'eau de surface), la spectrographie infra-rouge (dans le domaine d'absorption de l'eau), la resonance magnetique nucleaire (dans le domaine de resonance des protons). A l'aide de ces differentes techniques, cinq formes d'eau de constitution ont ete observees. L'attention est attiree sur la tres grande influence des conditions de traitement thermique sur l'evolution des

  6. A new insight into the interaction of ZnO with calf thymus DNA through surface defects.

    Science.gov (United States)

    Das, Sumita; Chatterjee, Sabyasachi; Pramanik, Srikrishna; Devi, Parukuttyamma Sujatha; Kumar, Gopinatha Suresh

    2018-01-01

    Experimental evidences on the binding interaction of ZnO and Calf Thymus (CT) DNA using several biophysical techniques are the centre of interest of the present study. The interaction of ZnO with CT DNA has been investigated in detail by absorption spectral study, fluorescence titration, Raman analysis, zeta potential measurement, viscometric experiment along with thermal melting study and microscopic analysis. Steady-state fluorescence study revealed the quenching (48%) of the surface defect related peak intensity of ZnO on interaction with DNA. The optimized concentration of ZnO and DNA to obtain this level of quenching has been found to be 0.049mM and 1.027μM, respectively. Additional fluorescence study with 8-hydroxy-5-quinoline (HQ) as a fluorescence probe for Zn 2+ ruled out the dissolution effect of ZnO under the experimental conditions. DNA conjugation on the surface of ZnO was also supported by Raman study. The quantitative variation in conductivity as well as electrophoretic mobility indicated significant interaction of ZnO with the DNA molecule. Circular dichroism (CD) and viscometry titrations provided clear evidence in support of the conformational retention of the DNA on interaction with ZnO. The binding interaction was found to be predominantly entropy driven in nature. The bio-physical studies presented in this paper exploring ZnO-CT DNA interaction could add a new horizon to understand the interaction between metal oxide and DNA. Copyright © 2017. Published by Elsevier B.V.

  7. cDNA sequence analysis of a 29-kDa cysteine-rich surface antigen of pathogenic Entamoeba histolytica

    International Nuclear Information System (INIS)

    Torian, B.E.; Stroeher, V.L.; Stamm, W.E.; Flores, B.M.; Hagen, F.S.

    1990-01-01

    A λgt11 cDNA library was constructed from poly(U)-Spharose-selected Entamoeba histolytica trophozoite RNA in order to clone and identify surface antigens. The library was screened with rabbit polyclonal anti-E. histolytica serum. A 700-base-pair cDNA insert was isolated and the nucleotide sequence was determined. The deduced amino acid sequence of the cDNA revealed a cysteine-rich protein. DNA hybridizations showed that the gene was specific to E. histolytica since the cDNA probe reacted with DNA from four axenic strains of E. histolytica but did not react with DNA from Entamoeba invadens, Acanthamoeba castellanii, or Trichomonas vaginalis. The insert was subcloned into the expression vector pGEX-1 and the protein was expressed as a fusion with the C terminus of glutathione S-transferase. Purified fusion protein was used to generate 22 monoclonal antibodies (mAbs) and a mouse polyclonal antiserum specific for the E. histolytica portion of the fusion protein. A 29-kDa protein was identified as a surface antigen when mAbs were used to immunoprecipitate the antigen from metabolically 35 S-labeled live trophozoites. The surface location of the antigen was corroborated by mAb immunoprecipitation of a 29-kDa protein from surface- 125 I-labeled whole trophozoites as well as by the reaction of mAbs with live trophozoites in an indirect immunofluorescence assay performed at 4 degree C. Immunoblotting with mAbs demonstrated that the antigen was present on four axenic isolates tested. mAbs recognized epitopes on the 29-kDa native antigen on some but not all clinical isolates tested

  8. cDNA sequence analysis of a 29-kDa cysteine-rich surface antigen of pathogenic Entamoeba histolytica

    Energy Technology Data Exchange (ETDEWEB)

    Torian, B.E.; Stroeher, V.L.; Stamm, W.E. (Univ. of Washington, Seattle (USA)); Flores, B.M. (Louisiana State Univ. Medical Center, New Orleans (USA)); Hagen, F.S. (Zymogenetics Incorporated, Seattle, WA (USA))

    1990-08-01

    A {lambda}gt11 cDNA library was constructed from poly(U)-Spharose-selected Entamoeba histolytica trophozoite RNA in order to clone and identify surface antigens. The library was screened with rabbit polyclonal anti-E. histolytica serum. A 700-base-pair cDNA insert was isolated and the nucleotide sequence was determined. The deduced amino acid sequence of the cDNA revealed a cysteine-rich protein. DNA hybridizations showed that the gene was specific to E. histolytica since the cDNA probe reacted with DNA from four axenic strains of E. histolytica but did not react with DNA from Entamoeba invadens, Acanthamoeba castellanii, or Trichomonas vaginalis. The insert was subcloned into the expression vector pGEX-1 and the protein was expressed as a fusion with the C terminus of glutathione S-transferase. Purified fusion protein was used to generate 22 monoclonal antibodies (mAbs) and a mouse polyclonal antiserum specific for the E. histolytica portion of the fusion protein. A 29-kDa protein was identified as a surface antigen when mAbs were used to immunoprecipitate the antigen from metabolically {sup 35}S-labeled live trophozoites. The surface location of the antigen was corroborated by mAb immunoprecipitation of a 29-kDa protein from surface-{sup 125}I-labeled whole trophozoites as well as by the reaction of mAbs with live trophozoites in an indirect immunofluorescence assay performed at 4{degree}C. Immunoblotting with mAbs demonstrated that the antigen was present on four axenic isolates tested. mAbs recognized epitopes on the 29-kDa native antigen on some but not all clinical isolates tested.

  9. Conformation-dependent DNA attraction.

    Science.gov (United States)

    Li, Weifeng; Nordenskiöld, Lars; Zhou, Ruhong; Mu, Yuguang

    2014-06-21

    Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg(2+) ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg(2+) or Na(+), benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg(2+) bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription.

  10. Purification and characterization of chromatin-bound DNA-dependent RNA polymerase I from parsley (Petroselinum crispum). Influence of nucleoside triphosphates.

    Science.gov (United States)

    Grossmann, K; Friedrich, H; Seitz, U

    1980-01-01

    The isolation and purification of DNA-dependent RNA polymerase I (EC 2.7.7.6) from parsley (Petroselinum crispum) callus cells grown in suspension culture is described. The enzyme was solubilized from isolated chromatin. Purification was achieved by using DEAE- and phospho-cellulose in batches, followed by column chromatography on DEAE- and phospho-cellulose (two columns) and density-gradient centrifugation. The highly purified enzyme was stable over several months. The properties of purified parsley RNA polymerase I were investigated. Optimum concentration for Mn2+ was 1 mM, and for Mg2+ 4-6 mM, Mn2+ was slightly more stimulatory than Mg2+. The enzyme was most active at low ionic strengths [10-20 mM-(NH4)SO4]. The influence of various phosphates was tested: pyrophosphate inhibited RNA polymerase at low concentrations, whereas orthophosphate had no effect on the enzyme activity. ADP was slightly inhibitory, and AMP had no effect on the enzyme reaction. Nucleoside triphosphates and bivalent cations in equimolar concentrations in the range 4-11 mM did not influence the RNA synthesis in vitro. Free nucleoside triphosphates in excess of this 1:1 ratio inhibited the enzyme activity, unlike free bivalent cations, which stimulated RNA polymerase I. PMID:7470092

  11. The Fanconi anemia associated protein FAAP24 uses two substrate specific binding surfaces for DNA recognition

    NARCIS (Netherlands)

    Wienk, H.L.J.; Slootweg, J.C.; Speerstra, S.; Kaptein, R.; Boelens, R.; Folkers, G.E.

    2013-01-01

    To maintain the integrity of the genome, multiple DNA repair systems exist to repair damaged DNA. Recognition of altered DNA, including bulky adducts, pyrimidine dimers and interstrand crosslinks (ICL), partially depends on proteins containing helix-hairpin-helix (HhH) domains. To understand how ICL

  12. Perceptron Mistake Bounds

    OpenAIRE

    Mohri, Mehryar; Rostamizadeh, Afshin

    2013-01-01

    We present a brief survey of existing mistake bounds and introduce novel bounds for the Perceptron or the kernel Perceptron algorithm. Our novel bounds generalize beyond standard margin-loss type bounds, allow for any convex and Lipschitz loss function, and admit a very simple proof.

  13. Progress toward an aberration-corrected low energy electron microscope for DNA sequencing and surface analysis.

    Science.gov (United States)

    Mankos, Marian; Shadman, Khashayar; N'diaye, Alpha T; Schmid, Andreas K; Persson, Henrik H J; Davis, Ronald W

    2012-11-01

    Monochromatic, aberration-corrected, dual-beam low energy electron microscopy (MAD-LEEM) is a novel imaging technique aimed at high resolution imaging of macromolecules, nanoparticles, and surfaces. MAD-LEEM combines three innovative electron-optical concepts in a single tool: a monochromator, a mirror aberration corrector, and dual electron beam illumination. The monochromator reduces the energy spread of the illuminating electron beam, which significantly improves spectroscopic and spatial resolution. The aberration corrector is needed to achieve subnanometer resolution at landing energies of a few hundred electronvolts. The dual flood illumination approach eliminates charging effects generated when a conventional, single-beam LEEM is used to image insulating specimens. The low landing energy of electrons in the range of 0 to a few hundred electronvolts is also critical for avoiding radiation damage, as high energy electrons with kilo-electron-volt kinetic energies cause irreversible damage to many specimens, in particular biological molecules. The performance of the key electron-optical components of MAD-LEEM, the aberration corrector combined with the objective lens and a magnetic beam separator, was simulated. Initial results indicate that an electrostatic electron mirror has negative spherical and chromatic aberration coefficients that can be tuned over a large parameter range. The negative aberrations generated by the electron mirror can be used to compensate the aberrations of the LEEM objective lens for a range of electron energies and provide a path to achieving subnanometer spatial resolution. First experimental results on characterizing DNA molecules immobilized on Au substrates in a LEEM are presented. Images obtained in a spin-polarized LEEM demonstrate that high contrast is achievable at low electron energies in the range of 1-10 eV and show that small changes in landing energy have a strong impact on the achievable contrast. The MAD-LEEM approach

  14. A nonviral DNA delivery system based on surface modified silica-nanoparticles can efficiently transfect cells in vitro

    NARCIS (Netherlands)

    Kneuer, C; Sameti, M; Bakowsky, U; Schiestel, T; Schirra, H

    2000-01-01

    Diverse polycationic polymers have been used as nonviral transfection agents. Here we report the ability of colloidal silica particles with covalently attached cationic surface modifications to transfect plasmid DNA in vitro and make an attempt to describe the structure of the resulting transfection

  15. Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO

    International Nuclear Information System (INIS)

    Pal, Subrata; Maiti, Prabal K; Bagchi, Biman

    2005-01-01

    We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics

  16. Circuit lower bounds in bounded arithmetics

    Czech Academy of Sciences Publication Activity Database

    Pich, Ján

    2015-01-01

    Roč. 166, č. 1 (2015), s. 29-45 ISSN 0168-0072 R&D Projects: GA AV ČR IAA100190902 Keywords : bounded arithmetic * circuit lower bounds Subject RIV: BA - General Mathematics Impact factor: 0.582, year: 2015 http://www.sciencedirect.com/science/article/pii/S0168007214000888

  17. Extracellular DNA is essential for maintaining Bordetella biofilm integrity on abiotic surfaces and in the upper respiratory tract of mice.

    Directory of Open Access Journals (Sweden)

    Matt S Conover

    2011-02-01

    Full Text Available Bacteria form complex and highly elaborate surface adherent communities known as biofilms which are held together by a self-produced extracellular matrix. We have previously shown that by adopting a biofilm mode of existence in vivo, the gram negative bacterial pathogens Bordetella bronchiseptica and Bordetella pertussis are able to efficiently colonize and persist in the mammalian respiratory tract. In general, the bacterial biofilm matrix includes polysaccharides, proteins and extracellular DNA (eDNA. In this report, we investigated the function of DNA in Bordetella biofilm development. We show that DNA is a significant component of Bordetella biofilm matrix. Addition of DNase I at the initiation of biofilm growth inhibited biofilm formation. Treatment of pre-established mature biofilms formed under both static and flow conditions with DNase I led to a disruption of the biofilm biomass. We next investigated whether eDNA played a role in biofilms formed in the mouse respiratory tract. DNase I treatment of nasal biofilms caused considerable dissolution of the biofilm biomass. In conclusion, these results suggest that eDNA is a crucial structural matrix component of both in vitro and in vivo formed Bordetella biofilms. This is the first evidence for the ability of DNase I to disrupt bacterial biofilms formed on host organs.

  18. TAF(II)170 interacts with the concave surface of TATA-binding protein to inhibit its DNA binding activity.

    Science.gov (United States)

    Pereira, L A; van der Knaap, J A; van den Boom, V; van den Heuvel, F A; Timmers, H T

    2001-11-01

    The human RNA polymerase II transcription factor B-TFIID consists of TATA-binding protein (TBP) and the TBP-associated factor (TAF) TAF(II)170 and can rapidly redistribute over promoter DNA. Here we report the identification of human TBP-binding regions in human TAF(II)170. We have defined the TBP interaction domain of TAF(II)170 within three amino-terminal regions: residues 2 to 137, 290 to 381, and 380 to 460. Each region contains a pair of Huntington-elongation-A subunit-Tor repeats and exhibits species-specific interactions with TBP family members. Remarkably, the altered-specificity TBP mutant (TBP(AS)) containing a triple mutation in the concave surface is defective for binding the TAF(II)170 amino-terminal region of residues 1 to 504. Furthermore, within this region the TAF(II)170 residues 290 to 381 can inhibit the interaction between Drosophila TAF(II)230 (residues 2 to 81) and TBP through competition for the concave surface of TBP. Biochemical analyses of TBP binding to the TATA box indicated that TAF(II)170 region 290-381 inhibits TBP-DNA complex formation. Importantly, the TBP(AS) mutant is less sensitive to TAF(II)170 inhibition. Collectively, our results support a mechanism in which TAF(II)170 induces high-mobility DNA binding by TBP through reversible interactions with its concave DNA binding surface.

  19. Influence of the surface free energy of silane-coupled mica substrate on the fixing and straightening of DNA

    International Nuclear Information System (INIS)

    Sasou, Megumi; Sugiyama, Shigeru; Ishida, Takao; Ohtani, Toshio; Miyake, Koji

    2009-01-01

    Methyltrimethoxysilane (MTMS)-coupled mica substrate is reportedly suitable for fixing and straightening of DNA, but 3-aminopropyltriethoxysilane (APTES)-coupled mica substrate has been found less suitable. On MTMS-coupled mica substrate, the straightness of fixed DNA was sufficient, and the adsorption of contaminants was not observed using fluorescence microscopy and atomic force microscopy. For the APTES-coupled mica substrate, however, aggregated or curved DNA and adsorption of contaminants were observed. To clarify the surface factors that are responsible for this suitability, we analyzed the surface free energies of these substrates using the extended Fowkes theory. In each of the surface free energy components, the dispersion force component in the MTMS-coupled mica substrate was lower than that in the APTES-coupled mica substrate. The ratio of the polar force component on the MTMS-coupled mica substrate was about one order of magnitude on the APTES-coupled mica substrate. In addition, the ratio of the hydrogen-bonding force component for the MTMS-coupled mica substrate was about two times larger than that of the APTES-coupled mica substrate. These results suggest that the polar force and hydrogen-bonding force components are important factors for the fixation and straightening of DNA and that the dispersion force components influence the production and adsorption of contaminants.

  20. Dissimilar kinetic behavior of electrically manipulated single- and double-stranded DNA tethered to a gold surface.

    Science.gov (United States)

    Rant, Ulrich; Arinaga, Kenji; Tornow, Marc; Kim, Yong Woon; Netz, Roland R; Fujita, Shozo; Yokoyama, Naoki; Abstreiter, Gerhard

    2006-05-15

    We report on the electrical manipulation of single- and double-stranded oligodeoxynucleotides that are end tethered to gold surfaces in electrolyte solution. The response to alternating repulsive and attractive electric surface fields is studied by time-resolved fluorescence measurements, revealing markedly distinct dynamics for the flexible single-stranded and stiff double-stranded DNA, respectively. Hydrodynamic simulations rationalize this finding and disclose two different kinetic mechanisms: stiff polymers undergo rotation around the anchoring pivot point; flexible polymers, on the other hand, are pulled onto the attracting surface segment by segment.

  1. DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

    Science.gov (United States)

    Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

    2012-10-11

    Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

  2. Surface density dependence of PCR amplicon hybridization on PNA/DNA probe layers

    DEFF Research Database (Denmark)

    Yao, Danfeng; Kim, Junyoung; Yu, Fang

    2005-01-01

    at an intermediate sodium concentration (approximately 100 mM). These effects were mainly ascribed to the electrostatic cross talk among the hybridized DNA molecules and the secondary structure of PCR amplicons. For the negatively charged DNA probes, the hybridization reaction was subjected additionally to the DNA....../DNA electrostatic barrier, particularly in lower ionic strength range (e.g., 10 approximately 150 mM Na(+)). The electrostatic cross talk was shown to be largely reduced if the PNA probe layer was sufficiently diluted by following a strategic templated immobilization method. As a consequence, a pseudo...

  3. A nonviral DNA delivery system based on surface modified silica-nanoparticles can efficiently transfect cells in vitro.

    Science.gov (United States)

    Kneuer, C; Sameti, M; Bakowsky, U; Schiestel, T; Schirra, H; Schmidt, H; Lehr, C M

    2000-01-01

    Diverse polycationic polymers have been used as nonviral transfection agents. Here we report the ability of colloidal silica particles with covalently attached cationic surface modifications to transfect plasmid DNA in vitro and make an attempt to describe the structure of the resulting transfection complexes. In analogy to the terms lipoplex and polyplex, we propose to describe the nanoparticle-DNA complexes by the term "nanoplex". Three batches, Si10E, Si100E, and Si26H, sized between 10 and 100 nm and with zeta potentials ranging from +7 to +31 mV at pH 7.4 were evaluated. The galactosidase expression plasmid DNA pCMVbeta was immobilized on the particle surface and efficiently transfected Cos-1 cells. The transfection activity was accompanied by very low cytotoxicity, with LD(50) values in the milligrams per milliliter range. The most active batch, Si26H, was produced by modification of commercially available silica particles with N-(6-aminohexyl)-3-aminopropyltrimethoxysilane, yielding spherical nanoparticles with a mean diameter of 26 nm and a zeta potential of +31 mV at pH 7.4. Complexes of Si26H and pCMVbeta plasmid DNA formed at w/w ratios of 10 were most effective in promoting transfection of Cos-1 cells in the absence of serum. At this ratio, >90% of the DNA was associated with the particles, yielding nanoplexes with a net negative surface charge. When the transfection medium was supplemented with 10% serum, maximum gene expression was observed at a w/w ratio of 30, at which the resulting particle-DNA complexes possessed a positive surface charge. Transfection was strongly increased in the presence of 100 microM chloroquine in the incubation medium and reached approximately 30% of the efficiency of a 60 kDa polyethylenimine. In contrast to polyethylenimine, no toxicity was observed at the concentrations required. Atomic force microscopy of Si26H-DNA complexes revealed a spaghetti-meatball-like structure. The surface of complexes prepared at a w/w ratio of

  4. Polarized DNA Ejection from the Herpesvirus Capsid

    Science.gov (United States)

    Newcomb, William W.; Cockrell, Shelley K.; Homa, Fred L.; Brown, Jay C.

    2009-01-01

    Ejection of DNA from the capsid is an early step in infection by all herpesviruses. Ejection or DNA uncoating occurs after a parental capsid has entered the host cell cytoplasm, migrated to the nucleus and bound to a nuclear pore. DNA exits the capsid through the portal vertex and proceeds by way of the nuclear pore complex into the nucleoplasm where it is transcribed and replicated. Here we describe use of an in vitro uncoating system to determine which genome end exits first from the herpes simplex virus (HSV-1) capsid. Purified DNA-containing capsids were bound to a solid surface and warmed under conditions in which some, but not all, of the DNA was ejected. Restriction endonuclease digestion was then used to identify the genomic origin of the ejected DNA. The results support the view that the S segment end exits the capsid first. Preferential release at the S end demonstrates that herpesvirus DNA uncoating conforms to the paradigm in dsDNA bacteriophage where the last end packaged is the first to be ejected. Release of HSV-1 DNA beginning at the S end causes the first gene to enter the host cell nucleus to be α4, a transcription factor required for expression of early genes. PMID:19631662

  5. Assessment of DNA damages caused by exposure of bacterial cells and spores to the Mars surface environment

    Science.gov (United States)

    Fajardo-Cavazos, Patricia; Schuerger, Andrew; Robles-Martinez, Jose; Douki, Thierry; Nicholson, Wayne

    Joint NASA and ESA missions are planned for the next decade to investigate the possibility of present or past life on Mars [1]. Evidence of extraterrestrial life will likely rely on the de-tection of biomarkers, highlighting the importance of preventing forward contamination not only with viable microorganisms, but also with biomolecules that could compromise the valid-ity of life-detection experiments [2-4]. The designation of DNA as a high-priority biomarker makes it necessary to evaluate its persistence in extraterrestrial environments, and the effects of exposure on its biological activity. To accomplish this, we deposited naked DNA, cells and spores of Bacillus subtilis 168 or B. pumilus SAFR-032, or cells of Acinetobacter radioresistens 50v1 onto spacecraft-qualified aluminum coupons. Samples were exposed to a simulated Mars surface environment as described in detail previously [4, 5] for various periods of time, and DNA damage was assessed by a number of measurements. Double-and single-strand breaks were measured by neutral and alkaline agarose gel electrophoresis, and DNA bipyrimidine pho-toproducts were measured by HPLC-mass spectrometry, as described previously [6, 7]. Loss of functionality of DNA to serve as a template for replication by DNA polymerase was measured using a quantitative polymerase chain reaction (qPCR) assay [8]. In all cases, DNA damage was directly correlated with time of exposure to simulated martian solar radiation (UV, visible, and infrared wavelengths). Exposure of samples to Mars surface conditions, but shielded from solar radiation, did not result in appreciable damage over the time periods tested, relative to controls. DNA contained within cells or spores was much less susceptible to damage than was naked DNA. Using the qPCR assay, we found that inactivation of naked DNA or DNA extracted from exposed spores of B. subtilis followed a multiphasic dose-response, and that a fraction of DNA molecules retained functionality after

  6. Scattering by bound nucleons

    International Nuclear Information System (INIS)

    Tezuka, Hirokazu.

    1984-10-01

    Scattering of a particle by bound nucleons is discussed. Effects of nucleons that are bound in a nucleus are taken as a structure function. The way how to calculate the structure function is given. (author)

  7. Biofunctionalization of ZnO nanowires for DNA sensory applications

    Energy Technology Data Exchange (ETDEWEB)

    Schroeder, Ulrich Christian; Gnauck, Martin; Ronning, Carsten [Institute of Solid State Physics, University of Jena, Max-Wien-Platz 1, D-07743 Jena (Germany); Moeller, Robert; Rudolph, Bettina; Fritzsche, Wolfgang [Institut fuer Photonische Technologien e.V., Albert-Einstein-Strasse 9, D-07745 Jena (Germany)

    2011-07-01

    In recent years, DNA detecting systems have received a growing interest due to promising fields of application like DNA diagnostics, gene analysis, virus detection or forensic applications. Nanowire-based DNA biosensor allows both miniaturization and easy continuous monitoring of a detection signal by electrical means. The label free detection scheme based on electrochemical changes of the surface potential during immobilization of specific DNA probes was heretofore mainly studied for silicon. In this work a surface decoration process with bifunctional molecules known as silanization was applied to VLS-grown ZnO nanowires which both feature a large sensitivity for surface modification, are biocompatible and easy to synthesize as well. Successfully bound DNA was proved by fluorescence microscopy. Dielectrophoresis (DEP) was chosen and optimized for quickly contacting the ZnO nanowires. Furthermore, electrical signal characterization was performed in preparation for DNA sensory applications.

  8. Crystal structure of the gamma-2 herpesvirus LANA DNA binding domain identifies charged surface residues which impact viral latency.

    Directory of Open Access Journals (Sweden)

    Bruno Correia

    Full Text Available Latency-associated nuclear antigen (LANA mediates γ2-herpesvirus genome persistence and regulates transcription. We describe the crystal structure of the murine gammaherpesvirus-68 LANA C-terminal domain at 2.2 Å resolution. The structure reveals an alpha-beta fold that assembles as a dimer, reminiscent of Epstein-Barr virus EBNA1. A predicted DNA binding surface is present and opposite this interface is a positive electrostatic patch. Targeted DNA recognition substitutions eliminated DNA binding, while certain charged patch mutations reduced bromodomain protein, BRD4, binding. Virus containing LANA abolished for DNA binding was incapable of viable latent infection in mice. Virus with mutations at the charged patch periphery exhibited substantial deficiency in expansion of latent infection, while central region substitutions had little effect. This deficiency was independent of BRD4. These results elucidate the LANA DNA binding domain structure and reveal a unique charged region that exerts a critical role in viral latent infection, likely acting through a host cell protein(s.

  9. Colloidal Au-enhanced surface plasmon resonance imaging: application in a DNA hybridization process

    International Nuclear Information System (INIS)

    Manera, M G; Spadavecchia, J; Taurino, A; Rella, R

    2010-01-01

    The detection of the DNA hybridization mechanism using monodispersed gold nanoparticles as labels is an interesting alternative to increase the sensitivity of the SPR imaging technique. DNA-modified Au nanoparticles (DNA-Au NPs) containing single-stranded (ss) portions of DNA were prepared by monitoring their monolayer formation by UV–vis spectroscopy. The hybridization process between specific thio-oligonucleotides immobilized on the DNA–Au NPs and the corresponding complementary strands is reported and compared with the traditional hybridization process on properly self-assembled thin gold films deposited on glass substrates. A remarkable signal amplification is observed, following the incorporation of colloidal Au into a SPR biosensing experiment, resulting in an increased SPR response to DNA–DNA interactions. In particular Fusarium thiolated DNA (5'HS poly(T) 15 ATC CCT CAA AAA CTG CCG CT-3) and trichothecenes complementary DNA (5'-AGC GGC AGT TTT TGA GGG AT-3') sequences have been explored due to their possible application to agro-industry for the control of food quality

  10. Label-Free Detection of Sequence-Specific DNA Based on Fluorescent Silver Nanoclusters-Assisted Surface Plasmon-Enhanced Energy Transfer.

    Science.gov (United States)

    Ma, Jin-Liang; Yin, Bin-Cheng; Le, Huynh-Nhu; Ye, Bang-Ce

    2015-06-17

    We have developed a label-free method for sequence-specific DNA detection based on surface plasmon enhanced energy transfer (SPEET) process between fluorescent DNA/AgNC string and gold nanoparticles (AuNPs). DNA/AgNC string, prepared by a single-stranded DNA template encoded two emitter-nucleation sequences at its termini and an oligo spacer in the middle, was rationally designed to produce bright fluorescence emission. The proposed method takes advantage of two strategies. The first one is the difference in binding properties of single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA) toward AuNPs. The second one is SPEET process between fluorescent DNA/AgNC string and AuNPs, in which fluorescent DNA/AgNC string can be spontaneously adsorbed onto the surface of AuNPs and correspondingly AuNPs serve as "nanoquencher" to quench the fluorescence of DNA/AgNC string. In the presence of target DNA, the sensing probe hybridized with target DNA to form duplex DNA, leading to a salt-induced AuNP aggregation and subsequently weakened SPEET process between fluorescent DNA/AgNC string and AuNPs. A red-to-blue color change of AuNPs and a concomitant fluorescence increase were clearly observed in the sensing system, which had a concentration dependent manner with specific DNA. The proposed method achieved a detection limit of ∼2.5 nM, offering the following merits of simple design, convenient operation, and low experimental cost because of no chemical modification, organic dye, enzymatic reaction, or separation procedure involved.

  11. Surface-attached molecular beacons light the way for DNA sequencing

    Czech Academy of Sciences Publication Activity Database

    Paleček, Emil

    2004-01-01

    Roč. 22, č. 2 (2004), s. 55-58 ISSN 0167-7799 R&D Projects: GA AV ČR IBS5004355; GA ČR GA204/03/0566 Institutional research plan: CEZ:AV0Z5004920 Keywords : molecular beacon * DNA stem-loop structure * DNA sensors Subject RIV: BO - Biophysics Impact factor: 8.606, year: 2004

  12. In-situ quartz crystal microgravimetric studies of molecular adsorbates containing thiol and hydroquinone moieties bound to Au(111) surfaces in aqueous electrolytes

    Energy Technology Data Exchange (ETDEWEB)

    Mo, Y.; Sukenik, C.; Sandifer, M. [Case Western Univ., Cleveland, OH (United States); Barriga, R.J.; Soriaga, M.P.; Scherson, D. [Texas A& M Univ., College Station, TX (United States)

    1995-12-01

    The microgravimetric properties of monolayers of 2, 5-dihydroxythiophenol, 2,5-dihydroxybenzyl mercaptan, and 2, 5-dihydroxy-4-methylbenzyl mercaptan adsorbed on Au(111) single crystal electrodes were examined by in situ quartz crystal microbalance techniques in aqueous perchloric acid electrolytes. The results obtained are consistent with the reversible loss of an average of about three waters per adsorbed molecule as the layers are oxidized and subsequently reduced. These observations provide evidence for discrete changes in the extent of bound water within the hydroquinone/quinone layer as the oxidation state of the monolayer is changed. 9 refs., 4 figs.

  13. Distinct DNA-binding surfaces in the ATPase and linker domains of MutLγ determine its substrate specificities and exert separable functions in meiotic recombination and mismatch repair.

    Directory of Open Access Journals (Sweden)

    Corentin Claeys Bouuaert

    2017-05-01

    Full Text Available Mlh1-Mlh3 (MutLγ is a mismatch repair factor with a central role in formation of meiotic crossovers, presumably through resolution of double Holliday junctions. MutLγ has DNA-binding, nuclease, and ATPase activities, but how these relate to one another and to in vivo functions are unclear. Here, we combine biochemical and genetic analyses to characterize Saccharomyces cerevisiae MutLγ. Limited proteolysis and atomic force microscopy showed that purified recombinant MutLγ undergoes ATP-driven conformational changes. In vitro, MutLγ displayed separable DNA-binding activities toward Holliday junctions (HJ and, surprisingly, single-stranded DNA (ssDNA, which was not predicted from current models. MutLγ bound DNA cooperatively, could bind multiple substrates simultaneously, and formed higher-order complexes. FeBABE hydroxyl radical footprinting indicated that the DNA-binding interfaces of MutLγ for ssDNA and HJ substrates only partially overlap. Most contacts with HJ substrates were located in the linker regions of MutLγ, whereas ssDNA contacts mapped within linker regions as well as the N-terminal ATPase domains. Using yeast genetic assays for mismatch repair and meiotic recombination, we found that mutations within different DNA-binding surfaces exert separable effects in vivo. For example, mutations within the Mlh1 linker conferred little or no meiotic phenotype but led to mismatch repair deficiency. Interestingly, mutations in the N-terminal domain of Mlh1 caused a stronger meiotic defect than mlh1Δ, suggesting that the mutant proteins retain an activity that interferes with alternative recombination pathways. Furthermore, mlh3Δ caused more chromosome missegregation than mlh1Δ, whereas mlh1Δ but not mlh3Δ partially alleviated meiotic defects of msh5Δ mutants. These findings illustrate functional differences between Mlh1 and Mlh3 during meiosis and suggest that their absence impinges on chromosome segregation not only via reduced

  14. Induction of Boosted Immune Response in Mice by Leptospiral Surface Proteins Expressed in Fusion with DnaK

    Directory of Open Access Journals (Sweden)

    Marina V. Atzingen

    2014-01-01

    Full Text Available Leptospirosis is an important global disease of human and veterinary concern. Caused by pathogenic Leptospira, the illness was recently classified as an emerging infectious disease. Currently available veterinarian vaccines do not induce long-term protection against infection and do not provide cross-protective immunity. Several studies have suggested the use of DnaK as an antigen in vaccine formulation, due to an exceptional degree of immunogenicity. We focused on four surface proteins: rLIC10368 (Lsa21, rLIC10494, rLIC12690 (Lp95, and rLIC12730, previously shown to be involved in host-pathogen interactions. Our goal was to evaluate the immunogenicity of the proteins genetically fused with DnaK in animal model. The chosen genes were amplified by PCR methodology and cloned into pAE, an E. coli vector. The recombinant proteins were expressed alone or in fusion with DnaK at the N-terminus. Our results demonstrate that leptospiral proteins fused with DnaK have elicited an enhanced immune response in mice when compared to the effect promoted by the individual proteins. The boosted immune effect was demonstrated by the production of total IgG, lymphocyte proliferation, and significant amounts of IL-10 in supernatant of splenocyte cell cultures. We believe that this approach could be employed in vaccines to enhance presentation of antigens of Leptospira to professional immune cells.

  15. Physical Uncertainty Bounds (PUB)

    Energy Technology Data Exchange (ETDEWEB)

    Vaughan, Diane Elizabeth [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Preston, Dean L. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2015-03-19

    This paper introduces and motivates the need for a new methodology for determining upper bounds on the uncertainties in simulations of engineered systems due to limited fidelity in the composite continuum-level physics models needed to simulate the systems. We show that traditional uncertainty quantification methods provide, at best, a lower bound on this uncertainty. We propose to obtain bounds on the simulation uncertainties by first determining bounds on the physical quantities or processes relevant to system performance. By bounding these physics processes, as opposed to carrying out statistical analyses of the parameter sets of specific physics models or simply switching out the available physics models, one can obtain upper bounds on the uncertainties in simulated quantities of interest.

  16. Photon virtual bound state

    International Nuclear Information System (INIS)

    Inoue, J.; Ohtaka, K.

    2004-01-01

    We study virtual bound states in photonics, which are a vectorial extension of electron virtual bound states. The condition for these states is derived. It is found that the Mie resonant state which satisfies the condition that the size parameter is less than the angular momentum should be interpreted as a photon virtual bound state. In order to confirm the validity of the concept, we compare the photonic density of states, the width of which represents the lifetime of the photon virtual bound states, with numerical results

  17. The DMM Bound

    DEFF Research Database (Denmark)

    Emiris, Ioannis Z.; Mourrain, Bernard; Tsigaridas, Elias

    2010-01-01

    ) resultant by means of mixed volume, as well as recent advances on aggregate root bounds for univariate polynomials, and are applicable to arbitrary positive dimensional systems. We improve upon Canny's gap theorem [7] by a factor of O(dn-1), where d bounds the degree of the polynomials, and n is the number...... bound on the number of steps that subdivision-based algorithms perform in order to isolate all real roots of a polynomial system. This leads to the first complexity bound of Milne's algorithm [22] in 2D....

  18. Ultra-small rhenium nanoparticles immobilized on DNA scaffolds: An excellent material for surface enhanced Raman scattering and catalysis studies.

    Science.gov (United States)

    Anantharaj, S; Sakthikumar, K; Elangovan, Ayyapan; Ravi, G; Karthik, T; Kundu, Subrata

    2016-12-01

    Highly Sensitive and ultra-small Rhenium (Re) metal nanoparticles (NPs) were successfully stabilized in water by the staging and fencing action of the versatile biomolecule DNA that resulted in two distinct aggregated chain-like morphologies with average grain sizes of 1.1±0.1nm and 0.7±0.1nm for the very first time within a minute of reaction time. Re NPs are formed by the borohydride reduction of ammonium perrhenate (NH4ReO4) in the presence of DNA at room temperature (RT) under stirring. The morphologies were controlled by carefully monitoring the molar ratio of NH4ReO4 and DNA. The synthesized material was employed in two potential applications: as a substrate for surface enhanced Raman scattering (SERS) studies and as a catalyst for the reduction of aromatic nitro compounds. SERS study was carried out by taking methylene blue (MB) as the probe and the highest SERS enhancement factor (EF) of 2.07×10(7) was found for the aggregated chain-like having average grain size of 0.7±0.1nm. Catalytic reduction of 4-nitro phenol (4-NP), 2-nitro phenol (2-NP) and 4-nitroaniline (4-NA) with a rate constant value of 6×10(-2)min(-1), 33.83×10(-2)min(-1) and 37.4×10(-2)min(-1) have testified the excellent catalytic performance of our Re NPs immobilized on DNA. The overall study have revealed the capability of DNA in stabilizing the highly reactive Re metal at nanoscale and made them applicable in practice. The present route can also be extended to prepare one dimensional (1-D), self-assembled NPs of other reactive metals, mixed metals or even metal oxides for specific applications in water based solutions. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. The role of surface charging during the coadsorption of mercaptohexanol to DNA layers on gold: direct observation of desorption and layer reorientation.

    Science.gov (United States)

    Arinaga, K; Rant, U; Tornow, M; Fujita, S; Abstreiter, G; Yokoyama, N

    2006-06-20

    We study the coadsorption of mercaptohexanol onto preimmobilized oligonucleotide layers on gold. Monitoring the position of the DNA relative to the surface by optical means directly shows the mercaptohexanol-induced desorption of DNA and the reorientation of surface-tethered strands in situ and in real time. By simultaneously recording the electrochemical electrode potential, we are able to demonstrate that changes in the layer conformation are predominantly of electrostatic origin and can be reversed by applying external bias to the substrate.

  20. Rapid outer-surface protein C DNA tattoo vaccination protects against Borrelia afzelii infection

    NARCIS (Netherlands)

    Wagemakers, A.; Mason, L. M. K.; Oei, A.; de Wever, B.; van der Poll, T.; Bins, A. D.; Hovius, J. W. R.

    2014-01-01

    Borrelia afzelii is the predominant Borrelia species causing Lyme borreliosis in Europe. Currently there is no human vaccine against Lyme borreliosis, and most research focuses on recombinant protein vaccines against Borrelia burgdorferi sensu stricto. DNA tattooing is a novel vaccination method

  1. An electrochemical study of neutral red-DNA interaction

    International Nuclear Information System (INIS)

    Heli, H.; Bathaie, S.Z.; Mousavi, M.F.

    2005-01-01

    Electrochemical methods were used to investigate the interaction of neutral red (NR) with double-stranded calf thymus DNA, in solution as well as using a DNA-modified glassy carbon (GC-DNA) electrode. The results were compared with those obtained from bare glassy carbon (GC) electrode. The formal potential of NR was more positive when GC-DNA electrode was used although the rate of heterogeneous electron transfer is as high as that of using GC electrode. GC-DNA electrode enables preconcentration of NR for chosen times on the electrode surface, despite the fact that the mass transfer effects in the thin DNA layer adsorbed on the surface was still observed using cyclic voltammetry and electrochemical impedance spectroscopy techniques. Parameters, such as the diffusion coefficient of NR, binding site size in base pairs and the ratio of the binding constants for the oxidized and reduced forms of the bound species were obtained. A binding isotherm for NR at GC-DNA electrode was obtained from coulometric titrations and gave an affinity constant equal to 2.76 x 10 4 L mol -1 . From the studies of the interaction in solution, the diffusion coefficient of free and DNA-bound NR, binding constant and binding site size of the DNA-NR complex was also obtained simultaneously by non-linear fitting analysis of voltammetric data

  2. Metagenomic characterization of airborne viral DNA diversity in the near-surface atmosphere.

    Science.gov (United States)

    Whon, Tae Woong; Kim, Min-Soo; Roh, Seong Woon; Shin, Na-Ri; Lee, Hae-Won; Bae, Jin-Woo

    2012-08-01

    Airborne viruses are expected to be ubiquitous in the atmosphere but they still remain poorly understood. This study investigated the temporal and spatial dynamics of airborne viruses and their genotypic characteristics in air samples collected from three distinct land use types (a residential district [RD], a forest [FR], and an industrial complex [IC]) and from rainwater samples freshly precipitated at the RD site (RD-rain). Viral abundance exhibited a seasonal fluctuation in the range between 1.7 × 10(6) and 4.0 × 10(7) viruses m(-3), which increased from autumn to winter and decreased toward spring, but no significant spatial differences were observed. Temporal variations in viral abundance were inversely correlated with seasonal changes in temperature and absolute humidity. Metagenomic analysis of air viromes amplified by rolling-circle phi29 polymerase-based random hexamer priming indicated the dominance of plant-associated single-stranded DNA (ssDNA) geminivirus-related viruses, followed by animal-infecting circovirus-related sequences, with low numbers of nanoviruses and microphages-related genomes. Particularly, the majority of the geminivirus-related viruses were closely related to ssDNA mycoviruses that infect plant-pathogenic fungi. Phylogenetic analysis based on the replication initiator protein sequence indicated that the airborne ssDNA viruses were distantly related to known ssDNA viruses, suggesting that a high diversity of viruses were newly discovered. This research is the first to report the seasonality of airborne viruses and their genetic diversity, which enhances our understanding of viral ecology in temperate regions.

  3. Bounded Gaussian process regression

    DEFF Research Database (Denmark)

    Jensen, Bjørn Sand; Nielsen, Jens Brehm; Larsen, Jan

    2013-01-01

    We extend the Gaussian process (GP) framework for bounded regression by introducing two bounded likelihood functions that model the noise on the dependent variable explicitly. This is fundamentally different from the implicit noise assumption in the previously suggested warped GP framework. We...... with the proposed explicit noise-model extension....

  4. Bounded Intention Planning Revisited

    OpenAIRE

    Sievers Silvan; Wehrle Martin; Helmert Malte

    2014-01-01

    Bounded intention planning provides a pruning technique for optimal planning that has been proposed several years ago. In addition partial order reduction techniques based on stubborn sets have recently been investigated for this purpose. In this paper we revisit bounded intention planning in the view of stubborn sets.

  5. Integration of Multiplexed Microfluidic Electrokinetic Concentrators with a Morpholino Microarray via Reversible Surface Bonding for Enhanced DNA Hybridization.

    Science.gov (United States)

    Martins, Diogo; Wei, Xi; Levicky, Rastislav; Song, Yong-Ak

    2016-04-05

    We describe a microfluidic concentration device to accelerate the surface hybridization reaction between DNA and morpholinos (MOs) for enhanced detection. The microfluidic concentrator comprises a single polydimethylsiloxane (PDMS) microchannel onto which an ion-selective layer of conductive polymer poly(3,4-ethylenedioxythiophene)-poly(styrenesulfonate) ( PSS) was directly printed and then reversibly surface bonded onto a morpholino microarray for hybridization. Using this electrokinetic trapping concentrator, we could achieve a maximum concentration factor of ∼800 for DNA and a limit of detection of 10 nM within 15 min. In terms of the detection speed, it enabled faster hybridization by around 10-fold when compared to conventional diffusion-based hybridization. A significant advantage of our approach is that the fabrication of the microfluidic concentrator is completely decoupled from the microarray; by eliminating the need to deposit an ion-selective layer on the microarray surface prior to device integration, interfacing between both modules, the PDMS chip for electrokinetic concentration and the substrate for DNA sensing are easier and applicable to any microarray platform. Furthermore, this fabrication strategy facilitates a multiplexing of concentrators. We have demonstrated the proof-of-concept for multiplexing by building a device with 5 parallel concentrators connected to a single inlet/outlet and applying it to parallel concentration and hybridization. Such device yielded similar concentration and hybridization efficiency compared to that of a single-channel device without adding any complexity to the fabrication and setup. These results demonstrate that our concentrator concept can be applied to the development of a highly multiplexed concentrator-enhanced microarray detection system for either genetic analysis or other diagnostic assays.

  6. Bounding species distribution models

    Directory of Open Access Journals (Sweden)

    Thomas J. STOHLGREN, Catherine S. JARNEVICH, Wayne E. ESAIAS,Jeffrey T. MORISETTE

    2011-10-01

    Full Text Available Species distribution models are increasing in popularity for mapping suitable habitat for species of management concern. Many investigators now recognize that extrapolations of these models with geographic information systems (GIS might be sensitive to the environmental bounds of the data used in their development, yet there is no recommended best practice for “clamping” model extrapolations. We relied on two commonly used modeling approaches: classification and regression tree (CART and maximum entropy (Maxent models, and we tested a simple alteration of the model extrapolations, bounding extrapolations to the maximum and minimum values of primary environmental predictors, to provide a more realistic map of suitable habitat of hybridized Africanized honey bees in the southwestern United States. Findings suggest that multiple models of bounding, and the most conservative bounding of species distribution models, like those presented here, should probably replace the unbounded or loosely bounded techniques currently used [Current Zoology 57 (5: 642–647, 2011].

  7. Bounding Species Distribution Models

    Science.gov (United States)

    Stohlgren, Thomas J.; Jarnevich, Cahterine S.; Morisette, Jeffrey T.; Esaias, Wayne E.

    2011-01-01

    Species distribution models are increasing in popularity for mapping suitable habitat for species of management concern. Many investigators now recognize that extrapolations of these models with geographic information systems (GIS) might be sensitive to the environmental bounds of the data used in their development, yet there is no recommended best practice for "clamping" model extrapolations. We relied on two commonly used modeling approaches: classification and regression tree (CART) and maximum entropy (Maxent) models, and we tested a simple alteration of the model extrapolations, bounding extrapolations to the maximum and minimum values of primary environmental predictors, to provide a more realistic map of suitable habitat of hybridized Africanized honey bees in the southwestern United States. Findings suggest that multiple models of bounding, and the most conservative bounding of species distribution models, like those presented here, should probably replace the unbounded or loosely bounded techniques currently used [Current Zoology 57 (5): 642-647, 2011].

  8. Polar silica-based stationary phases. Part II- Neutral silica stationary phases with surface bound maltose and sorbitol for hydrophilic interaction liquid chromatography.

    Science.gov (United States)

    Rathnasekara, Renuka; El Rassi, Ziad

    2017-07-28

    Two neutral polyhydroxylated silica bonded stationary phases, namely maltose-silica (MALT-silica) and sorbitol-silica (SOR-silica), have been introduced and chromatographically characterized in hydrophilic interaction liquid chromatography (HILIC) for a wide range of polar compounds. The bonding of the maltose and sorbitol to the silica surface was brought about by first converting bare silica to an epoxy-activated silica surface via reaction with γ-glycidoxypropyltrimethoxysilane (GPTMS) followed by attaching maltose and sorbitol to the epoxy surface in the presence of the Lewis acid catalyst BF 3 .ethereate. Both silica based columns offered the expected retention characteristics usually encountered for neutral polar surface. The retention mechanism is majorly based on solute' differential partitioning between an organic rich hydro-organic mobile phase (e.g., ACN rich mobile phase) and an adsorbed water layer on the surface of the stationary phase although additional hydrogen bonding was also responsible in some cases for solute retention. The MALT-silica column proved to be more hydrophilic and offered higher retention, separation efficiency and resolution than the SOR-silica column among the tested polar solutes such as derivatized mono- and oligosaccharides, weak phenolic acids, cyclic nucleotide monophosphate and nucleotide-5'-monophosphates, and weak bases, e.g., nucleobases and nucleosides. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. A single-surface electrochemical biosensor for the detection of DNA triplet repeat expansion

    Czech Academy of Sciences Publication Activity Database

    Fojta, Miroslav; Horáková Brázdilová, Petra; Cahová, Kateřina; Pečinka, Petr

    2006-01-01

    Roč. 18, č. 2 (2006), s. 141-151 ISSN 1040-0397 R&D Projects: GA MPO(CZ) 1H-PK/42; GA AV ČR(CZ) IAA4004402 Institutional research plan: CEZ:AV0Z50040507 Keywords : DNA hybridization * electrochemical biosensor * enzyme-linked assay Subject RIV: BO - Biophysics Impact factor: 2.444, year: 2006

  10. DNA Origami Directed Au Nanostar Dimers for Single-Molecule Surface-Enhanced Raman Scattering.

    Science.gov (United States)

    Tanwar, Swati; Haldar, Krishna Kanta; Sen, Tapasi

    2017-12-06

    We demonstrate the synthesis of Au nanostar dimers with tunable interparticle gap and controlled stoichiometry assembled on DNA origami. Au nanostars with uniform and sharp tips were immobilized on rectangular DNA origami dimerized structures to create nanoantennas containing monomeric and dimeric Au nanostars. Single Texas red (TR) dye was specifically attached in the junction of the dimerized origami to act as a Raman reporter molecule. The SERS enhancement factors of single TR dye molecules located in the conjunction region in dimer structures having interparticle gaps of 7 and 13 nm are 2 × 10 10 and 8 × 10 9 , respectively, which are strong enough for single analyte detection. The highly enhanced electromagnetic field generated by the plasmon coupling between sharp tips and cores of two Au nanostars in the wide conjunction region allows the accommodation and specific detection of large biomolecules. Such DNA-directed assembled nanoantennas with controlled interparticle separation distance and stoichiometry, and well-defined geometry, can be used as excellent substrates in single-molecule SERS spectroscopy and will have potential applications as a reproducible platform in single-molecule sensing.

  11. Surface-enhanced Raman scattering biosensor for DNA detection on nanoparticle island substrates

    DEFF Research Database (Denmark)

    Yuan, Scott Wu; Ho, Ho Pui; Lee, Rebecca K.Y.

    2009-01-01

    We present a study on the surface-enhanced Raman scattering (SERS) properties of Ag nanoparticle island substrates (NIS) and their applications for target oligonucleotide (OND) detection. It has been found that the surface nanostructure of NIS samples can be controlled with a good degree of repro......We present a study on the surface-enhanced Raman scattering (SERS) properties of Ag nanoparticle island substrates (NIS) and their applications for target oligonucleotide (OND) detection. It has been found that the surface nanostructure of NIS samples can be controlled with a good degree...

  12. Mutations on the DNA binding surface of TBP discriminate between yeast TATA and TATA-less gene transcription.

    Science.gov (United States)

    Kamenova, Ivanka; Warfield, Linda; Hahn, Steven

    2014-08-01

    Most RNA polymerase (Pol) II promoters lack a TATA element, yet nearly all Pol II transcription requires TATA binding protein (TBP). While the TBP-TATA interaction is critical for transcription at TATA-containing promoters, it has been unclear whether TBP sequence-specific DNA contacts are required for transcription at TATA-less genes. Transcription factor IID (TFIID), the TBP-containing coactivator that functions at most TATA-less genes, recognizes short sequence-specific promoter elements in metazoans, but analogous promoter elements have not been identified in Saccharomyces cerevisiae. We generated a set of mutations in the yeast TBP DNA binding surface and found that most support growth of yeast. Both in vivo and in vitro, many of these mutations are specifically defective for transcription of two TATA-containing genes with only minor defects in transcription of two TATA-less, TFIID-dependent genes. TBP binds several TATA-less promoters with apparent high affinity, but our results suggest that this binding is not important for transcription activity. Our results are consistent with the model that sequence-specific TBP-DNA contacts are not important at yeast TATA-less genes and suggest that other general transcription factors or coactivator subunits are responsible for recognition of TATA-less promoters. Our results also explain why yeast TBP derivatives defective for TATA binding appear defective in activated transcription. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  13. Feasibility of using DNA-immobilized nanocellulose-based immunoadsorbent for systemic lupus erythematosus plasmapheresis.

    Science.gov (United States)

    Xu, Changgang; Carlsson, Daniel O; Mihranyan, Albert

    2016-07-01

    The goal of this project was to study the feasibility of using a DNA-immobilized nanocellulose-based immunoadsorbent for possible application in medical apheresis such as systemic lupus erythematosus (SLE) treatment. Calf thymus DNA was bound to high surface area nanocellulose membrane at varying concentrations using UV-irradiation. The DNA-immobilized samples were characterized with scanning electron microscopy, atomic force microscopy, and phosphorus elemental analysis. The anti-ds-DNA IgG binding was tested in vitro using ELISA. The produced sample showed high affinity in vitro to bind anti-ds-DNA-antibodies from mice, as much as 80% of added IgG was bound by the membrane. Furthermore, the binding efficiency was quantitatively dependent on the amount of immobilized DNA onto nanocellulose membrane. The described nanocellulose membranes are interesting immunoadsorbents for continued clinical studies. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Organically bound tritium

    International Nuclear Information System (INIS)

    Diabate, S.; Strack, S.

    1993-01-01

    Tritium released into the environment may be incorporated into organic matter. Organically bound tritium in that case will show retention times in organisms that are considerably longer than those of tritiated water which has significant consequences on dose estimates. This article reviews the most important processes of organically bound tritium production and transport through food networks. Metabolic reactions in plant and animal organisms with tritiated water as a reaction partner are of great importance in this respect. The most important production process, in quantitative terms, is photosynthesis in green plants. The translocation of organically bound tritium from the leaves to edible parts of crop plants should be considered in models of organically bound tritium behavior. Organically bound tritium enters the human body on several pathways, either from the primary producers (vegetable food) or at a higher tropic level (animal food). Animal experiments have shown that the dose due to ingestion of organically bound tritium can be up to twice as high as a comparable intake of tritiated water in gaseous or liquid form. In the environment, organically bound tritium in plants and animals is often found to have higher specific tritium concentrations than tissue water. This is not due to some tritium enrichment effects but to the fact that no equilibrium conditions are reached under natural conditions. 66 refs

  15. Deeply bound pionic atom

    International Nuclear Information System (INIS)

    Toki, Hiroshi; Yamazaki, Toshimitsu

    1989-01-01

    The standard method of pionic atom formation does not produce deeply bound pionic atoms. A study is made on the properties of deeply bound pionic atom states by using the standard pion-nucleus optical potential. Another study is made to estimate the cross sections of the formation of ls pionic atom states by various methods. The pion-nucleus optical potential is determined by weakly bound pionic atom states and pion nucleus scattering. Although this potential may not be valid for deeply bound pionic atoms, it should provide some hint on binding energies and level widths of deeply bound states. The width of the ls state comes out to be 0.3 MeV and is well separated from the rest. The charge dependence of the ls state is investigated. The binding energies and the widths increase linearly with Z azbove a Z of 30. The report then discusses various methods to populate deeply bound pionic atoms. In particular, 'pion exchange' reactions are proposed. (n, pπ) reaction is discussed first. The cross section is calculated by assuming the in- and out-going nucleons on-shell and the produced pion in (n1) pionic atom states. Then, (n, dπ - ) cross sections are estimated. (p, 2 Heπ - ) reaction would have cross sections similar to the cross section of (n, dπ - ) reaction. In conclusion, it seems best to do (n, p) experiment on heavy nuclei for deeply bound pionic atom. (Nogami, K.)

  16. Whole genome expression profiling using DNA microarray for determining biocompatibility of polymeric surfaces

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Wang, Zhenyu; Kutter, Jörg Peter

    2006-01-01

    There is an ever increasing need to find surfaces that are biocompatible for applications like medical implants and microfluidics-based cell culture systems. The biocompatibility of five different surfaces with different hydrophobicity was determined using gene expression profiling as well as more...

  17. Electrostatic control by lipids upon the membrane-bound (Na+ + K+)-ATPase. II. The influence of surface potential upon the activating ion equilibria.

    Science.gov (United States)

    Ahrens, M L

    1983-07-13

    Electrostatic influences upon the enzymatic activity of the (Na+ + K+)-ATPase from ox brain (EC 3.6.1.3) have been studied. (1) The characteristics of the temperature dependence of the activity - the slopes and inflection temperature, Ti, of the Arrhenius plots - have been shown to depend on the total concentration, but not on the specific properties of added monovalent ions. (2) The enzymatic activity has been shown to be subject simultaneously to unspecific and specific influences of alkali-metal ions or NH+4. Ion-specific effects result from different binding constants of complexation between activating ions and enzyme. These stability constants are affected by the formation of an electrical double layer at the membrane surface. With increasing electrostatic screening, the complex formation is destabilized and, as a consequence, the enzymatic activity decreases. (3) This interaction between ion binding and surface electrostatics enables the enzyme to adapt its activity to the actual ionic conditions. This gives rise to a complex net dependence of the enzymatic activity upon the concentrations of activating ions. Such dependencies are analyzed, and an 'activity surface' has been constructed which represents the enzymatic activity as a function of simultaneously varying concentrations of sodium and potassium. The shape of this activity surface is determined by the relations between ion concentrations, surface potential and the resulting stability of the complexation between the activating ions and the enzyme. By means of three-dimensional representation it is demonstrated that the adaptability of the stability constants is of great importance with respect to the maintenance of the optimal ionic concentrations within the living cell. Therefore, by means of the surrounding membrane, the ATPase is provided with a quality, in addition to its substrate specificity and catalytic ability, which is necessary for its function as a transport enzyme.

  18. DNA condensation by partially acetylated poly(amido amine) dendrimers: effects of dendrimer charge density on complex formation.

    Science.gov (United States)

    Yu, Shi; Li, Ming-Hsin; Choi, Seok Ki; Baker, James R; Larson, Ronald G

    2013-09-03

    The ability of poly(amido amine) (or PAMAM) dendrimers to condense semiflexible dsDNA and penetrate cell membranes gives them great potential in gene therapy and drug delivery but their high positive surface charge makes them cytotoxic. Here, we describe the effects of partial neutralization by acetylation on DNA condensation using light scattering, circular dichroism, and single molecule imaging of dendrimer-DNA complexes combed onto surfaces and tethered to those surfaces under flow. We find that DNA can be condensed by generation-five (G5) dendrimers even when the surface charges are more than 65% neutralized, but that such dendrimers bind negligibly when an end-tethered DNA is stretched in flow. We also find that when fully charged dendrimers are introduced by flow to end-tethered DNA, all DNA molecules become equally highly coated with dendrimers at a rate that becomes very fast at high dendrimer concentration, and that dendrimers remain bound during subsequent flow of dendrimer-free buffer. These results suggest that the presence of dendrimer-free DNA coexisting with dendrimer-bound DNA after bulk mixing of the two in solution may result from diffusion-limited irreversible dendrimer-DNA binding, rather than, or in addition to, the previously proposed cooperative binding mechanism of dendrimers to DNA.

  19. DNA Condensation by Partially Acetylated Poly(amido amine Dendrimers: Effects of Dendrimer Charge Density on Complex Formation

    Directory of Open Access Journals (Sweden)

    Ronald G. Larson

    2013-09-01

    Full Text Available The ability of poly(amido amine (or PAMAM dendrimers to condense semiflexible dsDNA and penetrate cell membranes gives them great potential in gene therapy and drug delivery but their high positive surface charge makes them cytotoxic. Here, we describe the effects of partial neutralization by acetylation on DNA condensation using light scattering, circular dichroism, and single molecule imaging of dendrimer-DNA complexes combed onto surfaces and tethered to those surfaces under flow. We find that DNA can be condensed by generation-five (G5 dendrimers even when the surface charges are more than 65% neutralized, but that such dendrimers bind negligibly when an end-tethered DNA is stretched in flow. We also find that when fully charged dendrimers are introduced by flow to end-tethered DNA, all DNA molecules become equally highly coated with dendrimers at a rate that becomes very fast at high dendrimer concentration, and that dendrimers remain bound during subsequent flow of dendrimer-free buffer. These results suggest that the presence of dendrimer-free DNA coexisting with dendrimer-bound DNA after bulk mixing of the two in solution may result from diffusion-limited irreversible dendrimer-DNA binding, rather than, or in addition to, the previously proposed cooperative binding mechanism of dendrimers to DNA.

  20. Bounded Rationality and Budgeting

    OpenAIRE

    Ibrahim, Mukdad

    2016-01-01

    This article discusses the theory of bounded rationality which had been introduced by Herbert Simon in the 1950s. Simon introduced the notion of bounded rationality stating that while decision-makers strive for rationality, they are limited by the effect of the environment, their information process capacity and by the constraints on their information storage and retrieval capabilities. Moreover, this article tries to specifically blend this notion into budgeting, using the foundations of inc...

  1. [The Role of Membrane-Bound Heat Shock Proteins Hsp90 in Migration of Tumor Cells in vitro and Involvement of Cell Surface Heparan Sulfate Proteoglycans in Protein Binding to Plasma Membrane].

    Science.gov (United States)

    Snigireva, A V; Vrublevskaya, V V; Skarga, Y Y; Morenkov, O S

    2016-01-01

    Heat shock protein Hsp90, detected in the extracellular space and on the membrane of cells, plays an important role in cell motility, migration, invasion and metastasis of tumor cells. At present, the functional role and molecular mechanisms of Hsp90 binding to plasma membrane are not elucidated. Using isoform-specific antibodies against Hsp90, Hsp9α and Hsp90β, we showed that membrane-bound Hsp90α and Hsp90β play a significant role in migration of human fibrosarcoma (HT1080) and glioblastoma (A-172) cells in vitro. Disorders of sulfonation of cell heparan sulfates, cleavage of cell heparan. sulfates by heparinase I/III as well as treatment of cells with heparin lead to an abrupt reduction in the expression level of Hsp90 isoforms. Furthermore, heparin significantly inhibits tumor cell migration. The results obtained demonstrate that two isoforms of membrane-bound Hsp90 are involved in migration of tumor cells in vitro and that cell surface heparan sulfate proteoglycans play a pivotal role in the "anchoring" of Hsp90α and Hsp90β to the plasma membrane.

  2. Virial Expansion Bounds

    Science.gov (United States)

    Tate, Stephen James

    2013-10-01

    In the 1960s, the technique of using cluster expansion bounds in order to achieve bounds on the virial expansion was developed by Lebowitz and Penrose (J. Math. Phys. 5:841, 1964) and Ruelle (Statistical Mechanics: Rigorous Results. Benjamin, Elmsford, 1969). This technique is generalised to more recent cluster expansion bounds by Poghosyan and Ueltschi (J. Math. Phys. 50:053509, 2009), which are related to the work of Procacci (J. Stat. Phys. 129:171, 2007) and the tree-graph identity, detailed by Brydges (Phénomènes Critiques, Systèmes Aléatoires, Théories de Jauge. Les Houches 1984, pp. 129-183, 1986). The bounds achieved by Lebowitz and Penrose can also be sharpened by doing the actual optimisation and achieving expressions in terms of the Lambert W-function. The different bound from the cluster expansion shows some improvements for bounds on the convergence of the virial expansion in the case of positive potentials, which are allowed to have a hard core.

  3. Bound and rebound states

    International Nuclear Information System (INIS)

    Orzalesi, C.A.

    1979-01-01

    In relativistic quantum theory, bound states generate forces in the crossed channel; such forces can affect the binding and self-consistent solutions should be sought for the bound-state problem. The author investigates how self-consistency can be achieved by successive approximations, in a simple scalar model and with successive relativistic eikonal approximations (EAs). Within the generalized ladder approximation, some exact properties of the resulting ''first generation'' bound states are discussed. The binding energies in this approximation are rather small even for rather large values of the primary coupling constant. The coupling of the constituent particles to the first-generation reggeon is determined by a suitable EA and a new generalized ladder amplitude is constructed with rungs given either by the primary gluons or by the first-generation reggeons. The resulting new (second-generation) bound states are found in a reggeized EA. The size of the corrections to the binding energies due to the rebinding effects is surprisingly large. The procedure is then iterated, so as to find - again in an EA - the third-generation bound states. The procedure is found to be self-consistent already at this stage: the third-generation bound states coincide with those of second generation, and no further rebinding takes place in the higher iterations of the approximation method. Features - good and bad - of the model are discussed, as well as the possible relevance of rebinding mechanisms in hadron dynamics. (author)

  4. Maximally asymmetric transbilayer distribution of anionic lipids alters the structure and interaction with lipids of an amyloidogenic protein dimer bound to the membrane surface.

    Science.gov (United States)

    Cheng, Sara Y; Chou, George; Buie, Creighton; Vaughn, Mark W; Compton, Campbell; Cheng, Kwan H

    2016-03-01

    We used molecular dynamics simulations to explore the effects of asymmetric transbilayer distribution of anionic phosphatidylserine (PS) lipids on the structure of a protein on the membrane surface and subsequent protein-lipid interactions. Our simulation systems consisted of an amyloidogenic, beta-sheet rich dimeric protein (D42) absorbed to the phosphatidylcholine (PC) leaflet, or protein-contact PC leaflet, of two membrane systems: a single-component PC bilayer and double PC/PS bilayers. The latter comprised of a stable but asymmetric transbilayer distribution of PS in the presence of counterions, with a 1-component PC leaflet coupled to a 1-component PS leaflet in each bilayer. The maximally asymmetric PC/PS bilayer had a non-zero transmembrane potential (TMP) difference and higher lipid order packing, whereas the symmetric PC bilayer had a zero TMP difference and lower lipid order packing under physiologically relevant conditions. Analysis of the adsorbed protein structures revealed weaker protein binding, more folding in the N-terminal domain, more aggregation of the N- and C-terminal domains and larger tilt angle of D42 on the PC leaflet surface of the PC/PS bilayer versus the PC bilayer. Also, analysis of protein-induced membrane structural disruption revealed more localized bilayer thinning in the PC/PS versus PC bilayer. Although the electric field profile in the non-protein-contact PS leaflet of the PC/PS bilayer differed significantly from that in the non-protein-contact PC leaflet of the PC bilayer, no significant difference in the electric field profile in the protein-contact PC leaflet of either bilayer was evident. We speculate that lipid packing has a larger effect on the surface adsorbed protein structure than the electric field for a maximally asymmetric PC/PS bilayer. Our results support the mechanism that the higher lipid packing in a lipid leaflet promotes stronger protein-protein but weaker protein-lipid interactions for a dimeric protein on

  5. Surface modification of amorphous nanosilica particles suppresses nanosilica-induced cytotoxicity, ROS generation, and DNA damage in various mammalian cells

    International Nuclear Information System (INIS)

    Yoshida, Tokuyuki; Yoshioka, Yasuo; Matsuyama, Keigo; Nakazato, Yasutaro; Tochigi, Saeko; Hirai, Toshiro; Kondoh, Sayuri; Nagano, Kazuya; Abe, Yasuhiro; Kamada, Haruhiko; Tsunoda, Shin-ichi; Nabeshi, Hiromi; Yoshikawa, Tomoaki; Tsutsumi, Yasuo

    2012-01-01

    Highlights: ► There is increasing concern regarding the potential health risks of nanomaterials. ► We evaluated the effect of surface properties of nanomaterials on cellular responses. ► We showed that the surface properties play an important in determining its safety. ► These data provide useful information for producing safer nanomaterials. -- Abstract: Recently, nanomaterials have been utilized in various fields. In particular, amorphous nanosilica particles are increasingly being used in a range of applications, including cosmetics, food technology, and medical diagnostics. However, there is concern that the unique characteristics of nanomaterials might induce undesirable effects. The roles played by the physical characteristics of nanomaterials in cellular responses have not yet been elucidated precisely. Here, by using nanosilica particles (nSPs) with a diameter of 70 nm whose surface was either unmodified (nSP70) or modified with amine (nSP70-N) or carboxyl groups (nSP70-C), we examined the relationship between the surface properties of nSPs and cellular responses such as cytotoxicity, reactive oxygen species (ROS) generation, and DNA damage. To compare the cytotoxicity of nSP70, nSP70-N, or nSP70-C, we examined in vitro cell viability after nSP treatment. Although the susceptibility of each cell line to the nSPs was different, nSP70-C and nSP70-N showed lower cytotoxicity than nSP70 in all cell lines. Furthermore, the generation of ROS and induction of DNA damage in nSP70-C- and nSP70-N-treated cells were lower than those in nSP70-treated cells. These results suggest that the surface properties of nSP70 play an important role in determining its safety, and surface modification of nSP70 with amine or carboxyl groups may be useful for the development of safer nSPs. We hope that our results will contribute to the development of safer nanomaterials.

  6. New ab initio adiabatic potential energy surfaces and bound state calculations for the singlet ground X˜ 1A1 and excited C˜ 1B2(21A') states of SO2

    Science.gov (United States)

    Kłos, Jacek; Alexander, Millard H.; Kumar, Praveen; Poirier, Bill; Jiang, Bin; Guo, Hua

    2016-05-01

    We report new and more accurate adiabatic potential energy surfaces (PESs) for the ground X˜ 1A1 and electronically excited C˜ 1B2(21A') states of the SO2 molecule. Ab initio points are calculated using the explicitly correlated internally contracted multi-reference configuration interaction (icMRCI-F12) method. A second less accurate PES for the ground X ˜ state is also calculated using an explicitly correlated single-reference coupled-cluster method with single, double, and non-iterative triple excitations [CCSD(T)-F12]. With these new three-dimensional PESs, we determine energies of the vibrational bound states and compare these values to existing literature data and experiment.

  7. Time Course of Detection of Human Male DNA from Stained Blood Sample on Various Surfaces by Loop Mediated Isothermal Amplification and Polymerase Chain Reaction

    OpenAIRE

    Panan Kanchanaphum

    2018-01-01

    This study explores determining the sex of humans from blood stains taken from different surfaces and compares the time course of detection with the conventional PCR, Conventional Loop Mediated Isothermal Amplification (LAMP), and LAMP-Lateral Flow Dipstick (LFD). For the DNA templates, 7 male and 7 female blood stained samples were extracted and added to LAMP and PCR reaction solution to amplify the SRY gene. The DNA samples were extracted from the following blood stained materials: cloth, w...

  8. One-step polymer surface modification for minimizing drug, protein, and DNA adsorption in microanalytical systems

    DEFF Research Database (Denmark)

    Larsen, Esben Kjær Unmack; Larsen, Niels Bent

    2013-01-01

    The non-specific adsorption of dissolved analytes strongly reduces the sensitivity and reliability in polymer microanalytical systems. Here, a one-step aqueous phase procedure modifies polymer material surfaces to strongly reduce their non-specific adsorption of a broad range of organic analytes ...

  9. DNA-modified electrodes fabricated using copper-free click chemistry for enhanced protein detection.

    Science.gov (United States)

    Furst, Ariel L; Hill, Michael G; Barton, Jacqueline K

    2013-12-31

    A method of DNA monolayer formation has been developed using copper-free click chemistry that yields enhanced surface homogeneity and enables variation in the amount of DNA assembled; extremely low-density DNA monolayers, with as little as 5% of the monolayer being DNA, have been formed. These DNA-modified electrodes (DMEs) were characterized visually, with AFM, and electrochemically, and were found to facilitate DNA-mediated reduction of a distally bound redox probe. These low-density monolayers were found to be more homogeneous than traditional thiol-modified DNA monolayers, with greater helix accessibility through an increased surface area-to-volume ratio. Protein binding efficiency of the transcriptional activator TATA-binding protein (TBP) was also investigated on these surfaces and compared to that on DNA monolayers formed with standard thiol-modified DNA. Our low-density monolayers were found to be extremely sensitive to TBP binding, with a signal decrease in excess of 75% for 150 nM protein. This protein was detectable at 4 nM, on the order of its dissociation constant, with our low-density monolayers. The improved DNA helix accessibility and sensitivity of our low-density DNA monolayers to TBP binding reflects the general utility of this method of DNA monolayer formation for DNA-based electrochemical sensor development.

  10. Simultaneous detection of transgenic DNA by surface plasmon resonance imaging with potential application to gene doping detection.

    Science.gov (United States)

    Scarano, Simona; Ermini, Maria Laura; Spiriti, Maria Michela; Mascini, Marco; Bogani, Patrizia; Minunni, Maria

    2011-08-15

    Surface plasmon resonance imaging (SPRi) was used as the transduction principle for the development of optical-based sensing for transgenes detection in human cell lines. The objective was to develop a multianalyte, label-free, and real-time approach for DNA sequences that are identified as markers of transgenosis events. The strategy exploits SPRi sensing to detect the transgenic event by targeting selected marker sequences, which are present on shuttle vector backbone used to carry out the transfection of human embryonic kidney (HEK) cell lines. Here, we identified DNA sequences belonging to the Cytomegalovirus promoter and the Enhanced Green Fluorescent Protein gene. System development is discussed in terms of probe efficiency and influence of secondary structures on biorecognition reaction on sensor; moreover, optimization of PCR samples pretreatment was carried out to allow hybridization on biosensor, together with an approach to increase SPRi signals by in situ mass enhancement. Real-time PCR was also employed as reference technique for marker sequences detection on human HEK cells. We can foresee that the developed system may have potential applications in the field of antidoping research focused on the so-called gene doping.

  11. Bounded Tamper Resilience

    DEFF Research Database (Denmark)

    Damgård, Ivan Bjerre; Faust, Sebastian; Mukherjee, Pratyay

    2013-01-01

    Related key attacks (RKAs) are powerful cryptanalytic attacks where an adversary can change the secret key and observe the effect of such changes at the output. The state of the art in RKA security protects against an a-priori unbounded number of certain algebraic induced key relations, e.......g., affine functions or polynomials of bounded degree. In this work, we show that it is possible to go beyond the algebraic barrier and achieve security against arbitrary key relations, by restricting the number of tampering queries the adversary is allowed to ask for. The latter restriction is necessary......-protocols (including the Okamoto scheme, for instance) are secure even if the adversary can arbitrarily tamper with the prover’s state a bounded number of times and obtain some bounded amount of leakage. Interestingly, for the Okamoto scheme we can allow also independent tampering with the public parameters. We show...

  12. Massive Galileon positivity bounds

    Science.gov (United States)

    de Rham, Claudia; Melville, Scott; Tolley, Andrew J.; Zhou, Shuang-Yong

    2017-09-01

    The EFT coefficients in any gapped, scalar, Lorentz invariant field theory must satisfy positivity requirements if there is to exist a local, analytic Wilsonian UV completion. We apply these bounds to the tree level scattering amplitudes for a massive Galileon. The addition of a mass term, which does not spoil the non-renormalization theorem of the Galileon and preserves the Galileon symmetry at loop level, is necessary to satisfy the lowest order positivity bound. We further show that a careful choice of successively higher derivative corrections are necessary to satisfy the higher order positivity bounds. There is then no obstruction to a local UV completion from considerations of tree level 2-to-2 scattering alone. To demonstrate this we give an explicit example of such a UV completion.

  13. The binding parameters of radiolabelled monoclonal F (ab')2 and Fab' fragments relative to immunoglobulin G in reactions with surface-bound antigens

    International Nuclear Information System (INIS)

    Fjeld, J.G.; Nustad, K.; Michaelsen, T.E.

    1992-01-01

    The binding parameters of iodine-125-labelled intact monoclonal immunoglobulin G (IgG), F(ab') 2 and Fab' fragments were compared. The study was carried out with the two monoclonal antibodies (MoAbs) K13 and K16 specific for human Ig light chains κ and λ, respectively. When testing the 125 I-MoAbs against monodisperse polymer particles coated with the specific antigens, the K a for the F(ab') 2 fragments were similar to that for IgG, while the K a for the Fab' fragments were reduced to 10%-20% of that for IgG. The number N of effective target sites revealed with Fab' was higher than with F(ab') and IgG, presumably because less surface area is occupied by the small Fab' molecules. The immunoreactive fraction F ranged according to IgG>F(ab') 2 >Fab'. The explanation of the moderate difference between the K a of the monoclonal Fab' and the divalent IgG and F(ab') 2 was that the divalent molecules were not divalently attached to the particles. When testing the same antibody preparations against humanlymphoma cells producing Ig with light chains κ or λ, the binding results were less reliable than when particles were utilised, presumably due to antigen shedding. Different MoAbs vary in their loss of immunoreactivity due to enzymatic degradation and the radiolabelling procedure. The preparation of the radiolabelled fragments should therefore be optimized for each MoAb, and evaluation is necessary before injection. Artificial targets with a low leakage of antigen, like the monodisperse polymer particles here applied, are recommended for the in vitro evaluation of the immunoreactivity of labelled MoAb preparations. (orig.)

  14. Surface-enhanced Raman spectroscopy of genomic DNA from in vitro grown tomato (Lycopersicon esculentum Mill.) cultivars before and after plant cryopreservation.

    Science.gov (United States)

    Muntean, Cristina M; Leopold, Nicolae; Tripon, Carmen; Coste, Ana; Halmagyi, Adela

    2015-06-05

    In this work the surface-enhanced Raman scattering (SERS) spectra of five genomic DNAs from non-cryopreserved control tomato plants (Lycopersicon esculentum Mill. cultivars Siriana, Darsirius, Kristin, Pontica and Capriciu) respectively, have been analyzed in the wavenumber range 400-1800 cm(-1). Structural changes induced in genomic DNAs upon cryopreservation were discussed in detail for four of the above mentioned tomato cultivars. The surface-enhanced Raman vibrational modes for each of these cases, spectroscopic band assignments and structural interpretations of genomic DNAs are reported. We have found, that DNA isolated from Siriana cultivar leaf tissues suffers the weakest structural changes upon cryogenic storage of tomato shoot apices. On the contrary, genomic DNA extracted from Pontica cultivar is the most responsive system to cryopreservation process. Particularly, both C2'-endo-anti and C3'-endo-anti conformations have been detected. As a general observation, the wavenumber range 1511-1652 cm(-1), being due to dA, dG and dT residues seems to be influenced by cryopreservation process. These changes could reflect unstacking of DNA bases. However, not significant structural changes of genomic DNAs from Siriana, Darsirius and Kristin have been found upon cryopreservation process of tomato cultivars. Based on this work, specific plant DNA-ligand interactions or accurate local structure of DNA in the proximity of a metallic surface, might be further investigated using surface-enhanced Raman spectroscopy. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Toward three-dimensional microelectronic systems: directed self-assembly of silicon microcubes via DNA surface functionalization.

    Science.gov (United States)

    Lämmerhardt, Nico; Merzsch, Stephan; Ledig, Johannes; Bora, Achyut; Waag, Andreas; Tornow, Marc; Mischnick, Petra

    2013-07-02

    The huge and intelligent processing power of three-dimensional (3D) biological "processors" like the human brain with clock speeds of only 0.1 kHz is an extremely fascinating property, which is based on a massively parallel interconnect strategy. Artificial silicon microprocessors are 7 orders of magnitude faster. Nevertheless, they do not show any indication of intelligent processing power, mostly due to their very limited interconnectivity. Massively parallel interconnectivity can only be realized in three dimensions. Three-dimensional artificial processors would therefore be at the root of fabricating artificially intelligent systems. A first step in this direction would be the self-assembly of silicon based building blocks into 3D structures. We report on the self-assembly of such building blocks by molecular recognition, and on the electrical characterization of the formed assemblies. First, planar silicon substrates were functionalized with self-assembling monolayers of 3-aminopropyltrimethoxysilane for coupling of oligonucleotides (single stranded DNA) with glutaric aldehyde. The oligonucleotide immobilization was confirmed and quantified by hybridization with fluorescence-labeled complementary oligonucleotides. After the individual processing steps, the samples were analyzed by contact angle measurements, ellipsometry, atomic force microscopy, and fluorescence microscopy. Patterned DNA-functionalized layers were fabricated by microcontact printing (μCP) and photolithography. Silicon microcubes of 3 μm edge length as model objects for first 3D self-assembly experiments were fabricated out of silicon-on-insulator (SOI) wafers by a combination of reactive ion etching (RIE) and selective wet etching. The microcubes were then surface-functionalized using the same protocol as on planar substrates, and their self-assembly was demonstrated both on patterned silicon surfaces (88% correctly placed cubes), and to cube aggregates by complementary DNA

  16. Analysis of the role of PCNA-DNA contacts during clamp loading

    Directory of Open Access Journals (Sweden)

    Goedken Eric R

    2010-01-01

    Full Text Available Abstract Background Sliding clamps, such as Proliferating Cell Nuclear Antigen (PCNA in eukaryotes, are ring-shaped protein complexes that encircle DNA and enable highly processive DNA replication by serving as docking sites for DNA polymerases. In an ATP-dependent reaction, clamp loader complexes, such as the Replication Factor-C (RFC complex in eukaryotes, open the clamp and load it around primer-template DNA. Results We built a model of RFC bound to PCNA and DNA based on existing crystal structures of clamp loaders. This model suggests that DNA would enter the clamp at an angle during clamp loading, thereby interacting with positively charged residues in the center of PCNA. We show that simultaneous mutation of Lys 20, Lys 77, Arg 80, and Arg 149, which interact with DNA in the RFC-PCNA-DNA model, compromises the ability of yeast PCNA to stimulate the DNA-dependent ATPase activity of RFC when the DNA is long enough to extend through the clamp. Fluorescence anisotropy binding experiments show that the inability of the mutant clamp proteins to stimulate RFC ATPase activity is likely caused by reduction in the affinity of the RFC-PCNA complex for DNA. We obtained several crystal forms of yeast PCNA-DNA complexes, measuring X-ray diffraction data to 3.0 Å resolution for one such complex. The resulting electron density maps show that DNA is bound in a tilted orientation relative to PCNA, but makes different contacts than those implicated in clamp loading. Because of apparent partial disorder in the DNA, we restricted refinement of the DNA to a rigid body model. This result contrasts with previous analysis of a bacterial clamp bound to DNA, where the DNA was well resolved. Conclusion Mutational analysis of PCNA suggests that positively charged residues in the center of the clamp create a binding surface that makes contact with DNA. Disruption of this positive surface, which had not previously been implicated in clamp loading function, reduces RFC

  17. Aligned deposition and electrical measurements on single DNA molecules

    International Nuclear Information System (INIS)

    Eidelshtein, Gennady; Kotlyar, Alexander; Hashemi, Mohtadin; Gurevich, Leonid

    2015-01-01

    A reliable method of deposition of aligned individual dsDNA molecules on mica, silicon, and micro/nanofabricated circuits is presented. Complexes of biotinylated double stranded poly(dG)–poly(dC) DNA with avidin were prepared and deposited on mica and silicon surfaces in the absence of Mg 2+ ions. Due to its positive charge, the avidin attached to one end of the DNA anchors the complex to negatively charged substrates. Subsequent drying with a directional gas flow yields DNA molecules perfectly aligned on the surface. In the avidin–DNA complex only the avidin moiety is strongly and irreversibly bound to the surface, while the DNA counterpart interacts with the substrates much more weakly and can be lifted from the surface and realigned in any direction. Using this technique, avidin–DNA complexes were deposited across platinum electrodes on a silicon substrate. Electrical measurements on the deposited DNA molecules revealed linear IV-characteristics and exponential dependence on relative humidity. (paper)

  18. Bounded variation and around

    CERN Document Server

    Appell, Jürgen; Merentes Díaz, Nelson José

    2013-01-01

    This monographis a self-contained exposition of the definition and properties of functionsof bounded variation and their various generalizations; the analytical properties of nonlinear composition operators in spaces of such functions; applications to Fourier analysis, nonlinear integral equations, and boundary value problems. The book is written for non-specialists. Every chapter closes with a list of exercises and open problems.

  19. On-chip magnetic bead-based DNA melting curve analysis using a magnetoresistive sensor

    DEFF Research Database (Denmark)

    Rizzi, Giovanni; Østerberg, Frederik Westergaard; Henriksen, Anders Dahl

    2014-01-01

    We present real-time measurements of DNA melting curves in a chip-based system that detects the amount of surface-bound magnetic beads using magnetoresistive magnetic field sensors. The sensors detect the difference between the amount of beads bound to the top and bottom sensor branches....... The beads are magnetized by the field arising from the bias current passed through the sensors. We demonstrate the first on-chip measurements of the melting of DNA hybrids upon a ramping of the temperature. This overcomes the limitation of using a single washing condition at constant temperature. Moreover...

  20. Activation of protein kinase A and clustering of cell surface receptors by N-methyl-N'-nitro-N-nitrosoguanidine are independent of genomic DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Wang Zheng; Wang Guliang; Yang Jun; Guo Lei; Yu Yingnian

    2003-07-25

    Alkylating agent N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) induces cellular stress leading to chromosomal aberrations, mutations and cell death. Previous reports from our laboratory have shown that low concentration of MNNG induces untargeted mutation (UTM), which occurs on intact DNA in mammalian cells through changes in gene expression profile. It also causes the activation of cAMP-protein kinase A (PKA) and up-regulation of POL-{beta}, which is demonstrated to play a role in DNA repair system. In order to find out the possible initial signal involved in UTM, we try to investigate whether the activation of PKA-CREB signal pathway is closely related to DNA damage. Our data shows that the treatment of low concentration MNNG (0.2 {mu}M) activates PKA-CREB pathway in a comparable level both in a nuclear and enucleated cell system. And similar to the cell response caused by UV, the clustering of cell surface receptors of epidermal growth factor (EGF) and tumor necrosis factor {alpha} (TNF{alpha}) was also observed in cells exposed to MNNG. It was further demonstrated that the clustering of the surface receptors is independent of the genomic DNA damage, as this phenomenon was also observed in enucleated cells. These observations indicate that the initiation of signal cascades induced by low concentration of MNNG might be associated with its interaction with cell surface receptors and/or direct activation of related signal proteins but not its DNA damaging property.

  1. Recent Development of Nano-Materials Used in DNA Biosensors

    Directory of Open Access Journals (Sweden)

    Yibin Ying

    2009-07-01

    Full Text Available As knowledge of the structure and function of nucleic acid molecules has increased, sequence-specific DNA detection has gained increased importance. DNA biosensors based on nucleic acid hybridization have been actively developed because of their specificity, speed, portability, and low cost. Recently, there has been considerable interest in using nano-materials for DNA biosensors. Because of their high surface-to-volume ratios and excellent biological compatibilities, nano-materials could be used to increase the amount of DNA immobilization; moreover, DNA bound to nano-materials can maintain its biological activity. Alternatively, signal amplification by labeling a targeted analyte with nano-materials has also been reported for DNA biosensors in many papers. This review summarizes the applications of various nano-materials for DNA biosensors during past five years. We found that nano-materials of small sizes were advantageous as substrates for DNA attachment or as labels for signal amplification; and use of two or more types of nano-materials in the biosensors could improve their overall quality and to overcome the deficiencies of the individual nano-components. Most current DNA biosensors require the use of polymerase chain reaction (PCR in their protocols. However, further development of nano-materials with smaller size and/or with improved biological and chemical properties would substantially enhance the accuracy, selectivity and sensitivity of DNA biosensors. Thus, DNA biosensors without PCR amplification may become a reality in the foreseeable future.

  2. Inverse-scattering-theory approach to the exact n→∞ solutions of O(n) ϕ⁴ models on films and semi-infinite systems bounded by free surfaces.

    Science.gov (United States)

    Rutkevich, Sergei B; Diehl, H W

    2015-06-01

    The O(n) ϕ(4) model on a strip bounded by a pair of planar free surfaces at separation L can be solved exactly in the large-n limit in terms of the eigenvalues and eigenfunctions of a self-consistent one-dimensional Schrödinger equation. The scaling limit of a continuum version of this model is considered. It is shown that the self-consistent potential can be eliminated in favor of scattering data by means of appropriately extended methods of inverse scattering theory. The scattering data (Jost function) associated with the self-consistent potential are determined for the L=∞ semi-infinite case in the scaling regime for all values of the temperature scaling field t=(T-T(c))/T(c) above and below the bulk critical temperature T(c). These results are used in conjunction with semiclassical and boundary-operator expansions and a trace formula to derive exact analytical results for a number of quantities such as two-point functions, universal amplitudes of two excess surface quantities, the universal amplitude difference associated with the thermal singularity of the surface free energy, and potential coefficients. The asymptotic behaviors of the scaled eigenenergies and eigenfunctions of the self-consistent Schrödinger equation as function of x=t(L/ξ(+))(1/ν) are determined for x→-∞. In addition, the asymptotic x→-∞ forms of the universal finite-size scaling functions Θ(x) and ϑ(x) of the residual free energy and the Casimir force are computed exactly to order 1/x, including their x(-1)ln|x| anomalies.

  3. Maps of Bounded Rationality

    OpenAIRE

    Kahneman, Daniel

    2002-01-01

    The work cited by the Nobel committee was done jointly with the late Amos Tversky (1937-1996) during a long and unusually close collaboration. Together, we explored the psychology of intuitive beliefs and choices and examined their bounded rationality. This essay presents a current perspective on the three major topics of our joint work: heuristics of judgment, risky choice, and framing effects. In all three domains we studied intuitions - thoughts and preferences that come to mind quickly an...

  4. Bounded Satisfiability for PCTL

    OpenAIRE

    Bertrand, Nathalie; Fearnley, John; Schewe, Sven

    2012-01-01

    While model checking PCTL for Markov chains is decidable in polynomial-time, the decidability of PCTL satisfiability, as well as its finite model property, are long standing open problems. While general satisfiability is an intriguing challenge from a purely theoretical point of view, we argue that general solutions would not be of interest to practitioners: such solutions could be too big to be implementable or even infinite. Inspired by bounded synthesis techniques, we turn to the more appl...

  5. Harmonic maps of the bounded symmetric domains

    International Nuclear Information System (INIS)

    Xin, Y.L.

    1994-06-01

    A shrinking property of harmonic maps into R IV (2) is proved which is used to classify complete spacelike surfaces of the parallel mean curvature in R 4 2 with a reasonable condition on the Gauss image. Liouville-type theorems of harmonic maps from the higher dimensional bounded symmetric domains are also established. (author). 25 refs

  6. An inexpensive and simple method for thermally stable immobilization of DNA on an unmodified glass surface: UV linking of poly(T)10-poly(C)10-tagged DNA probes

    DEFF Research Database (Denmark)

    Guðnason, Haukur; Dufva, Hans Martin; Bang, Dang Duong

    2008-01-01

    be linked by UV light irradiation onto a plain, unmodified glass surface. Probes immobilized onto unmodified glass microscope slides performed similarly to probes bound to commercial amino-silane-coated slides and had comparable detection limits. The TC-tagged probes linked to unmodified glass did not show...... any significant decrease in hybridization performance after a 20 min incubation in water at 100 degrees C prior to rehybridization, indicating a covalent bond between the TC tag and unmodified glass. The probes were used in thermal minisequencing cycling reactions. Furthermore, the TC tag improved...

  7. Universal bounds on current fluctuations.

    Science.gov (United States)

    Pietzonka, Patrick; Barato, Andre C; Seifert, Udo

    2016-05-01

    For current fluctuations in nonequilibrium steady states of Markovian processes, we derive four different universal bounds valid beyond the Gaussian regime. Different variants of these bounds apply to either the entropy change or any individual current, e.g., the rate of substrate consumption in a chemical reaction or the electron current in an electronic device. The bounds vary with respect to their degree of universality and tightness. A universal parabolic bound on the generating function of an arbitrary current depends solely on the average entropy production. A second, stronger bound requires knowledge both of the thermodynamic forces that drive the system and of the topology of the network of states. These two bounds are conjectures based on extensive numerics. An exponential bound that depends only on the average entropy production and the average number of transitions per time is rigorously proved. This bound has no obvious relation to the parabolic bound but it is typically tighter further away from equilibrium. An asymptotic bound that depends on the specific transition rates and becomes tight for large fluctuations is also derived. This bound allows for the prediction of the asymptotic growth of the generating function. Even though our results are restricted to networks with a finite number of states, we show that the parabolic bound is also valid for three paradigmatic examples of driven diffusive systems for which the generating function can be calculated using the additivity principle. Our bounds provide a general class of constraints for nonequilibrium systems.

  8. The effect of the shape of single, sub-ms voltage pulses on the rates of surface immobilization and hybridization of DNA

    International Nuclear Information System (INIS)

    Cabeca, R; Rodrigues, M; Chu, V; Conde, J P; Prazeres, D M F

    2009-01-01

    Electric fields generated by single square and sinusoidal voltage pulses with amplitudes below 2 V were used to assist the covalent immobilization of single-stranded, thiolated DNA probes, onto a chemically functionalized SiO 2 surface and to assist the specific hybridization of single-stranded DNA targets with immobilized complementary probes. The single-stranded immobilized DNA probes were either covalently immobilized (chemisorption) or electrostatically adsorbed (physisorption) to a chemically functionalized surface. Comparing the speed of electric field assisted immobilization and hybridization with the corresponding control reactions (without electric field), an increase of several orders of magnitude is observed, with the reaction timescaled down from 1 to 2 h to a range between 100 ns and 1 ms. The influence of the shape of the voltage pulse (square versus sinusoidal) and its duration were studied for both immobilization and hybridization reactions. The results show that pulsed electric fields are a useful tool to achieve temporal and spatial control of surface immobilization and hybridization reactions of DNA.

  9. Multi-step surface functionalization of polyimide based evanescent wave photonic biosensors and application for DNA hybridization by Mach-Zehnder interferometer

    Energy Technology Data Exchange (ETDEWEB)

    Melnik, Eva [Health and Environment Department, Nano Systems, AIT Austrian Institute of Technology GmbH, Donau-City-Strasse 1, 1220 Vienna (Austria); Department of Analytical Chemistry, University of Vienna, Waehringer Strasse 38, 1090 Vienna (Austria); Bruck, Roman [Health and Environment Department, Nano Systems, AIT Austrian Institute of Technology GmbH, Donau-City-Strasse 1, 1220 Vienna (Austria); Hainberger, Rainer, E-mail: rainer.hainberger@ait.ac.at [Health and Environment Department, Nano Systems, AIT Austrian Institute of Technology GmbH, Donau-City-Strasse 1, 1220 Vienna (Austria); Laemmerhofer, Michael, E-mail: michael.laemmerhofer@univie.ac.at [Department of Analytical Chemistry, University of Vienna, Waehringer Strasse 38, 1090 Vienna (Austria)

    2011-08-12

    Highlights: {yields} We realize a biosensing platform for polyimide evanescent photonic wave sensors. {yields} We show that the surface functionalization via silanisation and biotinylation followed by streptavidin immobilization do not destroy or damage the thin polyimide film. {yields} A highly dense streptavidin layer enables the immobilisation of biotinylated ligands such as biotinylated ssDNA for the selective measurement of DNA hybridization. - Abstract: The process of surface functionalization involving silanization, biotinylation and streptavidin bonding as platform for biospecific ligand immobilization was optimized for thin film polyimide spin-coated silicon wafers, of which the polyimide film serves as a wave guiding layer in evanescent wave photonic biosensors. This type of optical sensors make great demands on the materials involved as well as on the layer properties, such as the optical quality, the layer thickness and the surface roughness. In this work we realized the binding of a 3-mercaptopropyl trimethoxysilane on an oxygen plasma activated polyimide surface followed by subsequent derivatization of the reactive thiol groups with maleimide-PEG{sub 2}-biotin and immobilization of streptavidin. The progress of the functionalization was monitored by using different fluorescence labels for optimization of the chemical derivatization steps. Further, X-ray photoelectron spectroscopy and atomic force microscopy were utilized for the characterization of the modified surface. These established analytical methods allowed to derive information like chemical composition of the surface, surface coverage with immobilized streptavidin, as well as parameters of the surface roughness. The proposed functionalization protocol furnished a surface density of 144 fmol mm{sup -2} streptavidin with good reproducibility (13.9% RSD, n = 10) and without inflicted damage to the surface. This surface modification was applied to polyimide based Mach-Zehnder interferometer

  10. Isolation and structure of a cDNA encoding the B1 (CD20) cell-surface antigen of human B lymphocytes

    International Nuclear Information System (INIS)

    Tender, T.F.; Streuli, M.; Schlossman, S.F.; Saito, H.

    1988-01-01

    The B1 (CD20) molecule is a M/sub r/ 33,000 phosphoprotein on the surface of human B lymphocytes that may serve a central role in the homoral immune response by regulating B-cell proliferation and differentiation. In this report, a cDNA clone that encodes the B1 molecule was isolated and the amino acid sequence of B1 was determined. B-cell-specific cDNA clones were selected from a human tonsillar cDNA library by differential hybridization with labeled cDNA derived from either size-fractionated B-cell mRNA or size-fractionated T-cell mRNA. Of the 261 cDNA clones isolated, 3 cross-hybridizing cDNA clones were chosen as potential candidates for encoding B1 based on their selective hybridization to RNA from B1-positive cell lines. The longest clone, pB1-21, contained a 2.8-kilobase insert with an 891-base-pair open reading frame that encodes a protein of 33 kDa. mRNA synthesized from the pB1-21 cDNA clone in vitro was translated into a protein of the same apparent molecular weight as B1. Limited proteinase digestion of the pB1-21 translation product and B1 generated peptides of the same sizes, indicating that the pB1-21 cDNA encodes the B1 molecule. Gel blot analysis indicated that pB1-21 hybridized with two mRNA species of 2.8 and 3.4 kilobases only in B1-positive cell lines. The amino acid sequence deduced from the pB1-21 nucleotide sequence apparently lacks a signal sequence and contains three extensive hydrophobic regions. The deduced B1 amino acid sequence shows no significant homology with other known patients

  11. A bound on chaos

    Energy Technology Data Exchange (ETDEWEB)

    Maldacena, Juan [School of Natural Sciences, Institute for Advanced Study,1 Einstein Drive, Princeton, NJ (United States); Shenker, Stephen H. [Stanford Institute for Theoretical Physics and Department of Physics, Stanford University,382 Via Pueblo Mall, Stanford, CA (United States); Stanford, Douglas [School of Natural Sciences, Institute for Advanced Study,1 Einstein Drive, Princeton, NJ (United States)

    2016-08-17

    We conjecture a sharp bound on the rate of growth of chaos in thermal quantum systems with a large number of degrees of freedom. Chaos can be diagnosed using an out-of-time-order correlation function closely related to the commutator of operators separated in time. We conjecture that the influence of chaos on this correlator can develop no faster than exponentially, with Lyapunov exponent λ{sub L}≤2πk{sub B}T/ℏ. We give a precise mathematical argument, based on plausible physical assumptions, establishing this conjecture.

  12. Radiolysis of DNA-protein complexes

    Energy Technology Data Exchange (ETDEWEB)

    Begusova, Marie [Department of Radiation Dosimetry, Nuclear Physics Institute, Na Truhlarce 39/64, CZ-18086, Prague 8 (Czech Republic)]. E-mail: begusova@ujf.cas.cz; Gillard, Nathalie [Centre de Biophysique Moleculaire, CNRS, rue Charles-Sadron, F-45071 Orleans Cedex 2 (France); Sy, Denise [Centre de Biophysique Moleculaire, CNRS, rue Charles-Sadron, F-45071 Orleans Cedex 2 (France); Castaing, Bertrand [Centre de Biophysique Moleculaire, CNRS, rue Charles-Sadron, F-45071 Orleans Cedex 2 (France); Charlier, Michel [Centre de Biophysique Moleculaire, CNRS, rue Charles-Sadron, F-45071 Orleans Cedex 2 (France); Spotheim-Maurizot, Melanie [Centre de Biophysique Moleculaire, CNRS, rue Charles-Sadron, F-45071 Orleans Cedex 2 (France)

    2005-02-01

    We discuss here modifications of DNA and protein radiolysis due to the interaction of these two partners in specific complexes. Experimental patterns of frank strand breaks (FSB) and alkali revealed breaks (ARB) obtained for DNA lac operator bound to the lac repressor and for a DNA containing an abasic site analog bound to the formamidopyrimidine-DNA glycosylase are reported. Experimental data are compared to predicted damage distribution obtained using the theoretical model RADACK.

  13. Radiolysis of DNA-protein complexes

    International Nuclear Information System (INIS)

    Begusova, Marie; Gillard, Nathalie; Sy, Denise; Castaing, Bertrand; Charlier, Michel; Spotheim-Maurizot, Melanie

    2005-01-01

    We discuss here modifications of DNA and protein radiolysis due to the interaction of these two partners in specific complexes. Experimental patterns of frank strand breaks (FSB) and alkali revealed breaks (ARB) obtained for DNA lac operator bound to the lac repressor and for a DNA containing an abasic site analog bound to the formamidopyrimidine-DNA glycosylase are reported. Experimental data are compared to predicted damage distribution obtained using the theoretical model RADACK

  14. Changing serum levels of quantitative hepatitis B surface antigen and hepatitis B virus DNA in hepatitis B virus surface antigen carriers: A follow-up study of an elderly cohort

    Directory of Open Access Journals (Sweden)

    Yuan-Hung Kuo

    2015-02-01

    Full Text Available This study was to elucidate longitudinally quantitative changes of hepatitis B virus (HBV surface antigen (HBsAg and HBV DNA in elder HBsAg carriers in a community. Among 1002 residents screened for HBsAg in 2005, 405 responded to this follow-up study in 2010. Fifty-nine (14.6% were HBsAg carriers in 2005; HBsAg quantification and HBV DNA were measured. HBsAg quantification (cutoff 1600 IU/mL and HBV DNA (cutoff 2000 IU/mL were combined to stratify the participants between two screens. A total of 30 men and 29 women with a mean age of 63.9 ± 7.9 years were enrolled. Quantitative levels of HBsAg and HBV DNA were significantly correlated in 2005 (r = 0.509, p < 0.001 and 2010 (r = 0.777, p < 0.001. Concentrations of HBsAg (IU/mL significantly decreased from 2.2 ± 1.0 log in 2005 to 1.7 ± 1.5 log in 2010 (p < 0.001. The level of HBsAg was decreased in 48 (81.4% individuals and HBsAg was undetectable in eight (13.6%. The annual incidence of HBsAg clearance was 2.7%. These 59 HBsAg carriers in 2005 were divided into four groups: low HBsAg low HBV DNA (n = 32, high HBsAg low HBV DNA (n = 5, low HBsAg high HBV DNA (n = 12 and high HBsAg high HBV DNA (n = 10. All 32 individuals in the low HBsAg low HBV DNA group were still in that group in 2010, whereas only two of the high HBsAg high HBV DNA group became inactive. As with a younger cohort in hospital, HBsAg quantification was still well correlated with HBV DNA in elderly HBsAg carriers in the community. Lower levels of both HBsAg and HBV DNA might represent an inactive HBV infection.

  15. Dielectric structures with bound modes for microcavity lasers

    NARCIS (Netherlands)

    Visser, P.M.; Allaart, K.; Lenstra, D.

    2002-01-01

    Cavity modes of dielectric microsphcres and vertical cavity surface emitting lasers, in spite of their high Q, are never exactly bound, but have a finite width due to leakage at the borders. We propose types of microstructures that sustain three-dimensionally bound modes of the radiation field when

  16. Ultrasensitive Direct Quantification of Nucleobase Modifications in DNA by Surface-Enhanced Raman Scattering: The Case of Cytosine.

    Science.gov (United States)

    Morla-Folch, Judit; Xie, Hai-nan; Gisbert-Quilis, Patricia; Gómez-de Pedro, Sara; Pazos-Perez, Nicolas; Alvarez-Puebla, Ramon A; Guerrini, Luca

    2015-11-09

    Recognition of chemical modifications in canonical nucleobases of nucleic acids is of key importance since such modified variants act as different genetic encoders, introducing variability in the biological information contained in DNA. Herein, we demonstrate the feasibility of direct SERS in combination with chemometrics and microfluidics for the identification and relative quantification of 4 different cytosine modifications in both single- and double-stranded DNA. The minute amount of DNA required per measurement, in the sub-nanogram regime, removes the necessity of pre-amplification or enrichment steps (which are also potential sources of artificial DNA damages). These findings show great potentials for the development of fast, low-cost and high-throughput screening analytical devices capable of detecting known and unknown modifications in nucleic acids (DNA and RNA) opening new windows of activity in several fields such as biology, medicine and forensic sciences. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. A sensitive DNA biosensor fabricated from gold nanoparticles, carbon nanotubes, and zinc oxide nanowires on a glassy carbon electrode

    International Nuclear Information System (INIS)

    Wang Jie; Li Shuping; Zhang Yuzhong

    2010-01-01

    We outline here the fabrication of a sensitive electrochemical DNA biosensor for the detection of sequence-specific target DNA. Zinc oxide nanowires (ZnONWs) were first immobilized on the surface of a glassy carbon electrode. Multi-walled carbon nanotubes (MWCNTs) with carboxyl groups were then dropped onto the surface of the ZnONWs. Gold nanoparticles (AuNPs) were subsequently introduced to the surface of the MWNTs/ZnONWs by electrochemical deposition. A single-stranded DNA probe with a thiol group at the end (HS-ssDNA) was covalently immobilized on the surface of the AuNPs by forming an Au-S bond. Scanning electron microscopy (SEM) and cyclic voltammetry (CV) were used to investigate the film assembly process. Differential pulse voltammetry (DPV) was used to monitor DNA hybridization by measuring the electrochemical signals of [Ru(NH 3 ) 6 ] 3+ bounding to double-stranded DNA (dsDNA). The incorporation of ZnONWs and MWCNTs in this sensor design significantly enhances the sensitivity and the selectivity. This DNA biosensor can detect the target DNA quantitatively in the range of 1.0 x 10 -13 to 1.0 x 10 -7 M, with a detection limit of 3.5 x 10 -14 M (S/N = 3). In addition, the DNA biosensor exhibits excellent selectivity, even for single-mismatched DNA detection.

  18. Cooperative assembly of Co-Smad4 MH1 with R-Smad1/3 MH1 on DNA: a molecular dynamics simulation study.

    Directory of Open Access Journals (Sweden)

    Guihong Wang

    Full Text Available Smads, the homologs of Sma and MAD proteins, play a key role in gene expression regulation in the transforming growth factor-β (TGF-β signaling pathway. Recent experimental studies have revealed that Smad4/R-Smad heterodimers bound on DNA are energetically more favorable than homodimeric R-Smad/R-Smad complexes bound on DNA, which indicates that Smad4 might act as binding vehicle to cooperatively assemble with activated R-Smads on DNA in the nucleus. However, the details of interaction mechanism for cooperative recruitment of Smad4 protein to R-Smad proteins on DNA, and allosteric communication between the Smad4-DNA and R-Smad-DNA interfaces via DNA mediating are not yet clear so far.In the present work, we have constructed a series of Smadn+DNA+Smadn (n = 1, 3, 4 models and carried out molecular dynamics simulations, free energy calculations and DNA dynamics analysis for them to study the interaction properties of Smadn (n = 1, 3, 4 with DNA molecule.The results revealed that the binding of Smad4 protein to DNA molecule facilitates energetically the formation of the heteromeric Smad4+DNA+Smad1/3 complex by increasing the affinity of Smad1/3 with DNA molecule. Further investigations through the residue/base motion correlation and DNA dynamics analyses predicted that the binding of Smad4 protein to DNA molecule in the heteromeric Smad4+DNA+Smad1/3 model induces an allosteric communication from the Smad4-DNA interface to Smad1/Smad3-DNA interface via DNA base-pair helical motions, surface conformation changes and new hydrogen bond formations. The present work theoretically explains the mechanism of cooperative recruitment of Smad4 protein to Smad1/3 protein via DNA-mediated indirect readout mode in the nucleus.

  19. Interaction of nucleic acids with electrically charged surfaces. VII. The effect of ionic strength of neutral medium on the conformation of dna adsorbed on the mercury electrode.

    Science.gov (United States)

    Brabec, V

    1980-02-01

    Triangular-wave direct current (d.c.) voltammetry at a hanging mercury drop electrode and phase-selective alternating current (a.c.) polarography at a dropping mercury electrode were used for the investigation of adsorption of double-helical (ds) DNA at mercury electrode surfaces from neutral solutions of 0.05-0.4 M HCOONH4. It was found for the potential region T (from -0.1 V up to ca. -1.0 V) that the height of voltammetric peaks of ds DNA is markedly influenced by the initial potential only at relatively low ionic strength (mu) (from 0.05 up to ca. 0.3). Also a decrease of differential capacity (measured by means of a.c. polarography) in the region T depended markedly on the electrode potential only at relatively low ionic strength. The following conclusions were made concerning the interaction of ds DNA with a mercury electrode charged to potentials of the region T in neutral medium of relatively low ionic strength mu potentials in the Vicinity of the zero charge potential a higher number of ds DNA segments can be opened, probably as a consequence of the strain which could act on the ds DNA molecule in the course of the segmental adsorption/desorption process.

  20. Relativistic bound states

    International Nuclear Information System (INIS)

    Ritchie, Burke

    2006-01-01

    The Hamiltonian for Dirac's second-order equation depends nonlinearly on the potential V and the energy E. For this reason the magnetic contribution to the Hamiltonian for s-waves, which has a short range, is attractive for a repulsive Coulomb potential (V>0) and repulsive for an attractive Coulomb potential (V 2 . Usually solutions are found in the regime E=mc 2 +ε , where except for high Z, ε 2 . Here it is shown that for V>0 the attractive magnetic term and the linear repulsive term combine to support a bound state near E=0.5mc 2 corresponding to a binding energy E b =-ε =0.5mc 2

  1. On-chip magnetic bead-based DNA melting curve analysis using a magnetoresistive sensor

    International Nuclear Information System (INIS)

    Rizzi, Giovanni; Østerberg, Frederik W.; Henriksen, Anders D.; Dufva, Martin; Hansen, Mikkel F.

    2015-01-01

    We present real-time measurements of DNA melting curves in a chip-based system that detects the amount of surface-bound magnetic beads using magnetoresistive magnetic field sensors. The sensors detect the difference between the amount of beads bound to the top and bottom sensor branches of the differential sensor geometry. The sensor surfaces are functionalized with wild type (WT) and mutant type (MT) capture probes, differing by a single base insertion (a single nucleotide polymorphism, SNP). Complementary biotinylated targets in suspension couple streptavidin magnetic beads to the sensor surface. The beads are magnetized by the field arising from the bias current passed through the sensors. We demonstrate the first on-chip measurements of the melting of DNA hybrids upon a ramping of the temperature. This overcomes the limitation of using a single washing condition at constant temperature. Moreover, we demonstrate that a single sensor bridge can be used to genotype a SNP. - Highlights: • We apply magnetoresistive sensors to study solid-surface hybridization kinetics of DNA. • We measure DNA melting profiles for perfectly matching DNA duplexes and for a single base mismatch. • We present a procedure to correct for temperature dependencies of the sensor output. • We reliably extract melting temperatures for the DNA hybrids. • We demonstrate direct measurement of differential binding signal for two probes on a single sensor

  2. Enterococcus faecium biofilm formation: identification of major autolysin AtlAEfm, associated Acm surface localization, and AtlAEfm-independent extracellular DNA Release.

    Science.gov (United States)

    Paganelli, Fernanda L; Willems, Rob J L; Jansen, Pamela; Hendrickx, Antoni; Zhang, Xinglin; Bonten, Marc J M; Leavis, Helen L

    2013-04-16

    Enterococcus faecium is an important multidrug-resistant nosocomial pathogen causing biofilm-mediated infections in patients with medical devices. Insight into E. faecium biofilm pathogenesis is pivotal for the development of new strategies to prevent and treat these infections. In several bacteria, a major autolysin is essential for extracellular DNA (eDNA) release in the biofilm matrix, contributing to biofilm attachment and stability. In this study, we identified and functionally characterized the major autolysin of E. faecium E1162 by a bioinformatic genome screen followed by insertional gene disruption of six putative autolysin genes. Insertional inactivation of locus tag EfmE1162_2692 resulted in resistance to lysis, reduced eDNA release, deficient cell attachment, decreased biofilm, decreased cell wall hydrolysis, and significant chaining compared to that of the wild type. Therefore, locus tag EfmE1162_2692 was considered the major autolysin in E. faecium and renamed atlAEfm. In addition, AtlAEfm was implicated in cell surface exposure of Acm, a virulence factor in E. faecium, and thereby facilitates binding to collagen types I and IV. This is a novel feature of enterococcal autolysins not described previously. Furthermore, we identified (and localized) autolysin-independent DNA release in E. faecium that contributes to cell-cell interactions in the atlAEfm mutant and is important for cell separation. In conclusion, AtlAEfm is the major autolysin in E. faecium and contributes to biofilm stability and Acm localization, making AtlAEfm a promising target for treatment of E. faecium biofilm-mediated infections. IMPORTANCE Nosocomial infections caused by Enterococcus faecium have rapidly increased, and treatment options have become more limited. This is due not only to increasing resistance to antibiotics but also to biofilm-associated infections. DNA is released in biofilm matrix via cell lysis, caused by autolysin, and acts as a matrix stabilizer. In this study

  3. The cytosolic DNA sensor cGAS forms an oligomeric complex with DNA and undergoes switch-like conformational changes in the activation loop.

    Science.gov (United States)

    Zhang, Xu; Wu, Jiaxi; Du, Fenghe; Xu, Hui; Sun, Lijun; Chen, Zhe; Brautigam, Chad A; Zhang, Xuewu; Chen, Zhijian J

    2014-02-13

    The presence of DNA in the cytoplasm is a danger signal that triggers immune and inflammatory responses. Cytosolic DNA binds to and activates cyclic GMP-AMP (cGAMP) synthase (cGAS), which produces the second messenger cGAMP. cGAMP binds to the adaptor protein STING and activates a signaling cascade that leads to the production of type I interferons and other cytokines. Here, we report the crystal structures of human cGAS in its apo form, representing its autoinhibited conformation as well as in its cGAMP- and sulfate-bound forms. These structures reveal switch-like conformational changes of an activation loop that result in the rearrangement of the catalytic site. The structure of DNA-bound cGAS reveals a complex composed of dimeric cGAS bound to two molecules of DNA. Functional analyses of cGAS mutants demonstrate that both the protein-protein interface and the two DNA binding surfaces are critical for cGAS activation. These results provide insights into the mechanism of DNA sensing by cGAS. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  4. The Cytosolic DNA Sensor cGAS Forms an Oligomeric Complex with DNA and Undergoes Switch-like Conformational Changes in the Activation Loop

    Directory of Open Access Journals (Sweden)

    Xu Zhang

    2014-02-01

    Full Text Available The presence of DNA in the cytoplasm is a danger signal that triggers immune and inflammatory responses. Cytosolic DNA binds to and activates cyclic GMP-AMP (cGAMP synthase (cGAS, which produces the second messenger cGAMP. cGAMP binds to the adaptor protein STING and activates a signaling cascade that leads to the production of type I interferons and other cytokines. Here, we report the crystal structures of human cGAS in its apo form, representing its autoinhibited conformation as well as in its cGAMP- and sulfate-bound forms. These structures reveal switch-like conformational changes of an activation loop that result in the rearrangement of the catalytic site. The structure of DNA-bound cGAS reveals a complex composed of dimeric cGAS bound to two molecules of DNA. Functional analyses of cGAS mutants demonstrate that both the protein-protein interface and the two DNA binding surfaces are critical for cGAS activation. These results provide insights into the mechanism of DNA sensing by cGAS.

  5. Chemo-mechanical pushing of proteins along single-stranded DNA.

    Science.gov (United States)

    Sokoloski, Joshua E; Kozlov, Alexander G; Galletto, Roberto; Lohman, Timothy M

    2016-05-31

    Single-stranded (ss)DNA binding (SSB) proteins bind with high affinity to ssDNA generated during DNA replication, recombination, and repair; however, these SSBs must eventually be displaced from or reorganized along the ssDNA. One potential mechanism for reorganization is for an ssDNA translocase (ATP-dependent motor) to push the SSB along ssDNA. Here we use single molecule total internal reflection fluorescence microscopy to detect such pushing events. When Cy5-labeled Escherichia coli (Ec) SSB is bound to surface-immobilized 3'-Cy3-labeled ssDNA, a fluctuating FRET signal is observed, consistent with random diffusion of SSB along the ssDNA. Addition of Saccharomyces cerevisiae Pif1, a 5' to 3' ssDNA translocase, results in the appearance of isolated, irregularly spaced saw-tooth FRET spikes only in the presence of ATP. These FRET spikes result from translocase-induced directional (5' to 3') pushing of the SSB toward the 3' ssDNA end, followed by displacement of the SSB from the DNA end. Similar ATP-dependent pushing events, but in the opposite (3' to 5') direction, are observed with EcRep and EcUvrD (both 3' to 5' ssDNA translocases). Simulations indicate that these events reflect active pushing by the translocase. The ability of translocases to chemo-mechanically push heterologous SSB proteins along ssDNA provides a potential mechanism for reorganization and clearance of tightly bound SSBs from ssDNA.

  6. Conformational elasticity can facilitate TALE-DNA recognition.

    Science.gov (United States)

    Lei, Hongxing; Sun, Jiya; Baldwin, Enoch P; Segal, David J; Duan, Yong

    2014-01-01

    Sequence-programmable transcription activator-like effector (TALE) proteins have emerged as a highly efficient tool for genome engineering. Recent crystal structures depict a transition between an open unbound solenoid and more compact DNA-bound solenoid formed by the 34 amino acid repeats. How TALEs switch conformation between these two forms without substantial energetic compensation, and how the repeat-variable di-residues (RVDs) discriminate between the cognate base and other bases still remain unclear. Computational analysis on these two aspects of TALE-DNA interaction mechanism has been conducted in order to achieve a better understanding of the energetics. High elasticity was observed in the molecular dynamics simulations of DNA-free TALE structure that started from the bound conformation where it sampled a wide range of conformations including the experimentally determined apo and bound conformations. This elastic feature was also observed in the simulations starting from the apo form which suggests low free energy barrier between the two conformations and small compensation required upon binding. To analyze binding specificity, we performed free energy calculations of various combinations of RVDs and bases using Poisson-Boltzmann surface area (PBSA) and other approaches. The PBSA calculations indicated that the native RVD-base structures had lower binding free energy than mismatched structures for most of the RVDs examined. Our theoretical analyses provided new insight on the dynamics and energetics of TALE-DNA binding mechanism. © 2014 Elsevier Inc. All rights reserved.

  7. DNA Diagnostics: Optical or by Electronics?

    KAUST Repository

    Khan, Hadayat Ullah

    2016-01-15

    In this paper, we very briefly review DNA biosensors based on optical and electrical detection principles, referring mainly to our past work applying both techniques but here using nearly identical sensor chip surface architectures, i.e., capture probe layers that were prepared based on a pulsed plasma deposition protocol for maleic anhydride and subsequent wet-chemical attachment of the amine-functionalized peptide nucleic acid (PNA) probe oligonucleotides. 15 mer DNA target strands, labeled with Cy5-chromophores that were attached at the 5’ end were used for surface plasmon optical detection and the same target DNA but without label was used in OTFT sensor-based detection where the mere charge density of the bound (hybridized) DNA molecules modulate the source-drain current. The sensing mechanisms and the detection limits of the devices are described in some detail. Both techniques allow for the monitoring of surface hybridization reactions, and offer the capacity to quantitatively discriminate between targets with different degrees of mismatched sequences.

  8. Bounding approaches to system identification

    CERN Document Server

    Norton, John; Piet-Lahanier, Hélène; Walter, Éric

    1996-01-01

    In response to the growing interest in bounding error approaches, the editors of this volume offer the first collection of papers to describe advances in techniques and applications of bounding of the parameters, or state variables, of uncertain dynamical systems. Contributors explore the application of the bounding approach as an alternative to the probabilistic analysis of such systems, relating its importance to robust control-system design.

  9. Market access through bound tariffs

    DEFF Research Database (Denmark)

    Sala, Davide; Yalcin, Erdal; Schröder, Philipp

    2010-01-01

    on the risk that exporters face in destination markets. The present paper formalizes the underlying interaction of risk, fixed export costs and firms' market entry decisions based on techniques known from the real options literature; doing so we highlight the important role of bound tariffs at the extensive...... margin of trade. We find that bound tariffs are more effective with higher risk destination markets, that a large binding overhang may still command substantial market access, and that reductions in bound tariffs generate effective market access even when bound rates are above current and longterm...

  10. Market Access through Bound Tariffs

    DEFF Research Database (Denmark)

    Sala, Davide; Schröder, Philipp J.H.; Yalcin, Erdal

    on the risk that exporters face in destination markets. The present paper formalizes the underlying interaction of risk, fixed export costs and firms' market entry decisions based on techniques known from the real options literature; doing so we highlight the important role of bound tariffs at the extensive...... margin of trade. We find that bound tariffs are more effective with higher risk destination markets, that a large binding overhang may still command substantial market access, and that reductions in bound tariffs generate effective market access even when bound rates are above current and long...

  11. Contribution of granule bound starch synthase in kernel modification ...

    African Journals Online (AJOL)

    The role of gbssI and gbssII genes, encoding granule bound starch synthase enzyme I and II, respectively, in quality protein maize (QPM) were studied at different days after pollination (DAP). Total RNA was used for first strand cDNA synthesis using the ImpromIISriptTM reverse transcriptase. No detectable levels of gbssI ...

  12. Quivers of Bound Path Algebras and Bound Path Coalgebras

    Directory of Open Access Journals (Sweden)

    Dr. Intan Muchtadi

    2010-09-01

    Full Text Available bras and coalgebras can be represented as quiver (directed graph, and from quiver we can construct algebras and coalgebras called path algebras and path coalgebras. In this paper we show that the quiver of a bound path coalgebra (resp. algebra is the dual quiver of its bound path algebra (resp. coalgebra.

  13. BIOPHYSICAL PROPERTIES OF NUCLEIC ACIDS AT SURFACES RELEVANT TO MICROARRAY PERFORMANCE

    OpenAIRE

    Rao, Archana N.; Grainger, David W.

    2014-01-01

    Both clinical and analytical metrics produced by microarray-based assay technology have recognized problems in reproducibility, reliability and analytical sensitivity. These issues are often attributed to poor understanding and control of nucleic acid behaviors and properties at solid-liquid interfaces. Nucleic acid hybridization, central to DNA and RNA microarray formats, depends on the properties and behaviors of single strand (ss) nucleic acids (e.g., probe oligomeric DNA) bound to surface...

  14. Presence of antibodies against a cell-surface protein, cross-reactive with DNA, in systemic lupus erythrematosus: a marker of the disease

    International Nuclear Information System (INIS)

    Jacob, L.; Lety, M.A.; Choquette, D.; Viard, J.P.; Jacob, F.; Louvard, D.; Bach, J.F.

    1987-01-01

    Antibodies against a cell-surface protein, cross-reactive with double-stranded DNA, were detected in the serum of 25 patients with active human systemic lupus erythematosus (SLE), defined on the basis of the revised American Rheumatism Association classification. Among these sera, two did not display anti-DNA antibodies, as shown by Farr assay, solid-phase radioimmunoassay, and Crithidia luciliae test. Five other SLE patients were consecutively studied in active and remission states. Antibodies against the protein were detected in the serum of the 5 SLE patients when they were in active phase but not in the serum of the same patients in inactive phase of the disease. The anti-protein antibodies were not found in the serum of 10 inactive SLE patients or in the sera of 10 normal human controls, 10 patients with rheumatoid arthritis, 5 patients with scleroderma, and 4 patients with primary sicca syndrome. Taken together, these results strongly suggest that antibodies against this cell-surface protein could provide a better diagnosis marker and activity index than anti-DNA antibodies in SLE

  15. Bounds for Asian basket options

    Science.gov (United States)

    Deelstra, Griselda; Diallo, Ibrahima; Vanmaele, Michèle

    2008-09-01

    In this paper we propose pricing bounds for European-style discrete arithmetic Asian basket options in a Black and Scholes framework. We start from methods used for basket options and Asian options. First, we use the general approach for deriving upper and lower bounds for stop-loss premia of sums of non-independent random variables as in Kaas et al. [Upper and lower bounds for sums of random variables, Insurance Math. Econom. 27 (2000) 151-168] or Dhaene et al. [The concept of comonotonicity in actuarial science and finance: theory, Insurance Math. Econom. 31(1) (2002) 3-33]. We generalize the methods in Deelstra et al. [Pricing of arithmetic basket options by conditioning, Insurance Math. Econom. 34 (2004) 55-57] and Vanmaele et al. [Bounds for the price of discrete sampled arithmetic Asian options, J. Comput. Appl. Math. 185(1) (2006) 51-90]. Afterwards we show how to derive an analytical closed-form expression for a lower bound in the non-comonotonic case. Finally, we derive upper bounds for Asian basket options by applying techniques as in Thompson [Fast narrow bounds on the value of Asian options, Working Paper, University of Cambridge, 1999] and Lord [Partially exact and bounded approximations for arithmetic Asian options, J. Comput. Finance 10 (2) (2006) 1-52]. Numerical results are included and on the basis of our numerical tests, we explain which method we recommend depending on moneyness and time-to-maturity.

  16. Product differentiation under bounded rationality

    NARCIS (Netherlands)

    Vermeulen, B.; Poutré, La J.A.; Kok, de A.G.; Pyka, A.; Handa, H.; Ishibuchi, H.; Ong, Y.-S.; Tan, K.-C.

    2015-01-01

    We study product differentiation equilibria and dynamics on the Salop circle under bounded rationality. Due to bounded rationality, firms tend to agglomerate in pairs. Upon adding a second tier of component suppliers, downstream assemblers may escape pairwise horizontal agglomeration. Moreover, we

  17. Metabolism of organically bound tritium

    International Nuclear Information System (INIS)

    Travis, C.C.

    1984-01-01

    The classic methodology for estimating dose to man from environmental tritium ignores the fact that organically bound tritium in foodstuffs may be directly assimilated in the bound compartment of tissues without previous oxidation. We propose a four-compartment model consisting of a free body water compartment, two organic compartments, and a small, rapidly metabolizing compartment. The utility of this model lies in the ability to input organically bound tritium in foodstuffs directly into the organic compartments of the model. We found that organically bound tritium in foodstuffs can increase cumulative total body dose by a factor of 1.7 to 4.5 times the free body water dose alone, depending on the bound-to-loose ratio of tritium in the diet. Model predictions are compared with empirical measurements of tritium in human urine and tissue samples, and appear to be in close agreement. 10 references, 4 figures, 3 tables

  18. Increasing surface enhanced Raman spectroscopy effect of RNA and DNA components by changing the pH of silver colloidal suspensions.

    Science.gov (United States)

    Primera-Pedrozo, Oliva M; Rodríguez, Gabriela Del Mar; Castellanos, Jorge; Felix-Rivera, Hilsamar; Resto, Oscar; Hernández-Rivera, Samuel P

    2012-02-15

    This work focused on establishing the parameters for enhancing the Raman signals of DNA and RNA constituents: nitrogenous bases, nucleosides and nucleotides, using metallic nanoparticles as surface enhanced Raman scattering substrates. Silver nanospheres were synthesized using sodium borohydride as a reducing agent and sodium citrate as a capping agent. The prepared nanoparticles had a surface plasmon band at ∼384nm and an average size of 12±3nm. The nanoparticles' surface charge was manipulated by changing the pH of the Ag colloidal suspensions in the range of 1-13. Low concentrations as 0.7μM were detected under the experimental conditions. The optimum pH values were: 7 for adenine, 9 for AMP, 5 for adenosine, 7 for dAMP and 11 for deoxyadenosine. Copyright © 2011 Elsevier B.V. All rights reserved.

  19. Impact of nanosilver on various DNA lesions and HPRT gene mutations - effects of charge and surface coating

    Czech Academy of Sciences Publication Activity Database

    Huk, A.; Izak-Nau, E.; el Yamani, N.; Uggerud, H.; Vadset, M.; Zasońska, Beata Anna; Duschl, A.; Dusinska, M.

    2015-01-01

    Roč. 12, 24 July (2015), 25_1-25_20 ISSN 1743-8977 Institutional support: RVO:61389013 Keywords : silver nanomaterials * surface charge * surface coating Subject RIV: CD - Macromolecular Chemistry Impact factor: 8.649, year: 2015

  20. Time Course of Detection of Human Male DNA from Stained Blood Sample on Various Surfaces by Loop Mediated Isothermal Amplification and Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Panan Kanchanaphum

    2018-01-01

    Full Text Available This study explores determining the sex of humans from blood stains taken from different surfaces and compares the time course of detection with the conventional PCR, Conventional Loop Mediated Isothermal Amplification (LAMP, and LAMP-Lateral Flow Dipstick (LFD. For the DNA templates, 7 male and 7 female blood stained samples were extracted and added to LAMP and PCR reaction solution to amplify the SRY gene. The DNA samples were extracted from the following blood stained materials: cloth, wood, clay, and tile. Then, the samples were stored at room temperature for 1, 7, 30, and 60 day(s. After the DNA amplification, the gel electrophoresis process was applied to detect LAMP product. The LFD was combined with the LAMP to detect LAMP product on the male cloth samples. For the male samples, the time course of detection on the first and seventh days indicated positive for both LAMP and PCR products on all the surfaces while no DNA amplification was found on any of the female samples. On day 30, positive LAMP product was still found on all the male samples. However, it had faded on the tiles. Moreover, all the male samples, which had tested positive for PCR product, were blurred and unclear. On day 60, LAMP product was still found on all the male samples. Conversely, the PCR method resulted in no bands showing for any of the male samples. However, the LAMP-LFD method detected product on all the male samples of cloth. The results show that the LAMP is an effective, practical, and reliable molecular-biological method. Moreover, the LFD can increase the efficiency and sensitivity of the LAMP, making it more suitable for field studies because gel electrophoresis apparatus is not required.

  1. Surface-enhanced Raman spectroscopic study of DNA and 6-mercapto-1-hexanol interactions using large area mapping

    DEFF Research Database (Denmark)

    Frøhling, Kasper Bayer; Alstrøm, Tommy Sonne; Bache, Michael

    2016-01-01

    intensities and peak positions it is possible to directly inspect the interplay between DNA and 6-mercapto-1-hexanol on gold covered nanopillars. It is demonstrated that optimised functionalization parameters can be extracted from the Raman spectra directly. Using the peak-fitting approach it is possible...

  2. Effect of the immobilisation of DNA aptamers on the detection of thrombin by means of surface plasmon resonance

    Czech Academy of Sciences Publication Activity Database

    Hianik, T.; Ostatná, V.; Vaisocherová, Hana; Homola, Jiří

    2008-01-01

    Roč. 391, č. 5 (2008), s. 1861-1869 ISSN 1618-2642 R&D Projects: GA AV ČR KAN200670701 Institutional research plan: CEZ:AV0Z20670512 Keywords : DNA aptamer * thrombin * dendrimer s Subject RIV: EI - Biotechnology ; Bionics Impact factor: 3.328, year: 2008

  3. Ancient DNA

    DEFF Research Database (Denmark)

    Willerslev, Eske; Cooper, Alan

    2004-01-01

    ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair......ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair...

  4. Curvature bound from gravitational catalysis

    Science.gov (United States)

    Gies, Holger; Martini, Riccardo

    2018-04-01

    We determine bounds on the curvature of local patches of spacetime from the requirement of intact long-range chiral symmetry. The bounds arise from a scale-dependent analysis of gravitational catalysis and its influence on the effective potential for the chiral order parameter, as induced by fermionic fluctuations on a curved spacetime with local hyperbolic properties. The bound is expressed in terms of the local curvature scalar measured in units of a gauge-invariant coarse-graining scale. We argue that any effective field theory of quantum gravity obeying this curvature bound is safe from chiral symmetry breaking through gravitational catalysis and thus compatible with the simultaneous existence of chiral fermions in the low-energy spectrum. With increasing number of dimensions, the curvature bound in terms of the hyperbolic scale parameter becomes stronger. Applying the curvature bound to the asymptotic safety scenario for quantum gravity in four spacetime dimensions translates into bounds on the matter content of particle physics models.

  5. Combining Alphas via Bounded Regression

    Directory of Open Access Journals (Sweden)

    Zura Kakushadze

    2015-11-01

    Full Text Available We give an explicit algorithm and source code for combining alpha streams via bounded regression. In practical applications, typically, there is insufficient history to compute a sample covariance matrix (SCM for a large number of alphas. To compute alpha allocation weights, one then resorts to (weighted regression over SCM principal components. Regression often produces alpha weights with insufficient diversification and/or skewed distribution against, e.g., turnover. This can be rectified by imposing bounds on alpha weights within the regression procedure. Bounded regression can also be applied to stock and other asset portfolio construction. We discuss illustrative examples.

  6. Improved Range Searching Lower Bounds

    DEFF Research Database (Denmark)

    Larsen, Kasper Green; Nguyen, Huy L.

    2012-01-01

    by constructing a hard input set and query set, and then invoking Chazelle and Rosenberg's [CGTA'96] general theorem on the complexity of navigation in the pointer machine. For the group model, we show that input sets and query sets that are hard for range reporting in the pointer machine (i.e. by Chazelle...... and Rosenberg's theorem), are also hard for dynamic range searching in the group model. This theorem allows us to reuse decades of research on range reporting lower bounds to immediately obtain a range of new group model lower bounds. Amongst others, this includes an improved lower bound for the fundamental...

  7. Surface-enhanced Raman Scattering Study of the Binding Modes of a Dibenzotetraaza[14]annulene Derivative with DNA/RNA Polynucleotides

    OpenAIRE

    Miljanić, Snežana; Dijanošić, Adriana; Kalac, Matea; Radić Stojković, Marijana; Piantanida, Ivo; Pawlica, Dariusz; Eilmes, Julita

    2012-01-01

    Binding modes of a dibenzotetraaza14annulene (DBTAA) derivative with synthetic nucleic acids were studied using surface-enhanced Raman spectroscopy (SERS). Changes in SERS intensity and appearance of new bands in spectra were attributed to different complexes formed between the DBTAA molecules and DNA/RNA polynucleotides. A decrease in intensity pointed to intercalation as the dominant binding mode of the annulene derivative with poly dGdC-poly dGdC and poly rA-poly rU, whereas new bands in...

  8. Electrochemistry and in situ scanning tunnelling microscopy of pure and redox-marked DNA- and UNA-based oligonucleotides on Au(111)-electrode surfaces

    DEFF Research Database (Denmark)

    Hansen, Allan Glargaard; Salvatore, Princia; Karlsen, K.

    2013-01-01

    the strongest and in accord with multiple site Ru-attachment. In situ STM disclosed molecular scale features in varying coverage on addition of the metal ions. The Ru-derivatives showed a bias voltage dependent broad maximum in the tunnelling current–overpotential correlation which could be correlated......We have studied adsorption and electrochemical electron transfer of several 13- and 15-base DNA and UNA (unlocked nucleic acids) oligonucleotides (ONs) linked to Au(111)-electrode surfaces via a 50-C6-SH group using cyclic voltammetry (CV) and scanning tunnelling microscopy in aqueous buffer under...

  9. The Effectiveness of the Removal of DNA from the Surfaces of EVA-Based Mouthguards using Standard Cleaning Protocols

    Science.gov (United States)

    2016-06-16

    true due to the fact that mouth guards are often used by athletes and military personnel in outdoor settings and given the fact that soil microbes...contact, DNA is transferred from plasmids or transposons. The genetic material transferred is often beneficial to the recipient with possible benefits of...oral injuries. J Am Dent Assoc 2006;137(12):1712-20. 3. Center for Science information, ADA Science Institute, ADA.org/oral health topics/. November

  10. Surface functionalized Cu{sub 2}Zn{sub 1-x}Cd{sub x}SnS{sub 4} quinternary alloyed nanostructure for DNA sensing

    Energy Technology Data Exchange (ETDEWEB)

    Ibraheam, A.S.; Voon, C.H.; Foo, K.L.; Azizah, N. [University Malaysia Perlis, Institute of Nano Electronic Engineering, Kangar, Perlis (Malaysia); Al-Douri, Y. [University of Sidi-Bel-Abbes, Physics Department, Faculty of Science, Sidi Bel-Abbes (Algeria); Gopinath, S.C.B. [University Malaysia Perlis, Institute of Nano Electronic Engineering, Kangar, Perlis (Malaysia); Universiti Malaysia Perlis, School of Bioprocess Engineering, Arau, Perlis (Malaysia); Ameri, M. [Universite Djilali Liabes de Sidi Bel-Abbes, Laboratoire Physico-Chimie des Materiaux Avances (LPCMA), Sidi Bel-Abbes (Algeria); Ibrahim, Sattar S. [University of Anbar, Chemisty Department, College of Science, Al Rumadi (Iraq)

    2017-03-15

    A sensing plate of extended Cu{sub 2}Zn{sub 1-x}Cd{sub x}SnS{sub 4} quinternary alloy nanostructures, fabricated on an oxidized silicon substrate by the sol-gel method, is reported in this paper. The fabricated device was characterized and analyzed via field emission-scanning electron microscopy, X-ray diffraction (XRD), and photoluminescence (PL). The XRD peaks shifted towards the lower angle side alongside increasing concentration of cadmium. The average diameter of the Cu{sub 2}Zn{sub 1-x}Cd{sub x}SnS{sub 4} quinternary alloy nanostructures falls between 21.55 and 43.12 nm, while the shift of the PL bandgap was from 1.81 eV (x = 0) to 1.72 eV (x = 1). The resulting Cu{sub 2}Zn{sub 1-x}Cd{sub x}SnS{sub 4} quinternary alloy nanostructures components were functionalized with oligonucleotides probe DNA molecules and interacted with the target, exhibiting good sensing capabilities due to its large surface-to-volume ratio. The fabrication, immobilization, and hybridization processes were analyzed via representative current-voltage (I-V) plots. Its electrical profile shows that the device is capable to distinguish biomolecules. Its high performance was evident from the linear relationship between the probe DNA from cervical cancer and the target DNA, showing its applicability for medical applications. (orig.)

  11. Bound states in string nets

    Science.gov (United States)

    Schulz, Marc Daniel; Dusuel, Sébastien; Vidal, Julien

    2016-11-01

    We discuss the emergence of bound states in the low-energy spectrum of the string-net Hamiltonian in the presence of a string tension. In the ladder geometry, we show that a single bound state arises either for a finite tension or in the zero-tension limit depending on the theory considered. In the latter case, we perturbatively compute the binding energy as a function of the total quantum dimension. We also address this issue in the honeycomb lattice where the number of bound states in the topological phase depends on the total quantum dimension. Finally, the internal structure of these bound states is analyzed in the zero-tension limit.

  12. On functions of bounded semivariation

    Czech Academy of Sciences Publication Activity Database

    Monteiro, Giselle Antunes

    2015-01-01

    Roč. 40, č. 2 (2015), s. 233-276 ISSN 0147-1937 Institutional support: RVO:67985840 Keywords : semivariation * functions of bounded variation * regulated functions Subject RIV: BA - General Mathematics http://projecteuclid.org/euclid.rae/1491271216

  13. Computational Lower Bounds Using Diagonalization

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 14; Issue 7. Computational Lower Bounds Using Diagonalization - Languages, Turing Machines and Complexity Classes. M V Panduranga Rao. General Article Volume 14 Issue 7 July 2009 pp 682-690 ...

  14. Lower bounds on Q of some dipole shapes

    DEFF Research Database (Denmark)

    Kim, Oleksiy S.

    2016-01-01

    The lower bound on the radiation Q of an arbitrary electrically small antenna shape can be determined by finding the optimal electric current density on the exterior surface of the shape, such that the Q of this current radiating in free space is minimized, and then augmenting it with a magnetic...... current density cancelling the fields inside the shape's surface. The Q of these coupled electric and magnetic currents radiating in free space is the lower bound on Q for the given shape. The approach is exemplified and its general applicability is substantiated by computing the lower bounds...... of spherically capped dipoles and comparing the results to the known bounds of a sphere and a thin cylinder....

  15. DNA damage and oxidative stress in human liver cell L-02 caused by surface water extracts during drinking water treatment in a waterworks in China.

    Science.gov (United States)

    Xie, Shao-Hua; Liu, Ai-Lin; Chen, Yan-Yan; Zhang, Li; Zhang, Hui-Juan; Jin, Bang-Xiong; Lu, Wen-Hong; Li, Xiao-Yan; Lu, Wen-Qing

    2010-04-01

    Because of the daily and life-long exposure to disinfection by-products formed during drinking water treatment, potential adverse human health risk of drinking water disinfection is of great concern. Toxicological studies have shown that drinking water treatment increases the genotoxicity of surface water. Drinking water treatment is comprised of different potabilization steps, which greatly influence the levels of genotoxic products in the surface water and thus may alter the toxicity and genotoxicity of surface water. The aim of the present study was to understand the influence of specific steps on toxicity and genotoxicity during the treatment of surface water in a water treatment plant using liquid chlorine as the disinfectant in China. An integrated approach of the comet and oxidative stress assays was used in the study, and the results showed that both the prechlorination and postchlorination steps increased DNA damage and oxidative stress caused by water extracts in human derived L-02 cells while the tube settling and filtration steps had the opposite effect. This research also highlighted the usefulness of an integrated approach of the comet and oxidative stress assays in evaluating the genotoxicity of surface water during drinking water treatment. Copyright 2009 Wiley-Liss, Inc.

  16. New optimized DNA extraction protocol for fingerprints deposited on a special self-adhesive security seal and other latent samples used for human identification.

    Science.gov (United States)

    Kopka, Julieta; Leder, Monika; Jaureguiberry, Stella M; Brem, Gottfried; Boselli, Gabriel O

    2011-09-01

    Obtaining complete short tandem repeat (STR) profiles from fingerprints containing minimal amounts of DNA, using standard extraction techniques, can be difficult. The aim of this study was to evaluate a new kit, Fingerprint DNA Finder (FDF Kit), recently launched for the extraction of DNA and STR profiling from fingerprints placed on a special device known as Self-Adhesive Security Seal Sticker(®) and other latent fingerprints on forensic evidentiary material like metallic guns. The DNA extraction system is based on a reversal of the silica principle, and all the potential inhibiting substances are retained on the surface of a special adsorbent, while nucleic acids are not bound and remain in solution dramatically improving DNA recovery. DNA yield was quite variable among the samples tested, rendering in most of the cases (>90%) complete STR profiles, free of PCR inhibitors, and devoid of artifacts. Even samples with DNA amount below 100 pg could be successfully analyzed. © 2011 American Academy of Forensic Sciences.

  17. Zinc fixation preserves flow cytometry scatter and fluorescence parameters and allows simultaneous analysis of DNA content and synthesis, and intracellular and surface epitopes

    DEFF Research Database (Denmark)

    Jensen, Uffe Birk; Owens, David; Pedersen, Søren

    2010-01-01

    Zinc salt-based fixation (ZBF) has proved advantageous in histochemical analyses conducted on intact tissues but has not been exploited in flow cytometry procedures that focus on quantitative analysis of individual cells. Here, we show that ZBF performs equally well to paraformaldehyde in the pre......Zinc salt-based fixation (ZBF) has proved advantageous in histochemical analyses conducted on intact tissues but has not been exploited in flow cytometry procedures that focus on quantitative analysis of individual cells. Here, we show that ZBF performs equally well to paraformaldehyde...... allowing subsequent quantitative PCR analysis or labeling for incorporation of the thymidine analog EdU following surface and intracellular epitope staining. Finally, ZBF treatment allows for long-term storage of labeled cells with little change in these parameters. Thus, we present a protocol for zinc...... salt fixation of cells that allows for the simultaneous analysis of DNA and intracellular and cell surface proteins by flow cytometry....

  18. DNA-cell conjugates

    Science.gov (United States)

    Hsiao, Shih-Chia; Francis, Matthew B.; Bertozzi, Carolyn; Mathies, Richard; Chandra, Ravi; Douglas, Erik; Twite, Amy; Toriello, Nicholas; Onoe, Hiroaki

    2018-05-15

    The present invention provides conjugates of DNA and cells by linking the DNA to a native functional group on the cell surface. The cells can be without cell walls or can have cell walls. The modified cells can be linked to a substrate surface and used in assay or bioreactors.

  19. DNA-cell conjugates

    Science.gov (United States)

    Hsiao, Shih-Chia; Francis, Matthew B.; Bertozzi, Carolyn; Mathies, Richard; Chandra, Ravi; Douglas, Erik; Twite, Amy; Toriello, Nicholas; Onoe, Hiroaki

    2016-05-03

    The present invention provides conjugates of DNA and cells by linking the DNA to a native functional group on the cell surface. The cells can be without cell walls or can have cell walls. The modified cells can be linked to a substrate surface and used in assay or bioreactors.

  20. Quantum Bound to Chaos and the Semiclassical Limit

    Science.gov (United States)

    Kurchan, Jorge

    2018-06-01

    We discuss the quantum bound on chaos in the context of the free propagation of a particle in an arbitrarily curved surface at low temperatures. The semiclassical calculation of the Lyapunov exponent can be performed in much the same way as the corresponding one for the `Loschmidt echo'. The bound appears here as the impossibility to scatter a wave, by effect of the curvature, over characteristic lengths smaller than the deBroglie wavelength.

  1. Structural Changes Induced in Grapevine (Vitis vinifera L. DNA by Femtosecond IR Laser Pulses: A Surface-Enhanced Raman Spectroscopic Study

    Directory of Open Access Journals (Sweden)

    Nicoleta E. Dina

    2016-05-01

    Full Text Available In this work, surface-enhanced Raman spectra of ten genomic DNAs extracted from leaf tissues of different grapevine (Vitis vinifera L. varieties, respectively, are analyzed in the wavenumber range 300–1800 cm−1. Furthermore, structural changes induced in grapevine genomic nucleic acids upon femtosecond (170 fs infrared (IR laser pulse irradiation (λ = 1100 nm are discussed in detail for seven genomic DNAs, respectively. Surface-enhanced Raman spectroscopy (SERS signatures, vibrational band assignments and structural characterization of genomic DNAs are reported for each case. As a general observation, the wavenumber range between 1500 and 1660 cm−1 of the spectra seems to be modified upon laser treatment. This finding could reflect changes in the base-stacking interactions in DNA. Spectral shifts are mainly attributed to purines (dA, dG and deoxyribose. Pyrimidine residues seem to be less affected by IR femtosecond laser pulse irradiation. Furthermore, changes in the conformational properties of nucleic acid segments are observed after laser treatment. We have found that DNA isolated from Feteasca Neagra grapevine leaf tissues is the most structurally-responsive system to the femtosecond IR laser irradiation process. In addition, using unbiased computational resources by means of principal component analysis (PCA, eight different grapevine varieties were discriminated.

  2. Lens-free imaging of magnetic particles in DNA assays.

    Science.gov (United States)

    Colle, Frederik; Vercruysse, Dries; Peeters, Sara; Liu, Chengxun; Stakenborg, Tim; Lagae, Liesbet; Del-Favero, Jurgen

    2013-11-07

    We present a novel opto-magnetic system for the fast and sensitive detection of nucleic acids. The system is based on a lens-free imaging approach resulting in a compact and cheap optical readout of surface hybridized DNA fragments. In our system magnetic particles are attracted towards the detection surface thereby completing the labeling step in less than 1 min. An optimized surface functionalization combined with magnetic manipulation was used to remove all nonspecifically bound magnetic particles from the detection surface. A lens-free image of the specifically bound magnetic particles on the detection surface was recorded by a CMOS imager. This recorded interference pattern was reconstructed in software, to represent the particle image at the focal distance, using little computational power. As a result we were able to detect DNA concentrations down to 10 pM with single particle sensitivity. The possibility of integrated sample preparation by manipulation of magnetic particles, combined with the cheap and highly compact lens-free detection makes our system an ideal candidate for point-of-care diagnostic applications.

  3. Rapid, highly sensitive and highly specific gene detection by combining enzymatic amplification and DNA chip detection simultaneously

    Directory of Open Access Journals (Sweden)

    Koji Hashimoto

    2016-05-01

    Full Text Available We have developed a novel gene detection method based on the loop-mediated isothermal amplification (LAMP reaction and the DNA dissociation reaction on the same DNA chip surface to achieve a lower detection limit, broader dynamic range and faster detection time than are attainable with a conventional DNA chip. Both FAM- and thiol-labeled DNA probe bound to the complementary sequence accompanying Dabcyl was immobilized on the gold surface via Au/thiol bond. The LAMP reaction was carried out on the DNA probe fixed gold surface. At first, Dabcyl molecules quenched the FAM fluorescence. According to the LAMP reaction, the complementary sequence with Dabcyl was competitively reacted with the amplified targeted sequence. As a result, the FAM fluorescence increased owing to dissociation of the complementary sequence from the DNA probe. The simultaneous reaction of LAMP and DNA chip detection was achieved, and 103 copies of the targeted gene were detected within an hour by measuring fluorescence intensity of the DNA probe. Keywords: Biosensor, DNA chip, Loop-mediated isothermal amplification (LAMP, Fluorescence detection, Gold substrate, Au/thiol bond

  4. DNA-DNA hybridization determined in micro-wells using covalent attachment of DNA

    DEFF Research Database (Denmark)

    Christensen, H.; Angen, Øystein; Mutters, R.

    2000-01-01

    The present study was aimed at reducing the time and labour used to perform DNA-DNA hybridizations for classification of bacteria at the species level. A micro-well-format DNA hybridization method was developed and validated. DNA extractions were performed by a small-scale method and DNA...... was sheared mechanically into fragments of between 400 and 700 bases. The hybridization conditions were calibrated according to DNA similarities obtained by the spectrophotometric method using strains within the family Pasteurellaceae, Optimal conditions were obtained with 300 ng DNA added per well and bound...... by covalent attachment to NucleoLink. Hybridization was performed with 500 ng DNA, 5% (w/w) of which was labelled with photo-activatable biotin (competitive hybridization) for 2.5 h at 65 degrees C in 2 x SSC followed by stringent washing with 2 x SSC at the same temperature. The criteria for acceptance...

  5. Single-molecule mechanics of protein-labelled DNA handles

    Directory of Open Access Journals (Sweden)

    Vivek S. Jadhav

    2016-01-01

    Full Text Available DNA handles are often used as spacers and linkers in single-molecule experiments to isolate and tether RNAs, proteins, enzymes and ribozymes, amongst other biomolecules, between surface-modified beads for nanomechanical investigations. Custom DNA handles with varying lengths and chemical end-modifications are readily and reliably synthesized en masse, enabling force spectroscopic measurements with well-defined and long-lasting mechanical characteristics under physiological conditions over a large range of applied forces. Although these chemically tagged DNA handles are widely used, their further individual modification with protein receptors is less common and would allow for additional flexibility in grabbing biomolecules for mechanical measurements. In-depth information on reliable protocols for the synthesis of these DNA–protein hybrids and on their mechanical characteristics under varying physiological conditions are lacking in literature. Here, optical tweezers are used to investigate different protein-labelled DNA handles in a microfluidic environment under different physiological conditions. Digoxigenin (DIG-dsDNA-biotin handles of varying sizes (1000, 3034 and 4056 bp were conjugated with streptavidin or neutravidin proteins. The DIG-modified ends of these hybrids were bound to surface-modified polystyrene (anti-DIG beads. Using different physiological buffers, optical force measurements showed consistent mechanical characteristics with long dissociation times. These protein-modified DNA hybrids were also interconnected in situ with other tethered biotinylated DNA molecules. Electron-multiplying CCD (EMCCD imaging control experiments revealed that quantum dot–streptavidin conjugates at the end of DNA handles remain freely accessible. The experiments presented here demonstrate that handles produced with our protein–DNA labelling procedure are excellent candidates for grasping single molecules exposing tags suitable for molecular

  6. Electron microscopic visualization of the RecA protein-mediated pairing and branch migration phases of DNA strand exchange

    DEFF Research Database (Denmark)

    Register, JC; Christiansen, Gunna; Griffith, J

    1987-01-01

    examined by electron microscopy: supertwisted double-stranded (ds) DNA and linear single-stranded (ss) DNA, linear dsDNA and circular ssDNA, and linear dsDNA and colinear ssDNA. Several major observations were: (i) with RecA protein bound to the DNA, plectonemic joints were ultrastructurally...

  7. Simulation bounds for system availability

    International Nuclear Information System (INIS)

    Tietjen, G.L.; Waller, R.A.

    1976-01-01

    System availability is a dominant factor in the practicality of nuclear power electrical generating plants. A proposed model for obtaining either lower bounds or interval estimates on availability uses observed data on ''n'' failure-to-repair cycles of the system to estimate the parameters in the time-to-failure and time-to-repair models. These estimates are then used in simulating failure/repair cycles of the system. The availability estimate is obtained for each of 5000 samples of ''n'' failure/repair cycles to form a distribution of estimates. Specific percentile points of those simulated distributions are selected as lower simulation bounds or simulation interval bounds for the system availability. The method is illustrated with operational data from two nuclear plants for which an exponential time-to-failure and a lognormal time-to-repair are assumed

  8. DNA vaccine encoding nucleocapsid and surface proteins of wild type canine distemper virus protects its natural host against distemper.

    Science.gov (United States)

    Cherpillod, P; Tipold, A; Griot-Wenk, M; Cardozo, C; Schmid, I; Fatzer, R; Schobesberger, M; Zurbriggen, R; Bruckner, L; Roch, F; Vandevelde, M; Wittek, R; Zurbriggen, A

    2000-07-01

    Canine distemper virus (CDV), a member of the genus Morbillivirus induces a highly infectious, frequently lethal disease in dogs and other carnivores. Current vaccines against canine distemper consisting of attenuated viruses have been in use for many years and have greatly reduced the incidence of distemper in the dog population. However, certain strains may not guarantee adequate protection and others can induce post vaccinal encephalitis. We tested a DNA vaccine for its ability to protect dogs, the natural host of CDV, against distemper. We constructed plasmids containing the nucleocapsid, the fusion, and the attachment protein genes of a virulent canine distemper virus strain. Mice inoculated with these plasmids developed humoral and cellular immune responses against CDV antigens. Dogs immunized with the expression plasmids developed virus-neutralizing antibodies. Significantly, vaccinated dogs were protected against challenge with virulent CDV, whereas unvaccinated animals succumbed to distemper.

  9. Ru(II)-polypyridyl surface functionalised gold nanoparticles as DNA targeting supramolecular structures and luminescent cellular imaging agents.

    Science.gov (United States)

    Martínez-Calvo, Miguel; Orange, Kim N; Elmes, Robert B P; la Cour Poulsen, Bjørn; Williams, D Clive; Gunnlaugsson, Thorfinnur

    2016-01-07

    The development of Ru(II) functionalized gold nanoparticles 1–3·AuNP is described. These systems were found to be mono-disperse with a hydrodynamic radius of ca. 15 nm in water but gave rise to the formation of higher order structures in buffered solution. The interaction of 1–3·AuNP with DNA was also studied by spectroscopic and microscopic methods and suggested the formation of large self-assembly structures in solution. The uptake of 1–3·AuNP by cancer cells was studied using both confocal fluorescence as well as transmission electron microscopy (TEM), with the aim of investigating their potential as tools for cellular biology. These systems displaying a non-toxic profile with favourable photophysical properties may have application across various biological fields including diagnostics and therapeutics.

  10. Relativistic bound state wave functions

    International Nuclear Information System (INIS)

    Micu, L.

    2005-01-01

    A particular method of writing the bound state wave functions in relativistic form is applied to the solutions of the Dirac equation with confining potentials in order to obtain a relativistic description of a quark antiquark bound system representing a given meson. Concerning the role of the effective constituent in the present approach we first observe that without this additional constituent we couldn't expand the bound state wave function in terms of products of free states. Indeed, we notice that if the wave function depends on the relative coordinates only, all the expansion coefficients would be infinite. Secondly we remark that the effective constituent enabled us to give a Lorentz covariant meaning to the potential energy of the bound system which is now seen as the 4th component of a 4-momentum. On the other side, by relating the effective constituent to the quantum fluctuations of the background field which generate the binding, we provided a justification for the existence of some spatial degrees of freedom accompanying the interaction potential. These ones, which are quite unusual in quantum mechanics, in our model are the natural consequence of the the independence of the quarks and can be seen as the effect of the imperfect cancellation of the vector momenta during the quantum fluctuations. Related with all these we remark that the adequate representation for the relativistic description of a bound system is the momentum representation, because of the transparent and easy way of writing the conservation laws and the transformation properties of the wave functions. The only condition to be fulfilled is to find a suitable way to take into account the potential energy of the bound system. A particular feature of the present approach is that the confining forces are due to a kind of glue where both quarks are embedded. This recalls other bound state models where the wave function is factorized in terms of constituent wave functions and the confinement is

  11. Four-quark bound states

    International Nuclear Information System (INIS)

    Zouzou, S.

    1986-01-01

    In the framework of simple non-relativistic potential models, we examine the system consisting of two quarks and two antiquarks with equal or unequal masses. We search for possible bound states below the threshold for the spontaneous dissociation into two mesons. We solve the four body problem by empirical or systematic variational methods and we include the virtual meson-meson components of the wave function. With standard two-body potentials, there is no proliferation of multiquarks. With unequal quark masses, we obtain however exotic (anti Qanti Qqq) bound states with a baryonic antidiquark-quark-quark structure very analogous to the heavy flavoured (Q'qq) baryons. (orig.)

  12. Bound entanglement and local realism

    International Nuclear Information System (INIS)

    Kaszlikowski, Dagomir; Zukowski, Marek; Gnacinski, Piotr

    2002-01-01

    We show using a numerical approach, which gives necessary and sufficient conditions for the existence of local realism, that the bound entangled state presented in Bennett et al. [Phys. Rev. Lett. 82, 5385 (1999)] admits a local and realistic description. We also find the lowest possible amount of some appropriate entangled state that must be ad-mixed to the bound entangled state so that the resulting density operator has no local and realistic description and as such can be useful in quantum communication and quantum computation

  13. DNA-Mediated Electrochemistry

    Science.gov (United States)

    Gorodetsky, Alon A.; Buzzeo, Marisa C.

    2009-01-01

    The base pair stack of DNA has been demonstrated as a medium for long range charge transport chemistry both in solution and at DNA-modified surfaces. This chemistry is exquisitely sensitive to structural perturbations in the base pair stack as occur with lesions, single base mismatches, and protein binding. We have exploited this sensitivity for the development of reliable electrochemical assays based on DNA charge transport at self-assembled DNA monolayers. Here we discuss the characteristic features, applications, and advantages of DNA-mediated electrochemistry. PMID:18980370

  14. Site-specific DNA Inversion by Serine Recombinases

    Science.gov (United States)

    2015-01-01

    Reversible site-specific DNA inversion reactions are widely distributed in bacteria and their viruses. They control a range of biological reactions that most often involve alterations of molecules on the surface of cells or phage. These programmed DNA rearrangements usually occur at a low frequency, thereby preadapting a small subset of the population to a change in environmental conditions, or in the case of phages, an expanded host range. A dedicated recombinase, sometimes with the aid of additional regulatory or DNA architectural proteins, catalyzes the inversion of DNA. RecA or other components of the general recombination-repair machinery are not involved. This chapter discusses site-specific DNA inversion reactions mediated by the serine recombinase family of enzymes and focuses on the extensively studied serine DNA invertases that are stringently controlled by the Fis-bound enhancer regulatory system. The first section summarizes biological features and general properties of inversion reactions by the Fis/enhancer-dependent serine invertases and the recently described serine DNA invertases in Bacteroides. Mechanistic studies of reactions catalyzed by the Hin and Gin invertases are then discussed in more depth, particularly with regards to recent advances in our understanding of the function of the Fis/enhancer regulatory system, the assembly of the active recombination complex (invertasome) containing the Fis/enhancer, and the process of DNA strand exchange by rotation of synapsed subunit pairs within the invertasome. The role of DNA topological forces that function in concert with the Fis/enhancer controlling element in specifying the overwhelming bias for DNA inversion over deletion and intermolecular recombination is emphasized. PMID:25844275

  15. The effect of pH and DNA concentration on organic thin-film transistor biosensors

    KAUST Repository

    Khan, Hadayat Ullah

    2012-03-01

    Organic electronics are beginning to attract more interest for biosensor technology as they provide an amenable interface between biology and electronics. Stable biosensor based on electronic detection platform would represent a significant advancement in technology as costs and analysis time would decrease immensely. Organic materials provide a route toward that goal due to their compatibility with electronic applications and biological molecules. In this report, we detail the effects of experimental parameters, such as pH and concentration, toward the selective detection of DNA via surface-bound peptide nucleic acid (PNA) sequences on organic transistor biosensors. The OTFT biosensors are fabricated with thin-films of the organic semiconductor, 5,5′-bis-(7-dodecyl-9H-fluoren-2-yl)-2,2′-bithiophene (DDFTTF), in which they exhibit a stable mobility of 0.2 cm 2 V -1 s -1 in buffer solutions (phosphate-buffer saline, pH 7.4 or sodium acetate, pH 7). Device performance were optimized to minimize the deleterious effects of pH on gate-bias stress such that the sensitivity toward DNA detection can be improved. In titration experiments, the surface-bound PNA probes were saturated with 50 nM of complementary target DNA, which required a 10-fold increase in concentration of single-base mismatched target DNA to achieve a similar surface saturation. The binding constant of DNA on the surface-bound PNA probes was determined from the concentration-dependent response (titration measurements) of our organic transistor biosensors. © 2011 Elsevier B.V. All rights reserved.

  16. The effect of pH and DNA concentration on organic thin-film transistor biosensors

    KAUST Repository

    Khan, Hadayat Ullah; Roberts, Mark E.; Johnson, Olasupo B.; Knoll, Wolfgang; Bao, Zhenan

    2012-01-01

    Organic electronics are beginning to attract more interest for biosensor technology as they provide an amenable interface between biology and electronics. Stable biosensor based on electronic detection platform would represent a significant advancement in technology as costs and analysis time would decrease immensely. Organic materials provide a route toward that goal due to their compatibility with electronic applications and biological molecules. In this report, we detail the effects of experimental parameters, such as pH and concentration, toward the selective detection of DNA via surface-bound peptide nucleic acid (PNA) sequences on organic transistor biosensors. The OTFT biosensors are fabricated with thin-films of the organic semiconductor, 5,5′-bis-(7-dodecyl-9H-fluoren-2-yl)-2,2′-bithiophene (DDFTTF), in which they exhibit a stable mobility of 0.2 cm 2 V -1 s -1 in buffer solutions (phosphate-buffer saline, pH 7.4 or sodium acetate, pH 7). Device performance were optimized to minimize the deleterious effects of pH on gate-bias stress such that the sensitivity toward DNA detection can be improved. In titration experiments, the surface-bound PNA probes were saturated with 50 nM of complementary target DNA, which required a 10-fold increase in concentration of single-base mismatched target DNA to achieve a similar surface saturation. The binding constant of DNA on the surface-bound PNA probes was determined from the concentration-dependent response (titration measurements) of our organic transistor biosensors. © 2011 Elsevier B.V. All rights reserved.

  17. Transient response in granular bounded heap flows

    Science.gov (United States)

    Xiao, Hongyi; Ottino, Julio M.; Lueptow, Richard M.; Umbanhowar, Paul B.

    2017-11-01

    Heap formation, a canonical granular flow, is common in industry and is also found in nature. Here, we study the transition between steady flow states in quasi-2D bounded heaps by suddenly changing the feed rate from one fixed value to another. During the transition, in both experiments and discrete element method simulations, an additional wedge of flowing particles propagates over the rising free surface. The downstream edge of the wedge - the wedge front - moves downstream with velocity inversely proportional to the square root of time. An additional longer duration transient process continues after the wedge front reaches the downstream wall. The transient flux profile during the entire transition is well modeled by a diffusion-like equation derived from local mass balance and a local linear relation between the flux and the surface slope. Scalings for the transient kinematics during the flow transitions are developed based on the flux profiles. Funded by NSF Grant CBET-1511450.

  18. Semiclassical bounds in magnetic bottles

    Czech Academy of Sciences Publication Activity Database

    Barseghyan, Diana; Exner, Pavel; Kovařík, H.; Weidl, T.

    2016-01-01

    Roč. 28, č. 1 (2016), s. 1650002 ISSN 0129-055X R&D Projects: GA ČR(CZ) GA14-06818S Institutional support: RVO:61389005 Keywords : magnetic Laplacian * discrete spectrum * eigenvalue bounds Subject RIV: BE - Theoretical Physics Impact factor: 1.426, year: 2016

  19. Positivity bounds for Sivers functions

    International Nuclear Information System (INIS)

    Kang Zhongbo; Soffer, Jacques

    2011-01-01

    We generalize a positivity constraint derived initially for parity-conserving processes to the parity-violating ones, and use it to derive non-trivial bounds on several Sivers functions, entering in the theoretical description of single spin asymmetry for various processes.

  20. Bound states of 'dressed' particles

    International Nuclear Information System (INIS)

    Shirokov, M.I.

    1994-01-01

    A new approach to the problem of bound states in relativistic quantum field theories is suggested. It uses the creation - destruction operators of 'dresses' particles which have been granted by Faddeev's (1963) 'dressing' formalism. Peculiarities of the proposed approach as compared to the known ones are discussed. 8 refs. (author)

  1. Quantum lower bound for sorting

    OpenAIRE

    Shi, Yaoyun

    2000-01-01

    We prove that \\Omega(n log(n)) comparisons are necessary for any quantum algorithm that sorts n numbers with high success probability and uses only comparisons. If no error is allowed, at least 0.110nlog_2(n) - 0.067n + O(1) comparisons must be made. The previous known lower bound is \\Omega(n).

  2. Unconditional lower bounds against advice

    NARCIS (Netherlands)

    Buhrman, H.; Fortnow, L.; Santhanam, R.

    2009-01-01

    We show several unconditional lower bounds for exponential time classes against polynomial time classes with advice, including: (1) For any constant c, NEXP not in P^{NP[n^c]} (2) For any constant c, MAEXP not in MA/n^c (3) BPEXP not in BPP/n^{o(1)}. It was previously unknown even whether NEXP in

  3. Stenostomum cf. leucops (Platyhelminthes in Thailand: a surface observation using scanning electron microscopy and phylogenetic analysis based on 18S ribosomal DNA sequences

    Directory of Open Access Journals (Sweden)

    Arin Ngamniyom

    2016-02-01

    Full Text Available The genus Stenostomum contains small turbellaria that are widely distributed in freshwater environments worldwide. However, there are only rare reports or studies of this genus from Thailand. Therefore, the objective of this study was to report S. cf. leucops in Thailand collected from Pathum Thani Province. The worm morphology and surface topography using scanning electron microscopy were determined. Moreover, the phylogenetic tree of S. cf. leucops was analysed with 17 flatworms based on the 18S ribosomal DNA sequences. The phylogenetic relationship shared a common ancestry of Catenulida species, and S. cf. leucops displayed a monophyletic pattern within Stenostomum spp. The results of the morphological and molecular data are discussed. These results may increase the knowledge of freshwater microturbellarians in Thailand.

  4. Binding energies of two deltas bound states

    International Nuclear Information System (INIS)

    Sato, Hiroshi; Saito, Koichi.

    1982-06-01

    Bound states of the two-deltas system are investigated by employing the realistic one boson exchange potential. It is found that there exist many bound states in each isospin channel and also found that the tensor interaction plays important role in producing these bound states. Relationship between these bound states and dibaryon resonances is discussed. (J.P.N.)

  5. Prepolishing on a CNC platform with bound abrasive contour tools

    Science.gov (United States)

    Schoeffler, Adrienne E.; Gregg, Leslie L.; Schoen, John M.; Fess, Edward M.; Hakiel, Michael; Jacobs, Stephen D.

    2003-05-01

    Deterministic microgrinding (DMG) of optical glasses and ceramics is the commercial manufacturing process of choice to shape glass surfaces prior to final finishing. This process employs rigid bound matrix diamond tooling resulting in surface roughness values of 3-5μm peak to valley and 100-400nm rms, as well as mid-spatial frequency tool marks that require subsequent removal in secondary finishing steps. The ability to pre-polish optical surfaces within the grinding platform would reduce final finishing process times. Bound abrasive contour wheels containing cerium oxide, alumina or zirconia abrasives were constructed with an epoxy matrix. The effects of abrasive type, composition, and erosion promoters were examined for tool hardness (Shore D), and tested with commercial optical glasses in an Optipro CNC grinding platform. Metrology protocols were developed to examine tool wear and subsequent surface roughness. Work is directed to demonstrating effective material removal, improved surface roughness and cutter mark removal.

  6. DNA preservation in silk.

    Science.gov (United States)

    Liu, Yawen; Zheng, Zhaozhu; Gong, He; Liu, Meng; Guo, Shaozhe; Li, Gang; Wang, Xiaoqin; Kaplan, David L

    2017-06-27

    The structure of DNA is susceptible to alterations at high temperature and on changing pH, irradiation and exposure to DNase. Options to protect and preserve DNA during storage are important for applications in genetic diagnosis, identity authentication, drug development and bioresearch. In the present study, the stability of total DNA purified from human dermal fibroblast cells, as well as that of plasmid DNA, was studied in silk protein materials. The DNA/silk mixtures were stabilized on filter paper (silk/DNA + filter) or filter paper pre-coated with silk and treated with methanol (silk/DNA + PT-filter) as a route to practical utility. After air-drying and water extraction, 50-70% of the DNA and silk could be retrieved and showed a single band on electrophoretic gels. 6% silk/DNA + PT-filter samples provided improved stability in comparison with 3% silk/DNA + filter samples and DNA + filter samples for DNA preservation, with ∼40% of the band intensity remaining at 37 °C after 40 days and ∼10% after exposure to UV light for 10 hours. Quantitative analysis using the PicoGreen assay confirmed the results. The use of Tris/borate/EDTA (TBE) buffer enhanced the preservation and/or extraction of the DNA. The DNA extracted after storage maintained integrity and function based on serving as a functional template for PCR amplification of the gene for zinc finger protein 750 (ZNF750) and for transgene expression of red fluorescence protein (dsRed) in HEK293 cells. The high molecular weight and high content of a crystalline beta-sheet structure formed on the coated surfaces likely accounted for the preservation effects observed for the silk/DNA + PT-filter samples. Although similar preservation effects were also obtained for lyophilized silk/DNA samples, the rapid and simple processing available with the silk-DNA-filter membrane system makes it appealing for future applications.

  7. Cdc45-induced loading of human RPA onto single-stranded DNA.

    Science.gov (United States)

    Szambowska, Anna; Tessmer, Ingrid; Prus, Piotr; Schlott, Bernhard; Pospiech, Helmut; Grosse, Frank

    2017-04-07

    Cell division cycle protein 45 (Cdc45) is an essential component of the eukaryotic replicative DNA helicase. We found that human Cdc45 forms a complex with the single-stranded DNA (ssDNA) binding protein RPA. Moreover, it actively loads RPA onto nascent ssDNA. Pull-down assays and surface plasmon resonance studies revealed that Cdc45-bound RPA complexed with ssDNA in the 8-10 nucleotide binding mode, but dissociated when RPA covered a 30-mer. Real-time analysis of RPA-ssDNA binding demonstrated that Cdc45 catalytically loaded RPA onto ssDNA. This placement reaction required physical contacts of Cdc45 with the RPA70A subdomain. Our results imply that Cdc45 controlled stabilization of the 8-nt RPA binding mode, the subsequent RPA transition into 30-mer mode and facilitated an ordered binding to ssDNA. We propose that a Cdc45-mediated loading guarantees a seamless deposition of RPA on newly emerging ssDNA at the nascent replication fork. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. A symmetric Roos bound for linear codes

    NARCIS (Netherlands)

    Duursma, I.M.; Pellikaan, G.R.

    2006-01-01

    The van Lint–Wilson AB-method yields a short proof of the Roos bound for the minimum distance of a cyclic code. We use the AB-method to obtain a different bound for the weights of a linear code. In contrast to the Roos bound, the role of the codes A and B in our bound is symmetric. We use the bound

  9. Interactions of DNA with graphene and sensing applications of graphene field-effect transistor devices: A review

    Energy Technology Data Exchange (ETDEWEB)

    Green, Nathaniel S.; Norton, Michael L., E-mail: norton@marshall.edu

    2015-01-01

    Highlights: • The interaction of DNA, including DNA nanostructures, and graphene is reviewed. • Comparison of DNA graphene field-effect transistor (GFET) with other detection methods. • Discussion of challenges present in the detection mechanism of GFETs. • Use of DNA aptamer GFET sensors for the detection of small molecules and proteins. - Abstract: Graphene field-effect transistors (GFET) have emerged as powerful detection platforms enabled by the advent of chemical vapor deposition (CVD) production of the unique atomically thin 2D material on a large scale. DNA aptamers, short target-specific oligonucleotides, are excellent sensor moieties for GFETs due to their strong affinity to graphene, relatively short chain-length, selectivity, and a high degree of analyte variability. However, the interaction between DNA and graphene is not fully understood, leading to questions about the structure of surface-bound DNA, including the morphology of DNA nanostructures and the nature of the electronic response seen from analyte binding. This review critically evaluates recent insights into the nature of the DNA graphene interaction and its affect on sensor viability for DNA, small molecules, and proteins with respect to previously established sensing methods. We first discuss the sorption of DNA to graphene to introduce the interactions and forces acting in DNA based GFET devices and how these forces can potentially affect the performance of increasingly popular DNA aptamers and even future DNA nanostructures as sensor substrates. Next, we discuss the novel use of GFETs to detect DNA and the underlying electronic phenomena that are typically used as benchmarks for characterizing the analyte response of these devices. Finally, we address the use of DNA aptamers to increase the selectivity of GFET sensors for small molecules and proteins and compare them with other, state of the art, detection methods.

  10. Computer simulation of bounded plasmas

    International Nuclear Information System (INIS)

    Lawson, W.S.

    1987-01-01

    The problems of simulating a one-dimensional bounded plasma system using particles in a gridded space are systematically explored and solutions to them are given. Such problems include the injection of particles at the boundaries, the solution of Poisson's equation, and the inclusion of an external circuit between the confining boundaries. A recently discovered artificial cooling effect is explained as being a side-effect of quiet injection, and its potential for causing serious but subtle errors in bounded simulation is noted. The methods described in the first part of the thesis are then applied to the simulation of an extension of the Pierce diode problem, specifically a Pierce diode modified by an external circuit between the electrodes. The results of these simulations agree to high accuracy with theory when a theory exists, and also show some interesting chaotic behavior in certain parameter regimes. The chaotic behavior is described in detail

  11. Bounded Rationality in Transposition Processes

    DEFF Research Database (Denmark)

    Vollaard, Hans; Martinsen, Dorte Sindbjerg

    2014-01-01

    Studies explaining the timeliness and correctness of the transposition of EU directives into national legislation have provided rather inconclusive findings. They do not offer a clear-cut prediction concerning the transposition of the patients’ rights directive, which is one of the first that con......Studies explaining the timeliness and correctness of the transposition of EU directives into national legislation have provided rather inconclusive findings. They do not offer a clear-cut prediction concerning the transposition of the patients’ rights directive, which is one of the first...... that concerns the organisation and financing of national healthcare systems. This article applies the perspective of bounded rationality to explain (irregularities in) the timely and correct transposition of EU directives. The cognitive and organisational constraints long posited by the bounded rationality...

  12. 78 FR 18326 - Agency Information Collection Activities; Comment Request; Upward Bound and Upward Bound Math...

    Science.gov (United States)

    2013-03-26

    ...; Comment Request; Upward Bound and Upward Bound Math Science Annual Performance Report AGENCY: The Office... considered public records. Title of Collection: Upward Bound and Upward Bound Math Science Annual Performance...) and Upward Bound Math and Science (UBMS) Programs. The Department is requesting a new APR because of...

  13. Spectrum of gluino bound states

    International Nuclear Information System (INIS)

    Chanowitz, M.; Sharpe, S.; California Univ., Berkeley

    1983-01-01

    Using the bag model to first order in αsub(s) we find that if light gluinos exist they will appear as constituents of electrically charged bound states which are stable against strong interaction decay. We review the present experimental constraints and conclude that light, long-lived charged hadrons containing gluinos might exist with lifetimes between 2x10 - 8 and 10 - 14 s. (orig.)

  14. Evaluation of hepatitis B surface antigen and hepatitis B virus-DNA results in postmortem plasma specimens

    Directory of Open Access Journals (Sweden)

    Nihan Ziyade

    2015-03-01

    Full Text Available Objective: To assess the presence of hepatitis B surface antigen, one of the serologic markers of hepatitis B virus (HBV infection, in postmortem blood samples from autopsy cases using ELISA, and to compare the results with those obtained by PCR, which is the gold standard method in assessing HBV infection. Methods: The HBV test results of the blood samples from 880 autopsy cases determined in our laboratory, were retrospectively studied. Results: When compared with the gold standard method PCR, the sensitivity and specificity of postmortem ELISA were 100% and 84.1%, respectively. Conclusions: The increasingly used molecular diagnostic methods, such as PCR, should be used in cases where serological tests remain insufficient.We think that prospective studies on the comparison of ELISA and PCR assessment of postmortem blood samples with larger material should be carried out.

  15. Cyclotron transitions of bound ions

    Science.gov (United States)

    Bezchastnov, Victor G.; Pavlov, George G.

    2017-06-01

    A charged particle in a magnetic field possesses discrete energy levels associated with particle rotation around the field lines. The radiative transitions between these levels are the well-known cyclotron transitions. We show that a bound complex of particles with a nonzero net charge displays analogous transitions between the states of confined motion of the entire complex in the field. The latter bound-ion cyclotron transitions are affected by a coupling between the collective and internal motions of the complex and, as a result, differ from the transitions of a "reference" bare ion with the same mass and charge. We analyze the cyclotron transitions for complex ions by including the coupling within a rigorous quantum approach. Particular attention is paid to comparison of the transition energies and oscillator strengths to those of the bare ion. Selection rules based on integrals of collective motion are derived for the bound-ion cyclotron transitions analytically, and the perturbation and coupled-channel approaches are developed to study the transitions quantitatively. Representative examples are considered and discussed for positive and negative atomic and cluster ions.

  16. Quantitive DNA Fiber Mapping

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Chun-Mei; Wang, Mei; Greulich-Bode, Karin M.; Weier, Jingly F.; Weier, Heinz-Ulli G.

    2008-01-28

    Several hybridization-based methods used to delineate single copy or repeated DNA sequences in larger genomic intervals take advantage of the increased resolution and sensitivity of free chromatin, i.e., chromatin released from interphase cell nuclei. Quantitative DNA fiber mapping (QDFM) differs from the majority of these methods in that it applies FISH to purified, clonal DNA molecules which have been bound with at least one end to a solid substrate. The DNA molecules are then stretched by the action of a receding meniscus at the water-air interface resulting in DNA molecules stretched homogeneously to about 2.3 kb/{micro}m. When non-isotopically, multicolor-labeled probes are hybridized to these stretched DNA fibers, their respective binding sites are visualized in the fluorescence microscope, their relative distance can be measured and converted into kilobase pairs (kb). The QDFM technique has found useful applications ranging from the detection and delineation of deletions or overlap between linked clones to the construction of high-resolution physical maps to studies of stalled DNA replication and transcription.

  17. The Motion Of A Deformable Body In - Bounded Fluid

    International Nuclear Information System (INIS)

    Galpert, A.R.; Miloh, T.

    1998-01-01

    The Hamiltonian formalism for the motion of a deformable body in an inviscid irrotational fluid is generalized for the case of the motion in a bounded fluid. We found that the presence of the boundaries in a liquid leads to the chaotization of the body's motion. The ('memory' effect connected with a free surface boundary condition is also accounted for

  18. On resonances and bound states of Smilansky Hamiltonian

    Czech Academy of Sciences Publication Activity Database

    Exner, Pavel; Lotoreichik, Vladimir; Tater, Miloš

    2016-01-01

    Roč. 7, č. 5 (2016), s. 789-802 ISSN 2220-8054 R&D Projects: GA ČR(CZ) GA14-06818S Institutional support: RVO:61389005 Keywords : Smilansky Hamiltonian * resonances * resonance free region * weak coupling asymptotics * Riemann surface * bound states Subject RIV: BE - Theoretical Physics

  19. Labeling schemes for bounded degree graphs

    DEFF Research Database (Denmark)

    Adjiashvili, David; Rotbart, Noy Galil

    2014-01-01

    We investigate adjacency labeling schemes for graphs of bounded degree Δ = O(1). In particular, we present an optimal (up to an additive constant) log n + O(1) adjacency labeling scheme for bounded degree trees. The latter scheme is derived from a labeling scheme for bounded degree outerplanar...... graphs. Our results complement a similar bound recently obtained for bounded depth trees [Fraigniaud and Korman, SODA 2010], and may provide new insights for closing the long standing gap for adjacency in trees [Alstrup and Rauhe, FOCS 2002]. We also provide improved labeling schemes for bounded degree...

  20. Binding of radiation-induced phenylalanine radicals to DNA

    International Nuclear Information System (INIS)

    Schans, G.P. van der; Rijn, C.J.S. van; Bleichrodt, J.F.

    1975-11-01

    When an aqueous solution of double-stranded DNA of bacteriophage PM2 containing phenylalanine and saturated with N 2 O is irradiated with γ-rays, radiation-induced phenylalanine radicals are bound covalently. Under the conditions used about 25 phenylalanine molecules may be bound per lethal hit. Also for single-stranded PM2 DNA, most of the phenylalanine radicals bound are non-lethal. Evidence is presented that in double-stranded DNA an appreciable fraction of the single-strand breaks is induced by phenylalanine radicals. Radiation products of phenylalanine and the phenylalanine bound to the DNA decrease the sensitivity of the DNA to the induction of single-strand breaks. There are indications that the high efficiency of protection by radiation products of phenylalanine is due to their positive charge, which will result in a relatively high concentration of these compounds in the vicinity of the negatively charged DNA molecules

  1. Microbial interactions chapter: binding and entry of DNA in bacterial transformation

    Energy Technology Data Exchange (ETDEWEB)

    Lacks, S.A.

    1977-01-01

    Genetic transformation of bacteria by DNA released from cells of a related strain is discussed. The mechanism by which the giant information-bearing molecules of DNA are transported into the bacterial cell was investigated. It was concluded that the overall process of DNA uptake consists of two main steps, binding of donor DNA to the outside of the cell and entry of the bound DNA into the cell. Each step is discussed in detail. Inasmuch as these phenomena occur at the cell surface, they are related to structures and functions of the cell wall and membrane. In addition, the development of competence, that is the formation of cell surface structures allowing DNA uptake, is examined from both a physiological and evolutionary point of view. Genetic transfer mediated by free DNA is an obvious and important form of cellular interaction. The development of competence involves another, quite distinct system of interaction between bacterial cells. Streptococcus pneumoniae, Bacillus subtilis, and Hemophilus influenzae were used as the test organisms. 259 references.

  2. Switchable DNA interfaces for the highly sensitive detection of label-free DNA targets.

    Science.gov (United States)

    Rant, Ulrich; Arinaga, Kenji; Scherer, Simon; Pringsheim, Erika; Fujita, Shozo; Yokoyama, Naoki; Tornow, Marc; Abstreiter, Gerhard

    2007-10-30

    We report a method to detect label-free oligonucleotide targets. The conformation of surface-tethered probe nucleic acids is modulated by alternating electric fields, which cause the molecules to extend away from or fold onto the biased surface. Binding (hybridization) of targets to the single-stranded probes results in a pronounced enhancement of the layer-height modulation amplitude, monitored optically in real time. The method features an exceptional detection limit of <3 x 10(8) bound targets per cm(2) sensor area. Single base-pair mismatches in the sequences of DNA complements may readily be identified; moreover, binding kinetics and binding affinities can be determined with high accuracy. When driving the DNA to oscillate at frequencies in the kHz regime, distinct switching kinetics are revealed for single- and double-stranded DNA. Molecular dynamics are used to identify the binding state of molecules according to their characteristic kinetic fingerprints by using a chip-compatible detection format.

  3. Molecular mechanism of DNA replication-coupled inactivation of the initiator protein in Escherichia coli: interaction of DnaA with the sliding clamp-loaded DNA and the sliding clamp-Hda complex.

    Science.gov (United States)

    Su'etsugu, Masayuki; Takata, Makoto; Kubota, Toshio; Matsuda, Yusaku; Katayama, Tsutomu

    2004-06-01

    In Escherichia coli, the ATP-DnaA protein initiates chromosomal replication. After the DNA polymerase III holoenzyme is loaded on to DNA, DnaA-bound ATP is hydrolysed in a manner depending on Hda protein and the DNA-loaded form of the DNA polymerase III sliding clamp subunit, which yields ADP-DnaA, an inactivated form for initiation. This regulatory DnaA-inactivation represses extra initiation events. In this study, in vitro replication intermediates and structured DNA mimicking replicational intermediates were first used to identify structural prerequisites in the process of DnaA-ATP hydrolysis. Unlike duplex DNA loaded with sliding clamps, primer RNA-DNA heteroduplexes loaded with clamps were not associated with DnaA-ATP hydrolysis, and duplex DNA provided in trans did not rescue this defect. At least 40-bp duplex DNA is competent for the DnaA-ATP hydrolysis when a single clamp was loaded. The DnaA-ATP hydrolysis was inhibited when ATP-DnaA was tightly bound to a DnaA box-bearing oligonucleotide. These results imply that the DnaA-ATP hydrolysis involves the direct interaction of ATP-DnaA with duplex DNA flanking the sliding clamp. Furthermore, Hda protein formed a stable complex with the sliding clamp. Based on these, we suggest a mechanical basis in the DnaA-inactivation that ATP-DnaA interacts with the Hda-clamp complex with the aid of DNA binding. Copyright Blackwell Publishing Limited

  4. Surface-enhanced Raman detection of RNA and DNA bases following flow-injection analysis or HPLC separation

    Science.gov (United States)

    Cotton, Therese M.; Sheng, Rong-Sheng; Ni, Fan

    1990-11-01

    The goal of this study is to develop Surface-enhanced Raman scattering (SERS) detection methods for flow injection analysis (FIA) and high performance liquid chromatography (HPLC). Nucleic acid bases have been chosen for analysis because of their importance in life processes. The advantages to the use of SERS-based detection include its sensitivity, specificity and versatility. With the development of improved methodology, the detection limits should be comparable to UV spectroscopy. However, the specificity is considerably superior to that obtained with electronic spectroscopy in that the Raman spectrum provides a molecular fingerprint of the individual analytes. Raman spectroscopy is very versatile: aqueous samples, gases and solids can be analyzed with equal facility. The results presented here demonstrate that SERS can be used as a detection method for both FIA and HPLC detection. In the following experiments Ag sols have been used as the active substrate. The effect of various parameters such as temperature, pH, flow rate, and the nature of the interface between the HPLC system and the Raman spectrometer have been examined. One of the most significant findings is that the temperature of the Ag sol/HPLC effluent mixture has a dramatic effect on the SERS intensities. This effect is a result of increased colloid aggregation at higher temperatures. Aggregation is known to produce greater enhancement in SERS and proceeds much more rapidly at elevated temperatures. An increase in the temperature of the Ag sol enables SERS detection under flowing conditions and in real time. This is a substantial improvement over many of the previous attempts to interface SERS detection to FIA or HPLC. In most of the previous studies, it was necessary to stop the flow as the analyte eluted from the chromatogram and measure the SERS spectra under static conditions.

  5. Dilation volumes of sets of bounded perimeter

    DEFF Research Database (Denmark)

    Kiderlen, Markus; Rataj, Jan

    , this derivative coincides up to sign with the directional derivative of the covariogram of A in direction u. By known results for the covariogram, this derivative can therefore be expressed by the cosine transform of the surface area measure of A. We extend this result to sets Q that are at most countable and use...... it to determine the derivative of the contact distribution function of a stationary random closed set at zero. A variant for uncountable Q is given, too. The proofs are based on approximation of the characteristic function of A by smooth functions of bounded variation and showing corresponding formulas for them....

  6. The algebras of bounded and essentially bounded Lebesgue measurable functions

    Directory of Open Access Journals (Sweden)

    Mortini Raymond

    2017-04-01

    Full Text Available Let X be a set in ℝn with positive Lebesgue measure. It is well known that the spectrum of the algebra L∞(X of (equivalence classes of essentially bounded, complex-valued, measurable functions on X is an extremely disconnected compact Hausdorff space.We show, by elementary methods, that the spectrum M of the algebra ℒb(X, ℂ of all bounded measurable functions on X is not extremely disconnected, though totally disconnected. Let ∆ = { δx : x ∈ X} be the set of point evaluations and let g be the Gelfand topology on M. Then (∆, g is homeomorphic to (X, Τdis,where Tdis is the discrete topology. Moreover, ∆ is a dense subset of the spectrum M of ℒb(X, ℂ. Finally, the hull h(I, (which is homeomorphic to M(L∞(X, of the ideal of all functions in ℒb(X, ℂ vanishing almost everywhere on X is a nowhere dense and extremely disconnected subset of the Corona M \\ ∆ of ℒb(X, ℂ.

  7. Organophosphonate functionalized silicon nanowires for DNA hybridization studies

    Energy Technology Data Exchange (ETDEWEB)

    Pedone, Daniel; Cattani Scholz, Anna; Birner, Stefan; Abstreiter, Gerhard [WSI, TU Muenchen (Germany); Dubey, Manish; Schwartz, Jeffrey [Princeton University, NJ (United States); Tornow, Marc [IHT, TU Braunschweig (Germany)

    2007-07-01

    Semiconductor nanowire field effect devices have great appeal for label-free sensing applications due to their sensitivity to surface potential changes that may originate from charged adsorbates. In addition to requiring high sensitivity, suitable passivation and functionalization of the semiconductor surface is obligatory. We have fabricated both freely suspended and oxide-supported silicon nanowires from Silicon-on-Insulator substrates using standard nanopatterning methods (EBL, RIE) and sacrificial oxide layer etching. Subsequent to nanofabrication, the devices were first coated with an hydroxyalkylphosphonate monolayer and then bound via bifunctional linker groups to single stranded DNA or PNA oligonucleotides, respectively. We investigated DNA hybridization on such functionalized nanowires using a difference resistance setup, where subtracting the reference signal from a second wire could be used to exclude most non-specific effects. A net change in surface potential on the order of a few mV could be detected upon addition of the complementary DNA strand. This surface potential change corresponds to the hybridization of about 10{sup 10}cm{sup -2} probe strands according to our model calculations that takes into account the entire hybrid system in electrolyte solution.

  8. Voronoi Diagrams Without Bounding Boxes

    Science.gov (United States)

    Sang, E. T. K.

    2015-10-01

    We present a technique for presenting geographic data in Voronoi diagrams without having to specify a bounding box. The method restricts Voronoi cells to points within a user-defined distance of the data points. The mathematical foundation of the approach is presented as well. The cell clipping method is particularly useful for presenting geographic data that is spread in an irregular way over a map, as for example the Dutch dialect data displayed in Figure 2. The automatic generation of reasonable cell boundaries also makes redundant a frequently used solution to this problem that requires data owners to specify region boundaries, as in Goebl (2010) and Nerbonne et al (2011).

  9. Sensitivity analysis using probability bounding

    International Nuclear Information System (INIS)

    Ferson, Scott; Troy Tucker, W.

    2006-01-01

    Probability bounds analysis (PBA) provides analysts a convenient means to characterize the neighborhood of possible results that would be obtained from plausible alternative inputs in probabilistic calculations. We show the relationship between PBA and the methods of interval analysis and probabilistic uncertainty analysis from which it is jointly derived, and indicate how the method can be used to assess the quality of probabilistic models such as those developed in Monte Carlo simulations for risk analyses. We also illustrate how a sensitivity analysis can be conducted within a PBA by pinching inputs to precise distributions or real values

  10. Bounded Densities and Their Derivatives

    DEFF Research Database (Denmark)

    Kozine, Igor; Krymsky, V.

    2009-01-01

    This paper describes how one can compute interval-valued statistical measures given limited information about the underlying distribution. The particular focus is on a bounded derivative of a probability density function and its combination with other available statistical evidence for computing ...... quantities of interest. To be able to utilise the evidence about the derivative it is suggested to adapt the ‘conventional’ problem statement to variational calculus and the way to do so is demonstrated. A number of examples are given throughout the paper....

  11. Removal of bound metal fasteners

    Science.gov (United States)

    Kramer, R. F.

    1981-04-01

    This project explored the removal of bound metal fasteners through the use of ultrasonically assisted wrenches. Two wrenches were designed, fabricated and tested. Previous studies had indicated an increase in thread tension for a given torque application under the influence of ultrasonics. Based on this, the loosening of seized and corroded fasteners with the aid of ultrasonics was explored. Experimental data confirmed our prior analysis of the torque-tension relationship under the influence of ultrasonics; however, our progress did not satisfy the requirements necessary to loosen seized studs in a shipyard environment.

  12. Space mappings with bounded distortion

    CERN Document Server

    Reshetnyak, Yu G

    1989-01-01

    This book is intended for researchers and students concerned with questions in analysis and function theory. The author provides an exposition of the main results obtained in recent years by Soviet and other mathematicians in the theory of mappings with bounded distortion, an active direction in contemporary mathematics. The mathematical tools presented can be applied to a broad spectrum of problems that go beyond the context of the main topic of investigation. For a number of questions in the theory of partial differential equations and the theory of functions with generalized derivatives, this is the first time they have appeared in an internationally distributed monograph.

  13. Substrate-Bound Protein Gradients to Study Haptotaxis

    Directory of Open Access Journals (Sweden)

    Sebastien G. Ricoult

    2015-03-01

    Full Text Available Cells navigate in response to inhomogeneous distributions of extracellular guidance cues. The cellular and molecular mechanisms underlying migration in response to gradients of chemical cues have been investigated for over a century. Following the introduction of micropipettes and more recently microfluidics for gradient generation, much attention and effort was devoted to study cellular chemotaxis, which is defined as guidance by gradients of chemical cues in solution. Haptotaxis, directional migration in response to gradients of substrate-bound cues, has received comparatively less attention; however it is increasingly clear that in vivo many physiologically relevant guidance proteins – including many secreted cues – are bound to cellular surfaces or incorporated into extracellular matrix and likely function via a haptotactic mechanism. Here, we review the history of haptotaxis. We examine the importance of the reference surface, the surface in contact with the cell that is not covered by the cue, which forms a gradient opposing the gradient of the protein cue and must be considered in experimental designs and interpretation of results. We review and compare microfluidics, contact-printing, light patterning and 3D fabrication to pattern substrate-bound protein gradients in vitro, and focus on their application to study axon guidance. The range of methods to create substrate-bound gradients discussed herein make possible systematic analyses of haptotactic mechanisms. Furthermore, understanding the fundamental mechanisms underlying cell motility will inform bioengineering approaches to program cell navigation and recover lost function.

  14. Determining Normal-Distribution Tolerance Bounds Graphically

    Science.gov (United States)

    Mezzacappa, M. A.

    1983-01-01

    Graphical method requires calculations and table lookup. Distribution established from only three points: mean upper and lower confidence bounds and lower confidence bound of standard deviation. Method requires only few calculations with simple equations. Graphical procedure establishes best-fit line for measured data and bounds for selected confidence level and any distribution percentile.

  15. On semidefinite programming bounds for graph bandwidth

    NARCIS (Netherlands)

    de Klerk, E.; Nagy, M.; Sotirov, R.

    2013-01-01

    In this paper, we propose two new lower bounds on graph bandwidth and cyclic bandwidth based on semidefinite programming (SDP) relaxations of the quadratic assignment problem. We compare the new bounds with two other SDP bounds reported in [A. Blum, G. Konjevod, R. Ravi, and S. Vempala,

  16. Observational Bounds on Cosmic Doomsday

    Energy Technology Data Exchange (ETDEWEB)

    Shmakova, Marina

    2003-07-11

    Recently it was found, in a broad class of models, that the dark energy density may change its sign during the evolution of the universe. This may lead to a global collapse of the universe within the time t{sub c} {approx} 10{sup 10}-10{sup 11} years. Our goal is to find what bounds on the future lifetime of the universe can be placed by the next generation of cosmological observations. As an example, we investigate the simplest model of dark energy with a linear potential V({phi}) = V{sub 0}(1 + {alpha}{phi}). This model can describe the present stage of acceleration of the universe if {alpha} is small enough. However, eventually the field {phi} rolls down, V({phi}) becomes negative, and the universe collapses. The existing observational data indicate that the universe described by this model will collapse not earlier than t{sub c} {approx_equal} 10 billion years from the present moment. We show that the data from SNAP and Planck satellites may extend the bound on the ''doomsday'' time to tc 40 billion years at the 95% confidence level.

  17. Quantum bounds on Bell inequalities

    Science.gov (United States)

    Pál, Károly F.; Vértesi, Tamás

    2009-02-01

    We have determined the maximum quantum violation of 241 tight bipartite Bell inequalities with up to five two-outcome measurement settings per party by constructing the appropriate measurement operators in up to six-dimensional complex and eight-dimensional real-component Hilbert spaces using numerical optimization. Out of these inequalities 129 have been introduced here. In 43 cases higher-dimensional component spaces gave larger violation than qubits, and in three occasions the maximum was achieved with six-dimensional spaces. We have also calculated upper bounds on these Bell inequalities using a method proposed recently. For all but 20 inequalities the best solution found matched the upper bound. Surprisingly, the simplest inequality of the set examined, with only three measurement settings per party, was not among them, despite the high dimensionality of the Hilbert space considered. We also computed detection threshold efficiencies for the maximally entangled qubit pair. These could be lowered in several instances if degenerate measurements were also allowed.

  18. DNA-PK dependent targeting of DNA-ends to a protein complex assembled on matrix attachment region DNA sequences

    International Nuclear Information System (INIS)

    Mauldin, S.K.; Getts, R.C.; Perez, M.L.; DiRienzo, S.; Stamato, T.D.

    2003-01-01

    Full text: We find that nuclear protein extracts from mammalian cells contain an activity that allows DNA ends to associate with circular pUC18 plasmid DNA. This activity requires the catalytic subunit of DNA-PK (DNA-PKcs) and Ku since it was not observed in mutants lacking Ku or DNA-PKcs but was observed when purified Ku/DNA-PKcs was added to these mutant extracts. Competition experiments between pUC18 and pUC18 plasmids containing various nuclear matrix attachment region (MAR) sequences suggest that DNA ends preferentially associate with plasmids containing MAR DNA sequences. At a 1:5 mass ratio of MAR to pUC18, approximately equal amounts of DNA end binding to the two plasmids were observed, while at a 1:1 ratio no pUC18 end-binding was observed. Calculation of relative binding activities indicates that DNA-end binding activities to MAR sequences was 7 to 21 fold higher than pUC18. Western analysis of proteins bound to pUC18 and MAR plasmids indicates that XRCC4, DNA ligase IV, scaffold attachment factor A, topoisomerase II, and poly(ADP-ribose) polymerase preferentially associate with the MAR plasmid in the absence or presence of DNA ends. In contrast, Ku and DNA-PKcs were found on the MAR plasmid only in the presence of DNA ends. After electroporation of a 32P-labeled DNA probe into human cells and cell fractionation, 87% of the total intercellular radioactivity remained in nuclei after a 0.5M NaCl extraction suggesting the probe was strongly bound in the nucleus. The above observations raise the possibility that DNA-PK targets DNA-ends to a repair and/or DNA damage signaling complex which is assembled on MAR sites in the nucleus

  19. Improved Yield of High Molecular Weight DNA Coincides with Increased Microbial Diversity Access from Iron Oxide Cemented Sub-Surface Clay Environments

    Science.gov (United States)

    Hurt, Richard A.; Robeson, Michael S.; Shakya, Migun; Moberly, James G.; Vishnivetskaya, Tatiana A.; Gu, Baohua; Elias, Dwayne A.

    2014-01-01

    Despite over three decades of progress, extraction of high molecular weight (HMW) DNA from high clay soils or iron oxide cemented clay has remained challenging. HMW DNA is desirable for next generation sequencing as it yields the most comprehensive coverage. Several DNA extraction procedures were compared from samples that exhibit strong nucleic acid adsorption. pH manipulation or use of alternative ion solutions offered no improvement in nucleic acid recovery. Lysis by liquid N2 grinding in concentrated guanidine followed by concentrated sodium phosphate extraction supported HMW DNA recovery from clays high in iron oxides. DNA recovered using 1 M sodium phosphate buffer (PB) as a competitive desorptive wash was 15.22±2.33 µg DNA/g clay, with most DNA consisting of >20 Kb fragments, compared to 2.46±0.25 µg DNA/g clay with the Powerlyzer system (MoBio). Increasing PB concentration in the lysis reagent coincided with increasing DNA fragment length during initial extraction. Rarefaction plots of 16S rRNA (V1–V3 region) pyrosequencing from A-horizon and clay soils showed an ∼80% and ∼400% larger accessed diversity compared to the Powerlyzer soil DNA system, respectively. The observed diversity from the Firmicutes showed the strongest increase with >3-fold more operational taxonomic units (OTU) recovered. PMID:25033199

  20. Spiky gold shells on magnetic particles for DNA biosensors.

    Science.gov (United States)

    Bedford, Erin E; Boujday, Souhir; Pradier, Claire-Marie; Gu, Frank X

    2018-05-15

    Combined separation and detection of biomolecules has the potential to speed up and improve the sensitivity of disease detection, environmental testing, and biomolecular analysis. In this work, we synthesized magnetic particles coated with spiky nanostructured gold shells and used them to magnetically separate out and detect oligonucleotides using SERS. The distance dependence of the SERS signal was then harnessed to detect DNA hybridization using a Raman label bound to a hairpin probe. The distance of the Raman label from the surface increased upon complementary DNA hybridization, leading to a decrease in signal intensity. This work demonstrates the use of the particles for combined separation and detection of oligonucleotides without the use of an extrinsic tag or secondary hybridization step. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. Molecular analysis of Toxoplasma gondii Surface Antigen 1 (SAG1) gene cloned from Toxoplasma gondii DNA isolated from Javanese acute toxoplasmosis

    Science.gov (United States)

    Haryati, Sri; Agung Prasetyo, Afiono; Sari, Yulia; Dharmawan, Ruben

    2018-05-01

    Toxoplasma gondii Surface Antigen 1 (SAG1) is often used as a diagnostic tool due to its immunodominant-specific as antigen. However, data of the Toxoplasma gondii SAG1 protein from Indonesian isolate is limited. To study the protein, genomic DNA was isolated from a Javanese acute toxoplasmosis blood samples patient. A complete coding sequence of Toxoplasma gondii SAG1 was cloned and inserted into an Escherichia coli expression plasmid and sequenced. The sequencing results were subjected to bioinformatics analysis. The Toxoplasma gondii SAG1 complete coding sequences were successfully cloned. Physicochemical analysis revealed the 336 aa of SAG1 had 34.7 kDa of weight. The isoelectric point and aliphatic index were 8.4 and 78.4, respectively. The N-terminal methionine half-life in Escherichia coli was more than 10 hours. The antigenicity, secondary structure, and identification of the HLA binding motifs also had been discussed. The results of this study would contribute information about Toxoplasma gondii SAG1 and benefits for further works willing to develop diagnostic and therapeutic strategies against the parasite.

  2. Normalization constraint for variational bounds on fluid permeability

    International Nuclear Information System (INIS)

    Berryman, J.G.; Milton, G.W.

    1985-01-01

    A careful reexamination of the formulation of Prager's original variational principle for viscous flow through porous media has uncovered a subtle error in the normalization constraint on the trial functions. Although a certain surface integral of the true pressure field over the internal surface area always vanishes for isotropic materials, the corresponding surface integral for a given trial pressure field does not necessarily vanish but has nevertheless been previously neglected in the normalization. When this error is corrected, the form of the variational estimate is actually simpler than before and furthermore the resulting bounds have been shown to improve when the constant trial functions are used in either the two-point or three-point bounds

  3. Sensing Conformational Changes in DNA upon Ligand Binding Using QCM-D. Polyamine Condensation and Rad51 Extension of DNA Layers

    KAUST Repository

    Sun, Lu

    2014-10-16

    © 2014 American Chemical Society. Biosensors, in which binding of ligands is detected through changes in the optical or electrochemical properties of a DNA layer confined to the sensor surface, are important tools for investigating DNA interactions. Here, we investigate if conformational changes induced in surface-attached DNA molecules upon ligand binding can be monitored by the quartz crystal microbalance with dissipation (QCM-D) technique. DNA duplexes containing 59-184 base pairs were formed on QCM-D crystals by stepwise assembly of synthetic oligonucleotides of designed base sequences. The DNA films were exposed to the cationic polyamines spermidine and spermine, known to condense DNA molecules in bulk experiments, or to the recombination protein Rad51, known to extend the DNA helix. The binding and dissociation of the ligands to the DNA films were monitored in real time by measurements of the shifts in resonance frequency (Δf) and in dissipation (ΔD). The QCM-D data were analyzed using a Voigt-based model for the viscoelastic properties of polymer films in order to evaluate how the ligands affect thickness and shear viscosity of the DNA layer. Binding of spermine shrinks all DNA layers and increases their viscosity in a reversible fashion, and so does spermidine, but to a smaller extent, in agreement with its lower positive charge. SPR was used to measure the amount of bound polyamines, and when combined with QCM-D, the data indicate that the layer condensation leads to a small release of water from the highly hydrated DNA films. The binding of Rad51 increases the effective layer thickness of a 59bp film, more than expected from the know 50% DNA helix extension. The combined results provide guidelines for a QCM-D biosensor based on ligand-induced structural changes in DNA films. The QCM-D approach provides high discrimination between ligands affecting the thickness and the structural properties of the DNA layer differently. The reversibility of the film

  4. Capacity Bounds for Parallel Optical Wireless Channels

    KAUST Repository

    Chaaban, Anas; Rezki, Zouheir; Alouini, Mohamed-Slim

    2016-01-01

    A system consisting of parallel optical wireless channels with a total average intensity constraint is studied. Capacity upper and lower bounds for this system are derived. Under perfect channel-state information at the transmitter (CSIT), the bounds have to be optimized with respect to the power allocation over the parallel channels. The optimization of the lower bound is non-convex, however, the KKT conditions can be used to find a list of possible solutions one of which is optimal. The optimal solution can then be found by an exhaustive search algorithm, which is computationally expensive. To overcome this, we propose low-complexity power allocation algorithms which are nearly optimal. The optimized capacity lower bound nearly coincides with the capacity at high SNR. Without CSIT, our capacity bounds lead to upper and lower bounds on the outage probability. The outage probability bounds meet at high SNR. The system with average and peak intensity constraints is also discussed.

  5. VORONOI DIAGRAMS WITHOUT BOUNDING BOXES

    Directory of Open Access Journals (Sweden)

    E. T. K. Sang

    2015-10-01

    Full Text Available We present a technique for presenting geographic data in Voronoi diagrams without having to specify a bounding box. The method restricts Voronoi cells to points within a user-defined distance of the data points. The mathematical foundation of the approach is presented as well. The cell clipping method is particularly useful for presenting geographic data that is spread in an irregular way over a map, as for example the Dutch dialect data displayed in Figure 2. The automatic generation of reasonable cell boundaries also makes redundant a frequently used solution to this problem that requires data owners to specify region boundaries, as in Goebl (2010 and Nerbonne et al (2011.

  6. Spectral computations for bounded operators

    CERN Document Server

    Ahues, Mario; Limaye, Balmohan

    2001-01-01

    Exact eigenvalues, eigenvectors, and principal vectors of operators with infinite dimensional ranges can rarely be found. Therefore, one must approximate such operators by finite rank operators, then solve the original eigenvalue problem approximately. Serving as both an outstanding text for graduate students and as a source of current results for research scientists, Spectral Computations for Bounded Operators addresses the issue of solving eigenvalue problems for operators on infinite dimensional spaces. From a review of classical spectral theory through concrete approximation techniques to finite dimensional situations that can be implemented on a computer, this volume illustrates the marriage of pure and applied mathematics. It contains a variety of recent developments, including a new type of approximation that encompasses a variety of approximation methods but is simple to verify in practice. It also suggests a new stopping criterion for the QR Method and outlines advances in both the iterative refineme...

  7. BIOPHYSICAL PROPERTIES OF NUCLEIC ACIDS AT SURFACES RELEVANT TO MICROARRAY PERFORMANCE.

    Science.gov (United States)

    Rao, Archana N; Grainger, David W

    2014-04-01

    Both clinical and analytical metrics produced by microarray-based assay technology have recognized problems in reproducibility, reliability and analytical sensitivity. These issues are often attributed to poor understanding and control of nucleic acid behaviors and properties at solid-liquid interfaces. Nucleic acid hybridization, central to DNA and RNA microarray formats, depends on the properties and behaviors of single strand (ss) nucleic acids (e.g., probe oligomeric DNA) bound to surfaces. ssDNA's persistence length, radius of gyration, electrostatics, conformations on different surfaces and under various assay conditions, its chain flexibility and curvature, charging effects in ionic solutions, and fluorescent labeling all influence its physical chemistry and hybridization under assay conditions. Nucleic acid (e.g., both RNA and DNA) target interactions with immobilized ssDNA strands are highly impacted by these biophysical states. Furthermore, the kinetics, thermodynamics, and enthalpic and entropic contributions to DNA hybridization reflect global probe/target structures and interaction dynamics. Here we review several biophysical issues relevant to oligomeric nucleic acid molecular behaviors at surfaces and their influences on duplex formation that influence microarray assay performance. Correlation of biophysical aspects of single and double-stranded nucleic acids with their complexes in bulk solution is common. Such analysis at surfaces is not commonly reported, despite its importance to microarray assays. We seek to provide further insight into nucleic acid-surface challenges facing microarray diagnostic formats that have hindered their clinical adoption and compromise their research quality and value as genomics tools.

  8. DNA interactions with a Methylene Blue redox indicator depend on the DNA length and are sequence specific.

    Science.gov (United States)

    Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt V; Ferapontova, Elena E

    2010-06-01

    A DNA molecular beacon approach was used for the analysis of interactions between DNA and Methylene Blue (MB) as a redox indicator of a hybridization event. DNA hairpin structures of different length and guanine (G) content were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 5'-end. Binding of MB to the folded hairpin DNA was electrochemically studied and compared with binding to the duplex structure formed by hybridization of the hairpin DNA to a complementary DNA strand. Variation of the electrochemical signal from the DNA-MB complex was shown to depend primarily on the DNA length and sequence used: the G-C base pairs were the preferential sites of MB binding in the duplex. For short 20 nts long DNA sequences, the increased electrochemical response from MB bound to the duplex structure was consistent with the increased amount of bound and electrochemically readable MB molecules (i.e. MB molecules that are available for the electron transfer (ET) reaction with the electrode). With longer DNA sequences, the balance between the amounts of the electrochemically readable MB molecules bound to the hairpin DNA and to the hybrid was opposite: a part of the MB molecules bound to the long-sequence DNA duplex seem to be electrochemically mute due to long ET distance. The increasing electrochemical response from MB bound to the short-length DNA hybrid contrasts with the decreasing signal from MB bound to the long-length DNA hybrid and allows an "off"-"on" genosensor development.

  9. Specific mutations in the C-terminus domain of HBV surface antigen significantly correlate with low level of serum HBV-DNA in patients with chronic HBV infection

    NARCIS (Netherlands)

    Mirabelli, Carmen; Surdo, Matteo; van Hemert, Formijn; Lian, Zhichao; Salpini, Romina; Cento, Valeria; Cortese, Maria Francesca; Aragri, Marianna; Pollicita, Michela; Alteri, Claudia; Bertoli, Ada; Berkhout, Ben; Micheli, Valeria; Gubertini, Guido; Santoro, Maria Mercedes; Romano, Sara; Visca, Michela; Bernassola, Martina; Longo, Roberta; de Sanctis, Giuseppe Maria; Trimoulet, Pascal; Fleury, Hervè; Marino, Nicoletta; Mazzotta, Francesco; Cappiello, Giuseppina; Spanò, Alberto; Sarrecchia, Cesare; Zhang, Jing Maria; Andreoni, Massimo; Angelico, Mario; Verheyen, Jens; Perno, Carlo Federico; Svicher, Valentina

    2015-01-01

    Background: To define HBsAg-mutations correlated with different serum HBV-DNA levels in HBV chronically-infected drug-naive patients. Methods: This study included 187 patients stratified into the following ranges of serum HBV-DNA: 12-2000 IU/ml, 2000-100,000 IU/ml, and > 100,000 IU/ml.

  10. Method and apparatus for synthesis of arrays of DNA probes

    Science.gov (United States)

    Cerrina, Francesco; Sussman, Michael R.; Blattner, Frederick R.; Singh-Gasson, Sangeet; Green, Roland

    2002-04-23

    The synthesis of arrays of DNA probes sequences, polypeptides, and the like is carried out using a patterning process on an active surface of a substrate. An image is projected onto the active surface of the substrate utilizing an image former that includes a light source that provides light to a micromirror device comprising an array of electronically addressable micromirrors, each of which can be selectively tilted between one of at least two positions. Projection optics receives the light reflected from the micromirrors along an optical axis and precisely images the micromirrors onto the active surface of the substrate, which may be used to activate the surface of the substrate. The first level of bases may then be applied to the substrate, followed by development steps, and subsequent exposure of the substrate utilizing a different pattern of micromirrors, with further repeats until the elements of a two dimensional array on the substrate surface have an appropriate base bound thereto. The micromirror array can be controlled in conjunction with a DNA synthesizer supplying appropriate reagents to a flow cell containing the active substrate to control the sequencing of images presented by the micromirror array in coordination of the reagents provided to the substrate.

  11. Variation in a surface-exposed region of the Mycoplasma pneumoniae P40 protein as a consequence of homologous DNA recombination between RepMP5 elements.

    Science.gov (United States)

    Spuesens, Emiel B M; van de Kreeke, Nick; Estevão, Silvia; Hoogenboezem, Theo; Sluijter, Marcel; Hartwig, Nico G; van Rossum, Annemarie M C; Vink, Cornelis

    2011-02-01

    Mycoplasma pneumoniae is a human pathogen that causes a range of respiratory tract infections. The first step in infection is adherence of the bacteria to the respiratory epithelium. This step is mediated by a specialized organelle, which contains several proteins (cytadhesins) that have an important function in adherence. Two of these cytadhesins, P40 and P90, represent the proteolytic products from a single 130 kDa protein precursor, which is encoded by the MPN142 gene. Interestingly, MPN142 contains a repetitive DNA element, termed RepMP5, of which homologues are found at seven other loci within the M. pneumoniae genome. It has been hypothesized that these RepMP5 elements, which are similar but not identical in sequence, recombine with their counterpart within MPN142 and thereby provide a source of sequence variation for this gene. As this variation may give rise to amino acid changes within P40 and P90, the recombination between RepMP5 elements may constitute the basis of antigenic variation and, possibly, immune evasion by M. pneumoniae. To investigate the sequence variation of MPN142 in relation to inter-RepMP5 recombination, we determined the sequences of all RepMP5 elements in a collection of 25 strains. The results indicate that: (i) inter-RepMP5 recombination events have occurred in seven of the strains, and (ii) putative RepMP5 recombination events involving MPN142 have induced amino acid changes in a surface-exposed part of the P40 protein in two of the strains. We conclude that recombination between RepMP5 elements is a common phenomenon that may lead to sequence variation of MPN142-encoded proteins.

  12. Tethered particle analysis of supercoiled circular DNA using peptide nucleic acid handles

    DEFF Research Database (Denmark)

    Norregaard, Kamilla; Andersson, Magnus; Nielsen, Peter Eigil

    2014-01-01

    This protocol describes how to monitor individual naturally supercoiled circular DNA plasmids bound via peptide nucleic acid (PNA) handles between a bead and a surface. The protocol was developed for single-molecule investigation of the dynamics of supercoiled DNA, and it allows the investigation...... of both the dynamics of the molecule itself and of its interactions with a regulatory protein. Two bis-PNA clamps designed to bind with extremely high affinity to predetermined homopurine sequence sites in supercoiled DNA are prepared: one conjugated with digoxigenin for attachment to an anti......-digoxigenin-coated glass cover slide, and one conjugated with biotin for attachment to a submicron-sized streptavidin-coated polystyrene bead. Plasmids are constructed, purified and incubated with the PNA handles. The dynamics of the construct is analyzed by tracking the tethered bead using video microscopy: less...

  13. Enzyme-enhanced fluorescence detection of DNA on etched optical fibers.

    Science.gov (United States)

    Niu, Shu-yan; Li, Quan-yi; Ren, Rui; Zhang, Shu-sheng

    2009-05-15

    A novel DNA biosensor based on enzyme-enhanced fluorescence detection on etched optical fibers was developed. The hybridization complex of DNA probe and biotinylated target was formed on the etched optical fiber, and was then bound with streptavidin labeled horseradish peroxidase (streptavidin-HRP). The target DNA was quantified through the fluorescent detection of bi-p,p'-4-hydroxyphenylacetic acid (DBDA) generated from the substrate 4-hydroxyphenylacetic acid (p-HPA) under the catalysis of HRP, with a detection limit of 1 pM and a linear range from 1.69 pM to 169 pM. It is facile to regenerate this sensor through surface treatment with concentrated urea solution. It was discovered that the sensor can retain 70% of its original activity after three detection-regeneration cycles.

  14. Instanton bound states in ABJM theory

    Energy Technology Data Exchange (ETDEWEB)

    Hatsuda, Yasuyuki [DESY Hamburg (Germany). Theory Group; Tokyo Institute of Technology (Japan). Dept. of Physics; Moriyama, Sanefumi [Nagoya Univ. (Japan). Kobayashi Maskawa Inst. and Graduate School of Mathematics; Okuyama, Kazumi [Shinshu Univ., Matsumoto, Nagano (Japan). Dept. of Physics

    2013-06-15

    The partition function of the ABJM theory receives non-perturbative corrections due to instanton effects. We study these non-perturbative corrections, including bound states of worldsheet instantons and membrane instantons, in the Fermi-gas approach. We require that the total non-perturbative correction should be always finite for arbitrary Chern-Simons level. This finiteness is realized quite non-trivially because each bound state contribution naively diverges at some levels. The poles of each contribution should be canceled out in total. We use this pole cancellation mechanism to find unknown bound state corrections from known ones. We conjecture a general expression of the bound state contribution. Summing up all the bound state contributions, we find that the effect of bound states is simply incorporated into the worldsheet instanton correction by a redefinition of the chemical potential in the Fermi-gas system. Analytic expressions of the 3- and 4-membrane instanton corrections are also proposed.

  15. DNA-based machines.

    Science.gov (United States)

    Wang, Fuan; Willner, Bilha; Willner, Itamar

    2014-01-01

    The base sequence in nucleic acids encodes substantial structural and functional information into the biopolymer. This encoded information provides the basis for the tailoring and assembly of DNA machines. A DNA machine is defined as a molecular device that exhibits the following fundamental features. (1) It performs a fuel-driven mechanical process that mimics macroscopic machines. (2) The mechanical process requires an energy input, "fuel." (3) The mechanical operation is accompanied by an energy consumption process that leads to "waste products." (4) The cyclic operation of the DNA devices, involves the use of "fuel" and "anti-fuel" ingredients. A variety of DNA-based machines are described, including the construction of "tweezers," "walkers," "robots," "cranes," "transporters," "springs," "gears," and interlocked cyclic DNA structures acting as reconfigurable catenanes, rotaxanes, and rotors. Different "fuels", such as nucleic acid strands, pH (H⁺/OH⁻), metal ions, and light, are used to trigger the mechanical functions of the DNA devices. The operation of the devices in solution and on surfaces is described, and a variety of optical, electrical, and photoelectrochemical methods to follow the operations of the DNA machines are presented. We further address the possible applications of DNA machines and the future perspectives of molecular DNA devices. These include the application of DNA machines as functional structures for the construction of logic gates and computing, for the programmed organization of metallic nanoparticle structures and the control of plasmonic properties, and for controlling chemical transformations by DNA machines. We further discuss the future applications of DNA machines for intracellular sensing, controlling intracellular metabolic pathways, and the use of the functional nanostructures for drug delivery and medical applications.

  16. Bounded elements in Locally C*-algebras

    International Nuclear Information System (INIS)

    El Harti, Rachid

    2001-09-01

    In order to get more useful information about Locally C*-algebras, we introduce in this paper the notion of bounded elements. First, we study the connection between bounded elements and spectrally bounded elements. Some structural results of Locally C*-algebras are established in Theorems 1 , 2 and 3. As an immediate consequence of Theorem 3, we give a characterization of the connected component of the identity in the group of unitary elements for a Locally C*-algebra. (author)

  17. Fuzzy upper bounds and their applications

    Energy Technology Data Exchange (ETDEWEB)

    Soleimani-damaneh, M. [Department of Mathematics, Faculty of Mathematical Science and Computer Engineering, Teacher Training University, 599 Taleghani Avenue, Tehran 15618 (Iran, Islamic Republic of)], E-mail: soleimani_d@yahoo.com

    2008-04-15

    This paper considers the concept of fuzzy upper bounds and provides some relevant applications. Considering a fuzzy DEA model, the existence of a fuzzy upper bound for the objective function of the model is shown and an effective approach to solve that model is introduced. Some dual interpretations are provided, which are useful for practical purposes. Applications of the concept of fuzzy upper bounds in two physical problems are pointed out.

  18. Bounded cohomology of discrete groups

    CERN Document Server

    Frigerio, Roberto

    2017-01-01

    The author manages a near perfect equilibrium between necessary technicalities (always well motivated) and geometric intuition, leading the readers from the first simple definition to the most striking applications of the theory in 13 very pleasant chapters. This book can serve as an ideal textbook for a graduate topics course on the subject and become the much-needed standard reference on Gromov's beautiful theory. -Michelle Bucher The theory of bounded cohomology, introduced by Gromov in the late 1980s, has had powerful applications in geometric group theory and the geometry and topology of manifolds, and has been the topic of active research continuing to this day. This monograph provides a unified, self-contained introduction to the theory and its applications, making it accessible to a student who has completed a first course in algebraic topology and manifold theory. The book can be used as a source for research projects for master's students, as a thorough introduction to the field for graduate student...

  19. Some Improved Nonperturbative Bounds for Fermionic Expansions

    Energy Technology Data Exchange (ETDEWEB)

    Lohmann, Martin, E-mail: marlohmann@gmail.com [Universita di Roma Tre, Dipartimento di Matematica (Italy)

    2016-06-15

    We reconsider the Gram-Hadamard bound as it is used in constructive quantum field theory and many body physics to prove convergence of Fermionic perturbative expansions. Our approach uses a recursion for the amplitudes of the expansion, discovered in a model problem by Djokic (2013). It explains the standard way to bound the expansion from a new point of view, and for some of the amplitudes provides new bounds, which avoid the use of Fourier transform, and are therefore superior to the standard bounds for models like the cold interacting Fermi gas.

  20. Quantitative characterization of conformational-specific protein-DNA binding using a dual-spectral interferometric imaging biosensor

    Science.gov (United States)

    Zhang, Xirui; Daaboul, George G.; Spuhler, Philipp S.; Dröge, Peter; Ünlü, M. Selim

    2016-03-01

    results of other DNA sequences (Table 2S); calculation of dissociation constants (Fig. 3S, 4S; Table 2S); geometric model for quantitation of DNA bending angle induced by specific IHF binding (Fig. 4S); customized flow cell assembly (Fig. 5S); real-time measurement of average fluorophore height change by SSFM (Fig. 6S); summary of binding parameters obtained from additive isotherm model fitting (Table 3S); average surface densities of 10 dsDNA spots and bound IHF at equilibrium (Table 4S); effects of surface densities on the binding and bending of dsDNA (Tables 5S, 6S and Fig. 7S-10S). See DOI: 10.1039/c5nr06785e

  1. Chromatin-bound RNA and the neurobiology of psychiatric disease.

    Science.gov (United States)

    Tushir, J S; Akbarian, S

    2014-04-04

    A large, and still rapidly expanding literature on epigenetic regulation in the nervous system has provided fundamental insights into the dynamic regulation of DNA methylation and post-translational histone modifications in the context of neuronal plasticity in health and disease. Remarkably, however, very little is known about the potential role of chromatin-bound RNAs, including many long non-coding transcripts and various types of small RNAs. Here, we provide an overview on RNA-mediated regulation of chromatin structure and function, with focus on histone lysine methylation and psychiatric disease. Examples of recently discovered chromatin-bound long non-coding RNAs important for neuronal health and function include the brain-derived neurotrophic factor antisense transcript (Bdnf-AS) which regulates expression of the corresponding sense transcript, and LOC389023 which is associated with human-specific histone methylation signatures at the chromosome 2q14.1 neurodevelopmental risk locus by regulating expression of DPP10, an auxillary subunit for voltage-gated K(+) channels. We predict that the exploration of chromatin-bound RNA will significantly advance our current knowledge base in neuroepigenetics and biological psychiatry. Copyright © 2013 IBRO. Published by Elsevier Ltd. All rights reserved.

  2. Radiation-induced DNA damage as a function of DNA hydration

    International Nuclear Information System (INIS)

    Swarts, S.G.; Miao, L.; Wheeler, K.T.; Sevilla, M.D.; Becker, D.

    1995-01-01

    Radiation-induced DNA damage is produced from the sum of the radicals generated by the direct ionization of the DNA (direct effect) and by the reactions of the DNA with free radicals formed in the surrounding environment (indirect effect). The indirect effect has been believed to be the predominant contributor to radiation-induced intracellular DNA damage, mainly as the result of reactions of bulk water radicals (e.g., OH·) with DNA. However, recent evidence suggests that DNA damage, derived from the irradiation of water molecules that are tightly bound in the hydration layer, may occur as the result of the transfer of electron-loss centers (e.g. holes) and electrons from these water molecules to the DNA. Since this mechanism for damaging DNA more closely parallels that of the direct effect, the irradiation of these tightly bound water molecules may contribute to a quasi-direct effect. These water molecules comprise a large fraction of the water surrounding intracellular DNA and could account for a significant proportion of intracellular radiation-induced DNA damage. Consequently, the authors have attempted to characterize this quasi-direct effect to determine: (1) the extent of the DNA hydration layer that is involved with this effect, and (2) what influence this effect has on the types and quantities of radiation-induced DNA damage

  3. Variational lower bound on the scattering length

    International Nuclear Information System (INIS)

    Rosenberg, L.; Spruch, L.

    1975-01-01

    The scattering length A characterizes the zero-energy scattering of one system by another. It was shown some time ago that a variational upper bound on A could be obtained using methods, of the Rayleigh-Ritz type, which are commonly employed to obtain upper bounds on energy eigenvalues. Here we formulate a method for obtaining a variational lower bound on A. Once again the essential idea is to express the scattering length as a variational estimate plus an error term and then to reduce the problem of bounding the error term to one involving bounds on energy eigenvalues. In particular, the variational lower bound on A is rigorously established provided a certin modified Hamiltonian can be shown to have no discrete states lying below the level of the continuum threshold. It is unfortunately true that necessary conditions for the existence of bound states are not available for multiparticle systems in general. However, in the case of positron-atom scattering the adiabatic approximation can be introduced as an (essentially) solvable comparison problem to rigorously establish the nonexistence of bound states of the modified Hamiltonian. It has recently been shown how the validity of the variational upper bound on A can be maintained when the target ground-state wave function is imprecisely known. Similar methods can be used to maintain the variational lower bound on A. Since the bound is variational, the error in the calculated scattering length will be of second order in the error in the wave function. The use of the adiabatic approximation in the present context places no limitation in principle on the accuracy achievable

  4. Dynamics of water bound to crystalline cellulose

    Energy Technology Data Exchange (ETDEWEB)

    O’Neill, Hugh; Pingali, Sai Venkatesh; Petridis, Loukas; He, Junhong; Mamontov, Eugene; Hong, Liang; Urban, Volker; Evans, Barbara; Langan, Paul; Smith, Jeremy C.; Davison, Brian H.

    2017-09-19

    Interactions of water with cellulose are of both fundamental and technological importance. Here, we characterize the properties of water associated with cellulose using deuterium labeling, neutron scattering and molecular dynamics simulation. Quasi-elastic neutron scattering provided quantitative details about the dynamical relaxation processes that occur and was supported by structural characterization using small-angle neutron scattering and X-ray diffraction. We can unambiguously detect two populations of water associated with cellulose. The first is “non-freezing bound” water that gradually becomes mobile with increasing temperature and can be related to surface water. The second population is consistent with confined water that abruptly becomes mobile at ~260 K, and can be attributed to water that accumulates in the narrow spaces between the microfibrils. Quantitative analysis of the QENS data showed that, at 250 K, the water diffusion coefficient was 0.85 ± 0.04 × 10-10 m2sec-1 and increased to 1.77 ± 0.09 × 10-10 m2sec-1 at 265 K. MD simulations are in excellent agreement with the experiments and support the interpretation that water associated with cellulose exists in two dynamical populations. Our results provide clarity to previous work investigating the states of bound water and provide a new approach for probing water interactions with lignocellulose materials.

  5. Torsional regulation of hRPA-induced unwinding of double-stranded DNA

    NARCIS (Netherlands)

    De Vlaminck, I.; Vidic, I.; Van Loenhout, M.T.J.; Kanaar, R.; Lebbink, J.H.G.; Dekker, C.

    2010-01-01

    All cellular single-stranded (ss) DNA is rapidly bound and stabilized by single stranded DNA-binding proteins (SSBs). Replication protein A, the main eukaryotic SSB, is able to unwind double-stranded (ds) DNA by binding and stabilizing transiently forming bubbles of ssDNA. Here, we study the

  6. Stacked spheres and lower bound theorem

    Indian Academy of Sciences (India)

    BASUDEB DATTA

    2011-11-20

    Nov 20, 2011 ... Preliminaries. Lower bound theorem. On going work. Definitions. An n-simplex is a convex hull of n + 1 affinely independent points. (called vertices) in some Euclidean space R. N . Stacked spheres and lower bound theorem. Basudeb Datta. Indian Institute of Science. 2 / 27 ...

  7. A strongly quasiconvex PAC-Bayesian bound

    DEFF Research Database (Denmark)

    Thiemann, Niklas; Igel, Christian; Wintenberger, Olivier

    2017-01-01

    We propose a new PAC-Bayesian bound and a way of constructing a hypothesis space, so that the bound is convex in the posterior distribution and also convex in a trade-off parameter between empirical performance of the posterior distribution and its complexity. The complexity is measured by the Ku...

  8. On the range of completely bounded maps

    Directory of Open Access Journals (Sweden)

    Richard I. Loebl

    1978-01-01

    Full Text Available It is shown that if every bounded linear map from a C*-algebra α to a von Neumann algebra β is completely bounded, then either α is finite-dimensional or β⫅⊗Mn, where is a commutative von Neumann algebra and Mn is the algebra of n×n complex matrices.

  9. Bounds in the location-allocation problem

    DEFF Research Database (Denmark)

    Juel, Henrik

    1981-01-01

    Develops a family of stronger lower bounds on the objective function value of the location-allocation problem. Solution methods proposed to solve problems in location-allocation; Efforts to develop a more efficient bound solution procedure; Determination of the locations of the sources....

  10. Experimental evidence for bounds on quantum correlations.

    Science.gov (United States)

    Bovino, F A; Castagnoli, G; Degiovanni, I P; Castelletto, S

    2004-02-13

    We implemented the experiment proposed by Cabello in the preceding Letter to test the bounds of quantum correlation. As expected from the theory we found that, for certain choices of local observables, Tsirelson's bound of the Clauser-Horne-Shimony-Holt inequality (2 x square root of 2) is not reached by any quantum states.

  11. Exponential Lower Bounds For Policy Iteration

    OpenAIRE

    Fearnley, John

    2010-01-01

    We study policy iteration for infinite-horizon Markov decision processes. It has recently been shown policy iteration style algorithms have exponential lower bounds in a two player game setting. We extend these lower bounds to Markov decision processes with the total reward and average-reward optimality criteria.

  12. Conductivity bound from dirty black holes

    Energy Technology Data Exchange (ETDEWEB)

    Bitaghsir Fadafan, Kazem, E-mail: bitaghsir@shahroodut.ac.ir

    2016-11-10

    We propose a lower bound of the dc electrical conductivity in strongly disordered, strongly interacting quantum field theories using holography. We study linear response of black holes with broken translational symmetry in Einstein–Maxwell-dilaton theories of gravity. Using the generalized Stokes equations at the horizon, we derive the lower bound of the electrical conductivity for the dual two dimensional disordered field theory.

  13. No-arbitrage bounds for financial scenarios

    DEFF Research Database (Denmark)

    Geyer, Alois; Hanke, Michael; Weissensteiner, Alex

    2014-01-01

    We derive no-arbitrage bounds for expected excess returns to generate scenarios used in financial applications. The bounds allow to distinguish three regions: one where arbitrage opportunities will never exist, a second where arbitrage may be present, and a third, where arbitrage opportunities...

  14. Spectroscopic evaluation of surface-bound cadmium on algal microorganisms

    International Nuclear Information System (INIS)

    Majidi, V.; Laude, D.A.; Holcombe, J.A.

    1989-01-01

    Several species of algae have been employed for preconcentration of metals from aqueous solutions. In all cases it is postulated that these organisms achieve preconcentration by using the active sites present on the cell walls. Some authors have indicated the possible existence of multiple active sites, which are responsible for multiple adsorption mechanisms observed in many algae species. Although a wide range of functional groups have been suggested as the means for binding, the identity and chemical environment of these active sites remains unknown. In the present study the metal adsorption process for these microorganisms is investigated with the use of Fourier transform nuclear magnetic resonance. In particular, this research is focused on adsorption of cadmium by a pure strain of algae (Stichococcus bacillaris). Initial experiments have indicated that as the pH of the solution changes, not only is the adsorption efficiency changed, but also a chemical shift for the adsorbed species is observed, suggesting major changes in the chemical environment of the active sites. Some of the topics discussed in detail include: competitive binding of various cations; the effect of anions; the effect of complexing ligands; the chemical nature of active sites; and the reversibility of adsorption process

  15. Surface-bounded growth modeling applied to human mandibles

    DEFF Research Database (Denmark)

    Andresen, Per Rønsholt

    1999-01-01

    This thesis presents mathematical and computational techniques for three dimensional growth modeling applied to human mandibles. The longitudinal shape changes make the mandible a complex bone. The teeth erupt and the condylar processes change direction, from pointing predominantly backward...... of the common features. 3.model the process that moves the matched points (growth modeling). A local shape feature called crest line has shown itself to be structurally stable on mandibles. Registration of crest lines (from different mandibles) results in a sparse deformation field, which must be interpolated...... old mandible based on the 3 month old scan. When using successively more recent scans as basis for the model the error drops to 2.0 mm for the 11 years old scan. Thus, it seems reasonable to assume that the mandibular growth is linear....

  16. Surface-bounded growth modeling applied to human mandibles

    DEFF Research Database (Denmark)

    Andresen, Per Rønsholt; Brookstein, F. L.; Conradsen, Knut

    2000-01-01

    From a set of longitudinal three-dimensional scans of the same anatomical structure, the authors have accurately modeled the temporal shape and size changes using a linear shape model. On a total of 31 computed tomography scans of the mandible from six patients, 14,851 semilandmarks are found...

  17. SHARP ENTRYWISE PERTURBATION BOUNDS FOR MARKOV CHAINS.

    Science.gov (United States)

    Thiede, Erik; VAN Koten, Brian; Weare, Jonathan

    For many Markov chains of practical interest, the invariant distribution is extremely sensitive to perturbations of some entries of the transition matrix, but insensitive to others; we give an example of such a chain, motivated by a problem in computational statistical physics. We have derived perturbation bounds on the relative error of the invariant distribution that reveal these variations in sensitivity. Our bounds are sharp, we do not impose any structural assumptions on the transition matrix or on the perturbation, and computing the bounds has the same complexity as computing the invariant distribution or computing other bounds in the literature. Moreover, our bounds have a simple interpretation in terms of hitting times, which can be used to draw intuitive but rigorous conclusions about the sensitivity of a chain to various types of perturbations.

  18. New bounds on isotropic Lorentz violation

    International Nuclear Information System (INIS)

    Carone, Christopher D.; Sher, Marc; Vanderhaeghen, Marc

    2006-01-01

    Violations of Lorentz invariance that appear via operators of dimension four or less are completely parametrized in the Standard Model Extension (SME). In the pure photonic sector of the SME, there are 19 dimensionless, Lorentz-violating parameters. Eighteen of these have experimental upper bounds ranging between 10 -11 and 10 -32 ; the remaining parameter, k-tilde tr , is isotropic and has a much weaker bound of order 10 -4 . In this Brief Report, we point out that k-tilde tr gives a significant contribution to the anomalous magnetic moment of the electron and find a new upper bound of order 10 -8 . With reasonable assumptions, we further show that this bound may be improved to 10 -14 by considering the renormalization of other Lorentz-violating parameters that are more tightly constrained. Using similar renormalization arguments, we also estimate bounds on Lorentz-violating parameters in the pure gluonic sector of QCD

  19. Covariant entropy bound and loop quantum cosmology

    International Nuclear Information System (INIS)

    Ashtekar, Abhay; Wilson-Ewing, Edward

    2008-01-01

    We examine Bousso's covariant entropy bound conjecture in the context of radiation filled, spatially flat, Friedmann-Robertson-Walker models. The bound is violated near the big bang. However, the hope has been that quantum gravity effects would intervene and protect it. Loop quantum cosmology provides a near ideal setting for investigating this issue. For, on the one hand, quantum geometry effects resolve the singularity and, on the other hand, the wave function is sharply peaked at a quantum corrected but smooth geometry, which can supply the structure needed to test the bound. We find that the bound is respected. We suggest that the bound need not be an essential ingredient for a quantum gravity theory but may emerge from it under suitable circumstances.

  20. Modeling DNA

    Science.gov (United States)

    Robertson, Carol

    2016-01-01

    Deoxyribonucleic acid (DNA) is life's most amazing molecule. It carries the genetic instructions that almost every organism needs to develop and reproduce. In the human genome alone, there are some three billion DNA base pairs. The most difficult part of teaching DNA structure, however, may be getting students to visualize something as small as a…

  1. BIOPHYSICAL PROPERTIES OF NUCLEIC ACIDS AT SURFACES RELEVANT TO MICROARRAY PERFORMANCE

    Science.gov (United States)

    Rao, Archana N.; Grainger, David W.

    2014-01-01

    Both clinical and analytical metrics produced by microarray-based assay technology have recognized problems in reproducibility, reliability and analytical sensitivity. These issues are often attributed to poor understanding and control of nucleic acid behaviors and properties at solid-liquid interfaces. Nucleic acid hybridization, central to DNA and RNA microarray formats, depends on the properties and behaviors of single strand (ss) nucleic acids (e.g., probe oligomeric DNA) bound to surfaces. ssDNA’s persistence length, radius of gyration, electrostatics, conformations on different surfaces and under various assay conditions, its chain flexibility and curvature, charging effects in ionic solutions, and fluorescent labeling all influence its physical chemistry and hybridization under assay conditions. Nucleic acid (e.g., both RNA and DNA) target interactions with immobilized ssDNA strands are highly impacted by these biophysical states. Furthermore, the kinetics, thermodynamics, and enthalpic and entropic contributions to DNA hybridization reflect global probe/target structures and interaction dynamics. Here we review several biophysical issues relevant to oligomeric nucleic acid molecular behaviors at surfaces and their influences on duplex formation that influence microarray assay performance. Correlation of biophysical aspects of single and double-stranded nucleic acids with their complexes in bulk solution is common. Such analysis at surfaces is not commonly reported, despite its importance to microarray assays. We seek to provide further insight into nucleic acid-surface challenges facing microarray diagnostic formats that have hindered their clinical adoption and compromise their research quality and value as genomics tools. PMID:24765522

  2. An exploration of sequence specific DNA-duplex/pyrene interactions for intercalated and surface-associated pyrene species. Final report, May 1, 1993--December 31, 1996

    Energy Technology Data Exchange (ETDEWEB)

    Netzel, T.L.

    1997-03-01

    The broad objective of this DOE sponsored work on photoinduced electron transfer (ET) within covalently modified DNA was to learn about the rates of Et among various DNA bases and commonly used organic electron donor (D) and acceptor (A) molecules. This hypothesis driven, multidisciplinary project combined skills in modified nucleic acid synthesis and in continuous and time-resolved optical spectroscopies. Covalently modified DNA chemistry as investigated in this program had two specific long term goals. The first was to use experimental and theoretical insights into the mechanisms of electron transfer (ET) reactions to design supramolecular assemblies of redox-active chromophores that function as efficient vectorial ET engines. The second was to construct oligonucleotide probes for real-time monitoring of intracellular processes involving DNA and RNA such as m-RNA expression and translocation. This research project laid the groundwork for studying ET reactions within DNA duplexes by examining the photophysics of uridine nucleosides which are covalently labeled at the 5-position with 1-pyrenyl chromophores.

  3. Development of a combined surface plasmon resonance/surface acoustic wave device for the characterization of biomolecules

    International Nuclear Information System (INIS)

    Bender, Florian; Tsortos, Achilleas; Papadakis, George; Gizeli, Electra; Roach, Paul; Newton, Michael I; McHale, Glen

    2009-01-01

    It is known that acoustic sensor devices, if operated in liquid phase, are sensitive not just to the mass of the analyte but also to various other parameters, such as size, shape, charge and elastic constants of the analyte as well as bound and viscously entrained water. This can be used to extract valuable information about a biomolecule, particularly if the acoustic device is combined with another sensor element which is sensitive to the mass or amount of analyte only. The latter is true in good approximation for various optical sensor techniques. This work reports on the development of a combined surface plasmon resonance/surface acoustic wave sensor system which is designed for the investigation of biomolecules such as proteins or DNA. Results for the deposition of neutravidin and DNA are reported

  4. DNA damage, homology-directed repair, and DNA methylation.

    Directory of Open Access Journals (Sweden)

    Concetta Cuozzo

    2007-07-01

    Full Text Available To explore the link between DNA damage and gene silencing, we induced a DNA double-strand break in the genome of Hela or mouse embryonic stem (ES cells using I-SceI restriction endonuclease. The I-SceI site lies within one copy of two inactivated tandem repeated green fluorescent protein (GFP genes (DR-GFP. A total of 2%-4% of the cells generated a functional GFP by homology-directed repair (HR and gene conversion. However, approximately 50% of these recombinants expressed GFP poorly. Silencing was rapid and associated with HR and DNA methylation of the recombinant gene, since it was prevented in Hela cells by 5-aza-2'-deoxycytidine. ES cells deficient in DNA methyl transferase 1 yielded as many recombinants as wild-type cells, but most of these recombinants expressed GFP robustly. Half of the HR DNA molecules were de novo methylated, principally downstream to the double-strand break, and half were undermethylated relative to the uncut DNA. Methylation of the repaired gene was independent of the methylation status of the converting template. The methylation pattern of recombinant molecules derived from pools of cells carrying DR-GFP at different loci, or from an individual clone carrying DR-GFP at a single locus, was comparable. ClustalW analysis of the sequenced GFP molecules in Hela and ES cells distinguished recombinant and nonrecombinant DNA solely on the basis of their methylation profile and indicated that HR superimposed novel methylation profiles on top of the old patterns. Chromatin immunoprecipitation and RNA analysis revealed that DNA methyl transferase 1 was bound specifically to HR GFP DNA and that methylation of the repaired segment contributed to the silencing of GFP expression. Taken together, our data support a mechanistic link between HR and DNA methylation and suggest that DNA methylation in eukaryotes marks homologous recombined segments.

  5. Mediated Electron Transfer at Vertically Aligned Single-Walled Carbon Nanotube Electrodes During Detection of DNA Hybridization

    Science.gov (United States)

    Wallen, Rachel; Gokarn, Nirmal; Bercea, Priscila; Grzincic, Elissa; Bandyopadhyay, Krisanu

    2015-06-01

    Vertically aligned single-walled carbon nanotube (VASWCNT) assemblies are generated on cysteamine and 2-mercaptoethanol (2-ME)-functionalized gold surfaces through amide bond formation between carboxylic groups generated at the end of acid-shortened single-walled carbon nanotubes (SWCNTs) and amine groups present on the gold surfaces. Atomic force microscopy (AFM) imaging confirms the vertical alignment mode of SWCNT attachment through significant changes in surface roughness compared to bare gold surfaces and the lack of any horizontally aligned SWCNTs present. These SWCNT assemblies are further modified with an amine-terminated single-stranded probe-DNA. Subsequent hybridization of the surface-bound probe-DNA in the presence of complementary strands in solution is followed using impedance measurements in the presence of Fe(CN)6 3-/4- as the redox probe in solution, which show changes in the interfacial electrochemical properties, specifically the charge-transfer resistance, due to hybridization. In addition, hybridization of the probe-DNA is also compared when it is attached directly to the gold surfaces without any intermediary SWCNTs. Contrary to our expectations, impedance measurements show a decrease in charge-transfer resistance with time due to hybridization with 300 nM complementary DNA in solution with the probe-DNA attached to SWCNTs. In contrast, an increase in charge-transfer resistance is observed with time during hybridization when the probe-DNA is attached directly to the gold surfaces. The decrease in charge-transfer resistance during hybridization in the presence of VASWCNTs indicates an enhancement in the electron transfer process of the redox probe at the VASWCNT-modified electrode. The results suggest that VASWCNTs are acting as mediators of electron transfer, which facilitate the charge transfer of the redox probe at the electrode-solution interface.

  6. Pluto's Paleoglaciation: Processes and Bounds.

    Science.gov (United States)

    Umurhan, O. M.; Howard, A. D.; White, O. L.; Moore, J. M.; Grundy, W. M.; Schenk, P.; Beyer, R. A.; McKinnon, W. B.; Singer, K. N.; Lauer, T.; Cheng, A. F.; Stern, A.; Weaver, H. A., Jr.; Young, L. A.; Ennico Smith, K.; Olkin, C.

    2017-12-01

    New Horizons imaging of Pluto's surface shows eroded landscapes reminiscent of assorted glaciated terrains found on the Earth such as alpine valleys, dendritic networks and others. For example, LORRI imaging of fluted craters show radially oriented ridging which also resembles Pluto's washboard terrain. Digital elevation modeling indicates that these down-gradient oriented ridges are about 3-4 km spaced apart with depths ranging from 0.2-0.5 km. Present day glaciation on Pluto is characterized by moving N2 ice blocks presumably riding over a H2O ice bedrock substrate. Assuming Pluto's ancient surface was sculpted by N2 glaciation, what remains a mystery is the specific nature of the glacial erosion mechanism(s) responsible for the observed features. To better resolve this puzzle, we perform landform evolution modeling of several glacial erosion processes known from terrestrial H2O ice glaciation studies. These terrestrial processes, which depend upon whether or not the glacier's base is wet or dry, include quarrying/plucking and fluvial erosion. We also consider new erosional processes (to be described in this presentation) which are unique to the highly insulating character of solid N2 including both phase change induced hydrofracture and geothermally driven basal melt. Until improvements in our knowledge of solid N2's rheology are made available (including its mechanical behavior as a binary/trinary mixture of CH4 and CO), it is difficult to assess with high precision which of the aforementioned erosion mechanisms are responsible for the observed surface etchings. Nevertheless, we consider a model crater surface and examine its erosional development due to flowing N2 glacial ice as built up over time according to N2 deposition rates based on GCM modeling of Pluto's ancient atmosphere. For given erosional mechanism our aim is to determine the permissible ranges of model input parameters (e.g., ice strength, flow rates, grain sizes, quarrying rates, etc.) that best

  7. Multiple conformational states of DnaA protein regulate its interaction with DnaA boxes in the initiation of DNA replication.

    Science.gov (United States)

    Patel, Meera J; Bhatia, Lavesh; Yilmaz, Gulden; Biswas-Fiss, Esther E; Biswas, Subhasis B

    2017-09-01

    DnaA protein is the initiator of genomic DNA replication in prokaryotes. It binds to specific DNA sequences in the origin of DNA replication and unwinds small AT-rich sequences downstream for the assembly of the replisome. The mechanism of activation of DnaA that enables it to bind and organize the origin DNA and leads to replication initiation remains unclear. In this study, we have developed double-labeled fluorescent DnaA probes to analyze conformational states of DnaA protein upon binding DNA, nucleotide, and Soj sporulation protein using Fluorescence Resonance Energy Transfer (FRET). Our studies demonstrate that DnaA protein undergoes large conformational changes upon binding to substrates and there are multiple distinct conformational states that enable it to initiate DNA replication. DnaA protein adopted a relaxed conformation by expanding ~15Å upon binding ATP and DNA to form the ATP·DnaA·DNA complex. Hydrolysis of bound ATP to ADP led to a contraction of DnaA within the complex. The relaxed conformation of DnaA is likely required for the formation of the multi-protein ATP·DnaA·DNA complex. In the initiation of sporulation, Soj binding to DnaA prevented relaxation of its conformation. Soj·ADP appeared to block the activation of DnaA, suggesting a mechanism for Soj·ADP in switching initiation of DNA replication to sporulation. Our studies demonstrate that multiple conformational states of DnaA protein regulate its binding to DNA in the initiation of DNA replication. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Eggshell membrane: A natural substrate for immobilization and detection of DNA

    Energy Technology Data Exchange (ETDEWEB)

    Ray, Preetam Guha; Roy, Somenath, E-mail: sroy@cgcri.res.in

    2016-02-01

    Chemically modified eggshell membranes (ESM) have been explored as potentially novel platforms for immobilization of oligonucleotides and subsequent detection of target DNA. The fibrous network of the native ESM as well those functionalized with acetic acid or n-butyl acetate has been examined by field-emission scanning electron microscopy (FESEM). The formation of surface functional moieties has been confirmed by Fourier-transform infrared spectroscopy (FTIR). DNA molecules, with an end terminal − NH{sub 2} group (at 5′ end) have been immobilized on the chemically modified ESM surface. The effect of surface modification on the DNA immobilization efficiency has been investigated using fluorescence microscopy and atomic force microscopy (AFM). The above studies concurrently suggest that functionalization of ESM with n-butyl acetate causes a better homogeneity of the DNA probes on the membrane surface. On-chip hybridization of the target DNA with the surface bound capture probes has been performed on the functionalized membranes. It is observed that n-butyl acetate modification of ESM pushes the limit of detection (LOD) of the DNA sensors by at least an order of magnitude compared to the other modification method. - Graphical abstract: Eggshell membranes (ESM) have been chemically modified with acetic acid or n-butyl acetate for immobilization of aminated capture probes and subsequent detection of fluorophore-tagged target DNA molecules. n-Butyl acetate modified ESM exhibits superior homogeneity of capture probe immobilization and lower limit of detection for the target DNA molecules. - Highlights: • Eggshell membranes (ESM) have been explored as potentially novel platforms for immobilization of oligonucleotides. • Compared to native ESM, those modified with acetic acid or n-butyl acetate have shown more efficient loading of DNA probes. • ESM modified with n-butyl acetate pushed the lower limit of detection (LOD) of the sensor down to 10 nM of target DNA

  9. The DnaA N-terminal domain interacts with Hda to facilitate replicase clamp-mediated inactivation of DnaA.

    Science.gov (United States)

    Su'etsugu, Masayuki; Harada, Yuji; Keyamura, Kenji; Matsunaga, Chika; Kasho, Kazutoshi; Abe, Yoshito; Ueda, Tadashi; Katayama, Tsutomu

    2013-12-01

    DnaA activity for replication initiation of the Escherichia coli chromosome is negatively regulated by feedback from the DNA-loaded form of the replicase clamp. In this process, called RIDA (regulatory inactivation of DnaA), ATP-bound DnaA transiently assembles into a complex consisting of Hda and the DNA-clamp, which promotes inter-AAA+ domain association between Hda and DnaA and stimulates hydrolysis of DnaA-bound ATP, producing inactive ADP-DnaA. Using a truncated DnaA mutant, we previously demonstrated that the DnaA N-terminal domain is involved in RIDA. However, the precise role of the N-terminal domain in RIDA has remained largely unclear. Here, we used an in vitro reconstituted system to demonstrate that the Asn-44 residue in the N-terminal domain of DnaA is crucial for RIDA but not for replication initiation. Moreover, an assay termed PDAX (pull-down after cross-linking) revealed an unstable interaction between a DnaA-N44A mutant and Hda. In vivo, this mutant exhibited an increase in the cellular level of ATP-bound DnaA. These results establish a model in which interaction between DnaA Asn-44 and Hda stabilizes the association between the AAA+ domains of DnaA and Hda to facilitate DnaA-ATP hydrolysis during RIDA. © 2013 Society for Applied Microbiology and John Wiley & Sons Ltd.

  10. Continuous bounded cohomology of locally compact groups

    CERN Document Server

    2001-01-01

    Recent research has repeatedly led to connections between important rigidity questions and bounded cohomology. However, the latter has remained by and large intractable. This monograph introduces the functorial study of the continuous bounded cohomology for topological groups, with coefficients in Banach modules. The powerful techniques of this more general theory have successfully solved a number of the original problems in bounded cohomology. As applications, one obtains, in particular, rigidity results for actions on the circle, for representations on complex hyperbolic spaces and on Teichmüller spaces. A special effort has been made to provide detailed proofs or references in quite some generality.

  11. Positivity bounds on double parton distributions

    International Nuclear Information System (INIS)

    Diehl, Markus; Kasemets, Tomas

    2013-03-01

    Double hard scattering in proton-proton collisions is described in terms of double parton distributions. We derive bounds on these distributions that follow from their interpretation as probability densities, taking into account all possible spin correlations between two partons in an unpolarized proton. These bounds constrain the size of the polarized distributions and can for instance be used to set upper limits on the effects of spin correlations in double hard scattering. We show that the bounds are stable under leading-order DGLAP evolution to higher scales.

  12. Remarks on Bousso's covariant entropy bound

    CERN Document Server

    Mayo, A E

    2002-01-01

    Bousso's covariant entropy bound is put to the test in the context of a non-singular cosmological solution of general relativity found by Bekenstein. Although the model complies with every assumption made in Bousso's original conjecture, the entropy bound is violated due to the occurrence of negative energy density associated with the interaction of some the matter components in the model. We demonstrate how this property allows for the test model to 'elude' a proof of Bousso's conjecture which was given recently by Flanagan, Marolf and Wald. This corroborates the view that the covariant entropy bound should be applied only to stable systems for which every matter component carries positive energy density.

  13. The bound state problem and quark confinement

    International Nuclear Information System (INIS)

    Chaichian, M.; Demichev, A.P.; Nelipa, N.F.

    1980-01-01

    A quantum field-theoretic model in which quark is confined is considered. System of equations for the Green functions of colour singlet and octet bound states is obtained. The method is based on the nonperturbative Schwinger-Dyson equations with the use of Slavnov-Taylor identities. It is shown that in the framework of the model if there exist singlet, then also exist octet bound states of the quark-antiquark system. Thus in general, confinement of free quarks does not mean absence of their coloured bound states. (author)

  14. Quasi-bound states in continuum

    International Nuclear Information System (INIS)

    Nakamura, Hiroaki; Hatano, Naomichi; Garmon, Sterling; Petrosky, Tomio

    2007-08-01

    We report the prediction of quasi-bound states (resonant states with very long lifetimes) that occur in the eigenvalue continuum of propagating states for a wide region of parameter space. These quasi-bound states are generated in a quantum wire with two channels and an adatom, when the energy bands of the two channels overlap. A would-be bound state that lays just below the upper energy band is slightly destabilized by the lower energy band and thereby becomes a resonant state with a very long lifetime (a second QBIC lays above the lower energy band). (author)

  15. Light-Triggered Release of DNA from Plasmon-Resonant Nanoparticles

    Science.gov (United States)

    Huschka, Ryan

    Plasmon-resonant nanoparticle complexes show promising potential for lighttriggered, controllable delivery of deoxyribonucleic acids (DNA) for research and therapeutic purposes. For example, the approach of RNA interference (RNAi) . using antisense DNA or RNA oligonucleotides to silence activity of a specific pathogenic gene transcript and reduce expression of the encoded protein . is very useful in dissecting genetic function and holds promise as a molecular therapeutic. Herein, we investigate the mechanism and probe the in vitro therapeutic potential of DNA light-triggered release from plasmonic nanoparticles. First, we investigate the mechanism of light-triggered release by dehybridizing double-stranded (dsDNA) via laser illumination from two types of nanoparticle substrates: gold (Au) nanoshells and Au nanorods. Both light-triggered and thermally induced releases are distinctly observable from nanoshell-based complexes. Surprisingly, no analogous measurable light-triggered release was observable from nanorod-based complexes below the DNA melting temperature. These results suggest that a nonthermal mechanism may play a role in light-triggered DNA release. Second, we demonstrate the in vitro light-triggered release of molecules noncovalently attached within dsDNA bound to the Au nanoshell surface. DAPI (4',6- diamidino-2-phenylindole), a bright blue fluorescent molecule that binds reversibly to double-stranded DNA, was chosen to visualize this intracellular light-induced release process. Illumination through the cell membrane of the nanoshell-dsDNA-DAPI complexes dehybridizes the DNA and releases the DAPI molecules within living cells. The DAPI molecules diffuse to the nucleus and associate with the cell's endogenous DNA. This work could have future applications towards drug delivery of molecules that associate with dsDNA. Finally, we demonstrate an engineered Au nanoshell (AuNS)-based therapeutic oligonucleotide delivery vehicle, designed to release its cargo on

  16. Decrease DNA contamination in the laboratories

    DEFF Research Database (Denmark)

    Kampmann, Marie-Louise; Børsting, Claus; Morling, Niels

    2017-01-01

    In this study, we tested various approaches to remove DNA from hard laboratory surfaces. We contaminated clean surfaces with four different concentrations of massively parallel sequencing libraries. The DNA was dried and left for 45 min and for 24 h, respectively, before any treatment. The surfaces.......9–1.8% hypochlorite in order to eliminate laboratory contamination and simultaneously minimise any poisonous gases....

  17. DNA2—An Important Player in DNA Damage Response or Just Another DNA Maintenance Protein?

    Directory of Open Access Journals (Sweden)

    Elzbieta Pawłowska

    2017-07-01

    Full Text Available The human DNA2 (DNA replication helicase/nuclease 2 protein is expressed in both the nucleus and mitochondria, where it displays ATPase-dependent nuclease and helicase activities. DNA2 plays an important role in the removing of long flaps in DNA replication and long-patch base excision repair (LP-BER, interacting with the replication protein A (RPA and the flap endonuclease 1 (FEN1. DNA2 can promote the restart of arrested replication fork along with Werner syndrome ATP-dependent helicase (WRN and Bloom syndrome protein (BLM. In mitochondria, DNA2 can facilitate primer removal during strand-displacement replication. DNA2 is involved in DNA double strand (DSB repair, in which it is complexed with BLM, RPA and MRN for DNA strand resection required for homologous recombination repair. DNA2 can be a major protein involved in the repair of complex DNA damage containing a DSB and a 5′ adduct resulting from a chemical group bound to DNA 5′ ends, created by ionizing radiation and several anticancer drugs, including etoposide, mitoxantrone and some anthracyclines. The role of DNA2 in telomere end maintenance and cell cycle regulation suggests its more general role in keeping genomic stability, which is impaired in cancer. Therefore DNA2 can be an attractive target in cancer therapy. This is supported by enhanced expression of DNA2 in many cancer cell lines with oncogene activation and premalignant cells. Therefore, DNA2 can be considered as a potential marker, useful in cancer therapy. DNA2, along with PARP1 inhibition, may be considered as a potential target for inducing synthetic lethality, a concept of killing tumor cells by targeting two essential genes.

  18. Tight Bounds for Distributed Functional Monitoring

    DEFF Research Database (Denmark)

    Woodruff, David P.; Zhang, Qin

    2011-01-01

    $, our bound resolves their main open question. Our lower bounds are based on new direct sum theorems for approximate majority, and yield significant improvements to problems in the data stream model, improving the bound for estimating $F_p, p > 2,$ in $t$ passes from $\\tilde{\\Omega}(n^{1-2/p}/(\\eps^{2/p......} t))$ to $\\tilde{\\Omega}(n^{1-2/p}/(\\eps^{4/p} t))$, giving the first bound for estimating $F_0$ in $t$ passes of $\\Omega(1/(\\eps^2 t))$ bits of space that does not use the gap-hamming problem, and showing a distribution for the gap-hamming problem with high external information cost or super...

  19. Redshift-space limits of bound structures

    NARCIS (Netherlands)

    Duenner, Rolando; Reisenegger, Andreas; Meza, Andres; Araya, Pablo A.; Quintana, Hernan

    2007-01-01

    An exponentially expanding Universe, possibly governed by a cosmological constant, forces gravitationally bound structures to become more and more isolated, eventually becoming causally disconnected from each other and forming so-called 'island universes'. This new scenario reformulates the question

  20. Error Bounds: Necessary and Sufficient Conditions

    Czech Academy of Sciences Publication Activity Database

    Outrata, Jiří; Kruger, A.Y.; Fabian, Marián; Henrion, R.

    2010-01-01

    Roč. 18, č. 2 (2010), s. 121-149 ISSN 1877-0533 R&D Projects: GA AV ČR IAA100750802 Institutional research plan: CEZ:AV0Z10750506; CEZ:AV0Z10190503 Keywords : Error bounds * Calmness * Subdifferential * Slope Subject RIV: BA - General Mathematics Impact factor: 0.333, year: 2010 http://library.utia.cas.cz/separaty/2010/MTR/outrata-error bounds necessary and sufficient conditions.pdf

  1. Malabsorption of protein bound vitamin B12.

    OpenAIRE

    Dawson, D W; Sawers, A H; Sharma, R K

    1984-01-01

    Patients with subnormal serum vitamin B12 concentrations were tested for absorption of protein bound vitamin B12 and compared with controls. Absorption of the protein bound vitamin appeared to decrease with increasing age in healthy subjects. Differences between the result of this test and the result of the Schilling test in patients who had undergone gastric surgery were confirmed; such differences were also seen in some patients who had iron deficiency anaemia, an excessive alcohol intake, ...

  2. New Spectral Features from Bound Dark Matter

    DEFF Research Database (Denmark)

    Catena, Riccardo; Kouvaris, Chris

    2016-01-01

    We demonstrate that dark matter particles gravitationally bound to the Earth can induce a characteristic nuclear recoil signal at low energies in direct detection experiments. The new spectral feature we predict can provide the ultimate smoking gun for dark matter discovery for experiments...... with positive signal but unclear background. The new feature is universal, in that the ratio of bound over halo dark matter event rates at detectors is independent of the dark matter-nucleon cross section....

  3. Automatic bounding estimation in modified NLMS algorithm

    International Nuclear Information System (INIS)

    Shahtalebi, K.; Doost-Hoseini, A.M.

    2002-01-01

    Modified Normalized Least Mean Square algorithm, which is a sign form of Nlm based on set-membership (S M) theory in the class of optimal bounding ellipsoid (OBE) algorithms, requires a priori knowledge of error bounds that is unknown in most applications. In a special but popular case of measurement noise, a simple algorithm has been proposed. With some simulation examples the performance of algorithm is compared with Modified Normalized Least Mean Square

  4. DNA Camouflage

    Science.gov (United States)

    2016-01-08

    1 DNA Camouflage Supplementary Information Bijan Zakeri1,2*, Timothy K. Lu1,2*, Peter A. Carr2,3* 1Department of Electrical Engineering and...ll.mit.edu). Distribution A: Public Release   2 Supplementary Figure 1 DNA camouflage with the 2-state device. (a) In the presence of Cre, DSD-2[α...10 1 + Cre 1 500 1,000 length (bp) chromatogram alignment template − Cre   4 Supplementary Figure 3 DNA camouflage with a switchable

  5. The holographic bound in the scalar-tensor and f(R) gravities

    International Nuclear Information System (INIS)

    Firouzjaee, J.T.

    2013-01-01

    The holographic bound has been extended to the different theory of gravities such as scalar-tensor gravity and f(R) gravity according to the Noether charge definition of the entropy for a black hole surface. We have introduced some popular examples of the flat FRW cosmology in order to investigate holographic bound in scalar-tensor and f(R) gravity. Using the holographic bound, we put an additional constraint on scalar-tensor gravity and the f(R) gravity parameters. We also discuss the transformation from Jordan frame to Einstein frame. (orig.)

  6. Absolute Lower Bound on the Bounce Action

    Science.gov (United States)

    Sato, Ryosuke; Takimoto, Masahiro

    2018-03-01

    The decay rate of a false vacuum is determined by the minimal action solution of the tunneling field: bounce. In this Letter, we focus on models with scalar fields which have a canonical kinetic term in N (>2 ) dimensional Euclidean space, and derive an absolute lower bound on the bounce action. In the case of four-dimensional space, we show the bounce action is generically larger than 24 /λcr, where λcr≡max [-4 V (ϕ )/|ϕ |4] with the false vacuum being at ϕ =0 and V (0 )=0 . We derive this bound on the bounce action without solving the equation of motion explicitly. Our bound is derived by a quite simple discussion, and it provides useful information even if it is difficult to obtain the explicit form of the bounce solution. Our bound offers a sufficient condition for the stability of a false vacuum, and it is useful as a quick check on the vacuum stability for given models. Our bound can be applied to a broad class of scalar potential with any number of scalar fields. We also discuss a necessary condition for the bounce action taking a value close to this lower bound.

  7. Laser-induced heating integrated with a microfluidic platform for real-time DNA replication and detection

    Science.gov (United States)

    Hung, Min-Sheng; Ho, Chia-Chin; Chen, Chih-Pin

    2016-08-01

    This study developed a microfluidic platform for replicating and detecting DNA in real time by integrating a laser and a microfluidic device composed of polydimethylsiloxane. The design of the microchannels consisted of a laser-heating area and a detection area. An infrared laser was used as the heating source for DNA replication, and the laser power was adjusted to heat the solutions directly. In addition, strong biotin-avidin binding was used to capture and detect the replicated products. The biotin on one end was bound to avidin and anchored to the surface of the microchannels, whereas the biotin on the other end was bound to the quantum dots (Qdots). The results showed that the fluorescent intensity of the Qdots bound to the replicated products in the detection area increased with the number of thermal cycles created by the laser. When the number of thermal cycles was ≥10, the fluorescent intensity of the Qdots was directly detectable on the surface of the microchannels. The proposed method is more sensitive than detection methods entailing gel electrophoresis.

  8. Bounds and maximum principles for the solution of the linear transport equation

    International Nuclear Information System (INIS)

    Larsen, E.W.

    1981-01-01

    Pointwise bounds are derived for the solution of time-independent linear transport problems with surface sources in convex spatial domains. Under specified conditions, upper bounds are derived which, as a function of position, decrease with distance from the boundary. Also, sufficient conditions are obtained for the existence of maximum and minimum principles, and a counterexample is given which shows that such principles do not always exist

  9. Plasmid DNA is released from nanosized acicular material surface by low molecular weight oligonucleotides: exogenous plasmid acquisition mechanism for penetration intermediates based on the Yoshida effect.

    Science.gov (United States)

    Yoshida, N; Ide, K

    2008-10-01

    When a colloidal solution consisting of nanosized acicular material and bacterial cells is stimulated with sliding friction at the interface between the hydrogel and interface-forming material where the frictional coefficient increases rapidly, the nanosized acicular material accompanying the bacterial cells forms a penetration intermediate. This effect is known as the Yoshida effect in honor of its discoverer. Through the Yoshida effect, a novel property in which penetration intermediates incorporate exogenous plasmid DNA has been identified. This report proposes a possible mechanism for exogenous plasmid acquisition by penetration intermediates in the Yoshida effect. Escherichia coli cells, pUC18, and chrysotile were used as recipient cells, plasmid DNA, and nanosized acicular material, respectively. Even when repeatedly washing the mixture consisting of pUC18 and chrysotile, transformation efficiency by pUC18 was stable. Accordingly, pUC18 adsorbed onto chrysotile was introduced into recipient E. coli cells. At saturation, the amount of pUC18 adsorbed onto chrysotile was 0.8-1.2 microg/mg. To investigate whether pUC18 adsorbed on chrysotile is replicated by polymerase, polymerase chain reaction (PCR) was carried out with the chrysotile. Amplification of the beta-lactamase gene coded in pUC18, which was adsorbed onto chrysotile, was strongly inhibited. This suggests that DNA adsorbed onto chrysotile is not replicated in vivo. When we searched for substances to release pUC18 adsorbed onto chrysotile, we found that a 300-bp single- or double-stranded segment of DNA releases pUC18 from chrysotile. Competitive adsorption onto chrysotile between double-stranded DNA and pUC18 was then examined through the Yoshida effect. The 310- and 603-bp double-stranded nucleotides caused 50% competitive inhibition at the same molar ratio with pUC18. Hence, the adsorbed region of pUC18 is about 300 bp in length. As the culture period for recipient cells increases, transformation

  10. Covalently bound conjugates of albumin and heparin: Synthesis, fractionation and characterization

    NARCIS (Netherlands)

    Hennink, Wim E.; Feijen, Jan; Ebert, Charles D.; Kim, Sung Wan

    1983-01-01

    Covalently bound conjugates of human serum albumin and heparin were prepared as compounds which could improve the blood-compatibility of polymer surfaces either by preadsorption or by covalent coupling of the conjugates onto blood contacting surfaces. The conjugates (10–16 weight % of heparin) were

  11. Detection of different categories of hepatitis B virus (HBV) infection in a multi-regional study comparing the clinical sensitivity of hepatitis B surface antigen and HBV-DNA testing

    DEFF Research Database (Denmark)

    Lelie, Nico; Bruhn, Roberta; Busch, Michael

    2017-01-01

    BACKGROUND: Twenty-two users of individual donation nucleic acid amplification technology (ID-NAT) in six geographical regions provided detailed hepatitis B virus (HBV) infection data in first-time, lapsed, and repeat donations and classified confirmed HBV-positive donors into different infection...... categories. These data were used to compare the clinical sensitivity of hepatitis B surface antigen (HBsAg) and HBV-DNA testing. STUDY DESIGN AND METHODS: In total 10,981,776 donations from South Africa, Egypt, the Mediterranean, North and Central Europe, South East Asia, and Oceania were screened for HBV...

  12. DNA binding and aggregation by carbon nanoparticles

    International Nuclear Information System (INIS)

    An, Hongjie; Liu, Qingdai; Ji, Qiaoli; Jin, Bo

    2010-01-01

    Significant environmental and health risks due to the increasing applications of engineered nanoparticles in medical and industrial activities have been concerned by many communities. The interactions between nanomaterials and genomes have been poorly studied so far. This study examined interactions of DNA with carbon nanoparticles (CNP) using atomic force microscopy (AFM). We experimentally assessed how CNP affect DNA molecule and bacterial growth of Escherichia coli. We found that CNP were bound to the DNA molecules during the DNA replication in vivo. The results revealed that the interaction of DNA with CNP resulted in DNA molecule binding and aggregation both in vivo and in vitro in a dose-dependent manner, and consequently inhabiting the E. coli growth. While this was a preliminary study, our results showed that this nanoparticle may have a significant impact on genomic activities.

  13. DNA Binding by the Ribosomal DNA Transcription Factor Rrn3 Is Essential for Ribosomal DNA Transcription*

    Science.gov (United States)

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.

    2013-01-01

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135

  14. DNA binding by the ribosomal DNA transcription factor rrn3 is essential for ribosomal DNA transcription.

    Science.gov (United States)

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I

    2013-03-29

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.

  15. Regular square planer bis-(4,4,4-trifluoro-1-(thiophen-2-yl)butane-1,3-dione)/copper(II) complex: Trans/cis-DFT isomerization, crystal structure, thermal, solvatochromism, hirshfeld surface and DNA-binding analysis

    Science.gov (United States)

    Hema, M. K.; Karthik, C. S.; Warad, Ismail; Lokanath, N. K.; Zarrouk, Abdelkader; Kumara, Karthik; Pampa, K. J.; Mallu, P.

    2018-04-01

    Trans-[Cu(O∩O)2] complex, O∩O = 4,4,4-trifluoro-1-(thiophen-2-yl)butane-1,3-dione was reported with high potential toward CT-DNA binder. The solved XRD-structure of complex indicated a perfect regular square-planer geometry around the Cu(II) center. The trans/cis-DFT-isomerization calculation supported the XRD seen in reflecting the trans-isomer as the kinetic-favor isomer. The desired complex structure was also characterized by conductivity measurement, CHN-elemental analyses, MS, EDX, SEM, UV-Vis., FT-IR, HAS and TG/DTG. The Solvatochromism behavior of the complex was evaluated using four different polar solvents. MPE and Hirshfeld surface analysis (HSA) come to an agreement that fluoride and thiophene protons atoms are with suitable electro-potential environment to form non-classical H-bonds of type CThsbnd H⋯F. The DNA-binding properties were investigated by viscosity tests and spectrometric titrations, the results revealed the complex as strong calf-thymus DNA binder. High intrinsic-binding constants value ∼1.8 × 105 was collected.

  16. Functional DNA-containing nanomaterials: cellular applications in biosensing, imaging, and targeted therapy.

    Science.gov (United States)

    Liang, Hao; Zhang, Xiao-Bing; Lv, Yifan; Gong, Liang; Wang, Ruowen; Zhu, Xiaoyan; Yang, Ronghua; Tan, Weihong

    2014-06-17

    CONSPECTUS: DNA performs a vital function as a carrier of genetic code, but in the field of nanotechnology, DNA molecules can catalyze chemical reactions in the cell, that is, DNAzymes, or bind with target-specific ligands, that is, aptamers. These functional DNAs with different modifications have been developed for sensing, imaging, and therapeutic systems. Thus, functional DNAs hold great promise for future applications in nanotechnology and bioanalysis. However, these functional DNAs face challenges, especially in the field of biomedicine. For example, functional DNAs typically require the use of cationic transfection reagents to realize cellular uptake. Such reagents enter the cells, increasing the difficulty of performing bioassays in vivo and potentially damaging the cell's nucleus. To address this obstacle, nanomaterials, such as metallic, carbon, silica, or magnetic materials, have been utilized as DNA carriers or assistants. In this Account, we describe selected examples of functional DNA-containing nanomaterials and their applications from our recent research and those of others. As models, we have chosen to highlight DNA/nanomaterial complexes consisting of gold nanoparticles, graphene oxides, and aptamer-micelles, and we illustrate the potential of such complexes in biosensing, imaging, and medical diagnostics. Under proper conditions, multiple ligand-receptor interactions, decreased steric hindrance, and increased surface roughness can be achieved from a high density of DNA that is bound to the surface of nanomaterials, resulting in a higher affinity for complementary DNA and other targets. In addition, this high density of DNA causes a high local salt concentration and negative charge density, which can prevent DNA degradation. For example, DNAzymes assembled on gold nanoparticles can effectively catalyze chemical reactions even in living cells. And it has been confirmed that DNA-nanomaterial complexes can enter cells more easily than free single

  17. DNA glue

    DEFF Research Database (Denmark)

    Filichev, Vyacheslav V; Astakhova, Irina V.; Malakhov, Andrei D.

    2008-01-01

    Significant alterations in thermal stability of parallel DNA triplexes and antiparallel duplexes were observed upon changing the attachment of ethynylpyrenes from para to ortho in the structure of phenylmethylglycerol inserted as a bulge into DNA (TINA). Insertions of two ortho-TINAs as a pseudo...

  18. Hyperstretching DNA

    NARCIS (Netherlands)

    Schakenraad, Koen; Biebricher, Andreas S.; Sebregts, Maarten; Ten Bensel, Brian; Peterman, Erwin J.G.; Wuite, Gijs J L; Heller, Iddo; Storm, Cornelis; Van Der Schoot, Paul

    2017-01-01

    The three-dimensional structure of DNA is highly susceptible to changes by mechanical and biochemical cues in vivo and in vitro. In particular, large increases in base pair spacing compared to regular B-DNA are effected by mechanical (over)stretching and by intercalation of compounds that are widely

  19. Upper bounds on superpartner masses from upper bounds on the Higgs boson mass.

    Science.gov (United States)

    Cabrera, M E; Casas, J A; Delgado, A

    2012-01-13

    The LHC is putting bounds on the Higgs boson mass. In this Letter we use those bounds to constrain the minimal supersymmetric standard model (MSSM) parameter space using the fact that, in supersymmetry, the Higgs mass is a function of the masses of sparticles, and therefore an upper bound on the Higgs mass translates into an upper bound for the masses for superpartners. We show that, although current bounds do not constrain the MSSM parameter space from above, once the Higgs mass bound improves big regions of this parameter space will be excluded, putting upper bounds on supersymmetry (SUSY) masses. On the other hand, for the case of split-SUSY we show that, for moderate or large tanβ, the present bounds on the Higgs mass imply that the common mass for scalars cannot be greater than 10(11)  GeV. We show how these bounds will evolve as LHC continues to improve the limits on the Higgs mass.

  20. DNA Topology and the Initiation of Virus DNA Packaging.

    Directory of Open Access Journals (Sweden)

    Choon Seok Oh

    Full Text Available During progeny assembly, viruses selectively package virion genomes from a nucleic acid pool that includes host nucleic acids. For large dsDNA viruses, including tailed bacteriophages and herpesviruses, immature viral DNA is recognized and translocated into a preformed icosahedral shell, the prohead. Recognition involves specific interactions between the viral packaging enzyme, terminase, and viral DNA recognition sites. Generally, viral DNA is recognized by terminase's small subunit (TerS. The large terminase subunit (TerL contains translocation ATPase and endonuclease domains. In phage lambda, TerS binds a sequence repeated three times in cosB, the recognition site. TerS binding to cosB positions TerL to cut the concatemeric DNA at the adjacent nicking site, cosN. TerL introduces staggered nicks in cosN, generating twelve bp cohesive ends. Terminase separates the cohesive ends and remains bound to the cosB-containing end, in a nucleoprotein structure called Complex I. Complex I docks on the prohead's portal vertex and translocation ensues. DNA topology plays a role in the TerSλ-cosBλ interaction. Here we show that a site, I2, located between cosN and cosB, is critically important for an early DNA packaging step. I2 contains a complex static bend. I2 mutations block DNA packaging. I2 mutant DNA is cut by terminase at cosN in vitro, but in vivo, no cos cleavage is detected, nor is there evidence for Complex I. Models for what packaging step might be blocked by I2 mutations are presented.

  1. BAF is a cytosolic DNA sensor that leads to exogenous DNA avoiding autophagy.

    Science.gov (United States)

    Kobayashi, Shouhei; Koujin, Takako; Kojidani, Tomoko; Osakada, Hiroko; Mori, Chie; Hiraoka, Yasushi; Haraguchi, Tokuko

    2015-06-02

    Knowledge of the mechanisms by which a cell detects exogenous DNA is important for controlling pathogen infection, because most pathogens entail the presence of exogenous DNA in the cytosol, as well as for understanding the cell's response to artificially transfected DNA. The cellular response to pathogen invasion has been well studied. However, spatiotemporal information of the cellular response immediately after exogenous double-stranded DNA (dsDNA) appears in the cytosol is lacking, in part because of difficulties in monitoring when exogenous dsDNA enters the cytosol of the cell. We have recently developed a method to monitor endosome breakdown around exogenous materials using transfection reagent-coated polystyrene beads incorporated into living human cells as the objective for microscopic observations. In the present study, using dsDNA-coated polystyrene beads (DNA-beads) incorporated into living cells, we show that barrier-to-autointegration factor (BAF) bound to exogenous dsDNA immediately after its appearance in the cytosol at endosome breakdown. The BAF(+) DNA-beads then assembled a nuclear envelope (NE)-like membrane and avoided autophagy that targeted the remnants of the endosome membranes. Knockdown of BAF caused a significant decrease in the assembly of NE-like membranes and increased the formation of autophagic membranes around the DNA-beads, suggesting that BAF-mediated assembly of NE-like membranes was required for the DNA-beads to evade autophagy. Importantly, BAF-bound beads without dsDNA also assembled NE-like membranes and avoided autophagy. We propose a new role for BAF: remodeling intracellular membranes upon detection of dsDNA in mammalian cells.

  2. Bounds on poloidal kinetic energy in plane layer convection

    Science.gov (United States)

    Tilgner, A.

    2017-12-01

    A numerical method is presented that conveniently computes upper bounds on heat transport and poloidal energy in plane layer convection for infinite and finite Prandtl numbers. The bounds obtained for the heat transport coincide with earlier results. These bounds imply upper bounds for the poloidal energy, which follow directly from the definitions of dissipation and energy. The same constraints used for computing upper bounds on the heat transport lead to improved bounds for the poloidal energy.

  3. Bounds for nonlinear composites via iterated homogenization

    Science.gov (United States)

    Ponte Castañeda, P.

    2012-09-01

    Improved estimates of the Hashin-Shtrikman-Willis type are generated for the class of nonlinear composites consisting of two well-ordered, isotropic phases distributed randomly with prescribed two-point correlations, as determined by the H-measure of the microstructure. For this purpose, a novel strategy for generating bounds has been developed utilizing iterated homogenization. The general idea is to make use of bounds that may be available for composite materials in the limit when the concentration of one of the phases (say phase 1) is small. It then follows from the theory of iterated homogenization that it is possible, under certain conditions, to obtain bounds for more general values of the concentration, by gradually adding small amounts of phase 1 in incremental fashion, and sequentially using the available dilute-concentration estimate, up to the final (finite) value of the concentration (of phase 1). Such an approach can also be useful when available bounds are expected to be tighter for certain ranges of the phase volume fractions. This is the case, for example, for the "linear comparison" bounds for porous viscoplastic materials, which are known to be comparatively tighter for large values of the porosity. In this case, the new bounds obtained by the above-mentioned "iterated" procedure can be shown to be much improved relative to the earlier "linear comparison" bounds, especially at low values of the porosity and high triaxialities. Consistent with the way in which they have been derived, the new estimates are, strictly, bounds only for the class of multi-scale, nonlinear composites consisting of two well-ordered, isotropic phases that are distributed with prescribed H-measure at each stage in the incremental process. However, given the facts that the H-measure of the sequential microstructures is conserved (so that the final microstructures can be shown to have the same H-measure), and that H-measures are insensitive to length scales, it is conjectured

  4. Thermalization Time Bounds for Pauli Stabilizer Hamiltonians

    Science.gov (United States)

    Temme, Kristan

    2017-03-01

    We prove a general lower bound to the spectral gap of the Davies generator for Hamiltonians that can be written as the sum of commuting Pauli operators. These Hamiltonians, defined on the Hilbert space of N-qubits, serve as one of the most frequently considered candidates for a self-correcting quantum memory. A spectral gap bound on the Davies generator establishes an upper limit on the life time of such a quantum memory and can be used to estimate the time until the system relaxes to thermal equilibrium when brought into contact with a thermal heat bath. The bound can be shown to behave as {λ ≥ O(N^{-1} exp(-2β overline{ɛ}))}, where {overline{ɛ}} is a generalization of the well known energy barrier for logical operators. Particularly in the low temperature regime we expect this bound to provide the correct asymptotic scaling of the gap with the system size up to a factor of N -1. Furthermore, we discuss conditions and provide scenarios where this factor can be removed and a constant lower bound can be proven.

  5. Universal bounds in even-spin CFTs

    Energy Technology Data Exchange (ETDEWEB)

    Qualls, Joshua D. [Department of Physics, National Taiwan University,Taipei, Taiwan (China)

    2015-12-01

    We prove using invariance under the modular S− and ST−transformations that every unitary two-dimensional conformal field theory (CFT) having only even-spin primary operators (with no extended chiral algebra and with right- and left-central charges c,c̃>1) contains a primary operator with dimension Δ{sub 1} satisfying 0<Δ{sub 1}<((c+c̃)/24)+0.09280…. After deriving both analytical and numerical bounds, we discuss how to extend our methods to bound higher conformal dimensions before deriving lower and upper bounds on the number of primary operators in a given energy range. Using the AdS{sub 3}/CFT{sub 2} dictionary, the bound on Δ{sub 1} proves the lightest massive excitation in appropriate theories of 3D matter and gravity with cosmological constant Λ<0 can be no heavier than 1/8G{sub N}+O(√(−Λ)); the bounds on the number of operators are related via AdS/CFT to the entropy of states in the dual gravitational theory. In the flat-space approximation, the limiting mass is exactly that of the lightest BTZ black hole.

  6. Conformational Analysis of DNA Repair Intermediates by Time-Resolved Fluorescence Spectroscopy

    OpenAIRE

    Lin, Su; Horning, David P.; Szostak, Jack W.; Chaput, John C.

    2009-01-01

    DNA repair enzymes are essential for maintaining the integrity of the DNA sequence. Unfortunately, very little is known about how these enzymes recognize damaged regions along the helix. Structural analysis of cellular repair enzymes bound to DNA reveals that these enzymes are able to recognize DNA in a variety of conformations. However, the prevalence of these deformations in the absence of enzymes remains unclear, as small populations of DNA conformations are often difficult to detect by NM...

  7. DNA ligase III is involved in a DNA-PK independent pathway of NHEJ in human cells

    International Nuclear Information System (INIS)

    Wang, H.; Perrault, A.R.; Qin, W.; Wang, H.; Iliakis, G.

    2003-01-01

    Full text: Double strand breaks (DSB) induced by ionizing radiation (IR) and other cytotoxic agents in the genome of higher eukaryotes are thought to be repaired either by homologous recombination repair (HRR), or non-homologous endjoining (NHEJ). We previously reported the operation of two components of NHEJ in vivo: a DNA-PK dependent component that operates with fast kinetics (D-NHEJ), and a DNA-PK independent component that acts as a backup (basic or B-NHEJ) and operates with kinetics an order of magnitude slower. To gain further insight into the mechanisms of B-NHEJ, we investigated DNA endjoining in extracts 180BR, a human cell line deficient in DNA ligase IV, using an in vitro plasmid-based DNA endjoining assay. An anti DNA ligase III antibody inhibited almost completely DNA endjoining activity in these extracts. On the other hand, an anti DNA ligase I antibody had no measurable effect in DNA endjoining activity. Immunodepletion of DNA ligase III from 180BR cell extracts abolished the DNA endjoining activity, which could be restored by addition of purified human DNA ligase IIIb. Full-length DNA ligase III bound to double stranded DNA and stimulated DNA endjoining in both intermolecular and intramolecular ligation. Furthermore, fractionation of HeLa cell extracts demonstrated the presence of an activity stimulating the function of DNA ligase III. Based on these observations we propose that DNA ligase III is the ligase operating in B-NHEJ

  8. Preferential binding of DNA primase to the nuclear matrix

    International Nuclear Information System (INIS)

    Wood, S.H.; Collins, J.M.

    1986-01-01

    Several lines of research have stimulated interest in the nuclear matrix as the subcellular site of DNA replication. The authors have recently reported a relationship between rates of DNA synthesis and the differential binding of polymerase α to the nuclear matrix. They now report the detection of DNA primase bound to the HeLa nuclear matrix. Matrix-bound primase can be measured either indirectly, by the incorporation of [ 32 P] dAMP into an unprimed single-stranded template, or directly, by the incorporation of [ 3 H] AMP into matrix DNA. Characteristics of this system include a requirement for ATP, inhibition by adenosine-5'-0-(3'-thiotriphosphate), a primase inhibitor, and insensitivity to aphidicolin and α-amanitine, inhibitors of polymerase α and RNA polymerase, respectively. Subcellular quantification of primase and polymerase α activity revealed that while a majority of primase activity is bound to the matrix (72%), only 32% of polymerase α activity is matrix-bound. Treatment of the nuclear matrix with β-D-Octylglucoside allowed the solubilization of 54% of primase activity and 39% of polymerase α activity. This data provides further evidence of a structural and functional role for the nuclear matrix in DNA replication. The ability to solubilize matrix-bound replicative enzymes may prove to be an important tool in the elucidation of the spatial organization of DNA replication

  9. Fragile DNA Repair Mechanism Reduces Ageing in Multicellular Model

    DEFF Research Database (Denmark)

    Bendtsen, Kristian Moss; Juul, Jeppe Søgaard; Trusina, Ala

    2012-01-01

    increases the amount of unrepaired DNA damage. Despite this vicious circle, we ask, can cells maintain a high DNA repair capacity for some time or is repair capacity bound to continuously decline with age? We here present a simple mathematical model for ageing in multicellular systems where cells subjected...... to DNA damage can undergo full repair, go apoptotic, or accumulate mutations thus reducing DNA repair capacity. Our model predicts that at the tissue level repair rate does not continuously decline with age, but instead has a characteristic extended period of high and non-declining DNA repair capacity......DNA damages, as well as mutations, increase with age. It is believed that these result from increased genotoxic stress and decreased capacity for DNA repair. The two causes are not independent, DNA damage can, for example, through mutations, compromise the capacity for DNA repair, which in turn...

  10. Reaction of misonidazole with DNA radicals and its effect on the template activity of DNA

    International Nuclear Information System (INIS)

    Endoh, Daiji; Kuwabara, Mikinori; Sato, Fumiaki; Yoshii, Giichi.

    1985-01-01

    After calf thymus DNA was gamma-irradiated in the solid state in vacuo and subsequently dissolved in aqueous solution containing misonidazole (3 mM) under hypoxic condition, the frequency of single-strand breaks and alkali-labile sites in DNA and the amount of misonidazole bound to DNA were measured. The presence of misonidazole converted the precursor radicals, which otherwise results in single-strand breaks, to alkali-labile sites, and the amount of alkali-labile sites increased linearly with increasing radiation dose. The amount of misonidazole bound to DNA also increased linearly with increasing radiation dose. The biological meaning of the changes in the frequency of single-strand breaks and alkali-labile sites by the reaction of misonidazole with DNA radicals and of binding misonidazole with DNA was examined using a model system to measure the template activity of DNA for RNA synthesis in vitro. The conversion of DNA radicals to alkali-labile sites protected the radiation-induced decrease in the template activity of DNA, while the adduct formation of misonidazole had no effect on it. (author)

  11. Authentication of forensic DNA samples.

    Science.gov (United States)

    Frumkin, Dan; Wasserstrom, Adam; Davidson, Ariane; Grafit, Arnon

    2010-02-01

    Over the past twenty years, DNA analysis has revolutionized forensic science, and has become a dominant tool in law enforcement. Today, DNA evidence is key to the conviction or exoneration of suspects of various types of crime, from theft to rape and murder. However, the disturbing possibility that DNA evidence can be faked has been overlooked. It turns out that standard molecular biology techniques such as PCR, molecular cloning, and recently developed whole genome amplification (WGA), enable anyone with basic equipment and know-how to produce practically unlimited amounts of in vitro synthesized (artificial) DNA with any desired genetic profile. This artificial DNA can then be applied to surfaces of objects or incorporated into genuine human tissues and planted in crime scenes. Here we show that the current forensic procedure fails to distinguish between such samples of blood, saliva, and touched surfaces with artificial DNA, and corresponding samples with in vivo generated (natural) DNA. Furthermore, genotyping of both artificial and natural samples with Profiler Plus((R)) yielded full profiles with no anomalies. In order to effectively deal with this problem, we developed an authentication assay, which distinguishes between natural and artificial DNA based on methylation analysis of a set of genomic loci: in natural DNA, some loci are methylated and others are unmethylated, while in artificial DNA all loci are unmethylated. The assay was tested on natural and artificial samples of blood, saliva, and touched surfaces, with complete success. Adopting an authentication assay for casework samples as part of the forensic procedure is necessary for maintaining the high credibility of DNA evidence in the judiciary system.

  12. Radioimmunological demonstration of DNA specific antibodies

    Energy Technology Data Exchange (ETDEWEB)

    Falck, P [Akademie der Wissenschaften der DDR, Berlin-Buch. Zentralinstitut fuer Isotopen- und Strahlenforschung

    1976-01-01

    Using /sup 125/I chemically labelled denatured (d) and native (n) DNA, specifically binding antibodies were demonstrated in the sera of Lupus erythemathodes patients by means of the Farr technique. (NH/sub 4/)/sub 2/SO/sub 4/ was used to separate the immunologically bound /sup 125/I-d-DNA. For /sup 125/I-n-DNA the use of a secondary antiserum for the precipitation of the primary immune complex is advantageous. The influence of antigen concentration upon the binding rate was studied. Titre determinations can be made with the proposed method.

  13. Co-Immobilization of Proteins and DNA Origami Nanoplates to Produce High-Contrast Biomolecular Nanoarrays.

    Science.gov (United States)

    Hager, Roland; Burns, Jonathan R; Grydlik, Martyna J; Halilovic, Alma; Haselgrübler, Thomas; Schäffler, Friedrich; Howorka, Stefan

    2016-06-01

    The biofunctionalization of nanopatterned surfaces with DNA origami nanostructures is an important topic in nanobiotechnology. An unexplored challenge is, however, to co-immobilize proteins with DNA origami at pre-determined substrate sites in high contrast relative to the nontarget areas. The immobilization should, in addition, preferably be achieved on a transparent substrate to allow ultrasensitive optical detection. If successful, specific co-binding would be a step towards stoichiometrically defined arrays with few to individual protein molecules per site. Here, we successfully immobilize with high specificity positively charged avidin proteins and negatively charged DNA origami nanoplates on 100 nm-wide carbon nanoislands while suppressing undesired adsorption to surrounding nontarget areas. The arrays on glass slides achieve unprecedented selectivity factors of up to 4000 and allow ultrasensitive fluorescence read-out. The co-immobilization onto the nanoislands leads to layered biomolecular architectures, which are functional because bound DNA origami influences the number of capturing sites on the nanopatches for other proteins. The novel hybrid DNA origami-protein nanoarrays allow the fabrication of versatile research platforms for applications in biosensing, biophysics, and cell biology, and, in addition, represent an important step towards single-molecule protein arrays. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Tethered particle analysis of supercoiled circular DNA using peptide nucleic acid handles.

    Science.gov (United States)

    Norregaard, Kamilla; Andersson, Magnus; Nielsen, Peter Eigil; Brown, Stanley; Oddershede, Lene B

    2014-09-01

    This protocol describes how to monitor individual naturally supercoiled circular DNA plasmids bound via peptide nucleic acid (PNA) handles between a bead and a surface. The protocol was developed for single-molecule investigation of the dynamics of supercoiled DNA, and it allows the investigation of both the dynamics of the molecule itself and of its interactions with a regulatory protein. Two bis-PNA clamps designed to bind with extremely high affinity to predetermined homopurine sequence sites in supercoiled DNA are prepared: one conjugated with digoxigenin for attachment to an anti-digoxigenin-coated glass cover slide, and one conjugated with biotin for attachment to a submicron-sized streptavidin-coated polystyrene bead. Plasmids are constructed, purified and incubated with the PNA handles. The dynamics of the construct is analyzed by tracking the tethered bead using video microscopy: less supercoiling results in more movement, and more supercoiling results in less movement. In contrast to other single-molecule methodologies, the current methodology allows for studying DNA in its naturally supercoiled state with constant linking number and constant writhe. The protocol has potential for use in studying the influence of supercoils on the dynamics of DNA and its associated proteins, e.g., topoisomerase. The procedure takes ~4 weeks.

  15. Extracellular DNA metabolism in Haloferax volcanii

    Directory of Open Access Journals (Sweden)

    Scott eChimileski

    2014-02-01

    Full Text Available Extracellular DNA is found in all environments and is a dynamic component of the micro-bial ecosystem. Microbial cells produce and interact with extracellular DNA through many endogenous mechanisms. Extracellular DNA is processed and internalized for use as genetic information and as a major source of macronutrients, and plays several key roles within prokaryotic biofilms. Hypersaline sites contain some of the highest extracellular DNA con-centrations measured in nature–a potential rich source of carbon, nitrogen and phosphorus for halophilic microorganisms. We conducted DNA growth studies for the halophilic archaeon Haloferax volcanii DS2 and show that this model Halobacteriales strain is capable of using exogenous double-stranded DNA as a nutrient. Further experiments with varying medium composition, DNA concentration and DNA types revealed that DNA is utilized primarily as a phosphorus source, that growth on DNA is concentration-dependent and that DNA isolated from different sources is metabolized selectively, with a bias against highly divergent methylated DNA sources. Additionally, fluorescence microscopy experiments showed that labeled DNA colocalized with Haloferax volcanii cells. The gene Hvo_1477 was also identified using a comparative genomic approach as a factor likely to be involved in extracellular DNA processing at the cell surface, and deletion of Hvo_1477 created an H. volcanii strain deficient in its ability to grow on extracellular DNA. Widespread distribution of Hvo_1477 homologs in archaea suggests metabolism of extracellular DNA may be of broad ecological and physiological relevance in this domain of life.

  16. DNA probes

    International Nuclear Information System (INIS)

    Castelino, J.

    1992-01-01

    The creation of DNA probes for detection of specific nucleotide segments differs from ligand detection in that it is a chemical rather than an immunological reaction. Complementary DNA or RNA is used in place of the antibody and is labelled with 32 P. So far, DNA probes have been successfully employed in the diagnosis of inherited disorders, infectious diseases, and for identification of human oncogenes. The latest approach to the diagnosis of communicable and parasitic infections is based on the use of deoxyribonucleic acid (DNA) probes. The genetic information of all cells is encoded by DNA and DNA probe approach to identification of pathogens is unique because the focus of the method is the nucleic acid content of the organism rather than the products that the nucleic acid encodes. Since every properly classified species has some unique nucleotide sequences that distinguish it from every other species, each organism's genetic composition is in essence a finger print that can be used for its identification. In addition to this specificity, DNA probes offer other advantages in that pathogens may be identified directly in clinical specimens

  17. DNA probes

    Energy Technology Data Exchange (ETDEWEB)

    Castelino, J

    1993-12-31

    The creation of DNA probes for detection of specific nucleotide segments differs from ligand detection in that it is a chemical rather than an immunological reaction. Complementary DNA or RNA is used in place of the antibody and is labelled with {sup 32}P. So far, DNA probes have been successfully employed in the diagnosis of inherited disorders, infectious diseases, and for identification of human oncogenes. The latest approach to the diagnosis of communicable and parasitic infections is based on the use of deoxyribonucleic acid (DNA) probes. The genetic information of all cells is encoded by DNA and DNA probe approach to identification of pathogens is unique because the focus of the method is the nucleic acid content of the organism rather than the products that the nucleic acid encodes. Since every properly classified species has some unique nucleotide sequences that distinguish it from every other species, each organism`s genetic composition is in essence a finger print that can be used for its identification. In addition to this specificity, DNA probes offer other advantages in that pathogens may be identified directly in clinical specimens 10 figs, 2 tabs

  18. Yukawa Bound States and Their LHC Phenomenology

    Directory of Open Access Journals (Sweden)

    Enkhbat Tsedenbaljir

    2013-01-01

    Full Text Available We present the current status on the possible bound states of extra generation quarks. These include phenomenology and search strategy at the LHC. If chiral fourth-generation quarks do exist their strong Yukawa couplings, implied by current experimental lower bound on their masses, may lead to formation of bound states. Due to nearly degenerate 4G masses suggested by Precision Electroweak Test one can employ “heavy isospin” symmetry to classify possible spectrum. Among these states, the color-octet isosinglet vector ω 8 is the easiest to be produced at the LHC. The discovery potential and corresponding decay channels are covered in this paper. With possible light Higgs at ~125 GeV two-Higgs doublet version is briefly discussed.

  19. Bounded Gaps between Products of Special Primes

    Directory of Open Access Journals (Sweden)

    Ping Ngai Chung

    2014-03-01

    Full Text Available In their breakthrough paper in 2006, Goldston, Graham, Pintz and Yıldırım proved several results about bounded gaps between products of two distinct primes. Frank Thorne expanded on this result, proving bounded gaps in the set of square-free numbers with r prime factors for any r ≥ 2, all of which are in a given set of primes. His results yield applications to the divisibility of class numbers and the triviality of ranks of elliptic curves. In this paper, we relax the condition on the number of prime factors and prove an analogous result using a modified approach. We then revisit Thorne’s applications and give a better bound in each case.

  20. Braneworld black holes and entropy bounds

    Directory of Open Access Journals (Sweden)

    Y. Heydarzade

    2018-01-01

    Full Text Available The Bousso's D-bound entropy for the various possible black hole solutions on a 4-dimensional brane is checked. It is found that the D-bound entropy here is apparently different from that of obtained for the 4-dimensional black hole solutions. This difference is interpreted as the extra loss of information, associated to the extra dimension, when an extra-dimensional black hole is moved outward the observer's cosmological horizon. Also, it is discussed that N-bound entropy is hold for the possible solutions here. Finally, by adopting the recent Bohr-like approach to black hole quantum physics for the excited black holes, the obtained results are written also in terms of the black hole excited states.