WorldWideScience

Sample records for stripe rust resistant

  1. substitution line for resistance to stripe rust

    Indian Academy of Sciences (India)

    2011-08-19

    Aug 19, 2011 ... c Indian Academy of Sciences. RESEARCH ARTICLE. Molecular cytogenetic characterization of a new wheat Secale africanum. 2R a. (2D) substitution line for resistance to stripe rust. MENGPING LEI, GUANGRONG LI, SUFEN ZHANG, CHENG LIU and ZUJUN YANG. ∗. School of Life Science and ...

  2. leaf and stripe rust resistance among ethiopian grown wheat ...

    African Journals Online (AJOL)

    ADMIN

    pathogen pathotypes. These varieties and lines, therefore, may be utilized in leaf and stripe rust resistance breeding programs. Key words/phrases: Leaf rust, resistance, stripe rust, Triticum aestivum, Triticum turgidum. * Current address: University of Limpopo, School of Agricultural and Environmental Sciences, Private Bag ...

  3. Mapping of stripe rust resistance gene in an Aegilops caudata ...

    Indian Academy of Sciences (India)

    ... rust resistance depicted a single major gene conditioning adult plant resistance (APR) with stripe rust reaction varying from TR-20MS in resistant RILs signifying the presence of some minor genes as well. Genetic association with leaf rust resistance revealed that two genes are located at a recombination distance of 13%.

  4. Transfer of stripe rust resistance from Aegilops variabilis to bread ...

    African Journals Online (AJOL)

    In terms of area, the bread wheat producing regions of China comprise the largest area in the world that is constantly threatened by stripe rust epidemics. Consequently, it is important to exploit new adultplant resistance genes in breeding. This study reports the transfer of stripe rust resistance from Aegilops variabilis to ...

  5. Mapping of stripe rust resistance gene in an Aegilops caudata ...

    Indian Academy of Sciences (India)

    Genetic mapping indicated the introgression of stripe rust resistance gene on wheat chromosome. 5DS in the region carrying leaf rust resistance gene LrAc, but as an independent introgression. Simple sequence repeat (SSR) and sequence-tagged site (STS) markers designed from the survey sequence data of 5DS ...

  6. Genetics of leaf and stripe rust resistance in a bread wheat cultivar ...

    Indian Academy of Sciences (India)

    MYT), Mexico, has shown resistance to leaf rust and stripe rust in the Indian ... rust resistance against. -isogenic line genes present Leaf rust. Stripe rust. Origin. Source. Parentage. Tonichi. –. TR. 10.0. Mexico. RAMC CAR422/Anahuac75. CSP44. Lr48 .... separately have been reported earlier by several authors. Table 2.

  7. Physical Localization of a Locus from Agropyron cristatum Conferring Resistance to Stripe Rust in Common Wheat.

    Science.gov (United States)

    Zhang, Zhi; Song, Liqiang; Han, Haiming; Zhou, Shenghui; Zhang, Jinpeng; Yang, Xinming; Li, Xiuquan; Liu, Weihua; Li, Lihui

    2017-11-13

    Stripe rust, caused by Puccinia striiformis f. sp. tritici ( Pst ), is one of the most destructive diseases of wheat ( Triticum aestivum L.) worldwide. Agropyron cristatum (L.) Gaertn. (2 n = 28, PPPP), one of the wild relatives of wheat, exhibits resistance to stripe rust. In this study, wheat- A . cristatum 6P disomic addition line 4844-12 also exhibited resistance to stripe rust. To identify the stripe rust resistance locus from A . cristatum 6P, ten translocation lines, five deletion lines and the BC₂F₂ and BC₃F₂ populations of two wheat- A . cristatum 6P whole-arm translocation lines were tested with a mixture of two races of Pst in two sites during 2015-2016 and 2016-2017, being genotyped with genomic in situ hybridization (GISH) and molecular markers. The result indicated that the locus conferring stripe rust resistance was located on the terminal 20% of 6P short arm's length. Twenty-nine 6P-specific sequence-tagged-site (STS) markers mapped on the resistance locus have been acquired, which will be helpful for the fine mapping of the stripe rust resistance locus. The stripe rust-resistant translocation lines were found to carry some favorable agronomic traits, which could facilitate their use in wheat improvement. Collectively, the stripe rust resistance locus from A . cristatum 6P could be a novel resistance source and the screened stripe rust-resistant materials will be valuable for wheat disease breeding.

  8. Mapping of stripe rust resistance gene in an Aegilops caudata ...

    Indian Academy of Sciences (India)

    Artificial rust epidemic was created by spraying the infector rows and experimental material with the mixture of uredinospores of Pst isolates 78S84 and 46S119. Stripe rust assessment was according to the modified Cobb's scale. (Peterson et al. 1948). The RIL population was screened at the seedling stage against leaf rust ...

  9. Genetics of adult plant stripe rust resistance in CSP44, a selection ...

    Indian Academy of Sciences (India)

    This suggests the presence of nonhypersensitive adult plant stripe rust resistance in the line CSP44. The evaluation of F1, F2 and F3 generations and F6 SSD families from the cross of CSP44 with susceptible wheat cultivar WL711 for stripe rust severity indicated that the resistance in CSP44 is based on two genes showing ...

  10. Stripe rust and leaf rust resistance QTL mapping, epistatic interactions, and co-localization with stem rust resistance loci in spring wheat evaluated over three continents.

    Science.gov (United States)

    Singh, A; Knox, R E; DePauw, R M; Singh, A K; Cuthbert, R D; Campbell, H L; Shorter, S; Bhavani, S

    2014-11-01

    In wheat, advantageous gene-rich or pleiotropic regions for stripe, leaf, and stem rust and epistatic interactions between rust resistance loci should be accounted for in plant breeding strategies. Leaf rust (Puccinia triticina Eriks.) and stripe rust (Puccinia striiformis f. tritici Eriks) contribute to major production losses in many regions worldwide. The objectives of this research were to identify and study epistatic interactions of quantitative trait loci (QTL) for stripe and leaf rust resistance in a doubled haploid (DH) population derived from the cross of Canadian wheat cultivars, AC Cadillac and Carberry. The relationship of leaf and stripe rust resistance QTL that co-located with stem rust resistance QTL previously mapped in this population was also investigated. The Carberry/AC Cadillac population was genotyped with DArT(®) and simple sequence repeat markers. The parents and population were phenotyped for stripe rust severity and infection response in field rust nurseries in Kenya (Njoro), Canada (Swift Current), and New Zealand (Lincoln); and for leaf rust severity and infection response in field nurseries in Canada (Swift Current) and New Zealand (Lincoln). AC Cadillac was a source of stripe rust resistance QTL on chromosomes 2A, 2B, 3A, 3B, 5B, and 7B; and Carberry was a source of resistance on chromosomes 2B, 4B, and 7A. AC Cadillac contributed QTL for resistance to leaf rust on chromosome 2A and Carberry contributed QTL on chromosomes 2B and 4B. Stripe rust resistance QTL co-localized with previously reported stem rust resistance QTL on 2B, 3B, and 7B, while leaf rust resistance QTL co-localized with 4B stem rust resistance QTL. Several epistatic interactions were identified both for stripe and leaf rust resistance QTL. We have identified useful combinations of genetic loci with main and epistatic effects. Multiple disease resistance regions identified on chromosomes 2A, 2B, 3B, 4B, 5B, and 7B are prime candidates for further investigation and

  11. Genetics of adult plant stripe rust resistance in CSP44, a selection ...

    Indian Academy of Sciences (India)

    Unknown

    Wheat line CSP44, a selection from an Australian bread wheat cultivar Condor, has shown resistance to stripe rust in. India since the last twenty years. Seedlings and adult plants of CSP44 showed susceptible infection types against stripe rust race 46S119 but displayed average terminal disease severity of 2.67 on adult ...

  12. Mapping genes for resistance to stripe rust in spring wheat landrace PI 480035

    Science.gov (United States)

    Stripe rust caused by Puccinia striiformis Westend. f. sp. tritici Erikks. is an economically important disease of wheat (Triticum aestivum L.). Hexaploid spring wheat landrace PI 480035 was highly resistant to stripe rust in the field in Washington during 2011 and 2012. The objective of this resear...

  13. Yr32 for resistance to stripe (yellow) rust present in the wheat cultivar Carstens V

    DEFF Research Database (Denmark)

    Eriksen, L.; Afshari, F.; Christiansen, M.J.

    2004-01-01

    Stripe or yellow rust of wheat, caused by Puccinia striiformis f. sp. tritici, is an important disease in many wheat-growing regions of the world. A number of major genes providing resistance to stripe rust have been used in breeding, including one gene that is present in the differential tester...... Carstens V. The objective of this study was to locate and map a stripe rust resistance gene transferred from Carstens V to Avocet S and to use molecular tools to locate a number of genes segregating in the cross Savannah/Senat. One of the genes present in Senat was predicted to be a gene that is present...... in Carstens V. For this latter purpose, stripe rust response data from both seedling and field tests on a doubled haploid population consisting of 77 lines were compared to an available molecular map for the same lines using a non-parametric quantitative trait loci (QTL) analysis. Results obtained in Denmark...

  14. Genetic analysis and location of gene for resistance to stripe rust in ...

    Indian Academy of Sciences (India)

    2013-08-06

    Aug 6, 2013 ... to rust race CYR26. The gene YrSD in Strube Dickkopf resistant to stripe rust CYR26 using SSR method was located on chromosome 5B. There are four pairs (Wmc640,. Barc59, Wmc783 and Wms497) polymorphic SSR primers on chromosome 5B which produced polymorphic DNA bands between the ...

  15. Introgression of Chromosome 3Ns from Psathyrostachys huashanica into Wheat Specifying Resistance to Stripe Rust

    Science.gov (United States)

    Kang, Houyang; Wang, Yi; Fedak, George; Cao, Wenguang; Zhang, Haiqin; Fan, Xing; Sha, Lina; Xu, Lili; Zheng, Youliang; Zhou, Yonghong

    2011-01-01

    Wheat stripe rust is a destructive disease in the cool and humid wheat-growing areas of the world. Finding diverse sources of stripe rust resistance is critical for increasing genetic diversity of resistance for wheat breeding programs. Stripe rust resistance was identified in the alien species Psathyrostachys huashanica, and a wheat- P. huashanica amphiploid line (PHW-SA) with stripe rust resistance was reported previously. In this study, a P. huashanica 3Ns monosomic addition line (PW11) with superior resistance to stripe rust was developed, which was derived from the cross between PHW-SA and wheat J-11. We evaluated the alien introgressions PW11-2, PW11-5 and PW11-8 which were derived from line PW11 for reaction to new Pst race CYR32, and used molecular and cytogenetic tools to characterize these lines. The introgressions were remarkably resistant to CYR32, suggesting that the resistance to stripe rust of the introgressions thus was controlled by gene(s) located on P. huashanica chromosome 3Ns. All derived lines were cytologically stable in term of meiotic chromosome behavior. Two 3Ns chromosomes of P. huashanica were detected in the disomic addition line PW11-2. Chromosomes 1B of substitution line PW11-5 had been replaced by a pair of P. huashanica 3Ns chromosomes. In PW11-8, a small terminal segment from P. huashanica chromosome arm 3NsS was translocated to the terminal region of wheat chromosomes 3BL. Thus, this translocated chromosome is designated T3BL-3NsS. These conclusions were further confirmed by SSR analyses. Two 3Ns-specific markers Xgwm181 and Xgwm161 will be useful to rapidly identify and trace the translocated fragments. These introgressions, which had significant characteristics of resistance to stripe rust, could be utilized as novel germplasms for wheat breeding. PMID:21760909

  16. Stem and stripe rust resistance in wheat induced by gamma rays and thermal neutrons

    International Nuclear Information System (INIS)

    Skorda, E.A.

    1977-01-01

    Attempts were made to produce rust-resistant mutants in wheat cultivars. Seeds of G-38290 and G-58383 (T. aestivum), Methoni and Ilectra (T. durum) varieties were irradiated with different doses of γ-rays (3.5, 5, 8, 11, 15 and 21 krad) and thermal neutrons (1.7, 4, 5.5, 7.5, 10.5 and 12.5x10 12 ) and the M 1 plants were grown under isolation in the field. The objective was mainly to induce stripe, leaf and stem rust resistance in G-38290, Methoni and Ilectra varieties and leaf rust resistance in G-58383. Mutations for rust resistance were detected by using the ''chimera method'' under natural and artificial field epiphytotic conditions in M 2 and successive generations. The mutants detected were tested for resistance to a broad spectrum of available races. Mutants resistant or moderately resistant to stripe and stem rusts but not to leaf rust, were selected from G-38290. From the other three varieties tested no rust-resistant mutants were detected. The frequency of resistant mutants obtained increased with increased γ-ray dose-rate, but not with increased thermal neutron doses. Some mutants proved to be resistant or moderately resistant to both rusts and others to one of them. Twenty of these mutants were evaluated for yield from M 5 to M 8 . Some of them have reached the final stage of regional yield trials and one, induced by thermal neutrons, was released this year. (author)

  17. Mapping of stripe rust resistance gene in an Aegilops caudate introgression line in wheat and its genetic association with leaf rust resistance.

    Science.gov (United States)

    Toor, Puneet Inder; Kaur, Satinder; Bansal, Mitaly; Yadav, Bharat; Chhuneja, Parveen

    2016-12-01

    A pair of stripe rust and leaf rust resistance genes was introgressed from Aegilops caudata, a nonprogenitor diploid species with the CC genome, to cultivated wheat. Inheritance and genetic mapping of stripe rust resistance gene in backcrossrecombinant inbred line (BC-RIL) population derived from the cross of a wheat-Ae. caudata introgression line (IL) T291- 2(pau16060) with wheat cv. PBW343 is reported here. Segregation of BC-RILs for stripe rust resistance depicted a single major gene conditioning adult plant resistance (APR) with stripe rust reaction varying from TR-20MS in resistant RILs signifying the presence of some minor genes as well. Genetic association with leaf rust resistance revealed that two genes are located at a recombination distance of 13%. IL T291-2 had earlier been reported to carry introgressions on wheat chromosomes 2D, 3D, 4D, 5D, 6D and 7D. Genetic mapping indicated the introgression of stripe rust resistance gene on wheat chromosome 5DS in the region carrying leaf rust resistance gene LrAc, but as an independent introgression. Simple sequence repeat (SSR) and sequence-tagged site (STS) markers designed from the survey sequence data of 5DS enriched the target region harbouring stripe and leaf rust resistance genes. Stripe rust resistance locus, temporarily designated as YrAc, mapped at the distal most end of 5DS linked with a group of four colocated SSRs and two resistance gene analogue (RGA)-STS markers at a distance of 5.3 cM. LrAc mapped at a distance of 9.0 cM from the YrAc and at 2.8 cM from RGA-STS marker Ta5DS_2737450, YrAc and LrAc appear to be the candidate genes for marker-assisted enrichment of the wheat gene pool for rust resistance.

  18. Identification and mapping of leaf, stem and stripe rust resistance quantitative trait loci and their interactions in durum wheat.

    Science.gov (United States)

    Singh, A; Pandey, M P; Singh, A K; Knox, R E; Ammar, K; Clarke, J M; Clarke, F R; Singh, R P; Pozniak, C J; Depauw, R M; McCallum, B D; Cuthbert, R D; Randhawa, H S; Fetch, T G

    2013-02-01

    Leaf rust (Puccinia triticina Eriks.), stripe rust (Puccinia striiformis f. tritici Eriks.) and stem rust (Puccinia graminis f. sp. tritici) cause major production losses in durum wheat (Triticum turgidum L. var. durum). The objective of this research was to identify and map leaf, stripe and stem rust resistance loci from the French cultivar Sachem and Canadian cultivar Strongfield. A doubled haploid population from Sachem/Strongfield and parents were phenotyped for seedling reaction to leaf rust races BBG/BN and BBG/BP and adult plant response was determined in three field rust nurseries near El Batan, Obregon and Toluca, Mexico. Stripe rust response was recorded in 2009 and 2011 nurseries near Toluca and near Njoro, Kenya in 2010. Response to stem rust was recorded in field nurseries near Njoro, Kenya, in 2010 and 2011. Sachem was resistant to leaf, stripe and stem rust. A major leaf rust quantitative trait locus (QTL) was identified on chromosome 7B at Xgwm146 in Sachem. In the same region on 7B, a stripe rust QTL was identified in Strongfield. Leaf and stripe rust QTL around DArT marker wPt3451 were identified on chromosome 1B. On chromosome 2B, a significant leaf rust QTL was detected conferred by Strongfield, and at the same QTL, a Yr gene derived from Sachem conferred resistance. Significant stem rust resistance QTL were detected on chromosome 4B. Consistent interactions among loci for resistance to each rust type across nurseries were detected, especially for leaf rust QTL on 7B. Sachem and Strongfield offer useful sources of rust resistance genes for durum rust breeding.

  19. Identification and mapping of leaf, stem and stripe rust resistance quantitative trait loci and their interactions in durum wheat

    OpenAIRE

    Singh, A.; Pandey, M. P.; Singh, A. K.; Knox, R. E.; Ammar, K.; Clarke, J. M.; Clarke, F. R.; Singh, R. P.; Pozniak, C. J.; DePauw, R. M.; McCallum, B. D.; Cuthbert, R. D.; Randhawa, H. S.; Fetch, T. G.

    2012-01-01

    Leaf rust (Puccinia triticina Eriks.), stripe rust (Puccinia striiformis f. tritici Eriks.) and stem rust (Puccinia graminis f. sp. tritici) cause major production losses in durum wheat (Triticum turgidum L. var. durum). The objective of this research was to identify and map leaf, stripe and stem rust resistance loci from the French cultivar Sachem and Canadian cultivar Strongfield. A doubled haploid population from Sachem/Strongfield and parents were phenotyped for seedling reaction to leaf ...

  20. Genetic characterisation of novel resistance alleles to stem rust and stripe rust in wheat-alien introgression lines

    OpenAIRE

    Rahmatov, Mahbubjon

    2016-01-01

    Bread wheat (Triticum aestivum L., 2n = 6x = 42, AABBDD) is one of the most important food crops world-wide, but is attacked by many diseases and pests that cause significant yield losses. Globally, stem rust (Sr) (Puccinia graminis f. sp. tritici Erikss & E. Henning), stripe rust (Yr) (Puccinia striiformis Westend. f. sp. tritici Eriks) and leaf rust (Lr) (Puccinia triticina Eriks) are a great threat to wheat production. The majority of the Sr, Yr and Lr resistance genes are already defeated...

  1. Partial resistance to stripe rust and its effect on sustainability of wheat yield

    International Nuclear Information System (INIS)

    Qamar, M.; Din, R.U.; Gardazi, D.A.

    2014-01-01

    Stripe rust (Puccinia striiformis Westend. f. sp. tritici) poses a serious threat to wheat production in cooler areas of Pakistan. The 70% area of wheat in Pakistan is prone to stripe rust disease. It can cause 10-17% yield losses if susceptible cultivars are planted under favorable conditions. Level of partial plant resistance in bread wheat and its impact on sustainable wheat production was studied at the National Agricultural Research Centre, Islamabad under natural conditions in the field. Eleven Pakistani commercial wheat cultivars/advance lines including check (Inqalab 91) were assessed for the level of partial resistance against stripe rust using Area Under the Disease Progress Curve (AUDPC), disease severity (DS) and epidemic growth rate in comparison with wheat cultivar, Inqalab 91. During 2007 cropping season, natural epidemic was developed and relative AUDPC was recorded from 0 to 100% whereas the 2008 cropping season was dry and no stripe rust appeared. Two advanced lines (NR 268 and NR 285) showed the infection type (IT) less than 7 (incompatible reaction) to the mixture of prevailing stripe rust inoculums. Very low level of DS and AUDPC were recorded in the remaining cultivars/lines indicating a high level of partial resistance to stripe rust compared to the susceptible check cultivar, Inqalab 91. Among eight cultivars/lines that showed compatible type of reaction (IT greater then equal to 7), one was resistant (relative AUDPC = 20% of Inqalab 91) and six showed very high resistance levels (relative AUDPC greater then equal to 5%). Maximum level of resistance (relative AUDPC = 0.1%) was observed in advanced line, NR 271. The wheat cultivars/lines that showed a slow disease development (low DS and AUDPC), could be considered as -1 partially resistant for stripe rust infection. The yield (2178 kg ha) of susceptible check cultivar Inqalab-91 during 2007 was reduced to 45% as -1 compared to its yield (3945 kg ha) in epidemic free year (2008). Thus the use

  2. Introgression of leaf rust and stripe rust resistance from Sharon goatgrass (Aegilops sharonensis Eig) into bread wheat (Triticum aestivum L.).

    Science.gov (United States)

    Millet, E; Manisterski, J; Ben-Yehuda, P; Distelfeld, A; Deek, J; Wan, A; Chen, X; Steffenson, B J

    2014-06-01

    Leaf rust and stripe rust are devastating wheat diseases, causing significant yield losses in many regions of the world. The use of resistant varieties is the most efficient way to protect wheat crops from these diseases. Sharon goatgrass (Aegilops sharonensis or AES), which is a diploid wild relative of wheat, exhibits a high frequency of leaf and stripe rust resistance. We used the resistant AES accession TH548 and induced homoeologous recombination by the ph1b allele to obtain resistant wheat recombinant lines carrying AES chromosome segments in the genetic background of the spring wheat cultivar Galil. The gametocidal effect from AES was overcome by using an "anti-gametocidal" wheat mutant. These recombinant lines were found resistant to highly virulent races of the leaf and stripe rust pathogens in Israel and the United States. Molecular DArT analysis of the different recombinant lines revealed different lengths of AES segments on wheat chromosome 6B, which indicates the location of both resistance genes.

  3. Mapping of stripe rust resistance gene in an Aegilops caudata ...

    Indian Academy of Sciences (India)

    PUNEET INDER TOOR

    end of 5DS linked with a group of four colocated SSRs and two resistance gene analogue (RGA)-STS markers at a distance of 5.3 cM. ... and LrAc appear to be the candidate genes for marker-assisted enrichment of the wheat gene pool for rust resistance. [Toor P. I., Kaur S., Bansal ..... stocks with reduced alien chromatin.

  4. Identification of QTL conferring resistance to stripe rust (Puccinia striiformis f. sp. hordei) and leaf rust (Puccinia hordei) in barley using nested association mapping (NAM).

    Science.gov (United States)

    Vatter, Thomas; Maurer, Andreas; Perovic, Dragan; Kopahnke, Doris; Pillen, Klaus; Ordon, Frank

    2018-01-01

    The biotrophic rust fungi Puccinia hordei and Puccinia striiformis are important barley pathogens with the potential to cause high yield losses through an epidemic spread. The identification of QTL conferring resistance to these pathogens is the basis for targeted breeding approaches aiming to improve stripe rust and leaf rust resistance of modern cultivars. Exploiting the allelic richness of wild barley accessions proved to be a valuable tool to broaden the genetic base of resistance of barley cultivars. In this study, SNP-based nested association mapping (NAM) was performed to map stripe rust and leaf rust resistance QTL in the barley NAM population HEB-25, comprising 1,420 lines derived from BC1S3 generation. By scoring the percentage of infected leaf area, followed by calculation of the area under the disease progress curve and the average ordinate during a two-year field trial, a large variability of resistance across and within HEB-25 families was observed. NAM based on 5,715 informative SNPs resulted in the identification of twelve and eleven robust QTL for resistance against stripe rust and leaf rust, respectively. Out of these, eight QTL for stripe rust and two QTL for leaf rust are considered novel showing no overlap with previously reported resistance QTL. Overall, resistance to both pathogens in HEB-25 is most likely due to the accumulation of numerous small effect loci. In addition, the NAM results indicate that the 25 wild donor QTL alleles present in HEB-25 strongly differ in regard to their individual effect on rust resistance. In future, the NAM concept will allow to select and combine individual wild barley alleles from different HEB parents to increase rust resistance in barley. The HEB-25 results will support to unravel the genetic basis of rust resistance in barley, and to improve resistance against stripe rust and leaf rust of modern barley cultivars.

  5. Identification of QTL conferring resistance to stripe rust (Puccinia striiformis f. sp. hordei) and leaf rust (Puccinia hordei) in barley using nested association mapping (NAM)

    Science.gov (United States)

    Vatter, Thomas; Maurer, Andreas; Perovic, Dragan; Kopahnke, Doris; Pillen, Klaus

    2018-01-01

    The biotrophic rust fungi Puccinia hordei and Puccinia striiformis are important barley pathogens with the potential to cause high yield losses through an epidemic spread. The identification of QTL conferring resistance to these pathogens is the basis for targeted breeding approaches aiming to improve stripe rust and leaf rust resistance of modern cultivars. Exploiting the allelic richness of wild barley accessions proved to be a valuable tool to broaden the genetic base of resistance of barley cultivars. In this study, SNP-based nested association mapping (NAM) was performed to map stripe rust and leaf rust resistance QTL in the barley NAM population HEB-25, comprising 1,420 lines derived from BC1S3 generation. By scoring the percentage of infected leaf area, followed by calculation of the area under the disease progress curve and the average ordinate during a two-year field trial, a large variability of resistance across and within HEB-25 families was observed. NAM based on 5,715 informative SNPs resulted in the identification of twelve and eleven robust QTL for resistance against stripe rust and leaf rust, respectively. Out of these, eight QTL for stripe rust and two QTL for leaf rust are considered novel showing no overlap with previously reported resistance QTL. Overall, resistance to both pathogens in HEB-25 is most likely due to the accumulation of numerous small effect loci. In addition, the NAM results indicate that the 25 wild donor QTL alleles present in HEB-25 strongly differ in regard to their individual effect on rust resistance. In future, the NAM concept will allow to select and combine individual wild barley alleles from different HEB parents to increase rust resistance in barley. The HEB-25 results will support to unravel the genetic basis of rust resistance in barley, and to improve resistance against stripe rust and leaf rust of modern barley cultivars. PMID:29370232

  6. Identification of QTL conferring resistance to stripe rust (Puccinia striiformis f. sp. hordei and leaf rust (Puccinia hordei in barley using nested association mapping (NAM.

    Directory of Open Access Journals (Sweden)

    Thomas Vatter

    Full Text Available The biotrophic rust fungi Puccinia hordei and Puccinia striiformis are important barley pathogens with the potential to cause high yield losses through an epidemic spread. The identification of QTL conferring resistance to these pathogens is the basis for targeted breeding approaches aiming to improve stripe rust and leaf rust resistance of modern cultivars. Exploiting the allelic richness of wild barley accessions proved to be a valuable tool to broaden the genetic base of resistance of barley cultivars. In this study, SNP-based nested association mapping (NAM was performed to map stripe rust and leaf rust resistance QTL in the barley NAM population HEB-25, comprising 1,420 lines derived from BC1S3 generation. By scoring the percentage of infected leaf area, followed by calculation of the area under the disease progress curve and the average ordinate during a two-year field trial, a large variability of resistance across and within HEB-25 families was observed. NAM based on 5,715 informative SNPs resulted in the identification of twelve and eleven robust QTL for resistance against stripe rust and leaf rust, respectively. Out of these, eight QTL for stripe rust and two QTL for leaf rust are considered novel showing no overlap with previously reported resistance QTL. Overall, resistance to both pathogens in HEB-25 is most likely due to the accumulation of numerous small effect loci. In addition, the NAM results indicate that the 25 wild donor QTL alleles present in HEB-25 strongly differ in regard to their individual effect on rust resistance. In future, the NAM concept will allow to select and combine individual wild barley alleles from different HEB parents to increase rust resistance in barley. The HEB-25 results will support to unravel the genetic basis of rust resistance in barley, and to improve resistance against stripe rust and leaf rust of modern barley cultivars.

  7. Remapping of the stripe rust resistance gene Yr10 in common wheat.

    Science.gov (United States)

    Yuan, Cuiling; Wu, Jingzheng; Yan, Baiqiang; Hao, Qunqun; Zhang, Chaozhong; Lyu, Bo; Ni, Fei; Caplan, Allan; Wu, Jiajie; Fu, Daolin

    2018-02-23

    Yr10 is an important gene to control wheat stripe rust, and the search for Yr10 needs to be continued. Wheat stripe rust or yellow rust is a devastating fungal disease caused by Puccinia striiformis f. sp. tritici (Pst). Host disease resistance offers a primary source for controlling wheat stripe rust. The stripe rust resistance gene Yr10 confers the race-specific resistance to most tested Pst races in China including CYR29. Early studies proposed that Yr10 was a nucleotide-binding site, leucine-rich repeat gene archived as GenBank accession AF149112 (hereafter designated the Yr10 candidate gene or Yr10 CG ). In this study, we revealed that 15 Chinese wheat cultivars positive for Yr10 CG are susceptible to CYR29. We then expressed the Yr10 CG cDNA in the common wheat 'Bobwhite'. The Yr10 CG -cDNA positive transgenic plants were also susceptible to CYR29. Thus, it is highly unlikely that Yr10 CG corresponds to the Yr10 resistance gene. Using the Yr10 donor 'Moro' and the Pst-susceptible wheat 'Huixianhong', we generated two F 3 populations that displayed a single Mendelian segregation on the Yr10 gene, and used them to remap the Yr10 gene. Six markers were placed in the Yr10 region, with the Yr10 CG gene now mapping about 1.2-cM proximal to the Yr10 locus and the Xsdauw79 marker is completely linked to the Yr10 locus. Apparently, the Yr10 gene has not yet been identified. Fine mapping and positional cloning of Yr10 is important for gene pyramiding for stripe rust resistance in wheat.

  8. Genetics of adult plant stripe rust resistance in CSP44, a selection ...

    Indian Academy of Sciences (India)

    Unknown

    areas of temperate zones (Johnson 1988). Yield losses can be considerable, ranging from about 40 per cent to com- plete destruction of the crop depending upon the growth stage at which the disease attacks. Using diverse genes for resistance against stripe rust disease is the most eco- nomical and environmentally safe ...

  9. Molecular mapping of a stripe rust resistance gene in wheat line C51

    Indian Academy of Sciences (India)

    Stripe rust, a major disease in areas where cool temperatures prevail, can strongly influence grain yield. To control this disease, breeders have incorporated seedling resistance genes from a variety of sources outside the primary wheat gene pool. The wheat line C51, introduced from the International Center for Agricultural ...

  10. Mapping of quantitative adult plant field resistance to leaf rust and stripe rust in two European winter wheat populations reveals co-location of three QTL conferring resistance to both rust pathogens.

    Science.gov (United States)

    Buerstmayr, Maria; Matiasch, Lydia; Mascher, Fabio; Vida, Gyula; Ittu, Marianna; Robert, Olivier; Holdgate, Sarah; Flath, Kerstin; Neumayer, Anton; Buerstmayr, Hermann

    2014-09-01

    We detected several, most likely novel QTL for adult plant resistance to rusts. Notably three QTL improved resistance to leaf rust and stripe rust simultaneously indicating broad spectrum resistance QTL. The rusts of wheat (Puccinia spp.) are destructive fungal wheat diseases. The deployment of resistant cultivars plays a central role in integrated rust disease management. Durability of resistance would be preferred, but is difficult to analyse. The Austrian winter wheat cultivar Capo was released in the 1989 and grown on a large acreage during more than two decades and maintained a good level of quantitative leaf rust and stripe rust resistance. Two bi-parental mapping populations: Capo × Arina and Capo × Furore were tested in multiple environments for severity of leaf rust and stripe rust at the adult plant stage in replicated field experiments. Quantitative trait loci associated with leaf rust and stripe rust severity were mapped using DArT and SSR markers. Five QTL were detected in multiple environments associated with resistance to leaf rust designated as QLr.ifa-2AL, QLr.ifa-2BL, QLr.ifa-2BS, QLr.ifa-3BS, and QLr.ifa-5BL, and five for resistance to stripe rust QYr.ifa-2AL, QYr.ifa-2BL, QYr.ifa-3AS, QYr.ifa-3BS, and QYr.ifa-5A. For all QTL apart from two (QYr.ifa-3AS, QLr.ifa-5BL) Capo contributed the resistance improving allele. The leaf rust and stripe rust resistance QTL on 2AL, 2BL and 3BS mapped to the same chromosome positions, indicating either closely linked genes or pleiotropic gene action. These three multiple disease resistance QTL (QLr.ifa-2AL/QYr.ifa-2AL, QLr.ifa.2BL/QYr.ifa-2BL, QLr.ifa-3BS/QYr.ifa.3BS) potentially contribute novel resistance sources for stripe rust and leaf rust. The long-lasting resistance of Capo apparently rests upon a combination of several genes. The described germplasm, QTL and markers are applicable for simultaneous resistance improvement against leaf rust and stripe rust.

  11. Race-Specific Adult-Plant Resistance in Winter Wheat to Stripe Rust and Characterization of Pathogen Virulence Patterns.

    Science.gov (United States)

    Milus, Eugene A; Moon, David E; Lee, Kevin D; Mason, R Esten

    2015-08-01

    Stripe rust, caused by Puccinia striiformis f. sp. tritici, is an important disease of wheat in the Great Plains and southeastern United States. Growing resistant cultivars is the preferred means for managing stripe rust, but new virulence in the pathogen population overcomes some of the resistance. The objectives of this study were to characterize the stripe rust resistance in contemporary soft and hard red winter wheat cultivars, to characterize the virulence of P. striiformis f. sp. tritici isolates based on the resistances found in the cultivars, and to determine wheat breeders' perceptions on the importance and methods for achieving stripe rust resistance. Seedlings of cultivars were susceptible to recent isolates, indicating they lacked effective all-stage resistance. However, adult-plants were resistant or susceptible depending on the isolate, indicating they had race-specific adult-plant resistance. Using isolates collected from 1990 to 2013, six major virulence patterns were identified on adult plants of twelve cultivars that were selected as adult-plant differentials. Race-specific adult-plant resistance appears to be the only effective type of resistance protecting wheat from stripe rust in eastern United States. Among wheat breeders, the importance of incorporating stripe rust resistance into cultivars ranged from high to low depending on the frequency of epidemics in their region, and most sources of stripe rust resistance were either unknown or already overcome by virulence in the pathogen population. Breeders with a high priority for stripe rust resistance made most of their selections based on adult-plant reactions in the field, whereas breeders with a low priority for resistance based selections on molecular markers for major all-stage resistance genes.

  12. Wheat Stripe Rust

    OpenAIRE

    Pace, Mike; Israelsen, Clark; Evans, Kent; Barnhill, James

    2008-01-01

    Stripe rust, or yellow rust, is primarily a foliar fungal disease of wheat, although it can infect spike and stem tissues. If the pathogen infects the spike (head) it causes extensive quality and grain yield loss. The disease is caused by the fungus Puccinia striiformis f. sp. tritici. The fungus can only survive and reproduce on wheat. It survives from one season to the next on volunteer plants.

  13. Appraisal of wheat germplasm for adult plant resistance against stripe rust

    Directory of Open Access Journals (Sweden)

    Saleem Kamran

    2015-12-01

    Full Text Available The resurgence of wheat stripe rust is of great concern for world food security. Owing to resistance breakdown and the appearance of new virulent high-temperature adapted races of Puccinia striiformis f. sp. tritici (Pst, many high yielding commercial varieties in the country lost their yield potential. Searching for new sources of resistance is the best approach to mitigate the problem. Quantitative resistance (partial or adult plant or durable resistance is reported to be more stable than race specific resistance. In the current perusal, a repertoire of 57 promising wheat lines along with the KLcheck line Morocco, developed through hybridisation and selection of local and international lines with International Maize and Wheat Improvement Center (CIMMYT origin, were evaluated under natural field conditions at Nuclear Institute for Agriculture and Biology (NIAB during the 2012−2013 and 2013−2014 time periods. Final rust severity (FRS, the area under the rust progress curve (AURPC, the relative area under the rust progress curve (rAURPC, and the coefficient of infection (CI were unraveled to infer the level of quantitative resistance. Final rust severity was recorded when the susceptible check exhibited 100% severity. There were 21 lines which were immune (no disease, 16 which were resistant, five moderately resistant, two resistant-to-moderately resistant, one moderately resistant-to-moderately susceptible, 5 moderately susceptible-to-susceptible, one moderately susceptible, and six exhibited a susceptible response. Nevertheless, 51 lines exhibited a high level of partial resistance while the three lines, NW-5-1212-1, NW-7-30-1, and NW-7-5 all showed a moderate level of partial resistance based on FRS, while 54 lines, on the basis of AURPC and rAURPC, were identified as conferring a high level of partial resistance. Moreover, adult plant resistance was conferred by 47 wheat lines, based on CI value. It was striking that, 13 immune lines

  14. Effective genes for resistance to stripe rust and virulence of Puccinia ...

    African Journals Online (AJOL)

    The results revealed that stripe rust resistance genes Yr3, Yr5, Yr10, Yr15, Yr26, YrSP and YrCV were resistant, while Yr18 showed moderate susceptibility at all locations. Genes YrA-, Yr2, Yr6, Yr7, Yr8, Yr9, Yr17, Yr27 and gene combinations Opata (Yr27+Yr18) and Super Kauz (Yr9, Yr27, Yr18) were found susceptible.

  15. Characterization of molecular diversity and genome-wide mapping of loci associated with resistance to stripe rust and stem rust in Ethiopian bread wheat accessions.

    Science.gov (United States)

    Muleta, Kebede T; Rouse, Matthew N; Rynearson, Sheri; Chen, Xianming; Buta, Bedada G; Pumphrey, Michael O

    2017-08-04

    The narrow genetic basis of resistance in modern wheat cultivars and the strong selection response of pathogen populations have been responsible for periodic and devastating epidemics of the wheat rust diseases. Characterizing new sources of resistance and incorporating multiple genes into elite cultivars is the most widely accepted current mechanism to achieve durable varietal performance against changes in pathogen virulence. Here, we report a high-density molecular characterization and genome-wide association study (GWAS) of stripe rust and stem rust resistance in 190 Ethiopian bread wheat lines based on phenotypic data from multi-environment field trials and seedling resistance screening experiments. A total of 24,281 single nucleotide polymorphism (SNP) markers filtered from the wheat 90 K iSelect genotyping assay was used to survey Ethiopian germplasm for population structure, genetic diversity and marker-trait associations. Upon screening for field resistance to stripe rust in the Pacific Northwest of the United States and Ethiopia over multiple growing seasons, and against multiple races of stripe rust and stem rust at seedling stage, eight accessions displayed resistance to all tested races of stem rust and field resistance to stripe rust in all environments. Our GWAS results show 15 loci were significantly associated with seedling and adult plant resistance to stripe rust at false discovery rate (FDR)-adjusted probability (P) rust in the Ethiopian wheat accessions. Many of the identified resistance loci were mapped close to previously identified rust resistance genes; however, three loci on the short arms of chromosomes 5A and 7B for stripe rust resistance and two on chromosomes 3B and 7B for stem rust resistance may be novel. Our results demonstrate that considerable genetic variation resides within the landrace accessions that can be utilized to broaden the genetic base of rust resistance in wheat breeding germplasm. The molecular markers identified in

  16. Cytogenetics and stripe rust resistance of wheat-Thinopyrum elongatum hybrid derivatives.

    Science.gov (United States)

    Li, Daiyan; Long, Dan; Li, Tinghui; Wu, Yanli; Wang, Yi; Zeng, Jian; Xu, Lili; Fan, Xing; Sha, Lina; Zhang, Haiqin; Zhou, Yonghong; Kang, Houyang

    2018-01-01

    Amphidiploids generated by distant hybridization are commonly used as genetic bridge to transfer desirable genes from wild wheat species into cultivated wheat. This method is typically used to enhance the resistance of wheat to biotic or abiotic stresses, and to increase crop yield and quality. Tetraploid Thinopyrum elongatum exhibits strong adaptability, resistance to stripe rust and Fusarium head blight, and tolerance to salt, drought, and cold. In the present study, we produced hybrid derivatives by crossing and backcrossing the Triticum durum-Th. elongatum partial amphidiploid ( Trititrigia 8801, 2 n  = 6 ×  = 42, AABBEE) with wheat cultivars common to the Sichuan Basin. By means of cytogenetic and disease resistance analyses, we identified progeny harboring alien chromosomes and measured their resistance to stripe rust. Hybrid progenies possessed chromosome numbers ranging from 40 to 47 (mean = 42.72), with 40.0% possessing 42 chromosomes. Genomic in situ hybridization revealed that the number of alien chromosomes ranged from 1 to 11. Out of the 50 of analyzed lines, five represented chromosome addition (2 n  = 44 = 42 W + 2E) and other five were chromosome substitution lines (2 n  = 42 = 40 W + 2E). Importantly, a single chromosome derived from wheat- Th. elongatum intergenomic Robertsonian translocations chromosome was occurred in 12 lines. Compared with the wheat parental cultivars ('CN16' and 'SM482'), the majority (70%) of the derivative lines were highly resistant to strains of stripe rust pathogen known to be prevalent in China. The findings suggest that these hybrid-derivative lines with stripe rust resistance could potentially be used as germplasm sources for further wheat improvement.

  17. The dissection and SSR mapping of a high-temperature adult-plant stripe rust resistance gene in American spring wheat cultivar Alturas

    Science.gov (United States)

    Stripe rust is one of major diseases in wheat production worldwide. The best economic and efficient method is to utilize resistant varieties. Alturas has high-temperature adult-plant resistance. In order to determine stripe rust resistance characteristics, resistance gene combination and molecular m...

  18. Genomic and pedigree-based prediction for leaf, stem, and stripe rust resistance in wheat.

    Science.gov (United States)

    Juliana, Philomin; Singh, Ravi P; Singh, Pawan K; Crossa, Jose; Huerta-Espino, Julio; Lan, Caixia; Bhavani, Sridhar; Rutkoski, Jessica E; Poland, Jesse A; Bergstrom, Gary C; Sorrells, Mark E

    2017-07-01

    Genomic prediction for seedling and adult plant resistance to wheat rusts was compared to prediction using few markers as fixed effects in a least-squares approach and pedigree-based prediction. The unceasing plant-pathogen arms race and ephemeral nature of some rust resistance genes have been challenging for wheat (Triticum aestivum L.) breeding programs and farmers. Hence, it is important to devise strategies for effective evaluation and exploitation of quantitative rust resistance. One promising approach that could accelerate gain from selection for rust resistance is 'genomic selection' which utilizes dense genome-wide markers to estimate the breeding values (BVs) for quantitative traits. Our objective was to compare three genomic prediction models including genomic best linear unbiased prediction (GBLUP), GBLUP A that was GBLUP with selected loci as fixed effects and reproducing kernel Hilbert spaces-markers (RKHS-M) with least-squares (LS) approach, RKHS-pedigree (RKHS-P), and RKHS markers and pedigree (RKHS-MP) to determine the BVs for seedling and/or adult plant resistance (APR) to leaf rust (LR), stem rust (SR), and stripe rust (YR). The 333 lines in the 45th IBWSN and the 313 lines in the 46th IBWSN were genotyped using genotyping-by-sequencing and phenotyped in replicated trials. The mean prediction accuracies ranged from 0.31-0.74 for LR seedling, 0.12-0.56 for LR APR, 0.31-0.65 for SR APR, 0.70-0.78 for YR seedling, and 0.34-0.71 for YR APR. For most datasets, the RKHS-MP model gave the highest accuracies, while LS gave the lowest. GBLUP, GBLUP A, RKHS-M, and RKHS-P models gave similar accuracies. Using genome-wide marker-based models resulted in an average of 42% increase in accuracy over LS. We conclude that GS is a promising approach for improvement of quantitative rust resistance and can be implemented in the breeding pipeline.

  19. Identification and characterization of pleiotropic and co-located resistance loci to leaf rust and stripe rust in bread wheat cultivar Sujata.

    Science.gov (United States)

    Lan, Caixia; Zhang, Yelun; Herrera-Foessel, Sybil A; Basnet, Bhoja R; Huerta-Espino, Julio; Lagudah, Evans S; Singh, Ravi P

    2015-03-01

    Two new co-located resistance loci, QLr.cim - 1AS/QYr.cim - 1AS and QLr.cim - 7BL/YrSuj , in combination with Lr46 / Yr29 and Lr67/Yr46 , and a new leaf rust resistance quantitative trait loci, conferred high resistance to rusts in adult plant stage. The tall Indian bread wheat cultivar Sujata displays high and low infection types to leaf rust and stripe rust, respectively, at the seedling stage in greenhouse tests. It was also highly resistant to both rusts at adult plant stage in field trials in Mexico. The genetic basis of this resistance was investigated in a population of 148 F5 recombinant inbred lines (RILs) derived from the cross Avocet × Sujata. The parents and RIL population were characterized in field trials for resistance to leaf rust during 2011 at El Batán, and 2012 and 2013 at Ciudad Obregón, Mexico, and for stripe rust during 2011 and 2012 at Toluca, Mexico; they were also characterized three times for stripe rust at seedling stage in the greenhouse. The RILs were genotyped with diversity arrays technology and simple sequence repeat markers. The final genetic map was constructed with 673 polymorphic markers. Inclusive composite interval mapping analysis detected two new significant co-located resistance loci, QLr.cim-1AS/QYr.cim-1AS and QLr.cim-7BL/YrSuj, on chromosomes 1AS and 7BL, respectively. The chromosomal position of QLr.cim-7BL overlapped with the seedling stripe rust resistance gene, temporarily designated as YrSuj. Two previously reported pleiotropic adult plant resistance genes, Lr46/Yr29 and Lr67/Yr46, and a new leaf rust resistance quantitative trait loci derived from Avocet were also mapped in the population. The two new co-located resistance loci are expected to contribute to breeding durable rust resistance in wheat. Closely linked molecular markers can be used to transfer all four resistance loci simultaneously to modern wheat varieties.

  20. Characterization of non-host resistance in broad bean to the wheat stripe rust pathogen

    Directory of Open Access Journals (Sweden)

    Cheng Yulin

    2012-06-01

    Full Text Available Abstract Background Non-host resistance (NHR confers plant species immunity against the majority of microbial pathogens and represents the most robust and durable form of plant resistance in nature. As one of the main genera of rust fungi with economic and biological importance, Puccinia infects almost all cereals but is unable to cause diseases on legumes. Little is known about the mechanism of this kind of effective defense in legumes to these non-host pathogens. Results In this study, the basis of NHR in broad bean (Vicia faba L. against the wheat stripe rust pathogen, Puccinia striiformis f. sp. tritici (Pst, was characterized. No visible symptoms were observed on broad bean leaves inoculated with Pst. Microscopic observations showed that successful location of stomata and haustoria formation were significantly reduced in Pst infection of broad bean. Attempted infection induced the formation of papillae, cell wall thickening, production of reactive oxygen species, callose deposition and accumulation of phenolic compounds in plant cell walls. The few Pst haustoria that did form in broad bean cells were encased in reactive oxygen and callose materials and those cells elicited cell death. Furthermore, a total of seven defense-related genes were identified and found to be up-regulated during the Pst infection. Conclusions The results indicate that NHR in broad bean against Pst results from a continuum of layered defenses, including basic incompatibility, structural and chemical strengthening of cell wall, posthaustorial hypersensitive response and induction of several defense-related genes, demonstrating the multi-layered feature of NHR. This work also provides useful information for further determination of resistance mechanisms in broad bean to rust fungi, especially the adapted important broad bean rust pathogen, Uromyces viciae-fabae, because of strong similarity and association between NHR of plants to unadapted pathogens and basal

  1. Genome-Wide Association Mapping for Resistance to Leaf and Stripe Rust in Winter-Habit Hexaploid Wheat Landraces.

    Directory of Open Access Journals (Sweden)

    Albert Kertho

    Full Text Available Leaf rust, caused by Puccinia triticina (Pt, and stripe rust, caused by P. striiformis f. sp. tritici (Pst, are destructive foliar diseases of wheat worldwide. Breeding for disease resistance is the preferred strategy of managing both diseases. The continued emergence of new races of Pt and Pst requires a constant search for new sources of resistance. Here we report a genome-wide association analysis of 567 winter wheat (Triticum aestivum landrace accessions using the Infinium iSelect 9K wheat SNP array to identify loci associated with seedling resistance to five races of Pt (MDCL, MFPS, THBL, TDBG, and TBDJ and one race of Pst (PSTv-37 frequently found in the Northern Great Plains of the United States. Mixed linear models identified 65 and eight significant markers associated with leaf rust and stripe rust, respectively. Further, we identified 31 and three QTL associated with resistance to Pt and Pst, respectively. Eleven QTL, identified on chromosomes 3A, 4A, 5A, and 6D, are previously unknown for leaf rust resistance in T. aestivum.

  2. Influence of stripe rust infection on the photosynthetic characteristics and antioxidant system of susceptible and resistant wheat cultivars at the adult plant stage.

    Science.gov (United States)

    Chen, Yang-Er; Cui, Jun-Mei; Su, Yan-Qiu; Yuan, Shu; Yuan, Ming; Zhang, Huai-Yu

    2015-01-01

    Wheat stripe rust (Puccinia striiformis f. sp. tritici, Pst), is one of the most serious diseases of wheat (Triticum aestivum L.) worldwide. To gain a better understanding of the protective mechanism against stripe rust at the adult plant stage, the differences in photosystem II and antioxidant enzymatic systems between susceptible and resistant wheat in response to stripe rust disease (P. striiformis) were investigated. We found that chlorophyll fluorescence and the activities of the antioxidant enzymes were higher in resistant wheat than in susceptible wheat after stripe rust infection. Compared with the susceptible wheat, the resistant wheat accumulated a higher level of D1 protein and a lower level of reactive oxygen species after infection. Furthermore, our results demonstrate that D1 and light-harvesting complex II (LHCII) phosphorylation are involved in the resistance to stripe rust in wheat. The CP29 protein was phosphorylated under stripe rust infection, like its phosphorylation in other monocots under environmental stresses. More extensive damages occur on the thylakoid membranes in the susceptible wheat compared with the resistant wheat. The findings provide evidence that thylakoid protein phosphorylation and antioxidant enzyme systems play important roles in plant responses and defense to biotic stress.

  3. Genetic effects for controlling stripe rust (Puccinia striiformis f. sp. tritici resistance in wheat through joint segregation analysis

    Directory of Open Access Journals (Sweden)

    Kalim Ullah

    2016-06-01

    Full Text Available Mixed inheritance analysis using joint segregation analysis (JSA for stripe rust (Puccinia striiformis f. sp. tritici resistance was carried out in six basic populations (P1, F1, P2, BC1, BC2 and F2 of four wheat crosses (Hashim-08 × LU-26, Farid-06 × Shafaq, Parula × Blue Silver, TD-1 × D-97603 during crop season 2009 to 2012. Genes controlling stripe rust resistance were assessed by using area under disease progress curve (AUDPC. The AUDPC was controlled by mixed two additive-dominant-epistatic major genes plus additive-dominant-epistasis of polygenes in cross Hashim-08 × LU-26 (model E, while in Farid-06 × Shafaq, it was controlled by mixed two major additive-dominant genes plus additive-dominant polygenes (model E-2. In cross Parula × Blue Silver, the AUDPC was managed by additive, dominance and epistasis of two major genes (model B-1, however, it was controlled by mixed one major gene and additive dominant polygenes in cross TD-1 × D-97603 (model D-1. Genetic variation and heritability was higher in major genes than polygene for all the crosses showing that AUDPC was mainly controlled by major genes. The genetic behavior of the AUDPC revealed that stripe rust resistance was controlled by mixed interaction of one to two major genes plus polygenes.

  4. Screening of wheat germplasm for the source of resistance against leaf and stripe rust under climatic conditions in Bhakkar

    International Nuclear Information System (INIS)

    Bhatti, M.A.; Burhan, M.; Shahzad, M.A.; Aslam, M.

    2009-01-01

    A field experiment was conducted to assess the level of resistance and susceptibility against stripe and leaf rust of wheat at Arid Zone Research 1, Institute, Bhakkar during, Rabi 2009, One hundred wheat genotypes were sown in second week of November. Each test line/variety of planted in two rows of 2 meter reach will two row of Morocco after every three entries to increase the disease pressure, fest lines/ varieties were inoculated thrice with highly susceptible Morocco and two most virulent Lr-26 and Lr-23 patho type. Out of eighty four test entries/varieties screened against le leaf rust, 5 exhibited resistant 21 moderately susceptible, 20 susceptible, 28 moderately resistant and 10 were highly susceptible. The present investigation indicated that there was no highly resistant lines/variety with zero disease severity. On the other hand, as regards stripe rust, out of thirty seven lines/varieties only two lines were susceptible to disease, Among other lines/ varieties, 12 resistant, 11 moderately resistant, 6 moderately susceptible and 2 susceptible against disease. Four (4) lines /varieties proved as highly resistant with zero disease severity.

  5. Quantitative trait loci for resistance to stripe rust of wheat revealed using global field nurseries and opportunities for stacking resistance genes.

    Science.gov (United States)

    Bokore, Firdissa E; Cuthbert, Richard D; Knox, Ron E; Randhawa, Harpinder S; Hiebert, Colin W; DePauw, Ron M; Singh, Asheesh K; Singh, Arti; Sharpe, Andrew G; N'Diaye, Amidou; Pozniak, Curtis J; McCartney, Curt; Ruan, Yuefeng; Berraies, Samia; Meyer, Brad; Munro, Catherine; Hay, Andy; Ammar, Karim; Huerta-Espino, Julio; Bhavani, Sridhar

    2017-12-01

    Quantitative trait loci controlling stripe rust resistance were identified in adapted Canadian spring wheat cultivars providing opportunity for breeders to stack loci using marker-assisted breeding. Stripe rust or yellow rust, caused by Puccinia striiformis Westend. f. sp. tritici Erikss., is a devastating disease of common wheat (Triticum aestivum L.) in many regions of the world. The objectives of this research were to identify and map quantitative trait loci (QTL) associated with stripe rust resistance in adapted Canadian spring wheat cultivars that are effective globally, and investigate opportunities for stacking resistance. Doubled haploid (DH) populations from the crosses Vesper/Lillian, Vesper/Stettler, Carberry/Vesper, Stettler/Red Fife and Carberry/AC Cadillac were phenotyped for stripe rust severity and infection response in field nurseries in Canada (Lethbridge and Swift Current), New Zealand (Lincoln), Mexico (Toluca) and Kenya (Njoro), and genotyped with SNP markers. Six QTL for stripe rust resistance in the population of Vesper/Lillian, five in Vesper/Stettler, seven in Stettler/Red Fife, four in Carberry/Vesper and nine in Carberry/AC Cadillac were identified. Lillian contributed stripe rust resistance QTL on chromosomes 4B, 5A, 6B and 7D, AC Cadillac on 2A, 2B, 3B and 5B, Carberry on 1A, 1B, 4A, 4B, 7A and 7D, Stettler on 1A, 2A, 3D, 4A, 5B and 6A, Red Fife on 2D, 3B and 4B, and Vesper on 1B, 2B and 7A. QTL on 1A, 1B, 2A, 2B, 3B, 4A, 4B, 5B, 7A and 7D were observed in multiple parents. The populations are compelling sources of recombination of many stripe rust resistance QTL for stacking disease resistance. Gene pyramiding should be possible with little chance of linkage drag of detrimental genes as the source parents were mostly adapted cultivars widely grown in Canada.

  6. Characterization and Mapping of Leaf Rust and Stripe Rust Resistance Loci in Hexaploid Wheat Lines UC1110 and PI610750 under Mexican Environments

    Directory of Open Access Journals (Sweden)

    Caixia Lan

    2017-08-01

    Full Text Available Growing resistant wheat varieties is a key method of minimizing the extent of yield losses caused by the globally important wheat leaf rust (LR and stripe rust (YR diseases. In this study, a population of 186 F8 recombinant inbred lines (RILs derived from a cross between a synthetic wheat derivative (PI610750 and an adapted common wheat line (cv. “UC1110” were phenotyped for LR and YR response at both seedling and adult plant stages over multiple seasons. Using a genetic linkage map consisting of single sequence repeats and diversity arrays technology markers, in combination with inclusive composite interval mapping analysis, we detected a new LR adult plant resistance (APR locus, QLr.cim-2DS, contributed by UC1110. One co-located resistance locus to both rusts, QLr.cim-3DC/QYr.cim-3DC, and the known seedling resistance gene Lr26 were also mapped. QLr.cim-2DS and QLr.cim-3DC showed a marginally significant interaction for LR resistance in the adult plant stage. In addition, two previously reported YR APR loci, QYr.ucw-3BS and Yr48, were found to exhibit stable performances in rust environments in both Mexico and the United States and showed a highly significant interaction in the field. Yr48 was also observed to confer intermediate seedling resistance against Mexican YR races, thus suggesting it should be re-classified as an all-stage resistance gene. We also identified 5 and 2 RILs that possessed all detected YR and LR resistance loci, respectively. With the closely linked molecular markers reported here, these RILs could be used as donors for multiple resistance loci to both rusts in wheat breeding programs.

  7. Characterization and Mapping of Leaf Rust and Stripe Rust Resistance Loci in Hexaploid Wheat Lines UC1110 and PI610750 under Mexican Environments.

    Science.gov (United States)

    Lan, Caixia; Hale, Iago L; Herrera-Foessel, Sybil A; Basnet, Bhoja R; Randhawa, Mandeep S; Huerta-Espino, Julio; Dubcovsky, Jorge; Singh, Ravi P

    2017-01-01

    Growing resistant wheat varieties is a key method of minimizing the extent of yield losses caused by the globally important wheat leaf rust (LR) and stripe rust (YR) diseases. In this study, a population of 186 F 8 recombinant inbred lines (RILs) derived from a cross between a synthetic wheat derivative (PI610750) and an adapted common wheat line (cv. "UC1110") were phenotyped for LR and YR response at both seedling and adult plant stages over multiple seasons. Using a genetic linkage map consisting of single sequence repeats and diversity arrays technology markers, in combination with inclusive composite interval mapping analysis, we detected a new LR adult plant resistance (APR) locus, QLr.cim-2DS , contributed by UC1110. One co-located resistance locus to both rusts, QLr.cim-3DC/QYr.cim-3DC , and the known seedling resistance gene Lr26 were also mapped. QLr.cim-2DS and QLr.cim-3DC showed a marginally significant interaction for LR resistance in the adult plant stage. In addition, two previously reported YR APR loci, QYr.ucw-3BS and Yr48 , were found to exhibit stable performances in rust environments in both Mexico and the United States and showed a highly significant interaction in the field. Yr48 was also observed to confer intermediate seedling resistance against Mexican YR races, thus suggesting it should be re-classified as an all-stage resistance gene. We also identified 5 and 2 RILs that possessed all detected YR and LR resistance loci, respectively. With the closely linked molecular markers reported here, these RILs could be used as donors for multiple resistance loci to both rusts in wheat breeding programs.

  8. Mapping of stripe rust resistance QTL in Cappelle-Desprez × PBW343 RIL population effective in northern wheat belt of India.

    Science.gov (United States)

    Pawar, Sushma Kumari; Sharma, Davinder; Duhan, Joginder Singh; Saharan, Mahender Singh; Tiwari, Ratan; Sharma, Indu

    2016-06-01

    Stripe rust caused by Puccinia striiformis f. sp. tritici is most important and devastating disease of wheat worldwide, which affects the grain yields, quality and nutrition. To elucidate, the genetic basis of resistance, a mapping population of recombinant inbred lines was developed from a cross between resistant Cappelle-Desprez and susceptible cultivar PBW343 using single-seed descent. Variety PBW343 had been one of the most popular cultivars of North Western Plains Zone, for more than a decade, before succumbing to the stripe rust. Cappelle-Desprez, a source of durable adult plant resistance, has maintained its resistance against stripe rust for a long time in Europe. Map construction and QTL analysis were completed with 1012 polymorphic (DArT and SSR) markers. Screenings for stripe rust disease were carried out in field condition for two consecutive crop seasons (2012-2013 and 2013-2014). Susceptible parent (PBW343) achieved a significant level of disease i.e., 100 % in both the years. In present investigations, resistance in Cappelle-Desprez was found stable and response to the rust ranged from 0 to 1.5 % over the years. The estimated broad-sense heritability (h 2 ) of stripe rust rAUDPC in the mapping population was 0.82. The relative area under the disease progress curve data showed continuous distributions, indicating that trait was controlled multigenically. Genomic region identified on chromosome 2D, was located within the short arm, with flanking markers (Xgwm484-Xcfd73), explained phenotypic variation (PVE) ranged from 13.9 to 31.8 %. The genomic region identified on chromosome 5B was found with the effect of maximum contribution with flanking DArT markers (1376633|F|0-1207571|F|0), PVE ranged from 24 to 27.0 %. This can, therefore, be utilized for marker assisted selection in developing much needed stripe rust resistant lines for the northern wheat belt of India.

  9. Wheat stripe rust resistance protein WKS1 reduces the ability of the thylakoid-associated ascorbate peroxidase to detoxify reactive oxygen species

    Science.gov (United States)

    Stripe rust is a devastating fungal disease of wheat caused by Puccinia striiformis f. sp. tritici(Pst). The WKS1 resistance gene has an unusual combination of serine/threonine kinase and START lipid-binding domains and confers partial resistance to Pst. Here we show that wheat plants transformed w...

  10. Mining centuries old in-situ conserved Turkish wheat landraces for grain yield and stripe rust resistance genes

    Directory of Open Access Journals (Sweden)

    Deepmala Sehgal

    2016-11-01

    Full Text Available Wheat landraces in Turkey are an important genetic resource for wheat improvement. An exhaustive five-year (2009-2014 effort made by the International Winter Wheat Improvement Programme (IWWIP a cooperative program between the Ministry of Food, Agriculture and Livestock of Turkey, the International Center for Maize and Wheat Improvement (CIMMYT and the International Center for Agricultural Research in the Dry Areas (ICARDA, led to the collection and documentation of around 2,000 landrace populations from 55 provinces throughout Turkey. This study reports the genetic characterization of a subset of bread wheat landraces collected in 2010 from 11 diverse provinces using genotyping-by-sequencing (GBS technology. The potential of this collection to identify loci determining grain yield and stripe rust resistance via genome-wide association (GWA analysis was explored. A high genetic diversity (diversity index = 0.260 and a moderate population structure based on highly inherited spike traits was revealed in the panel. The linkage disequilibrium decayed at 10 cM across the whole genome and was slower as compared to other landrace collections. In addition to previously reported QTL, GWA analysis also identified new candidate genomic regions for stripe rust resistance, grain yield and spike productivity components. New candidate genomic regions reflect the potential of this landrace collection to further increase genetic diversity in elite germplasm.

  11. Genome-wide association mapping reveals a rich genetic architecture of stripe rust resistance loci in emmer wheat (Triticum turgidum ssp. dicoccum).

    Science.gov (United States)

    Liu, Weizhen; Maccaferri, Marco; Chen, Xianming; Laghetti, Gaetano; Pignone, Domenico; Pumphrey, Michael; Tuberosa, Roberto

    2017-11-01

    SNP-based genome scanning in worldwide domesticated emmer germplasm showed high genetic diversity, rapid linkage disequilibrium decay and 51 loci for stripe rust resistance, a large proportion of which were novel. Cultivated emmer wheat (Triticum turgidum ssp. dicoccum), one of the oldest domesticated crops in the world, is a potentially rich reservoir of variation for improvement of resistance/tolerance to biotic and abiotic stresses in wheat. Resistance to stripe rust (Puccinia striiformis f. sp. tritici) in emmer wheat has been under-investigated. Here, we employed genome-wide association (GWAS) mapping with a mixed linear model to dissect effective stripe rust resistance loci in a worldwide collection of 176 cultivated emmer wheat accessions. Adult plants were tested in six environments and seedlings were evaluated with five races from the United States and one from Italy under greenhouse conditions. Five accessions were resistant across all experiments. The panel was genotyped with the wheat 90,000 Illumina iSelect single nucleotide polymorphism (SNP) array and 5106 polymorphic SNP markers with mapped positions were obtained. A high level of genetic diversity and fast linkage disequilibrium decay were observed. In total, we identified 14 loci associated with field resistance in multiple environments. Thirty-seven loci were significantly associated with all-stage (seedling) resistance and six of them were effective against multiple races. Of the 51 total loci, 29 were mapped distantly from previously reported stripe rust resistance genes or quantitative trait loci and represent newly discovered resistance loci. Our results suggest that GWAS is an effective method for characterizing genes in cultivated emmer wheat and confirm that emmer wheat is a rich source of stripe rust resistance loci that can be used for wheat improvement.

  12. Genome-Wide Linkage Mapping of QTL for Adult-Plant Resistance to Stripe Rust in a Chinese Wheat Population Linmai 2 × Zhong 892.

    Directory of Open Access Journals (Sweden)

    Jindong Liu

    Full Text Available Stripe rust is one of the most devastating diseases of wheat (Triticum aestivum worldwide. Adult-plant resistance (APR is an efficient approach to provide long-term protection of wheat from the disease. The Chinese winter wheat cultivar Zhong 892 has a moderate level of APR to stripe rust in the field. To determine the inheritance of the APR resistance in this cultivar, 273 F6 recombinant inbred lines (RILs were developed from a cross between Linmai 2 and Zhong 892. The RILs were evaluated for maximum disease severity (MDS in two sites during the 2011-2012, 2012-2013 and 2013-2014 cropping seasons, providing data for five environments. Illumina 90k SNP (single nucleotide polymorphism chips were used to genotype the RILs and their parents. Composite interval mapping (CIM detected eight QTL, namely QYr.caas-2AL, QYr.caas-2BL.3, QYr.caas-3AS, QYr.caas-3BS, QYr.caas-5DL, QYr.caas-6AL, QYr.caas-7AL and QYr.caas-7DS.1, respectively. All except QYr.caas-2BL.3 resistance alleles were contributed by Zhong 892. QYr.caas-3AS and QYr.caas-3BS conferred stable resistance to stripe rust in all environments, explaining 6.2-17.4% and 5.0-11.5% of the phenotypic variances, respectively. The genome scan of SNP sequences tightly linked to QTL for APR against annotated proteins in wheat and related cereals genomes identified two candidate genes (autophagy-related gene and disease resistance gene RGA1, significantly associated with stripe rust resistance. These QTL and their closely linked SNP markers, in combination with kompetitive allele specific PCR (KASP technology, are potentially useful for improving stripe rust resistances in wheat breeding.

  13. Loci associated with resistance to stripe rust (Puccinia striiformis f. sp. tritici) in a core collection of spring wheat (Triticum aestivum)

    Science.gov (United States)

    Bulli, Peter; Rynearson, Sheri; Chen, Xianming; Pumphrey, Michael

    2017-01-01

    Stripe rust, caused by Puccinia striiformis Westend. f. sp. tritici Erikss. (Pst) remains one of the most significant diseases of wheat worldwide. We investigated stripe rust resistance by genome-wide association analysis (GWAS) in 959 spring wheat accessions from the United States Department of Agriculture-Agricultural Research Service National Small Grains Collection, representing major global production environments. The panel was characterized for field resistance in multi-environment field trials and seedling resistance under greenhouse conditions. A genome-wide set of 5,619 informative SNP markers were used to examine the population structure, linkage disequilibrium and marker-trait associations in the germplasm panel. Based on model-based analysis of population structure and hierarchical Ward clustering algorithm, the accessions were clustered into two major subgroups. These subgroups were largely separated according to geographic origin and improvement status of the accessions. A significant correlation was observed between the population sub-clusters and response to stripe rust infection. We identified 11 and 7 genomic regions with significant associations with stripe rust resistance at adult plant and seedling stages, respectively, based on a false discovery rate multiple correction method. The regions harboring all, except three, of the QTL identified from the field and greenhouse studies overlap with positions of previously reported QTL. Further work should aim at validating the identified QTL using proper germplasm and populations to enhance their utility in marker assisted breeding. PMID:28591221

  14. TaLHY, a 1R-MYB Transcription Factor, Plays an Important Role in Disease Resistance against Stripe Rust Fungus and Ear Heading in Wheat.

    Science.gov (United States)

    Zhang, Zijin; Chen, Jieming; Su, Yongying; Liu, Hanmei; Chen, Yanger; Luo, Peigao; Du, Xiaogang; Wang, Dan; Zhang, Huaiyu

    2015-01-01

    LHY (late elongated hypocotyl) is an important gene that regulates and controls biological rhythms in plants. Additionally, LHY is highly expressed in the SSH (suppression subtractive hybridization) cDNA library-induced stripe rust pathogen (CYR32) in our previous research. To identify the function of the LHY gene in disease resistance against stripe rust, we used RACE-PCR technology to clone TaLHY in the wheat variety Chuannong19. The cDNA of TaLHY is 3085 bp long with an open reading frame of 1947 bp. TaLHY is speculated to encode a 70.3 kDa protein of 648 amino acids , which has one typical plant MYB-DNA binding domain; additionally, phylogenetic tree shows that TaLHY has the highest homology with LHY of Brachypodium distachyon(BdLHY-like). Quantitative fluorescence PCR indicates that TaLHY has higher expression in the leaf, ear and stem of wheat but lower expression in the root. Infestation of CYR32 can result in up-regulated expression of TaLHY, peaking at 72 h. Using VIGS (virus-induced gene silencing) technology to disease-resistant wheat in the fourth leaf stage, plants with silenced TaLHY cannot complete their heading stage. Through the compatible interaction with the stripe rust physiological race CYR32, Chuannong 19 loses its immune capability toward the stripe rust pathogen, indicating that TaLHY may regulate and participate in the heading of wheat, as well as the defense responses against stripe rust infection.

  15. TaLHY, a 1R-MYB Transcription Factor, Plays an Important Role in Disease Resistance against Stripe Rust Fungus and Ear Heading in Wheat.

    Directory of Open Access Journals (Sweden)

    Zijin Zhang

    Full Text Available LHY (late elongated hypocotyl is an important gene that regulates and controls biological rhythms in plants. Additionally, LHY is highly expressed in the SSH (suppression subtractive hybridization cDNA library-induced stripe rust pathogen (CYR32 in our previous research. To identify the function of the LHY gene in disease resistance against stripe rust, we used RACE-PCR technology to clone TaLHY in the wheat variety Chuannong19. The cDNA of TaLHY is 3085 bp long with an open reading frame of 1947 bp. TaLHY is speculated to encode a 70.3 kDa protein of 648 amino acids , which has one typical plant MYB-DNA binding domain; additionally, phylogenetic tree shows that TaLHY has the highest homology with LHY of Brachypodium distachyon(BdLHY-like. Quantitative fluorescence PCR indicates that TaLHY has higher expression in the leaf, ear and stem of wheat but lower expression in the root. Infestation of CYR32 can result in up-regulated expression of TaLHY, peaking at 72 h. Using VIGS (virus-induced gene silencing technology to disease-resistant wheat in the fourth leaf stage, plants with silenced TaLHY cannot complete their heading stage. Through the compatible interaction with the stripe rust physiological race CYR32, Chuannong 19 loses its immune capability toward the stripe rust pathogen, indicating that TaLHY may regulate and participate in the heading of wheat, as well as the defense responses against stripe rust infection.

  16. Isolation and molecular cytogenetic characterization of a wheat - Leymus mollis double monosomic addition line and its progenies with resistance to stripe rust.

    Science.gov (United States)

    Yang, Xiaofei; Li, Xin; Wang, Changyou; Chen, Chunhuan; Tian, Zengrong; Ji, Wanquan

    2017-12-01

    A common wheat - Leymus mollis (2n = 4x = 28, NsNsXmXm) double monosomic addition line, M11003-4-3-8/13/15 (2n = 44 = 42T.a + L.m2 + L.m3), with stripe rust resistance was developed (where T.a represents Triticum aestivum chromosome, L.m represents L. mollis chromosome, and L.m2/3 represents L. mollis chromosome of homoeologous groups 2 and 3). The progenies of line M11003-4-3-8/13/15 were characterized by cytological observation, specific molecular markers, fluorescence in situ hybridization (FISH), and genomic in situ hybridization (GISH). Among the progenies, there existed five different types (I, II, III, IV, and V) of chromosome constitution, the formulas of which were 2n = 44 = 42T.a + 1L.m2 + 1L.m3, 2n = 43 = 42T.a + 1L.m2, 2n = 43 = 42T.a + 1L.m3, 2n = 42 = 42T.a, and 2n = 44 = 42T.a + 2L.m2, respectively. Field disease screening showed that types I and III showed high resistance to stripe rust, while types II, IV, and V were susceptible. Leymus mollis was almost immune to stripe rust, whereas the wheat parent, cultivar 7182, was susceptible. Therefore, we concluded that the stripe rust resistance originated from L. mollis. These various lines could be further fully exploited as important disease resistance materials to enrich wheat genetic resources.

  17. Characterization of Stripe Rust Resistance Genes in the Wheat Cultivar Chuanmai45

    Directory of Open Access Journals (Sweden)

    Ennian Yang

    2016-04-01

    Full Text Available The objective of this research was to characterize the high level of resistance to stripe that has been observed in the released wheat cultivar, Chuanmai45. A combination of classic genetic analysis, molecular and cytogenetic methods were used to characterize resistance in an F2 population derived from Chuanmai45 and the susceptible Chuanmai42. Inheritance of resistance was shown to be conferred by two genes in Chuanmai45. Fluorescence in situ hybridization (FISH was used along with segregation studies to show that one gene was located on a 1RS.1BL translocation. Molecular markers were employed to show that the other locus was located on chromosome 4B. The defeated gene, Yr24/26, on chromosome 1BL was present in the susceptible parent and lines that recombined this gene with the 1RS.1BL translocation were identified. The germplasm, loci, and associated markers identified in this study will be useful for application in breeding programs utilizing marker-assisted selection.

  18. Molecular implications from ssr markers for stripe rust (puccinia striiformis F.Sp. tritici) resistance gene in bread wheat line N95175

    International Nuclear Information System (INIS)

    Ali, M.; Ji, W.G.; Hu, Y.G; Zhong, H.; Wang, C.Y.; Baloch, G.M.

    2010-01-01

    Stripe rust caused by Puccinia striiformis f. sp. tritici is one of the most devastating diseases of wheat in China as well as in Pakistan. In the present studies F2 population was established by crossing N95175 resistant to stripe rust race CYR32 with two susceptible lines Huixianhong and Abbondanza to molecularly tag resistance gene existing in wheat line N95175. The segregation of phenotype was accorded with an expected 3:1 ratio in both combinations studied and fit the model of a single dominant gene controlling stripe rust resistance in N95175. Thirty five SSR primer pairs were screened on the parents and bulks and also on individuals since resistance gene to be located in chromosome 1B. The result indicated that most of resistant plants amplified same band as resistant parent while susceptible plants amplified same as susceptible parents studied and considered that markers co-segregated with resistant loci in N95175. This yellow rust resistance gene was considered to be Yr26 originally thought to be also located in chromosome arm 1BS linked to marker loci Xgwm273 and Xgwm11 with genetic distances ranging from 1.075cM to 2.74cM in both combinations studied. However, the closest loci were observed 2.67cM for Xgwm273 and 1.075cM for Xgwm11 in Huixianhong XN95175 and Abbondanza XN95175 crosses respectively. Hence, it has been concluded that the PCR-based micro satellite markers Xgwm273 and Xgwm11 located in chromosome 1B were shown to be very effective for the detection of Yr26 gene in segregating population and can be applied in future wheat breeding strategies. (author)

  19. Molecular mapping of stripe rust resistance gene YrSE5756 in synthetic hexaploid wheat and its transfer to common wheat

    International Nuclear Information System (INIS)

    Wang, Y.J.; Wang, C.Y.; Zhang, H.

    2015-01-01

    Synthetic hexaploid wheat is an important germplasm resource for transfer of beneficial genes from alien species to common wheat (Triticum aestivum L.). Synthetic hexaploid wheat SE5756 confers a high level of resistance against a wide range of races of Puccinia striiformis West. f. sp. tritici Eriks. et Henn.(Pst). The objectives of this study were to determine the inheritance pattern, adjacent molecular markers, and chromosomal location of the stripe rust resistance gene in SE5756 and to develop new germplasm. We constructed a segregating population of 116 F2 plants and corresponding F2:3 families from a cross between SE5756 and Xinong979 with Pst races CYR32. Genetic analysis revealed that a single dominant gene, tentatively designated as YrSE5756, was responsible for seedling stage stripe rust resistance in SE5756. A genetic map, encompassing Xwmc626, Xwmc269, Xgwm11, Xbarx137, Xwmc419, Xwmc85, Xgpw5237, Xwmc134, WE173, Xwmc631, and YrSE5756, spanned 70.1 cM on chromosome 1BS. Xwmc419 and Xwmc85 were flanking markers tightly linked to YrSE5756 at genetic distances of 2.3 and 1.8 cM. Typical adult plant responses of the SE5756, varieties of the carrier Yr10 and Yr15, Chuanmai 42 (Yr24/Yr26), Yuanfeng 175 (Yr24/Yr26) and Huixianhong resistant to mixture Pst races (CYR32, CYR33 and V26) were experimented. The results showed that YrSE5756 was likely a new resistance stripe rust gene different from Yr24/Yr26, Yr10 and Yr15. From cross and backcross populations of SE5756/Xinong 979, we developed four new wheat lines with large seeds, stripe rust resistance, and improved agronomic traits: N07178-1, N07178-2, N08256-1, and N08256-2. These new germplasm lines could serve as sources of resistance to stripe rust in wheat breeding. SE5756 has the very vital significance in the development of breeding and expand our resistance germplasm resource gene pool. (author)

  20. [Genetic analysis and molecular mapping of stripe rust resistance gene in a restore line of Thermo-Photo sensitive hybrid wheat MR168].

    Science.gov (United States)

    Ren, Yong; Li, Sheng-Rong; Li, Jun; Zhou, Qiang; DU, Xiao-Ying; Li, Tai-Jun; Yang, Wu-Yun; Zheng, You-Liang

    2011-11-01

    Stripe rust, caused by Puccinia striiformis f. sp. tritici, is an important limiting factor to popularize hybrid wheat. The objectives of this study were to map a stripe rust resistance gene in a Chinese thermo-photo-sensitive hybrid wheat restore line MR168 using gene postulation and SSR markers. MR168 was highly resistant to 23 Pst races including CYR29, CYR31, CYR32, and CYR33. The populations F1, BC1, F2, and F3 from the cross between MR168 and SY95-71 (a wheat cultivar susceptible to Pst races) were inoculated with the race of Pst CYR32 of China in greenhouse. MR168 carried a single dominant gene for resistance to CYR32, tentatively designated YrMR168. It originated from Liaochun 10, a spring wheat variety. A total of 183 F2 plants, the resistant and susceptible parents and resistant and susceptible bulks were used for resistance gene mapping with 329 pairs of wheat SSR markers.Five SSR markers on chromosome 1BS including Xgwm18, Xbarc187, Xwmc269, Xgwm273, and Xwmc406 were linked with YrMR168. The resistance gene was closely linked to Xgwm18 and Xbarc187 with the genetic distances of 1.9 and 2.4 cM, respectively. Xgwm18 and Xbarc187 could be used for molecular marker assisted selection of YrMR168 in hybrid wheat breeding program.

  1. Characterization of molecular diversity and genome-wide mapping of loci associated with resistance to stripe rust and stem rust in Ethiopian bread wheat accessions

    OpenAIRE

    Muleta, Kebede T.; Rouse, Matthew N.; Rynearson, Sheri; Chen, Xianming; Buta, Bedada G.; Pumphrey, Michael O.

    2017-01-01

    Background The narrow genetic basis of resistance in modern wheat cultivars and the strong selection response of pathogen populations have been responsible for periodic and devastating epidemics of the wheat rust diseases. Characterizing new sources of resistance and incorporating multiple genes into elite cultivars is the most widely accepted current mechanism to achieve durable varietal performance against changes in pathogen virulence. Here, we report a high-density molecular characterizat...

  2. Genetic analysis and location of gene for resistance to stripe rust in ...

    Indian Academy of Sciences (India)

    Bulked segregant analysis (BSA) and F2 segregation analysis were used for detecting polymorphic primers to locate the gene. The resistance of the NIL Taichung 29*6/Strubes Dickkopf to CYR26 was controlled by a single dominant gene, named YrSD. The primer pair Xbarc59 on 5B was linked to YrSD and the genetic ...

  3. Characterization of Novel Gene Yr79 and Four Additional Quantitative Trait Loci for All-Stage and High-Temperature Adult-Plant Resistance to Stripe Rust in Spring Wheat PI 182103.

    Science.gov (United States)

    Feng, Junyan; Wang, Meinan; See, Deven R; Chao, Shiaoman; Zheng, Youliang; Chen, Xianming

    2018-04-25

    Stripe rust, caused by Puccinia striiformis f. sp. tritici, is an important disease of wheat worldwide. Exploring new resistance genes is essential for breeding resistant wheat cultivars. PI 182103, a spring wheat landrace originally from Pakistan, has shown a high level of resistance to stripe rust in fields for many years, but genes for resistance to stripe rust in the variety have not been studied. To map the resistance gene(s) in PI 182103, 185 recombinant inbred lines (RILs) were developed from a cross with Avocet Susceptible (AvS). The RIL population was genotyped with simple sequence repeat (SSR) and single nucleotide polymorphism markers and tested with races PST-100 and PST-114 at the seedling stage under controlled greenhouse conditions and at the adult-plant stage in fields at Pullman and Mt. Vernon, Washington under natural infection by the stripe rust pathogen in 2011, 2012, and 2013. A total of five quantitative trait loci (QTL) were detected. QyrPI182103.wgp-2AS and QyrPI182103.wgp-3AL were detected at the seedling stage, QyrPI182103.wgp-4DL was detected only in Mt. Vernon field tests, and QyrPI182103.wgp-5BS was detected in both seedling and field tests. QyrPI182103.wgp-7BL was identified as a high-temperature adult-plant resistance gene and detected in all field tests. Interactions among the QTL were mostly additive, but some negative interactions were detected. The 7BL QTL was mapped in chromosomal bin 7BL 0.40 to 0.45 and identified as a new gene, permanently designated as Yr79. SSR markers Xbarc72 and Xwmc335 flanking the Yr79 locus were highly polymorphic in various wheat genotypes, indicating that the molecular markers are useful for incorporating the new gene for potentially durable stripe rust resistance into new wheat cultivars.

  4. Saturation Mapping of a Major Effect QTL for Stripe Rust Resistance on Wheat Chromosome 2B in Cultivar Napo 63 Using SNP Genotyping Arrays

    Directory of Open Access Journals (Sweden)

    Dejun Han

    2017-04-01

    Full Text Available Stripe rust or yellow rust (YR, caused by Puccinia striiformis f. sp. tritici (Pst, is one of the most important diseases of wheat (Triticum aestivum L.. Widespread deployment of resistant cultivars is the best means of achieving durable disease control. The red grain, spring wheat cultivar Napo 63 produced by CIMMYT in the 1960s shows a high level of adult-plant resistance to stripe rust in the field. To elucidate the genetic basis of resistance in this cultivar we evaluated 224 F2:3 lines and 175 F2:6 recombinant inbred lines (RILs derived from a cross between Napo 63 and the Pst-susceptible line Avocet S. The maximum disease severity (MDS data of F2:3 lines and the relative area under the disease progress curve (rAUDPC data of RILs were collected during the 2014–2015 and 2015–2016 wheat growing seasons, respectively. Combined bulked segregant analysis and 90K single nucleotide polymorphism (SNP arrays placed 275 of 511 polymorphic SNPs on chromosome 2B. Sixty four KASP markers selected from the 275 SNPs and 76 SSR markers on 2B were used to identify a chromosome region associated with rust response. A major effect QTL, named Qyrnap.nwafu-2BS, was identified by inclusive composite interval mapping and was preliminarily mapped to a 5.46 cM interval flanked by KASP markers 90K-AN34 and 90K-AN36 in chromosome 2BS. Fourteen KASP markers more closely linked to the locus were developed following a 660K SNP array analysis. The QTL region was finally narrowed to a 0.9 cM interval flanked by KASP markers 660K-AN21 and 660K-AN57 in bin region 2BS-1-0.53. The resistance of Napo 63 was stable across all environments, and as a QTL, explained an average 66.1% of the phenotypic variance in MDS of F2:3 lines and 55.7% of the phenotypic variance in rAUDPC of F5:6 RILs. The short genetic interval and flanking KASP markers developed in the study will facilitate marker-assisted selection, gene pyramiding, and eventual positional cloning of Qyrnap.nwafu-2BS.

  5. A change in temperature modulates defence to yellow (stripe) rust in wheat line UC1041 independently of resistance gene Yr36.

    Science.gov (United States)

    Bryant, Ruth R M; McGrann, Graham R D; Mitchell, Alice R; Schoonbeek, Henk-Jan; Boyd, Lesley A; Uauy, Cristobal; Dorling, Steve; Ridout, Christopher J

    2014-01-08

    Rust diseases are of major importance in wheat production worldwide. With the constant evolution of new rust strains and their adaptation to higher temperatures, consistent and durable disease resistance is a key challenge. Environmental conditions affect resistance gene performance, but the basis for this is poorly understood. Here we show that a change in day temperature affects wheat resistance to Puccinia striiformis f. sp tritici (Pst), the causal agent of yellow (or stripe) rust. Using adult plants of near-isogenic lines UC1041 +/- Yr36, there was no significant difference between Pst percentage uredia coverage in plants grown at day temperatures of 18°C or 25°C in adult UC1041 + Yr36 plants. However, when plants were transferred to the lower day temperature at the time of Pst inoculation, infection increased up to two fold. Interestingly, this response was independent of Yr36, which has previously been reported as a temperature-responsive resistance gene as Pst development in adult UC1041 -Yr36 plants was similarly affected by the plants experiencing a temperature reduction. In addition, UC1041 -Yr36 plants grown at the lower temperature then transferred to the higher temperature were effectively resistant and a temperature change in either direction was shown to affect Pst development up to 8 days prior to inoculation. Results for seedlings were similar, but more variable compared to adult plants. Enhanced resistance to Pst was observed in seedlings of UC1041 and the cultivar Shamrock when transferred to the higher temperature. Resistance was not affected in seedlings of cultivar Solstice by a temperature change in either direction. Yr36 is effective at 18°C, refining the lower range of temperature at which resistance against Pst is conferred compared to previous studies. Results reveal previously uncharacterised defence temperature sensitivity in the UC1041 background which is caused by a change in temperature and independently of Yr36. This novel

  6. Determination of rust resistance genes in pakistani bread wheats

    International Nuclear Information System (INIS)

    Qamar, M.; Ahmad, S.D.; Rabbani, M.A.; Shinwari, Z.K.

    2014-01-01

    Stripe and leaf rusts are the major constraints to bread wheat production in Pakistan. Molecular markers were used to investigate the presence of leaf rust and stripe rust resistance gene cluster Lr34/Yr18 and stem rust resistance gene Sr2 in 52 Pakistani bread wheat cultivars/lines. PCR amplification of DNA fragments using DNA marker csLV-34 showed that 13 of the studied cultivars/lines, namely 03FJ26, NR 337, NR 339, NR 347, NR 350, Manthar, Margalla 99, Iqbal 2000, Saleem 2000, Wafaq 2001, Marwat 2001, Pirsabak 2004 and Fareed 2006 carry leaf rust and stripe rust resistance genes Lr34/Yr18. Stem rust resistance gene Sr2 was observed in 36 Pakistani spring wheat cultivars/lines using stm560.3tgag marker. The slow rusting gene Sr2 needs to be combined with additional stem rust resistance genes to establish durable resistance against Ug99 in modern wheat cultivars. Low frequency of Lr34/Yr18 was found in Pakistani wheats. This gene cluster needs to be incorporated into Pakistani wheats for durable rust resistance. (author)

  7. Development and Molecular Cytogenetic Identification of a Novel Wheat-Leymus mollis Lm#7Ns (7D Disomic Substitution Line with Stripe Rust Resistance.

    Directory of Open Access Journals (Sweden)

    Xiaofei Yang

    Full Text Available Leymus mollis (2n = 4x = 28, NsNsXmXm possesses novel and important genes for resistance against multi-fungal diseases. The development of new wheat-L. mollis introgression lines is of great significance for wheat disease resistance breeding. M11003-3-1-15-8, a novel disomic substitution line of common wheat cv. 7182 -L. mollis, developed and selected from the BC1F5 progeny between wheat cv. 7182 and octoploid Tritileymus M47 (2n = 8x = 56, AABBDDNsNs, was characterized by morphological and cytogenetic identification, analysis of functional molecular markers, genomic in situ hybridization (GISH, sequential fluorescence in situ hybridization (FISH-genomic in situ hybridization (GISH and disease resistance evaluation. Cytological observations suggested that M11003-3-1-15-8 contained 42 chromosomes and formed 21 bivalents at meiotic metaphase I. The GISH investigations showed that line contained 40 wheat chromosomes and a pair of L. mollis chromosomes. EST-STS multiple loci markers and PLUG (PCR-based Landmark Unique Gene markers confirmed that the introduced L. mollis chromosomes belonged to homoeologous group 7, it was designated as Lm#7Ns. While nulli-tetrasomic and sequential FISH-GISH analysis using the oligonucleotide Oligo-pSc119.2 and Oligo-pTa535 as probes revealed that the wheat 7D chromosomes were absent in M11003-3-1-15-8. Therefore, it was deduced that M11003-3-1-15-8 was a wheat-L. mollis Lm#7Ns (7D disomic substitution line. Field disease resistance demonstrated that the introduced L. mollis chromosomes Lm#7Ns were responsible for the stripe rust resistance at the adult stage. Moreover, M11003-3-1-15-8 had a superior numbers of florets. The novel disomic substitution line M11003-3-1-15-8, could be exploited as an important genetic material in wheat resistance breeding programs and genetic resources.

  8. Genome-wide association mapping for stripe rust (Puccinia striiformis F. sp. tritici) in US Pacific Northwest winter wheat (Triticum aestivum L.).

    Science.gov (United States)

    Naruoka, Y; Garland-Campbell, K A; Carter, A H

    2015-06-01

    Potential novel and known QTL for race-specific all-stage and adult plant resistance to stripe rust were identified by genome-wide association mapping in the US PNW winter wheat accessions. Stripe rust (Puccinia striiformis F. sp. tritici; also known as yellow rust) is a globally devastating disease of wheat (Triticum aestivum L.) and a major threat to wheat production in the US Pacific Northwest (PNW), therefore both adult plant and all-stage resistance have been introduced into the winter wheat breeding programs in the PNW. The goal of this study was to identify quantitative trait loci (QTL) and molecular markers for these resistances through genome-wide association (GWAS) mapping in winter wheat accessions adapted to the PNW. Stripe rust response for adult plants was evaluated in naturally occurring epidemics in a total of nine environments in Washington State, USA. Seedling response was evaluated with three races under artificial inoculation in the greenhouse. The panel was genotyped with the 9K Illumina Wheat single nucleotide polymorphism (SNP) array and additional markers linked to previously reported genes and QTL for stripe rust resistance. The population was grouped into three sub-populations. Markers linked to Yr17 and previously reported QTL for stripe rust resistance were identified on chromosomes 1B, 2A, and 2B. Potentially novel QTL associated with race-specific seedling response were identified on chromosomes 1B and 1D. Potentially novel QTL associated with adult plant response were located on chromosomes 2A, 2B, 3B, 4A, and 4B. Stripe rust was reduced when multiple alleles for resistance were present. The resistant allele frequencies were different among sub-populations in the panel. This information provides breeders with germplasm and closely linked markers for stripe rust resistance to facilitate the transfer of multiple loci for durable stripe rust resistance into wheat breeding lines and cultivars.

  9. Genetic analysis of rust resistance genes in global wheat cultivars: an overview

    International Nuclear Information System (INIS)

    Aktar-Uz-Zaman, Md; Tuhina-Khatun, Mst; Hanafi, Mohamed Musa; Sahebi, Mahbod

    2017-01-01

    Rust is the most devastating fungal disease in wheat. Three rust diseases, namely, leaf or brown rust caused by Puccinia triticina Eriks, stem or black rust caused by Puccinia graminis f. sp. tritici West, and stripe or yellow rust caused by Puccinia striiformis f. Tritici Eriks, are the most economically significant and common diseases among global wheat cultivars. Growing cultivars resistant to rust is the most sustainable, cost-effective and environmentally friendly approach for controlling rust diseases. To date, more than 187 rust resistance genes (80 leaf rust, 58 stem rust and 49 stripe rust) have been derived from diverse wheat or durum wheat cultivars and the related wild species using different molecular methods. This review provides a detailed discussion of the different aspects of rust resistance genes, their primitive sources, their distribution in global wheat cultivars and the importance of durable resistant varieties for controlling rust diseases. This information will serve as a foundation for plant breeders and geneticists to develop durable rust-resistant wheat varieties through marker-assisted breeding or gene pyramiding

  10. Characterization of the Wheat Stripe Rust (Puccinia striiformis f. sp. tritici) Fungal Effector Candidate PEC6 and Its Corresponding Host Targets

    DEFF Research Database (Denmark)

    Liu, Changhai

    Stripe rust caused by Puccinia striiformis f. sp. tritici (Pst), is one of the most important fungal diseases on wheat worldwide and a serious threat to wheat production. Understanding the plant-microbe interaction mechanism is the basic step to assist future plant breeding aiming at increasing...... disease resistance. Based on the sequenced stripe rust fungus genome, several hundreds of small, secreted candidates for effector proteins are predicted. Effectors are believed to be pivotal for fungal pathogenicity with key roles in suppressing host defense. Thus, identifying key effectors...... and understanding their mechanisms of action is fundamentally important to guide future fights against the stripe rust disease. In this PhD project, I studied the potential function of six stripe rust fungal effector candidates which are highly expressed in haustoria, by employing the Pseudomonas fluorescens Et...

  11. Postulation of rust resistance genes in Nordic spring wheat genotypes and identification of widely effective sources of resistance against the Australian rust flora.

    Science.gov (United States)

    Randhawa, Mandeep; Bansal, Urmil; Lillemo, Morten; Miah, Hanif; Bariana, Harbans

    2016-11-01

    Wild relatives, landraces and cultivars from different geographical regions have been demonstrated as the sources of genetic variation for resistance to rust diseases. This study involved assessment of diversity for resistance to three rust diseases among a set of Nordic spring wheat cultivars. These cultivars were tested at the seedling stage against several pathotypes of three rust pathogens in the greenhouse. All stage stem rust resistance genes Sr7b, Sr8a, Sr12, Sr15, Sr17, Sr23 and Sr30, and leaf rust resistance genes Lr1, Lr3a, Lr13, Lr14a, Lr16 and Lr20 were postulated either singly or in different combinations among these cultivars. A high proportion of cultivars were identified to carry linked rust resistance genes Sr15 and Lr20. Although 51 cultivars showed variation against Puccinia striiformis f. sp. tritici (Pst) pathotypes used in this study, results were not clearly contrasting to enable postulation of stripe rust resistance genes in these genotypes. Stripe rust resistance gene Yr27 was postulated in four cultivars and Yr1 was present in cultivar Zebra. Cultivar Tjalve produced low stripe rust response against all Pst pathotypes indicating the presence either of a widely effective resistance gene or combination of genes with compensating pathogenic specificities. Several cultivars carried moderate to high level of APR to leaf rust and stripe rust. Seedling stem rust susceptible cultivar Aston exhibited moderately resistant to moderately susceptible response, whereas other cultivars belonging to this class were rated moderately susceptible or higher. Molecular markers linked with APR genes Yr48, Lr34/Yr18/Sr57, Lr68 and Sr2 detected the presence of these genes in some genotypes.

  12. Strategies for Wheat Stripe Rust Pathogenicity Identified by Transcriptome Sequencing.

    Directory of Open Access Journals (Sweden)

    Diana P Garnica

    Full Text Available Stripe rust caused by the fungus Puccinia striiformis f.sp. tritici (Pst is a major constraint to wheat production worldwide. The molecular events that underlie Pst pathogenicity are largely unknown. Like all rusts, Pst creates a specialized cellular structure within host cells called the haustorium to obtain nutrients from wheat, and to secrete pathogenicity factors called effector proteins. We purified Pst haustoria and used next-generation sequencing platforms to assemble the haustorial transcriptome as well as the transcriptome of germinated spores. 12,282 transcripts were assembled from 454-pyrosequencing data and used as reference for digital gene expression analysis to compare the germinated uredinospores and haustoria transcriptomes based on Illumina RNAseq data. More than 400 genes encoding secreted proteins which constitute candidate effectors were identified from the haustorial transcriptome, with two thirds of these up-regulated in this tissue compared to germinated spores. RT-PCR analysis confirmed the expression patterns of 94 effector candidates. The analysis also revealed that spores rely mainly on stored energy reserves for growth and development, while haustoria take up host nutrients for massive energy production for biosynthetic pathways and the ultimate production of spores. Together, these studies substantially increase our knowledge of potential Pst effectors and provide new insights into the pathogenic strategies of this important organism.

  13. Evidence for Increased Aggressiveness in a Recent Widespread Strain of Puccinia striiformis f. sp. tritici Causing Stripe Rust of Wheat

    DEFF Research Database (Denmark)

    Milus, Eugene A; Kristensen, Kristian; Hovmøller, Mogens S

    2009-01-01

    Stripe rust (yellow rust) of wheat, caused by Puccinia striiformis f. sp. tritici, has become more severe in eastern United States, Australia, and elsewhere since 2000. Recent research has shown that this coincided with a global spread of two closely related strains that were similar based...... to the warm temperature regime for all variables. Based on these results and previously published models for stripe rust epidemics, recent severe stripe rust epidemics were most likely enhanced by the pathogen's increased aggressiveness, especially at higher temperature. Furthermore, these results demonstrate...... that wheat rust fungi can adapt to warmer temperatures and cause severe disease in previously unfavorable environments...

  14. The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence

    OpenAIRE

    Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G.; Singh, Davinder; Park, Robert F.; Lagudah, Evans; Ayliffe, Michael

    2017-01-01

    Summary The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad?spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field?grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when ...

  15. 78 FR 27855 - Black Stem Rust; Additions of Rust-Resistant Species and Varieties

    Science.gov (United States)

    2013-05-13

    .... APHIS-2012-0108] Black Stem Rust; Additions of Rust-Resistant Species and Varieties AGENCY: Animal and... stem rust quarantine and regulations by adding two varieties to the list of rust-resistant Berberis species and varieties and one variety to the list of rust-resistant Mahonia species and varieties. This...

  16. Small RNAs from the wheat stripe rust fungus (Puccinia striiformis f.sp. tritici).

    Science.gov (United States)

    Mueth, Nicholas A; Ramachandran, Sowmya R; Hulbert, Scot H

    2015-09-21

    Wheat stripe rust, caused by Puccinia striiformis f. sp. tritici, is a costly global disease that burdens farmers with yield loss and high fungicide expenses. This sophisticated biotrophic parasite infiltrates wheat leaves and develops infection structures inside host cells, appropriating nutrients while suppressing the plant defense response. Development in most eukaryotes is regulated by small RNA molecules, and the success of host-induced gene silencing technology in Puccinia spp. implies the existence of a functional RNAi system. However, some fungi lack this capability, and small RNAs have not yet been reported in rust fungi. The objective of this study was to determine whether P. striiformis carries an endogenous small RNA repertoire. We extracted small RNA from rust-infected wheat flag leaves and performed high-throughput sequencing. Two wheat cultivars were analyzed: one is susceptible; the other displays partial high-temperature adult plant resistance. Fungal-specific reads were identified by mapping to the P. striiformis draft genome and removing reads present in uninfected control libraries. Sequencing and bioinformatics results were verified by RT-PCR. Like other RNAi-equipped fungi, P. striiformis produces large numbers of 20-22 nt sequences with a preference for uracil at the 5' position. Precise post-transcriptional processing and high accumulation of specific sRNA sequences were observed. Some predicted sRNA precursors possess a microRNA-like stem-loop secondary structure; others originate from much longer inverted repeats containing gene sequences. Finally, sRNA-target prediction algorithms were used to obtain a list of putative gene targets in both organisms. Predicted fungal target genes were enriched for kinases and small secreted proteins, while the list of wheat targets included homologs of known plant resistance genes. This work provides an inventory of small RNAs endogenous to an important plant pathogen, enabling further exploration of gene

  17. Durable resistance to wheat stem rust needed.

    Science.gov (United States)

    Ayliffe, Michael; Singh, Ravi; Lagudah, Evans

    2008-04-01

    The recent outbreak of a new wheat stem rust race capable of parasitizing many commercial wheat cultivars highlights the need for durable disease resistance in crop plants. More advanced breeding approaches using quantitative disease resistance genes and resistance gene pyramids are being used to combat wheat stem rust and other diseases, though widespread adoption of these breeding methodologies is needed to maintain resistance efficacy. Advances in understanding the molecular basis of plant disease resistance at both host and nonhost levels offers further possibilities for stem rust resistance using biotechnological approaches. However, truly durable resistance to wheat stem rust and other phytopathogens seems an unlikely prospect in the face of continually evolving pathogen populations.

  18. Resistance Potential of Bread Wheat Genotypes Against Yellow Rust Disease Under Egyptian Climate.

    Science.gov (United States)

    Mahmoud, Amer F; Hassan, Mohamed I; Amein, Karam A

    2015-12-01

    Yellow rust (stripe rust), caused by Puccinia striiformis f. sp. tritici, is one of the most destructive foliar diseases of wheat in Egypt and worldwide. In order to identify wheat genotypes resistant to yellow rust and develop molecular markers associated with the resistance, fifty F8 recombinant inbred lines (RILs) derived from a cross between resistant and susceptible bread wheat landraces were obtained. Artificial infection of Puccinia striiformis was performed under greenhouse conditions during two growing seasons and relative resistance index (RRI) was calculated. Two Egyptian bread wheat cultivars i.e. Giza-168 (resistant) and Sakha-69 (susceptible) were also evaluated. RRI values of two-year trial showed that 10 RILs responded with RRI value >6 2 rust. However, further molecular analyses would be performed to confirm markers associated with the resistance and suitable for marker-assisted selection. Resistant RILs identified in the study could be efficiently used to improve the resistance to yellow rust in wheat.

  19. Specificity of a Rust Resistance Suppressor on 7DL in the Spring Wheat Cultivar Canthatch.

    Science.gov (United States)

    Talajoor, Mina; Jin, Yue; Wan, Anmin; Chen, Xianming; Bhavani, Sridhar; Tabe, Linda; Lagudah, Evans; Huang, Li

    2015-04-01

    The spring wheat 'Canthatch' has been shown to suppress stem rust resistance genes in the background due to the presence of a suppressor gene located on the long arm of chromosome 7D. However, it is unclear whether the suppressor also suppresses resistance genes against leaf rust and stripe rust. In this study, we investigated the specificity of the resistance suppression. To determine whether the suppression is genome origin specific, chromosome location specific, or rust species or race specific, we introduced 11 known rust resistance genes into the Canthatch background, including resistance to leaf, stripe, or stem rusts, originating from A, B, or D genomes and located on different chromosome homologous groups. F1 plants of each cross were tested with the corresponding rust race, and the infection types were scored and compared with the parents. Our results show that the Canthatch 7DL suppressor only suppressed stem rust resistance genes derived from either the A or B genome, and the pattern of the suppression is gene specific and independent of chromosomal location.

  20. Wheat hypersensitive-induced reaction genes TaHIR1 and TaHIR3 are involved in response to stripe rust fungus infection and abiotic stresses.

    Science.gov (United States)

    Duan, Yinghui; Guo, Jun; Shi, Xuexia; Guan, Xiangnan; Liu, Furong; Bai, Pengfei; Huang, Lili; Kang, Zhensheng

    2013-02-01

    KEY MESSAGE : TaHIR1 and TaHIR3 play positive roles in resistance to the stripe rust fungus via inducing HR and regulating defense-related genes, but are negatively regulated by various abiotic stimuli. Plant hypersensitive-induced reaction (HIR) genes are known to be associated with the hypersensitive response and disease defense. In wheat, two HIR genes, TaHIR1 and TaHIR3, have been identified and found to be up-regulated after infection with the stripe rust fungus. Here, we further determined their roles in defense against abiotic stresses and the stripe rust pathogen, Puccinia striiformis f. sp. tritici. TaHIR1 and TaHIR3 proteins were localized in the plasma membrane of tobacco cells. The expression of TaHIR1 and TaHIR3 was reduced by the environmental stimuli, including low temperature, drought, and high salinity stresses. In addition, the expression of TaHIR1 and TaHIR3 was down-regulated by exogenously applied ethrel and abscisic acid, whereas expression was not affected by treatments with salicylic acid and methyl jasmonate. Furthermore, barley stripe mosaic virus-induced gene silencing of TaHIR1 and TaHIR3 reduced resistance in wheat cultivar Suwon11 against an avirulent stripe rust pathotype CYR23 and area of necrotic cells neighboring the infection sites, and altered the expression levels of defense-related genes. These results suggest that TaHIR1 and TaHIR3 function positively in the incompatible interaction of wheat-stripe rust fungus, but exhibit negative transcriptional response to abiotic stresses.

  1. Strategies for improving rust resistance in oats

    International Nuclear Information System (INIS)

    Harder, D.E.; McKenzie, R.I.H.; Martens, J.W.; Brown, P.D.

    1977-01-01

    During the history of breeding oats for rust resistance in Canada the known sources of resistance proved inadequate to counter the virulence potential of both stem rust (Puccinia graminis avenae) and crown rust (P. coronata avenae). A major programme to overcome the rust problem was undertaken at Winnipeg, involving four alternate approaches: (1) A search for new resistance in wild oat species, particularly Avena sterilis, has provided a wealth of good resistance to crown rust, but less to stem rust. Much of the A. sterilis-derived crown rust resistance is now being used world-wide; (2) Efforts at synthesizing new resistance by mutation breeding methods have not been successful. Of about seven million plants examined, only one showed significant new resistance, but this was associated with poor plant type; (3) Resistance with low levels of expression but which appears broadly effective has been observed against both stem and crown rusts. It appears that numbers of these low-level genes exist, and that they can be accumulated to provide increasingly effective resistance. Problems in using this type of resistance in a practical way are discussed; (4) Excellent rust resistance has been found in lower ploidy species such as A. barbata, but it was not previously possible to stabilize this resistance in hexaploid species. By using mutagenic treatments attempts have been made to translocate smaller portions of the A. barbata chromosome carrying the resistance to the hexaploid cultivar Rodney. In conclusion, mutation breeding methods at present appear to have limited application in synthesizing new rust-resistant genotypes in oats. The search for already existing genetic resistance and its synthesis into multi-genic resistant lines appears to be the most effective way at present of resolving the rust problem in oats. (author)

  2. Screening oat populations for rust resistant mutants

    International Nuclear Information System (INIS)

    McKenzie, R.I.H.; Martens, J.W.; Harder, D.E.; Brown, P.D.

    1976-01-01

    In 1972 a two million M 2 plants were grown at Morden, Manitoba. Thirteen plants which were thought to have possible resistance to race CI0 of oat stem rust were harvested. After extensive seedling and adult plant rust tests the best of the selected plant progenies was crossed and backcrossed to Rodney 0, a stem rust susceptible oat. The resistance in this line M-72-6 was found to be controlled by a single gene. In 1973 another two million M 2 plants were examined for rust resistance at Morden and 38 were harvested. None of the M 2 plants selected in 1973 appeared to have any seedling or adult resistance when examined more thoroughly in the greenhouse and again in the field in 1974. In 1974 one million M 2 plants were examined for resistance and 73 selected. None appeared to have any resistance when tested further. The strain CI3034 which was good adult plant stem rust resistance associated with weak straw and a light green plant colour was treated with gamma radiation and EMS in 1973 and the M 2 grown in the C10 rust nursery at Morden in 1974. A considerable number of dark green plants were present in all treatments but unfortunately all were found to be stem rust susceptible. Thus it would appear to be difficult if not impossible to separate the rust resistance in CI3034 from the undesirable characters, weak straw and light green plant colour. (author)

  3. 75 FR 44881 - Black Stem Rust; Additions of Rust-Resistant Varieties

    Science.gov (United States)

    2010-07-30

    ...-0035] Black Stem Rust; Additions of Rust-Resistant Varieties AGENCY: Animal and Plant Health Inspection... direct final rule notified the public of our intention to amend the black stem rust quarantine and regulations by adding 21 varieties to the list of rust-resistant Berberis species or cultivars and 2 varieties...

  4. 76 FR 3011 - Black Stem Rust; Additions of Rust-Resistant Varieties

    Science.gov (United States)

    2011-01-19

    ...-0088] Black Stem Rust; Additions of Rust-Resistant Varieties AGENCY: Animal and Plant Health Inspection... notified the public of our intention to amend the black stem rust quarantine and regulations by adding four varieties to the list of rust-resistant Berberis species or cultivars. We did not receive any written...

  5. 75 FR 54461 - Black Stem Rust; Additions of Rust-Resistant Varieties

    Science.gov (United States)

    2010-09-08

    .... APHIS-2010-0088] Black Stem Rust; Additions of Rust-Resistant Varieties AGENCY: Animal and Plant Health Inspection Service, USDA. ACTION: Direct final rule. SUMMARY: We are amending the black stem rust quarantine and regulations by adding four varieties to the list of rust-resistant Berberis species or cultivars...

  6. [Prediction model of meteorological grade of wheat stripe rust in winter-reproductive area, Sichuan Basin, China].

    Science.gov (United States)

    Guo, Xiang; Wang, Ming Tian; Zhang, Guo Zhi

    2017-12-01

    The winter reproductive areas of Puccinia striiformis var. striiformis in Sichuan Basin are often the places mostly affected by wheat stripe rust. With data on the meteorological condition and stripe rust situation at typical stations in the winter reproductive area in Sichuan Basin from 1999 to 2016, this paper classified the meteorological conditions inducing wheat stripe rust into 5 grades, based on the incidence area ratio of the disease. The meteorological factors which were biologically related to wheat stripe rust were determined through multiple analytical methods, and a meteorological grade model for forecasting wheat stripe rust was created. The result showed that wheat stripe rust in Sichuan Basin was significantly correlated with many meteorological factors, such as the ave-rage (maximum and minimum) temperature, precipitation and its anomaly percentage, relative humidity and its anomaly percentage, average wind speed and sunshine duration. Among these, the average temperature and the anomaly percentage of relative humidity were the determining factors. According to a historical retrospective test, the accuracy of the forecast based on the model was 64% for samples in the county-level test, and 89% for samples in the municipal-level test. In a meteorological grade forecast of wheat stripe rust in the winter reproductive areas in Sichuan Basin in 2017, the prediction was accurate for 62.8% of the samples, with 27.9% error by one grade and only 9.3% error by two or more grades. As a result, the model could deliver satisfactory forecast results, and predicate future wheat stripe rust from a meteorological point of view.

  7. Nonhost resistance of rice to rust pathogens.

    Science.gov (United States)

    Ayliffe, Michael; Devilla, Rosangela; Mago, Rohit; White, Rosemary; Talbot, Mark; Pryor, Anthony; Leung, Hei

    2011-10-01

    Rice is atypical in that it is an agricultural cereal that is immune to fungal rust diseases. This report demonstrates that several cereal rust species (Puccinia graminis f. sp tritici, P. triticina, P. striiformis, and P. hordei) can infect rice and produce all the infection structures necessary for plant colonization, including specialized feeding cells (haustoria). Some rust infection sites are remarkably large and many plant cells are colonized, suggesting that nutrient uptake occurs to support this growth. Rice responds with an active, nonhost resistance (NHR) response that prevents fungal sporulation and that involves callose deposition, production of reactive oxygen species, and, occasionally, cell death. Genetic variation for the efficacy of NHR to wheat stem rust and wheat leaf rust was observed. Unlike cereal rusts, the rust pathogen (Melampsora lini) of the dicotyledenous plant flax (Linum usitatissimum) rarely successfully infects rice due to an apparent inability to recognize host-derived signals. Morphologically abnormal infection structures are produced and appressorial-like structures often don't coincide with stomata. These data suggest that basic compatibility is an important determinate of nonhost infection outcomes of rust diseases on cereals, with cereal rusts being more capable of infecting a cereal nonhost species compared with rust species that are adapted for dicot hosts.

  8. The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence.

    Science.gov (United States)

    Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael

    2017-07-01

    The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  9. Induced resistance to rust disease in lentil

    International Nuclear Information System (INIS)

    Paul, Amitava; Singh, D.P.

    2006-01-01

    Considerable yield reduction in lentil is due to rust caused by Uromyces fabae. So far the sources of resistance to rust are available in the small seeded background. There is a need to develop rust resistant/tolerant bold seeded cultivars. Mutations were induced by gamma rays (10 and 15 kR) for incorporating resistance to rust in K-75(Mallika), a high yielding bold seeded, but rust susceptible cultivar at Pantnagar which is the hot spot for this disease. Dry seeds (300) were irradiated for each treatment. In M 1 generation, individual plants from each treatment were selfed and harvested separately which constituted the M 2 generation. In M 2 individual plant progenies were scored following a rating scale of 1 (Free) to 9(highly susceptible). At 15 kR dose, 8 plants were resistant (score 3.0) and 14 plants were tolerant (score 5.0) to rust, while in control and 10 kR populations, all plants were susceptible or highly susceptible having score of 7 or 9, respectively. The M 2 plants segregated in ratio of 1 resistant: 3 susceptible. The progenies of resistant/tolerant M 2 plants were bred true in the M 3 generation suggesting that the resistance to rust is controlled by one recessive gene. (author)

  10. Identification and Severity Determination of Wheat Stripe Rust and Wheat Leaf Rust Based on Hyperspectral Data Acquired Using a Black-Paper-Based Measuring Method

    Science.gov (United States)

    Ruan, Liu; Wang, Rui; Liu, Qi; Ma, Zhanhong; Li, Xiaolong; Cheng, Pei; Wang, Haiguang

    2016-01-01

    It is important to implement detection and assessment of plant diseases based on remotely sensed data for disease monitoring and control. Hyperspectral data of healthy leaves, leaves in incubation period and leaves in diseased period of wheat stripe rust and wheat leaf rust were collected under in-field conditions using a black-paper-based measuring method developed in this study. After data preprocessing, the models to identify the diseases were built using distinguished partial least squares (DPLS) and support vector machine (SVM), and the disease severity inversion models of stripe rust and the disease severity inversion models of leaf rust were built using quantitative partial least squares (QPLS) and support vector regression (SVR). All the models were validated by using leave-one-out cross validation and external validation. The diseases could be discriminated using both distinguished partial least squares and support vector machine with the accuracies of more than 99%. For each wheat rust, disease severity levels were accurately retrieved using both the optimal QPLS models and the optimal SVR models with the coefficients of determination (R2) of more than 0.90 and the root mean square errors (RMSE) of less than 0.15. The results demonstrated that identification and severity evaluation of stripe rust and leaf rust at the leaf level could be implemented based on the hyperspectral data acquired using the developed method. A scientific basis was provided for implementing disease monitoring by using aerial and space remote sensing technologies. PMID:27128464

  11. Identification and Severity Determination of Wheat Stripe Rust and Wheat Leaf Rust Based on Hyperspectral Data Acquired Using a Black-Paper-Based Measuring Method.

    Science.gov (United States)

    Wang, Hui; Qin, Feng; Ruan, Liu; Wang, Rui; Liu, Qi; Ma, Zhanhong; Li, Xiaolong; Cheng, Pei; Wang, Haiguang

    2016-01-01

    It is important to implement detection and assessment of plant diseases based on remotely sensed data for disease monitoring and control. Hyperspectral data of healthy leaves, leaves in incubation period and leaves in diseased period of wheat stripe rust and wheat leaf rust were collected under in-field conditions using a black-paper-based measuring method developed in this study. After data preprocessing, the models to identify the diseases were built using distinguished partial least squares (DPLS) and support vector machine (SVM), and the disease severity inversion models of stripe rust and the disease severity inversion models of leaf rust were built using quantitative partial least squares (QPLS) and support vector regression (SVR). All the models were validated by using leave-one-out cross validation and external validation. The diseases could be discriminated using both distinguished partial least squares and support vector machine with the accuracies of more than 99%. For each wheat rust, disease severity levels were accurately retrieved using both the optimal QPLS models and the optimal SVR models with the coefficients of determination (R2) of more than 0.90 and the root mean square errors (RMSE) of less than 0.15. The results demonstrated that identification and severity evaluation of stripe rust and leaf rust at the leaf level could be implemented based on the hyperspectral data acquired using the developed method. A scientific basis was provided for implementing disease monitoring by using aerial and space remote sensing technologies.

  12. Identification and Severity Determination of Wheat Stripe Rust and Wheat Leaf Rust Based on Hyperspectral Data Acquired Using a Black-Paper-Based Measuring Method.

    Directory of Open Access Journals (Sweden)

    Hui Wang

    Full Text Available It is important to implement detection and assessment of plant diseases based on remotely sensed data for disease monitoring and control. Hyperspectral data of healthy leaves, leaves in incubation period and leaves in diseased period of wheat stripe rust and wheat leaf rust were collected under in-field conditions using a black-paper-based measuring method developed in this study. After data preprocessing, the models to identify the diseases were built using distinguished partial least squares (DPLS and support vector machine (SVM, and the disease severity inversion models of stripe rust and the disease severity inversion models of leaf rust were built using quantitative partial least squares (QPLS and support vector regression (SVR. All the models were validated by using leave-one-out cross validation and external validation. The diseases could be discriminated using both distinguished partial least squares and support vector machine with the accuracies of more than 99%. For each wheat rust, disease severity levels were accurately retrieved using both the optimal QPLS models and the optimal SVR models with the coefficients of determination (R2 of more than 0.90 and the root mean square errors (RMSE of less than 0.15. The results demonstrated that identification and severity evaluation of stripe rust and leaf rust at the leaf level could be implemented based on the hyperspectral data acquired using the developed method. A scientific basis was provided for implementing disease monitoring by using aerial and space remote sensing technologies.

  13. Evaluation of 19,460 Wheat Accessions Conserved in the Indian National Genebank to Identify New Sources of Resistance to Rust and Spot Blotch Diseases

    Science.gov (United States)

    Jacob, Sherry R.; Srinivasan, Kalyani; Radhamani, J.; Parimalan, R.; Sivaswamy, M.; Tyagi, Sandhya; Yadav, Mamata; Kumari, Jyotisna; Deepali; Sharma, Sandeep; Bhagat, Indoo; Meeta, Madhu; Bains, N. S.; Chowdhury, A. K.; Saha, B. C.; Bhattacharya, P. M.; Kumari, Jyoti; Singh, M. C.; Gangwar, O. P.; Prasad, P.; Bharadwaj, S. C.; Gogoi, Robin; Sharma, J. B.; GM, Sandeep Kumar; Saharan, M. S.; Bag, Manas; Roy, Anirban; Prasad, T. V.; Sharma, R. K.; Dutta, M.; Sharma, Indu; Bansal, K. C.

    2016-01-01

    A comprehensive germplasm evaluation study of wheat accessions conserved in the Indian National Genebank was conducted to identify sources of rust and spot blotch resistance. Genebank accessions comprising three species of wheat–Triticum aestivum, T. durum and T. dicoccum were screened sequentially at multiple disease hotspots, during the 2011–14 crop seasons, carrying only resistant accessions to the next step of evaluation. Wheat accessions which were found to be resistant in the field were then assayed for seedling resistance and profiled using molecular markers. In the primary evaluation, 19,460 accessions were screened at Wellington (Tamil Nadu), a hotspot for wheat rusts. We identified 4925 accessions to be resistant and these were further evaluated at Gurdaspur (Punjab), a hotspot for stripe rust and at Cooch Behar (West Bengal), a hotspot for spot blotch. The second round evaluation identified 498 accessions potentially resistant to multiple rusts and 868 accessions potentially resistant to spot blotch. Evaluation of rust resistant accessions for seedling resistance against seven virulent pathotypes of three rusts under artificial epiphytotic conditions identified 137 accessions potentially resistant to multiple rusts. Molecular analysis to identify different combinations of genetic loci imparting resistance to leaf rust, stem rust, stripe rust and spot blotch using linked molecular markers, identified 45 wheat accessions containing known resistance genes against all three rusts as well as a QTL for spot blotch resistance. The resistant germplasm accessions, particularly against stripe rust, identified in this study can be excellent potential candidates to be employed for breeding resistance into the background of high yielding wheat cultivars through conventional or molecular breeding approaches, and are expected to contribute toward food security at national and global levels. PMID:27942031

  14. Evaluation of 19,460 Wheat Accessions Conserved in the Indian National Genebank to Identify New Sources of Resistance to Rust and Spot Blotch Diseases.

    Directory of Open Access Journals (Sweden)

    Sundeep Kumar

    Full Text Available A comprehensive germplasm evaluation study of wheat accessions conserved in the Indian National Genebank was conducted to identify sources of rust and spot blotch resistance. Genebank accessions comprising three species of wheat-Triticum aestivum, T. durum and T. dicoccum were screened sequentially at multiple disease hotspots, during the 2011-14 crop seasons, carrying only resistant accessions to the next step of evaluation. Wheat accessions which were found to be resistant in the field were then assayed for seedling resistance and profiled using molecular markers. In the primary evaluation, 19,460 accessions were screened at Wellington (Tamil Nadu, a hotspot for wheat rusts. We identified 4925 accessions to be resistant and these were further evaluated at Gurdaspur (Punjab, a hotspot for stripe rust and at Cooch Behar (West Bengal, a hotspot for spot blotch. The second round evaluation identified 498 accessions potentially resistant to multiple rusts and 868 accessions potentially resistant to spot blotch. Evaluation of rust resistant accessions for seedling resistance against seven virulent pathotypes of three rusts under artificial epiphytotic conditions identified 137 accessions potentially resistant to multiple rusts. Molecular analysis to identify different combinations of genetic loci imparting resistance to leaf rust, stem rust, stripe rust and spot blotch using linked molecular markers, identified 45 wheat accessions containing known resistance genes against all three rusts as well as a QTL for spot blotch resistance. The resistant germplasm accessions, particularly against stripe rust, identified in this study can be excellent potential candidates to be employed for breeding resistance into the background of high yielding wheat cultivars through conventional or molecular breeding approaches, and are expected to contribute toward food security at national and global levels.

  15. Evaluation of 19,460 Wheat Accessions Conserved in the Indian National Genebank to Identify New Sources of Resistance to Rust and Spot Blotch Diseases.

    Science.gov (United States)

    Kumar, Sundeep; Archak, Sunil; Tyagi, R K; Kumar, Jagdish; Vk, Vikas; Jacob, Sherry R; Srinivasan, Kalyani; Radhamani, J; Parimalan, R; Sivaswamy, M; Tyagi, Sandhya; Yadav, Mamata; Kumari, Jyotisna; Deepali; Sharma, Sandeep; Bhagat, Indoo; Meeta, Madhu; Bains, N S; Chowdhury, A K; Saha, B C; Bhattacharya, P M; Kumari, Jyoti; Singh, M C; Gangwar, O P; Prasad, P; Bharadwaj, S C; Gogoi, Robin; Sharma, J B; Gm, Sandeep Kumar; Saharan, M S; Bag, Manas; Roy, Anirban; Prasad, T V; Sharma, R K; Dutta, M; Sharma, Indu; Bansal, K C

    2016-01-01

    A comprehensive germplasm evaluation study of wheat accessions conserved in the Indian National Genebank was conducted to identify sources of rust and spot blotch resistance. Genebank accessions comprising three species of wheat-Triticum aestivum, T. durum and T. dicoccum were screened sequentially at multiple disease hotspots, during the 2011-14 crop seasons, carrying only resistant accessions to the next step of evaluation. Wheat accessions which were found to be resistant in the field were then assayed for seedling resistance and profiled using molecular markers. In the primary evaluation, 19,460 accessions were screened at Wellington (Tamil Nadu), a hotspot for wheat rusts. We identified 4925 accessions to be resistant and these were further evaluated at Gurdaspur (Punjab), a hotspot for stripe rust and at Cooch Behar (West Bengal), a hotspot for spot blotch. The second round evaluation identified 498 accessions potentially resistant to multiple rusts and 868 accessions potentially resistant to spot blotch. Evaluation of rust resistant accessions for seedling resistance against seven virulent pathotypes of three rusts under artificial epiphytotic conditions identified 137 accessions potentially resistant to multiple rusts. Molecular analysis to identify different combinations of genetic loci imparting resistance to leaf rust, stem rust, stripe rust and spot blotch using linked molecular markers, identified 45 wheat accessions containing known resistance genes against all three rusts as well as a QTL for spot blotch resistance. The resistant germplasm accessions, particularly against stripe rust, identified in this study can be excellent potential candidates to be employed for breeding resistance into the background of high yielding wheat cultivars through conventional or molecular breeding approaches, and are expected to contribute toward food security at national and global levels.

  16. Secretome Characterization and Correlation Analysis Reveal Putative Pathogenicity Mechanisms and Identify Candidate Avirulence Genes in the Wheat Stripe Rust Fungus Puccinia striiformis f. sp. tritici.

    Science.gov (United States)

    Xia, Chongjing; Wang, Meinan; Cornejo, Omar E; Jiwan, Derick A; See, Deven R; Chen, Xianming

    2017-01-01

    Stripe (yellow) rust, caused by Puccinia striiformis f. sp. tritici ( Pst ), is one of the most destructive diseases of wheat worldwide. Planting resistant cultivars is an effective way to control this disease, but race-specific resistance can be overcome quickly due to the rapid evolving Pst population. Studying the pathogenicity mechanisms is critical for understanding how Pst virulence changes and how to develop wheat cultivars with durable resistance to stripe rust. We re-sequenced 7 Pst isolates and included additional 7 previously sequenced isolates to represent balanced virulence/avirulence profiles for several avirulence loci in seretome analyses. We observed an uneven distribution of heterozygosity among the isolates. Secretome comparison of Pst with other rust fungi identified a large portion of species-specific secreted proteins, suggesting that they may have specific roles when interacting with the wheat host. Thirty-two effectors of Pst were identified from its secretome. We identified candidates for Avr genes corresponding to six Yr genes by correlating polymorphisms for effector genes to the virulence/avirulence profiles of the 14 Pst isolates. The putative AvYr76 was present in the avirulent isolates, but absent in the virulent isolates, suggesting that deleting the coding region of the candidate avirulence gene has produced races virulent to resistance gene Yr76 . We conclude that incorporating avirulence/virulence phenotypes into correlation analysis with variations in genomic structure and secretome, particularly presence/absence polymorphisms of effectors, is an efficient way to identify candidate Avr genes in Pst . The candidate effector genes provide a rich resource for further studies to determine the evolutionary history of Pst populations and the co-evolutionary arms race between Pst and wheat. The Avr candidates identified in this study will lead to cloning avirulence genes in Pst , which will enable us to understand molecular mechanisms

  17. The development of quick, robust, quantitative phenotypic assays for describing the host-nonhost landscape to stripe rust.

    Science.gov (United States)

    Dawson, Andrew M; Bettgenhaeuser, Jan; Gardiner, Matthew; Green, Phon; Hernández-Pinzón, Inmaculada; Hubbard, Amelia; Moscou, Matthew J

    2015-01-01

    Nonhost resistance is often conceptualized as a qualitative separation from host resistance. Classification into these two states is generally facile, as they fail to fully describe the range of states that exist in the transition from host to nonhost. This poses a problem when studying pathosystems that cannot be classified as either host or nonhost due to their intermediate status relative to these two extremes. In this study, we investigate the efficacy of the Poaceae-stripe rust (Puccinia striiformis Westend.) interaction for describing the host-nonhost landscape. First, using barley (Hordeum vulgare L.) and Brachypodium distachyon (L.) P. Beauv. We observed that macroscopic symptoms of chlorosis and leaf browning were associated with hyphal colonization by P. striiformis f. sp. tritici, respectively. This prompted us to adapt a protocol for visualizing fungal structures into a phenotypic assay that estimates the percent of leaf colonized. Use of this assay in intermediate host and intermediate nonhost systems found the frequency of infection decreases with evolutionary divergence from the host species. Similarly, we observed that the pathogen's ability to complete its life cycle decreased faster than its ability to colonize leaf tissue, with no incidence of pustules observed in the intermediate nonhost system and significantly reduced pustule formation in the intermediate host system as compared to the host system, barley-P. striiformis f. sp. hordei. By leveraging the stripe rust pathosystem in conjunction with macroscopic and microscopic phenotypic assays, we now hope to dissect the genetic architecture of intermediate host and intermediate nonhost resistance using structured populations in barley and B. distachyon.

  18. The development of quick, robust, quantitative phenotypic assays for describing the host-nonhost landscape to stripe rust

    Directory of Open Access Journals (Sweden)

    Andrew Marc Dawson

    2015-10-01

    Full Text Available Nonhost resistance is often conceptualized as a qualitative separation from host resistance. Classification into these two states is generally facile, as they fail to fully describe the range of states that exist in the transition from host to nonhost. This poses a problem when studying pathosystems that cannot be classified as either host or nonhost due to their intermediate status relative to these two extremes. In this study, we investigate the efficacy of the Poaceae-stripe rust (Puccinia striiformis Westend. interaction for describing the host-nonhost landscape. First, using barley (Hordeum vulgare L. and Brachypodium distachyon (L. P. Beauv. we observed that macroscopic symptoms of chlorosis and leaf browning were associated with hyphal colonization by P. striiformis f. sp. tritici, respectively. This prompted us to adapt a protocol for visualizing fungal structures into a phenotypic assay that estimates the percent of leaf colonized. Use of this assay in intermediate host and intermediate nonhost systems found the frequency of infection decreases with evolutionary divergence from the host species. Similarly, we observed that the pathogen’s ability to complete its life cycle decreased faster than its ability to colonize leaf tissue, with no incidence of pustules observed in the intermediate nonhost system and significantly reduced pustule formation in the intermediate host system as compared to the host system, barley-P. striiformis f. sp. hordei. By leveraging the stripe rust pathosystem in conjunction with macroscopic and microscopic phenotypic assays, we now hope to dissect the genetic architecture of intermediate host and intermediate nonhost resistance using structured populations in barley and B. distachyon.

  19. Glyphosate inhibits rust diseases in glyphosate-resistant wheat and soybean

    Science.gov (United States)

    Feng, Paul C. C.; Baley, G. James; Clinton, William P.; Bunkers, Greg J.; Alibhai, Murtaza F.; Paulitz, Timothy C.; Kidwell, Kimberlee K.

    2005-01-01

    Glyphosate is a broad-spectrum herbicide used for the control of weeds in glyphosate-resistant crops. Glyphosate inhibits 5-enolpyruvyl shikimate 3-phosphate synthase, a key enzyme in the synthesis of aromatic amino acids in plants, fungi, and bacteria. Studies with glyphosate-resistant wheat have shown that glyphosate provided both preventive and curative activities against Puccinia striiformis f. sp. tritici and Puccinia triticina, which cause stripe and leaf rusts, respectively, in wheat. Growth-chamber studies demonstrated wheat rust control at multiple plant growth stages with a glyphosate spray dose typically recommended for weed control. Rust control was absent in formulation controls without glyphosate, dependent on systemic glyphosate concentrations in leaf tissues, and not mediated through induction of four common systemic acquired resistance genes. A field test with endemic stripe rust inoculum confirmed the activities of glyphosate pre- and postinfestation. Preliminary greenhouse studies also demonstrated that application of glyphosate in glyphosate-resistant soybeans suppressed Asian soybean rust, caused by Phakopsora pachyrhizi. PMID:16293685

  20. A novel fungal hyperparasite of Puccinia striiformis f. sp. tritici, the causal agent of wheat stripe rust.

    Directory of Open Access Journals (Sweden)

    Gangming Zhan

    Full Text Available Puccinia striiformis f. sp. tritici (Pst, the causal fungus of wheat stripe rust, was previously reported to be infected by Lecanicillium lecanii, Microdochium nivale and Typhula idahoensis. Here, we report a novel hyperparasite on Pst. This hyperparasitic fungus was identified as Cladosporium cladosporioides (Fresen. GA de Vries based on morphological characteristics observed by light and scanning electron microscopy together with molecular data. The hyperparasite reduced the production and viability of urediniospores and, therefore, could potentially be used for biological control of wheat stripe rust.

  1. Cytogenetic study and stripe rust response of the derivatives from a wheat - Thinopyrum intermedium - Psathyrostachys huashanica trigeneric hybrid.

    Science.gov (United States)

    Kang, Hou-Yang; Tang, Lin; Li, Dai-Yan; Diao, Cheng-Dou; Zhu, Wei; Tang, Yao; Wang, Yi; Fan, Xing; Xu, Li-Li; Zeng, Jian; Sha, Li-Na; Yu, Xiao-Fang; Zhang, Hai-Qin; Zhou, Yong-Hong

    2017-05-01

    To transfer multiple desirable alien genes into common wheat, we previously reported a new trigeneric hybrid synthesized by crossing a wheat - Thinopyrum intermedium partial amphiploid with wheat - Psathyrostachys huashanica amphiploid. Here, the meiotic behavior, chromosome constitution, and stripe rust resistance of F 5 derivatives from the wheat - Th. intermedium - P. huashanica trigeneric hybrid were studied. Cytological analysis indicated the F 5 progenies had chromosome numbers of 42-50 (average 44.96). The mean meiotic configuration was 1.28 univalents, 21.74 bivalents, 0.04 trivalents, and 0.02 tetravalents per pollen mother cell. In 2n = 42 lines, the average pairing configuration was 0.05 I + 19.91 II (ring) + 1.06 II (rod) + 0.003 IV, suggesting these lines were cytologically stable. Most lines with 2n = 43, 44, 46, 48, or 50, bearing a high frequency of univalents or multivalents, showed abnormal meiotic behavior. Genomic in situ hybridization karyotyping results revealed that 25 lines contained 1-7 Th. intermedium chromosomes, but no P. huashanica chromosomes were found among the 27 self-pollinated progenies. At meiosis, univalents (1-5) possessing Th. intermedium hybridization signals were detected in 19 lines. Bivalents (1-3) expressing fluorescence signals were observed in 12 lines. Importantly, 21 lines harbored wheat - Th. intermedium chromosomal translocations with various alien translocation types. Additionally, two homozygous lines, K13-668-10 and K13-682-12, possessed a pair of wheat - Th. intermedium small fragmental translocations. Compared with the recurrent parent Zhong 3, most lines showed high resistance to the stripe rust (Puccinia striiformis f. sp. tritici) pathogens prevalent in China, including race V26/Gui22. This paper reports a highly efficient technical method for inducing alien translocation between wheat and Th. intermedium by trigeneric hybridization. These lines might be potentially valuable germplasm resources for further

  2. Glyphosate inhibits rust diseases in glyphosate-resistant wheat and soybean

    OpenAIRE

    Feng, Paul C. C.; Baley, G. James; Clinton, William P.; Bunkers, Greg J.; Alibhai, Murtaza F.; Paulitz, Timothy C.; Kidwell, Kimberlee K.

    2005-01-01

    Glyphosate is a broad-spectrum herbicide used for the control of weeds in glyphosate-resistant crops. Glyphosate inhibits 5-enolpyruvyl shikimate 3-phosphate synthase, a key enzyme in the synthesis of aromatic amino acids in plants, fungi, and bacteria. Studies with glyphosate-resistant wheat have shown that glyphosate provided both preventive and curative activities against Puccinia striiformis f. sp. tritici and Puccinia triticina, which cause stripe and leaf rusts, respectively, in wheat. ...

  3. Resistance Potential of Bread Wheat Genotypes Against Yellow Rust Disease Under Egyptian Climate

    Directory of Open Access Journals (Sweden)

    Amer F. Mahmoud

    2015-12-01

    Full Text Available Yellow rust (stripe rust, caused by Puccinia striiformis f. sp. tritici, is one of the most destructive foliar diseases of wheat in Egypt and worldwide. In order to identify wheat genotypes resistant to yellow rust and develop molecular markers associated with the resistance, fifty F₈ recombinant inbred lines (RILs derived from a cross between resistant and susceptible bread wheat landraces were obtained. Artificial infection of Puccinia striiformis was performed under greenhouse conditions during two growing seasons and relative resistance index (RRI was calculated. Two Egyptian bread wheat cultivars i.e. Giza-168 (resistant and Sakha-69 (susceptible were also evaluated. RRI values of two-year trial showed that 10 RILs responded with RRI value >6 2 <6. However, only 7 RILs showed RRI value <2. Five RILs expressed hypersensitive type of resistance (R against the pathogen and showed the lowest Average Coefficient of Infection (ACI. Bulked segregant analysis (BSA with eight simple sequence repeat (SSR, eight sequence-related amplified polymorphism (SRAP and sixteen random amplified polymorphic DNA (RAPD markers revealed that three SSR, three SRAP and six RAPD markers were found to be associated with the resistance to yellow rust. However, further molecular analyses would be performed to confirm markers associated with the resistance and suitable for marker-assisted selection. Resistant RILs identified in the study could be efficiently used to improve the resistance to yellow rust in wheat.

  4. Sources of resistance to yellow rust and stem rust in wheat-alien introgressions

    OpenAIRE

    Rahmatov, Mahbubjon

    2013-01-01

    Wheat is the staple food and the main source of caloric intake in most developing countries, and thereby an important source in order to maintain food security for the growing populations in those countries. Stem rust Puccinia graminis f. sp. tritici, and yellow rust P. striiformis f. sp. tritici of wheat continues to cause severe damage locally and globally, thereby contributing to food insecurity. In this paper biology and taxonomy of stem rust and yellow rust, breeding for resistance, util...

  5. Aspects of durable resistance in wheat to yellow rust

    NARCIS (Netherlands)

    Danial, D.L.

    1994-01-01

    In Kenya, the number of virulence factors of the yellow rust populations showed a considerable increase and a wide variability. Selecting for complete to near complete resistance to yellow rust and other cereal rust diseases, was followed by a rapid erosion of resistance.

    Partial

  6. Development of RAPD based markers for wheat rust resistance ...

    African Journals Online (AJOL)

    Rust diseases are the major cause of low yield of wheat in Pakistan. Wheat breeders all over the world as well as in Pakistan are deriving rust resistance genes from alien species like Triticum ventricosum and introducing them in common wheat (Triticum aestivum). One such example is the introgression of rust resistance ...

  7. Resistance to Barley Leaf Stripe

    DEFF Research Database (Denmark)

    Nørgaard Knudsen, J. C.

    1986-01-01

    in well adapted Northwest European spring cultivars. Virulence matching two hitherto not overcome resistances was demonstrated. Differences in apparent race nonspecific or partial resistance were also present, changing the percentage of infected plants of susceptible genotypes from about 20 to 44 per cent.......Ten barley [Hordeum vulgare] genotypes were inoculated with twelve isolates of Pyrenophora graminea of diverse European and North African origin. Race specific resistance occurred. Four, possibly five, genetically different sources of race-specific resistance were found, three of them occurring...

  8. Induced mutations for soybean rust resistance

    International Nuclear Information System (INIS)

    Smutkupt, S.; Wongpiyasatid, A.; Lamseejan, S.

    1983-01-01

    Soybean mutation experiments for inducing rust resistance in the cultivars G 8375, Wakashima mutant number 10, Taichung N, S.J.2, S.J.4, BM 50, BM 98, G 8377, G 8586 and G 8587 have been carried out since 1979. Six pods from each of 4438 control and 43,907 M 1 plants were randomly harvested. M 2 seeds of each cultivar of different doses were bulked (M 2 bulk). In addition, 270 good M 1 plants were selected and threshed singly (M 2 single). M 2 -bulk and M 2 -single seeds were advanced to M 3 . Both, M 3 -bulk and M 3 -single plants, together with the remaining M 2 -bulk seeds were screened for rust resistance in the rainy season of 1980 in Nong Hoi Valley (altitude about 1000 m above sea level) and at Mae Joe Station, both in Chiang Mai Province (latitude 18 deg. 31'-19 deg. N). Based on the IWGSR rating system, soybean plants with slow growth of rust were selected from both locations. The results were as follows: Six plants were selected from a total of 2802 control plants, and 115 from a total of 28,834 M 2 and M 3 plants. Further evaluation of these selections for rust resistance will be carried out in the rainy season of 1981 in Nong Hoi Valley, Chiang Mai. (author)

  9. Inheritance and bulked segregant analysis of leaf rust and stem rust resistance genes in eight durum wheat genotypes

    Science.gov (United States)

    Leaf rust, caused by Puccinia triticina (Pt) and stem rust caused by Puccinia graminis f. sp. tritici (Pgt) are important diseases of durum wheat. This study determined the inheritance and genomic locations of leaf rust resistance (Lr) genes to Pt-race BBBQJ and stem rust resistance (Sr) genes to Pg...

  10. Lr67 and Lr34 rust resistance genes have much in common – they confer broad spectrum resistance to multiple pathogens in wheat

    Science.gov (United States)

    2013-01-01

    Background Adult plant rust resistance genes Lr67 and Lr34 confer race non-specific resistance to multiple fungal pathogens of wheat. Induced, susceptible mutants were characterised for both genes. Results Three categories of Lr34 mutants were identified that were either partial susceptible, fully susceptible or hyper-susceptible to stripe rust and leaf rust. The likely impact of the mutational change on the predicted Lr34 protein correlated with differences in response to rust infection. Four independent Lr67 mutants were recovered that were susceptible to stripe rust, leaf rust and stem rust pathogens, including one possible hyper-susceptible Lr67 mutant. Conclusions Detailed study of Lr34 mutants revealed that subtle changes in resistance response to multiple pathogens were correlated with mutational changes in the predicted protein. Recovery of independent Lr67 mutants indicates that as for Lr34, a single gene at the Lr67 locus is likely to confer resistance to multiple pathogens. The infection phenotypes of Lr67 mutants closely resembled that of Lr34 mutants. PMID:23819608

  11. Leaf Rust of Wheat: Pathogen Biology, Variation and Host Resistance

    Directory of Open Access Journals (Sweden)

    James Kolmer

    2013-01-01

    Full Text Available Rusts are important pathogens of angiosperms and gymnosperms including cereal crops and forest trees. With respect to cereals, rust fungi are among the most important pathogens. Cereal rusts are heteroecious and macrocyclic requiring two taxonomically unrelated hosts to complete a five spore stage life cycle. Cereal rust fungi are highly variable for virulence and molecular polymorphism. Leaf rust, caused by Puccinia triticina is the most common rust of wheat on a worldwide basis. Many different races of P. triticina that vary for virulence to leaf rust resistance genes in wheat differential lines are found annually in the US. Molecular markers have been used to characterize rust populations in the US and worldwide. Highly virulent races of P. triticina are selected by leaf rust resistance genes in the soft red winter wheat, hard red winter wheat and hard red spring wheat cultivars that are grown in different regions of the US. Cultivars that only have race-specific leaf rust resistance genes that are effective in seedling plants lose their effective resistance and become susceptible within a few years of release. Cultivars with combinations of race non-specific resistance genes have remained resistant over a period of years even though races of the leaf rust population have changed constantly.

  12. Inheritance and Bulked Segregant Analysis of Leaf Rust and Stem Rust Resistance in Durum Wheat Genotypes.

    Science.gov (United States)

    Aoun, Meriem; Kolmer, James A; Rouse, Matthew N; Chao, Shiaoman; Bulbula, Worku Denbel; Elias, Elias M; Acevedo, Maricelis

    2017-12-01

    Leaf rust, caused by Puccinia triticina, and stem rust, caused by P. graminis f. sp. tritici, are important diseases of durum wheat. This study determined the inheritance and genomic locations of leaf rust resistance (Lr) genes to P. triticina race BBBQJ and stem rust resistance (Sr) genes to P. graminis f. sp. tritici race TTKSK in durum accessions. Eight leaf-rust-resistant genotypes were used to develop biparental populations. Accessions PI 192051 and PI 534304 were also resistant to P. graminis f. sp. tritici race TTKSK. The resulting progenies were phenotyped for leaf rust and stem rust response at seedling stage. The Lr and Sr genes were mapped in five populations using single-nucleotide polymorphisms and bulked segregant analysis. Five leaf-rust-resistant genotypes carried single dominant Lr genes whereas, in the remaining accessions, there was deviation from the expected segregation ratio of a single dominant Lr gene. Seven genotypes carried Lr genes different from those previously characterized in durum. The single dominant Lr genes in PI 209274, PI 244061, PI387263, and PI 313096 were mapped to chromosome arms 6BS, 2BS, 6BL, and 6BS, respectively. The Sr gene in PI 534304 mapped to 6AL and is most likely Sr13, while the Sr gene in PI 192051 could be uncharacterized in durum.

  13. Possibility of cereals protection against rusts by resistant breeding method

    Directory of Open Access Journals (Sweden)

    Czesław Zamorski

    2013-12-01

    Full Text Available In the years 1999-2001 field trials were run on susceptibility of wheat and triticale genotypes to infection by three rust fungi (Puccinia recondita, Puccinia graminis, Puccinia striiformis. The results of the observation of the infection level in following years have been similar. Among genotypes of winter wheat, breeding lines susceptible to Puccinia striiformis infection were rare, but among spring wheat 50% of genotypes were susceptible to yellow rust infection. A much higher level of sensitivity than in the case of winter wheat has been found in winter triticale genotypes. Wheat genotypes were distinguished by the high sensitivity to Puccinia graminis infection, only a few breeding lines were resistant to stem rust. The susceptibility of wheat to brown rust (Puccinia recondita was a common feature. Triticale genotypes compared to wheat were affected significantly less and majority of them exhibited high level of resistant to brown rust. The use of the breeding method has justification in control yellow rust of winter wheat. Recommended cultivars are almost all fully resistant to Puccinia striiformis infection. The application of this method in selection of spring wheat and triticale is in large past limited. Some of the registered cultivars of spring wheat and triticale are very susceptible to yellow rust. Using the breeding method to protect wheat from stem rust and brown rust is of little practical benefit in our county at this moment. But it can be effecive to control stem and brown rusts of triticale.

  14. Genomic Prediction of Genetic Values for Resistance to Wheat Rusts

    Directory of Open Access Journals (Sweden)

    Leonardo Ornella

    2012-11-01

    Full Text Available Durable resistance to the rust diseases of wheat ( L. can be achieved by developing lines that have race-nonspecific adult plant resistance conferred by multiple minor slow-rusting genes. Genomic selection (GS is a promising tool for accumulating favorable alleles of slow-rusting genes. In this study, five CIMMYT wheat populations evaluated for resistance were used to predict resistance to stem rust ( and yellow rust ( using Bayesian least absolute shrinkage and selection operator (LASSO (BL, ridge regression (RR, and support vector regression with linear or radial basis function kernel models. All parents and populations were genotyped using 1400 Diversity Arrays Technology markers and different prediction problems were assessed. Results show that prediction ability for yellow rust was lower than for stem rust, probably due to differences in the conditions of infection of both diseases. For within population and environment, the correlation between predicted and observed values (Pearson’s correlation [ρ] was greater than 0.50 in 90% of the evaluations whereas for yellow rust, ρ ranged from 0.0637 to 0.6253. The BL and RR models have similar prediction ability, with a slight superiority of the BL confirming reports about the additive nature of rust resistance. When making predictions between environments and/or between populations, including information from another environment or environments or another population or populations improved prediction.

  15. Genetic analysis of resistance to soybean rust disease | Kiryowa ...

    African Journals Online (AJOL)

    Soybean rust (Phakopsora pachyrhizi Sydow.) causes the most damage of all the pathogens known to attack soybean (Glycine max. Merril). A study was conducted in Uganda to estimate the magnitude of genetic parameters controlling soybean rust resistance and to estimate narrow sense heritability of the resistance.

  16. Progress on introduction of rust resistance genes into confection sunflower

    Science.gov (United States)

    Sunflower rust (Puccinia helianthi) emerged as a serious disease in the last few years. Confection sunflower is particularly vulnerable to the disease due to the lack of resistance sources. The objectives of this project are to transfer rust resistance genes from oil sunflower to confectionery sunfl...

  17. A new early-warning system for stripe rust affecting wheat and triticale: Host-pathogen interactions under different environmental conditions

    DEFF Research Database (Denmark)

    Rodriguez Algaba, Julian; Justesen, Annemarie Fejer; Hovmøller, Mogens Støvring

    . The sudden change was explained by the appearance of an exotic and aggressive Pst race that attacked most of the triticale varieties grown at that time, resulting in yield losses of 50-100% for organic farmers. At present, Tulus is the most widely grown triticale variety in Denmark. Although originally......Stripe (yellow) rust has been the most damaging disease in Danish organic wheat and triticale production since 2009. There were estimated losses of approximately 50 million DKK (9 million USD) in 2009. Until that time, triticale was considered the most robust cereal crop for organic farming...... resistant it was susceptible under field conditions in March 2012. All Pst isolates from Tulus, obtained from multiple locations, were identified as the ‘Kranich’-race, and were avirulent on Tulus under experimental conditions. In May and June 2012 Tulus recovered on a country-wide scale and was resistant...

  18. stem rust seedling resistance genes in ethiopian wheat cultivars

    African Journals Online (AJOL)

    Prof. Adipala Ekwamu

    Stem rust caused by Puccinia graminis f. sp. tritici is one of the major biotic limiting factors for wheat production in Ethiopia. Host plant resistance is the best option to manage stem rust from its economic and environmental points of view. Wheat cultivars are released for production without carrying race specific tests against ...

  19. Stem rust seedling resistance genes in Ethiopian wheat cultivars ...

    African Journals Online (AJOL)

    Stem rust caused by Puccinia graminis f. sp. tritici is one of the major biotic limiting factors for wheat production in Ethiopia. Host plant resistance is the best option to manage stem rust from its economic and environmental points of view. Wheat cultivars are released for production without carrying race specific tests against ...

  20. development of wheat germplasm for stem rust resistance in eastern ...

    African Journals Online (AJOL)

    ACSS

    especially of the virulent stem rust (Puccinia graminis) race, Ug99. The objective of this study was to identify sources of resistance to the major pathotypes of stem rust prevalent in some countries of Eastern Africa. Three hundred and six elite breeding lines, selected and advanced at the Wheat Regional Centre of Excellence ...

  1. Molecular cytogenetic characterization and stripe rust response of a trigeneric hybrid involving Triticum, Psathyrostachys, and Thinopyrum.

    Science.gov (United States)

    Kang, Houyang; Zeng, Jian; Xie, Quan; Tao, Shan; Zhong, Meiyu; Zhang, Haiqin; Fan, Xing; Sha, Lina; Xu, Lili; Zhou, Yonghong

    2012-05-01

    Trigeneric hybrids offer opportunities to transfer alien traits into cultivated wheat. In this study, a new trigeneric hybrid involving species of Triticum, Psathyrostachys, and Thinopyrum was synthesized by crossing Triticum aestivum L. (wheat)--Thinopyrum intermedium (Host) Barkworth & D.R. Dewey amphiploid Zhong 3 with wheat--Psathyrostachys huashanica Keng ex Kuo amphiploid PHW-SA. Crossability of the two amphiploids was 19.74%, and the fertility of the hybrid was 16.20%. The mean meiotic configuration of the trigeneric hybrid (2n=56) was 13.06 I+17.24 IIring+3.73 IIrod+0.28 III+0.04 IV. GISH analysis indicated that the trigeneric F1 had seven P. huashanica chromosomes and seven Th. intermedium chromosomes. The mean chromosome numbers of F2, F3, and F4 progenies were 2n=49.24, 2n=48.13, and 2n=46.78, respectively, a gradual decrease. GISH analysis revealed that most F2 and F3 plants had 2–10 Th. intermedium chromosomes and 0–4 P. huashanica chromosomes. In the F4 progenies, 1–7 Th. intermedium chromosomes were labeled, but no P. huashanica chromosomes were detected. It seems that Th. intermedium chromosomes are more likely than P. huashanica chromosomes to be transmitted to the progenies. The stripe rust response of PHW-SA was expressed in the F1 and some F2 and F3 progenies. The trigeneric hybrid could be a useful bridge for transfering P. huashanica and Th. intermedium chromosomes to common wheat.

  2. Constructing Physical and Genomic Maps for Puccinia striiformis f. sp. tritici, the Wheat Stripe Rust Pathogen, by Comparing Its EST Sequences to the Genomic Sequence of P. graminis f. sp. tritici, the Wheat Stem Rust Pathogen

    OpenAIRE

    Jinbiao Ma; Xianming Chen; Meinan Wang; Zhensheng Kang

    2009-01-01

    The wheat stripe rust fungus, Puccinia striiformis f. sp. tritici (Pst), does not have a known alternate host for sexual reproduction, which makes it impossible to study gene linkages through classic genetic and molecular mapping approaches. In this study, we compared 4,219 Pst expression sequence tags (ESTs) to the genomic sequence of P. graminis f. sp. tritici (Pgt), the wheat stem rust fungus, using BLAST searches. The percentages of homologous genes varied greatly among different Pst libr...

  3. Heritable, de novo resistance to leaf rust and other novel traits in selfed descendants of wheat responding to inoculation with wheat streak mosaic virus.

    Science.gov (United States)

    Seifers, Dallas L; Haber, Steve; Martin, Terry J; McCallum, Brent D

    2014-01-01

    Stable resistance to infection with Wheat streak mosaic virus (WSMV) can be evolved de novo in selfing bread wheat lines subjected to cycles of WSMV inoculation and selection of best-performing plants or tillers. To learn whether this phenomenon might be applied to evolve resistance de novo to pathogens unrelated to WSMV, we examined the responses to leaf rust of succeeding generations of the rust- and WSMV-susceptible cultivar 'Lakin' following WSMV inoculation and derived rust-resistant sublines. After three cycles of the iterative protocol five plants, in contrast to all others, expressed resistance to leaf and stripe rust. A subset of descendant sublines of one of these, 'R1', heritably and uniformly expressed the new trait of resistance to leaf rust. Such sublines, into which no genes from a known source of resistance had been introgressed, conferred resistance to progeny of crosses with susceptible parents. The F1 populations produced from crosses between, respectively, susceptible and resistant 'Lakin' sublines 4-3-3 and 4-12-3 were not all uniform in their response to seedling inoculation with race TDBG. In seedling tests against TDBG and MKPS races the F2s from F1 populations that were uniformly resistant had 3∶1 ratios of resistant to susceptible individuals but the F2s from susceptible F1 progenitors were uniformly susceptible. True-breeding lines derived from resistant individuals in F2 populations were resistant to natural stripe and leaf rust inoculum in the field, while the 'Lakin' progenitor was susceptible. The next generation of six of the 'Lakin'-derived lines exhibited moderate to strong de novo resistance to stem rust races TPMK, QFCS and RKQQ in seedling tests while the 'Lakin' progenitor was susceptible. These apparently epigenetic effects in response to virus infection may help researchers fashion a new tool that expands the range of genetic resources already available in adapted germplasm.

  4. Heritable, de novo resistance to leaf rust and other novel traits in selfed descendants of wheat responding to inoculation with wheat streak mosaic virus.

    Directory of Open Access Journals (Sweden)

    Dallas L Seifers

    Full Text Available Stable resistance to infection with Wheat streak mosaic virus (WSMV can be evolved de novo in selfing bread wheat lines subjected to cycles of WSMV inoculation and selection of best-performing plants or tillers. To learn whether this phenomenon might be applied to evolve resistance de novo to pathogens unrelated to WSMV, we examined the responses to leaf rust of succeeding generations of the rust- and WSMV-susceptible cultivar 'Lakin' following WSMV inoculation and derived rust-resistant sublines. After three cycles of the iterative protocol five plants, in contrast to all others, expressed resistance to leaf and stripe rust. A subset of descendant sublines of one of these, 'R1', heritably and uniformly expressed the new trait of resistance to leaf rust. Such sublines, into which no genes from a known source of resistance had been introgressed, conferred resistance to progeny of crosses with susceptible parents. The F1 populations produced from crosses between, respectively, susceptible and resistant 'Lakin' sublines 4-3-3 and 4-12-3 were not all uniform in their response to seedling inoculation with race TDBG. In seedling tests against TDBG and MKPS races the F2s from F1 populations that were uniformly resistant had 3∶1 ratios of resistant to susceptible individuals but the F2s from susceptible F1 progenitors were uniformly susceptible. True-breeding lines derived from resistant individuals in F2 populations were resistant to natural stripe and leaf rust inoculum in the field, while the 'Lakin' progenitor was susceptible. The next generation of six of the 'Lakin'-derived lines exhibited moderate to strong de novo resistance to stem rust races TPMK, QFCS and RKQQ in seedling tests while the 'Lakin' progenitor was susceptible. These apparently epigenetic effects in response to virus infection may help researchers fashion a new tool that expands the range of genetic resources already available in adapted germplasm.

  5. Nonhost resistance to rust pathogens – a continuation of continua

    Science.gov (United States)

    Bettgenhaeuser, Jan; Gilbert, Brian; Ayliffe, Michael; Moscou, Matthew J.

    2014-01-01

    The rust fungi (order: Pucciniales) are a group of widely distributed fungal plant pathogens, which can infect representatives of all vascular plant groups. Rust diseases significantly impact several crop species and considerable research focuses on understanding the basis of host specificity and nonhost resistance. Like many pathogens, rust fungi vary considerably in the number of hosts they can infect, such as wheat leaf rust (Puccinia triticina), which can only infect species in the genera Triticum and Aegilops, whereas Asian soybean rust (Phakopsora pachyrhizi) is known to infect over 95 species from over 42 genera. A greater understanding of the genetic basis determining host range has the potential to identify sources of durable resistance for agronomically important crops. Delimiting the boundary between host and nonhost has been complicated by the quantitative nature of phenotypes in the transition between these two states. Plant–pathogen interactions in this intermediate state are characterized either by (1) the majority of accessions of a species being resistant to the rust or (2) the rust only being able to partially complete key components of its life cycle. This leads to a continuum of disease phenotypes in the interaction with different plant species, observed as a range from compatibility (host) to complete immunity within a species (nonhost). In this review we will highlight how the quantitative nature of disease resistance in these intermediate interactions is caused by a continuum of defense barriers, which a pathogen needs to overcome for successfully establishing itself in the host. To illustrate continua as this underlying principle, we will discuss the advances that have been made in studying nonhost resistance towards rust pathogens, particularly cereal rust pathogens. PMID:25566270

  6. Nonhost resistance to rust pathogens - a continuation of continua.

    Science.gov (United States)

    Bettgenhaeuser, Jan; Gilbert, Brian; Ayliffe, Michael; Moscou, Matthew J

    2014-01-01

    The rust fungi (order: Pucciniales) are a group of widely distributed fungal plant pathogens, which can infect representatives of all vascular plant groups. Rust diseases significantly impact several crop species and considerable research focuses on understanding the basis of host specificity and nonhost resistance. Like many pathogens, rust fungi vary considerably in the number of hosts they can infect, such as wheat leaf rust (Puccinia triticina), which can only infect species in the genera Triticum and Aegilops, whereas Asian soybean rust (Phakopsora pachyrhizi) is known to infect over 95 species from over 42 genera. A greater understanding of the genetic basis determining host range has the potential to identify sources of durable resistance for agronomically important crops. Delimiting the boundary between host and nonhost has been complicated by the quantitative nature of phenotypes in the transition between these two states. Plant-pathogen interactions in this intermediate state are characterized either by (1) the majority of accessions of a species being resistant to the rust or (2) the rust only being able to partially complete key components of its life cycle. This leads to a continuum of disease phenotypes in the interaction with different plant species, observed as a range from compatibility (host) to complete immunity within a species (nonhost). In this review we will highlight how the quantitative nature of disease resistance in these intermediate interactions is caused by a continuum of defense barriers, which a pathogen needs to overcome for successfully establishing itself in the host. To illustrate continua as this underlying principle, we will discuss the advances that have been made in studying nonhost resistance towards rust pathogens, particularly cereal rust pathogens.

  7. Nonhost resistance to rust pathogens – a continuation of continua

    Directory of Open Access Journals (Sweden)

    Jan eBettgenhaeuser

    2014-12-01

    Full Text Available The rust fungi (order: Pucciniales are a group of widely distributed fungal plant pathogens, which can infect representatives of all vascular plant groups. Rust diseases significantly impact several crop species and considerable research focuses on understanding the basis of host specificity and nonhost resistance. Like many pathogens, rust fungi vary considerably in the number of hosts they can infect, such as wheat leaf rust (Puccinia triticina, which can only infect species in the genera Triticum and Aegilops, whereas Asian soybean rust (Phakopsora pachyrhizi is known to infect over 95 species from over 42 genera. A greater understanding of the genetic basis determining host range has the potential to identify sources of durable resistance for agronomically important crops. Delimiting the boundary between host and nonhost has been complicated by the quantitative nature of phenotypes in the transition between these two states. Plant-pathogen interactions in this intermediate state are characterized either by (1 the majority of accessions of a species being resistant to the rust or (2 the rust only being able to partially complete key components of its life cycle. This leads to a continuum of disease phenotypes in the interaction with different plant species, observed as a range from compatibility (host to complete immunity within a species (nonhost. In this review we will highlight how the quantitative nature of disease resistance in these intermediate interactions is caused by a continuum of defense barriers, which a pathogen needs to overcome for successfully establishing itself in the host. To illustrate continua as this underlying principle, we will discuss the advances that have been made in studying nonhost resistance towards rust pathogens, particularly cereal rust pathogens.

  8. Host status of false brome grass to the leaf rust fungus Puccinia brachypodii and the stripe rust fungus P. Striiformis

    NARCIS (Netherlands)

    Barbieri, M.; Marcel, T.C.; Niks, R.E.

    2011-01-01

    Purple false brome grass (Brachypodium distachyon) has recently emerged as a model system for temperate grasses and is also a potential model plant to investigate plant interactions with economically important pathogens such as rust fungi. We determined the host status of five Brachypodium species

  9. Wheat TaRab7 GTPase is part of the signaling pathway in responses to stripe rust and abiotic stimuli.

    Directory of Open Access Journals (Sweden)

    Furong Liu

    Full Text Available Small GTP-binding proteins function as regulators of specific intercellular fundamental biological processes. In this study, a small GTP-binding protein Rab7 gene, designated as TaRab7, was identified and characterized from a cDNA library of wheat leaves infected with Puccinia striiformis f. sp. tritici (Pst the wheat stripe rust pathogen. The gene was predicted to encode a protein of 206 amino acids, with a molecular mass of 23.13 KDa and an isoeletric point (pI of 5.13. Further analysis revealed the presence of a conserved signature that is characteristic of Rab7, and phylogenetic analysis demonstrated that TaRab7 has the highest similarity to a small GTP binding protein gene (BdRab7-like from Brachypodium distachyon. Quantitative real-time PCR assays revealed that the expression of TaRab7 was higher in the early stage of the incompatible interactions between wheat and Pst than in the compatible interaction, and the transcription level of TaRab7 was also highly induced by environmental stress stimuli. Furthermore, knocking down TaRab7 expression by virus induced gene silencing enhanced the susceptibility of wheat cv. Suwon 11 to an avirulent race CYR23. These results imply that TaRab7 plays an important role in the early stage of wheat-stripe rust fungus interaction and in stress tolerance.

  10. Studies on stem and leaf rust resistance in wheat

    International Nuclear Information System (INIS)

    Knott, D.R.

    1983-01-01

    Stem and leaf rust resistance was successfully transferred from Agropyron to wheat by radiation-induced translocations. Mutation induction subsequently proved to be useful in separating an undesired gene for yellow pigment from the resistance. The homoeologous pairing mutant obtained by Sears was also used successfully in obtaining transfers through crossing-over between wheat and Agropyron chromosomes. Another experimental series succeeded in accumulating minor genes for rust resistance, after eliminating major genes for specific resistance. The resistance is polygenic and widely effective although not general. It is recessively inherited, and hoped to be more durable than major gene resistance used so far in the Canadian prairies. An attempt to induce mutations for leaf rust resistance in a small-scale experiment with leading Canadian wheat varieties Manitou and Neepawa using gamma rays and EMS has not been successful. (author)

  11. Two distinct classes of QTL determine rust resistance in sorghum.

    Science.gov (United States)

    Wang, Xuemin; Mace, Emma; Hunt, Colleen; Cruickshank, Alan; Henzell, Robert; Parkes, Heidi; Jordan, David

    2014-12-31

    Agriculture is facing enormous challenges to feed a growing population in the face of rapidly evolving pests and pathogens. The rusts, in particular, are a major pathogen of cereal crops with the potential to cause large reductions in yield. Improving stable disease resistance is an on-going major and challenging focus for many plant breeding programs, due to the rapidly evolving nature of the pathogen. Sorghum is a major summer cereal crop that is also a host for a rust pathogen Puccinia purpurea, which occurs in almost all sorghum growing areas of the world, causing direct and indirect yield losses in sorghum worldwide, however knowledge about its genetic control is still limited. In order to further investigate this issue, QTL and association mapping methods were implemented to study rust resistance in three bi-parental populations and an association mapping set of elite breeding lines in different environments. In total, 64 significant or highly significant QTL and 21 suggestive rust resistance QTL were identified representing 55 unique genomic regions. Comparisons across populations within the current study and with rust QTL identified previously in both sorghum and maize revealed a high degree of correspondence in QTL location. Negative phenotypic correlations were observed between rust, maturity and height, indicating a trend for both early maturing and shorter genotypes to be more susceptible to rust. The significant amount of QTL co-location across traits, in addition to the consistency in the direction of QTL allele effects, has provided evidence to support pleiotropic QTL action across rust, height, maturity and stay-green, supporting the role of carbon stress in susceptibility to rust. Classical rust resistance QTL regions that did not co-locate with height, maturity or stay-green QTL were found to be significantly enriched for the defence-related NBS-encoding gene family, in contrast to the lack of defence-related gene enrichment in multi-trait effect

  12. A new early-warning system for stripe rust affecting wheat and triticale: Host-pathogen interactions under different environmental conditions

    DEFF Research Database (Denmark)

    Rodriguez Algaba, Julian; Justesen, Annemarie Fejer; Hovmøller, Mogens Støvring

    Stripe (yellow) rust has been the most damaging disease in Danish organic wheat and triticale production since 2009. There were estimated losses of approximately 50 million DKK (9 million USD) in 2009. Until that time, triticale was considered the most robust cereal crop for organic farming. The ...

  13. Rust scoring guide

    NARCIS (Netherlands)

    Anonymous,

    1986-01-01

    This brief guide for identifying rust diseases of smaill grain cereals contains color photos depicting the growth stages of small grain cereal crops and provides instructions for recording rust severity and field response for stripe rust (Puccinia striiformis), stem rust (P. graminis), and leaf rust

  14. Rust scoring guide

    OpenAIRE

    Anonymous

    1986-01-01

    This brief guide for identifying rust diseases of smaill grain cereals contains color photos depicting the growth stages of small grain cereal crops and provides instructions for recording rust severity and field response for stripe rust (Puccinia striiformis), stem rust (P. graminis), and leaf rust (P. recondita).

  15. Barley Stem Rust Resistance Genes: Structure and Function

    Directory of Open Access Journals (Sweden)

    Andris Kleinhofs

    2009-07-01

    Full Text Available Rusts are biotrophic pathogens that attack many plant species but are particularly destructive on cereal crops. The stem rusts (caused by have historically caused severe crop losses and continue to threaten production today. Barley ( L. breeders have controlled major stem rust epidemics since the 1940s with a single durable resistance gene . As new epidemics have threatened, additional resistance genes were identified to counter new rust races, such as the complex locus against races QCCJ and TTKSK. To understand how these genes work, we initiated research to clone and characterize them. The gene encodes a unique protein kinase with dual kinase domains, an active kinase, and a pseudokinase. Function of both domains is essential to confer resistance. The and genes are closely linked and function coordinately to confer resistance to several wheat ( L. stem rust races, including the race TTKSK (also called Ug99 that threatens the world's barley and wheat crops. The gene encodes typical resistance gene domains NBS, LRR, and protein kinase but is unique in that all three domains reside in a single gene, a previously unknown structure among plant disease resistance genes. The gene encodes an actin depolymerizing factor that functions in cytoskeleton rearrangement.

  16. Legume breeding for rust resistance: Lessons to learn from the model Medicago truncatula

    OpenAIRE

    Rubiales, Diego; Castillejo Sánchez, M. Ángeles; Madrid, Eva; Barilli, Eleonora; Rispail, Nicolas

    2011-01-01

    Rusts are major biotic constraints of legumes worldwide. Breeding for rust resistance is regarded as the most cost efficient method for rust control. However, in contrast to common bean for which complete monogenic resistance exists and is efficiently used, most of the rust resistance reactions described so far in cool season food legumes are incomplete and of complex inheritance. Incomplete resistance has been described in faba bean, pea, chickpea and lentil and several of their associated Q...

  17. Improvement of wheat in Zambia using incomplete resistance against rusts

    NARCIS (Netherlands)

    Milliano, de W.A.J.

    1983-01-01

    The programme of wheat improvement developed in Zambia used local facilities (finance, personnel, infrastructure), low budget, and few personnel. Incomplete resistance against rusts was used to obtain durable resistance.
    The abiotic conditions, socio-economic status of the farmers,

  18. Genetic studies in wheat for leaf rust resistance (Puccinia recondita)

    African Journals Online (AJOL)

    user

    2011-04-18

    Apr 18, 2011 ... Additive and dominance, as well as epistatic genetic effects, are involved in the inheritance of leaf rust resistance. However, the narrow sense heritability estimates were low, which also exhibited the presence of epistatic genetic effects. Thus, selection of resistant adult plant in later segregating generations ...

  19. Induced mutations for resistance to leaf rust in wheat

    International Nuclear Information System (INIS)

    Borojevic, K.

    1983-01-01

    Problems related to the induction of mutations for disease resistance were investigated under several aspects, using the wheat/leaf rust system. Previously selected mutant lines, tested in M 11 and M 13 , were found to differ with regard to infection type and disease severity from the original varieties. To verify the induced-mutation origin, these mutants were examined further using test crosses with carriers of known genes for leaf rust resistance and electrophoresis. A separate experiment to induce mutations for leaf rust resistance in the wheat varieties Sava, Aurora and Siete Cerros, using gamma rays, fast neutrons and EMS, yielded mutants with different disease reaction in the varieties Sava and Aurora at a frequency of about 1x10 - 3 per M 1 plant progenies. (author)

  20. Genetic Resistance to Rust of Eucalyptus urophylla Progenies

    Directory of Open Access Journals (Sweden)

    André Carignato

    2018-02-01

    Full Text Available ABSTRACT This study assessed the genetic variability in open-pollinated progenies of Eucalyptus urophylla for resistance to rust (Puccinia psidii. The progeny trial was conducted on a statistical randomized block design with 20 progenies, five plants per plot, and nine replications. Analysis of variance showed high genetic variability for the studied trait, with potential for selection gains. The genetic variability of this population provides support to conduct a breeding program with superior individuals for rust resistance, allowing low costs and minimizing the yield losses on eucalyptus plantations.

  1. Mapping of stripe rust resistance gene in an Aegilops caudata ...

    Indian Academy of Sciences (India)

    PUNEET INDER TOOR

    binding site and leucine-rich repeats (NBS-LRR) genes on wheat chromosome 5DS, NBS-LRR protein sequences were fetched from B. distachyon protein file and BLAST searched against 5DS survey sequence. Wheat contigs containing. NBS-LRR sequences were annotated to locate the posi- tions of NBS-LRR encoding ...

  2. Studies on general resistance to stem rust in wheat

    International Nuclear Information System (INIS)

    Knott, D.R.

    1977-01-01

    Eight cultivars that were thought to have field resistance to stem rust were selected and crossed to produce four four-cultivar hybrids. From those crosses lines were produced that lacked seedling resistance to race 15B-1 of stem rust but had good field resistance to it. They also proved to have field resistance to many other races and it is hoped that the resistance is general. Genetic studies indicated that there is some variation in the lines, but resistance is generally inherited as a quantitative character with several largely recessive genes having small additive effects. This suggests that in an induced mutation programme, no one plant is likely to accumulate sufficient mutant genes that it will appear resistant. (author)

  3. Identification of leaf rust resistant gene Lr10 in Pakistani wheat ...

    African Journals Online (AJOL)

    Jane

    2011-08-10

    Aug 10, 2011 ... survey was conducted to screen 25 Pakistan wheat germplasm for the presence of leaf rust resistance gene Lr10 using specific STS primer. ... conducted on the life cycles of rust pathogens and their management. Due to airborne nature .... To date, more than 45 stem rust resistance Sr (genes) (McIntosh et ...

  4. Identification of leaf rust resistant gene Lr10 in Pakistani wheat ...

    African Journals Online (AJOL)

    Leaf (brown) rust is the major disease of wheat in Pakistan and other countries. The disease is more effectively controlled when several rust resistance genes are pyramided into a single line. Molecular survey was conducted to screen 25 Pakistan wheat germplasm for the presence of leaf rust resistance gene Lr10 using ...

  5. Induced resistance and gene expression in wheat against leaf rust ...

    African Journals Online (AJOL)

    uvp

    2013-05-15

    May 15, 2013 ... pathogenesis related (PR) proteins (β-1,3-glucanase, chitinase and peroxidase). This was the case in both susceptible and resistant wheat lines whether the plants were uninfected or infected with leaf rust. (Puccinia triticina). The aim of this study was to determine the influence of the A. africanus extract on.

  6. Developing clones of Eucalyptus cloeziana resistant to rust (Puccinia psidii)

    Science.gov (United States)

    Rafael F. Alfenas; Marcelo M. Coutinho; Camila S. Freitas; Rodrigo G. Freitas; Acelino C. Alfenas

    2012-01-01

    Besides its high resistance to Chrysoporthe cubensis canker, Eucalyptus cloeziana F. Muell. is a highly valuable tree species for wood production. It can be used for furniture, electric poles, fence posts, and charcoal. Nevertheless, it is highly susceptible to the rust caused by Puccinia psidii, which...

  7. Use of gamma radiation for inducing rust resistance in soybean

    International Nuclear Information System (INIS)

    Smutkupt, Sumit; Wongpiyasatid, Arunee; Lamseejan, Siranut; Naritoom, Kruik

    1982-01-01

    Experiments on induced mutations for rust resistance in 11 soybean cultivars were started in the rainy season of 1979. M 1 seeds were grown at Farm Suwan, Pak Chong, Nakorn Rajchasima Province. Six plods from each of 4,438 control and 43,907 M 1 plants were randomly harvested. M 2 seeds of each cultivar of different doses were bulked. In addition, 270 good M 1 plants were selected and threshed singly. M 2 -bulk and M 2 -single seeds were advanced to M 3 . Both of M 3 -bulk and M 3 -single plants together with M 2 -bulk plants derived from remnant M 2 seeds were screened for rust resistance in the rainy season of 1980. The IWGSR rust rating system was used. Based on the slow growth of rust reaction on the plant (323,333) compared with the average IWGSR rust rating notation of the rates (343) in the same row, 121 plants were selected. Among them, six were selected from a total of 2802 control plants, and 115 from a total of 28,834 M 2 and M 3 plants. Seeds of each selection harvested. Only 88 lines of M 4 and M 5 were available for further rust evaluation in the rainy season of 1981. The results were as follows: At 77 days after planting, 82 selected lines were rated 333, 323 in comparison with 87 out of 137 rows of control S.J.1, S.J.2, S.J.4 and T.K.5 were rated 343. At 86 days after planting, most of the selections reached the diseased level 343. However, six lines which were derived from G8586 were still rated 333. In addition, a plant with slow growth of rust (323) from Taichung N No. 81-1-032 was selected. The six selected lines having characteristics of slow growth of rust reaction on the plants will be further tested. The high yielding selections among 82 selected lines having low percentage of shrivelled seeds will be used for further yield evaluation in the rainy season of 1982

  8. Induced mutations in beans and peas for resistance to rust

    International Nuclear Information System (INIS)

    Fadl, F.A.M.

    1983-01-01

    Gamma rays and ethyl methanesulphonate (EMS) were applied in a mutation-induction programme for rust resistance in bean and pea. Bean and pea seeds were pre-soaked 2 hours before irradiation with 9, 10 and 12 krad. For chemical mutagen treatments bean and pea seeds were pre-soaked for 8 hours and treated with 0.5 and 1.5% EMS for four hours. M 2 seeds of beans and peas were planted in 1979. Resistant M 2 plants were selected for their rust resistance and other morphological characters. M 3 seeds of selected plants were planted in 1980. In 1980 more seeds of the same varieties of beans and peas were treated with 0.1 and 0.3% EMS with the aim to produce rust-resistant mutants. Seed germination was reduced by gamma rays or EMS. Dwarf, malformed and abnormal plants were noticed. Some resistant M 2 plants selected gave high grain yields. Some were different in morphological characters. In the M 3 of selected plants various other mutant characters appeared, such as different height of plants, early and late flowering, resistance to powdery mildew in peas, altered grain yield, thickness of stem, pod shape and flower colour. (author)

  9. Introgression of a leaf rust resistance gene from Aegilops caudata to ...

    Indian Academy of Sciences (India)

    Keywords. alien introgression; molecular mapping; leaf rust; Puccinia triticina; Triticum aestivum; Aegilops caudata. Abstract. Rusts are the most important biotic constraints limiting wheat productivity worldwide. Deployment of cultivars with broad spectrum rust resistance is the only environmentally viable option to combat ...

  10. Genetic characterization of stem rust resistance in a global spring wheat germplasm collection

    Science.gov (United States)

    Stem rust is considered one of the most damaging diseases of wheat. The recent emergence of the stem rust Ug99 race group poses a serious threat to world wheat production. Utilization of genetic resistance in cultivar development is the optimal way to control stem rust. Here we report association ma...

  11. Comparisons of visual rust assessments and DNA levels of Phakopsora pachyrhizi in soybean genotypes varying in rust resistance

    Science.gov (United States)

    Soybean resistance to Phakopsora pachyrhizi, the cause of soybean rust, has been characterized by the following three infection types (i) immune response (IM; complete resistance) with no visible lesions, (ii) resistant reaction with reddish brown (RB) lesions (incomplete resistance), and (iii) susc...

  12. Heritable, De Novo Resistance to Leaf Rust and Other Novel Traits in Selfed Descendants of Wheat Responding to Inoculation with Wheat Streak Mosaic Virus

    Science.gov (United States)

    Seifers, Dallas L.; Haber, Steve; Martin, Terry J.; McCallum, Brent D.

    2014-01-01

    Stable resistance to infection with Wheat streak mosaic virus (WSMV) can be evolved de novo in selfing bread wheat lines subjected to cycles of WSMV inoculation and selection of best-performing plants or tillers. To learn whether this phenomenon might be applied to evolve resistance de novo to pathogens unrelated to WSMV, we examined the responses to leaf rust of succeeding generations of the rust- and WSMV-susceptible cultivar ‘Lakin’ following WSMV inoculation and derived rust-resistant sublines. After three cycles of the iterative protocol five plants, in contrast to all others, expressed resistance to leaf and stripe rust. A subset of descendant sublines of one of these, ‘R1’, heritably and uniformly expressed the new trait of resistance to leaf rust. Such sublines, into which no genes from a known source of resistance had been introgressed, conferred resistance to progeny of crosses with susceptible parents. The F1 populations produced from crosses between, respectively, susceptible and resistant ‘Lakin’ sublines 4-3-3 and 4-12-3 were not all uniform in their response to seedling inoculation with race TDBG. In seedling tests against TDBG and MKPS races the F2s from F1 populations that were uniformly resistant had 3∶1 ratios of resistant to susceptible individuals but the F2s from susceptible F1 progenitors were uniformly susceptible. True-breeding lines derived from resistant individuals in F2 populations were resistant to natural stripe and leaf rust inoculum in the field, while the ‘Lakin’ progenitor was susceptible. The next generation of six of the ‘Lakin’-derived lines exhibited moderate to strong de novo resistance to stem rust races TPMK, QFCS and RKQQ in seedling tests while the ‘Lakin’ progenitor was susceptible. These apparently epigenetic effects in response to virus infection may help researchers fashion a new tool that expands the range of genetic resources already available in adapted germplasm. PMID:24497941

  13. Attempts to induce mutations for resistance of wheat to mildew, stem rust and leaf rust

    International Nuclear Information System (INIS)

    Kiraly, Z.; Barabas, Z.

    1983-01-01

    Research carried out between 1971 and 1981 is summarized. Attempts to find induced mutants with full resistance to pathotype mixtures of the three pathogens were not successful. Reasons are discussed. Studies on wheat lines tolerant to stem rust infection led to the conclusion that this disease reaction may be often accompanied by a reduced number of infection sites and a longer lag period resulting in reduced spore production. Various selection methods have been evaluated. Selecting for the multigenic 'non race specific' way is promising. (author)

  14. Laboratory, greenhouse and field methods for screening rust-resistant wheat cultivars

    International Nuclear Information System (INIS)

    Mashaal, S.F.; Kiraly, Z.; Barabas, Z.; Barna, B.; Cereal Research Inst., Szeged, Hungary)

    1977-01-01

    Detached flag leaf cultures were not suitable for evaluation of stem-rust resistance in our screening programme. On the basis of yield evaluation it was possible to screen out ten stem-rust ''tolerant'' wheat lines in field experiments. Rusted and protected microplots of each line were paired within a replicate. After artificial inoculation, the protected plants were sprayed with fungicides (benomyl plus dithiocarbamate plus copper salt) at weekly intervals until maturation to keep each protected plot rust-free. The thousand-kernel weights of rusted and protected plots were compared. When the thousand-kernel weight of protected plot increased only slightly and the rust reaction type of plants was susceptible in the rusted plot, the line was screened out as putative ''tolerant''. On the basis of three-year field trial ten ''tolerant'' lines were selected. Nine out of ten lines proved to be resistant to two stem-rust races in greenhouse tests in the seedling stage, when resistance was determined on the basis of reduced spore production instead of infection types. Resistance of these seedlings related partly to the reduced number of pustules and partly to a slow rusting character of plants. It seems possible to screen resistant cultivars in the greenhouse by the method outlined in this paper, when resistance is determined on the basis of a reduced number of infection sites and/or by the slow rusting capacity. (author)

  15. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    AMIT KUMAR SINGH

    Selection G12 showed resistance at both seedling and adult plant stages. Genetic analysis in F1, F2 and F2:3 families at the seedling stage revealed that leaf rust resistance in Selection G12 is conditioned by a single incompletely dominant gene. The leaf rust resistance gene was mapped to chromosome 3BL with SSR ...

  16. Studies of the genetics of inheritance of stem rust resistance in ...

    African Journals Online (AJOL)

    Five resistant wheat lines (KSL-2, KSL-3, KSL-5, KSL-12 and KSL-19) which were resistant in tests during 2008, 2009 and 2010 were used as parents in crosses with stem rust susceptible line CACUKE to develop genetic populations for determining the inheritance of resistance to stem rust. F3 populations were evaluated ...

  17. Discovery and characterization of two new stem rust resistance genes in Aegilops sharonensis

    OpenAIRE

    Yu, Guotai; Champouret, Nicolas; Steuernagel, Burkhard; Olivera, Pablo D.; Simmons, Jamie; Williams, Cole; Johnson, Ryan; Moscou, Matthew J.; Hern?ndez-Pinz?n, Inmaculada; Green, Phon; Sela, Hanan; Millet, Eitan; Jones, Jonathan D. G.; Ward, Eric R.; Steffenson, Brian J.

    2017-01-01

    Key message We identified two novel wheat stem rust resistance genes, Sr-1644-1Sh and Sr-1644-5Sh in Aegilops sharonensis that are effective against widely virulent African races of the wheat stem rust pathogen. Abstract Stem rust is one of the most important diseases of wheat in the world. When single stem rust resistance (Sr) genes are deployed in wheat, they are often rapidly overcome by the pathogen. To this end, we initiated a search for novel sources of resistance in diverse wheat relat...

  18. Molecular mapping of stem and leaf rust resistance in wheat.

    Science.gov (United States)

    Khan, R R; Bariana, H S; Dholakia, B B; Naik, S V; Lagu, M D; Rathjen, A J; Bhavani, S; Gupta, V S

    2005-09-01

    Stem rust caused by Puccinia graminis f. sp. tritici Eriks and Henn and leaf rust caused by Puccinia triticina Rob. ex Desm. are major constraints to wheat production worldwide. In the present study, F(4)-derived SSD population, developed from a cross between Australian cultivars 'Schomburgk' and 'Yarralinka', was used to identify molecular markers linked to rust resistance genes Lr 3 a and Sr 22. A total of 1,330 RAPD and 100 ISSR primers and 33 SSR primer pairs selected ob the basis of chromosomal locations of these genes were used. The ISSR marker UBC 840(540) was found to be linked with Lr 3 a in repulsion at a distance of 6.0 cM. Markers cfa 2019 and cfa 2123 flanked Sr 22 at a distance of 5.9 cM (distal) and 6.0 cM (proximal), respectively. The use of these markers in combination would predict the presence or absence of Sr 22 in breeding populations. A previously identified PCR-based diagnostic marker STS 638 linked to Lr 20 was validated in this population. This marker showed a recombination value of 7.1 cM with Lr 20.

  19. Resistance to wheat leaf rust and stem rust in Triticum tauschii and inheritance in hexaploid wheat of resistance transferred from T. tauschii.

    Science.gov (United States)

    Innes, R L; Kerber, E R

    1994-10-01

    Twelve accessions of Triticum tauschii (Coss.) Schmal. were genetically analyzed for resistance to leaf rust (Puccinia recondita Rob. ex Desm.) and stem rust (Puccinia graminis Pers. f.sp. tritici Eriks. and E. Henn.) of common wheat (Triticum aestivum L.). Four genes conferring seedling resistance to leaf rust, one gene conferring seedling resistance to stem rust, and one gene conferring adult-plant resistance to stem rust were identified. These genes were genetically distinct from genes previously transferred to common wheat from T. tauschii and conferred resistance to a broad spectrum of pathogen races. Two of the four seedling leaf rust resistance genes were not expressed in synthetic hexaploids, produced by combining tetraploid wheat with the resistant T. tauschii accessions, probably owing to the action of one or more intergenomic suppressor loci on the A or B genome. The other two seedling leaf rust resistance genes were expressed at the hexaploid level as effectively as in the source diploids. One gene was mapped to the short arm of chromosome 2D more than 50 cM from the centromere and the other was mapped to chromosome 5D. Suppression of seedling resistance to leaf rust in synthetic hexaploids derived from three accessions of T. tauschii allowed the detection of three different genes conferring adult-plant resistance to a broad spectrum of leaf rust races. The gene for seedling resistance to stem rust was mapped to chromosome ID. The degree of expression of this gene at the hexaploid level was dependent on the genetic background in which it occurred and on environmental conditions. The expression of the adult-plant gene for resistance to stem rust was slightly diminished in hexaploids. The production of synthetic hexaploids was determined to be the most efficient and flexible method for transferring genes from T. tauschii to T. aestivum, but crossing success was determined by the genotypes of both parents. Although more laborious, the direct introgression

  20. Genomic dissection of nonhost resistance to wheat stem rust in Brachypodium distachyon

    Science.gov (United States)

    Wheat stem rust caused by the fungus Puccinia graminis f.sp. tritici (Pgt) is a devastating disease that has largely been controlled for decades by the deployment of resistance genes. However, new races of this pathogen have emerged that overcome many important wheat stem rust resistance genes used ...

  1. Identification of unique genetic sources of soybean rust resistance from the USDA germplasm collection

    Science.gov (United States)

    Soybean rust (SBR) is caused by the fungal pathogen Phakopsora pachyrhizi. Thus far, six rust resistance loci (Rpp1, 2, 3, 4, 5, and 6) have been reported. On the basis of field and greenhouse phenotyping assays between 2006 and 2011, we identified 75 SBR-resistant plant introductions (PIs). Crosses...

  2. QTL analysis of crown rust resistance in perennial ryegrass under conditions of natural and artificial infection

    DEFF Research Database (Denmark)

    Schejbel, Britt; Jensen, Louise Friis Bach; Xing, Yongzhong

    2007-01-01

    Crown rust is an economically devastating disease of perennial ryegrass. Both artificial crown rust inoculations, with the possibility of several selection cycles in one year, as well as marker-assisted selection can be used for more efficient breeding of new resistant cultivars. The objective...... of this study was to map quantitative trait loci (QTL) for response to crown rust infection in perennial ryegrass. In order to identify relevant markers for response to crown rust infection, QTL mapping was performed on a ryegrass mapping population which was evaluated for resistance in the field for two years...

  3. Genome-Wide Analysis of Simple Sequence Repeats and Efficient Development of Polymorphic SSR Markers Based on Whole Genome Re-Sequencing of Multiple Isolates of the Wheat Stripe Rust Fungus.

    Directory of Open Access Journals (Sweden)

    Huaiyong Luo

    Full Text Available The biotrophic parasitic fungus Puccinia striiformis f. sp. tritici (Pst causes stripe rust, a devastating disease of wheat, endangering global food security. Because the Pst population is highly dynamic, it is difficult to develop wheat cultivars with durable and highly effective resistance. Simple sequence repeats (SSRs are widely used as molecular markers in genetic studies to determine population structure in many organisms. However, only a small number of SSR markers have been developed for Pst. In this study, a total of 4,792 SSR loci were identified using the whole genome sequences of six isolates from different regions of the world, with a marker density of one SSR per 22.95 kb. The majority of the SSRs were di- and tri-nucleotide repeats. A database containing 1,113 SSR markers were established. Through in silico comparison, the previously reported SSR markers were found mainly in exons, whereas the SSR markers in the database were mostly in intergenic regions. Furthermore, 105 polymorphic SSR markers were confirmed in silico by their identical positions and nucleotide variations with INDELs identified among the six isolates. When 104 in silico polymorphic SSR markers were used to genotype 21 Pst isolates, 84 produced the target bands, and 82 of them were polymorphic and revealed the genetic relationships among the isolates. The results show that whole genome re-sequencing of multiple isolates provides an ideal resource for developing SSR markers, and the newly developed SSR markers are useful for genetic and population studies of the wheat stripe rust fungus.

  4. Screening and incorporation of rust resistance from Allium cepa into bunching onion (Allium fistulosum) via alien chromosome addition.

    Science.gov (United States)

    Wako, Tadayuki; Yamashita, Ken-ichiro; Tsukazaki, Hikaru; Ohara, Takayoshi; Kojima, Akio; Yaguchi, Shigenori; Shimazaki, Satoshi; Midorikawa, Naoko; Sakai, Takako; Yamauchi, Naoki; Shigyo, Masayoshi

    2015-04-01

    Bunching onion (Allium fistulosum L.; 2n = 16), bulb onion (Allium cepa L. Common onion group), and shallot (Allium cepa L. Aggregatum group) cultivars were inoculated with rust fungus, Puccinia allii, isolated from bunching onion. Bulb onions and shallots are highly resistant to rust, suggesting they would serve as useful resources for breeding rust resistant bunching onions. To identify the A. cepa chromosome(s) related to rust resistance, a complete set of eight A. fistulosum - shallot monosomic alien addition lines (MAALs) were inoculated with P. allii. At the seedling stage, FF+1A showed a high level of resistance in controlled-environment experiments, suggesting that the genes related to rust resistance could be located on shallot chromosome 1A. While MAAL, multi-chromosome addition line, and hypoallotriploid adult plants did not exhibit strong resistance to rust. In contrast to the high resistance of shallot, the addition line FF+1A+5A showed reproducibly high levels of rust resistance.

  5. Identification of expressed genes during compatible interaction between stripe rust (Puccinia striiformis and wheat using a cDNA library

    Directory of Open Access Journals (Sweden)

    Huang Lili

    2009-12-01

    Full Text Available Abstract Background Wheat stripe rust, caused by Puccinia striiformis f. sp. tritici (Pst, is one of the most destructive diseases of wheat worldwide. To establish compatibility with the host, Pst forms special infection structures to invade the plant with minimal damage to host cells. Although compatible interaction between wheat and Pst has been studied using various approaches, research on molecular mechanisms of the interaction is limited. The aim of this study was to develop an EST database of wheat infected by Pst in order to determine transcription profiles of genes involved in compatible wheat-Pst interaction. Results Total RNA, extracted from susceptible infected wheat leaves harvested at 3, 5 and 8 days post inoculation (dpi, was used to create a cDNA library, from which 5,793 ESTs with high quality were obtained and clustered into 583 contigs and 2,160 singletons to give a set of 2,743 unisequences (GenBank accessions: GR302385 to GR305127. The BLASTx program was used to search for homologous genes of the unisequences in the GenBank non-redundant protein database. Of the 2,743 unisequences, 52.8% (the largest category were highly homologous to plant genes; 16.3% to fungal genes and 30% of no-hit. The functional classification of all ESTs was established based on the database entry giving the best E-value using the Bevan's classification categories. About 50% of the ESTs were significantly homologous to genes encoding proteins with known functions; 20% were similar to genes encoding proteins with unknown functions and 30% did not have significant homology to any sequence in the database. The quantitative real-time PCR (qRT-PCR analysis determined the transcription profiles and their involvement in the wheat-Pst interaction for seven of the gene. Conclusion The cDNA library is useful for identifying the functional genes involved in the wheat-Pst compatible interaction, and established a new database for studying Pst pathogenesis genes

  6. Resistance to rusts (uromyces pisi and u. viciae-fabae) in pea

    OpenAIRE

    Barilli, Eleonora; Sillero, Josefina C.; Prats, Elena; Rubiales, Diego

    2014-01-01

    Pea is the second most important food legume crop in the world. Rust is a pea disease widely distributed, particularly in regions with warm, humid weather. Pea rust can be incited by Uromyces viciae-fabae and by U. pisi. U. viciae-fabae prevails in tropical and subtropical regions such as India and China, while U. pisi prevails in temperate regions. Chemical control of rust is possible, but the use of host plant resistance is the most desired means of rust control. In this paper we revise and...

  7. A consensus map for Ug99 stem rust resistance loci in wheat.

    Science.gov (United States)

    Yu, Long-Xi; Barbier, Hugues; Rouse, Matthew N; Singh, Sukhwinder; Singh, Ravi P; Bhavani, Sridhar; Huerta-Espino, Julio; Sorrells, Mark E

    2014-07-01

    This consensus map of stem rust genes, QTLs, and molecular markers will facilitate the identification of new resistance genes and provide a resource of in formation for development of new markers for breeding wheat varieties resistant to Ug99. The global effort to identify new sources of resistance to wheat stem rust, caused by Puccinia graminis f. sp. tritici race group Ug99 has resulted in numerous studies reporting both qualitative genes and quantitative trait loci. The purpose of our study was to assemble all available information on loci associated with stem rust resistance from 21 recent studies on Triticum aestivum L. (bread wheat) and Triticum turgidum subsp. durum desf. (durum wheat). The software LPmerge was used to construct a stem rust resistance loci consensus wheat map with 1,433 markers incorporating Single Nucleotide Polymorphism, Diversity Arrays Technology, Genotyping-by-Sequencing as well as Simple Sequence Repeat marker information. Most of the markers associated with stem rust resistance have been identified in more than one population. Several loci identified in these populations map to the same regions with known Sr genes including Sr2, SrND643, Sr25 and Sr57 (Lr34/Yr18/Pm38), while other significant markers were located in chromosome regions where no Sr genes have been previously reported. This consensus map provides a comprehensive source of information on 141 stem rust resistance loci conferring resistance to stem rust Ug99 as well as linked markers for use in marker-assisted selection.

  8. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    AMIT KUMAR SINGH

    friendly method. Wild relatives of wheat are reservoir of useful genes, including genes for rust resis- tance. To date, 74 leaf rust resistance genes have been des- ignated and about half of them have originated from various closely or distantly related ...

  9. Genetics of leaf rust resistance in the hard red winter wheat cultivars Santa Fe and Duster

    Science.gov (United States)

    Leaf rust caused by Puccinia triticina is a common and important disease of hard red winter wheat in the Great Plains of the United States. The hard red winter wheat cultivars 'Santa Fe' and 'Duster' have had effective leaf rust resistance since their release in 2003 and 2006, respectively. Both cul...

  10. Genome-Wide Association Mapping of Crown Rust Resistance in Oat Elite Germplasm.

    Science.gov (United States)

    Klos, Kathy Esvelt; Yimer, Belayneh A; Babiker, Ebrahiem M; Beattie, Aaron D; Bonman, J Michael; Carson, Martin L; Chong, James; Harrison, Stephen A; Ibrahim, Amir M H; Kolb, Frederic L; McCartney, Curt A; McMullen, Michael; Fetch, Jennifer Mitchell; Mohammadi, Mohsen; Murphy, J Paul; Tinker, Nicholas A

    2017-07-01

    Oat crown rust, caused by f. sp. , is a major constraint to oat ( L.) production in many parts of the world. In this first comprehensive multienvironment genome-wide association map of oat crown rust, we used 2972 single-nucleotide polymorphisms (SNPs) genotyped on 631 oat lines for association mapping of quantitative trait loci (QTL). Seedling reaction to crown rust in these lines was assessed as infection type (IT) with each of 10 crown rust isolates. Adult plant reaction was assessed in the field in a total of 10 location-years as percentage severity (SV) and as infection reaction (IR) in a 0-to-1 scale. Overall, 29 SNPs on 12 linkage groups were predictive of crown rust reaction in at least one experiment at a genome-wide level of statistical significance. The QTL identified here include those in regions previously shown to be linked with seedling resistance genes , , , , , and and also with adult-plant resistance and adaptation-related QTL. In addition, QTL on linkage groups Mrg03, Mrg08, and Mrg23 were identified in regions not previously associated with crown rust resistance. Evaluation of marker genotypes in a set of crown rust differential lines supported as the identity of . The SNPs with rare alleles associated with lower disease scores may be suitable for use in marker-assisted selection of oat lines for crown rust resistance. Copyright © 2017 Crop Science Society of America.

  11. White pine blister rust resistance in limber pine: Evidence for a major gene

    Science.gov (United States)

    A. W. Schoettle; R. A. Sniezko; A. Kegley; K. S. Burns

    2014-01-01

    Limber pine (Pinus flexilis) is being threatened by the lethal disease white pine blister rust caused by the non-native pathogen Cronartium ribicola. The types and frequencies of genetic resistance to the rust will likely determine the potential success of restoration or proactive measures. These first extensive inoculation trials using individual tree seed collections...

  12. Development of wheat germplasm for stem rust resistance in eastern ...

    African Journals Online (AJOL)

    Wheat (Triticum aestivum) rust outbreak is the primary production constraint in Eastern Africa. Ethiopia, Kenya and Uganda are hot spots for the epidemic of rusts, due to higher rates of evolution of new pathogen races, especially of the virulent stem rust (Puccinia graminis) race, Ug99. The objective of this study was to ...

  13. Nuclear proteomic changes linked to soybean rust resistance.

    Science.gov (United States)

    Cooper, Bret; Campbell, Kimberly B; Feng, Jian; Garrett, Wesley M; Frederick, Reid

    2011-03-01

    Soybean rust, caused by the fungus Phakopsora pachyrhizi, is an emerging threat to the US soybean crop. In an effort to identify proteins that contribute to disease resistance in soybean we compared a susceptible Williams 82 cultivar to a resistant Williams 82 inbred isoline harboring the Rpp1 resistance gene (R-gene). Approximately 4975 proteins from nuclear preparations of leaves were detected using a high-throughput liquid chromatography-mass spectrometry method. Many of these proteins have predicted nuclear localization signals, have homology to transcription factors and other nuclear regulatory proteins, and are phosphorylated. Statistics of summed spectral counts revealed sets of proteins with differential accumulation changes between susceptible and resistant plants. These protein accumulation changes were compared to previously reported gene expression changes and very little overlap was found. Thus, it appears that numerous proteins are post-translationally affected in the nucleus after infection. To our knowledge, this is the first indication of large-scale proteomic change in a plant nucleus after infection. Furthermore, the data reveal distinct proteins under control of Rpp1 and show that this disease resistance gene regulates nuclear protein accumulation. These regulated proteins likely influence broader defense responses, and these data may facilitate the development of plants with improved resistance.

  14. 16 CFR 23.10 - Misuse of “corrosion proof,” “noncorrosive,” “corrosion resistant,” “rust proof,” “rust resistant...

    Science.gov (United States)

    2010-01-01

    ... INDUSTRIES § 23.10 Misuse of “corrosion proof,” “noncorrosive,” “corrosion resistant,” “rust proof,” “rust...,” “rust proof,” or any other term of similar meaning to describe an industry product unless all parts of the product will be immune from rust and other forms of corrosion during the life expectancy of the...

  15. QTL mapping of slow-rusting, adult plant resistance to race Ug99 of stem rust fungus in PBW343/Muu RIL population.

    Science.gov (United States)

    Singh, Sukhwinder; Singh, Ravi P; Bhavani, Sridhar; Huerta-Espino, Julio; Eugenio, Lopez-Vera Eric

    2013-05-01

    Races of stem rust fungus pose a major threat to wheat production worldwide. We mapped adult plant resistance (APR) to Ug99 in 141 lines of a PBW343/Muu recombinant inbred lines (RILs) population by phenotyping them for three seasons at Njoro, Kenya in field trials and genotyping them with Diversity Arrays Technology (DArT) markers. Moderately susceptible parent PBW343 and APR parent Muu displayed mean stem rust severities of 66.6 and 5 %, respectively. The mean disease severity of RILs ranged from 1 to 100 %, with an average of 23.3 %. Variance components for stem rust severity were highly significant (p stem rust where Sr2 and other minor slow rusting resistance genes can confer a higher level of resistance when present together.

  16. Polymerase Chain Reaction (PCR) applications in white pine blister rust resistance screening

    Science.gov (United States)

    Sam Hendricks; Wendy Sutton; Jeffrey Stone; Richard Sniezko; Angelia Kegley; Anna Schoettle

    2011-01-01

    A goal of breeding programs for resistance to white pine blister rust is the development of multigenic resistance, even if the genetics and mechanisms of resistance may be imperfectly understood. The goal of multigenic resistance has prompted efforts to categorize host resistance reactions at increasingly finer scales, to identify heritable traits that may confer...

  17. A perspective of leaf rust race fhprn and its impact on leaf rust resistance in pakistani wheat varieties

    International Nuclear Information System (INIS)

    Sohail, Y.

    2015-01-01

    Leaf rust infected leaves of a widely growing variety Seher-06 were collected in wheat season of 2011-12. The leaf rust isolates were assessed on Thatcher derived Lr isogenic lines and a race FHPRN was identified. Seventy six wheat varieties/lines besides Lr isogenic lines were screened against this race for seedling in glass house and for adult plant resistance at Bahawalpur and Faisalabad during 2012-13. Lr1, Lr2a, Lr9, Lr19, Lr24, Lr10+27+31 (Gatcher) and Lr28 were found completely resistant at both stages against FHPRN. Molecular screening of the wheat varieties/lines indicated the presence of leaf rust resistance genes Lr9 (0%), Lr13 (43%), Lr19 (1%), Lr20 (0%), Lr24 (4%), Lr26 (23%), Lr28 (0%), Lr34 (38%), Lr37 (1%) and Lr47 (1%) in them. Field data suggested that As-02 (Lr10+26+34), Bhakar-02 (Lr13) and Shafaq-06 (Lr10+13+27) were resistant; Pasban-90 (Lr10+13+26+27), Chenab-2000 (Lr10+13+26+27+31+34), Fbd-08 (Lr10), Millat-11 (unknown) and Punjab-11 (unknown) were found moderately resistant; Blue silver (Lr13+14a), Pak-81 (Lr10+23+26+31), Bahawalpur-97 (Lr13+26) and Lasani-08 (Lr13+27+31) were susceptible while Sh-88 (unknown), Auqab-2000 (Lr10+23+26+27+31), Iqbal-2000 (Lr3+10+13+26+27+31), Bahawalpur-2000 (Lr34) and Seher-06 (Lr10+27+31) were found highly susceptible against FHPRN. Present and previous studies revealed the presence of Lr3, 10, 13, 14a, 23, 26, 27, 31 and 34 in the Pakistani wheat varieties yet lacking Lr9, 19, 24 and 28. Therefore, the latter genes and their effective combinations should be incorporated in Pakistani varieties to combat leaf rust effectively. (author)

  18. Induced mutations for horizontal resistance. A model study using leaf rust resistance in wheat

    International Nuclear Information System (INIS)

    Chopra, V.L.; Sawhney, R.N.; Kumar, R.

    1983-01-01

    A mutant with seemingly non-specific resistance to leaf rust was obtained some time ago from the wheat variety Kharchia Local treated with NMH. This mutant is being studied genetically and in its disease reaction by laboratories in Australia, Canada and India in co-operation. The mutant showed a dominant inheritance of resistance in F 1 , but different segregation in F 2 and F 3 . This peculiar genetic behaviour has so far not been explained. (author)

  19. Stem Rust Resistance in a Geographically Diverse Collection of Spring Wheat Lines Collected from Across Africa

    OpenAIRE

    Prins, Ren?e; Dreisigacker, Susanne; Pretorius, Zakkie; van Schalkwyk, Hester; Wessels, Elsabet; Smit, Corneli; Bender, Cornel; Singh, Davinder; Boyd, Lesley A.

    2016-01-01

    Following the emergence of the Ug99 lineage of Puccinia graminis f. sp. tritici (Pgt) a collective international effort has been undertaken to identify new sources of wheat stem rust resistance effective against these races. Analyses were undertaken in a collection of wheat genotypes gathered from across Africa to identify stem rust resistance effective against the Pgt races found in Eastern and Southern Africa. The African wheat collection consisted of historic genotypes collected in Kenya, ...

  20. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    Genetic analysis in F1, F2 and F2.3 families at the seedling stage revealed that leaf rust resistance in Selection G12 is conditioned by a single incompletely dominant gene. The leaf rust resistance gene was mapped to chromosome 3BL with SSR markers Xgwm114 and Xgwm547 flanking the gene at a distance of 28.3 cM ...

  1. Screening of Soybean Germplasm Collection Resistance to Rust Disease (Phakopsora Pachyrhizi)

    OpenAIRE

    -, Sumartini

    2014-01-01

    Rust disease is an important disease on soybean, it was widely distributed in almost all soybeanproducing countries, the yield losses can be reach 85 %. One of the control measured is planting theresistant varieties. Resistant gens of one character can be obtained from the germplasm collection. Thestudy aiar to evaluate the resistance of soybean germplasm collection against rust diseases. The study wasconducted at Kendalpayak experimental station, Indonesian Legumes and Tuber Crops ResearchIn...

  2. Molecular tagging of a novel rust resistance gene R(12) in sunflower (Helianthus annuus L.).

    Science.gov (United States)

    Gong, L; Hulke, B S; Gulya, T J; Markell, S G; Qi, L L

    2013-01-01

    Sunflower production in North America has recently suffered economic losses in yield and seed quality from sunflower rust (Puccinia helianthi Schwein.) because of the increasing incidence and lack of resistance to new rust races. RHA 464, a newly released sunflower male fertility restorer line, is resistant to both of the most predominant and most virulent rust races identified in the Northern Great Plains of the USA. The gene conditioning rust resistance in RHA 464 originated from wild Helianthus annuus L., but has not been molecularly marked or determined to be independent from other rust loci. The objectives of this study are to identify molecular markers linked to the rust resistance gene and to investigate the allelism of this gene with the unmapped rust resistance genes present in HA-R6, HA-R8 and RHA 397. Virulence phenotypes of seedlings for the F(2) population and F(2:3) families suggested that a single dominant gene confers rust resistance in RHA 464, and this gene was designated as R(12). Bulked segregant analysis identified ten markers polymorphic between resistant and susceptible bulks. In subsequent genetic mapping, the ten markers covered 33.4 cM of genetic distance on linkage group 11 of sunflower. A co-dominant marker CRT275-11 is the closest marker distal to R(12) with a genetic distance of 1.0 cM, while ZVG53, a dominant marker linked in the repulsion phase, is proximal to R(12) with a genetic distance of 9.6 cM. The allelism test demonstrated that R(12) is not allelic to the rust resistance genes in HA-R6, HA-R8 and RHA 397, and it is also not linked to any previously mapped rust resistance genes. Discovery of the R(12) novel rust resistance locus in sunflower and associated markers will potentially support the molecular marker-assisted introgression and pyramiding of R(12) into sunflower breeding lines.

  3. Constructing Physical and Genomic Maps for Puccinia striiformis f. sp. tritici, the Wheat Stripe Rust Pathogen, by Comparing Its EST Sequences to the Genomic Sequence of P. graminis f. sp. tritici, the Wheat Stem Rust Pathogen.

    Science.gov (United States)

    Ma, Jinbiao; Chen, Xianming; Wang, Meinan; Kang, Zhensheng

    2009-01-01

    The wheat stripe rust fungus, Puccinia striiformis f. sp. tritici (Pst), does not have a known alternate host for sexual reproduction, which makes it impossible to study gene linkages through classic genetic and molecular mapping approaches. In this study, we compared 4,219 Pst expression sequence tags (ESTs) to the genomic sequence of P. graminis f. sp. tritici (Pgt), the wheat stem rust fungus, using BLAST searches. The percentages of homologous genes varied greatly among different Pst libraries with 54.51%, 51.21%, and 13.61% for the urediniospore, germinated urediniospore, and haustorial libraries, respectively, with an average of 33.92%. The 1,432 Pst genes with significant homology with Pgt sequences were grouped into physical groups corresponding to 237 Pgt supercontigs. The physical relationship was demonstrated by 12 pairs (57%), out of 21 selected Pst gene pairs, through PCR screening of a Pst BAC library. The results indicate that the Pgt genome sequence is useful in constructing Pst physical maps.

  4. Constructing Physical and Genomic Maps for Puccinia striiformis f. sp. tritici, the Wheat Stripe Rust Pathogen, by Comparing Its EST Sequences to the Genomic Sequence of P. graminis f. sp. tritici, the Wheat Stem Rust Pathogen

    Directory of Open Access Journals (Sweden)

    Jinbiao Ma

    2009-01-01

    Full Text Available The wheat stripe rust fungus, Puccinia striiformis f. sp. tritici (Pst, does not have a known alternate host for sexual reproduction, which makes it impossible to study gene linkages through classic genetic and molecular mapping approaches. In this study, we compared 4,219 Pst expression sequence tags (ESTs to the genomic sequence of P. graminis f. sp. tritici (Pgt, the wheat stem rust fungus, using BLAST searches. The percentages of homologous genes varied greatly among different Pst libraries with 54.51%, 51.21%, and 13.61% for the urediniospore, germinated urediniospore, and haustorial libraries, respectively, with an average of 33.92%. The 1,432 Pst genes with significant homology with Pgt sequences were grouped into physical groups corresponding to 237 Pgt supercontigs. The physical relationship was demonstrated by 12 pairs (57%, out of 21 selected Pst gene pairs, through PCR screening of a Pst BAC library. The results indicate that the Pgt genome sequence is useful in constructing Pst physical maps.

  5. Prehaustorial and posthaustorial resistance to wheat leaf rust in diploid wheat

    NARCIS (Netherlands)

    Anker, C.C.

    2001-01-01

    In modern wheat cultivars, resistance to wheat leaf rust, Puccinia triticina , is either based on hypersensitivity resistance or on partial resistance. Hypersensitivity resistance in wheat is monogenic, often complete and posthaustorial: it is induced after the

  6. Molecular mapping of a sunflower rust resistance gene from HAR6.

    Science.gov (United States)

    Bulos, Mariano; Ramos, María L; Altieri, Emiliano; Sala, Carlos A

    2013-03-01

    Sunflower rust, caused by Puccinia helianthi Schw., can result in significant yield losses in cultivated sunflower (Helianthus annuus L. var. macrocarpus Ckll.). HAR6 is a germplasm population resistant to most predominant rust races. The objectives of this study were to map the resistance factor present in HAR6 (R HAR6 ), and to provide and validate molecular tools for the identification of this gene for marker assisted selection purposes. Virulence reaction of seedlings for the F2 population and F2:3 families suggested that a single dominant gene confers rust resistance in HAR6-1, a selected rust resistance line from the original population. Genetic mapping with eight markers covered 97.4 cM of genetic distance on linkage group 13 of the sunflower consensus map. A co-dominant marker ZVG61 is the closest marker distal to R HAR6 at a genetic distance of 0.7 cM, while ORS581, a dominant marker linked in the coupling phase, is proximal to R HAR6 at a genetic distance of 1.5 cM. Validation of these markers was assessed by converting a susceptible line into a rust resistant isoline by means of marker assisted backcrossing. The application of these results to assist the breeding process and to design new strategies for rust control in sunflower is discussed.

  7. short communication sources of stem rust resistance in ethiopian ...

    African Journals Online (AJOL)

    Administrator

    Stem or black rust of wheat caused by the fungus Puccinia graminis f. sp. tritici Ericks and Henn (Pgt) is an important disease on wheat ... for their response to stem rust (Puccinia graminis f. sp. trictici) infection under greenhouse condition at Kulumsa. Agricultural .... are the phenotypic expression of host-pathogen interaction.

  8. Molecular mapping and improvement of leaf rust resistance in wheat breeding lines.

    Science.gov (United States)

    Tsilo, Toi J; Kolmer, James A; Anderson, James A

    2014-08-01

    Leaf rust, caused by Puccinia triticina, is the most common and widespread disease of wheat (Triticum aestivum) worldwide. Deployment of host-plant resistance is one of the strategies to reduce losses due to leaf rust disease. The objective of this study was to map genes for adult-plant resistance to leaf rust in a recombinant inbred line (RIL) population originating from MN98550-5/MN99394-1. The mapping population of 139 RILs and five checks were evaluated in 2005, 2009, and 2010 in five environments. Natural infection occurred in the 2005 trials and trials in 2009 and 2010 were inoculated with leaf rust. Four quantitative trait loci (QTL) on chromosomes 2BS, 2DS, 7AL, and 7DS were detected. The QTL on 2BS explained up to 33.6% of the phenotypic variation in leaf rust response, whereas the QTL on 2DS, 7AL, and 7DS explained up to 15.7, 8.1, and 34.2%, respectively. Seedling infection type tests conducted with P. triticina races BBBD and SBDG confirmed that the QTL on 2BS and 2DS were Lr16 and Lr2a, respectively, and these genes were expressed in the seedling and field plot tests. The Lr2a gene mapped at the same location as Sr6. The QTL on 7DS was Lr34. The QTL on 7AL is a new QTL for leaf rust resistance. The joint effects of all four QTL explained 74% of the total phenotypic variation in leaf rust severity. Analysis of different combinations of QTL showed that the RILs containing all four or three of the QTL had the lowest average leaf rust severity in all five environments. Deployment of these QTL in combination or with other effective genes will lead to successful control of leaf rust.

  9. Defeating the Warrior: genetic architecture of triticale resistance against a novel aggressive yellow rust race.

    Science.gov (United States)

    Losert, Dominik; Maurer, Hans Peter; Leiser, Willmar L; Würschum, Tobias

    2017-04-01

    Genome-wide association mapping of resistance against the novel, aggressive 'Warrior' race of yellow rust in triticale revealed a genetic architecture with some medium-effect QTL and a quantitative component, which in combination confer high levels of resistance on both leaves and ears. Yellow rust is an important destructive fungal disease in small grain cereals and the exotic 'Warrior' race has recently conquered Europe. The aim of this study was to investigate the genetic architecture of yellow rust resistance in hexaploid winter triticale as the basis for a successful resistance breeding. To this end, a diverse panel of 919 genotypes was evaluated for yellow rust infection on leaves and ears in multi-location field trials and genotyped by genotyping-by-sequencing as well as for known Yr resistance loci. Genome-wide association mapping identified ten quantitative trait loci (QTL) for yellow rust resistance on the leaves and seven of these also for ear resistance. The total genotypic variance explained by the QTL amounted to 44.0% for leaf and 26.0% for ear resistance. The same three medium-effect QTL were identified for both traits on chromosomes 1B, 2B, and 7B. Interestingly, plants pyramiding the resistance allele of all three medium-effect QTL were generally most resistant, but constitute less than 5% of the investigated triticale breeding material. Nevertheless, a genome-wide prediction yielded a higher predictive ability than prediction based on these three QTL. Taken together, our results show that yellow rust resistance in winter triticale is genetically complex, including both medium-effect QTL as well as a quantitative resistance component. Resistance to the novel 'Warrior' race of this fungal pathogen is consequently best achieved by recurrent selection in the field based on identified resistant lines and can potentially be assisted by genomic approaches.

  10. Lr67/Yr46 confers adult plant resistance to stem rust and powdery mildew in wheat.

    Science.gov (United States)

    Herrera-Foessel, Sybil A; Singh, Ravi P; Lillemo, Morten; Huerta-Espino, Julio; Bhavani, Sridhar; Singh, Sukhwinder; Lan, Caixia; Calvo-Salazar, Violeta; Lagudah, Evans S

    2014-04-01

    We demonstrate that Lr67/Yr46 has pleiotropic effect on stem rust and powdery mildew resistance and is associated with leaf tip necrosis. Genes are designated as Sr55, Pm46 and Ltn3 , respectively. Wheat (Triticum aestivum) accession RL6077, known to carry the pleiotropic slow rusting leaf and yellow rust resistance genes Lr67/Yr46 in Thatcher background, displayed significantly lower stem rust (P. graminis tritici; Pgt) and powdery mildew (Blumeria graminis tritici; Bgt) severities in Kenya and in Norway, respectively, compared to its recurrent parent Thatcher. We investigated the resistance of RL6077 to stem rust and powdery mildew using Avocet × RL6077 F6 recombinant inbred lines (RILs) derived from two photoperiod-insensitive F3 families segregating for Lr67/Yr46. Greenhouse seedling tests were conducted with Mexican Pgt race RTR. Field evaluations were conducted under artificially initiated stem rust epidemics with Pgt races RTR and TTKST (Ug99 + Sr24) at Ciudad Obregon (Mexico) and Njoro (Kenya) during 2010-2011; and under natural powdery mildew epiphytotic in Norway at Ås and Hamar during 2011 and 2012. In Mexico, a mean reduction of 41 % on stem rust severity was obtained for RILs carrying Lr67/Yr46, compared to RILs that lacked the gene, whereas in Kenya the difference was smaller (16 %) but significant. In Norway, leaf tip necrosis was associated with Lr67/Yr46 and RILs carrying Lr67/Yr46 showed a 20 % reduction in mean powdery mildew severity at both sites across the 2 years of evaluation. Our study demonstrates that Lr67/Yr46 confers partial resistance to stem rust and powdery mildew and is associated with leaf tip necrosis. The corresponding pleiotropic, or tightly linked, genes, designated as Sr55, Pm46, and Ltn3, can be utilized to provide broad-spectrum durable disease resistance in wheat.

  11. Genetic analysis of seedling resistance to crown rust in five diploid oat (Avena strigosa) accessions.

    Science.gov (United States)

    Cabral, A L; Park, R F

    2016-02-01

    Crown rust, caused by Puccinia coronata Corda f. sp. avenae Eriks., is a serious menace in oats, for which resistance is an effective means of control. Wild diploid oat accessions are a source of novel resistances that first need to be characterised prior to introgression into locally adapted oat cultivars. A genetic analysis of resistance to crown rust was carried out in three diverse diploid oat accessions (CIav6956, CIav9020, PI292226) and two cultivars (Saia and Glabrota) of A. strigosa. A single major gene conditioning resistance to Australian crown rust pathotype (Pt) 0000-2 was identified in each of the three accessions. Allelism tests suggested that these genes are either the same, allelic, or tightly linked with less than 1 % recombination. Similarly, a single gene was identified in Glabrota, and possibly two genes in Saia; both cultivars previously reported to carry two and three crown rust resistance genes, respectively. The identified seedling resistance genes could be deployed in combination with other resistance gene(s) to enhance durability of resistance to crown rust in hexaploid oat. Current diploid and hexaploid linkage maps and molecular anchor markers (simple sequence repeat [SSR] and diversity array technology [DArT] markers) should facilitate their mapping and introgression into hexaploid oat.

  12. Rust resistance evaluation of advanced wheat (triticum aestivum l.) genotypes using pcr-based dna markers

    International Nuclear Information System (INIS)

    Rahman, S.U.; Younis, M.; Iqbal, M.Z.; Nawaz, M.

    2014-01-01

    The most effective and environmental friendly approach for the control of wheat rust disease is the use of resistant genotypes. The present study was conducted to explore rust resistance potential of 85 elite wheat genotypes (36 varieties and 49 advanced lines) using various types of DNA markers like STS, SCAR and SSR. DNA markers linked with different genes conferring resistance to rusts (Leaf rust=Lr, Yellow rust=Yr and Stem rust=Sr) were employed in this study. A total of 18 genes, consisting of eleven Lr (lr1, lr10, lr19, lr21, lr28, lr34, lr39, lr46, lr47, lr51 and lr52), four Yr (yr5, yr18, yr26 and yr29) and three Sr genes (sr2, sr29, and sr36) were studied through linked DNA markers. Maximum number of Lr genes was found in 17 advanced lines and 9 varieties, Yr genes in 26 advanced lines and 20 wheat varieties, and Sr genes in 43 advanced lines and 27 varieties. Minimum number of Lr genes was found in advanced line D-97 and variety Kohinoor-83, Yr genes in wheat variety Bwp-97 and Sr genes in 6 advanced lines and 8 varieties. Molecular data revealed that genotypes having same origin, from a specified area showed resistance for similar type of genes. In this study, an average similarity of 84% was recorded among wheat genotypes. Out of 18 loci, 15 were found to be polymorphic. (author)

  13. Creation of variation in Basella for rust resistance through mutagenesis

    International Nuclear Information System (INIS)

    Makambila, C.

    1997-01-01

    African spinach, basella is grown as a leafy vegetable in Central Africa. Basella cultivars belong to the species Basella alba and B. rubra which are seed propagated and are likely Asiatic in origin. Basella alba seeds were irradiated with doses of 50, 100, 200, 300 and 500 Gy to create variation for rust resistance which is caused by the fungus, Uromyces basellae Sidow. The effects of irradiation were investigated on seed germination, plant mortality and height. Seed germination varied from 97% for those irradiated with 50 Gy to 39% with 500 Gy, and LD 50 for seed germination was between 300 to 400 Gy. Doses between 50 and 150 Gy did not cause any mortality of plants obtained from irradiated seeds; however, doses between 200 to 500 Gy caused high mortality among such plants. Irradiation with 150 Gy inhibited plant growth by 48% in relation to the growth of control plants. Based on the results, radiation doses above 150 and up to 400 Gy were used for the production of desired variation. (author). 11 refs, 9 figs

  14. Genome-Wide Association Mapping of Stem Rust Resistance in Hordeum vulgare subsp. spontaneum

    Directory of Open Access Journals (Sweden)

    Ahmad H. Sallam

    2017-10-01

    Full Text Available Stem rust was one of the most devastating diseases of barley in North America. Through the deployment of cultivars with the resistance gene Rpg1, losses to stem rust have been minimal over the past 70 yr. However, there exist both domestic (QCCJB and foreign (TTKSK aka isolate Ug99 pathotypes with virulence for this important gene. To identify new sources of stem rust resistance for barley, we evaluated the Wild Barley Diversity Collection (WBDC (314 ecogeographically diverse accessions of Hordeum vulgare subsp. spontaneum for seedling resistance to four pathotypes (TTKSK, QCCJB, MCCFC, and HKHJC of the wheat stem rust pathogen (Puccinia graminis f. sp. tritici, Pgt and one isolate (92-MN-90 of the rye stem rust pathogen (P. graminis f. sp. secalis, Pgs. Based on a coefficient of infection, the frequency of resistance in the WBDC was low ranging from 0.6% with HKHJC to 19.4% with 92-MN-90. None of the accessions was resistant to all five cultures of P. graminis. A genome-wide association study (GWAS was conducted to map stem rust resistance loci using 50,842 single-nucleotide polymorphic markers generated by genotype-by-sequencing and ordered using the new barley reference genome assembly. After proper accounting for genetic relatedness and structure among accessions, 45 quantitative trait loci were identified for resistance to P. graminis across all seven barley chromosomes. Three novel loci associated with resistance to TTKSK, QCCJB, MCCFC, and 92-MN-90 were identified on chromosomes 5H and 7H, and two novel loci associated with resistance to HKHJC were identified on chromosomes 1H and 3H. These novel alleles will enhance the diversity of resistance available for cultivated barley.

  15. Genome-Wide Association Mapping of Stem Rust Resistance in Hordeum vulgare subsp. spontaneum.

    Science.gov (United States)

    Sallam, Ahmad H; Tyagi, Priyanka; Brown-Guedira, Gina; Muehlbauer, Gary J; Hulse, Alex; Steffenson, Brian J

    2017-10-05

    Stem rust was one of the most devastating diseases of barley in North America. Through the deployment of cultivars with the resistance gene Rpg1 , losses to stem rust have been minimal over the past 70 yr. However, there exist both domestic (QCCJB) and foreign (TTKSK aka isolate Ug99) pathotypes with virulence for this important gene. To identify new sources of stem rust resistance for barley, we evaluated the Wild Barley Diversity Collection (WBDC) (314 ecogeographically diverse accessions of Hordeum vulgare subsp. spontaneum ) for seedling resistance to four pathotypes (TTKSK, QCCJB, MCCFC, and HKHJC) of the wheat stem rust pathogen ( Puccinia graminis f. sp. tritici , Pgt ) and one isolate (92-MN-90) of the rye stem rust pathogen ( P. graminis f. sp. secalis , Pgs ). Based on a coefficient of infection, the frequency of resistance in the WBDC was low ranging from 0.6% with HKHJC to 19.4% with 92-MN-90. None of the accessions was resistant to all five cultures of P. graminis A genome-wide association study (GWAS) was conducted to map stem rust resistance loci using 50,842 single-nucleotide polymorphic markers generated by genotype-by-sequencing and ordered using the new barley reference genome assembly. After proper accounting for genetic relatedness and structure among accessions, 45 quantitative trait loci were identified for resistance to P. graminis across all seven barley chromosomes. Three novel loci associated with resistance to TTKSK, QCCJB, MCCFC, and 92-MN-90 were identified on chromosomes 5H and 7H, and two novel loci associated with resistance to HKHJC were identified on chromosomes 1H and 3H. These novel alleles will enhance the diversity of resistance available for cultivated barley. Copyright © 2017 Sallam et al.

  16. Rust resistance in Arabic Coffee cultivars in northern Paraná

    Directory of Open Access Journals (Sweden)

    Leandro Del Grossi

    2013-02-01

    Full Text Available The objective of the study was to evaluate the resistance to rust in coffee cultivars developed by research institutes of Brazil in Paraná state. Resistance to the local leaf rust races was assessed in high disease intensity field conditions at Londrina and Congonhinhas in 2009 and 2010.The cultivars were developed by the EPAMIG/UFV, IAPAR, IAC and MAPA/Procafé. The resistant standard 'IAPAR 59' and the susceptible standards Catuaí Vermelho IAC 144' and 'Bourbon Amarelo' were used. A randomized block design with three replications and plots with 10 plants was used. A scale from 1 to 5 based on the rust intensity was used to evaluate the resistance. The Catiguá MG 1, Catiguá MG 2, IAPAR 59, IPR 98, IPR 104, Palma II, Paraíso H-419-10-6-2-5-1, Paraíso H-419-10-6-2-10-1, Paraíso H-419-10-6-2-12-1, Pau Brasil MG 1 and Sacramento MG 1 cultivars presented complete resistance to rust at Londrina and Congonhinhas. The cultivars derived from the Catucaí germplasm were susceptible or showed different levels of partial resistance. Partial resistance to the rust was observed in several coffees derived from "Hibrido de Timor". 'Acauã' and 'Obatã IAC 1669-20' presented complete resistance at Londrina, but at Congonhinhas, they were partially resistant, indicating that different rust races have occurred at these two locations.

  17. Genetics and mapping of stem rust resistance to Ug99 in the wheat cultivar Webster.

    Science.gov (United States)

    Hiebert, Colin W; Fetch, Thomas G; Zegeye, Taye

    2010-06-01

    New races of wheat stem rust, namely TTKSK (Ug99) and its variants, pose a threat to wheat production in the regions where they are found. The accession of the wheat cultivar Webster (RL6201) maintained at the Cereal Research Centre in Winnipeg, Canada, shows resistance to TTKSK and other races of stem rust. The purpose of this study was to study the inheritance of seedling resistance to stem rust in RL6201 and genetically map the resistance genes using microsatellite (SSR) markers. A population was produced by crossing the stem rust susceptible line RL6071 with Webster. The F(2) and F(3) were tested with TPMK, a stem rust race native to North America. The F(3) was also tested with TTKSK. Two independently assorting genes were identified in RL6201. Resistance to TPMK was conferred by Sr30, which was mapped with microsatellites on chromosome 5DL. The second gene, temporarily designated SrWeb, conferred resistance to TTKSK. SrWeb was mapped to chromosome 2BL using SSR markers. Comparison with previous genetic maps showed that SrWeb occupies a locus near Sr9. Further analysis will be required to determine if SrWeb is a new gene or an allele of a previously identified gene.

  18. Molecular Cytogenetic Characterization of two Triticum-Secale-Thinopyrum Trigeneric Hybrids Exhibiting Superior Resistance to Fusarium Head Blight, Leaf Rust, and Stem Rust Race Ug99.

    Science.gov (United States)

    Dai, Yi; Duan, Yamei; Liu, Huiping; Chi, Dawn; Cao, Wenguang; Xue, Allen; Gao, Yong; Fedak, George; Chen, Jianmin

    2017-01-01

    Fusarium head blight (FHB), leaf rust, and stem rust are the most destructive fungal diseases in current world wheat production. The diploid wheatgrass, Thinopyrum elongatum (Host) Dewey (2 n = 2 x = 14, EE) is an excellent source of disease resistance genes. Two new Triticum-Secale-Thinopyrum trigeneric hybrids were derived from a cross between a hexaploid triticale (X Triticosecale Wittmack, 2 n = 6 x = 42, AABBRR) and a hexaploid Triticum trititrigia (2 n = 6 x = 42, AABBEE), were produced and analyzed using genomic in situ hybridization and molecular markers. The results indicated that line RE21 contained 14 A-chromosomes, 14 B-chromosomes, three pairs of R-chromosomes (4R, 6R, and 7R), and four pairs of E-chromosomes (1E, 2E, 3E, and 5E) for a total chromosome number of 2 n = 42. Line RE62 contained 14 A-chromosomes, 14 B-chromosomes, six pairs of R-chromosomes, and one pair of translocation chromosomes between chromosome 5R and 5E, for a total chromosome number of 2 n = 42. At the seedling and adult growth stages under greenhouse conditions, line RE21 showed high levels of resistance to FHB, leaf rust, and stem rust race Ug99, and line RE62 was highly resistant to leaf rust and stem rust race Ug99. These two lines (RE21 and RE62) display superior disease resistance characteristics and have the potential to be utilized as valuable germplasm sources for future wheat improvement.

  19. Next generation sequencing provides rapid access to the genome of Puccinia striiformis f. sp. tritici, the causal agent of wheat stripe rust.

    Directory of Open Access Journals (Sweden)

    Dario Cantu

    Full Text Available BACKGROUND: The wheat stripe rust fungus (Puccinia striiformis f. sp. tritici, PST is responsible for significant yield losses in wheat production worldwide. In spite of its economic importance, the PST genomic sequence is not currently available. Fortunately Next Generation Sequencing (NGS has radically improved sequencing speed and efficiency with a great reduction in costs compared to traditional sequencing technologies. We used Illumina sequencing to rapidly access the genomic sequence of the highly virulent PST race 130 (PST-130. METHODOLOGY/PRINCIPAL FINDINGS: We obtained nearly 80 million high quality paired-end reads (>50x coverage that were assembled into 29,178 contigs (64.8 Mb, which provide an estimated coverage of at least 88% of the PST genes and are available through GenBank. Extensive micro-synteny with the Puccinia graminis f. sp. tritici (PGTG genome and high sequence similarity with annotated PGTG genes support the quality of the PST-130 contigs. We characterized the transposable elements present in the PST-130 contigs and using an ab initio gene prediction program we identified and tentatively annotated 22,815 putative coding sequences. We provide examples on the use of comparative approaches to improve gene annotation for both PST and PGTG and to identify candidate effectors. Finally, the assembled contigs provided an inventory of PST repetitive elements, which were annotated and deposited in Repbase. CONCLUSIONS/SIGNIFICANCE: The assembly of the PST-130 genome and the predicted proteins provide useful resources to rapidly identify and clone PST genes and their regulatory regions. Although the automatic gene prediction has limitations, we show that a comparative genomics approach using multiple rust species can greatly improve the quality of gene annotation in these species. The PST-130 sequence will also be useful for comparative studies within PST as more races are sequenced. This study illustrates the power of NGS for

  20. Discovery and characterization of two new stem rust resistance genes in Aegilops sharonensis.

    Science.gov (United States)

    Yu, Guotai; Champouret, Nicolas; Steuernagel, Burkhard; Olivera, Pablo D; Simmons, Jamie; Williams, Cole; Johnson, Ryan; Moscou, Matthew J; Hernández-Pinzón, Inmaculada; Green, Phon; Sela, Hanan; Millet, Eitan; Jones, Jonathan D G; Ward, Eric R; Steffenson, Brian J; Wulff, Brande B H

    2017-06-01

    We identified two novel wheat stem rust resistance genes, Sr-1644-1Sh and Sr-1644-5Sh in Aegilops sharonensis that are effective against widely virulent African races of the wheat stem rust pathogen. Stem rust is one of the most important diseases of wheat in the world. When single stem rust resistance (Sr) genes are deployed in wheat, they are often rapidly overcome by the pathogen. To this end, we initiated a search for novel sources of resistance in diverse wheat relatives and identified the wild goatgrass species Aegilops sharonesis (Sharon goatgrass) as a rich reservoir of resistance to wheat stem rust. The objectives of this study were to discover and map novel Sr genes in Ae. sharonensis and to explore the possibility of identifying new Sr genes by genome-wide association study (GWAS). We developed two biparental populations between resistant and susceptible accessions of Ae. sharonensis and performed QTL and linkage analysis. In an F 6 recombinant inbred line and an F 2 population, two genes were identified that mapped to the short arm of chromosome 1S sh , designated as Sr-1644-1Sh, and the long arm of chromosome 5S sh , designated as Sr-1644-5Sh. The gene Sr-1644-1Sh confers a high level of resistance to race TTKSK (a member of the Ug99 race group), while the gene Sr-1644-5Sh conditions strong resistance to TRTTF, another widely virulent race found in Yemen. Additionally, GWAS was conducted on 125 diverse Ae. sharonensis accessions for stem rust resistance. The gene Sr-1644-1Sh was detected by GWAS, while Sr-1644-5Sh was not detected, indicating that the effectiveness of GWAS might be affected by marker density, population structure, low allele frequency and other factors.

  1. Concerted action of two avirulent spore effectors activates Reaction to Puccinia graminis 1 (Rpg1)-mediated cereal stem rust resistance

    Science.gov (United States)

    The barley stem rust resistance gene Reaction to Puccinia graminis 1 (Rpg1), encoding a receptor-like kinase, confers durable resistance to the stem rust pathogen Puccinia graminis f. sp. tritici. The fungal urediniospores form adhesion structures with the leaf epidermal cells within 1 h of inocula...

  2. Targeted introgression of a wheat stem rust resistance gene by DNA marker-assisted chromosome engineering genetics

    Science.gov (United States)

    In wheat (Triticum aestivum L.), stem rust resistance gene Sr39, derived from Aegilops speltoides Tausch, is highly resistant to multiple stem rust races including TTKSK (Ug99). However, the gene has not been used in wheat breeding because of linkage drag associated with the large 2S chromosome segm...

  3. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in 'Thatcher' Wheat.

    Directory of Open Access Journals (Sweden)

    Colin W Hiebert

    Full Text Available Stem rust, caused by Puccinia graminis (Pgt, is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. 'Thatcher' wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in 'Thatcher' and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for 'Thatcher'-derived APR in several environments and this resistance was enhanced in the presence of Lr34.

  4. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in 'Thatcher' Wheat.

    Science.gov (United States)

    Hiebert, Colin W; Kolmer, James A; McCartney, Curt A; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N; Spielmeyer, Wolfgang

    2016-01-01

    Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. 'Thatcher' wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in 'Thatcher' and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for 'Thatcher'-derived APR in several environments and this resistance was enhanced in the presence of Lr34.

  5. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in ‘Thatcher’ Wheat

    Science.gov (United States)

    Hiebert, Colin W.; Kolmer, James A.; McCartney, Curt A.; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N.; Spielmeyer, Wolfgang

    2016-01-01

    Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. ‘Thatcher’ wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in ‘Thatcher’ and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for ‘Thatcher’-derived APR in several environments and this resistance was enhanced in the presence of Lr34. PMID:27309724

  6. Identifying leaf rust resistance gene Lr19 in durum wheat using ...

    African Journals Online (AJOL)

    Leaf rust, caused by Puccinia triticina Eriks., is an important disease affecting durum wheat (Triticum turgidum ssp. durum) worldwide, particularly in the Mediterranean region. The disease can be controlled through the use of plant host resistance. Based on seedling resistance tests of 103 durum genotypes against a bulk of ...

  7. Mapping fusiform rust resistance genes within a complex mating design of loblolly pine

    Science.gov (United States)

    Tania Quesada; Marcio F.R. Resende Jr.; Patricio Munoz; Jill L. Wegrzyn; David B. Neale; Matias Kirst; Gary F. Peter; Salvador A. Gezan; C.Dana Nelson; John M. Davis

    2014-01-01

    Fusiform rust resistance can involve gene-for-gene interactions where resistance (Fr) genes in the host interact with corresponding avirulence genes in the pathogen, Cronartium quercuum f.sp. fusiforme (Cqf). Here, we identify trees with Fr genes in a loblolly pine population derived from a complex mating design challenged with two Cqf inocula (one gall and 10 gall...

  8. Prehaustorial resistance to the wheat leaf rust fungus, Puccinia triticina, in Triticum monococcum (s.s.)

    NARCIS (Netherlands)

    Anker, C.C.; Niks, R.E.

    2001-01-01

    Diploid wheat, Triticum monococcum s.l., is a host for the wheat leaf rust fungus, Puccinia triticina. Some accessions have been reported to show a high degree of prehaustorial resistance. This is non-hypersensitivity resistance, which acts before the formation of haustoria by the pathogen. To

  9. A new soybean rust resistance allele from PI 423972 at the Rpp4 locus

    Science.gov (United States)

    Phakopsora pachyrhizi is a fungal pathogen and the cause of Asian soybean rust (SBR). P. pachyrhizi invaded the continental United States in 2004 and has since been a threat to the soybean industry. There are six described loci that harbor resistance to P. pachyrhizi (Rpp) genes. The resistance of P...

  10. Effects of planting density and the composition of wheat cultivar mixtures on stripe rust: an analysis taking into account limits to the replication of controls.

    Science.gov (United States)

    Garrett, K A; Mundt, C C

    2000-12-01

    ABSTRACT The effect of plant density on disease is not well understood in populations of a single host plant genotype and has been studied even less in mixtures of host genotypes. We performed an experiment to evaluate the effect of wheat planting density on infection by Puccinia striiformis in experimental plots with a single wheat genotype and in plots with two genotypes making up a range of frequencies. Stripe rust severity in single-genotype plots increased with planting density in 1997 but decreased with planting density in 1998. Disease in host mixtures was compared to the weighted mean of disease levels in the corresponding single-genotype plots. The design of the field experiment included limited replication of these reference treatments (that is, there was not a unique pair of single-genotype plots for each mixture plot); therefore, we devised an analysis based on collapsing the data into independent mean observations. Disease reduction due to host diversity was less when one genotype predominated than when both host genotypes were present at nearly equal frequencies. The greatest mean host-diversity effect for reduced disease was at the intermediate planting density of 250 seeds per m(2).

  11. Construction and characterization of a full-length cDNA library for the wheat stripe rust pathogen (Puccinia striiformis f. sp. tritici

    Directory of Open Access Journals (Sweden)

    Chen Xianming

    2007-06-01

    Full Text Available Abstract Background Puccinia striiformis is a plant pathogenic fungus causing stripe rust, one of the most important diseases on cereal crops and grasses worldwide. However, little is know about its genome and genes involved in the biology and pathogenicity of the pathogen. We initiated the functional genomic research of the fungus by constructing a full-length cDNA and determined functions of the first group of genes by sequence comparison of cDNA clones to genes reported in other fungi. Results A full-length cDNA library, consisting of 42,240 clones with an average cDNA insert of 1.9 kb, was constructed using urediniospores of race PST-78 of P. striiformis f. sp. tritici. From 196 sequenced cDNA clones, we determined functions of 73 clones (37.2%. In addition, 36 clones (18.4% had significant homology to hypothetical proteins, 37 clones (18.9% had some homology to genes in other fungi, and the remaining 50 clones (25.5% did not produce any hits. From the 73 clones with functions, we identified 51 different genes encoding protein products that are involved in amino acid metabolism, cell defense, cell cycle, cell signaling, cell structure and growth, energy cycle, lipid and nucleotide metabolism, protein modification, ribosomal protein complex, sugar metabolism, transcription factor, transport metabolism, and virulence/infection. Conclusion The full-length cDNA library is useful in identifying functional genes of P. striiformis.

  12. Construction and characterization of a full-length cDNA library for the wheat stripe rust pathogen (Puccinia striiformis f. sp. tritici).

    Science.gov (United States)

    Ling, Peng; Wang, Meinan; Chen, Xianming; Campbell, Kimberly Garland

    2007-06-04

    Puccinia striiformis is a plant pathogenic fungus causing stripe rust, one of the most important diseases on cereal crops and grasses worldwide. However, little is know about its genome and genes involved in the biology and pathogenicity of the pathogen. We initiated the functional genomic research of the fungus by constructing a full-length cDNA and determined functions of the first group of genes by sequence comparison of cDNA clones to genes reported in other fungi. A full-length cDNA library, consisting of 42,240 clones with an average cDNA insert of 1.9 kb, was constructed using urediniospores of race PST-78 of P. striiformis f. sp. tritici. From 196 sequenced cDNA clones, we determined functions of 73 clones (37.2%). In addition, 36 clones (18.4%) had significant homology to hypothetical proteins, 37 clones (18.9%) had some homology to genes in other fungi, and the remaining 50 clones (25.5%) did not produce any hits. From the 73 clones with functions, we identified 51 different genes encoding protein products that are involved in amino acid metabolism, cell defense, cell cycle, cell signaling, cell structure and growth, energy cycle, lipid and nucleotide metabolism, protein modification, ribosomal protein complex, sugar metabolism, transcription factor, transport metabolism, and virulence/infection. The full-length cDNA library is useful in identifying functional genes of P. striiformis.

  13. Studies on 32P transport and yellow rust resistance in barley

    International Nuclear Information System (INIS)

    Schubert, J.

    1982-01-01

    Several cultivars of barley (Hordeum vulgare L.) differing in their resistance to yellow rust were used to study the influence of the infection with Puccinia striiformis West. (strain 24) on 32 P transport in intact plants and isolated leaves. Close correlations exist between transport processes and resistance. For example, resistant plants seem to have a more intensive matter transport than susceptible ones. The importance of the rate of transport to the effectiveness of hypothetic inducers of resistance reactions and defence substances is discussed

  14. Transcriptome analysis of resistant and susceptible genotypes of Glycine tomentella during Phakopsora pachyrhizi infection reveals novel rust resistance genes.

    Science.gov (United States)

    Soria-Guerra, Ruth Elena; Rosales-Mendoza, Sergio; Chang, Sungyul; Haudenshield, James S; Padmanaban, Annamalai; Rodriguez-Zas, Sandra; Hartman, Glen L; Ghabrial, Said A; Korban, Schuyler S

    2010-05-01

    Soybean rust, caused by Phakopsora pachyrhizi, is a destructive foliar disease in nearly all soybean-producing countries. To identify genes controlling resistance to soybean rust, transcriptome profiling was conducted in resistant and susceptible Glycine tomentella genotypes triggered by P. pachyrhizi infection. Among 38,400 genes monitored using a soybean microarray, at 5% false discovery rate, 1,342 genes were identified exhibiting significant differential expression between uninfected and P. pachyrhizi-infected leaves at 12, 24, 48, and 72 h post-inoculation (hpi) in both rust-susceptible and rust-resistant genotypes. Differentially expressed genes were grouped into 12 functional categories, and among those, large numbers relate to basic plant metabolism. Transcripts for genes involved in the phenylpropanoid pathway were up-regulated early during rust infection. Similarly, genes coding for proteins related to stress and defense responses such as glutathione-S-transferases, peroxidases, heat shock proteins, and lipoxygenases were consistently up-regulated following infection at all four time points. Whereas, subsets of genes involved in cellular transport, cellular communication, cell cycle, and DNA processing were down-regulated. Quantitative real-time reverse-transcription polymerase chain reaction (qRT-PCR) on randomly selected genes from the different categories confirmed these findings. Of differentially expressed genes, those associated with the flavonoid biosynthesis pathway as well as those coding for peroxidases and lipoxygenases were likely to be involved in rust resistance in soybean, and would serve as good candidates for functional studies. These findings provided insights into mechanisms underlying resistance and general activation of plant defense pathways in response to rust infection.

  15. Association mapping and gene-gene interaction for stem rust resistance in CIMMYT spring wheat germplasm.

    Science.gov (United States)

    Yu, Long-Xi; Lorenz, Aaron; Rutkoski, Jessica; Singh, Ravi P; Bhavani, Sridhar; Huerta-Espino, Julio; Sorrells, Mark E

    2011-12-01

    The recent emergence of wheat stem rust Ug99 and evolution of new races within the lineage threatens global wheat production because they overcome widely deployed stem rust resistance (Sr) genes that had been effective for many years. To identify loci conferring adult plant resistance to races of Ug99 in wheat, we employed an association mapping approach for 276 current spring wheat breeding lines from the International Maize and Wheat Improvement Center (CIMMYT). Breeding lines were genotyped with Diversity Array Technology (DArT) and microsatellite markers. Phenotypic data was collected on these lines for stem rust race Ug99 resistance at the adult plant stage in the stem rust resistance screening nursery in Njoro, Kenya in seasons 2008, 2009 and 2010. Fifteen marker loci were found to be significantly associated with stem rust resistance. Several markers appeared to be linked to known Sr genes, while other significant markers were located in chromosome regions where no Sr genes have been previously reported. Most of these new loci colocalized with QTLs identified recently in different biparental populations. Using the same data and Q + K covariate matrices, we investigated the interactions among marker loci using linear regression models to calculate P values for pairwise marker interactions. Resistance marker loci including the Sr2 locus on 3BS and the wPt1859 locus on 7DL had significant interaction effects with other loci in the same chromosome arm and with markers on chromosome 6B. Other resistance marker loci had significant pairwise interactions with markers on different chromosomes. Based on these results, we propose that a complex network of gene-gene interactions is, in part, responsible for resistance to Ug99. Further investigation may provide insight for understanding mechanisms that contribute to this resistance gene network.

  16. Mutation breeding for disease resistance in wheat and field beans in Egypt

    International Nuclear Information System (INIS)

    Abdel-Hak, T.M.

    1983-01-01

    Seeds of three varieties of hexaploid wheat and of one variety of tetraploid wheat were treated with gamma rays in order to obtain mutants with improved resistance to stem rust, leaf rust and stripe rust. Mutants with resistance to prevailing races of rusts were selected; however, the race spectrum shifted and made the mutants useless for the time being. Induction of mutations for resistance to chocolate spot and rusts was attempted in Vicia faba. No resistant mutant was found but some mutants with lower levels of infection were. (author)

  17. Corrosion-resistant amorphous alloy ribbons for electromagnetic filtration of iron rusts from water

    International Nuclear Information System (INIS)

    Kawashima, Asahi; Asami, Katsuhiko; Sato, Takeaki; Hashimoto, Koji

    1985-01-01

    An attempt was made to use corrosion-resistant amorphous Fe-9Cr-13P-7C alloy ribbons as an electromagnetic filter material for trapping various iron rusts suspended in water at 40 0 C. The ferrimagnetic Fe 3 O 4 rust was trapped with the 100 % efficiency and paramagnetic rusts such as α-Fe 2 O 3 , α-FeOOH and amorphous ferric oxyhydroxide were trapped with certain efficiencies at the magnetic field strength of 0.5-10 kOe. The regeneration of the filter by back-washing was easy. The trapping capacity of electromagnetic filter was proportional to the edge length of the filter material where the high magnetic field strength existed. Therefore, melt-spun thin and narrow amorphous alloy ribbons having the high corrosion resistance have the potential utility as electromagnetic filter material. (author)

  18. White pine blister rust resistance research in Minnesota and Wisconsin

    Science.gov (United States)

    Andrew David; Paul Berrang; Carrie Pike

    2012-01-01

    The exotic fungus Cronartium ribicola causes the disease white pine blister rust on five-needled pines throughout North America. Although the effects of this disease are perhaps better known on pines in the western portion of the continent, the disease has also impacted regeneration and growth of eastern white pine (Pinus strobus L. ...

  19. Sources of stem rust resistance in Ethiopian tetraploid wheat ...

    African Journals Online (AJOL)

    Stem or black rust of wheat caused by the fungus Puccinia graminis f. sp. tritici Ericks and Henn (Pgt) is an important disease on wheat worldwide. Pgt is an obligate biotroph, heteroceous in its life cycle and heterothallic in mating type. Seedlings of 41 emmer (Triticum dicoccum), 56 durum (T. durum) wheat accessions were ...

  20. Registration of eight soybean germplasm lines resistant to soybean rust

    Science.gov (United States)

    Soybean rust (SBR), caused by the fungus Phakopsora pachyrhizi Sydow is a threat to soybean [Glycine max (L.) Merr.] production worldwide. Although SBR has not caused widespread damage in North America, the crop is still threatened by the disease because most cultivars in production are susceptible...

  1. Rapid Phenotyping Adult Plant Resistance to Stem Rust in Wheat Grown under Controlled Conditions.

    Science.gov (United States)

    Riaz, Adnan; T Hickey, Lee

    2017-01-01

    Stem rust (SR) or black rust caused by Puccinia graminis f. sp. tritici is one of the most common diseases of wheat (Triticum aestivum L.) crops globally. Among the various control measures, the most efficient and sustainable approach is the deployment of genetically resistant cultivars. Traditionally, wheat breeding programs deployed genetic resistance in cultivars, but unknowingly this is often underpinned by a single seedling resistance gene, which is readily overcome by the pathogen. Nowadays, adult plant resistance (APR) is a widely adopted form of rust resistance because more durable mechanisms often underpin it. However, only a handful of SR APR genes are available, so breeders currently strive to combine seedling and APR genes. Phenotyping adult wheat plants for resistance to SR typically involves evaluation in the field. But establishing a rust nursery can be challenging, and screening is limited to once a year. This slows down research efforts to isolate new APR genes and breeding of genetically resistant cultivars.In this study, we report a protocol for rapid evaluation of adult wheat plants for resistance to stem rust. We demonstrate the technique by evaluating a panel of 16 wheat genotypes consisting of near isogenic lines (NILs) for known Sr genes (i.e., Sr2, Sr33, Sr45, Sr50, Sr55, Sr57, and Sr58) and three landraces carrying uncharacterized APR from the N. I. Vavilov Institute of Plant Genetic Resources (VIR). The method can be completed in just 10 weeks and involves two inoculations: first conducted at seedling stage and a second at the adult stage (using the same plants). The technique can detect APR, such as that conferred by APR gene Sr2, along with pseudo-black chaff (the morphological marker). Phenotyping can be conducted throughout the year, and is fast and resource efficient. Further, the phenotyping method can be applied to screen breeding populations or germplasm accessions using local or exotic races of SR.

  2. Characterization of Sr9h, a wheat stem rust resistance allele effective to Ug99.

    Science.gov (United States)

    Rouse, Matthew N; Nirmala, Jayaveeramuthu; Jin, Yue; Chao, Shiaoman; Fetch, Thomas G; Pretorius, Zacharias A; Hiebert, Colin W

    2014-08-01

    Wheat stem rust resistance gene SrWeb is an allele at the Sr9 locus that confers resistance to Ug99. Race TTKSK (Ug99) of Puccinia graminis f. sp. tritici, the causal fungus of stem rust, threatens global wheat production because of its broad virulence to current wheat cultivars. A recently identified Ug99 resistance gene from cultivar Webster, temporarily designated as SrWeb, mapped near the stem rust resistance gene locus Sr9. We determined that SrWeb is also present in Ug99 resistant cultivar Gabo 56 by comparative mapping and an allelism test. Analysis of resistance in a population segregating for both Sr9e and SrWeb demonstrated that SrWeb is an allele at the Sr9 locus, which subsequently was designated as Sr9h. Webster and Gabo 56 were susceptible to the Ug99-related race TTKSF+ from South Africa. Race TTKSF+ possesses unique virulence to uncharacterized Ug99 resistance in cultivar Matlabas. This result validated that resistance to Ug99 in Webster and Gabo 56 is conferred by the same gene: Sr9h. The emergence of pathogen virulence to several resistance genes that are effective to the original Ug99 race TTKSK, including Sr9h, suggests that resistance genes should be used in combinations in order to increase resistance durability.

  3. Nested Association Mapping of Stem Rust Resistance in Wheat Using Genotyping by Sequencing.

    Directory of Open Access Journals (Sweden)

    Prabin Bajgain

    Full Text Available We combined the recently developed genotyping by sequencing (GBS method with joint mapping (also known as nested association mapping to dissect and understand the genetic architecture controlling stem rust resistance in wheat (Triticum aestivum. Ten stem rust resistant wheat varieties were crossed to the susceptible line LMPG-6 to generate F6 recombinant inbred lines. The recombinant inbred line populations were phenotyped in Kenya, South Africa, and St. Paul, Minnesota, USA. By joint mapping of the 10 populations, we identified 59 minor and medium-effect QTL (explained phenotypic variance range of 1% - 20% on 20 chromosomes that contributed towards adult plant resistance to North American Pgt races as well as the highly virulent Ug99 race group. Fifteen of the 59 QTL were detected in multiple environments. No epistatic relationship was detected among the QTL. While these numerous small- to medium-effect QTL are shared among the families, the founder parents were found to have different allelic effects for the QTL. Fourteen QTL identified by joint mapping were also detected in single-population mapping. As these QTL were mapped using SNP markers with known locations on the physical chromosomes, the genomic regions identified with QTL could be explored more in depth to discover candidate genes for stem rust resistance. The use of GBS-derived de novo SNPs in mapping resistance to stem rust shown in this study could be used as a model to conduct similar marker-trait association studies in other plant species.

  4. Nested Association Mapping of Stem Rust Resistance in Wheat Using Genotyping by Sequencing.

    Science.gov (United States)

    Bajgain, Prabin; Rouse, Matthew N; Tsilo, Toi J; Macharia, Godwin K; Bhavani, Sridhar; Jin, Yue; Anderson, James A

    2016-01-01

    We combined the recently developed genotyping by sequencing (GBS) method with joint mapping (also known as nested association mapping) to dissect and understand the genetic architecture controlling stem rust resistance in wheat (Triticum aestivum). Ten stem rust resistant wheat varieties were crossed to the susceptible line LMPG-6 to generate F6 recombinant inbred lines. The recombinant inbred line populations were phenotyped in Kenya, South Africa, and St. Paul, Minnesota, USA. By joint mapping of the 10 populations, we identified 59 minor and medium-effect QTL (explained phenotypic variance range of 1% - 20%) on 20 chromosomes that contributed towards adult plant resistance to North American Pgt races as well as the highly virulent Ug99 race group. Fifteen of the 59 QTL were detected in multiple environments. No epistatic relationship was detected among the QTL. While these numerous small- to medium-effect QTL are shared among the families, the founder parents were found to have different allelic effects for the QTL. Fourteen QTL identified by joint mapping were also detected in single-population mapping. As these QTL were mapped using SNP markers with known locations on the physical chromosomes, the genomic regions identified with QTL could be explored more in depth to discover candidate genes for stem rust resistance. The use of GBS-derived de novo SNPs in mapping resistance to stem rust shown in this study could be used as a model to conduct similar marker-trait association studies in other plant species.

  5. Frequency and distribution of the brown rust resistance gene Bru1 and implications for the Louisiana sugarcane breeding programme

    Science.gov (United States)

    Brown rust, caused by the fungus Puccinia melanocephala, is an important disease of sugarcane posing an increasing threat to sugarcane industries worldwide. A major gene, Bru1, has been shown to contribute a significant proportion of brown rust resistance in multiple sugarcane industries. The recent...

  6. Identification of nine pathotype-specific genes conferring resistance to fusiform rust in loblolly pine (Pinus taeda L.)

    Science.gov (United States)

    Henry Amerson; C. Dana Nelson; Thomas L. Kubisiak; E.George Kuhlman; Saul Garcia

    2015-01-01

    Nearly two decades of research on the host-pathogen interaction in fusiform rust of loblolly pine is detailed. Results clearly indicate that pathotype-specific genes in the host interacting with pathogen avirulence cause resistance as defined by the non-gall phenotype under favorable environmental conditions for disease development. In particular, nine fusiform rust...

  7. White pine blister rust in high-elevation white pines: Screening for simply-inherited, hypersensitive resistance

    Science.gov (United States)

    Detlev R. Vogler; Annette Delfino-Mix; Anna W. Schoettle

    2006-01-01

    Recent concern about survival and recovery of high-elevation white pine ecosystems has returned white pine blister rust (caused by Cronartiurn ribicola) to prominence as a significant threat to forest health in the western U.S. (Sainman et al., 2003). This, in turn, has spurred new research into potential rust-resistance mechanisms in high-elevation...

  8. Dissection of the multigenic wheat stem rust resistance present in the Montenegrin spring wheat accession PI 362698

    Science.gov (United States)

    Research to identify and characterize stem rust resistance genes in common wheat, Triticum aestivum, has been stimulated by the emergence of Ug99-lineage races of the wheat stem rust pathogen, Puccinia graminis f. sp. tritici (Pgt), in Eastern Africa. The Montenegrin spring wheat landrace PI 362698 ...

  9. Discovery of a novel stem rust resistance allele in durum wheat that exhibits differential reactions to Ug99 isolates

    Science.gov (United States)

    Wheat stem rust, caused by Puccinia graminis f. sp. tritici Erikss. & E. Henn, can incur yield losses on susceptible cultivars of durum wheat, Triticum turgidum ssp. durum (Desf.) Husnot. Though several durum cultivars possess the stem rust resistance gene Sr13, additional genes in durum wheat effec...

  10. Distribution and frequency of Bru1, a major brown rust resistance gene, in the sugarcane world collection

    Science.gov (United States)

    Brown rust, caused by Puccinia melanocephala, is an important disease of sugarcane worldwide. Molecular markers for a major brown rust resistance gene, Bru1, were used to screen a total of 1,282 clones in the World Collection of Sugarcane and Related Grasses (WCSRG) to determine the distribution and...

  11. Localising QTLs for leaf rust resistance and agronomic traits in barley (¤Hordeum vulgare¤ L.)

    DEFF Research Database (Denmark)

    Kicherer, S.; Backes, G.; Walther, U.

    2000-01-01

    to leaf rust by means of artificial infection, heading date, plant height and Kernel weight were assessed. For leaf rust resistance, 4 QTLs were localised, that explained 96.1% of the genetic variation. One QTL on chromosome 4H confirmed a position found in another genetic background and one mapped...

  12. Genetic mapping of stem rust resistance to Puccinia graminis f. sp. tritici race TRTTF in the Canadian wheat cultivar 'Harvest'

    Science.gov (United States)

    Stem rust, caused by Puccinia graminis Pers.:Pers. f. sp. tritici Eriks. & E. Henn.(Pgt), is a destructive disease of wheat that can be controlled by deploying effective stem rust resistance (Sr) genes. Highly virulent races of Pgt in Africa have been detected and characterized. These include race T...

  13. Mapping and characterization of wheat stem rust resistance genes SrTm5 and Sr60 from Triticum monococcum

    Science.gov (United States)

    The emergence and spread of new virulent races of the wheat stem rust pathogen (Puccinia graminis f. sp. tritici; Pgt), including the TTKSK (Ug99) race group, is a serious threat to global wheat production. In this study, we mapped and characterized two stem rust resistance genes from diploid wheat ...

  14. Adult Plant Leaf Rust Resistance Derived from Toropi Wheat is Conditioned by Lr78 and Three Minor QTL.

    Science.gov (United States)

    Kolmer, J A; Bernardo, A; Bai, G; Hayden, M J; Chao, S

    2018-02-01

    Leaf rust caused by Puccinia triticina is an important disease of wheat in many regions worldwide. Durable or long-lasting leaf rust resistance has been difficult to achieve because populations of P. triticina are highly variable for virulence to race-specific resistance genes, and respond to selection by resistance genes in released wheat cultivars. The wheat cultivar Toropi, developed and grown in Brazil, was noted to have long-lasting leaf rust resistance that was effective only in adult plants. The objectives of this study were to determine the chromosome location of the leaf rust resistance genes derived from Toropi in two populations of recombinant inbred lines in a partial Thatcher wheat background. In the first population, a single gene with major effects on chromosome 5DS that mapped 2.2 centimorgans distal to IWA6289, strongly reduced leaf rust severity in all 3 years of field plot tests. This gene for adult plant leaf rust resistance was designated as Lr78. In the second population, quantitative trait loci (QTL) with small effects on chromosomes 1BL, 3BS, and 4BS were found. These QTL expressed inconsistently over 4 years of field plot tests. The adult plant leaf rust resistance derived from Toropi involved a complex combination of QTL with large and small effects.

  15. Strong partial resistance to white pine blister rust in sugar pine

    Science.gov (United States)

    Bohun B. Kinloch, Jr.; Deems Burton; Dean A. Davis; Robert D. Westfall; Joan Dunlap; Detlev Vogler

    2012-01-01

    Quantitative resistance to white pine blister rust in 128 controlled- and open-pollinated sugar pine families was evaluated in a “disease garden”, where alternate host Ribes bushes were interplanted among test progenies. Overall infection was severe (88%), but with great variation among and within families: a 30-fold range in numbers of infections...

  16. Sources of stem rust resistance in wheat-alien introgression lines

    Science.gov (United States)

    Stem rust, caused by Puccinia graminis f. sp. tritici, is one of the most devastating diseases of wheat and the novel highly virulent race of TTKSK and its lineage are threatening wheat production worldwide. The objective of the study was to identify new sources of resistance in wheat-alien introgre...

  17. Introgression of a leaf rust resistance gene from Aegilops caudata to ...

    Indian Academy of Sciences (India)

    wheat were undertaken. An F2 population derived from the cross of Triticum aestivum cv. WL711 – Ae. caudata introgression line T291-2 with wheat cultivar PBW343 segregated for a single dominant leaf rust resistance gene at the seedling and adult plant stages. Progeny testing in F3 confirmed the introgression of a single ...

  18. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 96; Issue 2. Genetics and mapping of a new leaf rust resistance gene in Triticum aestivum L. × Triticum timopheevii Zhuk. derivative 'Selection G12'. AMIT KUMAR SINGH JAI BHAGWAN SHARMA VINOD PRADEEP KUMAR SINGH ANUPAM SINGH NIHARIKA MALLICK.

  19. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    AMIT KUMAR SINGH

    RESEARCH ARTICLE. Genetics and mapping of a new leaf rust resistance gene in Triticum aestivum L. × Triticum timopheevii Zhuk. derivative 'Selection G12'. AMIT KUMAR SINGH1,2∗, JAI BHAGWAN SHARMA1, VINOD1, PRADEEP KUMAR SINGH1,. ANUPAM SINGH1 and NIHARIKA MALLICK1. 1Indian Agricultural ...

  20. Identification of rust resistance genes Lr10 and Sr9a in Pakistani ...

    African Journals Online (AJOL)

    Identification of rust resistance genes Lr10 and Sr9a in Pakistani wheat germplasm using PCR based molecular markers. M Babar, AF Mashhadi, A Mehvish, AN Zahra, R Waheed, A Hasnain, S ur-Rahman, N Hussain, M Ali, I Khaliq, A Aziz ...

  1. Association analysis identifies Melampsora ×columbiana poplar leaf rust resistance SNPs.

    Directory of Open Access Journals (Sweden)

    Jonathan La Mantia

    Full Text Available Populus species are currently being domesticated through intensive time- and resource-dependent programs for utilization in phytoremediation, wood and paper products, and conversion to biofuels. Poplar leaf rust disease can greatly reduce wood volume. Genetic resistance is effective in reducing economic losses but major resistance loci have been race-specific and can be readily defeated by the pathogen. Developing durable disease resistance requires the identification of non-race-specific loci. In the presented study, area under the disease progress curve was calculated from natural infection of Melampsora ×columbiana in three consecutive years. Association analysis was performed using 412 P. trichocarpa clones genotyped with 29,355 SNPs covering 3,543 genes. We found 40 SNPs within 26 unique genes significantly associated (permutated P<0.05 with poplar rust severity. Moreover, two SNPs were repeated in all three years suggesting non-race-specificity and three additional SNPs were differentially expressed in other poplar rust interactions. These five SNPs were found in genes that have orthologs in Arabidopsis with functionality in pathogen induced transcriptome reprogramming, Ca²⁺/calmodulin and salicylic acid signaling, and tolerance to reactive oxygen species. The additive effect of non-R gene functional variants may constitute high levels of durable poplar leaf rust resistance. Therefore, these findings are of significance for speeding the genetic improvement of this long-lived, economically important organism.

  2. Rust resistance in seedling families of Pinus albicaulis and Pinus strobiformis and implications for restoration

    Science.gov (United States)

    R. A. Sniezko; A. Kegley; R. Danchok; J. Hamlin; J. Hill; D. Conklin

    2011-01-01

    Infection and mortality levels from Cronartium ribicola, the fungus causing white pine blister rust, are very high in parts of the geographic range of Pinus albicaulis (whitebark pine) and P. strobiformis (Southwestern white pine). Genetic resistance to this non-native fungus will be one of the key factors in maintaining or restoring populations of these species in...

  3. URS Brava – a new oat cultivar with partial resistance to crown rust

    Directory of Open Access Journals (Sweden)

    Luiz Carlos Federizzi

    2015-08-01

    Full Text Available The cultivar URS Brava, obtained from a simple cross between the line ‘UFRGS 995078-2’ and the cultivar ‘URS 21’, shows high grain yield and stability, high grain quality, desirable agronomical traits and partial resistance to crown rust, caused by the fungus Puccinia coronata f. sp. avenae.

  4. Discovery of a seventh Rpp soybean rust resistance locus in soybean accession PI 605823

    Science.gov (United States)

    Soybean rust, caused by the obligate biotrophic fungal pathogen Phakopsora pachyrhizi Syd. & Syd, is a disease threat to soybean production in regions of the world with mild winters. Host plant resistance to P. pachyrhizi conditioned by Rpp genes has been found in numerous soybean accessions, and at...

  5. genetic analysis of resistance to soybean rust disease abstract résumé

    African Journals Online (AJOL)

    Administrator

    GENETIC ANALYSIS OF RESISTANCE TO SOYBEAN RUST DISEASE. M. KIRYOWA, P. TUKAMUHABWA and E. ADIPALA1. Department of Crop Science, Faculty of Agriculture, Makerere University, P. O. Box 7062, Kampala, Uganda. 1Regional Universities Forum for Capacity Building in Agriculture, Makerere University,.

  6. Molecular and cytogenetic characterization of wheat introgression lines carrying the stem rust resistance gene Sr39.

    Science.gov (United States)

    Stem rust, caused by Puccinia graminis Pers.:Pers. f.sp. tritici Eriks. and Henn., poses a serious threat to global wheat production because of the emergence of Pgt-TTKSK (Ug99). The TTKSK resistant gene Sr39 was derived from Aegilops speltoides through chromosome translocation. In this study, we ch...

  7. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    AMIT KUMAR SINGH

    Abstract. A Triticum timopheevii-derived bread wheat line, Selection G12, was screened with 40 pathotypes of leaf rust pathogen,. Puccinia triticina at seedling stage and with two most commonly prevalent pathotypes 77-5 and 104-2 at adult plant stage. Selection G12 showed resistance at both seedling and adult plant ...

  8. Mapping of a new stem rust resistance gene Sr49 in chromosome 5B of wheat.

    Science.gov (United States)

    Bansal, Urmil K; Muhammad, Sher; Forrest, Kerrie L; Hayden, Matthew J; Bariana, Harbans S

    2015-10-01

    A new stem rust resistance gene Sr49 was mapped to chromosome 5BL of wheat. Usefulness of the closely linked markers sun209 and sun479 for marker-assisted selection of Sr49 was demonstrated. Landrace AUS28011 (Mahmoudi), collected from Ghardimaou, Tunisia, produced low stem rust response against Australian pathotypes of Puccinia graminis f. sp. tritici (Pgt) carrying virulence for several stem rust resistance genes deployed in modern wheat cultivars. Genetic analysis based on a Mahmoudi/Yitpi F3 population indicated the involvement of a single all-stage stem rust resistance gene and it was temporarily named SrM. Bulked segregant analysis using multiplex-ready SSR technology located SrM on the long arm of chromosome 5B. Since there is no other all-stage stem rust resistance gene located in chromosome 5BL, SrM was permanently designated Sr49. The Mahmoudi/Yitpi F3 population was enhanced to generate F6 recombinant inbred line (RIL) population for detailed mapping of Sr49 using publicly available genomic resources. Markers sun209 and sun479 flanked Sr49 at 1.5 and 0.9 cM distally and proximally, respectively. Markers sun209 and sun479 amplified PCR products different than the Sr49-linked alleles in 146 and 145 common wheat cultivars, respectively. Six and seven cultivars, respectively, carried the resistance-linked marker alleles sun209 148bp and sun479 200bp ; however, none of the cultivars carried both resistance-linked alleles. These results demonstrated the usefulness of these markers for marker-assisted selection of Sr49 in breeding programs.

  9. Resistance to recombinant stem rust race TPPKC in hard red spring wheat.

    Science.gov (United States)

    Klindworth, D L; Miller, J D; Williams, N D; Xu, S S

    2011-08-01

    The wheat (Triticum aestivum L.) stem rust (Puccinia graminis Pers.:Pers. f.sp. tritici Eriks. and Henn.) resistance gene SrWld1 conditions resistance to all North American stem rust races and is an important gene in hard red spring (HRS) wheat cultivars. A sexually recombined race having virulence to SrWld1 was isolated in the 1980s. Our objective was to determine the genetics of resistance to the race. The recombinant race was tested with the set of stem rust differentials and with a set of 36 HRS and 6 durum cultivars. Chromosomal location studies in cultivars Len, Coteau, and Stoa were completed using aneuploid analysis, molecular markers, and allelism tests. Stem rust differential tests coded the race as TPPKC, indicating it differed from TPMKC by having added virulence on Sr30 as well as SrWld1. Genes effective against TPPKC were Sr6, Sr9a, Sr9b, Sr13, Sr24, Sr31, and Sr38. Genetic studies of resistance to TPPKC indicated that Len, Coteau, and Stoa likely carried Sr9b, that Coteau and Stoa carried Sr6, and Stoa carried Sr24. Tests of HRS and durum cultivars indicated that five HRS and one durum cultivar were susceptible to TPPKC. Susceptible HRS cultivars were postulated to have SrWld1 as their major stem rust resistance gene. Divide, the susceptible durum cultivar, was postulated to lack Sr13. We concluded that although TPPKC does not constitute a threat similar to TTKSK and its variants, some cultivars would be lost from production if TPPKC became established in the field.

  10. Molecular Cytogenetic Characterization of two Triticum–Secale–Thinopyrum Trigeneric Hybrids Exhibiting Superior Resistance to Fusarium Head Blight, Leaf Rust, and Stem Rust Race Ug99

    Directory of Open Access Journals (Sweden)

    Yi Dai

    2017-05-01

    Full Text Available Fusarium head blight (FHB, leaf rust, and stem rust are the most destructive fungal diseases in current world wheat production. The diploid wheatgrass, Thinopyrum elongatum (Host Dewey (2n = 2x = 14, EE is an excellent source of disease resistance genes. Two new Triticum–Secale–Thinopyrum trigeneric hybrids were derived from a cross between a hexaploid triticale (X Triticosecale Wittmack, 2n = 6x = 42, AABBRR and a hexaploid Triticum trititrigia (2n = 6x = 42, AABBEE, were produced and analyzed using genomic in situ hybridization and molecular markers. The results indicated that line RE21 contained 14 A-chromosomes, 14 B-chromosomes, three pairs of R-chromosomes (4R, 6R, and 7R, and four pairs of E-chromosomes (1E, 2E, 3E, and 5E for a total chromosome number of 2n = 42. Line RE62 contained 14 A-chromosomes, 14 B-chromosomes, six pairs of R-chromosomes, and one pair of translocation chromosomes between chromosome 5R and 5E, for a total chromosome number of 2n = 42. At the seedling and adult growth stages under greenhouse conditions, line RE21 showed high levels of resistance to FHB, leaf rust, and stem rust race Ug99, and line RE62 was highly resistant to leaf rust and stem rust race Ug99. These two lines (RE21 and RE62 display superior disease resistance characteristics and have the potential to be utilized as valuable germplasm sources for future wheat improvement.

  11. Characterization of a pathogenesis-related thaumatin-like protein gene TaPR5 from wheat induced by stripe rust fungus.

    Science.gov (United States)

    Wang, Xiaojie; Tang, Chunlei; Deng, Lin; Cai, Gaolei; Liu, Xinying; Liu, Bo; Han, Qingmei; Buchenauer, Heinrich; Wei, Guorong; Han, Dejun; Huang, Lili; Kang, Zhensheng

    2010-05-01

    Pathogenesis-related (PR) proteins, induced in plants in response to various biotic and abiotic stresses, have been assumed to play a role in plant defense system. Proteins of the PR5 family, also named thaumatin-like proteins (TLPs), have been detected in numerous plant species. In this research, a novel PR5 gene, designated as TaPR5, was isolated and characterized from wheat leaves (cv. Suwon 11) infected by the stripe rust pathotype CY23 (incompatible interaction) using the rapid amplification of cDNA ends (RACE). TaPR5 was predicted to encode a protein of 173 amino acids with an estimated molecular mass of 17.6 kDa and a theoretical pI of 4.64. The deduced amino acid sequence of TaPR5 showed a significant sequence similarity with PR5 and TLPs from barley and other plants and contained a putative signal peptide at the amino terminus. Southern blot analysis indicated that TaPR5 is coded by a single-copy gene. Quantitative real-time polymerase chain reaction (qRT-PCR) analyses revealed that TaPR5 transcript is significantly induced and upregulated in the incompatible interaction while in the compatible interaction a relative low level of the transcript was detected. TaPR5 was also induced by phytohormones (SA, JA and ABA) and stress stimuli (wounding, cold temperature and high salinity). Using an assay of onion epidermal cells indicated accumulation of TaPR5 protein in the apoplast. The immunocytochemical method showed that the TaPR5 protein was detected on cell walls of wheat leaves in the incompatible interaction at markedly higher labeling density compared with the compatible interaction.

  12. Stem Rust Resistance in a Geographically Diverse Collection of Spring Wheat Lines Collected from Across Africa.

    Science.gov (United States)

    Prins, Renée; Dreisigacker, Susanne; Pretorius, Zakkie; van Schalkwyk, Hester; Wessels, Elsabet; Smit, Corneli; Bender, Cornel; Singh, Davinder; Boyd, Lesley A

    2016-01-01

    Following the emergence of the Ug99 lineage of Puccinia graminis f. sp. tritici (Pgt) a collective international effort has been undertaken to identify new sources of wheat stem rust resistance effective against these races. Analyses were undertaken in a collection of wheat genotypes gathered from across Africa to identify stem rust resistance effective against the Pgt races found in Eastern and Southern Africa. The African wheat collection consisted of historic genotypes collected in Kenya, South Africa, Ethiopia, Sudan, Zambia, Morocco, and Tunisia, and current South African breeding lines. Both Bayesian cluster and principal coordinate analyses placed the wheat lines from Sudan in a distinct group, but indicated a degree of genetic relatedness among the other wheat lines despite originating from countries across Africa. Seedling screens with Pgt race PTKST, pedigree information and marker haplotype analysis confirmed the presence of Sr2, Sr36, Sr24, Sr31, and Lr34/Yr18/Sr57 in a number of the lines. A genome-wide association study (GWAS) undertaken with Diversiry Arrays Technology (DArT) and stem rust (Sr) gene associated markers and Stem Area Infected (SAI) and Reaction Type (RT) field phenotypes, collected from trials carried out across two seasons in Kenya in 2009 and in South Africa in 2011, identified 29 marker-trait associations (MTA). Three MTA were in common between SAI and RT, with the biggest effect MTA being found on chromosome 6AS. Two wheat lines, W1406 and W6979 that exhibited high levels of adult plant stem rust resistance were selected to generate bi-parental mapping populations. Only the MTA on chromosomes 6AS and 3BS, and the locus Lr34/Yr18/Sr57 were confirmed following QTL mapping. Additional stem rust resistance QTL, not detected by the GWAS, were found on chromosomes 2BS, 2DL, 3DL, and 4D.

  13. Stem rust resistance in a geographically diverse collection of spring wheat lines collected from across Africa

    Directory of Open Access Journals (Sweden)

    Lesley Ann Boyd

    2016-07-01

    Full Text Available Following the emergence of the Ug99 lineage of Puccinia graminis f. sp. tritici (Pgt a collective international effort has been undertaken to identify new sources of wheat stem rust resistance effective against these races. Analyses were undertaken in a collection of wheat genotypes gathered from across Africa to identify stem rust resistance effective against the Pgt races found in Eastern and Southern Africa. The African wheat collection consisted of historic genotypes collected in Kenya, South Africa, Ethiopia, Sudan, Zambia, Morocco and Tunisia, and current South African breeding lines. Both Bayesian cluster and principal coordinate analyses placed the wheat lines from Sudan in a distinct group, but indicated a degree of genetic relatedness among the other wheat lines despite originating from countries across Africa. Seedling screens with Pgt race PTKST, pedigree information and marker haplotype analysis confirmed the presence of Sr2, Sr36, Sr24, Sr31 and Lr34/Yr18/Sr57 in a number of the lines. A genome-wide association study (GWAS undertaken with Diversity Arrays Technology (DArT and stem rust (Sr gene associated markers and Stem Area Infected (SAI and Reaction Type (RT field phenotypes, collected from trials carried out across two seasons in Kenya in 2009 and in South Africa in 2011, identified 29 marker-trait associations (MTA. Three MTA were in common between SAI and RT, with the biggest effect MTA being found on chromosome 6AS. Two wheat lines, W1406 and W6979 that exhibited high levels of adult plant stem rust resistance were selected to generate bi-parental mapping populations. Only the MTA on chromosomes 6AS and 3BS, and the locus Lr34/Yr18/Sr57 were confirmed following QTL mapping. Additional stem rust resistance QTL, not detected by the GWAS, were found on chromosomes 2BS, 2DL, 3DL and 4D.

  14. Seedling Resistance to Stem Rust and Molecular Marker Analysis of Resistance Genes in Wheat Cultivars of Yunnan, China.

    Science.gov (United States)

    Li, Tian Ya; Cao, Yuan Yin; Wu, Xian Xin; Xu, Xiao Feng; Wang, Wan Lin

    2016-01-01

    Stem rust is one of the most potentially harmful wheat diseases, but has been effectively controlled in China since 1970s. However, the interest in breeding wheat with durable resistance to stem rust has been renewed with the emergence of Ug99 (TTKSK) virulent to the widely used resistance gene Sr31, and by which the wheat stem rust was controlled for 40 years in wheat production area worldwide. Yunnan Province, located on the Southwest border of China, is one of the main wheat growing regions, playing a pivotal role in the wheat stem rust epidemic in China. This study investigated the levels of resistance in key wheat cultivars (lines) of Yunnan Province. In addition, the existence of Sr25, Sr26, Sr28, Sr31, Sr32, and Sr38 genes in 119 wheat cultivars was assessed using specific DNA markers. The results indicated that 77 (64.7%) tested wheat varieties showed different levels of resistance to all the tested races of Puccinia graminis f. sp. tritici. Using molecular markers, we identified the resistance gene Sr31 in 43 samples; Sr38 in 10 samples; Sr28 in 12 samples, and one sample which was resistant against Ug99 (avirulent to Sr32). No Sr25 or Sr26 (effective against Ug99) was identified in any cultivars tested. Furthermore, 5 out of 119 cultivars tested carried both Sr31 and Sr38 and eight contained both Sr31 and Sr28. The results enable the development of appropriate strategies to breed varieties resistant to stem rust.

  15. Seedling Resistance to Stem Rust and Molecular Marker Analysis of Resistance Genes in Wheat Cultivars of Yunnan, China.

    Directory of Open Access Journals (Sweden)

    Tian Ya Li

    Full Text Available Stem rust is one of the most potentially harmful wheat diseases, but has been effectively controlled in China since 1970s. However, the interest in breeding wheat with durable resistance to stem rust has been renewed with the emergence of Ug99 (TTKSK virulent to the widely used resistance gene Sr31, and by which the wheat stem rust was controlled for 40 years in wheat production area worldwide. Yunnan Province, located on the Southwest border of China, is one of the main wheat growing regions, playing a pivotal role in the wheat stem rust epidemic in China. This study investigated the levels of resistance in key wheat cultivars (lines of Yunnan Province. In addition, the existence of Sr25, Sr26, Sr28, Sr31, Sr32, and Sr38 genes in 119 wheat cultivars was assessed using specific DNA markers. The results indicated that 77 (64.7% tested wheat varieties showed different levels of resistance to all the tested races of Puccinia graminis f. sp. tritici. Using molecular markers, we identified the resistance gene Sr31 in 43 samples; Sr38 in 10 samples; Sr28 in 12 samples, and one sample which was resistant against Ug99 (avirulent to Sr32. No Sr25 or Sr26 (effective against Ug99 was identified in any cultivars tested. Furthermore, 5 out of 119 cultivars tested carried both Sr31 and Sr38 and eight contained both Sr31 and Sr28. The results enable the development of appropriate strategies to breed varieties resistant to stem rust.

  16. Tagging and mapping of SSR marker for rust resistance gene in lentil (Lens culinaris Medikus subsp. culinaris).

    Science.gov (United States)

    Dikshit, H K; Singh, Akanksha; Singh, D; Aski, M; Jain, Neelu; Hegde, V S; Basandrai, A K; Basandrai, D; Sharma, T R

    2016-06-01

    Lentil, as an economical source of protein, minerals and vitamins, plays important role in nutritional security of the common man. Grown mainly in West Asia, North Africa (WANA) region and South Asia, it suffers from several biotic stresses such as wilt, rust, blight and broomrape. Lentil rust caused by autoecious fungus Uromyces viciae fabae (Pers.) Schroet is a serious lentil disease in Algeria, Bangladesh, Ethiopia, India, Italy, Morocco, Pakistan and Nepal. The disease symptoms are observed during flowering and early podding stages. Rust causes severe yield losses in lentil. It can only be effectively controlled by identifying the resistant source, understanding its inheritance and breeding for host resistance. The obligate parasitic nature of pathogen makes it difficult to maintain the pathogen in culture and to apply it to screen segregating progenies under controlled growth conditions. Hence, the use of molecular markers will compliment in identification of resistant types in different breeding programs. Here, we studied the inheritance of resistance to rust in lentil using F₁, F₂ and F₂:₃ from cross PL 8 (susceptible) x L 4149 (resistant) varieties. The phenotyping of lentil population was carried out at Sirmour, India. The result of genetic analysis revealed that a single dominant gene controls rust resistance in lentil genotype L 4149. The F2 population from this cross was used to tag and map the rust resistance gene using SSR and SRAP markers. Markers such as 270 SRAP and 162 SSR were studied for polymorphism and 101 SRAP and 33 SSRs were found to be polymorphic between the parents. Two SRAP and two SSR markers differentiated the resistant and susceptible bulks. SSR marker Gllc 527 was estimated to be linked to rust resistant locus at a distance of 5.9 cM. The Gllc 527 marker can be used for marker assisted selection for rust resistance; however, additional markers closer to rust resistant locus are required. The markers linked to the rust

  17. Association mapping of stem rust race TTKSK resistance in US barley breeding germplasm.

    Science.gov (United States)

    Zhou, H; Steffenson, B J; Muehlbauer, Gary; Wanyera, Ruth; Njau, Peter; Ndeda, Sylvester

    2014-06-01

    Loci conferring resistance to the highly virulent African stem rust race TTKSK were identified in advanced barley breeding germplasm and positioned to chromosomes 5H and 7H using an association mapping approach. African races of the stem rust pathogen (Puccinia graminis f. sp. tritici) are a serious threat to barley production worldwide because of their wide virulence. To discover and characterize resistance to African stem rust race TTKSK in US barley breeding germplasm, over 3,000 lines/cultivars were assessed for resistance at the seedling stage in the greenhouse and also the adult plant stage in the field in Kenya. Only 12 (0.3 %) and 64 (2.1 %) lines exhibited a resistance level comparable to the resistant control at the seedling and adult plant stage, respectively. To map quantitative trait loci (QTL) for resistance to race TTKSK, an association mapping approach was conducted, utilizing 3,072 single nucleotide polymorphism (SNP) markers. At the seedling stage, two neighboring SNP markers (0.8 cM apart) on chromosome 7H (11_21491 and 12_30528) were found significantly associated with resistance. The most significant one found was 12_30528; thus, the resistance QTL was named Rpg-qtl-7H-12_30528. At the adult plant stage, two SNP markers on chromosome 5H (11_11355 and 12_31427) were found significantly associated with resistance. This resistance QTL was named Rpg-qtl-5H-11_11355 for the most significant marker identified. Adult plant resistance is of paramount importance for stem rust. The marker associated with Rpg-qtl-5H-11_11355 for adult plant resistance explained only a small portion of the phenotypic variation (0.02); however, this QTL reduced disease severity up to 55.0 % under low disease pressure and up to 21.1 % under heavy disease pressure. SNP marker 11_11355 will be valuable for marker-assisted selection of adult plant stem rust resistance in barley breeding.

  18. McGISH identification and phenotypic description of leaf rust and yellow rust resistant partial amphiploids originating from a wheat × Thinopyrum synthetic hybrid cross.

    Science.gov (United States)

    Kruppa, Klaudia; Türkösi, Edina; Mayer, Marianna; Tóth, Viola; Vida, Gyula; Szakács, Éva; Molnár-Láng, Márta

    2016-11-01

    A Thinopyrum intermedium × Thinopyrum ponticum synthetic hybrid wheatgrass is an excellent source of leaf and stem rust resistance produced by N.V.Tsitsin. Wheat line Mv9kr1 was crossed with this hybrid (Agropyron glael) in Hungary in order to transfer its advantageous agronomic traits into wheat. As the wheat parent was susceptible to leaf rust, the transfer of resistance was easily recognizable in the progenies. Three different partial amphiploid lines with leaf rust resistance were selected from the wheat/Thinopyrum hybrid derivatives by multicolour genomic in situ hybridization. Chromosome counting on the partial amphiploids revealed 58 chromosomes (18 wheatgrass) in line 194, 56 (14 wheatgrass) in line 195 and 54 (12 wheatgrass) in line 196. The wheat chromosomes present in these lines were identified and the wheatgrass chromosomes were characterized by fluorescence in situ hybridization using the repetitive DNA probes Afa-family, pSc119.2 and pTa71. The 3D wheat chromosome was missing from the lines. Molecular marker analysis showed the presence of the Lr24 leaf rust resistance gene in lines 195 and 196. The morphological traits were evaluated in the field during two consecutive seasons in two different locations.

  19. Pushing the boundaries of resistance: insights from Brachypodium-rust interactions

    Directory of Open Access Journals (Sweden)

    Melania eFigueroa

    2015-07-01

    Full Text Available The implications of global population growth urge transformation of current food and bioenergy production systems to sustainability. Members of the family Poaceae are of particular importance both in food security and for their applications as biofuel substrates. For centuries, rust fungi have threatened the production of valuable crops such as wheat, barley, oat and other small grains; similarly, biofuel crops can also be susceptible to these pathogens. Emerging rust pathogenic races with increased virulence and recurrent rust epidemics around the world point out the vulnerability of monocultures. Basic research in plant immunity, especially in model plants, can make contributions to understanding plant resistance mechanisms and improve disease management strategies. The development of the grass Brachypodium distachyon as a genetically tractable model for monocots, especially temperate cereals and grasses, offers the possibility to overcome the experimental challenges presented by the genetic and genomic complexities of economically valuable crop plants. The numerous resources and tools available in Brachypodium have opened new doors to investigate the underlying molecular and genetic bases of plant-microbe interactions in grasses and evidence demonstrating the applicability and advantages of working with B. distachyon is increasing. Importantly, several interactions between B. distachyon and devastating plant pathogens, such rust fungi, have been examined in the context of non-host resistance. Here, we discuss the use of B. distachyon in these various pathosystems. Exploiting B. distachyon to understand the mechanisms underpinning disease resistance to non-adapted rust fungi may provide effective and durable approaches to fend off these pathogens. The close phylogenetic relationship among Brachypodium spp. and grasses with industrial and agronomic value support harnessing this model plant to improve cropping systems and encourage its use in

  20. Genetic Mapping of SrTm4, a Recessive Stem Rust Resistance Gene from Diploid Wheat Effective to Ug99

    Science.gov (United States)

    Briggs, Jordan; Chen, Shisheng; Zhang, Wenjun; Nelson, Sarah; Dubcovsky, Jorge; Rouse, Matthew N.

    2016-01-01

    Briggs, J., Chen, S., Zhang, W., Nelson, S., Dubcovsky, J., Rouse, M. N. 2015. Genetic Mapping of SrTm4, a Recessive Stem Rust Resistance Gene from Diploid Wheat Effective to Ug99. Phytopathology. PMID:25844826

  1. Evaluation of Genetic Diversity and Host Resistance to Stem Rust in USDA NSGC Durum Wheat Accessions.

    Science.gov (United States)

    Chao, Shiaoman; Rouse, Matthew N; Acevedo, Maricelis; Szabo-Hever, Agnes; Bockelman, Harold; Bonman, J Michael; Elias, Elias; Klindworth, Daryl; Xu, Steven

    2017-07-01

    The USDA-ARS National Small Grains Collection (NSGC) maintains germplasm representing global diversity of small grains and their wild relatives. To evaluate the utility of the NSGC durum wheat ( L. ssp. ) accessions, we assessed genetic diversity and linkage disequilibrium (LD) patterns in a durum core subset containing 429 lines with spring growth habit originating from 64 countries worldwide. Genetic diversity estimated using wheat single-nucleotide polymorphism (SNP) markers showed considerable diversity captured in this collection. Average LD decayed over a genetic distance to within 3 cM at = 0.2, with a fast LD decay for markers linked at >5 cM. We evaluated accessions for resistance to wheat stem rust, caused by a fungal pathogen, Pers. Pers. f. sp. Eriks. and E. Henn (), using races from both eastern Africa and North America, at seedling and adult plant stages. Five accessions were identified as resistant to all stem rust pathogen races evaluated. Genome-wide association analysis detected 17 significant associations at the seedling stage with nine likely corresponding to , , and and the remaining potentially being novel genes located on six chromosomes. A higher frequency of resistant accessions was found at the adult plant stage than at the seedling stage. However, few significant associations were detected possibly a result of strong G × E interactions not properly accounted for in the mixed model. Nonetheless, the resistant accessions identified in this study should provide wheat breeders with valuable resources for improving stem rust resistance. Copyright © 2017 Crop Science Society of America.

  2. Transfer of genes for stem rust resistance from Agropyron elongatum and imperial rye to durum wheat

    International Nuclear Information System (INIS)

    Prabhakara Rao, M.V.

    1977-01-01

    The Agropyron elongatum gene for stem rust resistance on chromosome 6A of Knott's Thatcher translocation line was transferred to a susceptible local durum wheat variety, Jaya, through a series of back-crosses. Plants heterozygous for the Agropyron translocation always show at least one open bivalent. Homozygotes have not been obtained, probably because of the absence of male transmission in durum background. Monotelosomic addition of the short arm of Imperial rye chromosome 3R (formerly ''G'' of Sears), which carries a gene(s) for resistance to wheat stem rust, was obtained in the local durum variety. Rust-resistant plants from parents having the added rye telocentric were irradiated with gamma rays just before meiosis, and the pollen obtained from the irradiated spikes was used to pollinate euploid plants. In addition, seeds harvested from 2n+1 resistant plants were irradiated with thermal neutrons and the resistant M 1 plants were selfed to raise M 2 families. Two durum-rye translocation lines were obtained following irradiation. DRT-1 was transmitted normally through the female gametes but showed no male transmission. As a result of this, homozygotes have not been obtained. Gametic transmission rates of DRT-2 are being tested. Alien translocations, which show normal gametic and zygotic transmissions in the hexaploid wheat, may behave differently in a tetraploid background. The results indicate that alien genetic transfers may be more difficult to obtain in durum wheat, probably owing to the reduced buffering effect of the tetraploid genome. (author)

  3. Rpr1, a gene required for Rpg1-dependent resistance to stem rust in barley.

    Science.gov (United States)

    Zhang, L; Fetch, T; Nirmala, J; Schmierer, D; Brueggeman, R; Steffenson, B; Kleinhofs, A

    2006-09-01

    Rpg1 is a stem rust resistance gene that has protected barley from severe losses for over 60 years in the US and Canada. It confers resistance to many, but not all, pathotypes of the stem rust fungus Puccinia graminis f. sp. tritici. A fast neutron induced deletion mutant, showing susceptibility to stem rust pathotype Pgt-MCC, was identified in barley cv. Morex, which carries Rpg1. Genetic and Rpg1 mRNA and protein expression level analyses showed that the mutation was a suppressor of Rpg1 and was designated Rpr1 (Required for P. graminis resistance). Genome-wide expression profiling, using the Affymetrix Barley1 GeneChip containing approximately 22,840 probe sets, was conducted with Morex and the rpr1 mutant. Of the genes represented on the Barley1 microarray, 20 were up-regulated and 33 were down-regulated by greater than twofold in the mutant, while the Rpg1 mRNA level remained constant. Among the highly down-regulated genes (greater than fourfold), genomic PCR, RT-PCR and Southern analyses identified that three genes (Contig4901_s_at, HU03D17U_s_at, and Contig7061_s_at), were deleted in the rpr1 mutant. These three genes mapped to chromosome 4(4H) bin 5 and co-segregated with the rpr1-mediated susceptible phenotype. The loss of resistance was presumed to be due to a mutation in one or more of these genes. However, the possibility exists that there are other genes within the deletions, which are not represented on the Barley1 GeneChip. The Rpr1 gene was not required for Rpg5- and rpg4-mediated stem rust resistance, indicating that it shows specificity to the Rpg1-mediated resistance pathway.

  4. Genome-wide association study of stem rust resistance in a world collection of cultivated barley.

    Science.gov (United States)

    Case, Austin J; Bhavani, Sridhar; Macharia, Godwin; Steffenson, Brian J

    2018-01-01

    QTL conferring a 14-40% reduction in adult plant stem rust severity to multiple races of Pgt were found on chromosome 5H and will be useful in barley breeding. Stem rust, caused by Puccinia graminis f. sp. tritici (Pgt) is an important disease of barley. The resistance gene Rpg1 has protected the crop against stem rust losses for over 70 years in North America, but is not effective against the African Pgt race TTKSK (and its variants) nor the domestic race QCCJB. To identify resistance to these Rpg1-virulent races, the Barley iCore Collection, held by the United States Department of Agriculture-Agricultural Research Service National Small Grains Collection was evaluated for adult plant resistance (APR) and seedling resistance to race TTKSK and APR to race QCCJB and the Pgt TTKSK composite of races TTKSK, TTKST, TTKTK, and TTKTT. Using a genome-wide association study approach based on 6224 single nucleotide polymorphic markers, seven significant loci for stem rust resistance were identified on chromosomes 1H, 2H, 3H, and 5H. The most significant markers detected were 11_11355 and SCRI_RS_177017 at 71-75 cM on chromosome 5H, conferring APR to QCCJB and TTKSK composite. Significant markers were also detected for TTKSK seedling resistance on chromosome 5H. All markers detected on 5H were independent of the rpg4/Rpg5 complex at 152-168 cM. This study verified the importance of the 11_11355 locus in conferring APR to races QCCJB and TTKSK and suggests that it may be effective against other races in the Ug99 lineage.

  5. Studies on /sup 32/P transport and yellow rust resistance in barley

    Energy Technology Data Exchange (ETDEWEB)

    Schubert, J. (Akademie der Landwirtschaftswissenschaften der DDR, Aschersleben. Inst. fuer Phytopathologie)

    1982-01-01

    Several cultivars of barley (Hordeum vulgare L.) differing in their resistance to yellow rust were used to study the influence of the infection with Puccinia striiformis West. (strain 24) on /sup 32/P transport in intact plants and isolated leaves. Close correlations exist between transport processes and resistance. For example, resistant plants seem to have a more intensive matter transport than susceptible ones. The importance of the rate of transport to the effectiveness of hypothetic inducers of resistance reactions and defence substances is discussed.

  6. Winter wheat susceptibilty to leaf rust and resistance sources to diseases

    Directory of Open Access Journals (Sweden)

    Jerzy Chełkowski

    2012-12-01

    Full Text Available Winter wheat cultivars were significantly infected by Puccinia triticina causing leaf rust in seasons 2000-2002 in southern and also central regions of Poland. Resistance genes Lr9, Lr19 and Lr24 were found to be effective against dominating populations of the pathogen and typical isolates of P. triticina. Mentioned three resistance genes as well as genes Lr10 and Lr37 were identified using STS (Sequence Tagged Site DNA - PCR markers in cultivars and resistance sources. Mentioned markers were found very useful in resistance breeding of wheat.

  7. Identifying Quantitative Trait Loci (QTLs) and Developing Diagnostic Markers Linked to Orange Rust Resistance in Sugarcane (Saccharum spp.).

    Science.gov (United States)

    Yang, Xiping; Islam, Md S; Sood, Sushma; Maya, Stephanie; Hanson, Erik A; Comstock, Jack; Wang, Jianping

    2018-01-01

    Sugarcane ( Saccharum spp.) is an important economic crop, contributing up to 80% of table sugar used in the world and has become a promising feedstock for biofuel production. Sugarcane production has been threatened by many diseases, and fungicide applications for disease control have been opted out for sustainable agriculture. Orange rust is one of the major diseases impacting sugarcane production worldwide. Identifying quantitative trait loci (QTLs) and developing diagnostic markers are valuable for breeding programs to expedite release of superior sugarcane cultivars for disease control. In this study, an F 1 segregating population derived from a cross between two hybrid sugarcane clones, CP95-1039 and CP88-1762, was evaluated for orange rust resistance in replicated trails. Three QTLs controlling orange rust resistance in sugarcane (qORR109, qORR4 and qORR102) were identified for the first time ever, which can explain 58, 12 and 8% of the phenotypic variation, separately. We also characterized 1,574 sugarcane putative resistance ( R ) genes. These sugarcane putative R genes and simple sequence repeats in the QTL intervals were further used to develop diagnostic markers for marker-assisted selection of orange rust resistance. A PCR-based Resistance gene-derived maker, G1 was developed, which showed significant association with orange rust resistance. The putative QTLs and marker developed in this study can be effectively utilized in sugarcane breeding programs to facilitate the selection process, thus contributing to the sustainable agriculture for orange rust disease control.

  8. Pathotype-specific QTL for stem rust resistance in Lolium perenne.

    Science.gov (United States)

    Pfender, W F; Slabaugh, M E

    2013-05-01

    A genetic map populated with RAD and SSR markers was created from F1 progeny of a stem rust-susceptible and stem rust-resistant parent of perennial ryegrass (Lolium perenne). The map supplements a previous map of this population by having markers in common with several other Lolium spp. maps including EST-SSR anchor markers from a consensus map published by other researchers. A QTL analysis was conducted with disease severity and infection type data obtained by controlled inoculation of the population with each of two previously characterized pathotypes of Puccinia graminis subsp. graminicola that differ in virulence to different host plant genotypes in the F1 population. Each pathotype activated a specific QTL on one linkage group (LG): qLpPg1 on LG7 for pathotype 101, or qLpPg2 on LG1 for pathotype 106. Both pathotypes also activated a third QTL in common, qLpPg3 on LG6. Anchor markers, present on a consensus map, were located in proximity to each of the three QTL. These QTL had been detected also in previous experiments in which a genetically heterogeneous inoculum of the stem rust pathogen activated all three QTL together. The results of this and a previous study are consistent with the involvement of the pathotype-specific QTL in pathogen recognition and the pathotype-nonspecific QTL in a generalized resistance response. By aligning the markers common to other published reports, it appears that two and possibly all three of the stem rust QTL reported here are in the same general genomic regions containing some of the L. perenne QTL reported to be activated in response to the crown rust pathogen (P. coronata).

  9. Flavonoid Accumulation Plays an Important Role in the Rust Resistance of Malus Plant Leaves

    Directory of Open Access Journals (Sweden)

    Yanfen Lu

    2017-07-01

    Full Text Available Cedar-apple rust (Gymnosporangium yamadai Miyabe is a fungal disease that causes substantial injury to apple trees and results in fruit with reduced size and quality and a lower commercial value. The molecular mechanisms underlying the primary and secondary metabolic effects of rust spots on the leaves of Malus apple cultivars are poorly understood. Using HPLC, we found that the contents of flavonoid compounds, especially anthocyanin and catechin, were significantly increased in rust-infected symptomatic tissue (RIT. The expression levels of structural genes and MYB transcription factors related to flavonoid biosynthesis were one- to seven-fold higher in the RIT. Among these genes, CHS, DFR, ANS, FLS and MYB10 showed more than a 10-fold increase, suggesting that these genes were expressed at significantly higher levels in the RIT. Hormone concentration assays showed that the levels of abscisic acid (ABA, ethylene (ETH, jasmonate (JA and salicylic acid (SA were higher in the RIT and were consistent with the expression levels of McNCED, McACS, McLOX and McNPR1, respectively. Our study explored the complicated crosstalk of the signal transduction pathways of ABA, ETH, JA and SA; the primary metabolism of glucose, sucrose, fructose and sorbitol; and the secondary metabolism of flavonoids involved in the rust resistance of Malus crabapple leaves.

  10. Induced mutants in beans and peas resistant to rust

    International Nuclear Information System (INIS)

    Fadl, F.A.M.

    1983-01-01

    Beans (Phaseolus vulgaris) and peas (Pisum sativum) are important leguminous vegetable crops in Egypt. The area planted with beans is about 40,000 acres and peas 22,000 acres. These crops suffer from several diseases, particularly rusts, (Uromyces phaseoli/Uromyces pisi), which are mainly spread in northern Egypt. In our mutation induction programme we used 60 Co gamma rays and ethyl methane sulphonate (EMS). Bean and pea seeds were soaked in water for two hours before exposure to 8, 10 and 12 krad. For chemical treatments, bean and pea seeds were soaked in water for eight hours and then treated with 0.5 and 1.5% EMS for four hours. The M 1 was cultivated in 1978

  11. Association analysis of stem rust resistance in U.S. winter wheat.

    Science.gov (United States)

    Zhang, Dadong; Bowden, Robert L; Yu, Jianming; Carver, Brett F; Bai, Guihua

    2014-01-01

    Stem rust has become a renewed threat to global wheat production after the emergence and spread of race TTKSK (also known as Ug99) and related races from Africa. To elucidate U.S. winter wheat resistance genes to stem rust, association mapping was conducted using a panel of 137 lines from cooperative U.S. winter wheat nurseries from 2008 and simple sequence repeat (SSR) and sequence tagged site (STS) markers across the wheat genome. Seedling infection types were evaluated in a greenhouse experiment using six U.S. stem rust races (QFCSC, QTHJC, RCRSC, RKQQC, TPMKC and TTTTF) and TTKSK, and adult plant responses to bulked U.S. races were evaluated in a field experiment. A linearization algorithm was used to convert the qualitative Stakman scale seedling infection types for quantitative analysis. Association mapping successfully detected six known stem rust seedling resistance genes in U.S. winter wheat lines with frequencies: Sr6 (12%), Sr24 (9%), Sr31 (15%), Sr36 (9%), Sr38 (19%), and Sr1RSAmigo (8%). Adult plant resistance gene Sr2 was present in 4% of lines. SrTmp was postulated to be present in several hard winter wheat lines, but the frequency could not be accurately determined. Sr38 was the most prevalent Sr gene in both hard and soft winter wheat and was the most effective Sr gene in the adult plant field test. Resistance to TTKSK was associated with nine markers on chromosome 2B that were in linkage disequilibrium and all of the resistance was attributed to the Triticum timopheevii chromosome segment carrying Sr36. Potential novel rust resistance alleles were associated with markers Xwmc326-203 on 3BL, Xgwm160-195 and Xwmc313-225 on 4AL near Sr7, Xgwm495-182 on 4BL, Xwmc622-147 and Xgwm624-146 on 4DL, and Xgwm334-123 on 6AS near Sr8. Xwmc326-203 was associated with adult plant resistance to bulked U.S. races and Xgwm495-182 was associated with seedling resistance to TTKSK.

  12. Association analysis of stem rust resistance in U.S. winter wheat.

    Directory of Open Access Journals (Sweden)

    Dadong Zhang

    Full Text Available Stem rust has become a renewed threat to global wheat production after the emergence and spread of race TTKSK (also known as Ug99 and related races from Africa. To elucidate U.S. winter wheat resistance genes to stem rust, association mapping was conducted using a panel of 137 lines from cooperative U.S. winter wheat nurseries from 2008 and simple sequence repeat (SSR and sequence tagged site (STS markers across the wheat genome. Seedling infection types were evaluated in a greenhouse experiment using six U.S. stem rust races (QFCSC, QTHJC, RCRSC, RKQQC, TPMKC and TTTTF and TTKSK, and adult plant responses to bulked U.S. races were evaluated in a field experiment. A linearization algorithm was used to convert the qualitative Stakman scale seedling infection types for quantitative analysis. Association mapping successfully detected six known stem rust seedling resistance genes in U.S. winter wheat lines with frequencies: Sr6 (12%, Sr24 (9%, Sr31 (15%, Sr36 (9%, Sr38 (19%, and Sr1RSAmigo (8%. Adult plant resistance gene Sr2 was present in 4% of lines. SrTmp was postulated to be present in several hard winter wheat lines, but the frequency could not be accurately determined. Sr38 was the most prevalent Sr gene in both hard and soft winter wheat and was the most effective Sr gene in the adult plant field test. Resistance to TTKSK was associated with nine markers on chromosome 2B that were in linkage disequilibrium and all of the resistance was attributed to the Triticum timopheevii chromosome segment carrying Sr36. Potential novel rust resistance alleles were associated with markers Xwmc326-203 on 3BL, Xgwm160-195 and Xwmc313-225 on 4AL near Sr7, Xgwm495-182 on 4BL, Xwmc622-147 and Xgwm624-146 on 4DL, and Xgwm334-123 on 6AS near Sr8. Xwmc326-203 was associated with adult plant resistance to bulked U.S. races and Xgwm495-182 was associated with seedling resistance to TTKSK.

  13. IPR 107 – Dwarf arabic coffee cultivar with resistance to coffee leaf rust

    Directory of Open Access Journals (Sweden)

    Tumoru Sera

    2013-01-01

    Full Text Available ‘IPR 107’ was derived from a cross between ‘IAPAR 59’ and ‘Mundo Novo IAC 376-4’. ‘IPR 107’ is a dwarf medium sizeplant with medium precocity in ripening and with complete resistance to rust races in this time. This cultivar presents superior qualityand high yield in many coffee regions.

  14. SH1 leaf rust and bacterial halo blight coffee resistances are genetically independent

    Directory of Open Access Journals (Sweden)

    Lucas Mateus Rivero Rodrigues

    Full Text Available ABSTRACT Coffee resistance to Pseudomonas syringae pv. garcae has been associated to pleiotropic effect of SH1 allele, present in coffee plants resistant to certain races of Hemileia vastatrix, the causal agent of leaf rust, or genetic linkage between resistance alleles to both pathogens. To validate this hypothesis, 63 coffee plants in F2 generation were evaluated for resistance to 2 isolates of H. vastatrix carriers of alleles, respectively, v2, v5 (isolate I/2015 and v1; v2; v5 (isolate II/2015 with the objective to confirm presence of SH1 allele in resistant plants to isolate I/2015. The same coffee plants were evaluated for resistance to a mixture of P. syringae pv. garcae strains highly pathogenic to coffee. Results showed that, among F2 coffee allele SH1 carriers, resistant to isolate I/2015, resistant and susceptible plants to bacterial halo blight were found; the same segregation occurs between F2 homozygous for SH1 allele, susceptible to the same isolate (I/2015 of H. vastatrix. Results also indicate that there is no pleiotropic effect of gene or allele SH1 connection between genes conferring resistance to leaf rust caused by H. vastatrix and bacterial halo blight caused by P. syringae pv. garcae.

  15. White pine blister rust resistance in limber pine: evidence for a major gene.

    Science.gov (United States)

    Schoettle, A W; Sniezko, R A; Kegley, A; Burns, K S

    2014-02-01

    Limber pine (Pinus flexilis) is being threatened by the lethal disease white pine blister rust caused by the non-native pathogen Cronartium ribicola. The types and frequencies of genetic resistance to the rust will likely determine the potential success of restoration or proactive measures. These first extensive inoculation trials using individual tree seed collections from >100 limber pine trees confirm that genetic segregation of a stem symptom-free trait to blister rust is consistent with inheritance by a single dominant resistance (R) gene, and the resistance allele appears to be distinct from the R allele in western white pine. Following previous conventions, we are naming the R gene for limber pine "Cr4." The frequency of the Cr4 allele across healthy and recently invaded populations in the Southern Rocky Mountains was unexpectedly high (5.0%, ranging from 0 to 13.9%). Cr4 is in equilibrium, suggesting that it is not a product of a recent mutation and may have other adaptive significance within the species, possibly related to other abiotic or biotic stress factors. The identification of Cr4 in native populations of limber pine early in the invasion progress in this region provides useful information for predicting near-term impacts and structuring long-term management strategies.

  16. Adaptability and stability of soybean advanced lines of semi early cycle for rust resistance

    Directory of Open Access Journals (Sweden)

    Juliana Araújo Santos Martins

    2012-01-01

    Full Text Available This research work was carried out to verify the adaptability and phenotypic stability of soybean inbred lines of semi early cycle, using rust severity as the selection trait for partial resistance. The strains were evaluated during the growing seasons of 2007/08 and 2008/09, in the locations of Uberlândia and Uberaba, MG, Campo Alegre de Goiás and Senador Canedo, GO, using a randomized complete block design with three replications. Rust severity was evaluated by visual assessment of the leaflets at the medial third of five plants in each plot. By using disease severity, it was estimated: the mean absolute rate of disease progress (r, the area under the disease progress curve (AUDPC and the partial resistance factor (PRF. Adaptability and stability of the strains were estimated by the methods proposed by Eberhart and Russell, as well as by the AMMI method. It was found that the strains which were the most resistant to rust, in general, also showed the best adaptability and stability.

  17. A pigeonpea gene confers resistance to Asian soybean rust in soybean.

    Science.gov (United States)

    Kawashima, Cintia G; Guimarães, Gustavo Augusto; Nogueira, Sônia Regina; MacLean, Dan; Cook, Doug R; Steuernagel, Burkhard; Baek, Jongmin; Bouyioukos, Costas; Melo, Bernardo do V A; Tristão, Gustavo; de Oliveira, Jamile Camargos; Rauscher, Gilda; Mittal, Shipra; Panichelli, Lisa; Bacot, Karen; Johnson, Ebony; Iyer, Geeta; Tabor, Girma; Wulff, Brande B H; Ward, Eric; Rairdan, Gregory J; Broglie, Karen E; Wu, Gusui; van Esse, H Peter; Jones, Jonathan D G; Brommonschenkel, Sérgio H

    2016-06-01

    Asian soybean rust (ASR), caused by the fungus Phakopsora pachyrhizi, is one of the most economically important crop diseases, but is only treatable with fungicides, which are becoming less effective owing to the emergence of fungicide resistance. There are no commercial soybean cultivars with durable resistance to P. pachyrhizi, and although soybean resistance loci have been mapped, no resistance genes have been cloned. We report the cloning of a P. pachyrhizi resistance gene CcRpp1 (Cajanus cajan Resistance against Phakopsora pachyrhizi 1) from pigeonpea (Cajanus cajan) and show that CcRpp1 confers full resistance to P. pachyrhizi in soybean. Our findings show that legume species related to soybean such as pigeonpea, cowpea, common bean and others could provide a valuable and diverse pool of resistance traits for crop improvement.

  18. Mapping and characterization of the new adult plant leaf rust resistance gene Lr77 derived from Santa Fe winter wheat.

    Science.gov (United States)

    Kolmer, James A; Su, Zhenqi; Bernardo, Amy; Bai, Guihua; Chao, Shiaoman

    2018-04-25

    A new gene for adult plant leaf rust resistance in wheat was mapped to chromosome 3BL. This gene was designated as Lr77. 'Santa Fe' is a hard red winter cultivar that has had long-lasting resistance to the leaf rust fungus, Puccinia triticina. The objective of this study was to determine the chromosome location of the adult plant leaf rust resistance in Santa Fe wheat. A partial backcross line of 'Thatcher' (Tc) wheat with adult plant leaf rust resistance derived from Santa Fe was crossed with Thatcher to develop a Thatcher//Tc*2/Santa Fe F 6 recombinant inbred line (RIL) population. The RIL population and parental lines were evaluated for segregation of leaf rust resistance in three field plot tests and in an adult plant greenhouse test. A genetic map of the RIL population was constructed using 90,000 single-nucleotide polymorphism (SNP) markers with the Illumina Infinium iSelect 90K wheat bead array. A significant quantitative trait locus for reduction of leaf rust severity in all four tests was found on chromosome 3BL that segregated as a single adult plant resistance gene. The RILs with the allele from the resistant parent for SNP marker IWB10344 had lower leaf rust severity and a moderately resistant to moderately susceptible response compared to the susceptible RILs and Thatcher. The gene derived from Santa Fe on chromosome 3BL was designated as Lr77. Kompetitive allele-specific polymerase chain reaction assay markers linked to Lr77 on 3BL should be useful for selection of wheat germplasm with this gene.

  19. Cellular and molecular characterization of a stem rust resistance locus on wheat chromosome 7AL.

    Science.gov (United States)

    Pujol, Vincent; Robles, Jose; Wang, Penghao; Taylor, Jen; Zhang, Peng; Huang, Li; Tabe, Linda; Lagudah, Evans

    2016-12-07

    Wheat stem rust, caused by Puccinia graminis f. sp. tritici, is a major wheat disease which is mainly controlled through the release of resistant cultivars containing one or several resistance genes. Considerable effort has been put into the discovery of new resistance genes, but knowledge of their mechanisms of action is often lacking. In this study, the mechanism of resistance conferred by a recently discovered stem rust resistance locus on wheat chromosome 7AL was investigated through microscopic observations and RNA-sequencing, using the susceptible line Columbus and the independent, backcrossed, resistant lines Columbus-NS765 and Columbus-NS766. Microscopic observations of infected leaves revealed that the resistance conferred by the 7AL resistance locus was initiated 2 days post-inoculation, upon the fungus entry into the plant through the stoma. Resistance was manifested by death of guard and epidermal cells adjacent to an infection site. Occasionally, similar observations were made in the susceptible line, suggesting that the resistance response was the same in all genotypes, but enhanced in the resistant lines. Transcriptomic analysis, combined with assignment of genes to wheat chromosomes, revealed a disproportionately high number of differentially expressed genes were located on chromosomes 7AL and 6A. A number of genes annotated as cysteine-rich receptor-like kinases were located on chromosome 7AL. Closer investigation indicated that the encoded proteins were in fact putative receptor-like cytoplasmic kinases. One of the putative RLCK genes contained a SNP marker previously shown to co-segregate with the 7AL resistance locus. The results also indicated the presence of a large introgression on chromosome 6A in both resistant lines, but whether it has any role in the resistance response is unclear. This study represents the first investigation on the resistance mechanism conferred by the wheat 7AL stem rust resistance locus. The resistance response was

  20. Molecular mapping of a stripe rust resistance gene in wheat line C51

    Indian Academy of Sciences (India)

    2014-08-18

    Aug 18, 2014 ... McIntosh R. A., Dubcovsky J., Rogers W. J., Morris C., Appels R. and Xia X. C. 2010 Catalogue of gene symbols for wheat: 2010. Supplement. Annu. Wheat Newslett. 56, 273–282. McIntosh R. A., Yamazaki Y., Dubcovsky J., Rogers J., Morris C.,. Somers D. J. et al. 2008 Catalogue of gene symbols for wheat ...

  1. Genetic analysis and location of gene for resistance to stripe rust in ...

    Indian Academy of Sciences (India)

    2013-08-06

    Aug 6, 2013 ... anchor qualitative characteristics, so the gene can be directly located on the wheat genetic map. Also, the sequences of. SSR primers are open for easy genome research applica- tion and have become second-generation molecular markers. (Gupta et al. 2002), and play an important role in the wheat.

  2. Allelic variation at loci controlling stripe rust resistance in spring wheat

    Indian Academy of Sciences (India)

    2014-08-20

    Aug 20, 2014 ... 1Department of Plant Genomics & Biotechnology, PARC Institute of Advanced Studies in Agriculture, National Agricultural. Research Centre, Islamabad 45500, Pakistan. 2National Institute for Genomics & Advanced Biotechnology, National Agricultural Research Centre,. Park Road, Islamabad 45500, ...

  3. Allelic variation at loci controlling stripe rust resistance in spring wheat

    Indian Academy of Sciences (India)

    ... Studies in Agriculture, National Agricultural Research Centre, Islamabad 45500, Pakistan; National Institute for Genomics & Advanced Biotechnology, National Agricultural Research Centre, Park Road, Islamabad 45500, Pakistan; Department of Agricultural, Food and Nutritional Science, University of Alberta, Edmonton, ...

  4. Molecular mapping of a stripe rust resistance gene in wheat line C51

    Indian Academy of Sciences (India)

    2014-08-18

    Aug 18, 2014 ... markers.Among them, one STS marker, C51STS-4, was located at a genetic distance of 1.4 cM to YrC51 and was closely ..... 118. Horticulture Australia, Christchurch, New. Zealand. Fu D. L., Cristobal U., Assaf D., Ann B., Lynn E., Chen X. M. et al. 2009 A Kinase-START gene confers temperature dependent.

  5. Allelic variation at loci controlling stripe rust resistance in spring wheat

    Indian Academy of Sciences (India)

    ... National Agricultural Research Centre, Islamabad 45500, Pakistan; National Institute for Genomics & Advanced Biotechnology, National Agricultural Research Centre, Park Road, Islamabad 45500, Pakistan; Department of Agricultural, Food and Nutritional Science, University of Alberta, Edmonton, AB T6G 2P5, Canada ...

  6. Molecular mapping of stripe rust resistance gene Yr51 in chromosome 4AL of wheat

    Czech Academy of Sciences Publication Activity Database

    Randhawa, M.; Bansal, U.; Valárik, Miroslav; Klocová, Barbora; Doležel, Jaroslav; Bariana, H.

    2014-01-01

    Roč. 127, č. 2 (2014), s. 317-324 ISSN 0040-5752 R&D Projects: GA ČR GAP501/10/1740; GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : TRITICUM-AESTIVUM L. * DIVERSITY ARRAYS * MAP Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.790, year: 2014

  7. Allelic variation at loci controlling stripe rust resistance in spring wheat

    Indian Academy of Sciences (India)

    2014-08-20

    Aug 20, 2014 ... (2012) for the detection of Yr9 and Sr31 in Pakistani wheat varieties. Similarly, Pretorius et al. (2012) also used iag95 to detect Sr31 in African wheat. These studies indicated the reliability of marker iag95. Although this marker has been proved diagnostic, it can- not be used to differentiate the heterozygotes ...

  8. Control of Fe(O,OH)6 nano-network structures of rust for high atmospheric-corrosion resistance

    International Nuclear Information System (INIS)

    Kimura, Masao; Kihira, Hiroshi; Ohta, Noriaki; Hashimoto, Misao; Senuma, Takehide

    2005-01-01

    A new-type of weathering steel containing 3.0 mass% Ni and 0.4 mass% Cu ('advanced weathering steel') exhibits good atmospheric-corrosion resistance in an atmosphere containing relatively high air-born salinity. Here, we show that the high performance was successfully achieved by controlling Fe(O,OH) 6 nano-network structures of rust formed on their surfaces. A novel technique using synchrotron radiation has been developed for the in situ observation of rust-formation during wet-dry cycles. It has been revealed that the evolution of Fe(O,OH) 6 nano-network structures of rust formed on the advanced weathering steel was more unique than those of conventional weathering steel and mild steel. At an early stage of reaction, Fe 2 NiO 4 and CuO phases precipitate, which provide sites for the nucleation of the Fe(O,OH) 6 nano-network resulting in the formation of rust composed of fine and dense-packed grains. The existence of Fe 2 NiO 4 in the nano-network changes the ion-exchanging properties of rust from anion to cation selective. Then, the rust on the advanced weathering steel 'breathes out' chloride ions from the rust/steel interface, and protects steel for more than a century by reducing the life cycle maintenance cost in an environment-friendly manner

  9. Constructing high-density genetic maps for polyploid sugarcane (Saccharum spp.) and identifying quantitative trait loci controlling brown rust resistance

    Science.gov (United States)

    Sugarcane (Saccharum spp.) is an important economic crop for producing edible sugar and bioethanol. Brown rust had long been a major disease impacting sugarcane production world widely. Resistance resource and markers linked to the resistance are valuable tools for disease resistance improvement. An...

  10. Transcriptome analyses and virus induced gene silencing identify genes in the Rpp4-mediated Asian soybean rust resistance pathway

    Science.gov (United States)

    Rpp4 (Resistance to Phakopsora pachyrhizi 4) confers resistance to P. pachyrhizi, the causal agent of Asian soybean rust (ASR). By combining expression profiling and virus induced gene silencing (VIGS), we are developing a genetic framework for Rpp4-mediated resistance. We measured gene expression i...

  11. Identification of wheat gene Sr35 that confers resistance to Ug99 stem rust race group.

    Science.gov (United States)

    Saintenac, Cyrille; Zhang, Wenjun; Salcedo, Andres; Rouse, Matthew N; Trick, Harold N; Akhunov, Eduard; Dubcovsky, Jorge

    2013-08-16

    Wheat stem rust, caused by Puccinia graminis f. sp. tritici (Pgt), is a devastating disease that can cause severe yield losses. A previously uncharacterized Pgt race, designated Ug99, has overcome most of the widely used resistance genes and is threatening major wheat production areas. Here, we demonstrate that the Sr35 gene from Triticum monococcum is a coiled-coil, nucleotide-binding, leucine-rich repeat gene that confers near immunity to Ug99 and related races. This gene is absent in the A-genome diploid donor and in polyploid wheat but is effective when transferred from T. monococcum to polyploid wheat. The cloning of Sr35 opens the door to the use of biotechnological approaches to control this devastating disease and to analyses of the molecular interactions that define the wheat-rust pathosystem.

  12. Identification of a soybean rust resistance gene in PI 567104B.

    Science.gov (United States)

    Liu, Min; Li, Shuxian; Swaminathan, Sivakumar; Sahu, Binod B; Leandro, Leonor F; Cardinal, Andrea J; Bhattacharyya, Madan K; Song, Qijian; Walker, David R; Cianzio, Silvia R

    2016-05-01

    Using a combination of phenotypic screening and molecular, statistical, and linkage analyses, we have mapped a dominant soybean rust resistance gene in soybean PI 567104B. Asian soybean rust (SBR), caused by the fungus Phakopsora pachyrhizi Syd. and P. Syd., is one of the most economically important diseases that affect soybean production worldwide. A long-term strategy for minimizing the effects of SBR is the development of genetically resistant cultivars. The objectives of the study were to identify the location of a rust-resistance (Rpp) gene(s) in plant introduction (PI) 567104B, and to determine if the gene(s) in PI 567104B was different from previously mapped Rpp loci. The progeny of the cross of 'IAR 2001 BSR' × PI 567104B was phenotyped from field assays of the F 2:3 and F 4:5 generations and from a growth chamber assay of 253 F 5:6 recombinant inbred lines (RILs). For the growth chamber, the phenotyping was conducted by inoculation with a purified 2006 fungal isolate from Mississippi. A resistance gene locus on PI 567104B was mapped to a region containing the Rpp6 locus on chromosome 18. The high level of resistance of F 1 plants from two other crosses with PI 567104B as one of the parents indicated that the gene from PI 567104B was dominant. The interval containing the gene is flanked by the simple sequence repeat (SSR) markers Satt131 and Satt394, and includes the SSR markers BARCSOYSSR_18_0331 and BARCSOYSSR_18_0380. The results also indicated that the resistance gene from PI 567104B is different from the Rpp1 to the Rpp4 genes previously identified. To determine if the gene from PI 567104B is different from the Rpp6 gene from PI 567102B, additional research will be required.

  13. Introgression of stem rust resistance genes SrTA10187 and SrTA10171 from Aegilops tauschii to wheat.

    Science.gov (United States)

    Olson, Eric L; Rouse, Matthew N; Pumphrey, Michael O; Bowden, Robert L; Gill, Bikram S; Poland, Jesse A

    2013-10-01

    Aegilops tauschii, the diploid progenitor of the wheat D genome, is a readily accessible germplasm pool for wheat breeding as genes can be transferred to elite wheat cultivars through direct hybridization followed by backcrossing. Gene transfer and genetic mapping can be integrated by developing mapping populations during backcrossing. Using direct crossing, two genes for resistance to the African stem rust fungus race TTKSK (Ug99), were transferred from the Ae. tauschii accessions TA10187 and TA10171 to an elite hard winter wheat line, KS05HW14. BC2 mapping populations were created concurrently with developing advanced backcross lines carrying rust resistance. Bulked segregant analysis on the BC2 populations identified marker loci on 6DS and 7DS linked to stem rust resistance genes transferred from TA10187 and TA10171, respectively. Linkage maps were developed for both genes and closely linked markers reported in this study will be useful for selection and pyramiding with other Ug99-effective stem rust resistance genes. The Ae. tauschii-derived resistance genes were temporarily designated SrTA10187 and SrTA10171 and will serve as valuable resources for stem rust resistance breeding.

  14. Breeding wheat mutant Longfu 03D51 with resisting stem rust and genetic analyzation of resisting disease and RAPD maker

    International Nuclear Information System (INIS)

    Sun Yan; Yin Jing; Wang Guangjin; Zhang Hongji; Huang Jinghua; Guo Qiang; Diao Yanling; Liu Dongjun

    2007-01-01

    Longfu 03D51 was bred using Long 6239 immature embryo as explants through radiation mutagenesis breeding coupled with tissue culture technique. By artificial inoculation and field breeding identified Longfu 03D51 was identified with high resistance to dominant strain 21C 3 CPH, good quality and high yield. Genetic analysis suggested that stem rust was controlled by a single gene. The DNA polymorphism on Longfu 03D51 and its parents were studied by random amplified polymorphic DNA (RAPD), 3 primers out of 60 RAPD primers were found polymorphism between the Longfu 03D51 and its parent Long 6239, and 3 stable polyphymorphic bands amplified in Longfu 03D51 with the size of 380bp, 700bp, 600 bp by random primer E07, E11, E17, respectively. Genetic and RAPD analysis indicated that 3 RAPD primers E07, E11, E17 might be linked to the gene of stem rust resistance. (authors)

  15. Genetic mapping of rust resistance genes in confection sunflower line HA-R6 and oilseed line RHA 397.

    Science.gov (United States)

    Gong, L; Gulya, T J; Markell, S G; Hulke, B S; Qi, L L

    2013-08-01

    Few widely effective resistance sources to sunflower rust, incited by Puccinia helianthi Schwein., have been identified in confection sunflower (Helianthus annuus L.). The USDA inbred line HA-R6 is one of the few confection sunflower lines resistant to rust. A previous allelism test indicated that rust resistance genes in HA-R6 and RHA 397, an oilseed-type restorer line, are either allelic or closely linked; however, neither have been characterized nor molecularly mapped. The objectives of this study are (1) to locate the rust resistance genes in HA-R6 and RHA 397 on a molecular map, (2) to develop closely linked molecular markers for rust resistance diagnostics, and (3) to determine the resistance spectrum of two lines when compared with other rust-resistant lines. Two populations of 140 F2:3 families each from the crosses of HA 89, as susceptible parent, with HA-R6 and RHA 397 were inoculated with race 336 of P. helianthi in the greenhouse. The resistance genes (R-genes) in HA-R6 and RHA 397 were molecularly mapped to the lower end of linkage group 13, which encompasses a large R-gene cluster, and were designated as R 13a and R 13b, respectively. In the initial maps, SSR (simple sequence repeat) and InDel (insertion and deletion) markers revealed 2.8 and 8.2 cM flanking regions for R 13a and R 13b, respectively, linked with a common marker set of four co-segregating markers, ORS191, ORS316, ORS581, and ZVG61, in the distal side and one marker ORS464 in the proximal side. To identify new markers closer to the genes, sunflower RGC (resistance gene candidate) markers linked to the downy mildew R-gene Pl 8 and located at the same region as R 13a and R 13b were selected to screen the two F2 populations. The RGC markers RGC15/16 and a newly developed marker SUN14 designed from a BAC contig anchored by RGC251 further narrowed down the region flanking R 13a and R 13b to 1.1 and 0.1 cM, respectively. Both R 13a and R 13b are highly effective against all rust races

  16. Genotype-by-sequencing facilitates genetic mapping of a stem rust resistance locus in Aegilops umbellulata, a wild relative of cultivated wheat

    OpenAIRE

    Edae, Erena A.; Olivera, Pablo D.; Jin, Yue; Poland, Jesse A.; Rouse, Matthew N.

    2016-01-01

    Background Wild relatives of wheat play a significant role in wheat improvement as a source of genetic diversity. Stem rust disease of wheat causes significant yield losses at the global level and stem rust pathogen race TTKSK (Ug99) is virulent to most previously deployed resistance genes. Therefore, the objective of this study was to identify loci conferring resistance to stem rust pathogen races including Ug99 in an Aegilops umbelluata bi-parental mapping population using genotype-by-seque...

  17. Molecular Mapping of Stem Rust Resistance Loci Effective Against the Ug99 Race Group of the Stem Rust Pathogen and Validation of a Single Nucleotide Polymorphism Marker Linked to Stem Rust Resistance Gene Sr28.

    Science.gov (United States)

    Babiker, E M; Gordon, T C; Chao, S; Rouse, M N; Wanyera, R; Acevedo, M; Brown-Guedira, G; Bonman, J M

    2017-02-01

    Wheat landrace PI 177906 has seedling resistance to stem rust caused by Puccinia graminis f. sp. tritici races TTKSK, TTKST, and BCCBC and field resistance to the Ug99 race group. Parents, 140 recombinant inbred lines, and 138 double haploid (DH) lines were evaluated for seedling resistance to races TTKSK and BCCBC. Parents and the DH population were evaluated for field resistance to Ug99 in Kenya. The 90K wheat single nucleotide polymorphism (SNP) genotyping platform was used to genotype the parents and populations. Goodness-of-fit tests indicated that two dominant genes in PI 177906 conditioned seedling resistance to TTKSK. Two major loci for seedling resistance were consistently mapped to the chromosome arms 2BL and 6DS. The BCCBC resistance was mapped to the same location on 2BL as the TTKSK resistance. Using field data from the three seasons, two major QTL were consistently detected at the same regions on 2BL and 6DS. Based on the mapping result, race specificity, and the infection type observed in PI 177906, the TTKSK resistance on 2BL is likely due to Sr28. One SNP marker (KASP_IWB1208) was found to be predictive for the presence of the TTKSK resistance locus on 2BL and Sr28.

  18. Genome Targeted Introgression of Resistance to African Stem Rust fromAegilops sharonensisinto Bread Wheat.

    Science.gov (United States)

    Millet, Eitan; Steffenson, Brian J; Prins, Renée; Sela, Hanan; Przewieslik-Allen, Alexandra M; Pretorius, Zacharias A

    2017-11-01

    Many accessions of the wheat wild relative Sharon goatgrass ( Eig., ) are resistant to African races of the stem rust pathogen (i.e., Ug99 group races), which currently threaten wheat production worldwide. A procedure was designed to introgress the respective resistances to specific bread wheat genomes by producing plants homozygous for the A and B genomes and hemizygous for the D and S genomes or homozygous for the A and D genomes and hemizygous for the B and S genomes. In these genotypes, which lack the allele, homeologous pairing was expected mainly between chromosomes of the D and S genomes or B and S genomes, respectively. An antigametocidal (AG) wheat mutant () was used to overcome gametocidal effects. Wheat lines initially found resistant at the seedling stage were also highly resistant at the adult plant stage in rust nurseries established in the field. DNA of 41 selected homozygous resistant lines, analyzed by the Axiom wheat 820K SNP array, showed alien chromatin mainly in wheat chromosomes 1B, 1D, and 5B. This work suggests that, in most cases, it is possible to target introgressions into the homeologous chromosome of a selected genome of bread wheat. Copyright © 2017 Crop Science Society of America.

  19. Resistance to brown leaf rust of hybrids between wheat and amphiploids wheat-thinopyrum

    Directory of Open Access Journals (Sweden)

    Alexander Lvovivh SECHNYAK

    2011-11-01

    Full Text Available The resistance to a brown leaf rust in 56 chromosomal partial аmphiploids (Triticum aestivum L. × Thinopyrum ponticum (Podp. Z.-W. Liu and R.-C. Wang, РА 2 (Triticum aestivum L. × Thinopyrum intermedium (Host Barkworth and D.R. Devey, H79/9-9 (Triticum aestivum L. × Elymus sp., Triticum aestivum L. cvs. Albatross odesskiy, Fantaziya odesskaya, Zhatva Altaya and their hybrids, F2-F4 were studied at artificial infection in field infectious nursery in 2009, 2010 and 2011. The investigated varieties of wheat have shown a high susceptibility to pathogen. Amphiploids РА 1 and РА 2 also are susceptible to pathogen, but in a lesser degree, than the wheat. Good resistance was shown only by amphiploid Н79/9-9, but its hybrid with wheat Albatross Odessa appeared is susceptible to pathogen. The hybrids with amphiploids РА 1 and РА 2 have shown a various degree of resistance to brown leaf rust. Hybrid Zhatva Altaya × РА 2 within three years stably showed 8 point resistance to disease. The reasonsfor different resistance of amphiploids and its hybrids with wheat are discussed.

  20. Characterization of stem rust resistance gene Sr2 in Indian wheat ...

    African Journals Online (AJOL)

    Stem rust or black rust is one of the most important diseases of wheat worldwide. In India, central, peninsular and southern hill zones are particularly prone to stem rust where favourable environmental conditions exist. The recent emergence of wheat stem rust race Ug99 (TTKSK) and related strains threatens global wheat ...

  1. Genomic Selection for Quantitative Adult Plant Stem Rust Resistance in Wheat

    Directory of Open Access Journals (Sweden)

    Jessica E. Rutkoski

    2014-11-01

    Full Text Available Quantitative adult plant resistance (APR to stem rust ( f. sp. is an important breeding target in wheat ( L. and a potential target for genomic selection (GS. To evaluate the relative importance of known APR loci in applying GS, we characterized a set of CIMMYT germplasm at important APR loci and on a genome-wide profile using genotyping-by-sequencing (GBS. Using this germplasm, we describe the genetic architecture and evaluate prediction models for APR using data from the international Ug99 stem rust screening nurseries. Prediction models incorporating markers linked to important APR loci and seedling phenotype scores as fixed effects were evaluated along with the classic prediction models: Multiple linear regression (MLR, Genomic best linear unbiased prediction (G-BLUP, Bayesian Lasso (BL, and Bayes Cπ (BCπ. We found the region to play an important role in APR in this germplasm. A model using linked markers as fixed effects in G-BLUP was more accurate than MLR with linked markers (-value = 0.12, and ordinary G-BLUP (-value = 0.15. Incorporating seedling phenotype information as fixed effects in G-BLUP did not consistently increase accuracy. Overall, levels of prediction accuracy found in this study indicate that GS can be effectively applied to improve stem rust APR in this germplasm, and if genotypes at linked markers are available, modeling these genotypes as fixed effects could lead to better predictions.

  2. Resistance of some early mutant lines of soybean to rust fungus (Phakospora pachyrhizi Syd)

    International Nuclear Information System (INIS)

    Ratma, Rivaie

    1984-01-01

    A trial for resistance to rust fungus (Phakospora pachyrhizi Syd.) was conducted on 11 early mutant lines of soybean M6 (derived from Orba variety with a dose of 0.4 kGy of Co-60) at Citayam Experimental Station, Bogor, in the wet season of 80/81. Based on IWGSR rating system, soybean mutant lines number M6/40/6 was moderately susceptible to rust fungus (Phakospora pachyrhizi Syd). While 10 other soybean mutant lines M6/40/1, M6/40/2, M6/40/3, M6/40/4, M6/40/5, M6/40/7, M6/40/8, M6/40/9, M6/40/10 and M6/40/11 were susceptible to rust fungus. Significant differences in yield were observed between the early mutant lines M6/40/6 (moderate susceptible), 10 other mutant lines (susceptible) and ringgit variety (susceptible). However, a significant lower yield was produced by those mutant lines compared with the yield of orba variety. (author)

  3. Selection and evaluation of soybean lines derived from gamma irradiation for rust resistance

    International Nuclear Information System (INIS)

    Smutkupt, S.; Wongpiyasatid, A.; Lamseejan, S.

    1983-01-01

    In 1979, seeds of 11 soybean cultivars were gamma irradiated with 15 and 30 krad. Treated and control seeds of each cultivar were planted in the rainy season. In the rainy season of 1980, M 3 populations were screened for rust resistance in Nong Hoi Valley and Mae Joe Experiment Station, both in Chiang Main province. The IWGSR rust rating system was used. Based upon the slow growth of rust on soybean plants, 6 and 115 plants were selected from 2,802 control plants and from 28,824 treated plants, respectively. Selected lines were evaluated in Nong Hoi Valley in the rainy season of 1981. Sixteen selections with average good seed yield per plant and low percentage of shrivelled seeds were obtained. Among them, two lines, namely G8586/Line number 81-1-072 and S.J. 4/Line number 81-1-037 gave the higher average seed yield per plant than other lines. They are at present in a preliminary yield trial in Chiang Mai. Chiang Mai. (author)

  4. Discovery of a seventh Rpp soybean rust resistance locus in soybean accession PI 605823.

    Science.gov (United States)

    Childs, Silas P; King, Zachary R; Walker, David R; Harris, Donna K; Pedley, Kerry F; Buck, James W; Boerma, H Roger; Li, Zenglu

    2018-01-01

    A novel Rpp gene from PI 605823 for resistance to Phakopsora pachyrhizi was mapped on chromosome 19. Soybean rust, caused by the obligate biotrophic fungal pathogen Phakopsora pachyrhizi Syd. & P. Syd, is a disease threat to soybean production in regions of the world with mild winters. Host plant resistance conditioned by resistance to P. pachyrhizi (Rpp) genes has been found in numerous soybean accessions, and at least 10 Rpp genes or alleles have been mapped to six genetic loci. Identifying additional disease-resistance genes will facilitate development of soybean cultivars with durable resistance. PI 605823, a plant introduction from Vietnam, was previously identified as resistant to US populations of P. pachyrhizi in greenhouse and field trials. In this study, bulked segregant analysis using an F 2 population derived from 'Williams 82' × PI 605823 identified a genomic region associated with resistance to P. pachyrhizi isolate GA12, which had been collected in the US State of Georgia in 2012. To further map the resistance locus, linkage mapping was carried out using single-nucleotide polymorphism markers and phenotypic data from greenhouse assays with an F 2:3 population derived from Williams 82 × PI 605823 and an F 4:5 population derived from '5601T' × PI 605823. A novel resistance gene, Rpp7, was mapped to a 154-kb interval (Gm19: 39,462,291-39,616,643 Glyma.Wm82.a2) on chromosome 19 that is different from the genomic locations of any previously reported Rpp genes. This new gene could be incorporated into elite breeding lines to help provide more durable resistance to soybean rust.

  5. Production of Basella plants resistant to rust by irradiation of seeds and vegetative tissue

    International Nuclear Information System (INIS)

    Makambila, C.

    1997-01-01

    Basella is classified in the family Chenopodiaceae or Basellaceae. Also known as African spinach, this plant is consumed in Central Africa and several other African countries. There are two types of varieties grown in Congo: i. a local variety characterized by red leaves and stalks in which the principal way of propagation is from cuttings; ii. a group of varieties which have green or purple leaves and stalks. These varieties are called Basella alba and Basella rubra. These varieties have sexual reproduction. Among the two groups of varieties, the local variety is propagated vegetatively but is resistant to rust, while varieties with green leaves or with purple leaves (B. alba and B. rubra) that are propagated from seed are susceptible to rust. Since hybrid cannot be made by conventional crossing, the following procedures have been adopted to produce plants with disease tolerance: 1. production of resistant variants by irradiation of Basella alba seeds with Cesium 137; 2. production of resistant variants by irradiation of vegetative tissues obtained by culture of meristematic cells of B alba; and 3. obtaining resistant plants through somaclonal variation. 1 tab

  6. Molecular characterization of resistance to soybean rust (Phakopsora pachyrhizi Syd. & Syd.) in soybean cultivar DT 2000 (PI 635999)

    Science.gov (United States)

    Resistance to soybean rust (SBR), caused by Phakopsora pachyrhizi Syd.& Syd., has been identified in many soybean germplasm accessions and is conferred by either dominant or recessive genes that have been mapped to six independent loci (Rpp1 – Rpp6), but No U.S. cultivars are resistant to SBR. The c...

  7. Resistance to rust ( Puccinia psidii Winter) in eucalyptus: mode of inheritance and mapping of a major gene with RAPD markers.

    Science.gov (United States)

    Junghans, D T; Alfenas, A C; Brommonschenkel, S H; Oda, S; Mello, E J; Grattapaglia, D

    2003-12-01

    Rust is one of the most-damaging eucalypt diseases in Brazil and is considered a potential threat to eucalypt plantations worldwide. To determine the mode of inheritance of resistance in the Eucalyptus grandis- Puccinia psidii pathosystem, ten full-sib families, generated from crosses between susceptible and resistant trees, were inoculated with a single-pustule isolate of the pathogen and rust severity was scored. The observed segregation ratios in segregating families suggested major gene control of rust resistance, although clearly incomplete penetrance, variable expressivity and minor genes are also involved in the global rust-resistance response. To identify markers linked to the resistance locus, screening of RAPD polymorphisms was conducted using bulked segregant analysis in a large full-sib family. A linkage group was built around the Ppr1 gene ( P. psidii resistance gene 1) encompassing six RAPD markers, with a genetic window spanning 5 cM with the two most-closely linked flanking markers. Besides these two flanking markers, RAPD marker AT9/917 co-segregated with Ppr1 without a single recombinant in 994 meioses. This tightly linked marker should prove useful for marker-assisted introgression and will provide an initial lead for a positional cloning effort of this resistance allele. This is the first report of a disease resistance gene identified in Eucalyptus, and one of the few examples of the involvement of a major gene in a non-coevolved pathosystem.

  8. Evidence of isolate-specificity in non-hypersensitive resistance in spring wheat (Triticum aestivum) to wheat leaf rust

    NARCIS (Netherlands)

    Qamar, Maqsood; Niks, R.E.

    2007-01-01

    Isolate-specific aspect of non-hypersensitive resistance in wheat to wheat leaf rust was studied at seedling stage in the green house. Isolate-specific response of non-hypersensitive resistance was assessed from latency period (LP) and infection frequency (IF) of two single-pustule isolates of

  9. Adult plant leaf rust resistance derived from the soft red winter wheat cultivar Caldwell maps to chromosome 3BS

    Science.gov (United States)

    'Caldwell' is a U.S. soft red winter wheat that has partial, adult plant resistance to the leaf rust pathogen Puccinia triticina. A line of 'Thatcher*2/Caldwell' with adult plant resistance derived from Caldwell was crossed with 'Thatcher' to develop a population of recombinant inbred lines (RILs). ...

  10. Identification of Nine Pathotype-Specific Genes Conferring Resistance to Fusiform Rust in Loblolly Pine (Pinus taeda L.

    Directory of Open Access Journals (Sweden)

    Henry V. Amerson

    2015-08-01

    Full Text Available Nearly two decades of research on the host-pathogen interaction in fusiform rust of loblolly pine is detailed. Results clearly indicate that pathotype-specific genes in the host interacting with pathogen avirulence cause resistance as defined by the non-gall phenotype under favorable environmental conditions for disease development. In particular, nine fusiform rust resistance genes (Fr genes are described here including the specific methods to determine each and their localization on the reference genetic map of loblolly pine. Understanding how these and other apparent Fr genes in loblolly pine and other rust-susceptible pines impact resistance screening, parental and progeny selection, and family and clonal deployment is an important area in forest genetics research and operational tree breeding. The documentation of these Fr genes is a key piece of information towards gaining that understanding and ultimately improving breeding and deployment strategies.

  11. A study of the evolution of rust on Mo–Cu-bearing fire-resistant steel submitted to simulated atmospheric corrosion

    International Nuclear Information System (INIS)

    Hao Long; Zhang Sixun; Dong Junhua; Ke Wei

    2012-01-01

    Highlights: ► The rusting evolution of a Mo–Cu-bearing fire-resistant steel in a simulated industrial atmosphere was investigated. ► The rusting evolution of the steel is related to the rust composition, structure, and electrochemical characteristics. ► Increased content of α-FeOOH and decreased γ-FeOOH and Fe 3 O 4 indicate the enhanced resistance of the rust. ► Mo and Cu are involved in the formation of molybdate and Cu(I)-bearing compounds in the rust. - Abstract: The corrosion evolution of a Mo–Cu-bearing fire-resistant steel in a simulated industrial atmosphere was investigated by corrosion weight gain, XRD, EPMA, XPS, and polarization curves. The results indicate that the corrosion kinetics is closely related to the rust composition and electrochemical properties. As the corrosion proceeds, the relative content of γ-FeOOH and Fe 3 O 4 decreases and α-FeOOH increases, and the rust layer becomes compact and adherent to steel substrate. Molybdenum and copper enrich in the inner rust layer, especially at the bottom of the corrosion nest, forming non-soluble molybdate and Cu(I)-bearing compounds responsible for enhanced corrosion resistance of the rust layer.

  12. A new 2DS·2RL Robertsonian translocation transfers stem rust resistance gene Sr59 into wheat.

    Science.gov (United States)

    Rahmatov, Mahbubjon; Rouse, Matthew N; Nirmala, Jayaveeramuthu; Danilova, Tatiana; Friebe, Bernd; Steffenson, Brian J; Johansson, Eva

    2016-07-01

    A new stem rust resistance gene Sr59 from Secale cereale was introgressed into wheat as a 2DS·2RL Robertsonian translocation. Emerging new races of the wheat stem rust pathogen (Puccinia graminis f. sp. tritici), from Africa threaten global wheat (Triticum aestivum L.) production. To broaden the resistance spectrum of wheat to these widely virulent African races, additional resistance genes must be identified from all possible gene pools. From the screening of a collection of wheat-rye (Secale cereale L.) chromosome substitution lines developed at the Swedish University of Agricultural Sciences, we described the line 'SLU238' 2R (2D) as possessing resistance to many races of P. graminis f. sp. tritici, including the widely virulent race TTKSK (isolate synonym Ug99) from Africa. The breakage-fusion mechanism of univalent chromosomes was used to produce a new Robertsonian translocation: T2DS·2RL. Molecular marker analysis and stem rust seedling assays at multiple generations confirmed that the stem rust resistance from 'SLU238' is present on the rye chromosome arm 2RL. Line TA5094 (#101) was derived from 'SLU238' and was found to be homozygous for the T2DS·2RL translocation. The stem rust resistance gene on chromosome 2RL arm was designated as Sr59. Although introgressions of rye chromosome arms into wheat have most often been facilitated by irradiation, this study highlights the utility of the breakage-fusion mechanism for rye chromatin introgression. Sr59 provides an additional asset for wheat improvement to mitigate yield losses caused by stem rust.

  13. Identifying Quantitative Trait Loci (QTLs and Developing Diagnostic Markers Linked to Orange Rust Resistance in Sugarcane (Saccharum spp.

    Directory of Open Access Journals (Sweden)

    Xiping Yang

    2018-03-01

    Full Text Available Sugarcane (Saccharum spp. is an important economic crop, contributing up to 80% of table sugar used in the world and has become a promising feedstock for biofuel production. Sugarcane production has been threatened by many diseases, and fungicide applications for disease control have been opted out for sustainable agriculture. Orange rust is one of the major diseases impacting sugarcane production worldwide. Identifying quantitative trait loci (QTLs and developing diagnostic markers are valuable for breeding programs to expedite release of superior sugarcane cultivars for disease control. In this study, an F1 segregating population derived from a cross between two hybrid sugarcane clones, CP95-1039 and CP88-1762, was evaluated for orange rust resistance in replicated trails. Three QTLs controlling orange rust resistance in sugarcane (qORR109, qORR4 and qORR102 were identified for the first time ever, which can explain 58, 12 and 8% of the phenotypic variation, separately. We also characterized 1,574 sugarcane putative resistance (R genes. These sugarcane putative R genes and simple sequence repeats in the QTL intervals were further used to develop diagnostic markers for marker-assisted selection of orange rust resistance. A PCR-based Resistance gene-derived maker, G1 was developed, which showed significant association with orange rust resistance. The putative QTLs and marker developed in this study can be effectively utilized in sugarcane breeding programs to facilitate the selection process, thus contributing to the sustainable agriculture for orange rust disease control.

  14. RFLP markers linked to the durable stem rust resistance gene Rpg1 in barley.

    Science.gov (United States)

    Kilian, A; Steffenson, B J; Saghai Maroof, M A; Kleinhofs, A

    1994-01-01

    The gene, Rpg1, conferring stable resistance in barley to the wheat stem rust pathogen (Puccinia graminis f. sp. tritici) was mapped using two doubled haploid populations. Rpg1 mapped to the extreme subteleomeric region of barley chromosome 1P 0.3 and 1.1 cM proximal from the molecular markers ABG704 and plastocyanin (Plc), respectively, and 2.2 cM distal from MWG036B. The closest marker, ABG704, was sequenced and PCR-based markers were developed.

  15. Induced mutations of rust resistance genes in wheat

    International Nuclear Information System (INIS)

    McIntosh, R.A.

    1983-01-01

    Induced mutations are being used as a tool to study genes for resistance in wheat. It was found that Pm1 can be separated from Lr20 and Sr15, but these two react like a single pleiotropic gene. Mutants were further examined in crosses and backmutations have been attempted. (author)

  16. Genetics of leaf rust-resistant mutant WH 147-LM-1 in hexaploid wheat variety WH 147

    International Nuclear Information System (INIS)

    Reddy, V.R.K.; Viswanathan, P.

    1999-01-01

    By applying gamma rays, EMS and their combination in hexaploid wheat variety WH 147, a total of 20 mutants (0.0226%) exhibiting complete leaf rust resistance were isolated from segregating M2 rows.When one of the rust-resistant mutants, WH 147-LM-1 was crossed with the universally susceptible, suggesting that the mutant character is controlled by one dominant gene and one recessive gene.The F2 plants derived by crossing the mutant WH 147-LM with seven near-isogenic wheat lines showed segregation for susceptibility, indicating that the mutant character was indeed generated through induced mutations

  17. Characterization and selection of location for resistance to sugarcane brown rust disease under cuban conditions

    Directory of Open Access Journals (Sweden)

    Joaquín Montalván Delgado

    2016-01-01

    Full Text Available The sugarcane brown rust disease is caused by fungus Puccinia melanocephala Sydow & P. Sydow and it is one of the more importance diseases. The environment where the sugarcane is cultivated is constituted by numerous factors and its combination contributes to the formation of different development and production conditions, what influences in the varietal disease resistance. With the objective of to characterize and to define the resistance tests location to the brown rust disease were carried out experiments in 6 location of the country. Eleven varieties and six patterns were studied. The climatic variables were analyzed during the period in each location and they were carried out evaluations in different ages of the plant and number of the leaves. The quantity of pustules, long of the most frequent pustules, size of the biggest pustules and area per - centage occupied by pustules were evaluated. The data were analyzed statistically. Differential behavior of the locations and the importance of the relative humidity and the temperatures in the manifestation of the disease symptoms were proven. All the locations were important although similarity exists between Matanzas and Villa Clara and between Camagüey and Holguín. Mayabeque and Santiago de Cuba didn’t present similarity with any other one. These 6 locations can be used for the resistance tests and to define the progenitors’ Santiago de Cuba, Holguín, Villa Clara and Mayabeque

  18. An accurate DNA marker assay for stem rust resistance gene Sr2 in wheat.

    Science.gov (United States)

    Mago, R; Simkova, H; Brown-Guedira, G; Dreisigacker, S; Breen, J; Jin, Y; Singh, R; Appels, R; Lagudah, E S; Ellis, J; Dolezel, J; Spielmeyer, W

    2011-03-01

    The stem rust resistance gene Sr2 has provided broad-spectrum protection against stem rust (Puccinia graminis Pers. f. sp. tritici) since its wide spread deployment in wheat from the 1940s. Because Sr2 confers partial resistance which is difficult to select under field conditions, a DNA marker is desirable that accurately predicts Sr2 in diverse wheat germplasm. Using DNA sequence derived from the vicinity of the Sr2 locus, we developed a cleaved amplified polymorphic sequence (CAPS) marker that is associated with the presence or absence of the gene in 115 of 122 (95%) diverse wheat lines. The marker genotype predicted the absence of the gene in 100% of lines which were considered to lack Sr2. Discrepancies were observed in lines that were predicted to carry Sr2 but failed to show the CAPS marker. Given the high level of accuracy observed, the marker provides breeders with a selection tool for one of the most important disease resistance genes of wheat.

  19. Prospects for advancing defense to cereal rusts through genetical genomics.

    Science.gov (United States)

    Ballini, Elsa; Lauter, Nick; Wise, Roger

    2013-01-01

    Rusts are one of the most severe threats to cereal crops because new pathogen races emerge regularly, resulting in infestations that lead to large yield losses. In 1999, a new race of stem rust, Puccinia graminis f. sp. tritici (Pgt TTKSK or Ug99), was discovered in Uganda. Most of the wheat and barley cultivars grown currently worldwide are susceptible to this new race. Pgt TTKSK has already spread northward into Iran and will likely spread eastward throughout the Indian subcontinent in the near future. This scenario is not unique to stem rust; new races of leaf rust (Puccinia triticina) and stripe rust (Puccinia striiformis) have also emerged recently. One strategy for countering the persistent adaptability of these pathogens is to stack complete- and partial-resistance genes, which requires significant breeding efforts in order to reduce deleterious effects of linkage drag. These varied resistance combinations are typically more difficult for the pathogen to defeat, since they would be predicted to apply lower selection pressure. Genetical genomics or expression Quantitative Trait Locus (eQTL) analysis enables the identification of regulatory loci that control the expression of many to hundreds of genes. Integrated deployment of these technologies coupled with efficient phenotyping offers significant potential to elucidate the regulatory nodes in genetic networks that orchestrate host defense responses. The focus of this review will be to present advances in genetical genomic experimental designs and analysis, particularly as they apply to the prospects for discovering partial disease resistance alleles in cereals.

  20. Physical mapping of DNA markers linked to stem rust resistance gene Sr47 in durum wheat.

    Science.gov (United States)

    Klindworth, Daryl L; Saini, Jyoti; Long, Yunming; Rouse, Matthew N; Faris, Justin D; Jin, Yue; Xu, Steven S

    2017-06-01

    Markers linked to stem rust resistance gene Sr47 were physically mapped in three small Aegilops speltoides chromosomal bins. Five markers, including two PCR-based SNP markers, were validated for marker-assisted selection. In durum wheat (Triticum turgidum subsp. durum), the gene Sr47 derived from Aegilops speltoides conditions resistance to race TTKSK (Ug99) of the stem rust pathogen (Puccinia graminis f. sp. tritici). Sr47 is carried on small interstitial translocation chromosomes (Ti2BL-2SL-2BL·2BS) in which the Ae. speltoides chromosome 2S segments are divided into four bins in genetic stocks RWG35, RWG36, and RWG37. Our objective was to physically map molecular markers to bins and to determine if any of the molecular markers would be useful in marker-assisted selection (MAS). Durum cultivar Joppa was used as the recurrent parent to produce three BC 2 F 2 populations. Each BC 2 F 2 plant was genotyped with markers to detect the segment carrying Sr47, and stem rust testing of BC 2 F 3 progeny with race TTKSK confirmed the genotyping. Forty-nine markers from published sources, four new SSR markers, and five new STARP (semi-thermal asymmetric reverse PCR) markers, were evaluated in BC 2 F 2 populations for assignment of markers to bins. Sr47 was mapped to bin 3 along with 13 markers. No markers were assigned to bin 1; however, 7 and 13 markers were assigned to bins 2 and 4, respectively. Markers Xrwgs38a, Xmag1729, Xwmc41, Xtnac3119, Xrwgsnp1, and Xrwgsnp4 were found to be useful for MAS of Sr47. However, STARP markers Xrwgsnp1 and Xrwgsnp4 can be used in gel-free systems, and are the preferred markers for high-throughput MAS. The physical mapping data from this study will also be useful for pyramiding Sr47 with other Sr genes on chromosome 2B.

  1. Identification and mapping in spring wheat of genetic factors controlling stem rust resistance and the study of their epistatic interactions across multiple environments.

    Science.gov (United States)

    Singh, A; Knox, R E; DePauw, R M; Singh, A K; Cuthbert, R D; Campbell, H L; Singh, D; Bhavani, S; Fetch, T; Clarke, F

    2013-08-01

    Stem rust (Puccinia graminis f. sp. tritici) is responsible for major production losses in hexaploid wheat (Triticum aestivum L.) around the world. The spread of stem rust race Ug99 and variants is a threat to worldwide wheat production and efforts are ongoing to identify and incorporate resistance. The objectives of this research were to identify quantitative trait loci (QTL) and to study their epistatic interactions for stem rust resistance in a population derived from the Canadian wheat cultivars AC Cadillac and Carberry. A doubled haploid (DH) population was developed and genotyped with DArT(®) and SSR markers. The parents and DH lines were phenotyped for stem rust severity and infection response to Ug99 and variant races in 2009, 2010 and 2011 in field rust nurseries near Njoro, Kenya, and to North American races in 2011 and 2012 near Swift Current, SK, Canada. Seedling infection type to race TTKSK was assessed in a bio-containment facility in 2009 and 2012 near Morden, MB. Eight QTL for stem rust resistance and three QTL for pseudo-black chaff on nine wheat chromosomes were identified. The phenotypic variance (PV) explained by the stem rust resistance QTL ranged from 2.4 to 48.8 %. AC Cadillac contributed stem rust resistance QTL on chromosomes 2B, 3B, 5B, 6D, 7B and 7D. Carberry contributed resistance QTL on 4B and 5A. Epistatic interactions were observed between loci on 4B and 5B, 4B and 7B, 6D and 3B, 6D and 5B, and 6D and 7B. The stem rust resistance locus on 6D interacted synergistically with 5B to improve the disease resistance through both crossover and non-crossover interactions depending on the environment. Results from this study will assist in planning breeding for stem rust resistance by maximizing QTL main effects and epistatic interactions.

  2. Complementary epistasis involving Sr12 explains adult plant resistance to stem rust in Thatcher wheat (Triticum aestivum L.).

    Science.gov (United States)

    Rouse, Matthew N; Talbert, Luther E; Singh, Davinder; Sherman, Jamie D

    2014-07-01

    Quantitative trait loci conferring adult plant resistance to Ug99 stem rust in Thatcher wheat display complementary gene action suggesting multiple quantitative trait loci are needed for effective resistance. Adult plant resistance (APR) in wheat (Triticum aestivum L.) to stem rust, caused by Puccinia graminis f. sp. tritici (Pgt), is desirable because this resistance can be Pgt race non-specific. Resistance derived from cultivar Thatcher can confer high levels of APR to the virulent Pgt race TTKSK (Ug99) when combined with stem rust resistance gene Sr57 (Lr34). To identify the loci conferring APR in Thatcher, we evaluated 160 RILs derived from Thatcher crossed to susceptible cultivar McNeal for field stem rust reaction in Kenya for two seasons and in St. Paul for one season. All RILs and parents were susceptible as seedlings to race TTKSK. However, adult plant stem rust severities in Kenya varied from 5 to 80 %. Composite interval mapping identified four quantitative trait loci (QTL). Three QTL were inherited from Thatcher and one, Sr57, was inherited from McNeal. The markers closest to the QTL peaks were used in an ANOVA to determine the additive and epistatic effects. A QTL on 3BS was detected in all three environments and explained 27-35 % of the variation. The peak of this QTL was at the same location as the Sr12 seedling resistance gene effective to race SCCSC. Epistatic interactions were significant between Sr12 and QTL on chromosome arms 1AL and 2BS. Though Sr12 cosegregated with the largest effect QTL, lines with Sr12 were not always resistant. The data suggest that Sr12 or a linked gene, though not effective to race TTKSK alone, confers APR when combined with other resistance loci.

  3. Identification of genes involved in stem rust resistance from wheat mutant D51 with the cDNA-AFLP technique.

    Science.gov (United States)

    Yin, Jing; Wang, Guangjin; Xiao, Jialei; Ma, Fengming; Zhang, Hongji; Sun, Yan; Diao, Yanling; Huang, Jinghua; Guo, Qiang; Liu, Dongjun

    2010-02-01

    Wheat (Triticum aestivum L.) stem rust caused by Puccinia graminis f. sp. tritici is one of the main diseases of wheat worldwide. Wheat mutant line D51, which was derived from the highly susceptible cultivar L6239, shows resistance to the prevailing races 21C3CPH, 21C3CKH, and 21C3CTR of P. graminis f. sp. tritici in China. In this study, we used the cDNA-AFLP technology to identify the genes that are likely involved in the stem rust resistance. EcoRI/MseI selective primers were used to generate approximately 1920 DNA fragments. Seventy five differentially transcribed fragments (3.91%) were identified by comparing the samples of 21C3CPH infected D51 with infected L6239 or uninfected D51. Eleven amplified cDNA fragments were sequenced. Eight showed significant similarity to known genes, including TaLr1 (leaf rust resistance gene), wlm24 (wheat powdery mildew resistance gene), stress response genes and ESTs of environment stress of tall fescue. These identified genes are involved in plant defense response and stem rust resistance and need further research to determine their usefulness in breeding new resistance cultivars.

  4. Wheat rusts in the United States in 2016

    Science.gov (United States)

    In 2016, wheat stripe rust caused by Puccinia striiformis f. sp. graminis was widespread throughout the United States. Cool temperatures and abundant rainfall in the southern Great Plains allowed stripe rust to become widely established and spread throughout the Great Plains and eastern United State...

  5. Fine mapping of the Asian soybean rust resistance gene Rpp2 from soybean PI 230970.

    Science.gov (United States)

    Yu, Neil; Kim, Myungsik; King, Zachary R; Harris, Donna K; Buck, James W; Li, Zenglu; Diers, Brian W

    2015-03-01

    Asian soybean rust (ASR) resistance gene Rpp2 has been fine mapped into a 188.1 kb interval on Glyma.Wm82.a2, which contains a series of plant resistance ( R ) genes. Asian soybean rust (ASR), caused by the fungus Phakopsora pachyrihizi Syd. & P. Syd., is a serious disease in major soybean [Glycine max (L.) Merr.] production countries worldwide and causes yield losses up to 75 %. Defining the exact chromosomal position of ASR resistance genes is critical for improving the effectiveness of marker-assisted selection (MAS) for resistance and for cloning these genes. The objective of this study was to fine map the ASR resistance gene Rpp2 from the plant introduction (PI) 230970. Rpp2 was previously mapped within a 12.9-cM interval on soybean chromosome 16. The fine mapping was initiated by identifying recombination events in F2 and F3 plants using simple sequence repeat (SSR) and single nucleotide polymorphism (SNP) markers that flank the gene. Seventeen recombinant plants were identified and then tested with additional genetic markers saturating the gene region to localize the positions of each recombination. The progeny of these selected plants were tested for resistance to ASR and with SSR markers resulting in the mapping of Rpp2 to a 188.1 kb interval on the Williams 82 reference genome (Glyma.Wm82.a2). Twelve genes including ten toll/interleukin-1 receptor (TIR)-nucleotide-binding site (NBS)-leucine-rich repeat (LRR) genes were predicted to exist in this interval on the Glyma.Wm82.a2.v1 gene model map. Eight of these ten genes were homologous to the Arabidopsis TIR-NBS-LRR gene AT5G17680.1. The identified SSR and SNP markers close to Rpp2 and the candidate gene information presented in this study will be significant resources for MAS and gene cloning research.

  6. Molecular cytological characterization of two novel durum--Thinopyrum intermedium partial amphiploids with resistance to leaf rust, stem rust and Fusarium head blight.

    Science.gov (United States)

    Zeng, J; Cao, W; Fedak, G; Sun, S; McCallum, B; Fetch, T; Xue, A; Zhou, Y

    2013-02-01

    Thinopyrum intermedium, a wild relative of wheat, is an excellent source of disease resistance. Two novel partial amphiploids, 08-47-50 and 08-53-55 (2n = 6x = 42), were developed from wide crosses between durum wheat and Th. intermedium. Meiotic analysis showed that pollen mother cells of the two partial amphiploids formed an average 20.49 bivalents for 08-47-50 and 20.67 bivalents for 08-53-55, indicating that they are basically cytologically stable. GISH analysis revealed that the two partial amphiploids carried different chromosome compositions. 08-47-50 had fourteen chromosomes from Th. intermedium and its alien chromosomes included six St-, four E(e) - and four E(e)-St translocated chromosomes, whereas 08-53-55 had four St- and ten E(e)-St translocated chromosomes. Fungal disease evaluation indicated that both partial amphiploids had a high level of resistance to FHB, leaf rust and stem rust race Ug99. These two novel partial amphiploids with multiple disease resistance could be used as a new source of multiple disease resistance in bread wheat and durum wheat breeding programs. © 2013 The Authors.

  7. Investigating Gene Function in Cereal Rust Fungi by Plant-Mediated Virus-Induced Gene Silencing.

    Science.gov (United States)

    Panwar, Vinay; Bakkeren, Guus

    2017-01-01

    Cereal rust fungi are destructive pathogens, threatening grain production worldwide. Targeted breeding for resistance utilizing host resistance genes has been effective. However, breakdown of resistance occurs frequently and continued efforts are needed to understand how these fungi overcome resistance and to expand the range of available resistance genes. Whole genome sequencing, transcriptomic and proteomic studies followed by genome-wide computational and comparative analyses have identified large repertoire of genes in rust fungi among which are candidates predicted to code for pathogenicity and virulence factors. Some of these genes represent defence triggering avirulence effectors. However, functions of most genes still needs to be assessed to understand the biology of these obligate biotrophic pathogens. Since genetic manipulations such as gene deletion and genetic transformation are not yet feasible in rust fungi, performing functional gene studies is challenging. Recently, Host-induced gene silencing (HIGS) has emerged as a useful tool to characterize gene function in rust fungi while infecting and growing in host plants. We utilized Barley stripe mosaic virus-mediated virus induced gene silencing (BSMV-VIGS) to induce HIGS of candidate rust fungal genes in the wheat host to determine their role in plant-fungal interactions. Here, we describe the methods for using BSMV-VIGS in wheat for functional genomics study in cereal rust fungi.

  8. Aberrant mRNA processing of the maize Rp1-D rust resistance gene in wheat and barley.

    Science.gov (United States)

    Ayliffe, Michael A; Steinau, Martin; Park, Robert F; Rooke, Lee; Pacheco, Maria G; Hulbert, Scot H; Trick, Harold N; Pryor, Anthony J

    2004-08-01

    The maize Rp1-D gene confers race-specific resistance against Puccinia sorghi (common leaf rust) isolates containing a corresponding avrRp1-D avirulence gene. An Rp1-D genomic clone and a similar Rp1-D transgene regulated by the maize ubiquitin promoter were transformed independently into susceptible maize lines and shown to confer Rp1-D resistance, demonstrating that this resistance can be transferred as a single gene. Transfer of these functional transgenes into wheat and barley did not result in novel resistances when these plants were challenged with isolates of wheat stem rust (P. graminis), wheat leaf rust (P. triticina), or barley leaf rust (P. hordei). Regardless of the promoter employed, low levels of gene expression were observed. When constitutive promoters were used for transgene expression, a majority of Rp1-D transcripts were truncated in the nucleotide binding site-encoding region by premature polyadenylation. This aberrant mRNA processing was unrelated to gene function because an inactive version of the gene also generated such transcripts. These data demonstrate that resistance gene transfer between species may not be limited only by divergence of signaling effector molecules and pathogen avirulence ligands, but potentially also by more fundamental gene expression and transcript processing limitations.

  9. Whitebark Pine Germination, Rust Resistance, and Cold Hardiness Among Seed Sources in the Inland Northwest: Planting Strategies for Restoration

    Science.gov (United States)

    Mary F. Mahalovich; Karen E. Burr; David L. Foushee

    2006-01-01

    A synthesis of several studies highlights above-average performing seed sources (n = 108) of whitebark pine (Pinus albicaulis), which practitioners can utilize for restoration, wildlife habitat improvement, and operational planting programs. It is the first report of this magnitude of blister rust resistance for this species. Whitebark pine does have...

  10. Resistance to Stem Rust Pathotype TTKSK Maps to the Rgp4/Rpg5 Complex of Chromosome 5H of Barley

    Science.gov (United States)

    The wheat stem rust (Puccinia graminis f. sp. tritici) pathotype TTKSK (original isolate synonym Ug99) is a serious threat to both wheat and barley production worldwide because of its wide virulence on many cultivars and rapid spread from eastern Africa. Line Q21861 is one of the most resistant bar...

  11. Effect of partial resistance to barley leaf rust, Puccinia hordei, on the yield of three barley cultivars

    NARCIS (Netherlands)

    Ochoa, J.; Parlevliet, J.E.

    2007-01-01

    Three barley cultivars, Shyri, Clipper and Terán, with different levels of partial resistance to barley leaf rust, caused by Puccinia hordei, were exposed to six levels of the pathogen. These levels were obtained by 5, 4, 3, 2, 1 and 0 fungicide (Propiconazol) applications respectively and occurred

  12. QTLs for resistance to the false brome rust Puccinia brachypodii in the model grass Brachypodium distachyon L.

    NARCIS (Netherlands)

    Barbieri, M.; Marcel, T.C.; Niks, R.E.; Francia, E.; Pasquariello, M.; Mazzamurro, V.; Garvin, D.F.; Pecchioni, N.

    2012-01-01

    The potential of the model grass Brachypodium distachyon L. (Brachypodium) for studying grass–pathogen interactions is still underexploited. We aimed to identify genomic regions in Brachypodium associated with quantitative resistance to the false brome rust fungus Puccinia brachypodii. The inbred

  13. Molecular and cytogenetic characterization of a durum wheat Aegilops speltoides chromosome translocation conferring resistance to stem rust

    Science.gov (United States)

    Stem rust is a serious disease of wheat that has caused historical epidemics, but it has not been a threat in recent decades in North America due to the eradication of the alternate host and deployment of resistant cultivars. However, the recent emergence of Ug99 (or race TTKS) poses a threat to glo...

  14. Morphological and molecular characterisation confirm that Triticum monococcum s.s. is resistant to wheat leaf rust

    NARCIS (Netherlands)

    Anker, C.C.; Buntjer, J.B.; Niks, R.E.

    2001-01-01

    The three diploid wheat species Triticum monococcum, Triticum boeoticum and Triticum urartu differ in their reaction to wheat leaf rust, Puccinia triticina. In general, T. monococcum is resistant while T. boeoticum and T. urartu are susceptible. However, upon screening a large collection of diploid

  15. Genetics and mapping of seedling resistance to Ug99 stem rust in Canadian wheat cultivars 'Peace' and 'AC Cadillac'.

    Science.gov (United States)

    Hiebert, Colin W; Fetch, Tom G; Zegeye, Taye; Thomas, Julian B; Somers, Daryl J; Humphreys, D Gavin; McCallum, Brent D; Cloutier, Sylvie; Singh, Davinder; Knott, Doug R

    2011-01-01

    Stem rust (caused by Puccinia graminis Pers.:Pers. f. sp. tritici Eriks. & E. Henn.) has re-emerged as a threat to wheat production with the evolution of new pathogen races, namely TTKSK (Ug99) and its variants, in Africa. Deployment of resistant wheat cultivars has provided long-term control of stem rust. Identification of new resistance genes will contribute to future cultivars with broad resistance to stem rust. The related Canadian cultivars Peace and AC Cadillac show resistance to Ug99 at the seedling stage and in the field. The purpose of this study was to elucidate the inheritance and genetically map resistance to Ug99 in these two cultivars. Two populations were produced, an F(2:3) population from LMPG/AC Cadillac and a doubled haploid (DH) population from RL6071/Peace. Both populations showed segregation at the seedling stage for a single stem rust resistance (Sr) gene, temporarily named SrCad. SrCad was mapped to chromosome 6DS in both populations with microsatellite markers and a marker (FSD_RSA) that is tightly linked to the common bunt resistance gene Bt10. FSD_RSA was the closest marker to SrCad (≈ 1.6 cM). Evaluation of the RL6071/Peace DH population and a second DH population, AC Karma/87E03-S2B1, in Kenya showed that the combination of SrCad and leaf rust resistance gene Lr34 provided a high level of resistance to Ug99-type races in the field, whereas in the absence of Lr34 SrCad conferred moderate resistance. A survey confirmed that SrCad is the basis for all of the seedling resistance to Ug99 in Canadian wheat cultivars. While further study is needed to determine the relationship between SrCad and other Sr genes on chromosome 6DS, SrCad represents a valuable genetic resource for producing stem rust resistant wheat cultivars.

  16. Molecular mapping of two loci that confer resistance to Asian rust in soybean.

    Science.gov (United States)

    Silva, Danielle C G; Yamanaka, Naoki; Brogin, Rodrigo L; Arias, Carlos A A; Nepomuceno, Alexandre L; Di Mauro, Antônio O; Pereira, Selma S; Nogueira, Livia M; Passianotto, André L L; Abdelnoor, Ricardo V

    2008-06-01

    Asian soybean rust (ASR) is caused by the fungal pathogen Phakopsora pachyrhizi Sydow & Sydow. It was first identified in Brazil in 2001 and quickly infected soybean areas in several countries in South America. Primary efforts to combat this disease must involve the development of resistant cultivars. Four distinct genes that confer resistance against ASR have been reported: Rpp1, Rpp2, Rpp3, and Rpp4. However, no cultivar carrying any of those resistance loci has been released. The main objective of this study was to genetically map Rpp2 and Rpp4 resistance genes. Two F(2:3) populations, derived from the crosses between the resistant lines PI 230970 (Rpp2), PI 459025 (Rpp4) and the susceptible cultivar BRS 184, were used in this study. The mapping populations and parental lines were inoculated with a field isolate of P. pachyrhizi and evaluated for lesion type as resistant (RB lesions) or susceptible (TAN lesions). The mapping populations were screened with SSR markers, using the bulk segregant analysis (BSA) to expedite the identification of linked markers. Both resistance genes showed an expected segregation ratio for a dominant trait. This study allowed mapping Rpp2 and Rpp4 loci on the linkage groups J and G, respectively. The associated markers will be of great value on marker assisted selection for this trait.

  17. Soybean rust resistance sources and inheritance in the common bean (Phaseolus vulgaris L.).

    Science.gov (United States)

    Souza, T L P O; Dessaune, S N; Moreira, M A; Barros, E G

    2014-07-25

    Soybean rust (SBR), caused by the fungus Phakopsora pachyrhizi, has been reported in common bean (Phaseolus vulgaris L.) cultivars and elite lines that were infected under controlled and natural field conditions in South Africa, the United States, Argentina, and Brazil. Although SBR is currently not a top priority problem for the common bean crop, many bean breeders are concerned about this disease because of the high severity and virulence diversity of P. pachyrhizi and its broad host range. In this study, a set of 44 P. vulgaris genotypes were tested for resistance to P. pachyrhizi; these genotypes included resistance sources to several fungal common bean diseases, carioca-, black- and red-seeded Brazilian cultivars, and elite lines that were developed by the main common bean breeding programs in Brazil. Twenty-four SBR resistance sources were identified. They presented the reddish-brown (RB) lesion type, characterizing resistance reactions. In addition to the RB lesion type, the PI181996 line presented the lowest disease severity mean score, considering its associated standard error value. For this reason, it was crossed with susceptible lines to study the inheritance of resistance. The results support the hypothesis that resistance to SBR in PI181996 is monogenic and dominant. We propose that this SBR resistance gene, the first to be identified and characterized in common bean, might be designated as Pkp-1.

  18. Identification of a second Asian soybean rust resistance gene in Hyuuga soybean.

    Science.gov (United States)

    Kendrick, Mandy D; Harris, Donna K; Ha, Bo-Keun; Hyten, David L; Cregan, Perry B; Frederick, Reid D; Boerma, H Roger; Pedley, Kerry F

    2011-05-01

    ABSTRACT Asian soybean rust (ASR) is an economically significant disease caused by the fungus Phakopsora pachyrhizi. The soybean genes Rpp3 and Rpp?(Hyuuga) confer resistance to specific isolates of the pathogen. Both genes map to chromosome 6 (Gm06) (linkage group [LG] C2). We recently identified 12 additional soybean accessions that harbor ASR resistance mapping to Gm06, within 5 centimorgans of Rpp3 and Rpp?(Hyuuga). To further characterize genotypes with resistance on Gm06, we used a set of eight P. pachyrhizi isolates collected from geographically diverse areas to inoculate plants and evaluate them for differential phenotypic responses. Three isolates elicited different responses from soybean accessions PI 462312 (Ankur) (Rpp3) and PI 506764 (Hyuuga) (Rpp?[Hyuuga]). In all, 11 of the new accessions yielded responses identical to either PI 462312 or Hyuuga and 1 of the new accessions, PI 417089B (Kuro daizu), differed from all others. Additional screening of Hyuuga-derived recombinant inbred lines indicated that Hyuuga carries two resistance genes, one at the Rpp3 locus on Gm06 and a second, unlinked ASR resistance gene mapping to Gm03 (LG-N) near Rpp5. These findings reveal a natural case of gene pyramiding for ASR resistance in Hyuuga and underscore the importance of utilizing multiple isolates of P. pachyrhizi when screening for ASR resistance.

  19. EPIDEMIOLOGY OF WHEAT LEAF AND STEM RUST IN THE CENTRAL GREAT PLAINS OF THE USA.

    Science.gov (United States)

    Eversmeyer, M. G.; Kramer, C. L.

    2000-01-01

    Wheat (Triticum aestivum L) is grown throughout the grasslands from southern Mexico into the prairie provinces of Canada, a distance of nearly 4200 km. The total area seeded to wheat varies considerably each year; however, from 28 to 32 million ha are planted in the Great Plains of the United States alone. Generally in the central Great Plains, an area from central Texas through central Nebraska, 15 million ha are seeded to winter wheat each year. A wide range of environmental conditions exist throughout this area that may affect the development and final severity of wheat leaf rust (caused by Puccinia triticina L), stripe rust (caused by P. striiformis), and stem rust (caused by P. graminis Pers. f. sp tritici) epidemics and the subsequent reduction in wheat yields. Variation in severity of rust epidemics in this area depends on differences in crop maturity at the time of infection by primary inoculum, host resistance used, and environmental conditions. The interrelationships among time, host, pathogen and environment are complex, and studying the interactions is very difficult. Historically, cultivars with new or different leaf rust resistance genes become ineffective after several years of large-scale production within the Great Plains, and then cultivars carrying new or different resistance genes must be developed and released into production. This is the typical "boom and bust" cycle of the cereal rust resistance genes in the central Great Plains.

  20. Prediction and analysis of three gene families related to leaf rust (Puccinia triticina) resistance in wheat (Triticum aestivum L.).

    Science.gov (United States)

    Peng, Fred Y; Yang, Rong-Cai

    2017-06-20

    The resistance to leaf rust (Lr) caused by Puccinia triticina in wheat (Triticum aestivum L.) has been well studied over the past decades with over 70 Lr genes being mapped on different chromosomes and numerous QTLs (quantitative trait loci) being detected or mapped using DNA markers. Such resistance is often divided into race-specific and race-nonspecific resistance. The race-nonspecific resistance can be further divided into resistance to most or all races of the same pathogen and resistance to multiple pathogens. At the molecular level, these three types of resistance may cover across the whole spectrum of pathogen specificities that are controlled by genes encoding different protein families in wheat. The objective of this study is to predict and analyze genes in three such families: NBS-LRR (nucleotide-binding sites and leucine-rich repeats or NLR), START (Steroidogenic Acute Regulatory protein [STaR] related lipid-transfer) and ABC (ATP-Binding Cassette) transporter. The focus of the analysis is on the patterns of relationships between these protein-coding genes within the gene families and QTLs detected for leaf rust resistance. We predicted 526 ABC, 1117 NLR and 144 START genes in the hexaploid wheat genome through a domain analysis of wheat proteome. Of the 1809 SNPs from leaf rust resistance QTLs in seedling and adult stages of wheat, 126 SNPs were found within coding regions of these genes or their neighborhood (5 Kb upstream from transcription start site [TSS] or downstream from transcription termination site [TTS] of the genes). Forty-three of these SNPs for adult resistance and 18 SNPs for seedling resistance reside within coding or neighboring regions of the ABC genes whereas 14 SNPs for adult resistance and 29 SNPs for seedling resistance reside within coding or neighboring regions of the NLR gene. Moreover, we found 17 nonsynonymous SNPs for adult resistance and five SNPs for seedling resistance in the ABC genes, and five nonsynonymous SNPs for

  1. Monosomic and molecular mapping of adult plant leaf rust resistance genes in the Brazilian wheat cultivar Toropi.

    Science.gov (United States)

    Da-Silva, P R; Brammer, S P; Guerra, D; Milach, S C K; Barcellos, A L; Baggio, M I

    2012-08-24

    Leaf rust is one of the most destructive diseases affecting wheat worldwide. The most effective way to control it is to use resistant cultivars. Resistance based on slow-rusting adult plant resistance (APR) genes has proven to be the best method for developing cultivars with durable resistance. A source of slow-rusting APR for leaf rust is the Brazilian wheat cultivar Toropi. The Toropi/IAC 13 F₂ and F₇ recombinant inbred lines (RILs) were developed in previous studies. Phenotypic analysis of the F₂ and F₇ RILs showed that 2 recessive genes that were temporarily named trp-1 and trp-2 conferred APR in Toropi. In the present study, we used monosomic families and amplified fragment length polymorphism (AFLP), sequence-tagged site, and simple sequence repeat (SSR) markers to map trp-1 and trp-2 on wheat chromosomes. Analysis of the F₂ monosomic RIL showed that trp- 1 and trp-2 were located on chromosomes 1A and 4D, respectively. AFLP analysis of the F₇ RIL identified 2 independent AFLP markers, XPacgMcac3 and XPacgMcac6, which were associated with Toropi APR. These markers explained 71.5% of the variation in the phenotypic data in a multiple linear regression model. The AFLP markers XPacg/ Mcac3 and XPacg/Mcac6 were anchored by SSR markers previously mapped on the short arms of chromosomes 1A (1AS) and 4D (4DS), respectively. The trp-2 gene is the first leaf rust resistance gene mapped on wheat chromosome 4DS. The mapping of trp-1 and trp-2 provides novel and valuable information that could be used in future studies involving the fine mapping of these genes, as well as in the identification of molecular markers that are closely related to these genes for marker-assisted selection of this important trait in wheat.

  2. Genotype-by-sequencing facilitates genetic mapping of a stem rust resistance locus in Aegilops umbellulata, a wild relative of cultivated wheat.

    Science.gov (United States)

    Edae, Erena A; Olivera, Pablo D; Jin, Yue; Poland, Jesse A; Rouse, Matthew N

    2016-12-15

    Wild relatives of wheat play a significant role in wheat improvement as a source of genetic diversity. Stem rust disease of wheat causes significant yield losses at the global level and stem rust pathogen race TTKSK (Ug99) is virulent to most previously deployed resistance genes. Therefore, the objective of this study was to identify loci conferring resistance to stem rust pathogen races including Ug99 in an Aegilops umbelluata bi-parental mapping population using genotype-by-sequencing (GBS) SNP markers. A bi-parental F 2:3 population derived from a cross made between stem rust resistant accession PI 298905 and stem rust susceptible accession PI 542369 was used for this study. F 2 individuals were evaluated with stem rust race TTTTF followed by testing F 2:3 families with races TTTTF and TTKSK. The segregation pattern of resistance to both stem rust races suggested the presence of one resistance gene. A genetic linkage map, comprised 1,933 SNP markers, was created for all seven chromosomes of Ae. umbellulata using GBS. A major stem rust resistance QTL that explained 80% and 52% of the phenotypic variations for TTTTF and TTKSK, respectively, was detected on chromosome 2U of Ae. umbellulata. The novel resistance gene for stem rust identified in this study can be transferred to commercial wheat varieties assisted by the tightly linked markers identified here. These markers identified through our mapping approach can be a useful strategy to identify and track the resistance gene in marker-assisted breeding in wheat.

  3. Functional analysis of the Asian soybean rust resistance pathway mediated by Rpp2.

    Science.gov (United States)

    Pandey, Ajay K; Yang, Chunling; Zhang, Chunquan; Graham, Michelle A; Horstman, Heidi D; Lee, Yeunsook; Zabotina, Olga A; Hill, John H; Pedley, Kerry F; Whitham, Steven A

    2011-02-01

    Asian soybean rust is an aggressive foliar disease caused by the obligate biotrophic fungus Phakopsora pachyrhizi. On susceptible plants, the pathogen penetrates and colonizes leaf tissue, resulting in the formation of necrotic lesions and the development of numerous uredinia. The soybean Rpp2 gene confers resistance to specific isolates of P. pachyrhizi. Rpp2-mediated resistance limits the growth of the pathogen and is characterized by the formation of reddish-brown lesions and few uredinia. Using virus-induced gene silencing, we screened 140 candidate genes to identify those that play a role in Rpp2 resistance toward P. pachyrhizi. Candidate genes included putative orthologs to known defense-signaling genes, transcription factors, and genes previously found to be upregulated during the Rpp2 resistance response. We identified 11 genes that compromised Rpp2-mediated resistance when silenced, including GmEDS1, GmNPR1, GmPAD4, GmPAL1, five predicted transcription factors, an O-methyl transferase, and a cytochrome P450 monooxygenase. Together, our results provide new insight into the signaling and biochemical pathways required for resistance against P. pachyrhizi.

  4. Molecular mapping of soybean rust (Phakopsora pachyrhizi) resistance genes: discovery of a novel locus and alleles.

    Science.gov (United States)

    Garcia, Alexandre; Calvo, Eberson Sanches; de Souza Kiihl, Romeu Afonso; Harada, Arlindo; Hiromoto, Dario Minoru; Vieira, Luiz Gonzaga Esteves

    2008-08-01

    Soybean production in South and North America has recently been threatened by the widespread dissemination of soybean rust (SBR) caused by the fungus Phakopsora pachyrhizi. Currently, chemical spray containing fungicides is the only effective method to control the disease. This strategy increases production costs and exposes the environment to higher levels of fungicides. As a first step towards the development of SBR resistant cultivars, we studied the genetic basis of SBR resistance in five F2 populations derived from crossing the Brazilian-adapted susceptible cultivar CD 208 to each of five different plant introductions (PI 200487, PI 200526, PI 230970, PI 459025, PI 471904) carrying SBR-resistant genes (Rpp). Molecular mapping of SBR-resistance genes was performed in three of these PIs (PI 459025, PI 200526, PI 471904), and also in two other PIs (PI 200456 and 224270). The strategy mapped two genes present in PI 230970 and PI 459025, the original sources of Rpp2 and Rpp4, to linkage groups (LG) J and G, respectively. A new SBR resistance locus, rpp5 was mapped in the LG-N. Together, the genetic and molecular analysis suggested multiple alleles or closely linked genes that govern SBR resistance in soybean.

  5. Inheritance of resistance to Ug99 stem rust in wheat cultivar Norin 40 and genetic mapping of Sr42.

    Science.gov (United States)

    Ghazvini, Habibollah; Hiebert, Colin W; Zegeye, Taye; Liu, Sixin; Dilawari, Mridull; Tsilo, Toi; Anderson, James A; Rouse, Matthew N; Jin, Yue; Fetch, Tom

    2012-08-01

    Stem rust, caused by Puccinia graminis f. sp. tritici, is a devastating disease of wheat. The emergence of race TTKSK (Ug99) and new variants in Africa threatens wheat production worldwide. The best method of controlling stem rust is to deploy effective resistance genes in wheat cultivars. Few stem rust resistance (Sr) genes derived from the primary gene pool of wheat confer resistance to TTKSK. Norin 40, which carries Sr42, is resistant to TTKSK and variants TTKST and TTTSK. The goal of this study was to elucidate the inheritance of resistance to Ug99 in Norin 40 and map the Sr gene(s). A doubled haploid (DH) population of LMPG-6/Norin 40 was evaluated for resistance to the race TTKST. Segregation of 248 DH lines fitted a 1:1 ratio (χ (2) 1:1= 0.58, p = 0.45), indicating a single gene in Norin 40 conditioned resistance to Ug99. This was confirmed by an independent F(2:3) population also derived from the cross LMPG-6/Norin 40 where a 1:2:1 ratio (χ (2)1:2:1 = 0.69, p = 0.71) was observed following the inoculation with race TTKSK. Mapping with DNA markers located this gene to chromosome 6DS, the known location of Sr42. PCR marker FSD_RSA co-segregated with Sr42, and simple sequence repeat (SSR) marker BARC183 was closely linked (0.5 cM) to Sr42. A previous study found close linkage between FSD_RSA and SrCad, a temporarily designated gene that also confers resistance to Ug99, thus Sr42 may be the same gene or allelic. Marker FSD_RSA is suitable for marker-assisted selection (MAS) in wheat breeding programs to improve stem rust resistance, including Ug99.

  6. Genome-wide association study on stem rust resistance in Kazakh spring barley lines.

    Science.gov (United States)

    Turuspekov, Yerlan; Ormanbekova, Danara; Rsaliev, Aralbek; Abugalieva, Saule

    2016-01-27

    Stem rust (SR) is one of the most economically devastating barley diseases in Kazakhstan, and in some years it causes up to 50 % of yield losses. Routine conventional breeding for resistance to stem rust is almost always in progress in all Kazakhstan breeding stations. However, molecular marker based approach towards new SR resistance genes identification and relevant marker-assisted selection had never been employed in Kazakhstan yet. In this study, as a preliminary step the GWAS (genome-wide association study) mapping was applied in attempt to identify reliable SNP markers and quantitative trait loci (QTL) associated with resistance to SR. Barley collection of 92 commercial cultivars and promising lines was genotyped using a high-throughput single nucleotide polymorphism (9,000 SNP) Illumina iSelect array. 6,970 SNPs out of 9,000 total were polymorphic and scorable. 5,050 SNPs out of 6,970 passed filtering threshold and were used for association mapping (AM). All 92 accessions were phenotyped for resistance to SR by observing adult plants in artificially infected plots at the Research Institute for Biological Safety Problems in Dzhambul region of Kazakhstan. GLM analysis allowed the identification of 15 SNPs associated with the resistance at the heading time (HA) phase, and 2 SNPs at the seed's milky-waxy maturity (SM) phase. However, after application of 5 % Bonferroni multiple test correction, only 2 SNPs at the HA stage on the same position of chromosome 6H can be claimed as reliable markers for SR resistance. The MLM analysis after the Bonferroni correction did not reveal any associations in this study, although distribution lines in the quantile-quantile (QQ) plot indicates that overcorrection in the test due to both Q and K matrices usage. Obtained data suggest that genome wide genotyping of 92 spring barley accessions from Kazakhstan with 9 K Illumina SNP array was highly efficient. Linkage disequilibrium based mapping approach allowed the

  7. QTLs for resistance to the false brome rust Puccinia brachypodii in the model grass Brachypodium distachyon L.

    Science.gov (United States)

    Barbieri, Mirko; Marcel, Thierry C; Niks, Rients E; Francia, Enrico; Pasquariello, Marianna; Mazzamurro, Valentina; Garvin, David F; Pecchioni, Nicola

    2012-02-01

    The potential of the model grass Brachypodium distachyon L. (Brachypodium) for studying grass-pathogen interactions is still underexploited. We aimed to identify genomic regions in Brachypodium associated with quantitative resistance to the false brome rust fungus Puccinia brachypodii . The inbred lines Bd3-1 and Bd1-1, differing in their level of resistance to P. brachypodii, were crossed to develop an F(2) population. This was evaluated for reaction to a virulent isolate of P. brachypodii at both the seedling and advanced growth stages. To validate the results obtained on the F(2), resistance was quantified in F(2)-derived F(3) families in two experiments. Disease evaluations showed quantitative and transgressive segregation for resistance. A new AFLP-based Brachypodium linkage map consisting of 203 loci and spanning 812 cM was developed and anchored to the genome sequence with SSR and SNP markers. Three false brome rust resistance QTLs were identified on chromosomes 2, 3, and 4, and they were detected across experiments. This study is the first quantitative trait analysis in Brachypodium. Resistance to P. brachypodii was governed by a few QTLs: two acting at the seedling stage and one acting at both seedling and advanced growth stages. The results obtained offer perspectives to elucidate the molecular basis of quantitative resistance to rust fungi.

  8. The gene Sr33, an ortholog of barley Mla genes, encodes resistance to wheat stem rust race Ug99.

    Science.gov (United States)

    Periyannan, Sambasivam; Moore, John; Ayliffe, Michael; Bansal, Urmil; Wang, Xiaojing; Huang, Li; Deal, Karin; Luo, Mingcheng; Kong, Xiuying; Bariana, Harbans; Mago, Rohit; McIntosh, Robert; Dodds, Peter; Dvorak, Jan; Lagudah, Evans

    2013-08-16

    Wheat stem rust, caused by the fungus Puccinia graminis f. sp. tritici, afflicts bread wheat (Triticum aestivum). New virulent races collectively referred to as "Ug99" have emerged, which threaten global wheat production. The wheat gene Sr33, introgressed from the wild relative Aegilops tauschii into bread wheat, confers resistance to diverse stem rust races, including the Ug99 race group. We cloned Sr33, which encodes a coiled-coil, nucleotide-binding, leucine-rich repeat protein. Sr33 is orthologous to the barley (Hordeum vulgare) Mla mildew resistance genes that confer resistance to Blumeria graminis f. sp. hordei. The wheat Sr33 gene functions independently of RAR1, SGT1, and HSP90 chaperones. Haplotype analysis from diverse collections of Ae. tauschii placed the origin of Sr33 resistance near the southern coast of the Caspian Sea.

  9. Concerted action of two avirulent spore effectors activates Reaction to Puccinia graminis 1 (Rpg1)-mediated cereal stem rust resistance.

    Science.gov (United States)

    Nirmala, Jayaveeramuthu; Drader, Tom; Lawrence, Paulraj K; Yin, Chuntao; Hulbert, Scot; Steber, Camille M; Steffenson, Brian J; Szabo, Les J; von Wettstein, Diter; Kleinhofs, Andris

    2011-08-30

    The barley stem rust resistance gene Reaction to Puccinia graminis 1 (Rpg1), encoding a receptor-like kinase, confers durable resistance to the stem rust pathogen Puccinia graminis f. sp. tritici. The fungal urediniospores form adhesion structures with the leaf epidermal cells within 1 h of inoculation, followed by hyphae and haustorium formation. The RPG1 protein is constitutively expressed and not phosphorylated. On inoculation with avirulent urediniospores, it is phosphorylated in vivo within 5 min and subsequently degraded. Application of arginine-glycine-aspartic acid peptide loops prevented the formation of adhesion structures for spore attachment, the phosphorylation of RPG1, and germination of the viable spores. Arginine-glycine-aspartic acid affinity chromatography of proteins from the ungerminated avirulent rust spores led to the purification and identification of a protein with fibronectin type III and breast cancer type 1 susceptibility protein domains and a vacuolar protein sorting-associated protein 9 with a coupling of ubiquitin to endoplasmic reticulum degradation domain. Both proteins are required to induce in vivo phosphorylation and degradation of RPG1. Combined application of both proteins caused hypersensitive reaction on the stem rust-resistant cultivar Morex but not on the susceptible cultivar Steptoe. Expression studies indicated that mRNA of both genes are present in ungerminated urediniospores and are constitutively transcribed in sporelings, infected leaves, and haustoria in the investigated avirulent races. Evidence is presented that RPG1, in yeast, interacts with the two protein effectors from the urediniospores that activate cooperatively the stem rust resistance protein RPG1 long before haustoria formation.

  10. Characterization of kudzu (Pueraria spp.) resistance to Phakopsora pachyrhizi, the causal agent of soybean rust.

    Science.gov (United States)

    Jordan, Stephen A; Mailhot, Daniel J; Gevens, Amanda J; Marois, Jim J; Wright, David L; Harmon, Carrie L; Harmon, Philip F

    2010-09-01

    Kudzu (Pueraria spp.) is an accessory host for soybean rust (SBR) (caused by Phakopsora pachyrhizi) that is widespread throughout the southeastern United States. An expanded survey of kudzu sites was conducted in 2008 to determine the proportion of natural resistance in the north-Florida kudzu population. Of the 139 sites evaluated, approximately 18% were found to be free of SBR infection, while 23% had reduced sporulation. Ten accessions of kudzu from north-central Florida were characterized for their response to challenge by a single isolate of P. pachyrhizi under laboratory conditions. Three outcomes were observed: tan lesions with profuse sporulation (susceptible); reddish-brown lesions with delayed, reduced sporulation (resistant); and an immune response in which no lesions developed (immune). Of the 10 accessions, 6 were susceptible, 3 were immune, and 1 was resistant. Cytological examination revealed that resistant interactions were typified by early onset of a multicell hypersensitive response (HR) while typical immune interactions were the result of cell wall depositions that blocked penetration in combination with early onset of the HR. Quantitative real-time polymerase chain reaction was performed to determine the extent of colonization. After 15 days, there was 10-fold less P. pachyrhizi DNA present in resistant compared with susceptible kudzu, while the amount of P. pachyrhizi DNA present in the immune kudzu was below the detection level. Susceptible kudzu had approximately half the amount of P. pachyrhizi DNA present when compared with a susceptible soybean cultivar.

  11. Genetic Gain from Phenotypic and Genomic Selection for Quantitative Resistance to Stem Rust of Wheat

    Directory of Open Access Journals (Sweden)

    J. Rutkoski

    2015-07-01

    Full Text Available Stem rust of wheat ( L. caused by f. sp. Eriks. and E. Henn. is a globally important disease that can cause severe yield loss. Breeding for quantitative stem rust resistance (QSRR is important for developing cultivars with durable resistance. Genomic selection (GS could increase rates of genetic gain for quantitative traits, but few experiments comparing GS and phenotypic selection (PS have been conducted. Our objectives were to (i compare realized gain from GS based on markers only with that of PS for QSRR in spring wheat using equal selection intensities; (ii determine if gains agree with theoretical expectations; and (iii compare the impact of GS and PS on inbreeding, genetic variance, and correlated response for pseudo-black chaff (PBC, a correlated trait. Over 2 yr, two cycles of GS were performed in parallel with one cycle of PS, with each method replicated twice. For GS, markers were generated using genotyping-by-sequencing, the prediction model was initially trained using historical data, and the model was updated before the second GS cycle. Overall, GS and PS led to a 31 ± 11 and 42 ± 12% increase in QSRR and a 138 ± 22 and 180 ± 70% increase in PBC, respectively. Genetic gains were not significant but were in agreement with expectations. Per year, gains from GS and PS were equal, but GS led to significantly lower genetic variance. This shows that while GS and PS can lead to equal rates of short-term gains, GS can reduce genetic variance more rapidly. Further work to develop efficient GS implementation strategies in spring wheat is warranted.

  12. Simultaneous transfer, introgression, and genomic localization of genes for resistance to stem rust race TTKSK (Ug99) from Aegilops tauschii to wheat.

    Science.gov (United States)

    Olson, Eric L; Rouse, Matthew N; Pumphrey, Michael O; Bowden, Robert L; Gill, Bikram S; Poland, Jesse A

    2013-05-01

    Wheat production is currently threatened by widely virulent races of the wheat stem rust fungus, Puccinia graminis f. sp. tritici, that are part of the TTKSK (also known as 'Ug99') race group. The diploid D genome donor species Aegilops tauschii (2n = 2x = 14, DD) is a readily accessible source of resistance to TTKSK and its derivatives that can be transferred to hexaploid wheat, Triticum aestivum (2n = 6x = 42, AABBDD). To expedite transfer of TTKSK resistance from Ae. tauschii, a direct hybridization approach was undertaken that integrates gene transfer, mapping, and introgression into one process. Direct crossing of Ae. tauschii accessions with an elite wheat breeding line combines the steps of gene transfer and introgression while development of mapping populations during gene transfer enables the identification of closely linked markers. Direct crosses were made using TTKSK-resistant Ae. tauschii accessions TA1662 and PI 603225 as males and a stem rust-susceptible T. aestivum breeding line, KS05HW14, as a female. Embryo rescue enabled recovery of F1 (ABDD) plants that were backcrossed as females to the hexaploid recurrent parent. Stem rust-resistant BC1F1 plants from each Ae. tauschii donor source were used as males to generate BC2F1 mapping populations. Bulked segregant analysis of BC2F1 genotypes was performed using 70 SSR loci distributed across the D genome. Using this approach, stem rust resistance genes from both accessions were located on chromosome arm 1DS and mapped using SSR and EST-STS markers. An allelism test indicated the stem rust resistance gene transferred from PI 603225 is Sr33. Race specificity suggests the stem rust resistance gene transferred from TA1662 is unique and this gene has been temporarily designated SrTA1662. Stem rust resistance genes derived from TA1662 and PI 603225 have been made available with selectable molecular markers in genetic backgrounds suitable for stem rust resistance breeding.

  13. Searching for novel sources of field resistance to Ug99 and Ethiopian stem rust races in durum wheat via association mapping.

    Science.gov (United States)

    Letta, Tesfaye; Maccaferri, Marco; Badebo, Ayele; Ammar, Karim; Ricci, Andrea; Crossa, Jose; Tuberosa, Roberto

    2013-05-01

    Puccinia graminis f. sp. tritici, the causative agent of stem rust in wheat, is a devastating disease of durum wheat. While more than 50 stem rust resistance (Sr) loci have been identified in wheat, only a few of them have remained effective against Ug99 (TTKSK race) and other durum-specific Ethiopian races. An association mapping (AM) approach based on 183 diverse durum wheat accessions was utilized to identify resistance loci for stem rust response in Ethiopia over four field-evaluation seasons and artificial inoculation with Ug99 and a mixture of durum-specific races. The panel was profiled with simple sequence repeat, Diversity Arrays Technology and sequence-tagged site markers (1,253 in total). The resistance turned out to be oligogenic, with twelve QTL-tagging markers that were significant (P stem rust resistance under field conditions.

  14. Identification of a new soybean rust resistance gene in PI 567102B.

    Science.gov (United States)

    Li, Shuxian; Smith, James R; Ray, Jeffery D; Frederick, Reid D

    2012-06-01

    Soybean rust (SBR) caused by Phakopsora pachyrhizi Syd. and P. Syd. is one of the most economically important diseases of soybean (Glycine max (L.) Merr.). Durable resistance to P. pachyrhizi is the most effective long-term strategy to control SBR. The objective of this study was to investigate the genetics of resistance to P. pachyrhizi in soybean accession PI 567102B. This accession was previously identified as resistant to SBR in Paraguay and to P. pachyrhizi isolates from seven states in the USA (Alabama, Florida, Georgia, Louisiana, Mississippi, South Carolina, and Texas). Analysis of two independent populations, one in which F(2) phenotypes were inferred from F(2)-derived F(3) (F(2:3)) families and the other in which F(2) plants had phenotypes measured directly, showed that the resistance in PI 567102B was controlled by a single dominant gene. Two different isolates (MS06-1 and LA04-1) at different locations (Stoneville, MS and Ft. Detrick, MD) were used to independently assay the two populations. Linkage analysis of both populations indicated that the resistance locus was located on chromosome 18 (formerly linkage group G), but at a different location than either Rpp1 or Rpp4, which were previously mapped to this linkage group. Therefore, the SBR resistance in PI 567102B appeared to be conditioned by a previously unreported locus, with an underlying single dominant gene inferred. We propose this gene to be designated Rpp6. Incorporating Rpp6 into improved soybean cultivars may have wide benefits as PI 567102B has been shown to provide resistance to P. pachyrhizi isolates from Paraguay and the US.

  15. Stability of rust resistance and yield potential of some icarda bread wheat lines in Pakistan

    International Nuclear Information System (INIS)

    Shah, S.J.A.; Khan, A.J.; Azam, F.; Mirza, J.I.; Atiq-ur-Rehman

    2003-01-01

    Thirty bread wheat lines resistant to Yellow rust (Yr) were selected after careful screening from two ICARDA nurseries during 1998 - 1999, Rabi season at Nuclear Institute for Food and Agriculture (NIFA), Tarnab, Peshawar under severe disease pressure. In the following crop cycle, these selections were again field evaluated for stability and effectiveness of Yr resistance at multilocations while their yield potential was ascertained at Tarnab in two different trials with Tatara as commercial check. Results revealed that uniformity was found in the potential behavior of 23 lines (77%) in both the cropping seasons against Yr. This included some high yielding (up to 7067 kg/ ha) and low yielding lines (up to 4333 kg / ha) when compared with the check (6089 kg / ha). Yield potential of some high yielding lines with stable Yr resistance should be further evaluated over sites and seasons for wide adaptability, under national uniform testing in order to select and deploy future varieties to combat Yr for acquiring food security in Pakistan.(author)

  16. Characterization of nonhost resistance of Arabidopsis to the Asian soybean rust.

    Science.gov (United States)

    Loehrer, Marco; Langenbach, Caspar; Goellner, Katharina; Conrath, Uwe; Schaffrath, Ulrich

    2008-11-01

    Asian soybean rust (ASR), caused by Phakopsora pachyrhizi, is a devastating disease of soybean. We report the use of the nonhost plant Arabidopsis thaliana to identify the genetic basis of resistance to P. pachyrhizi. Upon attack by P. pachyrhizi, epidermal cells of wild-type Arabidopsis accumulated H2O2, which likely orchestrates the frequently observed epidermal cell death. However, even when epidermal cell death occurred, fungal hyphae grew on and infection was terminated at the mesophyll boundary. These events were associated with expression of PDF1.2, suggesting that P. pachyrhizi, an ostensible biotroph, mimics aspects of a necrotroph. Extensive colonization of the mesophyll occurred in Arabidopsis pen mutants with defective penetration resistance. Although haustoria were found occasionally in mesophyll cells, the successful establishment of biotrophy failed, as evidenced by the cessation of fungal growth. Double mutants affected in either jasmonic acid or salicylic acid signaling in the pen3-1 background revealed the involvement of both pathways in nonhost resistance (NHR) of Arabidopsis to P. pachyrhizi. Interestingly, expression of AtNHL10, a gene that is expressed in tissue undergoing the hypersensitive response, was only triggered in infected pen3-1 mutants. Thus, a suppression of P. pachyrhizi-derived effectors by PEN3 can be inferred. Our results demonstrate that Arabidopsis can be used to study mechanisms of NHR to ASR.

  17. Simultaneous Transfer of Leaf Rust and Powdery Mildew Resistance Genes from Hexaploid Triticale Cultivar Sorento into Bread Wheat

    Directory of Open Access Journals (Sweden)

    Feng Li

    2018-02-01

    Full Text Available Wheat powdery mildew, caused by Blumeria graminis f. sp. tritici, and wheat leaf rust, caused by Puccinia triticina Eriks, are two important diseases that severely threaten wheat production. Sorento, a hexaploid triticale cultivar from Poland, shows high resistance to the wheat powdery mildew isolate E09 and the leaf rust isolate PHT in Beijing, China. To introduce resistance genes into common wheat, Sorento was crossed with wheat line Xuezao, which is susceptible to both diseases, and the F1 hybrids were then backcrossed with Xuezao as the recurrent male parent. By marker analysis, we demonstrate that the long arm of the 2R (2RL chromosome confers resistance to both the leaf rust and powdery mildew isolates at adult-plant and seedling stages, while the long arm of 4R (4RL confers resistance only to powdery mildew at both stages. The chromosomal composition of BC2F3 plants containing 2R or 2RL and 4R or 4RL in the form of substitution and translocation were confirmed by GISH (genomic in situ hybridization and FISH (fluorescence in situ hybridization. Monosomic and disomic substitutions of a wheat chromosome with chromosome 2R or 4R, as well as one 4RS-4DL/4DS-4RL reciprocal translocation homozigote and one 2RL-1DL translocation hemizigote, were recovered. Such germplasms are of great value in wheat improvement.

  18. Markers Linked to Wheat Stem Rust Resistance Gene Sr11 Effective to Puccinia graminis f. sp. tritici Race TKTTF.

    Science.gov (United States)

    Nirmala, Jayaveeramuthu; Chao, Shiaoman; Olivera, Pablo; Babiker, Ebrahiem M; Abeyo, Bekele; Tadesse, Zerihun; Imtiaz, Muhammad; Talbert, Luther; Blake, Nancy K; Akhunov, Eduard; Pumphrey, Michael O; Jin, Yue; Rouse, Matthew N

    2016-11-01

    Wheat stem rust, caused by Puccinia graminis f. sp. tritici, can cause severe yield losses on susceptible wheat varieties and cultivars. Although stem rust can be controlled by the use of genetic resistance, population dynamics of P. graminis f. sp. tritici can frequently lead to defeat of wheat stem rust resistance genes. P. graminis f. sp. tritici race TKTTF caused a severe epidemic in Ethiopia on Ug99-resistant 'Digalu' in 2013 and 2014. The gene Sr11 confers resistance to race TKTTF and is present in 'Gabo 56'. We identified seven single-nucleotide polymorphism (SNP) markers linked to Sr11 from a cross between Gabo 56 and 'Chinese Spring' exploiting a 90K Infinium iSelect Custom beadchip. Five SNP markers were validated on a 'Berkut'/'Scalavatis' population that segregated for Sr11, using KBioscience competitive allele-specific polymerase chain reaction (KASP) assays. Two of the SNP markers, KASP_6BL_IWB10724 and KASP_6BL_IWB72471, were predictive of Sr11 among wheat genetic stocks, cultivars, and breeding lines from North America, Ethiopia, and Pakistan. These markers can be utilized to select for Sr11 in wheat breeding and to detect the presence of Sr11 in uncharacterized germplasm.

  19. Mapping of SrTm4, a Recessive Stem Rust Resistance Gene from Diploid Wheat Effective to Ug99.

    Science.gov (United States)

    Briggs, Jordan; Chen, Shisheng; Zhang, Wenjun; Nelson, Sarah; Dubcovsky, Jorge; Rouse, Matthew N

    2015-10-01

    Race TTKSK (or Ug99) of Puccinia graminis f. sp. tritici, the causal agent of wheat stem rust, is a serious threat to wheat production worldwide. Diploid wheat, Triticum monococcum (genome Am), has been utilized previously for the introgression of stem rust resistance genes Sr21, Sr22, and Sr35. Multipathotype seedling tests of biparental populations demonstrated that T. monococcum accession PI 306540 collected in Romania contains a recessive resistance gene effective to all P. graminis f. sp. tritici races screened, including race TTKSK. We will refer to this gene as SrTm4, which is the fourth stem rust resistance gene characterized from T. monococcum. Using two mapping populations derived from crosses of PI 272557×PI 306540 and G3116×PI 306540, we mapped SrTm4 on chromosome arm 2AmL within a 2.1 cM interval flanked by sequence-tagged markers BQ461276 and DR732348, which corresponds to a 240-kb region in Brachypodium chromosome 5. The eight microsatellite and nine sequence-tagged markers linked to SrTm4 will facilitate the introgression and accelerate the deployment of SrTm4-mediated Ug99 resistance in wheat breeding programs.

  20. Assessment of Relationship Between Bacterial Stripe Resistance And Leaf Protein Bands In Rice (Oryza sativa L.) Varieties.

    Science.gov (United States)

    Talei, D.; Fotokian, M. H.

    2008-01-01

    Bacterial stripe as a new rice disease in Iran is more frequent nowadays. The objective of this study was to assessment of resistance in rice varieties together with evaluating of zymogram bands resulted from SDS PAGE electrophoresis of leaf proteins. For this purpose, 30 lines were tested in a randomized complete block design with three replications. The analysis of variance showed that there was significant difference between genotypes for resistance. Mean compare based on field results revealed that Domsiyah had the lowest resistance while Nemat and 7162 demonstrated the highest resistance. Laboratory results showed that there were significant difference between protein bands resulted from sensitive and resistance verities. Twenty bands were observed through SDS PAGE electrophoresis of leaf proteins. The 9th and 12th bands were found in sensitive varieties while were not in resistance genotypes. According to the results of this study, 7162 variety can be considered as the sources of resistance in breeding programs. Meanwhile attending to existence of 9th and 12th bands in sensitive varieties, resistance against bacterial stripe of rice maybe influenced by absence of these proteins.

  1. Identification and evaluation of resistance to powdery mildew and yellow rust in a wheat mapping population

    Science.gov (United States)

    Zhang, Xu; Wang, Jirui; Luo, Mingcheng; Yang, Mujun; Wang, Hua; Xiang, Libo; Zeng, Fansong; Yu, Dazhao; Fu, Daolin

    2017-01-01

    Deployment of cultivars with genetic resistance is an effective approach to control the diseases of powdery mildew (PM) and yellow rust (YR). Chinese wheat cultivar XK0106 exhibits high levels of resistance to both diseases, while cultivar E07901 has partial, adult plant resistance (APR). The aim of this study was to map resistance loci derived from the two cultivars and analyze their effects against PM and YR in a range of environments. A doubled haploid population (388 lines) was used to develop a framework map consisting of 117 SSR markers, while a much higher density map using the 90K Illumina iSelect SNP array was produced with a subset of 80 randomly selected lines. Seedling resistance was characterized against a range of PM and YR isolates, while field scores in multiple environments were used to characterize APR. Composite interval mapping (CIM) of seedling PM scores identified two QTLs (QPm.haas-6A and QPm.haas-2A), the former being located at the Pm21 locus. These QTLs were also significant in field scores, as were Qpm.haas-3A and QPm.haas-5A. QYr.haas-1B-1 and QYr.haas-2A were identified in field scores of YR and were located at the Yr24/26 and Yr17 chromosomal regions respectively. A second 1B QTL, QYr.haas-1B-2 was also identified. QPm.haas-2A and QYr.haas-1B-2 are likely to be new QTLs that have not been previously identified. Effects of the QTLs were further investigated in multiple environments through the testing of selected lines predicted to contain various QTL combinations. Significant additive interactions between the PM QTLs highlighted the ability to pyramid these loci to provide higher level of resistance. Interactions between the YR QTLs gave insights into the pathogen populations in the different locations as well as showing genetic interactions between these loci. PMID:28542459

  2. Identification and evaluation of resistance to powdery mildew and yellow rust in a wheat mapping population.

    Directory of Open Access Journals (Sweden)

    Lijun Yang

    Full Text Available Deployment of cultivars with genetic resistance is an effective approach to control the diseases of powdery mildew (PM and yellow rust (YR. Chinese wheat cultivar XK0106 exhibits high levels of resistance to both diseases, while cultivar E07901 has partial, adult plant resistance (APR. The aim of this study was to map resistance loci derived from the two cultivars and analyze their effects against PM and YR in a range of environments. A doubled haploid population (388 lines was used to develop a framework map consisting of 117 SSR markers, while a much higher density map using the 90K Illumina iSelect SNP array was produced with a subset of 80 randomly selected lines. Seedling resistance was characterized against a range of PM and YR isolates, while field scores in multiple environments were used to characterize APR. Composite interval mapping (CIM of seedling PM scores identified two QTLs (QPm.haas-6A and QPm.haas-2A, the former being located at the Pm21 locus. These QTLs were also significant in field scores, as were Qpm.haas-3A and QPm.haas-5A. QYr.haas-1B-1 and QYr.haas-2A were identified in field scores of YR and were located at the Yr24/26 and Yr17 chromosomal regions respectively. A second 1B QTL, QYr.haas-1B-2 was also identified. QPm.haas-2A and QYr.haas-1B-2 are likely to be new QTLs that have not been previously identified. Effects of the QTLs were further investigated in multiple environments through the testing of selected lines predicted to contain various QTL combinations. Significant additive interactions between the PM QTLs highlighted the ability to pyramid these loci to provide higher level of resistance. Interactions between the YR QTLs gave insights into the pathogen populations in the different locations as well as showing genetic interactions between these loci.

  3. Mapping resistance to the Ug99 race group of the stem rust pathogen in a spring wheat landrace.

    Science.gov (United States)

    Babiker, E M; Gordon, T C; Chao, S; Newcomb, M; Rouse, M N; Jin, Y; Wanyera, R; Acevedo, M; Brown-Guedira, G; Williamson, S; Bonman, J M

    2015-04-01

    A new gene for Ug99 resistance from wheat landrace PI 374670 was detected on the long arm of chromosome 7A. Wheat landrace PI 374670 has seedling and field resistance to stem rust caused by Puccinia graminis f. sp tritici Eriks. & E. Henn (Pgt) race TTKSK. To elucidate the inheritance of resistance, 216 BC1F2 families, 192 double haploid (DH) lines, and 185 recombinant inbred lines (RILs) were developed by crossing PI 374670 and the susceptible line LMPG-6. The parents and progeny were evaluated for seedling resistance to Pgt races TTKSK, MCCFC, and TPMKC. The DH lines were tested in field stem rust nurseries in Kenya and Ethiopia. The DH lines were genotyped with the 90K wheat iSelect SNP genotyping platform. Goodness-of-fit tests indicated that a single dominant gene in PI 374670 conditioned seedling resistance to the three Pgt races. The seedling resistance locus mapped to the long arm of chromosome 7A and this result was verified in the RIL population screened with the flanking SNP markers using KASP assays. In the same region, a major QTL for field resistance was detected in a 7.7 cM interval and explained 34-54 and 29-36% of the variation in Kenya and Ethiopia, respectively. Results from tests with specific Pgt races and the csIH81 marker showed that the resistance was not due to Sr22. Thus, a new stem rust resistance gene or allele, either closely linked or allelic to Sr15, is responsible for the seedling and field resistance of PI 374670 to Ug99.

  4. Identification and characterization of resistance to yellow rust and powdery mildew in wild emmer wheat and their transfer to bread wheat

    NARCIS (Netherlands)

    Silfhout, van C.H.

    1989-01-01

    In wild emmer wheat three different kinds of genes for resistance to yellow rust were found, namely genes causing overall resistance, genes causing adult-plant resistance and genes which induce resistance detectable at higher temperatures. At least eleven different and probably novel major

  5. Preliminary evaluation of daylily cultivars for rust resistance in a landscaping setting

    Science.gov (United States)

    A large, established landscape collection of 575 newer cultivars was evaluated for daylily rust which had not been sprayed with fungicides to prevent infection during 2013. The warm, damp summer of 2013 was ideal for spread of daylily rust. A total of 119 of the 575 cultivars received a median ratin...

  6. Resistance to white pine blister rust in Pinus flexilis and P

    Science.gov (United States)

    Anna W. Schoettle; Richard A. Sniezko; Angelia Kegley; Jerry Hill; Kelly S. Burns

    2010-01-01

    The non-native fungus Cronartium ribicola, that causes white pine blister rust (WPBR), is impacting or threatening limber pine, Pinus flexilis, and Rocky Mountain bristlecone pine, Pinus aristata. In the Southern Rockies, where the rust invasion is still expanding, we have the opportunity to be proactive and prepare the landscape for invasion. Genetic...

  7. 29-34 Yellow Rust Resistance in Advanced Lines and Commercial ...

    African Journals Online (AJOL)

    Abstract: Bread wheat (Triticum aestivum L.) cultivars often succumb to yellow rust (Puccinia striiformis f.sp. tritici Westend.) soon after their release for commercial production, especially in the highlands of south-eastern Ethiopia. Variety diversification may buffer the ever evolving new races of the yellow rust pathogen.

  8. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  9. Identification of a robust molecular marker for the detection of the stem rust resistance gene Sr45 in common wheat.

    Science.gov (United States)

    Periyannan, Sambasivam; Bansal, Urmil; Bariana, Harbans; Deal, Karin; Luo, Ming-Cheng; Dvorak, Jan; Lagudah, Evans

    2014-04-01

    Fine mapping of the Ug99 effective stem rust resistance gene Sr45 introgressed into common wheat from the D -genome goatgrass Aegilops tauschii. Stem rust resistance gene Sr45, discovered in Aegilops tauschii, the progenitor of the D -genome of wheat, is effective against commercially important Puccinia graminis f. sp. tritici races prevalent in Australia, South Africa and the Ug99 race group. A synthetic hexaploid wheat (RL5406) generated by crossing Ae. tauschii accession RL5289 (carrying Sr45 and the leaf rust resistance gene Lr21) with a tetraploid experimental line 'TetraCanthatch' was previously used as the source in the transfer of these rust resistance genes to other hexaploid cultivars. Previous genetic studies on hexaploid wheats mapped Sr45 on the short arm of chromosome 1D with the following gene order: centromere-Sr45-Sr33-Lr21-telomere. To identify closely linked markers, we fine mapped the Sr45 region in a large mapping population generated by crossing CS1D5406 (disomic substitution line with chromosome 1D of RL5406 substituted for Chinese Spring 1D) with Chinese Spring. Closely linked markers based on 1DS-specific microsatellites, expressed sequence tags and AFLP were useful in the delineation of the Sr45 region. Sequences from an AFLP marker amplified a fragment that was linked with Sr45 at a distance of 0.39 cM. The fragment was located in a bacterial artificial chromosome clone of contig (ctg)2981 of the Ae. tauschii accession AL8/78 physical map. A PCR marker derived from clone MI221O11 of ctg2981 amplified 1DS-specific sequence that harboured an 18-bp indel polymorphism that specifically tagged the Sr45 carrying haplotype. This new Sr45 marker can be combined with a previously reported marker for Lr21, which will facilitate selecting Sr45 and Lr21 in breeding populations.

  10. New Seeds are Resistant to Wheat Stem Rust (Ug99) Multinational Programme Supported by FAO and IAEA

    International Nuclear Information System (INIS)

    2013-01-01

    Full text: A multinational effort supported by the International Atomic Energy Agency and the U.N. Food and Agriculture Organization marked a key milestone this week when a Kenyan university debuted two new varieties of disease-resistant wheat to the nation's farmers. Over the past two days, thousands of Kenyan farmers have visited Eldoret University in western Kenya for a two-day agriculture fair highlighting the latest farming technologies. Supporting the development of the new varieties were the IAEA's Technical Cooperation Department and the Joint FAO/IAEA Programme of Nuclear Techniques in Food and Agriculture. They manage an interregional Technical Cooperation project to develop varieties of wheat that are resistant to a devastating type of fungus, causing a disease known as wheat stem rust. Wheat stem rust under control for over 30 years, but a resurgence of the disease was discovered in 1999 in Uganda that swiftly spread to neighbouring Kenya. The wheat stem rust, caused by the strain of the fungus known as Ug99, named after its place and year of origin, has since spread to Iran, Yemen and South Africa and threatens crops as far away as India as spores are carried by wind. Parasitic rusts threaten global wheat production, reducing plant growth and crop yields. The disease can destroy up to 70-100 percent of the yield of wheat crop if not prevented. 'Improving food security in developing countries through the use of nuclear techniques is an important priority of the IAEA', said IAEA Director General Yukiya Amano. 'I am pleased that we have been able to make an important contribution to fighting wheat rust'. 'Wheat rusts, particularly the Ug99 strain, are a major threat to food security because rust epidemics can result in devastating yield losses. This international project involving affected countries, plant scientists and breeders and international organizations is a major breakthrough. It clearly shows the benefits of FAO/IAEA collaboration and that

  11. Identification of new resistance loci to African stem rust race TTKSK in tetraploid wheats based on linkage and genome-wide association mapping

    Directory of Open Access Journals (Sweden)

    Giovanni eLaidò

    2015-12-01

    Full Text Available Stem rust, caused by Puccinia graminis Pers. f. sp. tritici Eriks. & E. Henn. (Pgt, is one of the most destructive diseases of wheat. Races of the pathogen in the Ug99 lineage are of international concern due to their virulence for widely used stem rust resistance genes and their spread throughout Africa. Disease resistant cultivars provide one of the best means for controlling stem rust. To identify quantitative trait loci (QTL conferring resistance to African stem rust race TTKSK at the seedling stage, we evaluated an association mapping (AM panel consisting of 230 tetraploid wheat accessions under greenhouse conditions. A high level of phenotypic variation was observed in response to race TTKSK in the AM panel, allowing for genome-wide association mapping of resistance QTL in wild, landrace, and cultivated tetraploid wheats. Thirty-five resistance QTL were identified on all chromosomes, and seventeen are of particular interest as identified by multiple associations. Many of the identified resistance loci were coincident with previously identified rust resistance genes; however, nine on chromosomes 1AL, 2AL, 4AL, 5BL and 7BS may be novel. To validate AM results, a biparental population of 146 recombinant inbred lines was also considered, which derived from a cross between the resistant

  12. Identification of New Resistance Loci to African Stem Rust Race TTKSK in Tetraploid Wheats Based on Linkage and Genome-Wide Association Mapping.

    Science.gov (United States)

    Laidò, Giovanni; Panio, Giosuè; Marone, Daniela; Russo, Maria A; Ficco, Donatella B M; Giovanniello, Valentina; Cattivelli, Luigi; Steffenson, Brian; de Vita, Pasquale; Mastrangelo, Anna M

    2015-01-01

    Stem rust, caused by Puccinia graminis Pers. f. sp. tritici Eriks. and E. Henn. (Pgt), is one of the most destructive diseases of wheat. Races of the pathogen in the "Ug99 lineage" are of international concern due to their virulence for widely used stem rust resistance genes and their spread throughout Africa. Disease resistant cultivars provide one of the best means for controlling stem rust. To identify quantitative trait loci (QTL) conferring resistance to African stem rust race TTKSK at the seedling stage, we evaluated an association mapping (AM) panel consisting of 230 tetraploid wheat accessions under greenhouse conditions. A high level of phenotypic variation was observed in response to race TTKSK in the AM panel, allowing for genome-wide association mapping of resistance QTL in wild, landrace, and cultivated tetraploid wheats. Thirty-five resistance QTL were identified on all chromosomes, and seventeen are of particular interest as identified by multiple associations. Many of the identified resistance loci were coincident with previously identified rust resistance genes; however, nine on chromosomes 1AL, 2AL, 4AL, 5BL, and 7BS may be novel. To validate AM results, a biparental population of 146 recombinant inbred lines was also considered, which derived from a cross between the resistant cultivar "Cirillo" and susceptible "Neodur." The stem rust resistance of Cirillo was conferred by a single gene on the distal region of chromosome arm 6AL in an interval map coincident with the resistance gene Sr13, and confirmed one of the resistance loci identified by AM. A search for candidate resistance genes was carried out in the regions where QTL were identified, and many of them corresponded to NBS-LRR genes and protein kinases with LRR domains. The results obtained in the present study are of great interest as a high level of genetic variability for resistance to race TTKSK was described in a germplasm panel comprising most of the tetraploid wheat sub-species.

  13. QTL-seq approach identified genomic regions and diagnostic markers for rust and late leaf spot resistance in groundnut (Arachis hypogaea L.).

    Science.gov (United States)

    Pandey, Manish K; Khan, Aamir W; Singh, Vikas K; Vishwakarma, Manish K; Shasidhar, Yaduru; Kumar, Vinay; Garg, Vanika; Bhat, Ramesh S; Chitikineni, Annapurna; Janila, Pasupuleti; Guo, Baozhu; Varshney, Rajeev K

    2017-08-01

    Rust and late leaf spot (LLS) are the two major foliar fungal diseases in groundnut, and their co-occurrence leads to significant yield loss in addition to the deterioration of fodder quality. To identify candidate genomic regions controlling resistance to rust and LLS, whole-genome resequencing (WGRS)-based approach referred as 'QTL-seq' was deployed. A total of 231.67 Gb raw and 192.10 Gb of clean sequence data were generated through WGRS of resistant parent and the resistant and susceptible bulks for rust and LLS. Sequence analysis of bulks for rust and LLS with reference-guided resistant parent assembly identified 3136 single-nucleotide polymorphisms (SNPs) for rust and 66 SNPs for LLS with the read depth of ≥7 in the identified genomic region on pseudomolecule A03. Detailed analysis identified 30 nonsynonymous SNPs affecting 25 candidate genes for rust resistance, while 14 intronic and three synonymous SNPs affecting nine candidate genes for LLS resistance. Subsequently, allele-specific diagnostic markers were identified for three SNPs for rust resistance and one SNP for LLS resistance. Genotyping of one RIL population (TAG 24 × GPBD 4) with these four diagnostic markers revealed higher phenotypic variation for these two diseases. These results suggest usefulness of QTL-seq approach in precise and rapid identification of candidate genomic regions and development of diagnostic markers for breeding applications. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  14. Discovery of a Novel Stem Rust Resistance Allele in Durum Wheat that Exhibits Differential Reactions to Ug99 Isolates

    Directory of Open Access Journals (Sweden)

    Jayaveeramuthu Nirmala

    2017-10-01

    Full Text Available Wheat stem rust, caused by Puccinia graminis f. sp. tritici Eriks. & E. Henn, can incur yield losses in susceptible cultivars of durum wheat, Triticum turgidum ssp. durum (Desf. Husnot. Although several durum cultivars possess the stem rust resistance gene Sr13, additional genes in durum wheat effective against emerging virulent races have not been described. Durum line 8155-B1 confers resistance against the P. graminis f. sp. tritici race TTKST, the variant race of the Ug99 race group with additional virulence to wheat stem rust resistance gene Sr24. However, 8155-B1 does not confer resistance to the first-described race in the Ug99 race group: TTKSK. We mapped a single gene conferring resistance in 8155-B1 against race TTKST, Sr8155B1, to chromosome arm 6AS by utilizing Rusty/8155-B1 and Rusty*2/8155-B1 populations and the 90K Infinium iSelect Custom bead chip supplemented by KASP assays. One marker, KASP_6AS_IWB10558, cosegregated with Sr8155B1 in both populations and correctly predicted Sr8155B1 presence or absence in 11 durum cultivars tested. We confirmed the presence of Sr8155B1 in cultivar Mountrail by mapping in the population Choteau/Mountrail. The marker developed in this study could be used to predict the presence of resistance to race TTKST in uncharacterized durum breeding lines, and also to combine Sr8155B1 with resistance genes effective to Ug99 such as Sr13. The map location of Sr8155B1 cannot rule out the possibility that this gene is an allele at the Sr8 locus. However, race specificity indicates that Sr8155B1 is different from the known alleles Sr8a and Sr8b.

  15. Discovery of a Novel Stem Rust Resistance Allele in Durum Wheat that Exhibits Differential Reactions to Ug99 Isolates.

    Science.gov (United States)

    Nirmala, Jayaveeramuthu; Saini, Jyoti; Newcomb, Maria; Olivera, Pablo; Gale, Sam; Klindworth, Daryl; Elias, Elias; Talbert, Luther; Chao, Shiaoman; Faris, Justin; Xu, Steven; Jin, Yue; Rouse, Matthew N

    2017-10-05

    Wheat stem rust, caused by Puccinia graminis f. sp. tritici Eriks. & E. Henn, can incur yield losses in susceptible cultivars of durum wheat, Triticum turgidum ssp. durum (Desf.) Husnot. Although several durum cultivars possess the stem rust resistance gene Sr13 , additional genes in durum wheat effective against emerging virulent races have not been described. Durum line 8155-B1 confers resistance against the P. graminis f. sp. tritici race TTKST, the variant race of the Ug99 race group with additional virulence to wheat stem rust resistance gene Sr24 However, 8155-B1 does not confer resistance to the first-described race in the Ug99 race group: TTKSK. We mapped a single gene conferring resistance in 8155-B1 against race TTKST, Sr8155B1 , to chromosome arm 6AS by utilizing Rusty/8155-B1 and Rusty*2/8155-B1 populations and the 90K Infinium iSelect Custom bead chip supplemented by KASP assays. One marker, KASP_6AS_IWB10558 , cosegregated with Sr8155B1 in both populations and correctly predicted Sr8155B1 presence or absence in 11 durum cultivars tested. We confirmed the presence of Sr8155B1 in cultivar Mountrail by mapping in the population Choteau/Mountrail. The marker developed in this study could be used to predict the presence of resistance to race TTKST in uncharacterized durum breeding lines, and also to combine Sr8155B1 with resistance genes effective to Ug99 such as Sr13 The map location of Sr8155B1 cannot rule out the possibility that this gene is an allele at the Sr8 locus. However, race specificity indicates that Sr8155B1 is different from the known alleles Sr8a and Sr8b . Copyright © 2017 Nirmala et al.

  16. Sensory Description of Cultivars (Coffea Arabica L. Resistant to Rust and Its Correlation with Caffeine, Trigonelline, and Chlorogenic Acid Compounds

    Directory of Open Access Journals (Sweden)

    Larissa de Oliveira Fassio

    2016-01-01

    Full Text Available Considering the importance of the chemical compounds in Arabica coffee beans in the definition of the drink sensory quality and authentication of coffee regions, the aim of this study was to evaluate, from principal component analysis—PCA—if there is a relation between the caffeine, trigonelline, and chlorogenic acid (5-CQA content and the sensory attributes of the drink, and in this context, enabling the differentiation of cultivars in two coffee-producing regions of Brazil. We evaluated seven rust-resistant Coffea arabica cultivars, and two rust-susceptible cultivars in two cultivation environments: Lavras, in the southern region of Minas Gerais state, and Patrocinio in the Cerrado region of Minas Gerais. The flavor and acidity were determinant for differentiation of the cultivars and their interaction with the evaluated environments. Cultivars Araponga MG1, Catigua MG2, and Catigua MG1 are the most suitable for the production of specialty coffee in the state of Minas Gerais. A poor correlation was found between caffeine, trigonelline, 5-CQA contents, and fragrance, flavor, acidity, body, and final score attributes. However, these compounds enabled the differentiation of the environments. The PCA indicated superiority in the sensory quality of cultivars resistant to rust, compared to the control, Bourbon Amarelo, and Topázio MG1190.

  17. Genetic Mapping of Stem Rust Resistance to Puccinia graminis f. sp. tritici Race TRTTF in the Canadian Wheat Cultivar Harvest.

    Science.gov (United States)

    Hiebert, Colin W; Rouse, Matthew N; Nirmala, Jayaveeramuthu; Fetch, Tom

    2017-02-01

    Stem rust, caused by Puccinia graminis f. sp. tritici, is a destructive disease of wheat that can be controlled by deploying effective stem rust resistance (Sr) genes. Highly virulent races of P. graminis f. sp. tritici in Africa have been detected and characterized. These include race TRTTF and the Ug99 group of races such as TTKSK. Several Canadian and U.S. spring wheat cultivars, including the widely grown Canadian cultivar 'Harvest', are resistant to TRTTF. However, the genetic basis of resistance to TRTTF in Canadian and U.S. spring wheat cultivars is unknown. The objectives of this study were to determine the number of Sr genes involved in TRTTF resistance in Harvest, genetically map the resistance with DNA markers, and use markers to assess the distribution of that resistance in a panel of Canadian cultivars. A doubled haploid (DH) population was produced from the cross LMPG-6S/Harvest. The DH population was tested with race TRTTF at the seedling stage. Of 92 DH progeny evaluated, 46 were resistant and 46 were susceptible which perfectly fit a 1:1 ratio indicating a single Sr gene was responsible for conferring resistance to TRTTF in Harvest. Mapping with single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers placed the resistance gene distally on the chromosome 6AS genetic map, which corresponded to the location reported for Sr8. SSR marker gwm459 and 30 cosegregating SNP markers showed the closest linkage, mapping 2.2 cM proximal to the Sr gene. Gene Sr8a confers resistance to TRTTF and may account for the resistance in Harvest. Testing a panel of Canadian wheat cultivars with four SNP markers closely linked to resistance to TRTTF suggested that the resistance present in Harvest is present in many Canadian cultivars. Two of these SNP markers were also predictive of TRTTF resistance in a panel of 241 spring wheat lines from the United States, Canada, and Mexico.

  18. Fine mapping of the Bsr1 barley stripe mosaic virus resistance gene in the model grass Brachypodium distachyon.

    Directory of Open Access Journals (Sweden)

    Yu Cui

    Full Text Available The ND18 strain of Barley stripe mosaic virus (BSMV infects several lines of Brachypodium distachyon, a recently developed model system for genomics research in cereals. Among the inbred lines tested, Bd3-1 is highly resistant at 20 to 25 °C, whereas Bd21 is susceptible and infection results in an intense mosaic phenotype accompanied by high levels of replicating virus. We generated an F(6:7 recombinant inbred line (RIL population from a cross between Bd3-1 and Bd21 and used the RILs, and an F(2 population of a second Bd21 × Bd3-1 cross to evaluate the inheritance of resistance. The results indicate that resistance segregates as expected for a single dominant gene, which we have designated Barley stripe mosaic virus resistance 1 (Bsr1. We constructed a genetic linkage map of the RIL population using SNP markers to map this gene to within 705 Kb of the distal end of the top of chromosome 3. Additional CAPS and Indel markers were used to fine map Bsr1 to a 23 Kb interval containing five putative genes. Our study demonstrates the power of using RILs to rapidly map the genetic determinants of BSMV resistance in Brachypodium. Moreover, the RILs and their associated genetic map, when combined with the complete genomic sequence of Brachypodium, provide new resources for genetic analyses of many other traits.

  19. Identification of Ug99 stem rust resistance loci in winter wheat germplasm using genome-wide association analysis.

    Science.gov (United States)

    Yu, Long-Xi; Morgounov, Alexey; Wanyera, Ruth; Keser, Mesut; Singh, Sanjay Kumar; Sorrells, Mark

    2012-08-01

    The evolution of a new race of stem rust, generally referred to as Ug99, threatens global wheat production because it can overcome widely deployed resistance genes that had been effective for many years. To identify loci conferring resistance to Ug99 in wheat, a genome-wide association study was conducted using 232 winter wheat breeding lines from the International Winter Wheat Improvement Program. Breeding lines were genotyped with diversity array technology, simple sequence repeat and sequence-tagged site markers, and phenotyped at the adult plant stage for resistance to stem rust in the stem rust resistance screening nursery at Njoro, Kenya during 2009-2011. A mixed linear model was used for detecting marker-trait associations. Twelve loci associated with Ug99 resistance were identified including markers linked to known genes Sr2 and Lr34. Other markers were located in the chromosome regions where no Sr genes have been previously reported, including one each on chromosomes 1A, 2B, 4A and 7B, two on chromosome 5B and four on chromosome 6B. The same data were used for investigating epistatic interactions between markers with or without main effects. The marker csSr2 linked to Sr2 interacted with wPt4930 on 6BS and wPt729773 in an unknown location. Another marker, csLV34 linked to Lr34, also interacted with wPt4930 on 6BS and wPt4916 on 2BS. The frequent involvement of wPt4916 on 2BS and wPt4930 on 6BS in interactions with other significant loci on the same or different chromosomes suggested complex genetic control for adult plant resistance to Ug99 in winter wheat germplasm.

  20. Allele characterization of genes required for rpg4-mediated wheat stem rust resistance identifies Rpg5 as the R gene.

    Science.gov (United States)

    Arora, D; Gross, T; Brueggeman, R

    2013-11-01

    A highly virulent form of the wheat stem rust pathogen Puccinia graminis f. sp. tritici race TTKSK is virulent on both wheat and barley, presenting a major threat to world food security. The recessive and temperature-sensitive rpg4 gene is the only effective source of resistance identified in barley (Hordeum vulgare) against P. graminis f. sp. tritici race TTKSK. Efforts to position clone rpg4 localized resistance to a small interval on barley chromosome 5HL, tightly linked to the rye stem rust (P. graminis f. sp. secalis) resistance (R) gene Rpg5. High-resolution genetic analysis and post-transcriptional gene silencing of the genes at the rpg4/Rpg5 locus determined that three tightly linked genes (Rpg5, HvRga1, and HvAdf3) are required together for rpg4-mediated wheat stem rust resistance. Alleles of the three genes were analyzed from a diverse set of 14 domesticated barley lines (H. vulgare) and 8 wild barley accessions (H. vulgare subsp. spontaneum) to characterize diversity that may determine incompatibility (resistance). The analysis determined that HvAdf3 and HvRga1 code for predicted functional proteins that do not appear to contain polymorphisms determining the compatible (susceptible) interactions with the wheat stem rust pathogen and were expressed at the transcriptional level from both resistant and susceptible barley lines. The HvAdf3 alleles shared 100% amino acid identity among all 22 genotypes examined. The P. graminis f. sp. tritici race QCCJ-susceptible barley lines with HvRga1 alleles containing the limited amino acid substitutions unique to the susceptible varieties also contained predicted nonfunctional rpg5 alleles. Thus, susceptibility in these lines is likely due to the nonfunctional RPG5 proteins. The Rpg5 allele analysis determined that 9 of the 13 P. graminis f. sp. tritici race QCCJ-susceptible barley lines contain alleles that either code for predicted truncated proteins as the result of a single nucleotide substitution, resulting in a

  1. White pine blister rust resistance in North American, Asian and european species - results from artificial inoculartion trials in Oregon

    Directory of Open Access Journals (Sweden)

    R.A. Sniezko

    2013-12-01

    Full Text Available Dorena Genetic Resource Center (DGRC has used artificial inoculation trials to evaluate progenies of thousands of Pinus monticola and P. lambertiana selections from Oregon and Washington for resistance to white pine blister rust caused by Cronartium ribicola. In addition, early results are now available for P. albicaulis and P. strobiformis. DGRC has also recently evaluated seed orchard progenies of P. strobus, as well as bulked seedlots from P. armandii and P. peuce. The majority of P. monticola, P. lambertiana, P. albicaulis, and P. strobus progenies are very susceptible to blister rust. However, resistance exists in all these species. P. strobiformis showed relatively high levels of resistance for the eight progenies tested. Resistance in P. armandii was mainly reflected in the very low percentage of cankered seedlings; for P. peuce, the high percentage of cankered seedlings alive three years after inoculation was notable. R-genes are present in some of the North American five-needle pine species, but partial resistance traits (e.g. bark reaction will play a major role in breeding activities for P. monticola and P. lambertiana and will likely be the key to developing durable resistance.

  2. Induced resistant mutations in alfalfa and broad bean against rust, leaf spot and wilh diseases by Gamma rays and ethylmethanesulfonate

    International Nuclear Information System (INIS)

    1988-01-01

    In alfalfa after gamma irradiation with 50,100, and 150 krads, 38 rust resistant plants have been selected throughout a screening programme. During four months, cuttings were obtained from these plants individually. Results revealed that 20 plants were remar-kably surpassed the origin in the total fresh weight and in the average weight of each cutting. In broad bean, following gamma irradiation and EMS in two cuitivars for induction of wilt resistance. Seeds of these plants were sown in artificially infested soil . During the growing season, all susceptible plants were removed and at epidemic form of wilt disease

  3. Pushing the boundaries of resistance: insights from Brachypodium-rust interactions

    OpenAIRE

    Figueroa, Melania; Castell-Miller, Claudia V.; Li, Feng; Hulbert, Scot H.; Bradeen, James M.

    2015-01-01

    The implications of global population growth urge transformation of current food and bioenergy production systems to sustainability. Members of the family Poaceae are of particular importance both in food security and for their applications as biofuel substrates. For centuries, rust fungi have threatened the production of valuable crops such as wheat, barley, oat, and other small grains; similarly, biofuel crops can also be susceptible to these pathogens. Emerging rust pathogenic races with i...

  4. Resistance to stem rust race TTKSK maps to the rpg4/Rpg5 complex of chromosome 5H of barley.

    Science.gov (United States)

    Steffenson, B J; Jin, Y; Brueggeman, R S; Kleinhofs, A; Sun, Y

    2009-10-01

    Race TTKSK (Ug99) of the wheat stem rust pathogen (Puccinia graminis f. sp. tritici) is a serious threat to both wheat and barley production worldwide because of its wide virulence on many cultivars and rapid spread from eastern Africa. Line Q21861 is one of the most resistant barleys known to this race. To elucidate the genetics of resistance in this line, we evaluated the Q21861/SM89010 (Q/SM) doubled-haploid population for reaction to race TTKSK at the seedling stage. Segregation for resistance:susceptibility in Q/SM doubled-haploid lines fit a 1:1 ratio (58:71 with chi2=1.31 and P=0.25), indicating that a single gene in Q21861 confers resistance to race TTKSK. In previous studies, a recessive gene (rpg4) and a partially dominant gene (Rpg5) were reported to control resistance to P. graminis f. sp. tritici race QCCJ and P. graminis f. sp. secalis isolate 92-MN-90, respectively, in Q21861. These resistance genes co-segregate with each other in the Q/SM population and were mapped to the long arm of chromosome 5H. Resistance to race TTKSK also co-segregated with resistance to both rusts, indicating that the gene conferring resistance to race TTKSK also lies at the rpg4/Rpg5 locus. This result was confirmed through the molecular analysis of recombinants previously used to characterize loci conferring resistance to race QCCJ and isolate 92-MN-90. The 70-kb region contains Rpg5 (a nucleotide-binding site leucine-rich repeat serine/threonine-protein kinase gene), rpg4 (an actin depolymerizing factor-like gene), and two other genes of unidentified function. Research is underway to resolve which of the genes are required for conferring resistance to race TTKSK. Regardless, the simple inheritance should make Q21861 a valuable source of TTKSK resistance in barley breeding programs.

  5. Characterization of a novel wheat NAC transcription factor gene involved in defense response against stripe rust pathogen infection and abiotic stresses.

    Science.gov (United States)

    Xia, Ning; Zhang, Gang; Liu, Xin-Ying; Deng, Lin; Cai, Gao-Lei; Zhang, Yi; Wang, Xiao-Jie; Zhao, Jie; Huang, Li-Li; Kang, Zhen-Sheng

    2010-12-01

    Proteins encoded by the NAC gene family constitute one of the largest plant-specific transcription factors, which have been identified to play many important roles in both abiotic and biotic stress adaptation, as well as in plant development regulation. In the current paper, a full-length cDNA sequence of a novel wheat NAC gene, designated as TaNAC4, was isolated using in silico cloning and the reverse transcription PCR (RT-PCR) methods. TaNAC4 sharing high homology with rice OsNAC4 gene was predicted to encode a protein of 308 amino acid residues, which contained a plant-specific NAC domain in the N-terminus. Transient expression analysis indicated that the deduced TaNAC4 protein was localized in the nucleus of onion epidemical cells. Yeast one-hybrid assay revealed that the C-terminal region of the TaNAC4 protein had transcriptional activity. The expression of TaNAC4 was largely higher in the wheat seedling roots, than that in leaves and stems. TaNAC4 transcript in wheat leaves was induced by the infection of strip rust pathogen, and also by exogenous applied methyl jasmonate (MeJA), ABA and ethylene. However, salicylic acid (SA) had no obvious effect on TaNAC4 expression. Environmental stimuli, including high salinity, wounding, and low-temperature also induced TaNAC4 expression. These results indicate that this novel TaNAC4 gene functions as a transcriptional activator involved in wheat response to biotic and abiotic stresses.

  6. Role of Alternate Hosts in Epidemiology and Pathogen Variation of Cereal Rusts.

    Science.gov (United States)

    Zhao, Jie; Wang, Meinan; Chen, Xianming; Kang, Zhensheng

    2016-08-04

    Cereal rusts, caused by obligate and biotrophic fungi in the genus Puccinia, are important diseases that threaten world food security. With the recent discovery of alternate hosts for the stripe rust fungus (Puccinia striiformis), all cereal rust fungi are now known to be heteroecious, requiring two distinct plant species serving as primary or alternate hosts to complete their sexual life cycle. The roles of the alternate hosts in disease epidemiology and pathogen variation vary greatly from species to species and from region to region because of different climatic and cropping conditions. We focus this review on rust fungi of small grains, mainly stripe rust, stem rust, leaf rust, and crown rust of wheat, barley, oat, rye, and triticale, with emphases on the contributions of alternate hosts to the development and management of rust diseases.

  7. Development and characterization of wheat lines carrying stem rust resistance gene Sr43 derived from Thinopyrum ponticum.

    Science.gov (United States)

    Niu, Z; Klindworth, D L; Yu, G; L Friesen, T; Chao, S; Jin, Y; Cai, X; Ohm, J-B; Rasmussen, J B; Xu, Steven S

    2014-04-01

    Wheat lines carrying Ug99-effective stem rust resistance gene Sr43 on shortened alien chromosome segments were produced using chromosome engineering, and molecular markers linked to Sr43 were identified for marker-assisted selection. Stem rust resistance gene Sr43, transferred into common wheat (Triticum aestivum) from Thinopyrum ponticum, is an effective gene against stem rust Ug99 races. However, this gene has not been used in wheat breeding because it is located on a large Th. ponticum 7el(2) chromosome segment, which also harbors genes for undesirable traits. The objective of this study was to eliminate excessive Th. ponticum chromatin surrounding Sr43 to make it usable in wheat breeding. The two original translocation lines KS10-2 and KS24-1 carrying Sr43 were first analyzed using simple sequence repeat (SSR) markers and florescent genomic in situ hybridization. Six SSR markers located on wheat chromosome arm 7DL were identified to be associated with the Th. ponticum chromatin in KS10-2 and KS24-1. The results confirmed that KS24-1 is a 7DS·7el(2)L Robertsonian translocation as previously reported. However, KS10-2, which was previously designated as a 7el(2)S·7el(2)L-7DL translocation, was identified as a 7DS-7el(2)S·7el(2)L translocation. To reduce the Th. ponticum chromatin carrying Sr43, a BC(2)F(1) population (Chinese Spring//Chinese Spring ph1bph1b*2/KS10-2) containing ph1b-induced homoeologous recombinants was developed, tested with stem rust, and genotyped with the six SSR markers identified above. Two new wheat lines (RWG33 and RWG34) carrying Sr43 on shortened alien chromosome segments (about 17.5 and 13.7 % of the translocation chromosomes, respectively) were obtained, and two molecular markers linked to Sr43 in these lines were identified. The new wheat lines with Sr43 and the closely linked markers provide new resources for improving resistance to Ug99 and other races of stem rust in wheat.

  8. Mapping of Leaf Rust Resistance Genes and Molecular Characterization of the 2NS/2AS Translocation in the Wheat Cultivar Jagger.

    Science.gov (United States)

    Xue, Shulin; Kolmer, James A; Wang, Shuwen; Yan, Liuling

    2018-04-19

    Winter wheat cultivar 'Jagger' was recently found to have an alien chromosomal segment 2NS that has Lr37 , a gene conferring resistance against leaf rust caused by Puccinia triticina The objective of this study was to map and characterize the gene(s) for seedling leaf rust resistance in Jagger. The recombinant inbred line (RIL) population of Jagger × '2174' was inoculated with leaf rust pathogen THBJG and BBBDB, and evaluated for infection type (IT) response. A major quantitative trait locus (QTL) for THBJG and BBBDB was coincidently mapped to chromosome arm 2AS, and the QTL accounted for 56.6% - 66.2% of total phenotypic variation in infection type (IT) response to THBJG, and 72.1% - 86.9% to BBBDB. The causal gene for resistance to these rust races was mapped to the 2NS segment in Jagger. The 2NS segment was located in a region of approximately 27.8 Mb starting from the telomere of chromosome arm 2AS, based on the sequences of the A genome in tetraploid wheat. The Lr17a gene on chromosome arm 2AS was delimited to 3.1 Mb in the genomic region, which was orthologous to the 2NS segment. Therefore, the Lr37 gene in the 2NS segment can be pyramided with other effective resistance genes, rather than Lr17a in wheat, to improve resistance to rust diseases. Copyright © 2018, G3: Genes, Genomes, Genetics.

  9. Genetic mapping, marker assisted selection and allelic relationships for the Pu 6 gene conferring rust resistance in sunflower.

    Science.gov (United States)

    Bulos, Mariano; Vergani, Pablo Nicolas; Altieri, Emiliano

    2014-09-01

    Rust resistance in the sunflower line P386 is controlled by Pu 6 , a gene which was reported to segregate independently from other rust resistant genes, such as R 4 . The objectives of this work were to map Pu 6 , to provide and validate molecular tools for its identification, and to determine the linkage relationship of Pu 6 and R 4 . Genetic mapping of Pu 6 with six markers covered 24.8 cM of genetic distance on the lower end of linkage Group 13 of the sunflower consensus map. The marker most closely linked to Pu 6 was ORS316 at 2.5 cM in the distal position. ORS316 presented five alleles when was assayed with a representative set of resistant and susceptible lines. Allelism test between Pu 6 and R 4 indicated that both genes are linked at a genetic distance of 6.25 cM. This is the first confirmation based on an allelism test that at least two members of the R adv /R 4 /R 11 / R 13a /R 13b /Pu 6 cluster of genes are at different loci. A fine elucidation of the architecture of this complex locus will allow designing and constructing completely new genomic regions combining genes from different resistant sources and the elimination of the linkage drag around each resistant gene.

  10. Prospects for Advancing Defense to Cereal Rusts through Genetical Genomics

    Directory of Open Access Journals (Sweden)

    Elsa eBallini

    2013-05-01

    Full Text Available Rusts are one of the most severe threats to cereal crops because new pathogen races emerge regularly, resulting in infestations that lead to large yield losses. In 1999, a new race of stem rust, Puccinia graminis f. sp. tritici (Pgt TTKSK or Ug99, was discovered in Uganda. Most of the wheat and barley cultivars grown currently worldwide are susceptible to this new race. Pgt TTKSK has already spread northward into Iran and will likely spread eastward throughout the Indian subcontinent in the near future. This scenario is not unique to stem rust; new races of leaf rust (Puccinia triticina and stripe rust (Puccinia striiformis have also emerged recently. One strategy for countering the persistent adaptability of these pathogens is to stack complete- and partial-resistance genes, which requires significant breeding efforts in order to reduce deleterious effects of linkage drag. These varied resistance combinations are typically more difficult for the pathogen to defeat, since they would be predicted to apply lower selection pressure. Genetical genomics or expression Quantitative Trait Locus (eQTL analysis enables the identification of regulatory loci that control the expression of many to hundreds of genes. Integrated deployment of these technologies coupled with efficient phenotyping offers significant potential to elucidate the regulatory nodes in genetic networks that orchestrate host defense responses. The focus of this review will be to present advances in genetical genomic experimental designs and analysis, particularly as they apply to the prospects for discovering partial disease resistance alleles in cereals.

  11. Cytogenetic analysis and mapping of leaf rust resistance in Aegilops speltoides Tausch derived bread wheat line Selection2427 carrying putative gametocidal gene(s).

    Science.gov (United States)

    Niranjana, M; Vinod; Sharma, J B; Mallick, Niharika; Tomar, S M S; Jha, S K

    2017-12-01

    Leaf rust (Puccinia triticina) is a major biotic stress affecting wheat yields worldwide. Host-plant resistance is the best method for controlling leaf rust. Aegilops speltoides is a good source of resistance against wheat rusts. To date, five Lr genes, Lr28, Lr35, Lr36, Lr47, and Lr51, have been transferred from Ae. speltoides to bread wheat. In Selection2427, a bread wheat introgresed line with Ae. speltoides as the donor parent, a dominant gene for leaf rust resistance was mapped to the long arm of chromosome 3B (LrS2427). None of the Lr genes introgressed from Ae. speltoides have been mapped to chromosome 3B. Since none of the designated seedling leaf rust resistance genes have been located on chromosome 3B, LrS2427 seems to be a novel gene. Selection2427 showed a unique property typical of gametocidal genes, that when crossed to other bread wheat cultivars, the F 1 showed partial pollen sterility and poor seed setting, whilst Selection2427 showed reasonable male and female fertility. Accidental co-transfer of gametocidal genes with LrS2427 may have occurred in Selection2427. Though LrS2427 did not show any segregation distortion and assorted independently of putative gametocidal gene(s), its utilization will be difficult due to the selfish behavior of gametocidal genes.

  12. SNP assay to detect the ‘Hyuuga’ red-brown lesion resistance gene for Asian soybean rust

    Science.gov (United States)

    Ha, Bo-Keun; Phillips, Daniel V.; Boerma, H. Roger

    2010-01-01

    Asian soybean rust (ASR), caused by Phakopsora pachyrhizi Syd., has the potential to become a serious threat to soybean, Glycine max L. Merr., production in the USA. A novel rust resistance gene, Rpp?(Hyuuga), from the Japanese soybean cultivar Hyuuga has been identified and mapped to soybean chromosome 6 (Gm06). Our objectives were to fine-map the Rpp?(Hyuuga) gene and develop a high-throughput single nucleotide polymorphism (SNP) assay to detect this ASR resistance gene. The integration of recombination events from two different soybean populations and the ASR reaction data indicates that the Rpp?(Hyuuga) locus is located in a region of approximately 371 kb between STS70887 and STS70923 on chromosome Gm06. A set of 32 ancestral genotypes which is predicted to contain 95% of the alleles present in current elite North American breeding populations and the sources of the previously reported ASR resistance genes (Rpp1, Rpp2, Rpp3, Rpp4, Rpp5, and rpp5) were genotyped with five SNP markers. We developed a SimpleProbe assay based on melting curve analysis for SNP06-44058 which is tighly linked to the Rpp?(Hyuuga) gene. This SNP assay can differentiate plants/lines that are homozygous/homogeneous or heterozygous/heterogeneous for the resistant and susceptible alleles at the Rpp?(Hyuuga) locus. PMID:20532750

  13. Identification, introgression, and molecular marker genetic analysis and selection of a highly effective novel oat crown rust resistance from diploid oat, Avena strigosa

    Science.gov (United States)

    A new highly effective resistance to oat crown rust (Puccinia coronata f. sp. avenae) was identified in the diploid oat Avena strigosa PI 258731 and introgressed into hexaploid cultivated oat. Young plants with this resistance show moderate susceptibility, whereas older plant tissues and adult plant...

  14. Identification and characterization of Sr13, a tetraploid wheat gene that confers resistance to the Ug99 stem rust race group

    Science.gov (United States)

    The Puccinia graminis f. sp. tritici (Pgt) Ug99 race group is virulent to most stem rust resistance genes currently deployed in wheat and poses a serious threat to global wheat production. The durum wheat (Triticum turgidum ssp. durum) gene Sr13 confers resistance to Ug99 in addition to virulent rac...

  15. First report of Phakopsora pachyrhizi adapting to soybean genotypes with Rpp1 or Rpp6 rust resistance genes in field plots in the United States

    Science.gov (United States)

    Since the first detection of soybean rust, caused by Phakopsora pachyrhizi Syd., in the continental United States in November, 2004, soybean [Glycine max (L.) Merr.] genotypes with the Rpp1 or Rpp6 resistance genes have exhibited high levels of resistance in the United States. In 2011 and 2012, howe...

  16. Dissection of the multigenic wheat stem rust resistance present in the Montenegrin spring wheat accession PI 362698.

    Science.gov (United States)

    Zurn, Jason D; Rouse, Matthew N; Chao, Shiaoman; Aoun, Meriem; Macharia, Godwin; Hiebert, Colin W; Pretorius, Zacharias A; Bonman, J Michael; Acevedo, Maricelis

    2018-01-22

    Research to identify and characterize stem rust resistance genes in common wheat, Triticum aestivum, has been stimulated by the emergence of Ug99-lineage races of the wheat stem rust pathogen, Puccinia graminis f. sp. tritici (Pgt), in Eastern Africa. The Montenegrin spring wheat landrace PI 362698 was identified as a source of Pgt resistance. This accession exhibits resistance to multiple Ug99-lineage and North American Pgt races at seedling and adult-plant stages. A recombinant inbred population was developed by crossing the susceptible line LMPG-6 with a single plant selection of PI 362698. A genetic map was constructed using the Illumina iSelect 90 K wheat assay and the markers csLv34, NB-LRR3, and wMAS000003 and quantitative trait locus (QTL) analysis was performed. QTL analysis identified five significant QTLs (α = 0.05) on chromosomes 2B, 3B, 6A, 6D, and 7A associated with wheat stem rust resistance. The QTL on chromosome 3B was identified using both field data from Kenya (Pgt Ug99-lineage races) and seedling data from Pgt race MCCF. This QTL potentially corresponds to Sr12 or a new allele of Sr12. The multi-pathogen resistance gene Sr57 located on chromosome 7D is present in PI 362698 according to the diagnostic markers csLv34 and wMAS000003, however a significant QTL was not detected at this locus. The QTLs on chromosomes 2B, 6A, and 6D were identified during seedling trials and are thought to correspond to Sr16, Sr8a, and Sr5, respectively. The QTL identified on chromosome 7A was detected using MCCF seedling data and may be Sr15 or a potentially novel allele of recently detected Ug99 resistance QTLs. The combination of resistance QTLs found in PI 362698 is like the resistance gene combination present in the broadly resistant cultivar Thatcher. As such, PI 362698 may not be a landrace as previously thought. PI 362698 has been crossed with North Dakota wheat germplasm for future breeding efforts. Additional work is needed to fully understand why the

  17. The rpg4/Rpg5 stem rust resistance locus in barley: resistance genes and cytoskeleton dynamics.

    Science.gov (United States)

    Brueggeman, Robert; Steffenson, Brian J; Kleinhofs, Andris

    2009-04-01

    Two closely linked resistance genes, rpg4 and Rpg5, conferring resistance to several races of Puccinia graminis, were cloned and characterized. The Rpg5 gene confers resistance to an isolate of Puccinia graminis f. sp. secalis (Pgs), while rpg4 confers resistance to Puccinia graminis f. sp. tritici (Pgt). Rpg5 is a novel gene containing nucleotide binding site-leucine rich repeat domains in combination with a serine threonine protein kinase domain. High-resolution mapping plus allele and recombinant sequencing identified the rpg4 gene, which encodes an actin depolymerizing factor-like protein (ADF2). Resistance against the Pgt races QCCJ, MCCF, TTKSK (aka Ug99) and RCRS requires both Rpg5 and rpg4, while Rpg5 alone confers resistance to Pgs isolate 92-MN-90. The dependency on the actin modifying protein ADF2 indicates cytoskeleton reorganization or redirection plays a role in pathogen-host interactions. Rpg5 may interact with ADF2 to activate or deactivate its function in the resistance response. Alternatively, Rpg5 could initiate signal transduction leading to resistance in response to detecting ADF2 protein modification. Pgt may redirect the actin cytoskeleton by inducing modifications of ADF2. The redirection of actin could possibly enable the pathogen to develop a haustoria-plant cell cytoskeleton interface for acquisition of nutrients.

  18. Analyzing Genetic Diversity for Virulence and Resistance Phenotypes in Populations of Stem Rust (Puccinia graminis f. sp. secalis) and Winter Rye (Secale cereale).

    Science.gov (United States)

    Miedaner, Thomas; Schmitt, Ann-Kristin; Klocke, Bettina; Schmiedchen, Brigitta; Wilde, Peer; Spieß, Hartmut; Szabo, Lilla; Koch, Silvia; Flath, Kerstin

    2016-11-01

    Stem rust (Puccinia graminis f. sp. secalis) leads to considerable yield losses in rye-growing areas with continental climate, from Eastern Germany to Siberia. For implementing resistance breeding, it is of utmost importance to (i) analyze the diversity of stem rust populations in terms of pathotypes (= virulence combinations) and (ii) identify resistance sources in winter rye populations. We analyzed 323 single-uredinial isolates mainly collected from German rye-growing areas across 3 years for their avirulence/virulence on 15 rye inbred differentials. Out of these, 226 pathotypes were detected and only 56 pathotypes occurred more than once. This high diversity was confirmed by a Simpson index of 1.0, a high Shannon index (5.27), and an evenness index of 0.97. In parallel, we investigated stem rust resistance among and within 121 heterogeneous rye populations originating mainly from Russia, Poland, Austria, and the United States across 3 to 15 environments (location-year combinations). While German rye populations had an average stem rust severity of 49.7%, 23 nonadapted populations were significantly (P stem rust severity ranging from 3 to 40%. Out of these, two modern Russian breeding populations and two old Austrian landraces were the best harboring 32 to 70% fully resistant plants across 8 to 10 environments. These populations with the lowest disease severity in adult-plant stage in the field also displayed resistance in leaf segment tests. In conclusion, stem rust populations are highly diverse and the majority of resistances in rye populations seems to be race specific.

  19. Identification and validation of single nucleotide polymorphic markers linked to Ug99 stem rust resistance in spring wheat.

    Directory of Open Access Journals (Sweden)

    Long-Xi Yu

    Full Text Available Wheat stem rust (Puccinia graminis f. sp. tritici Eriks. and E. Henn. is one of the most destructive diseases world-wide. Races belonging to Ug99 (or TTKSK continue to cause crop losses in East Africa and threaten global wheat production. Developing and deploying wheat varieties with multiple race-specific genes or complex adult plant resistance is necessary to achieve durability. In the present study, we applied genome-wide association studies (GWAS for identifying loci associated with the Ug99 stem rust resistance (SR in a panel of wheat lines developed at the International Maize and Wheat Improvement Center (CIMMYT. Genotyping was carried out using the wheat 9K iSelect single nucleotide polymorphism (SNP chip. Phenotyping was done in the field in Kenya by infection of Puccinia graminis f. sp. tritici race TTKST, the Sr24-virulent variant of Ug99. Marker-trait association identified 12 SNP markers significantly associated with resistance. Among them, 7 were mapped on five chromosomes. Markers located on chromosomes 4A and 4B overlapped with the location of the Ug99 resistance genes SrND643 and Sr37, respectively. Markers identified on 7DL were collocated with Sr25. Additional significant markers were located in the regions where no Sr gene has been reported. The chromosome location for five of the SNP markers was unknown. A BLASTN search of the NCBI database using the flanking sequences of the SNPs associated with Ug99 resistance revealed that several markers were linked to plant disease resistance analogues, while others were linked to regulatory factors or metabolic enzymes. A KASP (Kompetitive Allele Specific PCR assay was used for validating six marker loci linked to genes with resistance to Ug99. Of those, four co-segregated with the Sr25-pathotypes while the rest identified unknown resistance genes. With further investigation, these markers can be used for marker-assisted selection in breeding for Ug99 stem rust resistance in wheat.

  20. Genetic mapping of stem rust resistance gene Sr13 in tetraploid wheat (Triticum turgidum ssp. durum L.)

    Science.gov (United States)

    Simons, Kristin; Abate, Zewdie; Chao, Shiaoman; Zhang, Wenjun; Rouse, Matt; Jin, Yue; Elias, Elias; Dubcovsky, Jorge

    2016-01-01

    Wheat stem rust caused by Puccinia graminis f. sp. tritici, can cause significant yield losses. To combat the disease breeders have deployed resistance genes both individually and in combinations to increase resistance durability. A new race, TTKSK (Ug99), identified in Uganda in 1999, is virulent on most of the resistance genes currently deployed, and is rapidly spreading to other regions of the world. It is therefore important to identify, map, and deploy resistance genes that are still effective against TTKSK. One of these resistance genes, Sr13, was previously assigned to the long arm of chromosome 6A, but its precise map location was not known. In this study, the genome location of Sr13 was determined in four tetraploid wheat (T. turgidum ssp. durum) mapping populations involving the TTKSK resistant varieties Kronos, Kofa, Medora and Sceptre. Our results showed that resistance was linked to common molecular markers in all four populations, suggesting that these durum lines carry the same resistance gene. Based on its chromosome location and infection types against different races of stem rust, this gene is postulated to be Sr13. Sr13 was mapped within a 1.2 to 2.8 cM interval (depending on the mapping population) between EST markers CD926040 and BE471213, which corresponds to a 285-kb region in rice chromosome 2, and a 3.1-Mb region in Brachypodium chromosome 3. These maps will be the foundation for developing high-density maps, identifying diagnostic markers, and positional cloning of Sr13. PMID:20857083

  1. Genetic mapping of stem rust resistance gene Sr13 in tetraploid wheat (Triticum turgidum ssp. durum L.).

    Science.gov (United States)

    Simons, Kristin; Abate, Zewdie; Chao, Shiaoman; Zhang, Wenjun; Rouse, Matt; Jin, Yue; Elias, Elias; Dubcovsky, Jorge

    2011-02-01

    Wheat stem rust caused by Puccinia graminis f. sp. tritici, can cause significant yield losses. To combat the disease, breeders have deployed resistance genes both individually and in combinations to increase resistance durability. A new race, TTKSK (Ug99), identified in Uganda in 1999 is virulent on most of the resistance genes currently deployed, and is rapidly spreading to other regions of the world. It is therefore important to identify, map, and deploy resistance genes that are still effective against TTKSK. One of these resistance genes, Sr13, was previously assigned to the long arm of chromosome 6A, but its precise map location was not known. In this study, the genome location of Sr13 was determined in four tetraploid wheat (T. turgidum ssp. durum) mapping populations involving the TTKSK resistant varieties Kronos, Kofa, Medora and Sceptre. Our results showed that resistance was linked to common molecular markers in all four populations, suggesting that these durum lines carry the same resistance gene. Based on its chromosome location and infection types against different races of stem rust, this gene is postulated to be Sr13. Sr13 was mapped within a 1.2-2.8 cM interval (depending on the mapping population) between EST markers CD926040 and BE471213, which corresponds to a 285-kb region in rice chromosome 2, and a 3.1-Mb region in Brachypodium chromosome 3. These maps will be the foundation for developing high-density maps, identifying diagnostic markers, and positional cloning of Sr13.

  2. High-throughput genotyping-by-sequencing facilitates molecular tagging of a novel rust resistance gene, R 15 , in sunflower (Helianthus annuus L.).

    Science.gov (United States)

    Ma, G J; Song, Q J; Markell, S G; Qi, L L

    2018-03-21

    A novel rust resistance gene, R 15 , derived from the cultivated sunflower HA-R8 was assigned to linkage group 8 of the sunflower genome using a genotyping-by-sequencing approach. SNP markers closely linked to R 15 were identified, facilitating marker-assisted selection of resistance genes. The rust virulence gene is co-evolving with the resistance gene in sunflower, leading to the emergence of new physiologic pathotypes. This presents a continuous threat to the sunflower crop necessitating the development of resistant sunflower hybrids providing a more efficient, durable, and environmentally friendly host plant resistance. The inbred line HA-R8 carries a gene conferring resistance to all known races of the rust pathogen in North America and can be used as a broad-spectrum resistance resource. Based on phenotypic assessments of 140 F 2 individuals derived from a cross of HA 89 with HA-R8, rust resistance in the population was found to be conferred by a single dominant gene (R 15 ) originating from HA-R8. Genotypic analysis with the currently available SSR markers failed to find any association between rust resistance and any markers. Therefore, we used genotyping-by-sequencing (GBS) analysis to achieve better genomic coverage. The GBS data showed that R 15 was located at the top end of linkage group (LG) 8. Saturation with 71 previously mapped SNP markers selected within this region further showed that it was located in a resistance gene cluster on LG8, and mapped to a 1.0-cM region between three co-segregating SNP makers SFW01920, SFW00128, and SFW05824 as well as the NSA_008457 SNP marker. These closely linked markers will facilitate marker-assisted selection and breeding in sunflower.

  3. Diagnostic and co-dominant PCR markers for wheat stem rust resistance genes Sr25 and Sr26.

    Science.gov (United States)

    Liu, Sixin; Yu, Long-Xi; Singh, Ravi P; Jin, Yue; Sorrells, Mark E; Anderson, James A

    2010-02-01

    Wheat stem rust, caused by Puccinia graminis f. sp. tritici, is one of the most destructive diseases of wheat. A new race of the pathogen named TTKSK (syn. Ug99) and its derivatives detected in East Africa are virulent to many designated and undesignated stem rust resistance genes. The emergence and spread of those races pose an imminent threat to wheat production worldwide. Genes Sr25 and Sr26 transferred into wheat from Thinopyrum ponticum are effective against these new races. DNA markers for Sr25 and Sr26 are needed to pyramid both genes into adapted germplasm. The previously published dominant markers Gb for Sr25 and Sr26#43 for Sr26 were validated with eight wheat lines with or without Sr25 or Sr26. We tested six published STS (sequence tagged site) markers amplifying diagnostic bands of Th. ponticum. Marker BF145935 consistently amplified well and can be used as a co-dominant marker for Sr25. Among 16 STS markers developed from wheat ESTs mapped to deletion bin 6AL8-0.90-1.00, none was co-dominant for tagging Sr26. However, five 6A-specific markers were identified. Multiplex PCR with marker Sr26#43 and 6A-specific marker BE518379 can be used as a co-dominant marker for Sr26. The co-dominant markers for Sr25 and Sr26 were validated with 37 lines with known stem rust resistance genes. A diverse set of germplasm consisting 170 lines from CIMMYT, China, USA and other counties were screened with the co-dominant markers for Sr25 and Sr26. Five lines with the diagnostic fragment for Sr25 were identified, and they all have 'Wheatear' in their pedigrees, which is known to carry Sr25. None of the 170 lines tested had Sr26, as expected.

  4. Selection for resistance to white pine blister rust affects the abiotic stress tolerances of limber pine

    Science.gov (United States)

    Patrick J. Vogan; Anna W. Schoettle

    2015-01-01

    Limber pine (Pinus flexilis) mortality is increasing across the West as a result of the combined stresses of white pine blister rust (Cronartium ribicola; WPBR), mountain pine beetle (Dendroctonus ponderosae), and dwarf mistletoe (Arceuthobium cyanocarpum) in a changing climate. With the continued spread of WPBR, extensive mortality will continue with strong selection...

  5. Characterization of stem rust resistance gene Sr2 in Indian wheat ...

    African Journals Online (AJOL)

    SONY

    2013-05-01

    May 1, 2013 ... accelerating wheat production in the last forty years and ensured food security of the Nation. In the present investigation, Sr2 specific molecular markers were used to assess their efficacy for assessing the deployment of Sr2 gene in Indian wheat cultivars of highly productive north-west plains and stem rust ...

  6. Virulence of wheat yellow rust races and resistance genes of wheat cultivars in Ecuador

    NARCIS (Netherlands)

    Ochoa, J.B.; Danial, D.L.; Paucar, B.

    2007-01-01

    Virulence factors of the yellow rust, Puccinia striiformis, populations in bread wheat were studied in Ecuador between 1973 and 2004. The number of virulence factors has increased markedly from very few in the early seventies to 16 at the end of the 90s. Isolates belonging to race 0E0 seem to be the

  7. Cytosolic activation of cell death and stem rust resistance by cereal MLA-family CC–NLR proteins

    Science.gov (United States)

    Cesari, Stella; Moore, John; Chen, Chunhong; Webb, Daryl; Periyannan, Sambasivam; Mago, Rohit; Bernoux, Maud; Lagudah, Evans S.; Dodds, Peter N.

    2016-01-01

    Plants possess intracellular immune receptors designated “nucleotide-binding domain and leucine-rich repeat” (NLR) proteins that translate pathogen-specific recognition into disease-resistance signaling. The wheat immune receptors Sr33 and Sr50 belong to the class of coiled-coil (CC) NLRs. They confer resistance against a broad spectrum of field isolates of Puccinia graminis f. sp. tritici, including the Ug99 lineage, and are homologs of the barley powdery mildew-resistance protein MLA10. Here, we show that, similarly to MLA10, the Sr33 and Sr50 CC domains are sufficient to induce cell death in Nicotiana benthamiana. Autoactive CC domains and full-length Sr33 and Sr50 proteins self-associate in planta. In contrast, truncated CC domains equivalent in size to an MLA10 fragment for which a crystal structure was previously determined fail to induce cell death and do not self-associate. Mutations in the truncated region also abolish self-association and cell-death signaling. Analysis of Sr33 and Sr50 CC domains fused to YFP and either nuclear localization or nuclear export signals in N. benthamiana showed that cell-death induction occurs in the cytosol. In stable transgenic wheat plants, full-length Sr33 proteins targeted to the cytosol provided rust resistance, whereas nuclear-targeted Sr33 was not functional. These data are consistent with CC-mediated induction of both cell-death signaling and stem rust resistance in the cytosolic compartment, whereas previous research had suggested that MLA10-mediated cell-death and disease resistance signaling occur independently, in the cytosol and nucleus, respectively. PMID:27555587

  8. Cytosolic activation of cell death and stem rust resistance by cereal MLA-family CC-NLR proteins.

    Science.gov (United States)

    Cesari, Stella; Moore, John; Chen, Chunhong; Webb, Daryl; Periyannan, Sambasivam; Mago, Rohit; Bernoux, Maud; Lagudah, Evans S; Dodds, Peter N

    2016-09-06

    Plants possess intracellular immune receptors designated "nucleotide-binding domain and leucine-rich repeat" (NLR) proteins that translate pathogen-specific recognition into disease-resistance signaling. The wheat immune receptors Sr33 and Sr50 belong to the class of coiled-coil (CC) NLRs. They confer resistance against a broad spectrum of field isolates of Puccinia graminis f. sp. tritici, including the Ug99 lineage, and are homologs of the barley powdery mildew-resistance protein MLA10. Here, we show that, similarly to MLA10, the Sr33 and Sr50 CC domains are sufficient to induce cell death in Nicotiana benthamiana Autoactive CC domains and full-length Sr33 and Sr50 proteins self-associate in planta In contrast, truncated CC domains equivalent in size to an MLA10 fragment for which a crystal structure was previously determined fail to induce cell death and do not self-associate. Mutations in the truncated region also abolish self-association and cell-death signaling. Analysis of Sr33 and Sr50 CC domains fused to YFP and either nuclear localization or nuclear export signals in N benthamiana showed that cell-death induction occurs in the cytosol. In stable transgenic wheat plants, full-length Sr33 proteins targeted to the cytosol provided rust resistance, whereas nuclear-targeted Sr33 was not functional. These data are consistent with CC-mediated induction of both cell-death signaling and stem rust resistance in the cytosolic compartment, whereas previous research had suggested that MLA10-mediated cell-death and disease resistance signaling occur independently, in the cytosol and nucleus, respectively.

  9. Molecular Characterization of Resistance to Soybean Rust (Phakopsora pachyrhizi Syd. & Syd.) in Soybean Cultivar DT 2000 (PI 635999).

    Science.gov (United States)

    Vuong, Tri D; Walker, David R; Nguyen, Binh T; Nguyen, Tuyet T; Dinh, Hoan X; Hyten, David L; Cregan, Perry B; Sleper, David A; Lee, Jeong D; Shannon, James G; Nguyen, Henry T

    2016-01-01

    Resistance to soybean rust (SBR), caused by Phakopsora pachyrhizi Syd. & Syd., has been identified in many soybean germplasm accessions and is conferred by either dominant or recessive genes that have been mapped to six independent loci (Rpp1 -Rpp6), but No U.S. cultivars are resistant to SBR. The cultivar DT 2000 (PI 635999) has resistance to P. pachyrhizi isolates and field populations from the United States as well as Vietnam. A F6:7 recombinant inbred line (RIL) population derived from Williams 82 × DT 2000 was used to identify genomic regions associated with resistance to SBR in the field in Ha Noi, Vietnam, and in Quincy, Florida, in 2008. Bulked segregant analysis (BSA) was conducted using the soybean single nucleotide polymorphism (SNP) USLP 1.0 panel along with simple sequence repeat (SSR) markers to detect regions of the genome associated with resistance. BSA identified four BARC_SNP markers near the Rpp3 locus on chromosome (Chr.) 6. Genetic analysis identified an additional genomic region around the Rpp4 locus on Chr. 18 that was significantly associated with variation in the area under disease progress curve (AUDPC) values and sporulation in Vietnam. Molecular markers tightly linked to the DT 2000 resistance alleles on Chrs. 6 and 18 will be useful for marker-assisted selection and backcrossing in order to pyramid these genes with other available SBR resistance genes to develop new varieties with enhanced and durable resistance to SBR.

  10. A genome-wide association study of field and seedling response to stem rust pathogen races reveals combinations of race-specific resistance genes in North American spring wheat

    Science.gov (United States)

    Stem rust of wheat caused by the fungal pathogen Puccinia graminis f. sp. tritici historically caused major yield losses of wheat worldwide. To understand the genetic basis of stem rust resistance in conventional North American spring wheat, genome-wide association analysis (GWAS) was conducted on a...

  11. Insights into Tan Spot and Stem Rust Resistance and Susceptibility by Studying the Pre-Green Revolution Global Collection of Wheat

    Directory of Open Access Journals (Sweden)

    Sidrat Abdullah

    2017-04-01

    Full Text Available Tan spot (TS, caused by the fungus Pyrenophora tritici-repentis (Died Drechs, is an important foliar disease of wheat and has become a threat to world wheat production since the 1970s. In this study a globally diverse pre-1940s collection of 247 wheat genotypes was evaluated against Ptr ToxA, P. tritici-repentis race 1, and stem rust to determine if; (i acquisition of Ptr ToxA by the P. tritici-repentis from Stagonospora nodorum led to increased pathogen virulence or (ii incorporation of TS susceptibility during development stem rust resistant cultivars led to an increase in TS epidemics globally. Most genotypes were susceptible to stem rust; however, a range of reactions to TS and Ptr ToxA were observed. Four combinations of disease-toxin reactions were observed among the genotypes; TS susceptible-Ptr ToxA sensitive, TS susceptible-Ptr ToxA insensitive, TS resistant-Ptr ToxA insensitive, and TS resistant-Ptr ToxA toxin sensitive. A weak correlation (r = 0.14 for bread wheat and −0.082 for durum was observed between stem rust susceptibility and TS resistance. Even though there were no reported epidemics in the pre-1940s, TS sensitive genotypes were widely grown in that period, suggesting that Ptr ToxA may not be an important factor responsible for enhanced prevalence of TS.

  12. Insights into Tan Spot and Stem Rust Resistance and Susceptibility by Studying the Pre-Green Revolution Global Collection of Wheat.

    Science.gov (United States)

    Abdullah, Sidrat; Sehgal, Sunish Kumar; Jin, Yue; Turnipseed, Brent; Ali, Shaukat

    2017-04-01

    Tan spot (TS), caused by the fungus Pyrenophora tritici-repentis (Died) Drechs, is an important foliar disease of wheat and has become a threat to world wheat production since the 1970s. In this study a globally diverse pre-1940s collection of 247 wheat genotypes was evaluated against Ptr ToxA, P. tritici-repentis race 1, and stem rust to determine if; (i) acquisition of Ptr ToxA by the P. tritici-repentis from Stagonospora nodorum led to increased pathogen virulence or (ii) incorporation of TS susceptibility during development stem rust resistant cultivars led to an increase in TS epidemics globally. Most genotypes were susceptible to stem rust; however, a range of reactions to TS and Ptr ToxA were observed. Four combinations of disease-toxin reactions were observed among the genotypes; TS susceptible-Ptr ToxA sensitive, TS susceptible-Ptr ToxA insensitive, TS resistant-Ptr ToxA insensitive, and TS resistant-Ptr ToxA toxin sensitive. A weak correlation (r = 0.14 for bread wheat and -0.082 for durum) was observed between stem rust susceptibility and TS resistance. Even though there were no reported epidemics in the pre-1940s, TS sensitive genotypes were widely grown in that period, suggesting that Ptr ToxA may not be an important factor responsible for enhanced prevalence of TS.

  13. Brachypodium distachyon line Bd3-1 resistance is elicited by the barley stripe mosaic virus triple gene block 1 movement protein

    NARCIS (Netherlands)

    Lee, M.Y.; Yan, L.J.; Gorter, F.A.; Kim, B.Y.T.; Cui, Y.; Hu, Y.; Yuan, C.; Grindheim, J.; Ganesan, U.; Liu, Z.Y.; Han, C.G.; Yu, J.L.; Li, D.W.; Jackson, A.O.

    2012-01-01

    Barley stripe mosaic virus North Dakota 18 (ND18), Beijing (BJ), Xinjiang (Xi), Type (TY) and CV21 strains are unable to infect the Brachypodium distachyon Bd3-1 inbred line, which harbours a resistance gene designated Bsr1, but the Norwich (NW) strain is virulent on Bd3-1. Analysis of ND18 and NW

  14. Identification and mapping of Sr46 from Aegilops tauschii accession CIae 25 conferring resistance to race TTKSK (Ug99) of wheat stem rust pathogen.

    Science.gov (United States)

    Yu, Guotai; Zhang, Qijun; Friesen, Timothy L; Rouse, Matthew N; Jin, Yue; Zhong, Shaobin; Rasmussen, Jack B; Lagudah, Evans S; Xu, Steven S

    2015-03-01

    Mapping studies confirm that resistance to Ug99 race of stem rust pathogen in Aegilops tauschii accession Clae 25 is conditioned by Sr46 and markers linked to the gene were developed for marker-assisted selection. The race TTKSK (Ug99) of Puccinia graminis f. sp. tritici, the causal pathogen for wheat stem rust, is considered as a major threat to global wheat production. To address this threat, researchers across the world have been devoted to identifying TTKSK-resistant genes. Here, we report the identification and mapping of a stem rust resistance gene in Aegilops tauschii accession CIae 25 that confers resistance to TTKSK and the development of molecular markers for the gene. An F2 population of 710 plants from an Ae. tauschii cross CIae 25 × AL8/78 were first evaluated against race TPMKC. A set of 14 resistant and 116 susceptible F2:3 families from the F2 plants were then evaluated for their reactions to TTKSK. Based on the tests, 179 homozygous susceptible F2 plants were selected as the mapping population to identify the simple sequence repeat (SSR) and sequence tagged site (STS) markers linked to the gene by bulk segregant analysis. A dominant stem rust resistance gene was identified and mapped with 16 SSR and five new STS markers to the deletion bin 2DS5-0.47-1.00 of chromosome arm 2DS in which Sr46 was located. Molecular marker and stem rust tests on CIae 25 and two Ae. tauschii accessions carrying Sr46 confirmed that the gene in CIae 25 is Sr46. This study also demonstrated that Sr46 is temperature-sensitive being less effective at low temperatures. The marker validation indicated that two closely linked markers Xgwm210 and Xwmc111 can be used for marker-assisted selection of Sr46 in wheat breeding programs.

  15. Identification of a stem rust resistance locus effective against Ug99 on wheat chromosome 7AL using a RAD-Seq approach.

    Science.gov (United States)

    Pujol, Vincent; Forrest, Kerrie L; Zhang, Peng; Rouse, Matthew N; Hayden, Matthew J; Huang, Li; Tabe, Linda; Lagudah, Evans

    2015-07-01

    A locus of major effect for stem rust resistance, effective against Ug99 and possibly a target of a suppressor on chromosome arm 7DL in wheat cultivar Canthatch, was mapped to 7AL. Wheat stem rust, caused by Puccinia graminis f. sp. tritici (Pgt), is responsible for major production losses around the world. The development of resistant cultivars is an effective and environmentally friendly way to manage the disease, but outbreaks can occur when new pathogen races overcome the existing host resistance genes. Ug99 (race TTKSK) and related Pgt races are virulent to the majority of existing cultivars, which presents a potential threat to global wheat production. The hexaploid wheat cultivar Canthatch has long been known to carry a suppressor of stem rust resistance on chromosome arm 7DL. Multiple "non-suppressor" mutants of Canthatch are reported to have gained resistance to Pgt races, including Ug99 (TTKSK) and related races TTKST and TTTSK. To genetically map the suppressor locus, a mapping population was developed from a cross between the susceptible cultivar Columbus, thought to possess the suppressor, and Columbus-NS766, a resistant, near-isogenic line believed to contain a mutant non-suppressor allele introgressed from Canthatch. Genetic mapping using a 9K SNP genotyping assay and restriction site-associated DNA sequencing (RAD-Seq) on bulked segregants led to the identification of markers linked to a locus of stem rust resistance. Surprisingly, genomic sequence information revealed the markers to be located on 7AL instead of 7DL, indicating that the resistance phenotype was due to a new resistance locus, rather than the inactivated suppressor. We suggest that the 7AL locus of resistance is most likely suppressed by the 7DL suppressor.

  16. Effect of white pine blister rust (Cronartium ribicola) and rust-resistance breeding on genetic variation in western white pine Pinus monticola)

    Science.gov (United States)

    M. -S. Kim; S. J. Brunsfeld; G. I. McDonald; N. B. Klopfenstein

    2003-01-01

    Western white pine (Pinus monticola) is an economically and ecologically important species from western North America that has declined over the past several decades mainly due to the introduction of blister rust (Cronartium ribicola) and reduced opportunities for regeneration. Amplified fragment length polymorphism (AFLP) was used...

  17. Molecular and genetic study of wheat rusts | Le Maitre | African ...

    African Journals Online (AJOL)

    Puccinia triticina, Puccinia graminis and Puccinia striiformis cause leaf, stem and yellow rust, respectively. Wheat rusts can cause losses as high as 70%. The rusts ability to evolve fungicide resistance has resulted in the use of resistant cultivars as the primary method of control. Breeding resistant cultivars is a long process ...

  18. An interspecific barberry hybrid enables genetic dissection of non-host resistance to the stem rust pathogen Puccinia graminis.

    Science.gov (United States)

    Bartaula, Radhika; Melo, Arthur T O; Connolly, Bryan A; Jin, Yue; Hale, Iago

    2018-02-26

    Stem rust, caused by Puccinia graminis (Pg), remains a devastating disease of wheat; and the emergence of new Pg races virulent on deployed resistance genes fuels the ongoing search for sources of durable resistance. Despite its intrinsic durability, non-host resistance (NHR) is largely unexplored as a protection strategy against Pg, partly due to the inherent challenge of developing a genetically tractable system within which NHR segregates. Here we demonstrate that Pg's far less-studied ancestral host, barberry (Berberis spp.), provides such a unique pathosystem. Characterization of a natural population of B. ×ottawensis (B×o), an interspecific hybrid of Pg-susceptible B. vulgaris and Pg-resistant B. thunbergii (Bt), reveals that this uncommon nothospecies can be used to dissect the genetic mechanism(s) of Pg-NHR exhibited by Bt. Artificial inoculation of a natural population of B×o accessions, verified via genotyping-by-sequencing to be first generation hybrids, revealed 51% susceptible, 33% resistant, and 16% intermediate phenotypes. Characterization of a B×o full-sib family excluded the possibility of maternal inheritance of the resistance. By demonstrating segregation of Pg-NHR in a hybrid population, this study challenges the assumed irrelevance of Bt to Pg epidemiology and lays a novel foundation for the genetic dissection of NHR to one of agriculture's most studied pathogens.

  19. Resistance of Glycine tomentella to soybean leaf rust Phakopsora pachyrhizi in relation to ploidy level and geographic distribution.

    Science.gov (United States)

    Schoen, D J; Burdon, J J; Brown, A H

    1992-04-01

    Accessions of five diploid and five tetraploid isozymically defined groups of Glycine tomentella collected from throughout the species range in Australasia were scored for resistance to three separate isolates of Phakopsora pachyrhizi, the causal agent of soybean leaf rust. Resistance levels were found to be high (>75%) in most of the groups. While resistance levels differed among groups, the overall levels in polyploids were similar to those in diploids. Geographical patterns of resistance and susceptibility to P. pachyrhizi indicate that two regions of susceptibility exist. The highest proportion of susceptible accessions occurs in the Kimberley Plateau region of Western Australia and the Northern Territory, while another region of susceptibility is found in the Townsville/Cairns region of Queensland. Results from genetic crosses between accessions within two forms of the tetraploids indicate that in the aneuploid form (2n = 78), resistance to P. pachyrhizi was under the control of a single dominant gene, whereas in a second group of tetraploids (2n=80), resistance was controlled by two or three gene loci.

  20. Development and characterization of a Psathyrostachys huashanica Keng 7Ns chromosome addition line with leaf rust resistance.

    Directory of Open Access Journals (Sweden)

    Wanli Du

    Full Text Available The aim of this study was to characterize a Triticum aestivum-Psathyrostachys huashanica Keng (2n = 2x = 14, NsNs disomic addition line 2-1-6-3. Individual line 2-1-6-3 plants were analyzed using cytological, genomic in situ hybridization (GISH, EST-SSR, and EST-STS techniques. The alien addition line 2-1-6-3 was shown to have two P. huashanica chromosomes, with a meiotic configuration of 2n = 44 = 22 II. We tested 55 EST-SSR and 336 EST-STS primer pairs that mapped onto seven different wheat chromosomes using DNA from parents and the P. huashanica addition line. One EST-SSR and nine EST-STS primer pairs indicated that the additional chromosome of P. huashanica belonged to homoeologous group 7, the diagnostic fragments of five EST-STS markers (BE404955, BE591127, BE637663, BF482781 and CD452422 were cloned, sequenced and compared. The results showed that the amplified polymorphic bands of P. huashanica and disomic addition line 2-1-6-3 shared 100% sequence identity, which was designated as the 7Ns disomic addition line. Disomic addition line 2-1-6-3 was evaluated to test the leaf rust resistance of adult stages in the field. We found that one pair of the 7Ns genome chromosomes carried new leaf rust resistance gene(s. Moreover, wheat line 2-1-6-3 had a superior numbers of florets and grains per spike, which were associated with the introgression of the paired P. huashanica chromosomes. These high levels of disease resistance and stable, excellent agronomic traits suggest that this line could be utilized as a novel donor in wheat breeding programs.

  1. Exploiting regulatory variation to identify genes underlying quantitative resistance to the wheat stem rust pathogen Puccinia graminis f. sp. tritici in barley.

    Science.gov (United States)

    Druka, Arnis; Potokina, Elena; Luo, Zewei; Bonar, Nicola; Druka, Ilze; Zhang, Ling; Marshall, David F; Steffenson, Brian J; Close, Timothy J; Wise, Roger P; Kleinhofs, Andris; Williams, Robert W; Kearsey, Michael J; Waugh, Robbie

    2008-07-01

    We previously mapped mRNA transcript abundance traits (expression-QTL or eQTL) using the Barley1 Affymetrix array and 'whole plant' tissue from 139 progeny of the Steptoe x Morex (St/Mx) reference barley mapping population. Of the 22,840 probesets (genes) on the array, 15,987 reported transcript abundance signals that were suitable for eQTL analysis, and this revealed a genome-wide distribution of 23,738 significant eQTLs. Here we have explored the potential of using these mRNA abundance eQTL traits as surrogates for the identification of candidate genes underlying the interaction between barley and the wheat stem rust fungus Puccinia graminis f. sp. tritici. We re-analysed quantitative 'resistance phenotype' data collected on this population in 1990/1991 and identified six loci associated with barley's reaction to stem rust. One of these coincided with the major stem rust resistance locus Rpg1, that we had previously positionally cloned using this population. Correlation analysis between phenotype values for rust infection and mRNA abundance values reported by the 22,840 GeneChip probe sets placed Rpg1, which is on the Barley1 GeneChip, in the top five candidate genes for the major QTL on chromosome 7H corresponding to the location of Rpg1. A second co-located with the rpg4/Rpg5 stem rust resistance locus that has been mapped in a different population and the remaining four were novel. Correlation analyses identified candidate genes for the rpg4/Rpg5 locus on chromosome 5H. By combining our data with additional published mRNA profiling data sets, we identify a putative sensory transduction histidine kinase as a strong candidate for a novel resistance locus on chromosome 2H and compile candidate gene lists for the other three loci.

  2. Genome-wide identification and characterization of NB-ARC resistant genes in wheat (Triticum aestivum L.) and their expression during leaf rust infection.

    Science.gov (United States)

    Chandra, Saket; Kazmi, Andaleeb Z; Ahmed, Zainab; Roychowdhury, Gargi; Kumari, Veena; Kumar, Manish; Mukhopadhyay, Kunal

    2017-07-01

    NB-ARC domain-containing resistance genes from the wheat genome were identified, characterized and localized on chromosome arms that displayed differential yet positive response during incompatible and compatible leaf rust interactions. Wheat (Triticum aestivum L.) is an important cereal crop; however, its production is affected severely by numerous diseases including rusts. An efficient, cost-effective and ecologically viable approach to control pathogens is through host resistance. In wheat, high numbers of resistance loci are present but only few have been identified and cloned. A comprehensive analysis of the NB-ARC-containing genes in complete wheat genome was accomplished in this study. Complete NB-ARC encoding genes were mined from the Ensembl Plants database to predict 604 NB-ARC containing sequences using the HMM approach. Genome-wide analysis of orthologous clusters in the NB-ARC-containing sequences of wheat and other members of the Poaceae family revealed maximum homology with Oryza sativa indica and Brachypodium distachyon. The identification of overlap between orthologous clusters enabled the elucidation of the function and evolution of resistance proteins. The distributions of the NB-ARC domain-containing sequences were found to be balanced among the three wheat sub-genomes. Wheat chromosome arms 4AL and 7BL had the most NB-ARC domain-containing contigs. The spatio-temporal expression profiling studies exemplified the positive role of these genes in resistant and susceptible wheat plants during incompatible and compatible interaction in response to the leaf rust pathogen Puccinia triticina. Two NB-ARC domain-containing sequences were modelled in silico, cloned and sequenced to analyze their fine structures. The data obtained in this study will augment isolation, characterization and application NB-ARC resistance genes in marker-assisted selection based breeding programs for improving rust resistance in wheat.

  3. Crown rust control on oats

    International Nuclear Information System (INIS)

    Frey, K.J.; Browning, J.A.; Simons, M.D.

    1976-01-01

    Attempts have been made to test the relative effectiveness of EMS treatment for inducing tolerance to crown rust among oat strains Clintland-60 of different ploidy levels. One strain of diploid and one of tetraploid oats were treated with EMS. These two strains are as susceptible to damage from crown rust as are cultivars of hexaploid oats. Multiline cultivars of oats have been shown to provide adequate protection from economic loss due to crown-rust disease in Iowa. Since 1968, eleven multiline cultivars of oats have been released from the Iowa station for use in commercial production in the midwestern USA. During the past two winter seasons, the effectiveness of multiline oat cultivars against crown-rust disease has been researched in Texas, USA, which has a ''long rust season'' of about four months, not an Iowa ''short rust season''. The protection against crown rust afforded by the multiline cultivars appeared equally good in Texas and Iowa. The seasonal productions of crown-rust spores relative to completely resistant and susceptible checks were nearly identical in both environments. Fifteen new isolines of oats have been developed for use in multiline varieties, with seed supplies sufficiently large for immediate use

  4. Effector proteins of rust fungi.

    Science.gov (United States)

    Petre, Benjamin; Joly, David L; Duplessis, Sébastien

    2014-01-01

    Rust fungi include many species that are devastating crop pathogens. To develop resistant plants, a better understanding of rust virulence factors, or effector proteins, is needed. Thus far, only six rust effector proteins have been described: AvrP123, AvrP4, AvrL567, AvrM, RTP1, and PGTAUSPE-10-1. Although some are well established model proteins used to investigate mechanisms of immune receptor activation (avirulence activities) or entry into plant cells, how they work inside host tissues to promote fungal growth remains unknown. The genome sequences of four rust fungi (two Melampsoraceae and two Pucciniaceae) have been analyzed so far. Genome-wide analyses of these species, as well as transcriptomics performed on a broader range of rust fungi, revealed hundreds of small secreted proteins considered as rust candidate secreted effector proteins (CSEPs). The rust community now needs high-throughput approaches (effectoromics) to accelerate effector discovery/characterization and to better understand how they function in planta. However, this task is challenging due to the non-amenability of rust pathosystems (obligate biotrophs infecting crop plants) to traditional molecular genetic approaches mainly due to difficulties in culturing these species in vitro. The use of heterologous approaches should be promoted in the future.

  5. Screening for and Inheritance of Resistance to Barley Leaf Stripe (Drechslera graminea),

    Science.gov (United States)

    1987-12-01

    number of resistant varie- ties. The heredity of resistance was treated to only a limited extent in these investigations. On this background we decided to...been said in this connection that the resistance appeared to be a form of hypersensitivity (SKOROPAD and ARNY, 1956; SMEDEGAARD-PEERSEN, 1976...large number of barleys were ,moderately resistant or moderate)y susceptible in all the series (Figs 6-12). It is possible to trace the heredity of the

  6. Transcriptomic and metabolomic analyses identify a role for chlorophyll catabolism and phytoalexin during Medicago nonhost resistance against Asian soybean rust.

    Science.gov (United States)

    Ishiga, Yasuhiro; Uppalapati, Srinivasa Rao; Gill, Upinder S; Huhman, David; Tang, Yuhong; Mysore, Kirankumar S

    2015-08-12

    Asian soybean rust (ASR) caused by Phakopsora pachyrhizi is a devastating foliar disease affecting soybean production worldwide. Understanding nonhost resistance against ASR may provide an avenue to engineer soybean to confer durable resistance against ASR. We characterized a Medicago truncatula-ASR pathosystem to study molecular mechanisms of nonhost resistance. Although urediniospores formed appressoria and penetrated into epidermal cells of M. truncatula, P. pachyrhizi failed to sporulate. Transcriptomic analysis revealed the induction of phenylpropanoid, flavonoid and isoflavonoid metabolic pathway genes involved in the production of phytoalexin medicarpin in M. truncatula upon infection with P. pachyrhizi. Furthermore, genes involved in chlorophyll catabolism were induced during nonhost resistance. We further characterized one of the chlorophyll catabolism genes, Stay-green (SGR), and demonstrated that the M. truncatula sgr mutant and alfalfa SGR-RNAi lines showed hypersensitive-response-like enhanced cell death upon inoculation with P. pachyrhizi. Consistent with transcriptomic analysis, metabolomic analysis also revealed the accumulation of medicarpin and its intermediate metabolites. In vitro assay showed that medicarpin inhibited urediniospore germination and differentiation. In addition, several triterpenoid saponin glycosides accumulated in M. truncatula upon inoculation with P. pachyrhizi. In summary, using multi-omic approaches, we identified a correlation between phytoalexin production and M. truncatula defense responses against ASR.

  7. Genetic analysis of adult-plant resistance to leaf rust in a double haploid wheat (Triticum aestivum L. em Thell population

    Directory of Open Access Journals (Sweden)

    Sandra Patussi Brammer

    2004-01-01

    Full Text Available A genetic analysis of adult plant resistance to leaf rust (Puccinia triticina was performed in in vitro obtained double haploid progenies from a cross between the Brazilian wheat cultivar Trigo BR 35, which, under the high inoculum pressure of the southern region, has been resistant to leaf rust for more than 12 years, and the susceptible cultivar IAC 13-Lorena. Haplodiploidization via in vitro gimnogenesis was done by somatic elimination of the pollen donor genome after maize pollination of the F1 plants. The advantages and usefulness of double haploids (DH for genetic analysis of complex inherited traits like durable adult-plant resistance to wheat leaf rust were evident: it was possible to analyze inheritance patterns in this cross by using only the 35 DH homozygous segregant lines obtained by in vitro embryo culture of F1 flowers pollinated by maize, this number being equivalent to 1,225 conventional F2 lines because of lack of heterozygosity. After being infected with MCG and LPG races, the results indicated that Trigo BR 35 has two resistance genes. One of the genes expressed resistance only after the intermediate stage of plant development (5-6 leaves.

  8. Marker-assisted pyramiding of Thinopyrumderived leaf rust ...

    Indian Academy of Sciences (India)

    2017-03-20

    Mar 20, 2017 ... (Short Title: Marker assisted pyramiding of leaf rust resistance genes). Key words: Wheat, leaf rust, molecular marker, gene pyramiding,marker assisted selection. Abstract. The study was undertaken to pyramid two effective leaf rust resistance genes (Lr19 and Lr24) derived from Thinopyrum(syn.Agropyron) ...

  9. Genetic Variation of Growth and Disease Resistance Traits in Open-Pollinated Provenance-Progeny Trials of Falcataria moluccana Growing on Two Rust-Affected Sites at Age-18 Months

    Directory of Open Access Journals (Sweden)

    Liliana Baskorowati

    2017-04-01

    Full Text Available Two Falcataria moluccana (sengon progeny trials, incorporating 100 different families from 12 provenances growing on two highly gall rust (Uromycladium falcatarium prone sites were used to estimate genetic parameters and potentially identify rust-resistant material. Analysis was performed to assess provenance- and family-level survival, rust incidence, and growth at the two progeny trials. Height, diameter, survival, and rust incidence was measured at two progeny trials at 18 months-of-age located at Jember and Lumajang, East Java. Rust incidence at the two trial sites was severe, with only 39% overall survival (35% and 43% at Jember and Lumajang, repectively. The analysis revealed significant genetic variation at the provenance level for survival, rust incidence, and growth. No statistically meaningful narrow-sense heritability of these traits was indicated, though this is probably reflective of the inadequate within-family replication and effects associated with uneven stocking resulting from rust-induced mortality. Significant genotype-by environment (provenance-by-site interaction was also indicated, though the performance of some of the best- and worst-performing provenances was relatively stable, allowing recommendations of suitable provenances for further testing on rust-prone sites

  10. Development of PCR markers for the selection of wheat stem rust resistance genes Sr24 and Sr26 in diverse wheat germplasm.

    Science.gov (United States)

    Mago, R; Bariana, H S; Dundas, I S; Spielmeyer, W; Lawrence, G J; Pryor, A J; Ellis, J G

    2005-08-01

    The use of major resistance genes is the most cost-effective strategy for preventing stem rust epidemics in Australian wheat crops. The long-term success of this strategy is dependent on combining resistance genes that are effective against all predominant races of the pathogen, a task greatly assisted by the use of molecular markers linked to individual resistance genes. The wheat stem rust resistance genes Sr24 and Sr26 (derived from Agropyron elongatum) and SrR and Sr31 (derived from rye) are available in wheat as segments of alien chromosome translocated to wheat chromosomes. Each of these genes provides resistance to all races of wheat stem rust currently found in Australia . We have developed robust PCR markers for Sr24 and Sr26 (this study) and SrR and Sr31 (previously reported) that are applicable across a wide selection of Australian wheat germplasm. Wheat lines have recently become available in which the size of the alien segments containing Sr26, SrR and Sr31 has been reduced. Newly developed PCR-markers can be used to identify the presence of the shorter alien segment in all cases. Assuming that these genes have different gene-for-gene specificities and that the wheat industry will discourage the use of varieties carrying single genes only, the newly developed PCR markers will facilitate the incorporation of two or more of the genes Sr24, Sr26, SrR and Sr31 into wheat lines and have the potential to provide durable control to stem rust in Australia and elsewhere.

  11. Genetic mapping of SrCad and SNP marker development for marker-assisted selection of Ug99 stem rust resistance in wheat.

    Science.gov (United States)

    Kassa, Mulualem T; You, Frank M; Fetch, Tom G; Fobert, Pierre; Sharpe, Andrew; Pozniak, Curtis J; Menzies, James G; Jordan, Mark C; Humphreys, Gavin; Zhu, Tingting; Luo, Ming-Cheng; McCartney, Curt A; Hiebert, Colin W

    2016-07-01

    New SNP markers that can be used for marker-assisted selection and map-based cloning saturate the chromosome region carrying SrCad , a wheat gene that confers resistance to Ug99 stem rust. Wheat stem rust, caused by Puccinia graminis f. sp. tritici, is a devastating disease of wheat worldwide. Development of cultivars with effective resistance has been the primary means to control this disease, but the appearance of new virulent strains such as Ug99 has rendered most wheat varieties vulnerable. The stem rust resistance gene SrCad located on chromosome arm 6DS has provided excellent resistance to various strains of Ug99 in field nurseries conducted in Njoro, Kenya since 2005. Three genetic populations were used to identify SNP markers closely linked to the SrCad locus. Of 220 SNP markers evaluated, 27 were found to be located within a 2 cM region surrounding SrCad. The diagnostic potential of these SNPs was evaluated in a diverse set of 50 wheat lines that were primarily of Canadian origin with known presence or absence of SrCad. Three SNP markers tightly linked proximally to SrCad and one SNP that co-segregated with SrCad were completely predictive of the presence or absence of SrCad. These markers also differentiated SrCad from Sr42 and SrTmp which are also located in the same region of chromosome arm 6DS. These markers should be useful in marker-assisted breeding to develop new wheat varieties containing SrCad-based resistance to Ug99 stem rust.

  12. White pine blister rust resistance of 12 western white pine families at three field sites in the Pacific Northwest

    Science.gov (United States)

    Richard A. Sniezko; Robert Danchok; Jim Hamlin; Angelia Kegley; Sally Long; James Mayo

    2012-01-01

    Western white pine (Pinus monticola Douglas ex D. Don) is highly susceptible to the non-native, invasive pathogen Cronartium ribicola, the causative agent of white pine blister rust. The susceptibility of western white pine to blister rust has limited its use in restoration and reforestation throughout much of western North...

  13. Genetic control of partial resistance to Asian soybean rust doi: 10.4025/actasciagron.v36i1.16919

    Directory of Open Access Journals (Sweden)

    Juliana Araújo Santos Martins

    2014-01-01

    Full Text Available The genetic control of rust resistance was studied using the Caiapônia x IAC-100 and Luziânia x Potenza crosses. The F2 and F3 generations were evaluated. Rust severity was quantified through visual assessment of the middle third of three leaflets per plant and performed by three different evaluators; the average score was calculated foreach individual plant. From these data, we estimated the mean and variance of the genetic components by employing the weighted least squares method. The estimated number of genes and broad- and narrow-sense heritabilities were also obtained. It was concluded that rust resistance is a characteristic controlled by 2 to 23 genes that are predominantly dominant. The estimate of narrow-sense heritability was greater than 70% for the Caiapônia x IAC-100 cross, and the wide-sense heritability was greater than 60% for the Luziânia x Potenza cross; thus, it is possible to successfully select resistant individuals in early generations.

  14. High-resolution mapping reveals linkage between genes in common bean cultivar Ouro Negro conferring resistance to the rust, anthracnose, and angular leaf spot diseases.

    Science.gov (United States)

    Valentini, Giseli; Gonçalves-Vidigal, Maria Celeste; Hurtado-Gonzales, Oscar P; de Lima Castro, Sandra Aparecida; Cregan, Perry B; Song, Qijian; Pastor-Corrales, Marcial A

    2017-08-01

    Co-segregation analysis and high-throughput genotyping using SNP, SSR, and KASP markers demonstrated genetic linkage between Ur-14 and Co-3 4 /Phg-3 loci conferring resistance to the rust, anthracnose and angular leaf spot diseases of common bean. Rust, anthracnose, and angular leaf spot are major diseases of common bean in the Americas and Africa. The cultivar Ouro Negro has the Ur-14 gene that confers broad spectrum resistance to rust and the gene cluster Co-3 4 /Phg-3 containing two tightly linked genes conferring resistance to anthracnose and angular leaf spot, respectively. We used co-segregation analysis and high-throughput genotyping of 179 F 2:3 families from the Rudá (susceptible) × Ouro Negro (resistant) cross-phenotyped separately with races of the rust and anthracnose pathogens. The results confirmed that Ur-14 and Co-3 4 /Phg-3 cluster in Ouro Negro conferred resistance to rust and anthracnose, respectively, and that Ur-14 and the Co-3 4 /Phg-3 cluster were closely linked. Genotyping the F 2:3 families, first with 5398 SNPs on the Illumina BeadChip BARCBEAN6K_3 and with 15 SSR, and eight KASP markers, specifically designed for the candidate region containing Ur-14 and Co-3 4 /Phg-3, permitted the creation of a high-resolution genetic linkage map which revealed that Ur-14 was positioned at 2.2 cM from Co-3 4 /Phg-3 on the short arm of chromosome Pv04 of the common bean genome. Five flanking SSR markers were tightly linked at 0.1 and 0.2 cM from Ur-14, and two flanking KASP markers were tightly linked at 0.1 and 0.3 cM from Co-3 4 /Phg-3. Many other SSR, SNP, and KASP markers were also linked to these genes. These markers will be useful for the development of common bean cultivars combining the important Ur-14 and Co-3 4 /Phg-3 genes conferring resistance to three of the most destructive diseases of common bean.

  15. Relocation of a rust resistance gene R 2 and its marker-assisted gene pyramiding in confection sunflower (Helianthus annuus L.).

    Science.gov (United States)

    Qi, L L; Ma, G J; Long, Y M; Hulke, B S; Gong, L; Markell, S G

    2015-03-01

    The rust resistance gene R 2 was reassigned to linkage group 14 of the sunflower genome. DNA markers linked to R 2 were identified and used for marker-assisted gene pyramiding in a confection type genetic background. Due to the frequent evolution of new pathogen races, sunflower rust is a recurring threat to sunflower production worldwide. The inbred line Morden Cross 29 (MC29) carries the rust resistance gene, R 2 , conferring resistance to numerous races of rust fungus in the US, Canada, and Australia, and can be used as a broad-spectrum resistance resource. Based on phenotypic assessments and SSR marker analyses on the 117 F2 individuals derived from a cross of HA 89 with MC29 (USDA), R 2 was mapped to linkage group (LG) 14 of the sunflower, and not to the previously reported location on LG9. The closest SSR marker HT567 was located at 4.3 cM distal to R 2 . Furthermore, 36 selected SNP markers from LG14 were used to saturate the R 2 region. Two SNP markers, NSA_002316 and SFW01272, flanked R 2 at a genetic distance of 2.8 and 1.8 cM, respectively. Of the three closely linked markers, SFW00211 amplified an allele specific for the presence of R 2 in a marker validation set of 46 breeding lines, and SFW01272 was also shown to be diagnostic for R 2 . These newly developed markers, together with the previously identified markers linked to the gene R 13a , were used to screen 524 F2 individuals from a cross of a confection R 2 line and HA-R6 carrying R 13a . Eleven homozygous double-resistant F2 plants with the gene combination of R 2 and R 13a were obtained. This double-resistant line will be extremely useful in confection sunflower, where few rust R genes are available, risking evolution of new virulence phenotypes and further disease epidemics.

  16. Genetic mapping of the stem rust (Puccinia graminis f. sp. tritici Eriks. & E. Henn) resistance gene Sr13 in wheat (Triticum aestivum L.).

    Science.gov (United States)

    Admassu, Belayneh; Perovic, Dragan; Friedt, Wolfgang; Ordon, Frank

    2011-02-01

    Puccinia graminis f. sp. tritici, the causative agent of stem rust in wheat, is known for its high virulence variability and ability to evolve new virulence to resistance genes. Thus, pyramiding of several resistance genes in a single line is the best strategy for a sustainable control of wheat stem rust. Sr13 is one of the few resistance genes that are effective against wide ranging P. graminis f. sp. tritici races, including the pestilent race Ug99. Its effectiveness to Ug99 makes it a valuable source for resistance to stem rust. Molecular markers play a pivotal role in the genetic characterization of the new sources of resistance as well as in stacking two or more resistance genes in a single line. Therefore, the aim of this study was to develop molecular markers for Sr13 facilitating efficient pyramiding of Sr genes. Based on the 158 F(2) individuals derived from a cross of Khapstein/9*LMPG × Morocco and SSR analyses, the Sr13 locus was mapped on chromosome 6A of wheat, and a genetic map comprising about 90 cM was constructed with the closest marker barc37 being located 4.0 cM distally of Sr13. Of the nine mapped markers, barc37 amplified an allele specific for the presence of Sr13 as shown by testing different cultivars and breeding lines. These newly developed markers will increase the efficiency of incorporating Sr13 into cultivars that are widely adopted, but susceptible to hazardous Ug99 and/or assist for the development of new elite lines that are resistant to Ug99.

  17. Development of wheat-Aegilops speltoides recombinants and simple PCR-based markers for Sr32 and a new stem rust resistance gene on the 2S#1 chromosome.

    Science.gov (United States)

    Mago, Rohit; Verlin, Dawn; Zhang, Peng; Bansal, Urmil; Bariana, Harbans; Jin, Yue; Ellis, Jeffrey; Hoxha, Sami; Dundas, Ian

    2013-12-01

    Wheat- Aegilops speltoides recombinants carrying stem rust resistance genes Sr32 and SrAes1t effective against Ug99 and PCR markers for marker-assisted selection. Wild relatives of wheat are important resources for new rust resistance genes but underutilized because the valuable resistances are often linked to negative traits that prevent deployment of these genes in commercial wheats. Here, we report ph1b-induced recombinants with reduced alien chromatin derived from E.R. Sears' wheat-Aegilops speltoides 2D-2S#1 translocation line C82.2, which carries the widely effective stem rust resistance gene Sr32. Infection type assessments of the recombinants showed that the original translocation in fact carries two stem rust resistance genes, Sr32 on the short arm and a previously undescribed gene SrAes1t on the long arm of chromosome 2S#1. Recombinants with substantially shortened alien chromatin were produced for both genes, which confer resistance to stem rust races in the TTKSK (Ug99) lineage and representative races of all Australian stem rust lineages. Selected recombinants were back crossed into adapted Australian cultivars and PCR markers were developed to facilitate the incorporation of these genes into future wheat varieties. Our recombinants and those from several other labs now show that Sr32, Sr39, and SrAes7t on the short arm and Sr47 and SrAes1t on the long arm of 2S#1 form two linkage groups and at present no rust races are described that can distinguish these resistance specificities.

  18. Genetics and mapping of the R₁₁ gene conferring resistance to recently emerged rust races, tightly linked to male fertility restoration, in sunflower (Helianthus annuus L.).

    Science.gov (United States)

    Qi, L L; Seiler, G J; Vick, B A; Gulya, T J

    2012-09-01

    Sunflower oil is one of the major sources of edible oil. As the second largest hybrid crop in the world, hybrid sunflowers are developed by using the PET1 cytoplasmic male sterility system that contributes to a 20 % yield advantage over the open-pollinated varieties. However, sunflower production in North America has recently been threatened by the evolution of new virulent pathotypes of sunflower rust caused by the fungus Puccinia helianthi Schwein. Rf ANN-1742, an 'HA 89' backcross restorer line derived from wild annual sunflower (Helianthus annuus L.), was identified as resistant to the newly emerged rust races. The aim of this study was to elucidate the inheritance of rust resistance and male fertility restoration and identify the chromosome location of the underlying genes in Rf ANN-1742. Chi-squared analysis of the segregation of rust response and male fertility in F(2) and F(3) populations revealed that both traits are controlled by single dominant genes, and that the rust resistance gene is closely linked to the restorer gene in the coupling phase. The two genes were designated as R ( 11 ) and Rf5, respectively. A set of 723 mapped SSR markers of sunflower was used to screen the polymorphism between HA 89 and the resistant plant. Bulked segregant analysis subsequently located R ( 11 ) on linkage group (LG) 13 of sunflower. Based on the SSR analyses of 192 F(2) individuals, R ( 11 ) and Rf5 both mapped to the lower end of LG13 at a genetic distance of 1.6 cM, and shared a common marker, ORS728, which was mapped 1.3 cM proximal to Rf5 and 0.3 cM distal to R ( 11 ) (Rf5/ORS728/R ( 11 )). Two additional SSRs were linked to Rf5 and R ( 11 ): ORS995 was 4.5 cM distal to Rf5 and ORS45 was 1.0 cM proximal to R ( 11 ). The advantage of such an introduced alien segment harboring two genes is its large phenotypic effect and simple inheritance, thereby facilitating their rapid deployment in sunflower breeding programs. Suppressed recombination was observed in LGs 2, 9

  19. Quantitative and qualitative stem rust resistance factors in barley are associated with transcriptional suppression of defense regulons.

    Science.gov (United States)

    Moscou, Matthew J; Lauter, Nick; Steffenson, Brian; Wise, Roger P

    2011-07-01

    Stem rust (Puccinia graminis f. sp. tritici; Pgt) is a devastating fungal disease of wheat and barley. Pgt race TTKSK (isolate Ug99) is a serious threat to these Triticeae grain crops because resistance is rare. In barley, the complex Rpg-TTKSK locus on chromosome 5H is presently the only known source of qualitative resistance to this aggressive Pgt race. Segregation for resistance observed on seedlings of the Q21861 × SM89010 (QSM) doubled-haploid (DH) population was found to be predominantly qualitative, with little of the remaining variance explained by loci other than Rpg-TTKSK. In contrast, analysis of adult QSM DH plants infected by field inoculum of Pgt race TTKSK in Njoro, Kenya, revealed several additional quantitative trait loci that contribute to resistance. To molecularly characterize these loci, Barley1 GeneChips were used to measure the expression of 22,792 genes in the QSM population after inoculation with Pgt race TTKSK or mock-inoculation. Comparison of expression Quantitative Trait Loci (eQTL) between treatments revealed an inoculation-dependent expression polymorphism implicating Actin depolymerizing factor3 (within the Rpg-TTKSK locus) as a candidate susceptibility gene. In parallel, we identified a chromosome 2H trans-eQTL hotspot that co-segregates with an enhancer of Rpg-TTKSK-mediated, adult plant resistance discovered through the Njoro field trials. Our genome-wide eQTL studies demonstrate that transcript accumulation of 25% of barley genes is altered following challenge by Pgt race TTKSK, but that few of these genes are regulated by the qualitative Rpg-TTKSK on chromosome 5H. It is instead the chromosome 2H trans-eQTL hotspot that orchestrates the largest inoculation-specific responses, where enhanced resistance is associated with transcriptional suppression of hundreds of genes scattered throughout the genome. Hence, the present study associates the early suppression of genes expressed in this host-pathogen interaction with enhancement

  20. Quantitative and qualitative stem rust resistance factors in barley are associated with transcriptional suppression of defense regulons.

    Directory of Open Access Journals (Sweden)

    Matthew J Moscou

    2011-07-01

    Full Text Available Stem rust (Puccinia graminis f. sp. tritici; Pgt is a devastating fungal disease of wheat and barley. Pgt race TTKSK (isolate Ug99 is a serious threat to these Triticeae grain crops because resistance is rare. In barley, the complex Rpg-TTKSK locus on chromosome 5H is presently the only known source of qualitative resistance to this aggressive Pgt race. Segregation for resistance observed on seedlings of the Q21861 × SM89010 (QSM doubled-haploid (DH population was found to be predominantly qualitative, with little of the remaining variance explained by loci other than Rpg-TTKSK. In contrast, analysis of adult QSM DH plants infected by field inoculum of Pgt race TTKSK in Njoro, Kenya, revealed several additional quantitative trait loci that contribute to resistance. To molecularly characterize these loci, Barley1 GeneChips were used to measure the expression of 22,792 genes in the QSM population after inoculation with Pgt race TTKSK or mock-inoculation. Comparison of expression Quantitative Trait Loci (eQTL between treatments revealed an inoculation-dependent expression polymorphism implicating Actin depolymerizing factor3 (within the Rpg-TTKSK locus as a candidate susceptibility gene. In parallel, we identified a chromosome 2H trans-eQTL hotspot that co-segregates with an enhancer of Rpg-TTKSK-mediated, adult plant resistance discovered through the Njoro field trials. Our genome-wide eQTL studies demonstrate that transcript accumulation of 25% of barley genes is altered following challenge by Pgt race TTKSK, but that few of these genes are regulated by the qualitative Rpg-TTKSK on chromosome 5H. It is instead the chromosome 2H trans-eQTL hotspot that orchestrates the largest inoculation-specific responses, where enhanced resistance is associated with transcriptional suppression of hundreds of genes scattered throughout the genome. Hence, the present study associates the early suppression of genes expressed in this host-pathogen interaction with

  1. Molecular and genetic study of wheat rusts | Le Maitre | African ...

    African Journals Online (AJOL)

    Molecular and genetic study of wheat rusts. ... Puccinia triticina, Puccinia graminis and Puccinia striiformis cause leaf, stem and yellow rust, respectively. Wheat rusts can cause ... Breeding resistant cultivars is a long process and requires an accurate picture of the current and future pathogen population. Differentiation of ...

  2. Variation in theAvrSr35gene determinesSr35resistance against wheat stem rust race Ug99.

    Science.gov (United States)

    Salcedo, Andres; Rutter, William; Wang, Shichen; Akhunova, Alina; Bolus, Stephen; Chao, Shiaoman; Anderson, Nickolas; De Soto, Monica Fernandez; Rouse, Matthew; Szabo, Les; Bowden, Robert L; Dubcovsky, Jorge; Akhunov, Eduard

    2017-12-22

    Puccinia graminis f. sp. tritici ( Pgt ) causes wheat stem rust, a devastating fungal disease. The Sr35 resistance gene confers immunity against this pathogen's most virulent races, including Ug99. We used comparative whole-genome sequencing of chemically mutagenized and natural Pgt isolates to identify a fungal gene named AvrSr35 that is required for Sr35 avirulence. The AvrSr35 gene encodes a secreted protein capable of interacting with Sr35 and triggering the immune response. We show that the origin of Pgt isolates virulent on Sr35 is associated with the nonfunctionalization of the AvrSr35 gene by the insertion of a mobile element. The discovery of AvrSr35 provides a new tool for Pgt surveillance, identification of host susceptibility targets, and characterization of the molecular determinants of immunity in wheat. Copyright © 2017 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  3. Transferring Translucent Endosperm Mutant Gene Wx-mq and Rice Stripe Disease Resistance Gene Stv-bi by Marker-Assisted Selection in Rice (Oryza sativa

    Directory of Open Access Journals (Sweden)

    Shu YAO

    2011-06-01

    Full Text Available A high-yielding japonica rice variety, Wuyunjing 7, bred in Jiangsu Province, China as a female parent was crossed with a Japanese rice variety Kantou 194, which carries a rice stripe disease resistance gene Stv-bi and a translucent endosperm mutant gene Wx-mq. From F2 generations, a sequence characterized amplified region (SCAR marker tightly linked with Stv-bi and a cleaved amplified polymorphic sequence (CAPS marker for Wx-mq were used for marker-assisted selection. Finally, a new japonica rice line, Ning 9108, with excellent agronomic traits was obtained by multi-generational selection on stripe disease resistance and endosperm appearance. The utilization of the markers from genes related to rice quality and disease resistance was helpful not only for establishing a marker-assisted selection system of high-quality and disease resistance for rice but also for providing important intermediate materials and rapid selection method for good quality, disease resistance and high yield in rice breeding.

  4. Marcadores RAPD para detecção de resistência à ferrugem-asiática-da-soja RAPD markers for detection soybean rust resistance

    Directory of Open Access Journals (Sweden)

    Marcelo Marchi Costa

    2008-12-01

    Full Text Available Os objetivos deste trabalho foram confirmar a herança da resistência da PI 459025 (Rpp4 à ferrugem-asiática-da-soja e identificar marcadores moleculares do tipo RAPD, ligados a este gene de resistência, em populações de soja. Pelo cruzamento dos genitores contrastantes PI 459025 x Coodetec 208 obteve-se uma população, cujas populações das gerações F2 e F2:3 foram artificialmente infectadas e avaliadas quanto à reação ao fungo Phakopsora pachyrhizi, pelo tipo de lesão (RB - resistente e TAN - suscetível. Com os resultados da avaliação fenotípica, dois "bulks" foram obtidos com DNA de plantas homozigóticas resistentes e suscetíveis, respectivamente, pela análise de "bulks" segregantes. De 600 iniciadores RAPD aleatórios, foram identificados três com fragmentos polimórficos entre os "bulks" e parentais contrastantes quanto à resistência. Pela análise do qui-quadrado, confirmaram-se: a herança monogênica, com dominância completa quanto à resistência ao patógeno, e a segregação 3:1 para a presença de banda dos três marcadores. Os três marcadores são ligados respectivamente a 5,1, 6,3 e 14,7 cM de distância do loco de resistência, em fase de repulsão no grupo de ligação G, o que foi confirmado pela utilização do marcador microssatélite Satt288. Estes marcadores são promissores na seleção assistida para resistência à ferrugem-asiática-da-soja.The objectives of this work were to confirm the PI 459025 inheritance of resistance (Rpp4 to Asian soybean rust pathogen and to detect RAPD markers linked to this resistance gene in soybean populations. Through the cross of the distint parental lines PI 459025 x Coodetec 208, a population was obtained, whose F2 and F2:3 generations had their populations artificially infected and evaluated for the reaction to Phakopsora pachyrhizi, by lesion type classification (RB - resistant and TAN - susceptible. Using the phenotypic results, the bulked segregant analysis

  5. Genetic Characterization of Resistance to Wheat Stem Rust Race TTKSK in Landrace and Wild Barley Accessions Identifies the rpg4/Rpg5 Locus.

    Science.gov (United States)

    Mamo, Bullo Erena; Smith, Kevin P; Brueggeman, Robert S; Steffenson, Brian J

    2015-01-01

    Race TTKSK of the wheat stem rust pathogen (Puccinia graminis f. sp. tritici) threatens the production of wheat and barley worldwide because of its broad-spectrum virulence on many widely grown cultivars. Sources of resistance against race TTKSK were recently identified in several barley landraces (Hordeum vulgare subsp. vulgare) and wild barley accessions (H. vulgare subsp. spontaneum). The objectives of this study were to characterize the inheritance of resistance to wheat stem rust race TTKSK in four barley landraces (Hv501, Hv545, Hv602, and Hv612) and two wild barley (WBDC213 and WBDC345) accessions, map the resistance genes, and determine the allelic relationships among the genes in these accessions and the previously described rpg4/Rpg5 locus. Resistant accessions were crossed with the susceptible cv. Steptoe and resulting F3 populations were evaluated for resistance to race TTKSK at the seedling stage. Segregation of F3 families in populations involving the resistance sources of Hv501, Hv545, Hv612, WBDC213, and WBDC345 fit a 1:2:1 ratio for homozygous resistant (HR)/segregating (SEG)/homozygous susceptible (HS) progenies (with χ2=2.27 to 5.87 and P=0.053 to 0.321), indicating that a single gene confers resistance to race TTKSK. Segregation of F3 families in cross Steptoe/Hv602 did not fit a 1:2:1 ratio (HR/SEG/HS of 20:47:43 with χ2=11.95 and P=0.003), indicating that more than one gene is involved in imparting resistance to race TTKSK. Bulked segregant analysis using >1,500 single-nucleotide polymorphism markers positioned a resistance locus in all six populations on chromosome 5HL in very close proximity to the known location of the rpg4/Rpg5 complex locus. Allelism tests were conducted by making crosses among resistant accessions Hv501, Hv545, and Hv612 and also Q21861 with the rpg4/Rpg5 complex. No segregation was observed in F2 families inoculated with race TTKSK, demonstrating that all Hv lines carry the same allele for resistance and that it

  6. Molecular Mapping and Validation of SrND643: A New Wheat Gene for Resistance to the Stem Rust Pathogen Ug99 Race Group.

    Science.gov (United States)

    Basnet, Bhoja R; Singh, Sukhwinder; Lopez-Vera, Eric E; Huerta-Espino, Julio; Bhavani, Sridhar; Jin, Yue; Rouse, Matthew N; Singh, Ravi P

    2015-04-01

    This study reports the identification of a new gene conferring resistance to the Ug99 lineage of races of Puccinia graminis f. sp. tritici in wheat (Triticum aestivum L.). Because the virulent races of stem rust pathogen continue to pose a serious threat in global wheat production, identification and molecular characterization of new resistance genes remains of utmost important to enhance resistance diversity and durability in wheat germplasm. Advanced wheat breeding line 'ND643/2*Weebill1' carries a stem rust resistance gene, temporarily designated as SrND643, effective against the Ug99 group of P. graminis f. sp. tritici races at both seedling and adult growth stages. This study was conducted to map the chromosomal location of SrND643 and identify closely linked molecular markers to allow its selection in breeding populations. In total, 123 recombinant inbred lines, developed by crossing ND643/2*Weebill1 with susceptible line 'Cacuke', were evaluated for stem rust response in field nurseries at Njoro, Kenya, during two growing seasons in 2010, and were genotyped with DNA markers, including Diversity Arrays Technology, simple sequence repeats (SSR), and single-nucleotide polymorphisms. Linkage mapping tagged SrND643 at the distal end of chromosome 4AL, showing close association with SSR markers Xgwm350 (0.5 centimorgans [cM]), Xwmc219 (4.1 cM), and Xwmc776 (2.9 cM). The race specificity of SrND643 is different from that of Sr7a and Sr7b, indicating that the resistance is conferred by a gene at a new locus or by a new allele of Sr7. The flanking markers Xgwm350 and Xwmc219 were predictive of the presence of SrND643 in advanced germplasm, thus validating the map location and their use in marker-assisted selection.

  7. Winnie Rust

    African Journals Online (AJOL)

    Owner

    Om te trek is om jou kortstondig in 'n liminale staat te bevind. Nóg by jou vertrekpunt, nóg by jou uiteindelike bestemming, sonder die geborgenheid wat hierdie twee vaste plekke kwansuis bied. In 'n hele aantal opsigte is Trek van Winnie Rust 'n beskrywing van verskil- lende liminale state. Dit is egter nie 'n reisverhaal met ...

  8. Seeing Rust

    Science.gov (United States)

    2004-01-01

    The rust color of the Martian landscape is apparent in this low-resolution thumbnail image taken by the panoramic camera on the Mars Exploration Rover Spirit. This image is part of a larger image currently stored onboard the rover in its memory.

  9. Rust essentials

    CERN Document Server

    Balbaert, Ivo

    2015-01-01

    This book is intended for software developers interested in systems level and application programming, and are looking for a quick entry into using Rust and understanding the core features of the framework. It is assumed that you have a basic understanding of Java, C#, Ruby, Python or JavaScript.

  10. Caracteres epidemiológicos e uso da análise de agrupamento para resistência parcial à ferrugem da soja Epidemiological characters and the use of cluster analysis for characterizing partial resistance to soybean rust

    Directory of Open Access Journals (Sweden)

    Juliana Araújo Santos

    2007-03-01

    Full Text Available O objetivo deste trabalho foi avaliar a resistência parcial de genótipos de soja ao fungo Phakopsora pachyrhizi. Calcularam-se o número médio de pústulas, a severidade e a área abaixo da curva de progresso da doença. Foram encontradas diferenças significativas entre os genótipos quanto ao número médio de pústulas e severidade, aos 12 dias após a inoculação. A análise de agrupamento permitiu a discriminação de genótipos parcialmente resistentes. Os genótipos G4, G41 e G42, referentes aos parentais Cristalina e IAC 100, foram detectados como os de maior resistência parcial à ferrugem da soja.The objective of this work was to evaluate the partial resistance of soybean genotypes against Phakopsora pachyrhizi. Resistance characteristics were: average number of pustules, rust severity and the area under the disease progress curve. Significant differences were found among the genotypes for the average number of pustules and rust severity. Multivariate analysis allowed the discrimination of partially resistant genotypes. Three genotypes (G4, G41, and G42, referring to parents Cristalina and IAC 100, presented greater partial resistance to soybean rust.

  11. genetic analysis of resistance to soybean rust disease abstract résumé

    African Journals Online (AJOL)

    Administrator

    Department of Crop Science, Faculty of Agriculture, Makerere University, P. O. Box 7062, Kampala, Uganda .... pollinating crops like soybean depends on the .... Resistant. UG5. -. Uganda. Resistant. Kabanyolo 1. Mutant of Clark 63. Uganda. Susceptible. Nam 1. Hales x P1307-861. Colombia. Susceptible. Wondersoya.

  12. Studies of the genetics of inheritance of stem rust resistance in ...

    African Journals Online (AJOL)

    User

    2013-05-22

    May 22, 2013 ... inheritance studies. Moreso, the recessive nature of some resistance genes and confounding effects of genes in the wheat germplasm background aggravate the pro- blem (Babiker et al., 2009). This calls for the proper understanding of the genetics of disease resistance and use of appropriate crosses in ...

  13. A novel Robertsonian translocation event leads to transfer of a stem rust resistance gene (Sr52) effective against race Ug99 from Dasypyrum villosum into bread wheat.

    Science.gov (United States)

    Qi, L L; Pumphrey, M O; Friebe, Bernd; Zhang, P; Qian, C; Bowden, R L; Rouse, M N; Jin, Y; Gill, B S

    2011-06-01

    Stem rust (Puccinia graminis f. sp. tritici Eriks. & E. Henn.) (the causal agent of wheat stem rust) race Ug99 (also designated TTKSK) and its derivatives have defeated several important stem rust resistance genes widely used in wheat (Triticum aestivum L.) production, rendering much of the worldwide wheat acreage susceptible. In order to identify new resistance sources, a large collection of wheat relatives and genetic stocks maintained at the Wheat Genetic and Genomic Resources Center was screened. The results revealed that most accessions of the diploid relative Dasypyrum villosum (L.) Candargy were highly resistant. The screening of a set of wheat-D. villosum chromosome addition lines revealed that the wheat-D. villosum disomic addition line DA6V#3 was moderately resistant to race Ug99. The objective of the present study was to produce and characterize compensating wheat-D. villosum whole arm Robertsonian translocations (RobTs) involving chromosomes 6D of wheat and 6V#3 of D. villosum through the mechanism of centric breakage-fusion. Seven 6V#3-specific EST-STS markers were developed for screening F(2) progeny derived from plants double-monosomic for chromosomes 6D and 6V#3. Surprisingly, although 6D was the target chromosome, all recovered RobTs involved chromosome 6A implying a novel mechanism for the origin of RobTs. Homozygous translocations (T6AS·6V#3L and T6AL·6V#3S) with good plant vigor and full fertility were selected from F(3) families. A stem rust resistance gene was mapped to the long arm 6V#3L in T6AS·6V#3L and was designated as Sr52. Sr52 is temperature-sensitive and is most effective at 16°C, partially effective at 24°C, and ineffective at 28°C. The T6AS·6V#3L stock is a new source of resistance to Ug99, is cytogenetically stable, and may be useful in wheat improvement.

  14. Identifying and utilizing resistance to Puccinia striiformis in wheat

    International Nuclear Information System (INIS)

    Line, R.F.; Allan, R.E.; Konzak, C.F.

    1976-01-01

    Resistance to Puccinia striiformis in wheat cultivars, breeding lines, and induced mutants, was studied on plants exposed to natural rust inoculum at field sites and on plants inoculated with specific races and grown under controlled temperatures. Based on infection types and disease intensity at various stages of plant growth throughout the duration of rust establishment, the following resistance-types (R-types) were identified: R-type 1, plants resistant or susceptible at all stages of growth and at both low and high temperatures throughout duration of rust establishment; R-type 2, plants initially resistant in the seedling stage but eventually become susceptible, plants resistant at later stages in the field; R-type 3, variable resistance in the seedling stage, high resistance in later growth stages; R-type 4, plants resistant in the eedling stage, but susceptible in late stages of growth; R-type 5, plants susceptible, but the pathogen is slow to sporulate and consequently, rust increases slower in the field; R-type 6, plants susceptible at low temperatures and resistant at high temperatures at all stages of growth; R-type 7, plants very susceptible at both low and high temperatures in the seedling stage and at low temperatures in later stages; when temperatures are high, plants become more resistant in later stages; R-type 8, plants susceptible at all stages, when rust intensity is low and when not under stress, but become more resistant when intensity is high or under moderate stress in the field. Combinations of the above types were also observed. Techniques for identifying resistance to stripe rust, race specificity of the resistance-types, relationship of plant growth habit and head characteristics to disease intensity, historical significance of various types of resistance in the United States, and methods of using the resistance-types are also discussed. (author)

  15. Inheritance and genetic mapping of resistance to Asian soybean rust in cultivar TMG 803

    Directory of Open Access Journals (Sweden)

    Éder Matsuo

    2014-11-01

    Full Text Available This study analyzed the inheritance and identified microsatellite markers linked to the resistance gene to Phakopsora pachyrhizi in soybean cultivar TMG 803. Hybridization between the cultivars TMG 803 and BRS Valiosa RR was performed to obtain F1 progenies and the F2 population. The response of the parents ‘TMG 803’ and ‘BRS Valiosa RR’ to P. pachyrhizi was, respectively, resistant and susceptible, and among the 116 F2 plants, 93 were resistant and 23 susceptible, under natural infection and field conditions. It was found that the resistance of cultivar TMG 803 is controlled by one gene with complete dominance, mapped as resistance locus Rpp4 of linkage group G. Of the 16 tested, one microsatellite marker, sc21_3420, was completely linked to the resistance gene (distance 0.0cM and the favorable allelic form was present in cultivar TMG 803, which may therefore be useful in assisted selection in segregating populations.

  16. Efficient Use of Historical Data for Genomic Selection: A Case Study of Stem Rust Resistance in Wheat

    Directory of Open Access Journals (Sweden)

    J. Rutkoski

    2015-03-01

    Full Text Available Genomic selection (GS is a methodology that can improve crop breeding efficiency. To implement GS, a training population (TP with phenotypic and genotypic data is required to train a statistical model used to predict genotyped selection candidates (SCs. A key factor impacting prediction accuracy is the relationship between the TP and the SCs. This study used empirical data for quantitative adult plant resistance to stem rust of wheat ( L. to investigate the utility of a historical TP (TP compared with a population-specific TP (TP, the potential for TP optimization, and the utility of TP data when close relative data is available for training. We found that, depending on the population size, a TP was 1.5 to 4.4 times more accurate than a TP, and TP optimization based on the mean of the generalized coefficient of determination or prediction error variance enabled the selection of subsets that led to significantly higher accuracy than randomly selected subsets. Retaining historical data when data on close relatives were available lead to a 11.9% increase in accuracy, at best, and a 12% decrease in accuracy, at worst, depending on the heritability. We conclude that historical data could be used successfully to initiate a GS program, especially if the dataset is very large and of high heritability. Training population optimization would be useful for the identification of TP subsets to phenotype additional traits. However, after model updating, discarding historical data may be warranted. More studies are needed to determine if these observations represent general trends.

  17. Over-summering of wheat stripe rust (Puccinia striiformis f.sp. tritici in the California Central valley: A case study Supervivencia estival de la roya estriada (Puccinia striiformis f.sp. tritici del trigo en el Valle Central de California: Estudio de caso

    Directory of Open Access Journals (Sweden)

    Huib Tollenaar

    2012-12-01

    Full Text Available To study the over-summering of wheat stripe rust (Puccinia striiformis f.sp. tritici in the California Central Valley (CCV, temperature records from various locations in the CCV during the period 1950-2009 were examined for the occurrence of lethal maximum temperatures for the uredinia and uredinio-mycelium of this fungus. The lethal upper threshold temperature for the uredinial stage of P.s. tritici, estimated to be 40.5 °C on the basis of data published elsewhere, and the sum, accumulated during ten consecutive days, of the respective lethal temperature quotients (ALTQio, accounting for the partial lethal effect of the daily ambient temperatures between 30 and 40.5 °C on the uredinial stage of P.s. tritici, were used as yardsticks for thermal lethality. The results indicate that, in these 60 yr, the uredinia and the uredinio-mycelium of P.s. tritici could not possibly have over-summered at any of the locations studied. The Sierra Nevada Mountains, together with the Tulelake Basin and the coastal zone of the Pacific Ocean are the only two areas in California with appropriate environmental conditions for the summer-survival of the uredinial stage of stripe rust. Therefore, it is presumed that the inoculum for the initial infections of P.s. tritici in wheat fields in the CCV during the following growing season originates in either one or both of these areas, although, a potential third source of inoculum for the initial infections of stripe rust in the CCV could also be involved. Namely, the possible presence of telia with viable teliospores of P.s. tritici in autumn on straw of the threshed wheat fields or on volunteer wheat plants in the CCV, in conjunction with the accidental concurrence of nearby stripe rust susceptible barberry (Berberis spp., could lead to the development of alternative, endogenous sources of inoculum in the CCV.Para estudiar la supervivencia estival de la roya estriada (Puccinia striiformis f.sp. tritici del trigo

  18. Molecular cytogenetic characterization and stem rust resistance of five wheat-thinopyrum ponticum partial amphiploids

    Science.gov (United States)

    Partial amphiploids created by crossing common wheat (Triticum aestivum L.) and Thinopyrum ponticum (Podp.), Barkworth & D. R. Dewey may be resistant to major wheat diseases and are an important intermediate material in wheat breeding. In this study, we examined chromosome composition of five Xiaoy...

  19. The stem rust resistance gene Rpg5 encodes a protein with nucleotide-binding-site, leucine-rich, and protein kinase domains.

    Science.gov (United States)

    Brueggeman, R; Druka, A; Nirmala, J; Cavileer, T; Drader, T; Rostoks, N; Mirlohi, A; Bennypaul, H; Gill, U; Kudrna, D; Whitelaw, C; Kilian, A; Han, F; Sun, Y; Gill, K; Steffenson, B; Kleinhofs, A

    2008-09-30

    We isolated the barley stem rust resistance genes Rpg5 and rpg4 by map-based cloning. These genes are colocalized on a 70-kb genomic region that was delimited by recombination. The Rpg5 gene consists of an unusual structure encoding three typical plant disease resistance protein domains: nucleotide-binding site, leucine-rich repeat, and serine threonine protein kinase. The predicted RPG5 protein has two putative transmembrane sites possibly involved in membrane binding. The gene is expressed at low but detectable levels. Posttranscriptional gene silencing using VIGS resulted in a compatible reaction with a normally incompatible stem rust pathogen. Allele sequencing also validated the candidate Rpg5 gene. Allele and recombinant sequencing suggested that the probable rpg4 gene encoded an actin depolymerizing factor-like protein. Involvement of actin depolymerizing factor genes in nonhost resistance has been documented, but discovery of their role in gene-for-gene interaction would be novel and needs to be further substantiated.

  20. Resistance of soybean genotipes of the cerrado region to rust caused by Phakopsora pachyrhizi

    OpenAIRE

    Azevedo, Luís Antônio Siqueira de; Juliatti, Fernando Cezar; Barreto, Modesto

    2007-01-01

    O presente trabalho teve como objetivo, quantificar a resistência à Phakopsora pachyrhizi em 50 genótipos de soja na região do cerrado. Foi conduzido em Uberlândia, MG , um experimento em casa de vegetação, durante o período de janeiro a julho de 2004. Foram avaliados os seguintes parâmetros de resistência: período latente médio, número médio de pústulas por cm² e severidade da ferrugem. Com base nesses parâmetros, calculou-se a área abaixo da curva de progresso da doença. Após, análise de va...

  1. QTL Mapping of Adult-Plant Resistance to Leaf Rust in the Wheat Cross Zhou 8425B/Chinese Spring Using High-Density SNP Markers

    Directory of Open Access Journals (Sweden)

    Peipei Zhang

    2017-05-01

    Full Text Available Wheat leaf rust is an important disease worldwide. Growing resistant cultivars is an effective means to control the disease. In the present study, 244 recombinant inbred lines from Zhou 8425B/Chinese Spring cross were phenotyped for leaf rust severities during the 2011–2012, 2012–2013, 2013–2014, and 2014–2015 cropping seasons at Baoding, Hebei province, and 2012–2013 and 2013–2014 cropping seasons in Zhoukou, Henan province. The population was genotyped using the high-density Illumina iSelect 90K SNP assay and SSR markers. Inclusive composite interval mapping identified eight QTL, designated as QLr.hebau-2AL, QLr.hebau-2BS, QLr.hebau-3A, QLr.hebau-3BS, QLr.hebau-4AL, QLr.hebau-4B, QLr.hebau-5BL, and QLr.hebau-7DS, respectively. QLr.hebau-2BS, QLr.hebau-3A, QLr.hebau-3BS, and QLr.hebau-5BL were derived from Zhou 8425B, whereas the other four were from Chinese Spring. Three stable QTL on chromosomes 2BS, 4B and 7DS explained 7.5–10.6%, 5.5–24.4%, and 11.2–20.9% of the phenotypic variance, respectively. QLr.hebau-2BS in Zhou 8425B might be the same as LrZH22 in Zhoumai 22; QLr.hebau-4B might be the residual resistance of Lr12, and QLr.hebau-7DS is Lr34. QLr.hebau-2AL, QLr.hebau-3BS, QLr.hebau-4AL, and QLr.hebau-5BL are likely to be novel QTL for leaf rust. These QTL and their closely linked SNP and SSR markers can be used for fine mapping, candidate gene discovery, and marker-assisted selection in wheat breeding.

  2. Isolate specificity and polygenic inheritance of resistance in barley to the heterologous rust pathogen Puccinia graminis f. sp. avenae

    NARCIS (Netherlands)

    Dracatos, P.M.; Nansamba, M.; Berlin, A.; Park, R.F.; Niks, R.E.

    2016-01-01

    Barley is a near-nonhost to numerous heterologous (nonadapted) rust pathogens because a small proportion of genotypes are somewhat susceptible. We assessed 66 barley accessions and three mapping populations (Vada x SusPtrit, Cebada Capa x SusPtrit, and SusPtrit x Golden Promise) for response to

  3. Using landscape genetics simulations for planting blister rust resistant whitebark pine in the US northern Rocky Mountains

    Science.gov (United States)

    Erin L. Landguth; Zachary A. Holden; Mary F. Mahalovich; Samuel A. Cushman

    2017-01-01

    Recent population declines to the high elevation western North America foundation species whitebark pine, have been driven by the synergistic effects of the invasive blister rust pathogen, mountain pine beetle (MPB), fire exclusion, and climate change. This has led to consideration for listing whitebark pine (WBP) as a threatened or endangered species under the...

  4. Identification and validation of single nucleotide polymorphic markers linked to Ug99 stem rust resistance in spring wheat

    Science.gov (United States)

    Wheat stem rust (Puccinia graminis f. sp. tritici Eriks. and E. Henn.) is one of the most destructive diseases world-wide. Races belonging to Ug99 (or TTKSK) continue to cause crop losses in East Africa and threaten global wheat production. Developing and deploying wheat varieties with multiple race...

  5. Association mapping of North American spring wheat breeding germplasm reveals loci conferring resistance to Ug99 and other African stem rust races.

    Science.gov (United States)

    Bajgain, P; Rouse, M N; Bulli, P; Bhavani, S; Gordon, T; Wanyera, R; Njau, P N; Legesse, W; Anderson, J A; Pumphrey, M O

    2015-10-14

    The recently identified Puccinia graminis f. sp. tritici (Pgt) race TTKSK (Ug99) poses a severe threat to global wheat production because of its broad virulence on several widely deployed resistance genes. Additional virulences have been detected in the Ug99 group of races, and the spread of this race group has been documented across wheat growing regions in Africa, the Middle East (Yemen), and West Asia (Iran). Other broadly virulent Pgt races, such as TRTTF and TKTTF, present further difficulties in maintaining abundant genetic resistance for their effective use in wheat breeding against this destructive fungal disease of wheat. In an effort to identify loci conferring resistance to these races, a genome-wide association study was carried out on a panel of 250 spring wheat breeding lines from the International Maize and Wheat Improvement Center (CIMMYT), six wheat breeding programs in the United States and three wheat breeding programs in Canada. The lines included in this study were grouped into two major clusters, based on the results of principal component analysis using 23,976 SNP markers. Upon screening for adult plant resistance (APR) to Ug99 during 2013 and 2014 in artificial stem rust screening nurseries at Njoro, Kenya and at Debre Zeit, Ethiopia, several wheat lines were found to exhibit APR. The lines were also screened for resistance at the seedling stage against races TTKSK, TRTTF, and TKTTF at USDA-ARS Cereal Disease Laboratory in St. Paul, Minnesota; and only 9 of the 250 lines displayed seedling resistance to all the races. Using a mixed linear model, 27 SNP markers associated with APR against Ug99 were detected, including markers linked with the known APR gene Sr2. Using the same model, 23, 86, and 111 SNP markers associated with seedling resistance against races TTKSK, TRTTF, and TKTTF were identified, respectively. These included markers linked to the genes Sr8a and Sr11 providing seedling resistance to races TRTTF and TKTTF, respectively. We

  6. THE HOMOLOGOUS IDENTIFICATION OF THE STEM RUST RESISTANCE GENES RDg5, Adf3 AND RGA1 IN THE RELATIVES OF BARLEY.

    Science.gov (United States)

    Ivaschuk, B V; Samofalova, D O; Pirko, Ya V; Fedak, G; Blume, Ya B

    2016-01-01

    The barley genes Rpg5, RGA1 and Adf3, which provide a strong resistance to many pathotypes of stem rust, were cloned a few years ago, but it was still unclear whether their homologues were represented in wheat and in related species. The paper describes the results of a bioinformatic research to determine the homologues of Rpg5, RGA1 and Adf3 in the genomes of Triticum aestivum and several wild grasses, which breeders usually use as sources of stem rust resistance, and which are available in the genome databases. It was found that the Th. elongatum sequence Q9FEC6 and T. aestivum sequence Q43655 were the high identical homologues of the Adf3 sequence. T. urartu M8A999 sequence and T. aestivum W5FCU1 sequence were found to be the closest homologues of Rpg5 complete protein sequence, but the identity of their kinase domains were not as clear as that of the other domains. The separate Rpg5 kinase part analysis did not provide the strong evidences that its orthologs were presented in our corn species. T urartu M7ZZX9 sequence and T. aestivum W5FFP0 and W5F133 sequences were showed to be the homologues of RGA1. The analysis of the predicted active sites allowed finding out the difference between sequences of Rpg5, RGA1, Adf3 protein and their homologues.

  7. Lighting up superconducting stripes

    Science.gov (United States)

    Ergeçen, Emre; Gedik, Nuh

    2018-02-01

    Cuprate superconductors display a plethora of complex phases as a function of temperature and carrier concentration, the understanding of which could provide clues into the mechanism of superconductivity. For example, when about one-eighth of the conduction electrons are removed from the copper oxygen planes in cuprates such as La2‑xBaxCuO4 (LBCO), the doped holes (missing electrons) organize into one-dimensional stripes (1). The bulk superconducting transition temperature (Tc) is greatly reduced, and just above Tc, electrical transport perpendicular to the planes (along the c axis) becomes resistive, but parallel to the copper oxygen planes, resistivity remains zero for a range of temperatures (2). It was proposed a decade ago (3) that this anisotropic behavior is caused by pair density waves (PDWs); superconducting Cooper pairs exist along the stripes within the planes but cannot tunnel to the adjacent layers. On page 575 of this issue, Rajasekaran et al. (4) now report detection of this state in LBCO using nonlinear reflection of high-intensity terahertz (THz) light.

  8. Development and characterization of a compensating wheat-Thinopyrum intermedium Robertsonian translocation with Sr44 resistance to stem rust (Ug99).

    Science.gov (United States)

    Liu, Wenxuan; Danilova, Tatiana V; Rouse, Matthew N; Bowden, Robert L; Friebe, Bernd; Gill, Bikram S; Pumphrey, Michael O

    2013-05-01

    The emergence of the highly virulent Ug99 race complex of the stem rust fungus (Puccinia graminis Pers. f. sp. tritici Eriks. and Henn.) threatens wheat (Triticum aestivum L.) production worldwide. One of the effective genes against the Ug99 race complex is Sr44, which was derived from Thinopyrum intermedium (Host) Barkworth and D.R. Dewey and mapped to the short arm of 7J (designated 7J#1S) present in the noncompensating T7DS-7J#1L∙7J#1S translocation. Noncompensating wheat-alien translocations are known to cause genomic duplications and deficiencies leading to poor agronomic performance, precluding their direct use in wheat improvement. The present study was initiated to produce compensating wheat-Th. intermedium Robertsonian translocations with Sr44 resistance. One compensating RobT was identified consisting of the wheat 7DL arm translocated to the Th. intermedium 7J#1S arm resulting in T7DL∙7J#1S. The T7DL∙7J#1S stock was designated as TA5657. The 7DL∙7J#1S stock carries Sr44 and has resistance to the Ug99 race complex. This compensating RobT with Sr44 resistance may be useful in wheat improvement. In addition, we identified an unnamed stem rust resistance gene located on the 7J#1L arm that confers resistance not only to Ug99, but also to race TRTTF, which is virulent to Sr44. However, the action of the second gene can be modified by the presence of suppressors in the recipient wheat cultivars.

  9. Variability generation in sugar cane for resistance to mosaic viruses and rusts (puccinia melanocephala) by means of the cultivation of explants and irradiated callus

    International Nuclear Information System (INIS)

    Ventura Gonzalez, Morella Fuchs; Castroni, Sonia; Diaz, Ezequiel

    1997-01-01

    With the purpose to generate sugar cane variability in vitro, in order the obtain genotypes resistant to the mosaic viruses and to the rusts (Puccinia melanocephala), callus coming from cultivars susceptible to the mosaic viruses (B 6749, B 7987 and PR 62258) and to the rusts (B 4362 and PR 641791) were irradiated with different gamma radiation dose. The IVIC cobalt source was used, being applied two, four, eight and twelve krads. The effect of irradiation on the percentage of regeneration of plants for each dose and variety was evaluated. The regenerated plants were taken to shelter, where they were inoculated with the mosaic viruses B (SCMB-B). The asymptomatic subclons were transplanted to field in August of 1992, to evaluate the presence of symptoms of mosaic and rusts. A high proportion of the plants didn't show symptoms of illnesses, being obtained 2,35% of sick plants coming from cultivar B 6749 and 0,72 from cultivar PR 62258. This low incidence of infection remained stable up to the following year of evaluation. The genetic variation was studied through isoenzymatics pattern, peroxidase specifically. This analysis allowed to detect variation in the number and intensity of the bands among the subclons and in the original variety. 229 subclons were selected from cultivar B 6749 and they were incorporated to the program of cultivation improvement. Among them 60 subclons, with good agronomic and productivity characteristics, were chosen and continue being evaluated to be incorporated to the regional essays, last phase of the selection process [es

  10. Wheat Rust Information Resources - Integrated tools and data for improved decision making

    DEFF Research Database (Denmark)

    Hodson, David; Hansen, Jens Grønbech; Lassen, Poul

    an integrated set of datasets on both pathogen and host at the global scale. The Global Cereal Rust Monitoring System (GCRMS), created under the Durable Rust resistance in Wheat (DRRW) project, represents a unique and increasingly comprehensive resource of rust information. A suite of tools are now available....... Integration of the CIMMYT Wheat Atlas and the Genetic Resources Information System (GRIS) databases provides a rich resource on wheat cultivars and their resistance to important rust races. Data access is facilitated via dedicated web portals such as Rust Tracker (www.rusttracker.org) and the Global Rust...

  11. Rust transformation/rust compatible primers

    Science.gov (United States)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  12. Evaluation of rumble stripes.

    Science.gov (United States)

    2010-01-01

    The objective of this study were to: a) monitor the initial installations of rumble stripes and b) evaluate the results of rumble stripe installations. : Ten rural, two-lane road locations were selected by the Kentucky Transportation Cabinet across t...

  13. Resitência de Eucalyptus globulus e Eucalyptus nitens à ferrugem (Puccinia psidii Resistance of Eucalyptus globulus and E. nitens to rust

    Directory of Open Access Journals (Sweden)

    Adelica Aparecida Xavier

    2007-08-01

    Full Text Available Avaliou-se a resistência das espécies de Eucalyptus globulus e Eucalyptus nitens inoculadas com um isolado uredinospórico monopustular de Puccinia psidii origininário de plantio de Eucalypstus grandis (UFV-2 em Itapetininga, SP. A avaliação foi realizada aos 12 dias após a inoculação, e quantificou-se a doença por meio de uma escala de notas com quatro classes de severidade da doença (S0, S1, S2 e S3. Em média, aproximadamente 60% das plantas de E. globulus e 50% de E. nitens foram resistentes a P. psidii. A variabilidade intra-específica nos materiais estudados indica ser possível a clonagem de genótipos resistentes para plantio comercial ou para uso em programas de melhoramento genético.Eucalyptus globulus and Eucalyptus nitens were evaluated for resistance to rust caused by Puccinia psidii. Seedlings were inoculated with a single urediniosporic pustule isolate of P. psidii (UFV-2 obtained from E. grandis from Itapetininga, SP. Disease assessment was carried out 12 days after inoculation based on a rust rating scale with four class of severity (S0, S1, S2 and S3. Percentages of resistant plants were 60% and 50% for E. globulus and E. nitens, respectively. The high intra-specific variability found in this study allows using the clonal propagation of resistant genotypes in commercial plantations or in breeding programs.

  14. Saturated genic SNP mapping identified functional candidates and selection tools for the Pinus monticola Cr2 locus controlling resistance to white pine blister rust.

    Science.gov (United States)

    Liu, Jun-Jun; Sniezko, Richard A; Zamany, Arezoo; Williams, Holly; Wang, Ning; Kegley, Angelia; Savin, Douglas P; Chen, Hao; Sturrock, Rona N

    2017-09-01

    Molecular breeding incorporates efficient tools to increase rust resistance in five-needle pines. Susceptibility of native five-needle pines to white pine blister rust (WPBR), caused by the non-native invasive fungus Cronartium ribicola (J.C. Fisch.), has significantly reduced wild populations of these conifers in North America. Major resistance (R) genes against specific avirulent pathotypes have been found in several five-needle pine species. In this study, we screened genic SNP markers by comparative transcriptome and genetic association analyses and constructed saturated linkage maps for the western white pine (Pinus monticola) R locus (Cr2). Phenotypic segregation was measured by a hypersensitive reaction (HR)-like response on the needles and disease symptoms of cankered stems post inoculation by the C. ribicola avcr2 race. SNP genotypes were determined by HRM- and TaqMan-based SNP genotyping. Saturated maps of the Cr2-linkage group (LG) were constructed in three seed families using a total of 34 SNP markers within 21 unique genes. Cr2 was consistently flanked by contig_2142 (encoding a ruvb-like protein) and contig_3772 (encoding a delta-fatty acid desaturase) across the three seed families. Cr2 was anchored to the Pinus consensus LG-1, which differs from LGs where other R loci of Pinus species were mapped. GO annotation identified a set of NBS-LRR and other resistance-related genes as R candidates in the Cr2 region. Association of one nonsynonymous SNP locus of an NBS-LRR gene with Cr2-mediated phenotypes provides a valuable tool for marker-assisted selection (MAS), which will shorten the breeding cycle of resistance screening and aid in the restoration of WPBR-disturbed forest ecosystems. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  15. A High-Density Integrated DArTseq SNP-Based Genetic Map of Pisum fulvum and Identification of QTLs Controlling Rust Resistance

    Directory of Open Access Journals (Sweden)

    Eleonora Barilli

    2018-02-01

    Full Text Available Pisum fulvum, a wild relative of pea is an important source of allelic diversity to improve the genetic resistance of cultivated species against fungal diseases of economic importance like the pea rust caused by Uromyces pisi. To unravel the genetic control underlying resistance to this fungal disease, a recombinant inbred line (RIL population was generated from a cross between two P. fulvum accessions, IFPI3260 and IFPI3251, and genotyped using Diversity Arrays Technology. A total of 9,569 high-quality DArT-Seq and 8,514 SNPs markers were generated. Finally, a total of 12,058 markers were assembled into seven linkage groups, equivalent to the number of haploid chromosomes of P. fulvum and P. sativum. The newly constructed integrated genetic linkage map of P. fulvum covered an accumulated distance of 1,877.45 cM, an average density of 1.19 markers cM−1 and an average distance between adjacent markers of 1.85 cM. The composite interval mapping revealed three QTLs distributed over two linkage groups that were associated with the percentage of rust disease severity (DS%. QTLs UpDSII and UpDSIV were located in the LGs II and IV respectively and were consistently identified both in adult plants over 3 years at the field (Córdoba, Spain and in seedling plants under controlled conditions. Whenever they were detected, their contribution to the total phenotypic variance varied between 19.8 and 29.2. A third QTL (UpDSIV.2 was also located in the LGIVand was environmentally specific as was only detected for DS % in seedlings under controlled conditions. It accounted more than 14% of the phenotypic variation studied. Taking together the data obtained in the study, it could be concluded that the expression of resistance to fungal diseases in P. fulvum originates from the resistant parent IFPI3260.

  16. Resistência de genótipos de soja à Phakopsora pachyrhizi Resistance of soybean genotipes of the cerrado region to rust caused by Phakopsora pachyrhizi

    Directory of Open Access Journals (Sweden)

    Luís Antônio Siqueira de Azevedo

    2007-09-01

    Full Text Available O presente trabalho teve como objetivo, quantificar a resistência à Phakopsora pachyrhizi em 50 genótipos de soja na região do cerrado. Foi conduzido em Uberlândia, MG , um experimento em casa de vegetação, durante o período de janeiro a julho de 2004. Foram avaliados os seguintes parâmetros de resistência: período latente médio, número médio de pústulas por cm² e severidade da ferrugem. Com base nesses parâmetros, calculou-se a área abaixo da curva de progresso da doença. Após, análise de variância e teste de médias que foram comparadas pelo teste de Duncan ao nível de 5% de probabilidade, utilizando-se o software ESTAT. Foram encontradas diferenças significativas entre os genótipos de soja para os parâmetros estudados. As cultivares Emgopa 313 e Monsoy 8211 apresentaram menor período latente médio, menor número de pústulas, severidade e área abaixo da curva do progresso da doença, sendo classificadas como resistentes ao patógeno no experimento realizado.The aim of the present study, was to quantify the resistance in fifty soybean genotipes of the cerrado region to the rust caused by Phakopsora pachyrhizi .One experiment in greenhouse were conducted in Uberlândia , MG from January to July 2004. Average latent period, number of pustules per cm² and disease severity were evaluated. Based on these parameters, it was calculated the area under the disease progress curve. Significant differences were found among the soybean genotipes to the three studied parameters. The cultivars Emgopa 313 and Monsoy 8211 were more resistant to Pkakopsora pachyrhizi in greenhouse experiment.

  17. Fighting Asian soybean rust

    Directory of Open Access Journals (Sweden)

    Caspar eLangenbach

    2016-06-01

    Full Text Available Phakopsora pachyrhizi is a biotrophic fungus provoking Asian soybean rust (SBR disease. SBR poses a major threat to global soybean production. Though several resistance genes provided soybean immunity to certain P. pachyrhizi races, the pathogen swiftly overcame this resistance. Therefore, fungicides are the only current means to control SBR. However, insensitivity to fungicides is soaring in P. pachyrhizi and, therefore, alternative measures are needed for SBR control. In this article, we discuss the different approaches for fighting SBR and their potential, disadvantages, and advantages over other measures. These encompass conventional breeding for SBR resistance, transgenic approaches, exploitation of transcription factors, secondary metabolites, and antimicrobial peptides, RNAi/HIGS, and biocontrol strategies. It seems that an integrating approach exploiting different measures is likely to provide the best possible means for the effective control of SBR.

  18. Genome-wide association study for crown rust (Puccinia coronata f. sp. avenae) and powdery mildew (Blumeria graminis f. sp. avenae) resistance in an oat (Avena sativa) collection of commercial varieties and landraces.

    Science.gov (United States)

    Montilla-Bascón, Gracia; Rispail, Nicolas; Sánchez-Martín, Javier; Rubiales, Diego; Mur, Luis A J; Langdon, Tim; Howarth, Catherine J; Prats, Elena

    2015-01-01

    Diseases caused by crown rust (Puccinia coronata f. sp. avenae) and powdery mildew (Blumeria graminis f. sp. avenae) are among the most important constraints for the oat crop. Breeding for resistance is one of the most effective, economical, and environmentally friendly means to control these diseases. The purpose of this work was to identify elite alleles for rust and powdery mildew resistance in oat by association mapping to aid selection of resistant plants. To this aim, 177 oat accessions including white and red oat cultivars and landraces were evaluated for disease resistance and further genotyped with 31 simple sequence repeat and 15,000 Diversity Arrays Technology (DArT) markers to reveal association with disease resistance traits. After data curation, 1712 polymorphic markers were considered for association analysis. Principal component analysis and a Bayesian clustering approach were applied to infer population structure. Five different general and mixed linear models accounting for population structure and/or kinship corrections and two different statistical tests were carried out to reduce false positive. Five markers, two of them highly significant in all models tested were associated with rust resistance. No strong association between any marker and powdery mildew resistance at the seedling stage was identified. However, one DArT sequence, oPt-5014, was strongly associated with powdery mildew resistance in adult plants. Overall, the markers showing the strongest association in this study provide ideal candidates for further studies and future inclusion in strategies of marker-assisted selection.

  19. Genome-wide association study for crown rust (Puccinia coronata f. sp. avenae and powdery mildew (Blumeria graminis f. sp. avenae resistance in an oat (Avena sativa collection of commercial varieties and landraces

    Directory of Open Access Journals (Sweden)

    Gracia eMontilla-Bascón

    2015-03-01

    Full Text Available Diseases caused by crown rust (Puccinia coronata f. sp. avenae and powdery mildew (Blumeria graminis f. sp. avenae are among the most important constraints for the oat crop. Breeding for resistance is one of the most effective, economical, and environmentally friendly means to control these diseases. The purpose of this work was to identify elite alleles for rust and powdery mildew resistance in oat by association mapping to aid selection of resistant plants. To this aim, 177 oat accessions including white and red oat cultivars and landraces were evaluated for disease resistance and further genotyped with 31 simple sequence repeat (SSR and 15,000 Diversity Arrays Technology (DArT markers to reveal association with disease resistance traits. After data curation, 1712 polymorphic markers were considered for association analysis. Principal component analysis and a Bayesian clustering approach were applied to infer population structure. Five different general and mixed linear models accounting for population structure and/or kinship corrections and two different statistical tests were carried out to reduce false positive. Five markers, two of them highly significant in all models tested were associated with rust resistance. No strong association between any marker and powdery mildew resistance at the seedling stage was identified. However, one DArT sequence, oPt-5014, was strongly associated with powdery mildew resistance in adult plants. Overall, the markers showing the strongest association in this study provide ideal candidates for further studies and future inclusion in strategies of marker assisted selection.

  20. Determining the order of resistance genes against Stagonospora nodorum blotch, Fusarium head blight and stem rust on wheat chromosome arm 3BS.

    Science.gov (United States)

    Thapa, Rima; Brown-Guedira, Gina; Ohm, Herbert W; Mateos-Hernandez, Maria; Wise, Kiersten A; Goodwin, Stephen B

    2016-02-02

    Stagonospora nodorum blotch (SNB), Fusarium head blight (FHB) and stem rust (SR), caused by the fungi Parastagonospora (synonym Stagonospora) nodorum, Fusarium graminearum and Puccinia graminis, respectively, significantly reduce yield and quality of wheat. Three resistance factors, QSng.sfr-3BS, Fhb1 and Sr2, conferring resistance, respectively, to SNB, FHB and SR, each from a unique donor line, were mapped previously to the short arm of wheat chromosome 3B. Based on published reports, our hypothesis was that Sr2 is the most distal, Fhb1 the most proximal and QSng.sfr-3BS is in between Sr2 and Fhb1 on wheat chromosome arm 3BS. To test this hypothesis, 1600 F2 plants from crosses between parental lines Arina, Alsen and Ocoroni86, conferring resistance genes QSng.sfr-3BS, Fhb1 and Sr2, respectively, were genotyped and phenotyped for SNB along with the parental lines. Five closely linked single-nucleotide polymorphism (SNP) markers were used to make the genetic map and determine the gene order. The results indicate that QSng.sfr-3BS is located between the other two resistance genes on chromosome 3BS. Knowing the positional order of these resistance genes will aid in developing a wheat line with all three genes in coupling, which has the potential to provide broad-spectrum resistance preventing grain yield and quality losses.

  1. Mapping and characterization of wheat stem rust resistance genes SrTm5 and Sr60 from Triticum monococcum.

    Science.gov (United States)

    Chen, Shisheng; Guo, Yan; Briggs, Jordan; Dubach, Felix; Chao, Shiaoman; Zhang, Wenjun; Rouse, Matthew N; Dubcovsky, Jorge

    2018-03-01

    The new stem rust resistance gene Sr60 was fine-mapped to the distal region of chromosome arm 5A m S, and the TTKSK-effective gene SrTm5 could be a new allele of Sr22. The emergence and spread of new virulent races of the wheat stem rust pathogen (Puccinia graminis f. sp. tritici; Pgt), including the Ug99 race group, is a serious threat to global wheat production. In this study, we mapped and characterized two stem rust resistance genes from diploid wheat Triticum monococcum accession PI 306540. We mapped SrTm5, a previously postulated gene effective to Ug99, on chromosome arm 7A m L, completely linked to Sr22. SrTm5 displayed a different race specificity compared to Sr22 indicating that they are distinct. Sequencing of the Sr22 homolog in PI 306540 revealed a novel haplotype. Characterization of the segregating populations with Pgt race QFCSC revealed an additional resistance gene on chromosome arm 5A m S that was assigned the official name Sr60. This gene was also effective against races QTHJC and SCCSC but not against TTKSK (a Ug99 group race). Using two large mapping populations (4046 gametes), we mapped Sr60 within a 0.44 cM interval flanked by sequenced-based markers GH724575 and CJ942731. These two markers delimit a 54.6-kb region in Brachypodium distachyon chromosome 4 and a 430-kb region in the Chinese Spring reference genome. Both regions include a leucine-rich repeat protein kinase (LRRK123.1) that represents a potential candidate gene. Three CC-NBS-LRR genes were found in the colinear Brachypodium region but not in the wheat genome. We are currently developing a Bacterial Artificial Chromosome library of PI 306540 to determine which of these candidate genes are present in the T. monococcum genome and to complete the cloning of Sr60.

  2. Expression of beta-1,3-glucanase and chitinase in healthy, stem-rust-affected and elicitor-treated near-isogenic wheat lines showing Sr5-or Sr24-specified race-specific rust resistance.

    Science.gov (United States)

    Münch-Garthoff, S; Neuhaus, J M; Boller, T; Kemmerling, B; Kogel, K H

    1997-01-01

    Pathogenesis-related expression of the two antifungal hydrolases beta-1,3-glucanase (EC 3.2.1.39) and chitinase (EC 3.2.1.14) was studied in wheat (Triticum aestivum L.) as part of the defence response to stem rust (Puccinia graminis f.sp. tritici, Pgt), mediated by the semi-dominantly acting resistance genes Sr5 and Sr24. Complete resistance (infection type 0), mediated by the Sr5 gene in cultivar Pre-Sr5, closely correlates with the hypersensitive response of penetrated cells at early stage of the interaction, when the first haustorium is formed. In contrast, cultivar Pre-Sr24 shows intermediate resistance (infection type 2-3) which is not directly linked to cell death. In both cases, the plant response included a rapid increase in beta-1,3-glucanase activity between 24 and 48 h after inoculation. One main extracellular 30-kDa isform of beta-1,3-glucanase was present in both lines, as shown by polyacrylamide-gel electrophoresis. Two additional minor isoforms (32 and 23 kDa) were detected only in Pre-Sr24, and only at later time points. Increased enzme activity and the appearance of new isoforms in the resistance lines was preceded by accumulation of mRNAs encoding beta-1,3-glucanase and chitinases. However, there were no changes in chitinase activity or isoforms. A high constitutive level of chitinase activity was observed in all wheat genotypes. Serological studies indicated the presence of a class II chitinase of 26 kDa. Accumulation of beta-1,3-glucanase and chitinase transcripts was detected before the pathogen penetrated the leaves through stomata and approximately 16 h before the typical hypersensitive response was observed, indicating that signal(s) for defense gene activation were recognised by the host plant long before a tight contact between the pathogen and a host cell is established. A glycoprotein (Pgt elicitor) derived from hyphal walls, strongly induced beta-1,3-glucanase. We discuss the possible role of the elicitor in the early signalling

  3. The rpg4-mediated resistance to wheat stem rust (Puccinia graminis) in barley (Hordeum vulgare) requires Rpg5, a second NBS-LRR gene, and an actin depolymerization factor.

    Science.gov (United States)

    Wang, X; Richards, J; Gross, T; Druka, A; Kleinhofs, A; Steffenson, B; Acevedo, M; Brueggeman, R

    2013-04-01

    The rpg4 gene confers recessive resistance to several races of wheat stem rust (Puccinia graminis f. sp. tritici) and Rpg5 provides dominant resistance against isolates of the rye stem rust (P. graminis f. sp. secalis) in barley. The rpg4 and Rpg5 genes are tightly linked on chromosome 5H, and positional cloning using high-resolution populations clearly separated the genes, unambiguously identifying Rpg5; however, the identity of rpg4 remained unclear. High-resolution genotyping of critical recombinants at the rpg4/Rpg5 locus, designated here as rpg4-mediated resistance locus (RMRL) delimited two distinct yet tightly linked loci required for resistance, designated as RMRL1 and RMRL2. Utilizing virus-induced gene silencing, each gene at RMRL1, i.e., HvRga1 (a nucleotide-binding site leucine-rich repeat [NBS-LRR] domain gene), Rpg5 (an NBS-LRR-protein kinase domain gene), and HvAdf3 (an actin depolymerizing factor-like gene), was individually silenced followed by inoculation with P. graminis f. sp. tritici race QCCJ. Silencing each gene changed the reaction type from incompatible to compatible, indicating that all three genes are required for rpg4-mediated resistance. This stem rust resistance mechanism in barley follows the emerging theme of unrelated pairs of genetically linked NBS-LRR genes required for specific pathogen recognition and resistance. It also appears that actin cytoskeleton dynamics may play an important role in determining resistance against several races of stem rust in barley.

  4. A mutagenesis-derived broad-spectrum disease resistance locus in wheat.

    Science.gov (United States)

    Campbell, Jackie; Zhang, Hongtao; Giroux, Michael J; Feiz, Leila; Jin, Yue; Wang, Meinan; Chen, Xianming; Huang, Li

    2012-07-01

    Wheat leaf rust, stem rust, stripe rust, and powdery mildew caused by the fungal pathogens Puccinia triticina, P. graminis f. sp. tritici, P. striiformis f. sp. tritici, and Blumeria graminis f. sp. tritici, respectively, are destructive diseases of wheat worldwide. Breeding durable disease resistance cultivars rely largely on continually introgressing new resistance genes, especially the genes with different defense mechanisms, into adapted varieties. Here, we describe a new resistance gene obtained by mutagenesis. The mutant, MNR220 (mutagenesis-derived new resistance), enhances resistance to three rusts and powdery mildew, with the characteristics of delayed disease development at the seedling stage and completed resistance at the adult plant stage. Genetic analysis demonstrated that the resistance in MNR220 is conferred by a single semidominant gene mapped on the short arm of chromosome 2B. Gene expression profiling of several pathogenesis-related genes indicated that MNR220 has an elevated and rapid pathogen-induced response. In addition to its potential use in breeding for resistance to multiple diseases, high-resolution mapping and cloning of the disease resistance locus in MNR220 may lead to a better understanding of the regulation of defense responses in wheat.

  5. Molecular mapping of soybean rust resistance in soybean accession PI 561356 and SNP haplotype analysis of the Rpp1 region in diverse germplasm.

    Science.gov (United States)

    Kim, Ki-Seung; Unfried, Jair R; Hyten, David L; Frederick, Reid D; Hartman, Glen L; Nelson, Randall L; Song, Qijian; Diers, Brian W

    2012-10-01

    Soybean rust (SBR), caused by Phakopsora pachyrhizi Sydow, is one of the most economically important and destructive diseases of soybean [Glycine max (L.) Merr.] and the discovery of novel SBR resistance genes is needed because of virulence diversity in the pathogen. The objectives of this research were to map SBR resistance in plant introduction (PI) 561356 and to identify single nucleotide polymorphism (SNP) haplotypes within the region on soybean chromosome 18 where the SBR resistance gene Rpp1 maps. One-hundred F(2:3) lines derived from a cross between PI 561356 and the susceptible experimental line LD02-4485 were genotyped with genetic markers and phenotyped for resistance to P. pachyrhizi isolate ZM01-1. The segregation ratio of reddish brown versus tan lesion type in the population supported that resistance was controlled by a single dominant gene. The gene was mapped to a 1-cM region on soybean chromosome 18 corresponding to the same interval as Rpp1. A haplotype analysis of diverse germplasm across a 213-kb interval that included Rpp1 revealed 21 distinct haplotypes of which 4 were present among 5 SBR resistance sources that have a resistance gene in the Rpp1 region. Four major North American soybean ancestors belong to the same SNP haplotype as PI 561356 and seven belong to the same haplotype as PI 594538A, the Rpp1-b source. There were no North American soybean ancestors belonging to the SNP haplotypes found in PI 200492, the source of Rpp1, or PI 587886 and PI 587880A, additional sources with SBR resistance mapping to the Rpp1 region.

  6. Resistência à ferrugem da folha e potencial produtivo em genótipos de trigo Leaf rust resistance and grain yield potential in wheat genotypes

    Directory of Open Access Journals (Sweden)

    João Carlos Felicio

    2008-12-01

    o Paulo, Brazil, during 2003-2005 crop seasons. The evaluation of the genotypes to the causal agent of leaf rust was made at the seedling stage in greenhouse, where the genotypes were individually inoculated with spores of 12 races of Puccinia triticina, which represented the spectrum of pathogen virulence occurring in Brazil and under natural infection out in the field. Grain yield of each genotype was evaluated in the different regions and in a group of experiments, as well as the stability and adaptability. The genotypes 8 (BH1146// AA"S"/WIN"S"/3/BUC/FKL//MYNA/VUL, 12 and 14 (BH1146//AA"S"/WIN"S"/3/VEE //DOVE/BUC showed resistance the physiologic races of Puccinia triticina in greenhouse in the seedling stage. The genotypes 4, 5, 8, 12, 13, 16 e 20 and the cultivar IAC 1004 (T. durum presented leaf rust resistance, under natural disease infection conditions. The highest grain yields were obtained by the genotypes 8 (BH1146// AA"S"/WIN"S"/3/BUC/FKL//MYNA/VUL, 7 (BH1146//AA"S"/WIN"S"/3/HANN*2/ PRL and 18 (CMH75.A.66/SERI/ 3/BH1146// AA"S"/WIN"S". Genotype 16 (KAUZ/3/ BH1146//AA"S"/WIN"S" presented the lowest yield.

  7. The Big Rust and the Red Queen: Long-Term Perspectives on Coffee Rust Research.

    Science.gov (United States)

    McCook, Stuart; Vandermeer, John

    2015-09-01

    Since 2008, there has been a cluster of outbreaks of the coffee rust (Hemileia vastatrix) across the coffee-growing regions of the Americas, which have been collectively described as the Big Rust. These outbreaks have caused significant hardship to coffee producers and laborers. This essay situates the Big Rust in a broader historical context. Over the past two centuries, coffee farmers have had to deal with the "curse of the Red Queen"-the need to constantly innovate in the face of an increasing range of threats, which includes the rust. Over the 20th century, particularly after World War II, national governments and international organizations developed a network of national, regional, and international coffee research institutions. These public institutions played a vital role in helping coffee farmers manage the rust. Coffee farmers have pursued four major strategies for managing the rust: bioprospecting for resistant coffee plants, breeding resistant coffee plants, chemical control, and agroecological control. Currently, the main challenge for researchers is to develop rust control strategies that are both ecologically and economically viable for coffee farmers, in the context of a volatile, deregulated coffee industry and the emergent challenges of climate change.

  8. An AFLP marker linked to the leaf rust resistance gene LrBi16 and test of allelism with Lr14a on chromosome arm 7BL

    Directory of Open Access Journals (Sweden)

    Peipei Zhang

    2015-04-01

    Full Text Available Leaf rust (LR, caused by Puccinia triticina, is one of the most widespread diseases of common wheat (Triticum aestivum L. worldwide. The LR resistance gene LrBi16 has been mapped on chromosome arm 7BL in Chinese wheat cultivar Bimai 16 and was closely linked to SSR loci Xcfa2257 and Xgwm344 with genetic distances of 2.8 cM and 2.9 cM, respectively. In the present study