WorldWideScience

Sample records for striatal adenosine a2a

  1. Adenosine A2A receptors and A2A receptor heteromers as key players in striatal function

    Directory of Open Access Journals (Sweden)

    Sergi eFerre

    2011-06-01

    Full Text Available A very significant density of adenosine adenosine A2A receptors (A2ARs is present in the striatum, where they are preferentially localized postsynaptically in striatopallidal medium spiny neurons (MSNs. In this localization A2ARs establish reciprocal antagonistic interactions with dopamine D2 receptors (D2Rs. In one type of interaction, A2AR and D2R are forming heteromers and, by means of an allosteric interaction, A2AR counteracts D2R-mediated inhibitory modulation of the effects of NMDA receptor stimulation in the striato-pallidal neuron. This interaction is probably mostly responsible for the locomotor depressant and activating effects of A2AR agonist and antagonists, respectively. The second type of interaction involves A2AR and D2R that do not form heteromers and takes place at the level of adenylyl-cyclase (AC. Due to a strong tonic effect of endogenous dopamine on striatal D2R, this interaction keeps A2AR from signaling through AC. However, under conditions of dopamine depletion or with blockade of D2R, A2AR-mediated AC activation is unleashed with an increased gene expression and activity of the striato-pallidal neuron and with a consequent motor depression. This interaction is probably the main mechanism responsible for the locomotor depression induced by D2R antagonists. Finally, striatal A2ARs are also localized presynaptically, in cortico-striatal glutamatergic terminals that contact the striato-nigral MSN. These presynaptic A2ARs heteromerize with A1 receptors (A1Rs and their activation facilitates glutamate release. These three different types of A2ARs can be pharmacologically dissected by their ability to bind ligands with different affinity and can therefore provide selective targets for drug development in different basal ganglia disorders.

  2. Striatal Pre- and Postsynaptic Profile of Adenosine A2A Receptor Antagonists

    Science.gov (United States)

    Quiroz, César; Beaumont, Vahri; Goldberg, Steven R.; Lluís, Carme; Cortés, Antoni; Franco, Rafael; Casadó, Vicent; Canela, Enric I.; Ferré, Sergi

    2011-01-01

    Striatal adenosine A2A receptors (A2ARs) are highly expressed in medium spiny neurons (MSNs) of the indirect efferent pathway, where they heteromerize with dopamine D2 receptors (D2Rs). A2ARs are also localized presynaptically in cortico-striatal glutamatergic terminals contacting MSNs of the direct efferent pathway, where they heteromerize with adenosine A1 receptors (A1Rs). It has been hypothesized that postsynaptic A2AR antagonists should be useful in Parkinson's disease, while presynaptic A2AR antagonists could be beneficial in dyskinetic disorders, such as Huntington's disease, obsessive-compulsive disorders and drug addiction. The aim or this work was to determine whether selective A2AR antagonists may be subdivided according to a preferential pre- versus postsynaptic mechanism of action. The potency at blocking the motor output and striatal glutamate release induced by cortical electrical stimulation and the potency at inducing locomotor activation were used as in vivo measures of pre- and postsynaptic activities, respectively. SCH-442416 and KW-6002 showed a significant preferential pre- and postsynaptic profile, respectively, while the other tested compounds (MSX-2, SCH-420814, ZM-241385 and SCH-58261) showed no clear preference. Radioligand-binding experiments were performed in cells expressing A2AR-D2R and A1R-A2AR heteromers to determine possible differences in the affinity of these compounds for different A2AR heteromers. Heteromerization played a key role in the presynaptic profile of SCH-442416, since it bound with much less affinity to A2AR when co-expressed with D2R than with A1R. KW-6002 showed the best relative affinity for A2AR co-expressed with D2R than co-expressed with A1R, which can at least partially explain the postsynaptic profile of this compound. Also, the in vitro pharmacological profile of MSX-2, SCH-420814, ZM-241385 and SCH-58261 was is in accordance with their mixed pre- and postsynaptic profile. On the basis of their preferential

  3. Striatal pre- and postsynaptic profile of adenosine A(2A receptor antagonists.

    Directory of Open Access Journals (Sweden)

    Marco Orru

    2011-01-01

    Full Text Available Striatal adenosine A(2A receptors (A(2ARs are highly expressed in medium spiny neurons (MSNs of the indirect efferent pathway, where they heteromerize with dopamine D(2 receptors (D(2Rs. A(2ARs are also localized presynaptically in cortico-striatal glutamatergic terminals contacting MSNs of the direct efferent pathway, where they heteromerize with adenosine A(1 receptors (A(1Rs. It has been hypothesized that postsynaptic A(2AR antagonists should be useful in Parkinson's disease, while presynaptic A(2AR antagonists could be beneficial in dyskinetic disorders, such as Huntington's disease, obsessive-compulsive disorders and drug addiction. The aim or this work was to determine whether selective A(2AR antagonists may be subdivided according to a preferential pre- versus postsynaptic mechanism of action. The potency at blocking the motor output and striatal glutamate release induced by cortical electrical stimulation and the potency at inducing locomotor activation were used as in vivo measures of pre- and postsynaptic activities, respectively. SCH-442416 and KW-6002 showed a significant preferential pre- and postsynaptic profile, respectively, while the other tested compounds (MSX-2, SCH-420814, ZM-241385 and SCH-58261 showed no clear preference. Radioligand-binding experiments were performed in cells expressing A(2AR-D(2R and A(1R-A(2AR heteromers to determine possible differences in the affinity of these compounds for different A(2AR heteromers. Heteromerization played a key role in the presynaptic profile of SCH-442416, since it bound with much less affinity to A(2AR when co-expressed with D(2R than with A(1R. KW-6002 showed the best relative affinity for A(2AR co-expressed with D(2R than co-expressed with A(1R, which can at least partially explain the postsynaptic profile of this compound. Also, the in vitro pharmacological profile of MSX-2, SCH-420814, ZM-241385 and SCH-58261 was is in accordance with their mixed pre- and postsynaptic profile

  4. GDNF control of the glutamatergic cortico-striatal pathway requires tonic activation of adenosine A2A Receptors

    Science.gov (United States)

    Gomes, Catarina A.R.V.; Simões, Patrícia F.; Canas, Paula M.; Quiroz, César; Sebastião, Ana M.; Ferré, Sergi; Cunha, Rodrigo A.; Ribeiro, Joaquim A.

    2009-01-01

    Glial cell line-derived neurotrophic factor (GDNF) affords neuroprotection in Parkinson’s disease in accordance with its ability to bolster nigrostriatal innervation. We previously found that GDNF facilitates dopamine release in a manner dependent on adenosine A2A receptor activation. Since motor dysfunction also involves modifications of striatal glutamatergic innervation, we now tested if GDNF and its receptor system, Ret (rearranged during transfection) and GFRα1 (GDNF family receptor alpha 1) controlled the cortico-striatal glutamatergic pathway in an A2A receptor-dependent manner. GDNF (10 ng/ml) enhanced (by ≈13%) glutamate release from rat striatal nerve endings, an effect potentiated (up to ≈ 30%) by the A2A receptor agonist CGS 21680 (10 nM) and prevented by the A2A receptor antagonist, SCH 58261 (50 nM). Triple immunocytochemical studies revealed that Ret and GFRα1 were located in 50% of rat striatal glutamatergic terminals (immunopositive for vesicular glutamate transporters-1/2), where they were found to be co-located with A2A receptors. Activation of the glutamatergic system upon in vivo electrical stimulation of the rat cortico-striatal input induced striatal Ret phosphoprylation that was prevented by pre-treatment with the A2A receptor antagonist, MSX-3 (3 mg/kg). The results provide the first functional and morphological evidence that GDNF controls cortico-striatal glutamatergic pathways in a manner largely dependent on the co-activation of adenosine A2A receptors. PMID:19141075

  5. Key modulatory role of presynaptic adenosine A2A receptors in cortical neurotransmission to the striatal direct pathway.

    Science.gov (United States)

    Quiroz, César; Luján, Rafael; Uchigashima, Motokazu; Simoes, Ana Patrícia; Lerner, Talia N; Borycz, Janusz; Kachroo, Anil; Canas, Paula M; Orru, Marco; Schwarzschild, Michael A; Rosin, Diane L; Kreitzer, Anatol C; Cunha, Rodrigo A; Watanabe, Masahiko; Ferré, Sergi

    2009-11-18

    Basal ganglia processing results from a balanced activation of direct and indirect striatal efferent pathways, which are controlled by dopamine D1 and D2 receptors, respectively. Adenosine A2A receptors are considered novel antiparkinsonian targets, based on their selective postsynaptic localization in the indirect pathway, where they modulate D2 receptor function. The present study provides evidence for the existence of an additional, functionally significant, segregation of A2A receptors at the presynaptic level. Using integrated anatomical, electrophysiological, and biochemical approaches, we demonstrate that presynaptic A2A receptors are preferentially localized in cortical glutamatergic terminals that contact striatal neurons of the direct pathway, where they exert a selective modulation of corticostriatal neurotransmission. Presynaptic striatal A2A receptors could provide a new target for the treatment of neuropsychiatric disorders.

  6. Key Modulatory Role of Presynaptic Adenosine A2A Receptors in Cortical Neurotransmission to the Striatal Direct Pathway

    Directory of Open Access Journals (Sweden)

    César Quiroz

    2009-01-01

    Full Text Available Basal ganglia processing results from a balanced activation of direct and indirect striatal efferent pathways, which are controlled by dopamine D1 and D2 receptors, respectively. Adenosine A2A receptors are considered novel antiparkinsonian targets, based on their selective postsynaptic localization in the indirect pathway, where they modulate D2 receptor function. The present study provides evidence for the existence of an additional, functionally significant, segregation of A2A receptors at the presynaptic level. Using integrated anatomical, electrophysiological, and biochemical approaches, we demonstrate that presynaptic A2A receptors are preferentially localized in cortical glutamatergic terminals that contact striatal neurons of the direct pathway, where they exert a selective modulation of corticostriatal neurotransmission. Presynaptic striatal A2A receptors could provide a new target for the treatment of neuropsychiatric disorders.

  7. Up-regulation of striatal adenosine A2A receptors with iron deficiency in rats. Effects on locomotion and cortico-striatal neurotransmission

    Science.gov (United States)

    Quiroz, César; Pearson, Virginia; Gulyani, Seema; Allen, Richard; Earley, Christopher; Ferré, Sergi

    2010-01-01

    Brain iron deficiency leads to altered dopaminergic function in experimental animals, which can provide a mechanistic explanation for iron deficiency-related human sensory-motor disorders, such as Restless Legs Syndrome (RLS). However, mechanisms linking both conditions have not been determined. Considering the strong modulation exerted by adenosine on dopamine signaling, one connection could involve changes in adenosine receptor expression or function. In the striatum, presynaptic A2A receptors are localized in glutamatergic terminals contacting GABAergic dynorphinergic neurons and their function can be analyzed by the ability of A2A receptor antagonists to block the motor output induced by cortical electrical stimulation. Postsynaptic A2A receptors are localized in the dendritic field of GABAergic enkephalinergic neurons and their function can be analyzed by studying the ability of A2A receptor antagonists to produce locomotor activity and to counteract striatal ERK1/2 phosphorylation induced by cortical electrical stimulation. Increased density of striatal A2A receptors was found in rats fed during three weeks with an iron-deficient diet during the post-weaning period. In iron-deficient rats, the selective A2A receptor antagonist MSX-3, at doses of 1 and 3 mg/kg, was more effective at blocking motor output induced by cortical electrical stimulation (presynaptic A2A receptor-mediated effect) and at enhancing locomotor activation and blocking striatal ERK phosphorylation induced by cortical electrical stimulation (postsynaptic A2A receptor-mediated effects). These results indicate that brain iron deficiency induces a functional up-regulation of both striatal pre- and postsynaptic A2A receptor, which could be involved in sensory-motor disorders associated with iron deficiency such as RLS. PMID:20385128

  8. Up-regulation of striatal adenosine A(2A) receptors with iron deficiency in rats: effects on locomotion and cortico-striatal neurotransmission.

    Science.gov (United States)

    Quiroz, César; Pearson, Virginia; Gulyani, Seema; Allen, Richard; Earley, Christopher; Ferré, Sergi

    2010-07-01

    Brain iron deficiency leads to altered dopaminergic function in experimental animals, which can provide a mechanistic explanation for iron deficiency-related human sensory-motor disorders, such as Restless Legs Syndrome (RLS). However, mechanisms linking both conditions have not been determined. Considering the strong modulation exerted by adenosine on dopamine signaling, one connection could involve changes in adenosine receptor expression or function. In the striatum, presynaptic A(2A) receptors are localized in glutamatergic terminals contacting GABAergic dynorphinergic neurons and their function can be analyzed by the ability of A(2A) receptor antagonists to block the motor output induced by cortical electrical stimulation. Postsynaptic A(2A) receptors are localized in the dendritic field of GABAergic enkephalinergic neurons and their function can be analyzed by studying the ability of A(2A) receptor antagonists to produce locomotor activity and to counteract striatal ERK1/2 phosphorylation induced by cortical electrical stimulation. Increased density of striatal A(2A) receptors was found in rats fed during 3 weeks with an iron-deficient diet during the post-weaning period. In iron-deficient rats, the selective A(2A) receptor antagonist MSX-3, at doses of 1 and 3 mg/kg, was more effective at blocking motor output induced by cortical electrical stimulation (presynaptic A(2A) receptor-mediated effect) and at enhancing locomotor activation and blocking striatal ERK phosphorylation induced by cortical electrical stimulation (postsynaptic A(2A) receptor-mediated effects). These results indicate that brain iron deficiency induces a functional up-regulation of both striatal pre- and postsynaptic A(2A) receptor, which could be involved in sensory-motor disorders associated with iron deficiency such as RLS. Copyright 2010. Published by Elsevier Inc.

  9. Caffeine and a selective adenosine A2A receptor antagonist induce sensitization and cross-sensitization behavior associated with increased striatal dopamine in mice

    Directory of Open Access Journals (Sweden)

    Hsu Chih W

    2010-01-01

    Full Text Available Abstract Background Caffeine, a nonselective adenosine A1 and A2A receptor antagonist, is the most widely used psychoactive substance in the world. Evidence demonstrates that caffeine and selective adenosine A2A antagonists interact with the neuronal systems involved in drug reinforcement, locomotor sensitization, and therapeutic effect in Parkinson's disease (PD. Evidence also indicates that low doses of caffeine and a selective adenosine A2A antagonist SCH58261 elicit locomotor stimulation whereas high doses of these drugs exert locomotor inhibition. Since these behavioral and therapeutic effects are mediated by the mesolimbic and nigrostriatal dopaminergic pathways which project to the striatum, we hypothesize that low doses of caffeine and SCH58261 may modulate the functions of dopaminergic neurons in the striatum. Methods In this study, we evaluated the neuroadaptations in the striatum by using reverse-phase high performance liquid chromatography (HPLC to quantitate the concentrations of striatal dopamine and its metabolites, dihydroxylphenylacetic acid (DOPAC and homovanilic acid (HVA, and using immunoblotting to measure the level of phosphorylation of tyrosine hydroxylase (TH at Ser31, following chronic caffeine and SCH58261 sensitization in mice. Moreover, to validate further that the behavior sensitization of caffeine is through antagonism at the adenosine A2A receptor, we also evaluate whether chronic pretreatment with a selective adenosine A2A antagonist SCH58261 or a selective adenosine A1 antagonist DPCPX can sensitize the locomotor stimulating effects of caffeine. Results Chronic treatments with low dose caffeine (10 mg/kg or SCH58261 (2 mg/kg increased the concentrations of dopamine, DOPAC and HVA, concomitant with increased TH phosphorylation at Ser31 and consequently enhanced TH activity in the striatal tissues in both caffeine- and SCH58261-sensitized mice. In addition, chronic caffeine or SCH58261 administration induced

  10. Adenosine Receptor Heteromers and their Integrative Role in Striatal Function

    Directory of Open Access Journals (Sweden)

    Sergi Ferré

    2007-01-01

    Full Text Available By analyzing the functional role of adenosine receptor heteromers, we review a series of new concepts that should modify our classical views of neurotransmission in the central nervous system (CNS. Neurotransmitter receptors cannot be considered as single functional units anymore. Heteromerization of neurotransmitter receptors confers functional entities that possess different biochemical characteristics with respect to the individual components of the heteromer. Some of these characteristics can be used as a “biochemical fingerprint” to identify neurotransmitter receptor heteromers in the CNS. This is exemplified by changes in binding characteristics that are dependent on coactivation of the receptor units of different adenosine receptor heteromers. Neurotransmitter receptor heteromers can act as “processors” of computations that modulate cell signaling, sometimes critically involved in the control of pre- and postsynaptic neurotransmission. For instance, the adenosine A1-A2A receptor heteromer acts as a concentration-dependent switch that controls striatal glutamatergic neurotransmission. Neurotransmitter receptor heteromers play a particularly important integrative role in the “local module” (the minimal portion of one or more neurons and/or one or more glial cells that operates as an independent integrative unit, where they act as processors mediating computations that convey information from diverse volume-transmitted signals. For instance, the adenosine A2A-dopamine D2 receptor heteromers work as integrators of two different neurotransmitters in the striatal spine module.

  11. Transcriptional profiling of striatal neurons in response to single or concurrent activation of dopamine D2, adenosine A(2A) and metabotropic glutamate type 5 receptors: focus on beta-synuclein expression.

    Science.gov (United States)

    Canela, Laia; Selga, Elisabet; García-Martínez, Juan Manuel; Amaral, Olavo B; Fernández-Dueñas, Víctor; Alberch, Jordi; Canela, Enric I; Franco, Rafael; Noé, Véronique; Lluís, Carme; Ciudad, Carlos J; Ciruela, Francisco

    2012-10-25

    G protein-coupled receptor oligomerization is a concept which is changing the understanding of classical pharmacology. Both, oligomerization and functional interaction between adenosine A(2A,) dopamine D(2) and metabotropic glutamate type 5 receptors have been demonstrated in the striatum. However, the transcriptional consequences of receptors co-activation are still unexplored. We aim here to determine the changes in gene expression of striatal primary cultured neurons upon isolated or simultaneous receptor activation. Interestingly, we found that 95 genes of the total analyzed (15,866 transcripts and variants) changed their expression in response to simultaneous stimulation of all three receptors. Among these genes, we focused on the β-synuclein (β-Syn) gene (SCNB). Quantitative PCR verified the magnitude and direction of change in expression of SCNB. Since β-Syn belongs to the homologous synuclein family and may be considered a natural regulator of α-synuclein (α-Syn), it has been proposed that β-Syn might act protectively against α-Syn neuropathology. Copyright © 2012 Elsevier B.V. All rights reserved.

  12. A2A adenosine receptor ligand binding and signalling is allosterically modulated by adenosine deaminase.

    Science.gov (United States)

    Gracia, Eduard; Pérez-Capote, Kamil; Moreno, Estefanía; Barkešová, Jana; Mallol, Josefa; Lluís, Carme; Franco, Rafael; Cortés, Antoni; Casadó, Vicent; Canela, Enric I

    2011-05-01

    A2ARs (adenosine A2A receptors) are highly enriched in the striatum, which is the main motor control CNS (central nervous system) area. BRET (bioluminescence resonance energy transfer) assays showed that A2AR homomers may act as cell-surface ADA (adenosine deaminase; EC 3.5.4.4)-binding proteins. ADA binding affected the quaternary structure of A2ARs present on the cell surface. ADA binding to adenosine A2ARs increased both agonist and antagonist affinity on ligand binding to striatal membranes where these proteins are co-expressed. ADA also increased receptor-mediated ERK1/2 (extracellular-signal-regulated kinase 1/2) phosphorylation. Collectively, the results of the present study show that ADA, apart from regulating the concentration of extracellular adenosine, may behave as an allosteric modulator that markedly enhances ligand affinity and receptor function. This powerful regulation may have implications for the physiology and pharmacology of neuronal A2ARs.

  13. PET imaging of adenosine A2A receptors

    NARCIS (Netherlands)

    Zhou, Xiaoyun

    2017-01-01

    This thesis describes the development and evaluation of [11C]preladenant as a novel radioligand for in vivo imaging of adenosine A2A receptors in the brain with positron-emission tomography (PET). The 11C-labeled drug [11C]preladenant was produced with high radiochemical yield and specific activity.

  14. Singular Location and Signaling Profile of Adenosine A2A-Cannabinoid CB1Receptor Heteromers in the Dorsal Striatum.

    Science.gov (United States)

    Moreno, Estefanía; Chiarlone, Anna; Medrano, Mireia; Puigdellívol, Mar; Bibic, Lucka; Howell, Lesley A; Resel, Eva; Puente, Nagore; Casarejos, María J; Perucho, Juan; Botta, Joaquín; Suelves, Nuria; Ciruela, Francisco; Ginés, Silvia; Galve-Roperh, Ismael; Casadó, Vicent; Grandes, Pedro; Lutz, Beat; Monory, Krisztina; Canela, Enric I; Lluís, Carmen; McCormick, Peter J; Guzmán, Manuel

    2018-04-01

    The dorsal striatum is a key node for many neurobiological processes such as motor activity, cognitive functions, and affective processes. The proper functioning of striatal neurons relies critically on metabotropic receptors. Specifically, the main adenosine and endocannabinoid receptors present in the striatum, ie, adenosine A 2A receptor (A 2A R) and cannabinoid CB 1 receptor (CB 1 R), are of pivotal importance in the control of neuronal excitability. Facilitatory and inhibitory functional interactions between striatal A 2A R and CB 1 R have been reported, and evidence supports that this cross-talk may rely, at least in part, on the formation of A 2A R-CB 1 R heteromeric complexes. However, the specific location and properties of these heteromers have remained largely unknown. Here, by using techniques that allowed a precise visualization of the heteromers in situ in combination with sophisticated genetically modified animal models, together with biochemical and pharmacological approaches, we provide a high-resolution expression map and a detailed functional characterization of A 2A R-CB 1 R heteromers in the dorsal striatum. Specifically, our data unveil that the A 2A R-CB 1 R heteromer (i) is essentially absent from corticostriatal projections and striatonigral neurons, and, instead, is largely present in striatopallidal neurons, (ii) displays a striking G protein-coupled signaling profile, where co-stimulation of both receptors leads to strongly reduced downstream signaling, and (iii) undergoes an unprecedented dysfunction in Huntington's disease, an archetypal disease that affects striatal neurons. Altogether, our findings may open a new conceptual framework to understand the role of coordinated adenosine-endocannabinoid signaling in the indirect striatal pathway, which may be relevant in motor function and neurodegenerative diseases.

  15. A2A adenosine receptor antagonism enhances synaptic and motor effects of cocaine via CB1 cannabinoid receptor activation.

    Directory of Open Access Journals (Sweden)

    Alessandro Tozzi

    Full Text Available BACKGROUND: Cocaine increases the level of endogenous dopamine (DA in the striatum by blocking the DA transporter. Endogenous DA modulates glutamatergic inputs to striatal neurons and this modulation influences motor activity. Since D2 DA and A2A-adenosine receptors (A2A-Rs have antagonistic effects on striatal neurons, drugs targeting adenosine receptors such as caffeine-like compounds, could enhance psychomotor stimulant effects of cocaine. In this study, we analyzed the electrophysiological effects of cocaine and A2A-Rs antagonists in striatal slices and the motor effects produced by this pharmacological modulation in rodents. PRINCIPAL FINDINGS: Concomitant administration of cocaine and A2A-Rs antagonists reduced glutamatergic synaptic transmission in striatal spiny neurons while these drugs failed to produce this effect when given in isolation. This inhibitory effect was dependent on the activation of D2-like receptors and the release of endocannabinoids since it was prevented by L-sulpiride and reduced by a CB1 receptor antagonist. Combined application of cocaine and A2A-R antagonists also reduced the firing frequency of striatal cholinergic interneurons suggesting that changes in cholinergic tone might contribute to this synaptic modulation. Finally, A2A-Rs antagonists, in the presence of a sub-threshold dose of cocaine, enhanced locomotion and, in line with the electrophysiological experiments, this enhanced activity required activation of D2-like and CB1 receptors. CONCLUSIONS: The present study provides a possible synaptic mechanism explaining how caffeine-like compounds could enhance psychomotor stimulant effects of cocaine.

  16. Adenosine A₂A receptors in striatal glutamatergic terminals and GABAergic neurons oppositely modulate psychostimulant action and DARPP-32 phosphorylation.

    Directory of Open Access Journals (Sweden)

    Hai-Ying Shen

    Full Text Available Adenosine A2A receptors (A2AR are located postsynaptically in striatopallidal GABAergic neurons, antagonizing dopamine D2 receptor functions, and are also located presynaptically at corticostriatal terminals, facilitating glutamate release. To address the hypothesis that these two A2AR populations differently control the action of psychostimulants, we characterized A2AR modulation of cocaine-induced effects at the level of DARPP-32 phosphorylation at Thr-34 and Thr-75, c-Fos expression, and psychomotor activity using two lines of cell-type selective A2AR knockout (KO mice with selective A2AR deletion in GABAergic neurons (striatum-A2AR-KO mice, or with A2AR deletion in both striatal GABAergic neurons and projecting cortical glutamatergic neurons (forebrain-A2AR-KO mice. We demonstrated that striatum-A2AR KO mice lacked A2ARs exclusively in striatal GABAergic terminals whereas forebrain-A2AR KO mice lacked A2ARs in both striatal GABAergic and glutamatergic terminals leading to a blunted A2AR-mediated facilitation of synaptosomal glutamate release. The inactivation of A2ARs in GABAergic neurons reduced striatal DARPP-32 phosphorylation at Thr-34 and increased its phosphorylation at Thr-75. Conversely, the additional deletion of corticostriatal glutamatergic A2ARs produced opposite effects on DARPP-32 phosphorylation at Thr-34 and Thr-75. This distinct modulation of DARPP-32 phosphorylation was associated with opposite responses to cocaine-induced striatal c-Fos expression and psychomotor activity in striatum-A2AR KO (enhanced and forebrain-A2AR KO mice (reduced. Thus, A2ARs in glutamatergic corticostriatal terminals and in GABAergic striatal neurons modulate the action of psychostimulants and DARPP-32 phosphorylation in opposite ways. We conclude that A2ARs in glutamatergic terminals prominently control the action of psychostimulants and define a novel mechanism by which A2ARs fine-tune striatal activity by integrating GABAergic, dopaminergic and

  17. Adenosine A(2A) receptor dynamics studied with the novel fluorescent agonist Alexa488-APEC.

    Science.gov (United States)

    Brand, Frank; Klutz, Athena M; Jacobson, Kenneth A; Fredholm, Bertil B; Schulte, Gunnar

    2008-08-20

    G protein-coupled receptors, such as the adenosine A(2A) receptor, are dynamic proteins, which undergo agonist-dependent redistribution from the cell surface to intracellular membranous compartments, such as endosomes. In order to study the kinetics of adenosine A(2A) receptor redistribution in living cells, we synthesized a novel fluorescent agonist, Alexa488-APEC. Alexa488-APEC binds to adenosine A(2A) (K(i)=149+/-27 nM) as well as A(3) receptors (K(i)=240+/-160 nM) but not to adenosine A(1) receptors. Further, we characterized the dose-dependent increase in Alexa488-APEC-induced cAMP production as well as cAMP response element binding (CREB) protein phosphorylation, verifying the ligand's functionality at adenosine A(2A) but not A(2B) receptors. In live-cell imaging studies, Alexa488-APEC-induced adenosine A(2A) receptor internalization, which was blocked by the competitive reversible antagonist ZM 241385 and hyperosmolaric sucrose. Further, internalized adenosine A(2A) receptors co-localized with clathrin and Rab5, indicating that agonist stimulation promotes adenosine A(2A) receptor uptake through a clathrin-dependent mechanism to Rab5-positive endosomes. The basic characterization of Alexa488-APEC described here showed that it provides a useful tool for tracing adenosine A(2A) receptors in vitro.

  18. Adenosine A2A receptor binding profile of two antagonists, ST1535 and KW6002: consideration on the presence of atypical adenosine A2A binding sites

    Directory of Open Access Journals (Sweden)

    Teresa Riccioni

    2010-08-01

    Full Text Available Adenosine A2A receptors seem to exist in typical (more in striatum and atypical (more in hippocampus and cortex subtypes. In the present study, we investigated the affinity of two adenosine A2A receptor antagonists, ST1535 [2 butyl -9-methyl-8-(2H-1,2,3-triazol 2-yl-9H-purin-6-xylamine] and KW6002 [(E-1,3-diethyl-8-(3,4-dimethoxystyryl-7-methyl-3,7-dihydro-1H-purine-2,6,dione] to the “typical” and “atypical” A2A binding sites. Affinity was determined by radioligand competition experiments in membranes from rat striatum and hippocampus. Displacement of the adenosine analog [3H]CGS21680 [2-p-(2-carboxyethylphenethyl-amino-5’-N-ethylcarbox-amidoadenosine] was evaluated in the absence or in the presence of either CSC [8-(3-chlorostyryl-caffeine], an adenosine A2A antagonist that pharmacologically isolates atypical binding sites, or DPCPX (8-cyclopentyl-1,3-dipropylxanthine, an adenosine A1 receptor antagonist that pharmacologically isolates typical binding site. ZM241385 [84-(2-[7-amino-2-(2-furyl [1,2,4]-triazol[2,3-a][1,3,5]triazin-5-yl amino]ethyl phenol] and SCH58261 [(5-amino-7-(β-phenylethyl-2-(8-furylpyrazolo(4,3-e-1,2,4-triazolo(1,5-c pyrimidine], two other adenosine A2A receptor antagonists, which were reported to differently bind to atypical and typical A2A receptors, were used as reference compounds. ST1535, KW6002, ZM241385 and SCH58261 displaced [3H]CGS21680 with higher affinity in striatum than in hippocampus. In hippocampus, no typical adenosine A2A binding was detected, and ST1535 was the only compound that occupied atypical A2A adenosine receptors. Present data are explained in terms of heteromeric association among adenosine A2A, A2B and A1 receptors, rather than with the presence of atypical A2A receptor subtype.

  19. Adenosine A2A Receptor Modulates the Activity of Globus Pallidus Neurons in Rats

    Directory of Open Access Journals (Sweden)

    Hui-Ling Diao

    2017-11-01

    Full Text Available The globus pallidus is a central nucleus in the basal ganglia motor control circuit. Morphological studies have revealed the expression of adenosine A2A receptors in the globus pallidus. To determine the modulation of adenosine A2A receptors on the activity of pallidal neurons in both normal and parkinsonian rats, in vivo electrophysiological and behavioral tests were performed in the present study. The extracellular single unit recordings showed that micro-pressure administration of adenosine A2A receptor agonist, CGS21680, regulated the pallidal firing activity. GABAergic neurotransmission was involved in CGS21680-induced modulation of pallidal neurons via a PKA pathway. Furthermore, application of two adenosine A2A receptor antagonists, KW6002 or SCH442416, mainly increased the spontaneous firing of pallidal neurons, suggesting that endogenous adenosine system modulates the activity of pallidal neurons through adenosine A2A receptors. Finally, elevated body swing test (EBST showed that intrapallidal microinjection of adenosine A2A receptor agonist/antagonist induced ipsilateral/contralateral-biased swing, respectively. In addition, the electrophysiological and behavioral findings also revealed that activation of dopamine D2 receptors by quinpirole strengthened KW6002/SCH442416-induced excitation of pallidal activity. Co-application of quinpirole with KW6002 or SCH442416 alleviated biased swing in hemi-parkinsonian rats. Based on the present findings, we concluded that pallidal adenosine A2A receptors may be potentially useful in the treatment of Parkinson's disease.

  20. Essential Control of the Function of the Striatopallidal Neuron by Pre-coupled Complexes of Adenosine A2A-Dopamine D2 Receptor Heterotetramers and Adenylyl Cyclase

    Directory of Open Access Journals (Sweden)

    Sergi Ferré

    2018-04-01

    Full Text Available The central adenosine system and adenosine receptors play a fundamental role in the modulation of dopaminergic neurotransmission. This is mostly achieved by the strategic co-localization of different adenosine and dopamine receptor subtypes in the two populations of striatal efferent neurons, striatonigral and striatopallidal, that give rise to the direct and indirect striatal efferent pathways, respectively. With optogenetic techniques it has been possible to dissect a differential role of the direct and indirect pathways in mediating “Go” responses upon exposure to reward-related stimuli and “NoGo” responses upon exposure to non-rewarded or aversive-related stimuli, respectively, which depends on their different connecting output structures and their differential expression of dopamine and adenosine receptor subtypes. The striatopallidal neuron selectively expresses dopamine D2 receptors (D2R and adenosine A2A receptors (A2AR, and numerous experiments using multiple genetic and pharmacological in vitro, in situ and in vivo approaches, demonstrate they can form A2AR-D2R heteromers. It was initially assumed that different pharmacological interactions between dopamine and adenosine receptor ligands indicated the existence of different subpopulations of A2AR and D2R in the striatopallidal neuron. However, as elaborated in the present essay, most evidence now indicates that all interactions can be explained with a predominant population of striatal A2AR-D2R heteromers forming complexes with adenylyl cyclase subtype 5 (AC5. The A2AR-D2R heteromer has a tetrameric structure, with two homodimers, which allows not only multiple allosteric interactions between different orthosteric ligands, agonists, and antagonists, but also the canonical Gs-Gi antagonistic interaction at the level of AC5. We present a model of the function of the A2AR-D2R heterotetramer-AC5 complex, which acts as an integrative device of adenosine and dopamine signals that

  1. Molecular Evidence of Adenosine Deaminase Linking Adenosine A2A Receptor and CD26 Proteins

    Directory of Open Access Journals (Sweden)

    Estefanía Moreno

    2018-02-01

    Full Text Available Adenosine is an endogenous purine nucleoside that acts in all living systems as a homeostatic network regulator through many pathways, which are adenosine receptor (AR-dependent and -independent. From a metabolic point of view, adenosine deaminase (ADA is an essential protein in the regulation of the total intracellular and extracellular adenosine in a tissue. In addition to its cytosolic localization, ADA is also expressed as an ecto-enzyme on the surface of different cells. Dipeptidyl peptidase IV (CD26 and some ARs act as binding proteins for extracellular ADA in humans. Since CD26 and ARs interact with ADA at opposite sites, we have investigated if ADA can function as a cell-to-cell communication molecule by bridging the anchoring molecules CD26 and A2AR present on the surfaces of the interacting cells. By combining site-directed mutagenesis of ADA amino acids involved in binding to A2AR and a modification of the bioluminescence resonance energy transfer (BRET technique that allows detection of interactions between two proteins expressed in different cell populations with low steric hindrance (NanoBRET, we show direct evidence of the specific formation of trimeric complexes CD26-ADA-A2AR involving two cells. By dynamic mass redistribution assays and ligand binding experiments, we also demonstrate that A2AR-NanoLuc fusion proteins are functional. The existence of this ternary complex is in good agreement with the hypothesis that ADA could bridge T-cells (expressing CD26 and dendritic cells (expressing A2AR. This is a new metabolic function for ecto-ADA that, being a single chain protein, it has been considered as an example of moonlighting protein, because it performs more than one functional role (as a catalyst, a costimulator, an allosteric modulator and a cell-to-cell connector without partitioning these functions in different subunits.

  2. Allosteric interactions between agonists and antagonists within the adenosine A2A receptor-dopamine D2 receptor heterotetramer.

    Science.gov (United States)

    Bonaventura, Jordi; Navarro, Gemma; Casadó-Anguera, Verònica; Azdad, Karima; Rea, William; Moreno, Estefanía; Brugarolas, Marc; Mallol, Josefa; Canela, Enric I; Lluís, Carme; Cortés, Antoni; Volkow, Nora D; Schiffmann, Serge N; Ferré, Sergi; Casadó, Vicent

    2015-07-07

    Adenosine A2A receptor (A2AR)-dopamine D2 receptor (D2R) heteromers are key modulators of striatal neuronal function. It has been suggested that the psychostimulant effects of caffeine depend on its ability to block an allosteric modulation within the A2AR-D2R heteromer, by which adenosine decreases the affinity and intrinsic efficacy of dopamine at the D2R. We describe novel unsuspected allosteric mechanisms within the heteromer by which not only A2AR agonists, but also A2AR antagonists, decrease the affinity and intrinsic efficacy of D2R agonists and the affinity of D2R antagonists. Strikingly, these allosteric modulations disappear on agonist and antagonist coadministration. This can be explained by a model that considers A2AR-D2R heteromers as heterotetramers, constituted by A2AR and D2R homodimers, as demonstrated by experiments with bioluminescence resonance energy transfer and bimolecular fluorescence and bioluminescence complementation. As predicted by the model, high concentrations of A2AR antagonists behaved as A2AR agonists and decreased D2R function in the brain.

  3. Adenosine A2A Receptors Modulate Acute Injury and Neuroinflammation in Brain Ischemia

    Directory of Open Access Journals (Sweden)

    Felicita Pedata

    2014-01-01

    Full Text Available The extracellular concentration of adenosine in the brain increases dramatically during ischemia. Adenosine A2A receptor is expressed in neurons and glial cells and in inflammatory cells (lymphocytes and granulocytes. Recently, adenosine A2A receptor emerged as a potential therapeutic attractive target in ischemia. Ischemia is a multifactorial pathology characterized by different events evolving in the time. After ischemia the early massive increase of extracellular glutamate is followed by activation of resident immune cells, that is, microglia, and production or activation of inflammation mediators. Proinflammatory cytokines, which upregulate cell adhesion molecules, exert an important role in promoting recruitment of leukocytes that in turn promote expansion of the inflammatory response in ischemic tissue. Protracted neuroinflammation is now recognized as the predominant mechanism of secondary brain injury progression. A2A receptors present on central cells and on blood cells account for important effects depending on the time-related evolution of the pathological condition. Evidence suggests that A2A receptor antagonists provide early protection via centrally mediated control of excessive excitotoxicity, while A2A receptor agonists provide protracted protection by controlling massive blood cell infiltration in the hours and days after ischemia. Focus on inflammatory responses provides for adenosine A2A receptor agonists a wide therapeutic time-window of hours and even days after stroke.

  4. Adenosine A2A receptor antagonists and Parkinson's disease: state of the art and future directions.

    Science.gov (United States)

    Simola, N; Morelli, M; Pinna, A

    2008-01-01

    Adenosine A(2A) receptors present in the central nervous system have been implicated in the modulation of motor functions. Accordingly, adenosine A(2A) receptor antagonists currently constitute an attractive non-dopaminergic option for use in the treatment of Parkinson's disease (PD). The highly enriched distributions of adenosine A(2A) receptors in striatopallidal neurons, and their ability to form functional heteromeric complexes with dopamine D(2) and metabotropic glutamate mGlu5 receptors, render A(2A) receptor antagonists of particular interest in the modulation of motor behavior, whilst at the same time displaying a low predisposition to inducing non-motor side effects. Furthermore, adenosine A(2A) receptor antagonists appear to exert a marked efficacy on PD tremor and in reducing the progress of underlying neurodegeneration and maladaptive neuroplasticity that complicates standard dopamine replacement treatments in PD. Finally, recent evidence has illustrated an improvement of cognitive function as well as enhancement of attention in rodents following administration of A(2A) receptor antagonists. This article is aimed at examining preclinical studies describing these findings as well as reports from clinical trials, in order to provide a comprehensive review of the evidence suggesting that this class of drugs may represent an advance in the treatment of PD.

  5. Adenosine A2A receptor hyperexpression in patients with severe SIRS after cardiopulmonary bypass.

    Science.gov (United States)

    Kerbaul, François; Bénard, Frédéric; Giorgi, Roch; Youlet, By; Carrega, Louis; Zouher, Ibrahim; Mercier, Laurence; Gérolami, Victoria; Bénas, Vincent; Blayac, Dorothée; Gariboldi, Vlad; Collart, Frédéric; Guieu, Régis

    2008-08-01

    Adenosine (ADO) is an endogenous nucleoside, which has been involved in blood pressure failure during severe systemic inflammatory response syndrome (severe SIRS) after cardiac surgery with cardiopulmonary bypass (CPB). Adenosine acts via its receptor subtypes, namely A1, A2A, A2B, or A3. Because A2A receptors are implicated in vascular tone, their expression might contribute to severe SIRS. We compared adenosine plasma levels (APLs) and A2A ADO receptor expression (ie, B, K, and mRNA amount) in patients with or without postoperative SIRS. : This was a prospective comparative observational study. Forty-four patients who underwent cardiac surgery involving CPB. Ten healthy subjects served as controls. Among the patients, 11 presented operative vasoplegia and postoperative SIRS (named complicated patients) and 33 were without vasoplegia or SIRS (named uncomplicated patients). Adenosine plasma levels, K, B, and mRNA amount (mean +/- SD) were measured on peripheral blood mononuclear cells. Adenosine plasma levels, B, and K were significantly higher in complicated patients than in uncomplicated patients (APLs: 2.7 +/- 1.0 vs 1.0 +/- 0.5 micromol l, P SIRS after CPB.

  6. Adenosine activates brown adipose tissue and recruits beige adipocytes via A2A receptors

    DEFF Research Database (Denmark)

    Gnad, Thorsten; Scheibler, Saskia; von Kügelgen, Ivar

    2014-01-01

    Brown adipose tissue (BAT) is specialized in energy expenditure, making it a potential target for anti-obesity therapies. Following exposure to cold, BAT is activated by the sympathetic nervous system with concomitant release of catecholamines and activation of β-adrenergic receptors. Because BAT...... therapies based on cold exposure or β-adrenergic agonists are clinically not feasible, alternative strategies must be explored. Purinergic co-transmission might be involved in sympathetic control of BAT and previous studies reported inhibitory effects of the purinergic transmitter adenosine in BAT from...... receptor is the most abundant adenosine receptor in human and murine BAT. Pharmacological blockade or genetic loss of A2A receptors in mice causes a decrease in BAT-dependent thermogenesis, whereas treatment with A2A agonists significantly increases energy expenditure. Moreover, pharmacological stimulation...

  7. Adenosine A(1) and A(2A) receptors in mouse prefrontal cortex modulate acetylcholine release and behavioral arousal.

    Science.gov (United States)

    Van Dort, Christa J; Baghdoyan, Helen A; Lydic, Ralph

    2009-01-21

    During prolonged intervals of wakefulness, brain adenosine levels rise within the basal forebrain and cortex. The view that adenosine promotes sleep is supported by the corollary that N-methylated xanthines such as caffeine increase brain and behavioral arousal by blocking adenosine receptors. The four subtypes of adenosine receptors are distributed heterogeneously throughout the brain, yet the neurotransmitter systems and brain regions through which adenosine receptor blockade causes arousal are incompletely understood. This study tested the hypothesis that adenosine A(1) and A(2A) receptors in the prefrontal cortex contribute to the regulation of behavioral and cortical arousal. Dependent measures included acetylcholine (ACh) release in the prefrontal cortex, cortical electroencephalographic (EEG) power, and time to waking after anesthesia. Sleep and wakefulness were also quantified after microinjecting an adenosine A(1) receptor antagonist into the prefrontal cortex. The results showed that adenosine A(1) and A(2A) receptors in the prefrontal cortex modulate cortical ACh release, behavioral arousal, EEG delta power, and sleep. Additional dual microdialysis studies revealed that ACh release in the pontine reticular formation is significantly altered by dialysis delivery of adenosine receptor agonists and antagonists to the prefrontal cortex. These data, and early brain transection studies demonstrating that the forebrain is not needed for sleep cycle generation, suggest that the prefrontal cortex modulates EEG and behavioral arousal via descending input to the pontine brainstem. The results provide novel evidence that adenosine A(1) receptors within the prefrontal cortex comprise part of a descending system that inhibits wakefulness.

  8. Interactions between Calmodulin, Adenosine A2A, and Dopamine D2 Receptors*

    Science.gov (United States)

    Navarro, Gemma; Aymerich, Marisol S.; Marcellino, Daniel; Cortés, Antoni; Casadó, Vicent; Mallol, Josefa; Canela, Enric I.; Agnati, Luigi; Woods, Amina S.; Fuxe, Kjell; Lluís, Carmen; Lanciego, Jose Luis; Ferré, Sergi; Franco, Rafael

    2009-01-01

    The Ca2+-binding protein calmodulin (CaM) has been shown to bind directly to cytoplasmic domains of some G protein-coupled receptors, including the dopamine D2 receptor. CaM binds to the N-terminal portion of the long third intracellular loop of the D2 receptor, within an Arg-rich epitope that is also involved in the binding to Gi/o proteins and to the adenosine A2A receptor, with the formation of A2A-D2 receptor heteromers. In the present work, by using proteomics and bioluminescence resonance energy transfer (BRET) techniques, we provide evidence for the binding of CaM to the A2A receptor. By using BRET and sequential resonance energy transfer techniques, evidence was obtained for CaM-A2A-D2 receptor oligomerization. BRET competition experiments indicated that, in the A2A-D2 receptor heteromer, CaM binds preferentially to a proximal C terminus epitope of the A2A receptor. Furthermore, Ca2+ was found to induce conformational changes in the CaM-A2A-D2 receptor oligomer and to selectively modulate A2A and D2 receptor-mediated MAPK signaling in the A2A-D2 receptor heteromer. These results may have implications for basal ganglia disorders, since A2A-D2 receptor heteromers are being considered as a target for anti-parkinsonian agents. PMID:19632986

  9. Involvement of adenosine A2A receptors in depression and anxiety.

    Science.gov (United States)

    Yamada, Koji; Kobayashi, Minoru; Kanda, Tomoyuki

    2014-01-01

    When administered to normal healthy patients, a nonselective adenosine A1/A2A antagonist, caffeine, tended to improve anxiety and depression at low doses and to exacerbate anxiety at high doses. Caffeine also appears to enhance anxiety-related symptoms in patients with panic disorder, and A2A receptor-deficient mice have been reported to exhibit higher anxiety-like behaviors, as well as a lower incidence of depression-like behaviors. Some selective A2A antagonists were reported to ameliorate anxiety-like behaviors in rodents, while others did not affect these behaviors. In addition, most A2A antagonists showed inhibitory effects on depression-like behaviors. The mechanisms underlying the relationship between A2A receptor antagonists and anxiety and depression remain unclear at the present time, although many studies have produced hypotheses. Given that a selective A2A receptor antagonist has recently become available for use in humans, research on the role of A2A receptors in the treatment of mental illness should progress in the near future. © 2014 Elsevier Inc. All rights reserved.

  10. Adenosine A(2A) receptors are necessary and sufficient to trigger memory impairment in adult mice.

    Science.gov (United States)

    Pagnussat, N; Almeida, A S; Marques, D M; Nunes, F; Chenet, G C; Botton, P H S; Mioranzza, S; Loss, C M; Cunha, R A; Porciúncula, L O

    2015-08-01

    Caffeine (a non-selective adenosine receptor antagonist) prevents memory deficits in aging and Alzheimer's disease, an effect mimicked by adenosine A2 A receptor, but not A1 receptor, antagonists. Hence, we investigated the effects of adenosine receptor agonists and antagonists on memory performance and scopolamine-induced memory impairment in mice. We determined whether A2 A receptors are necessary for the emergence of memory impairments induced by scopolamine and whether A2 A receptor activation triggers memory deficits in naïve mice, using three tests to assess short-term memory, namely the object recognition task, inhibitory avoidance and modified Y-maze. Scopolamine (1.0 mg·kg(-1) , i.p.) impaired short-term memory performance in all three tests and this scopolamine-induced amnesia was prevented by the A2 A receptor antagonist (SCH 58261, 0.1-1.0 mg·kg(-1) , i.p.) and by the A1 receptor antagonist (DPCPX, 0.2-5.0 mg·kg(-1) , i.p.), except in the modified Y-maze where only SCH58261 was effective. Both antagonists were devoid of effects on memory or locomotion in naïve rats. Notably, the activation of A2 A receptors with CGS 21680 (0.1-0.5 mg·kg(-1) , i.p.) before the training session was sufficient to trigger memory impairment in the three tests in naïve mice, and this effect was prevented by SCH 58261 (1.0 mg·kg(-1) , i.p.). Furthermore, i.c.v. administration of CGS 21680 (50 nmol) also impaired recognition memory in the object recognition task. These results show that A2 A receptors are necessary and sufficient to trigger memory impairment and further suggest that A1 receptors might also be selectively engaged to control the cholinergic-driven memory impairment. © 2015 The British Pharmacological Society.

  11. Adenosine A2A receptors are necessary and sufficient to trigger memory impairment in adult mice

    Science.gov (United States)

    Pagnussat, N; Almeida, A S; Marques, D M; Nunes, F; Chenet, G C; Botton, P H S; Mioranzza, S; Loss, C M; Cunha, R A; Porciúncula, L O

    2015-01-01

    Background and Purpose Caffeine (a non-selective adenosine receptor antagonist) prevents memory deficits in aging and Alzheimer’s disease, an effect mimicked by adenosine A2A receptor, but not A1 receptor, antagonists. Hence, we investigated the effects of adenosine receptor agonists and antagonists on memory performance and scopolamine-induced memory impairment in mice. Experimental Approach We determined whether A2A receptors are necessary for the emergence of memory impairments induced by scopolamine and whether A2A receptor activation triggers memory deficits in naïve mice, using three tests to assess short-term memory, namely the object recognition task, inhibitory avoidance and modified Y-maze. Key Results Scopolamine (1.0 mg·kg−1, i.p.) impaired short-term memory performance in all three tests and this scopolamine-induced amnesia was prevented by the A2A receptor antagonist (SCH 58261, 0.1–1.0 mg·kg−1, i.p.) and by the A1 receptor antagonist (DPCPX, 0.2–5.0 mg·kg−1, i.p.), except in the modified Y-maze where only SCH58261 was effective. Both antagonists were devoid of effects on memory or locomotion in naïve rats. Notably, the activation of A2A receptors with CGS 21680 (0.1–0.5 mg·kg−1, i.p.) before the training session was sufficient to trigger memory impairment in the three tests in naïve mice, and this effect was prevented by SCH 58261 (1.0 mg·kg−1, i.p.). Furthermore, i.c.v. administration of CGS 21680 (50 nmol) also impaired recognition memory in the object recognition task. Conclusions and Implications These results show that A2A receptors are necessary and sufficient to trigger memory impairment and further suggest that A1 receptors might also be selectively engaged to control the cholinergic-driven memory impairment. PMID:25939452

  12. Human Adenosine A2A Receptor: Molecular Mechanism of Ligand Binding and Activation

    Directory of Open Access Journals (Sweden)

    Byron Carpenter

    2017-12-01

    Full Text Available Adenosine receptors (ARs comprise the P1 class of purinergic receptors and belong to the largest family of integral membrane proteins in the human genome, the G protein-coupled receptors (GPCRs. ARs are classified into four subtypes, A1, A2A, A2B, and A3, which are all activated by extracellular adenosine, and play central roles in a broad range of physiological processes, including sleep regulation, angiogenesis and modulation of the immune system. ARs are potential therapeutic targets in a variety of pathophysiological conditions, including sleep disorders, cancer, and dementia, which has made them important targets for structural biology. Over a decade of research and innovation has culminated with the publication of more than 30 crystal structures of the human adenosine A2A receptor (A2AR, making it one of the best structurally characterized GPCRs at the atomic level. In this review we analyze the structural data reported for A2AR that described for the first time the binding of mode of antagonists, including newly developed drug candidates, synthetic and endogenous agonists, sodium ions and an engineered G protein. These structures have revealed the key conformational changes induced upon agonist and G protein binding that are central to signal transduction by A2AR, and have highlighted both similarities and differences in the activation mechanism of this receptor compared to other class A GPCRs. Finally, comparison of A2AR with the recently solved structures of A1R has provided the first structural insight into the molecular determinants of ligand binding specificity in different AR subtypes.

  13. The neuronal Ca(2+) -binding protein 2 (NECAB2) interacts with the adenosine A(2A) receptor and modulates the cell surface expression and function of the receptor.

    Science.gov (United States)

    Canela, Laia; Luján, Rafael; Lluís, Carme; Burgueño, Javier; Mallol, Josefa; Canela, Enric I; Franco, Rafael; Ciruela, Francisco

    2007-09-01

    Heptaspanning membrane also known as G protein-coupled receptors (GPCR) do interact with a variety of intracellular proteins whose function is regulate receptor traffic and/or signaling. Using a yeast two-hybrid screen, NECAB2, a neuronal calcium binding protein, was identified as a binding partner for the adenosine A(2A) receptor (A(2A)R) interacting with its C-terminal domain. Co-localization, co-immunoprecipitation and pull-down experiments showed a close and specific interaction between A(2A)R and NECAB2 in both transfected HEK-293 cells and also in rat striatum. Immunoelectron microscopy detection of NECAB2 and A(2A)R in the rat striatopallidal structures indicated that both proteins are co-distributed in the same glutamatergic nerve terminals. The interaction of NECAB2 with A(2A)R modulated the cell surface expression, the ligand-dependent internalization and the receptor-mediated activation of the MAPK pathway. Overall, these results show that A(2A)R interacts with NECAB2 in striatal neurones co-expressing the two proteins and that the interaction is relevant for A(2A)R function.

  14. Adenosine A2A Receptor Deletion Blocks the Beneficial Effects of Lactobacillus reuteri in Regulatory T-Deficient Scurfy Mice

    Directory of Open Access Journals (Sweden)

    Baokun He

    2017-12-01

    Full Text Available The lack of a functional Foxp3 transcription factor and regulatory T (Treg cells causes lethal, CD4+ T cell-driven autoimmune diseases in scurfy (SF mice and humans. Recent studies have shown that adenosine A2A receptor activation limits inflammation and tissue damage, thereby playing an anti-inflammatory role. However, the role of the adenosine A2A receptor in the development of disease in SF mice remains unclear. Using a genetic approach, we found that adenosine A2A receptor deletion in SF mice (SF⋅A2A-/- does not affect early life events, the development of a lymphoproliferative disorder, or hyper-production of pro-inflammatory cytokines seen in the Treg-deficiency state. As shown previously, Lactobacillus reuteri DSM 17938 treatment prolonged survival and reduced multiorgan inflammation in SF mice. In marked contrast, A2A receptor deletion completely blocked these beneficial effects of L. reuteri in SF mice. Altogether, these results suggest that although absence of the adenosine A2A receptor does not affect the development of disease in SF mice, it plays a critical role in the immunomodulation by L. reuteri in Treg-deficiency disease. The adenosine A2A receptor and its activation may have a role in treating other Treg dysfunction-mediated autoimmune diseases.

  15. Adenosine A2A Receptor Deletion Blocks the Beneficial Effects of Lactobacillus reuteri in Regulatory T-Deficient Scurfy Mice

    Science.gov (United States)

    He, Baokun; Hoang, Thomas K.; Tran, Dat Q.; Rhoads, Jon Marc; Liu, Yuying

    2017-01-01

    The lack of a functional Foxp3 transcription factor and regulatory T (Treg) cells causes lethal, CD4+ T cell-driven autoimmune diseases in scurfy (SF) mice and humans. Recent studies have shown that adenosine A2A receptor activation limits inflammation and tissue damage, thereby playing an anti-inflammatory role. However, the role of the adenosine A2A receptor in the development of disease in SF mice remains unclear. Using a genetic approach, we found that adenosine A2A receptor deletion in SF mice (SF⋅A2A-/-) does not affect early life events, the development of a lymphoproliferative disorder, or hyper-production of pro-inflammatory cytokines seen in the Treg-deficiency state. As shown previously, Lactobacillus reuteri DSM 17938 treatment prolonged survival and reduced multiorgan inflammation in SF mice. In marked contrast, A2A receptor deletion completely blocked these beneficial effects of L. reuteri in SF mice. Altogether, these results suggest that although absence of the adenosine A2A receptor does not affect the development of disease in SF mice, it plays a critical role in the immunomodulation by L. reuteri in Treg-deficiency disease. The adenosine A2A receptor and its activation may have a role in treating other Treg dysfunction-mediated autoimmune diseases. PMID:29270168

  16. Reduced adenosine A2a receptor-mediated efferent arteriolar vasodilation contributes to diabetes-induced glomerular hyperfiltration.

    Science.gov (United States)

    Persson, Patrik; Hansell, Peter; Palm, Fredrik

    2015-01-01

    Diabetes is associated with increased risk for development of kidney disease, and an increased glomerular filtration rate is an early indication of altered kidney function. Here we determine whether reduced adenosine A2a receptor-mediated vasodilation of the efferent arteriole contributes to the increased glomerular filtration rate in diabetes. The glomerular filtration rate, renal blood flow, and proximal tubular stop flow pressure were investigated in control and streptozotocin-diabetic rats during baseline and after administration of the adenosine A2a receptor antagonist ZM241385 or the adenosine A2a receptor agonist CGS21680. The diabetes-induced glomerular hyperfiltration was reduced by 24% following A2a receptor stimulation but was unaffected by A2a receptor inhibition. Contrarily, glomerular filtration rate in controls increased by 22% after A2a receptor inhibition and was unaffected by A2a stimulation. The increased glomerular filtration rate after A2a receptor inhibition in controls and decreased glomerular filtration rate after A2a receptor activation in diabetics were caused by increased and decreased stop flow pressure, respectively. None of the interventions affected renal blood flow. Thus, the normal adenosine A2a receptor-mediated tonic vasodilation of efferent arterioles is abolished in the diabetic kidney. This causes increased efferent arteriolar resistance resulting in increased filtration fraction and hyperfiltration.

  17. NCS-1 associates with adenosine A2A receptors and modulates receptor function

    Directory of Open Access Journals (Sweden)

    Gemma eNavarro

    2012-04-01

    Full Text Available Modulation of G protein-coupled receptor (GPCR signalling by local changes in intracellular calcium concentration is an established function of Calmodulin which is known to interact with many GPCRs. Less is known about the functional role of the closely related neuronal EF-hand Ca2+-sensor proteins that frequently associate with calmodulin targets with different functional outcome. In the present study we aimed to investigate if a target of calmodulin – the A2A adenosine receptor, is able to associate with two other neuronal calcium binding proteins, namely NCS-1 and caldendrin. Using bioluminescence resonance energy transfer and co-immunoprecipitation experiments we show the existence of A2A - NCS-1 complexes in living cells whereas caldendrin did not associate with A2A receptors under the conditions tested. Interestingly, NCS-1 binding modulated downstream A2A receptor intracellular signalling in a Ca2+-dependent manner. Taken together this study provides further evidence that neuronal Ca2+-sensor proteins play an important role in modulation of GPCR signalling.

  18. Role of Microglia Adenosine A2A Receptors in Retinal and Brain Neurodegenerative Diseases

    Science.gov (United States)

    Santiago, Ana R.; Baptista, Filipa I.; Santos, Paulo F.; Cristóvão, Gonçalo; Ambrósio, António F.; Cunha, Rodrigo A.; Gomes, Catarina A.

    2014-01-01

    Neuroinflammation mediated by microglial cells in the brain has been commonly associated with neurodegenerative diseases. Whether this microglia-mediated neuroinflammation is cause or consequence of neurodegeneration is still a matter of controversy. However, it is unequivocal that chronic neuroinflammation plays a role in disease progression and halting that process represents a potential therapeutic strategy. The neuromodulator adenosine emerges as a promising targeting candidate based on its ability to regulate microglial proliferation, chemotaxis, and reactivity through the activation of its G protein coupled A2A receptor (A2AR). This is in striking agreement with the ability of A2AR blockade to control several brain diseases. Retinal degenerative diseases have been also associated with microglia-mediated neuroinflammation, but the role of A2AR has been scarcely explored. This review aims to compare inflammatory features of Parkinson's and Alzheimer's diseases with glaucoma and diabetic retinopathy, discussing the therapeutic potential of A2AR in these degenerative conditions. PMID:25132733

  19. Potential Therapeutic Applications of Adenosine A2A Receptor Ligands and Opportunities for A2A Receptor Imaging

    NARCIS (Netherlands)

    van Waarde, Aren; Dierckx, Rudi A. J. O.; Zhou, Xiaoyun; Khanapur, Shivashankar; Tsukada, Hideo; Ishiwata, Kiichi; Luurtsema, Gert; de Vries, Erik F. J.; Elsinga, Philip H.

    Adenosine A2A receptors (A2ARs) are highly expressed in the human striatum, and at lower densities in the cerebral cortex, the hippocampus, and cells of the immune system. Antagonists of these receptors are potentially useful for the treatment of motor fluctuations, epilepsy, postischemic brain

  20. Overexpression of adenosine A2A receptors in rats: effects on depression, locomotion and anxiety

    Directory of Open Access Journals (Sweden)

    Joana E Coelho

    2014-06-01

    Full Text Available Adenosine A2A receptors (A2AR are a sub-type of receptors enriched in basal ganglia, activated by the neuromodulator adenosine, which interact with dopamine D2 receptors. Although this reciprocal antagonistic interaction is well established in motor function, the outcome in dopamine-related behaviors remains uncertain, in particular in depression and anxiety. We have demonstrated an upsurge of A2AR associated to aging and chronic stress. Furthermore, Alzheimer’s disease patients present A2AR accumulation in cortical areas together with depressive signs. We now tested the impact of overexpressing A2AR in forebrain neurons on dopamine related behavior, namely depression. Adult male rats overexpressing human A2AR under the control of CaMKII promoter [Tg(CaMKII-hA2AR] and aged-matched wild-types (WT of the same strain (Sprague-Dawley were studied. The forced swimming test (FST, sucrose preference test (SPT and the open-field test (OFT were performed to evaluate behavioral despair, anhedonia, locomotion and anxiety. Tg(CaMKII-hA2AR animals spent more time floating and less time swimming in the FST and presented a decreased sucrose preference at 48h in the SPT. They also covered higher distances in the OFT and spent more time in the central zone than the WT. The results indicate that Tg(CaMKII-hA2AR rats exhibit depressive-like behavior, hyperlocomotion and altered exploratory behavior. This A2AR overexpression may explain the depressive signs found in aging, chronic stress and Alzheimer’s disease.

  1. Overexpression of Adenosine A2A Receptors in Rats: Effects on Depression, Locomotion, and Anxiety

    Science.gov (United States)

    Coelho, Joana E.; Alves, Pedro; Canas, Paula M.; Valadas, Jorge S.; Shmidt, Tatiana; Batalha, Vânia L.; Ferreira, Diana G.; Ribeiro, Joaquim A.; Bader, Michael; Cunha, Rodrigo A.; do Couto, Frederico Simões; Lopes, Luísa V.

    2014-01-01

    Adenosine A2A receptors (A2AR) are a sub-type of receptors enriched in basal ganglia, activated by the neuromodulator adenosine, which interact with dopamine D2 receptors. Although this reciprocal antagonistic interaction is well-established in motor function, the outcome in dopamine-related behaviors remains uncertain, in particular in depression and anxiety. We have demonstrated an upsurge of A2AR associated to aging and chronic stress. Furthermore, Alzheimer’s disease patients present A2AR accumulation in cortical areas together with depressive signs. We now tested the impact of overexpressing A2AR in forebrain neurons on dopamine-related behavior, namely depression. Adult male rats overexpressing human A2AR under the control of CaMKII promoter [Tg(CaMKII-hA2AR)] and aged-matched wild-types (WT) of the same strain (Sprague-Dawley) were studied. The forced swimming test (FST), sucrose preference test (SPT), and the open-field test (OFT) were performed to evaluate behavioral despair, anhedonia, locomotion, and anxiety. Tg(CaMKII-hA2AR) animals spent more time floating and less time swimming in the FST and presented a decreased sucrose preference at 48 h in the SPT. They also covered higher distances in the OFT and spent more time in the central zone than the WT. The results indicate that Tg(CaMKII-hA2AR) rats exhibit depressive-like behavior, hyperlocomotion, and altered exploratory behavior. This A2AR overexpression may explain the depressive signs found in aging, chronic stress, and Alzheimer’s disease. PMID:24982640

  2. Adenosine A(2A receptors measured with [C]TMSX PET in the striata of Parkinson's disease patients.

    Directory of Open Access Journals (Sweden)

    Masahiro Mishina

    Full Text Available Adenosine A(2A receptors (A2ARs are thought to interact negatively with the dopamine D(2 receptor (D2R, so selective A2AR antagonists have attracted attention as novel treatments for Parkinson's disease (PD. However, no information about the receptor in living patients with PD is available. The purpose of this study was to investigate the relationship between A2ARs and the dopaminergic system in the striata of drug-naïve PD patients and PD patients with dyskinesia, and alteration of these receptors after antiparkinsonian therapy. We measured binding ability of striatal A2ARs using positron emission tomography (PET with [7-methyl-(11C]-(E-8-(3,4,5-trimethoxystyryl-1,3,7-trimethylxanthine ([(11C]TMSX in nine drug-naïve patients with PD, seven PD patients with mild dyskinesia and six elderly control subjects using PET. The patients and eight normal control subjects were also examined for binding ability of dopamine transporters and D2Rs. Seven of the drug-naïve patients underwent a second series of PET scans following therapy. We found that the distribution volume ratio of A2ARs in the putamen were larger in the dyskinesic patients than in the control subjects (p<0.05, Tukey-Kramer post hoc test. In the drug-naïve patients, the binding ability of the A2ARs in the putamen, but not in the head of caudate nucleus, was significantly lower on the more affected side than on the less affected side (p<0.05, paired t-test. In addition, the A2ARs were significantly increased after antiparkinsonian therapy in the bilateral putamen of the drug-naïve patients (p<0.05, paired t-test but not in the bilateral head of caudate nucleus. Our study demonstrated that the A2ARs in the putamen were increased in the PD patients with dyskinesia, and also suggest that the A2ARs in the putamen compensate for the asymmetrical decrease of dopamine in drug-naïve PD patients and that antiparkinsonian therapy increases the A2ARs in the putamen. The A2ARs may play an

  3. The adenosine A2A receptor agonist CGS 21680 exhibits antipsychotic-like activity in Cebus apella monkeys

    DEFF Research Database (Denmark)

    Andersen, M B; Fuxe, K; Werge, T

    2002-01-01

    The adenosine A2A receptor agonist CGS 21680 has shown effects similar to dopamine antagonists in behavioural assays in rats predictive for antipsychotic activity, without induction of extrapyramidal side-effects (EPS). In the present study, we examined whether this functional dopamine antagonism...

  4. Synthesis and Properties of a New Water-Soluble Prodrug of the Adenosine A2A Receptor Antagonist MSX-2

    Directory of Open Access Journals (Sweden)

    Christa E. Müller

    2008-02-01

    Full Text Available The compound L-valine-3-{8-[(E-2-[3-methoxyphenylethenyl]-7-methyl-1-propargylxanthine-3-yl}propyl ester hydrochloride (MSX-4 was synthesized as an aminoacid ester prodrug of the adenosine A2A receptor antagonist MSX-2. It was found to bestable in artificial gastric acid, but readily cleaved by pig liver esterase.

  5. 6-(2-Furanyl)-9H-purin-2-amine derivatives as A2A adenosine antagonists.

    Science.gov (United States)

    Kiselgof, Eugenia; Tulshian, Deen B; Arik, Leyla; Zhang, Hongtao; Fawzi, Ahmad

    2005-04-15

    Structure-activity relationships have been investigated through substitutions at the 9-position of the 2-amino-6-(2-furanyl) purine (5) to identify novel and selective A(2A) adenosine receptor antagonists. Several potent and selective antagonists were identified. In particular, compounds 20, 25, and 26 show very high affinity with excellent selectivity.

  6. Selective adenosine A2A receptor agonists and antagonists protect against spinal cord injury through peripheral and central effects

    Directory of Open Access Journals (Sweden)

    Esposito Emanuela

    2011-04-01

    Full Text Available Abstract Background Permanent functional deficits following spinal cord injury (SCI arise both from mechanical injury and from secondary tissue reactions involving inflammation. Enhanced release of adenosine and glutamate soon after SCI represents a component in the sequelae that may be responsible for resulting functional deficits. The role of adenosine A2A receptor in central ischemia/trauma is still to be elucidated. In our previous studies we have demonstrated that the adenosine A2A receptor-selective agonist CGS21680, systemically administered after SCI, protects from tissue damage, locomotor dysfunction and different inflammatory readouts. In this work we studied the effect of the adenosine A2A receptor antagonist SCH58261, systemically administered after SCI, on the same parameters. We investigated the hypothesis that the main action mechanism of agonists and antagonists is at peripheral or central sites. Methods Spinal trauma was induced by extradural compression of SC exposed via a four-level T5-T8 laminectomy in mouse. Three drug-dosing protocols were utilized: a short-term systemic administration by intraperitoneal injection, a chronic administration via osmotic minipump, and direct injection into the spinal cord. Results SCH58261, systemically administered (0.01 mg/kg intraperitoneal. 1, 6 and 10 hours after SCI, reduced demyelination and levels of TNF-α, Fas-L, PAR, Bax expression and activation of JNK mitogen-activated protein kinase (MAPK 24 hours after SCI. Chronic SCH58261 administration, by mini-osmotic pump delivery for 10 days, improved the neurological deficit up to 10 days after SCI. Adenosine A2A receptors are physiologically expressed in the spinal cord by astrocytes, microglia and oligodendrocytes. Soon after SCI (24 hours, these receptors showed enhanced expression in neurons. Both the A2A agonist and antagonist, administered intraperitoneally, reduced expression of the A2A receptor, ruling out the possibility that the

  7. Allosteric mechanisms within the adenosine A2A-dopamine D2 receptor heterotetramer

    Science.gov (United States)

    Ferré, Sergi; Bonaventura, Jordi; Tomasi, Dardo; Navarro, Gemma; Moreno, Estefanía; Cortés, Antonio; Lluís, Carme; Casadó, Vicent; Volkow, Nora D.

    2017-01-01

    The structure constituted by a G protein coupled receptor (GPCR) homodimer and a G protein provides a main functional unit and oligomeric entities can be viewed as multiples of dimers. For GPCR heteromers, experimental evidence supports a tetrameric structure, comprised of two different homodimers, each able to signal with its preferred G protein. GPCR homomers and heteromers can act as the conduit of allosteric interactions between orthosteric ligands. The well-known agonist/agonist allosteric interaction in the adenosine A2A receptor (A2AR)-dopamine D2 receptor (D2R) heteromer, by which A2AR agonists decrease the affinity of D2R agonists, gave the first rationale for the use of A2AR antagonists in Parkinson’s disease. We review new pharmacological findings that can be explained in the frame of a tetrameric structure of the A2AR-D2R heteromer: first, ligand-independent allosteric modulations by the D2R that result in changes of the binding properties of A2AR ligands; second, differential modulation of the intrinsic efficacy of D2R ligands for G protein-dependent and independent signaling; third, the canonical antagonistic Gs-Gi interaction within the frame of the heteromer; and fourth, the ability of A2AR antagonists, including caffeine, to also exert the same allosteric modulations of D2R ligands than A2AR agonists, while A2AR agonists and antagonists counteract each other’s effects. These findings can have important clinical implications when evaluating the use of A2AR antagonists. They also call for the need of monitoring caffeine intake when evaluating the effect of D2R ligands, when used as therapeutic agents in neuropsychiatric disorders or as probes in imaging studies. PMID:26051403

  8. Differential effects of presynaptic versus postsynaptic adenosine A2A receptor blockade on Δ9-tetrahydrocannabinol (THC) self-administration in squirrel monkeys.

    Science.gov (United States)

    Justinová, Zuzana; Redhi, Godfrey H; Goldberg, Steven R; Ferré, Sergi

    2014-05-07

    Different doses of an adenosine A2A receptor antagonist MSX-3 [3,7-dihydro-8-[(1E)-2-(3-ethoxyphenyl)ethenyl]-7 methyl-3-[3-(phosphooxy)propyl-1-(2 propynil)-1H-purine-2,6-dione] were found previously to either decrease or increase self-administration of cannabinoids delta-9-tetrahydrocannabinol (THC) or anandamide in squirrel monkeys. It was hypothesized that the decrease observed with a relatively low dose of MSX-3 was related to blockade of striatal presynaptic A2A receptors that modulate glutamatergic neurotransmission, whereas the increase observed with a higher dose was related to blockade of postsynaptic A2A receptors localized in striatopallidal neurons. This hypothesis was confirmed in the present study by testing the effects of the preferential presynaptic and postsynaptic A2A receptor antagonists SCH-442416 [2-(2-furanyl)-7-[3-(4-methoxyphenyl)propyl]-7H-pyrazolo[4,3-e][1,2,4]triazolo[1,5-c]pyrimidin-5-amine] and KW-6002 [(E)-1, 3-diethyl-8-(3,4-dimethoxystyryl)-7-methyl-3,7-dihydro-1H-purine-2,6-dione], respectively, in squirrel monkeys trained to intravenously self-administer THC. SCH-442416 produced a significant shift to the right of the THC self-administration dose-response curves, consistent with antagonism of the reinforcing effects of THC. Conversely, KW-6002 produced a significant shift to the left, consistent with potentiation of the reinforcing effects of THC. These results show that selectively blocking presynaptic A2A receptors could provide a new pharmacological approach to the treatment of marijuana dependence and underscore corticostriatal glutamatergic neurotransmission as a possible main mechanism involved in the rewarding effects of THC.

  9. Adenosine A(2A) receptor up-regulates retinal wave frequency via starburst amacrine cells in the developing rat retina.

    Science.gov (United States)

    Huang, Pin-Chien; Hsiao, Yu-Tien; Kao, Shao-Yen; Chen, Ching-Feng; Chen, Yu-Chieh; Chiang, Chung-Wei; Lee, Chien-Fei; Lu, Juu-Chin; Chern, Yijuang; Wang, Chih-Tien

    2014-01-01

    Developing retinas display retinal waves, the patterned spontaneous activity essential for circuit refinement. During the first postnatal week in rodents, retinal waves are mediated by synaptic transmission between starburst amacrine cells (SACs) and retinal ganglion cells (RGCs). The neuromodulator adenosine is essential for the generation of retinal waves. However, the cellular basis underlying adenosine's regulation of retinal waves remains elusive. Here, we investigated whether and how the adenosine A(2A) receptor (A(2A)R) regulates retinal waves and whether A(2A)R regulation of retinal waves acts via presynaptic SACs. We showed that A(2A)R was expressed in the inner plexiform layer and ganglion cell layer of the developing rat retina. Knockdown of A(2A)R decreased the frequency of spontaneous Ca²⁺ transients, suggesting that endogenous A(2A)R may up-regulate wave frequency. To investigate whether A(2A)R acts via presynaptic SACs, we targeted gene expression to SACs by the metabotropic glutamate receptor type II promoter. Ca²⁺ transient frequency was increased by expressing wild-type A(2A)R (A2AR-WT) in SACs, suggesting that A(2A)R may up-regulate retinal waves via presynaptic SACs. Subsequent patch-clamp recordings on RGCs revealed that presynaptic A(2A)R-WT increased the frequency of wave-associated postsynaptic currents (PSCs) or depolarizations compared to the control, without changing the RGC's excitability, membrane potentials, or PSC charge. These findings suggest that presynaptic A(2A)R may not affect the membrane properties of postsynaptic RGCs. In contrast, by expressing the C-terminal truncated A(2A)R mutant (A(2A)R-ΔC) in SACs, the wave frequency was reduced compared to the A(2A)R-WT, but was similar to the control, suggesting that the full-length A(2A)R in SACs is required for A(2A)R up-regulation of retinal waves. A(2A)R up-regulates the frequency of retinal waves via presynaptic SACs, requiring its full-length protein structure. Thus, by

  10. METABOTROPIC GLUTAMATE TYPE 5, DOPAMINE D2 AND ADENOSINE A2A RECEPTORS FORM HIGHER-ORDER OLIGOMERS IN LIVING CELLS

    Science.gov (United States)

    Cabello, Nuria; Gandía, Jorge; Bertarelli, Daniela C. G.; Watanabe, Masahiko; Lluís, Carme; Franco, Rafael; Ferré, Sergi; Luján, Rafael; Ciruela, Francisco

    2009-01-01

    G protein-coupled receptors are known to form homo- and heteromers at the plasma membrane, but the stoichiometry of these receptor oligomers are relatively unknown. Here, by using bimolecular fluorescence complementation, we visualized for the first time the occurrence of heterodimers of metabotropic glutamate mGlu5 receptors (mGlu5R) and dopamine D2 receptors (D2R) in living cells. Furthermore, the combination of bimolecular fluorescence complementation and bioluminescence resonance energy transfer techniques, as well as the sequential resonance energy transfer (SRET) technique, allowed us to detect the occurrence receptor oligomers containing more than two protomers, mGlu5R, D2R and adenosine A2A receptor (A2AR). Interestingly, by using high-resolution immunoelectron microscopy we could confirm that the three receptors co-distribute within the extrasynaptic plasma membrane of the same dendritic spines of asymmetrical, putative glutamatergic, striatal synapses. Also, co-immunoprecipitation experiments in native tissue demonstrated the existence of an association of mGlu5R, D2R and A2AR in rat striatum homogenates. Overall, these results provide new insights into the molecular composition of G protein-coupled receptor oligomers in general and the mGlu5R/D2R/A2AR oligomer in particular, a receptor oligomer that might constitute an important target for the treatment of some neuropsychiatric disorders. PMID:19344374

  11. The adenosine A2A receptor agonist CGS 21680 exhibits antipsychotic-like activity in Cebus apella monkeys

    DEFF Research Database (Denmark)

    Andersen, M B; Fuxe, K; Werge, T

    2002-01-01

    The adenosine A2A receptor agonist CGS 21680 has shown effects similar to dopamine antagonists in behavioural assays in rats predictive for antipsychotic activity, without induction of extrapyramidal side-effects (EPS). In the present study, we examined whether this functional dopamine antagonism......-induced behaviours (unrest, stereotypies, arousal) were unaffected. EPS were not observed at any dose. At 0.05 mg/kg CGS 21680 produced vomiting. The two lower doses did not produce observable side-effects. Though the differential effect on amphetamine- and apomorphine-induced behaviours is intriguing, CGS 21680...... showed a functional anti-dopaminergic effect in Cebus apella monkeys without production of EPS. This further substantiates that adenosine A2A receptor agonists may have potential as antipsychotics with atypical profiles....

  12. Cholesterol 27-hydroxylase but not apolipoprotein apoE contributes to A2A adenosine receptor stimulated reverse cholesterol transport.

    Science.gov (United States)

    Bingham, Taiese Crystal; Parathath, Saj; Tian, Heather; Reiss, Allison; Chan, Edwin; Fisher, Edward A; Cronstein, Bruce N

    2012-02-01

    Movement of free cholesterol between the cellular compartment and acceptor is governed by cholesterol gradients that are determined by several enzymes and reverse cholesterol transport proteins. We have previously demonstrated that adenosine A(2A) receptors inhibit foam cell formation and stimulate production of cholesterol 27-hydroxylase (CYP27A1), an enzyme involved in the conversion of cholesterol to oxysterols. We therefore asked whether the effect of adenosine A(2A) receptors on foam cell formation in vitro is mediated by CYP27A1 or apoE, a carrier for cholesterol in the serum. We found that specific lentiviral siRNA infection markedly reduced apoE or 27-hydroxylase mRNA in THP-1 cells. Despite diminished apoE expression (p CYP27A1 KD cells (4 ± 2%; pCYP27A1 KD cells but reduced efflux in apoE KD cells. These results demonstrate that adenosine A(2A) receptor occupancy diminishes foam cell formation by increasing expression and function of CYP27A1.

  13. Role of Adenosine Receptor A2A in Traumatic Optic Neuropathies (Addendum)

    Science.gov (United States)

    2016-03-01

    provides seizure suppression in various models of epilepsy (Ugarkar et al., 2000); 3) inhibition of AK in hippocampal slicesincreases endogenous...Diabetes 2003;52:506–11. Boison D. Adenosine kinase, epilepsy and stroke: mechanisms and therapies. Trends Pharmacol Sci 2006;27:652–8. Bong GW...Remessy AB, Al-ShabraweyM, Khalifa Y, Tsai NT, Caldwell RB, Liou GI. Neuroprotective and blood–retinal barrier-preserving effects of cannabidiol in

  14. Role of Adenosine Receptor A2A in Traumatic Optic Neuropathies

    Science.gov (United States)

    2013-12-01

    transient focal ischemia in mice. J. Neurosci. 19, 9192–9200. Collis, M.G., Hourani, S.M., 1993. Adenosine receptor subtypes. Trends Pharmacol. Sci. 14...4 INTRODUCTION Traumatic optic nerve injury is commonly seen in motor vehicle accidents , assaults, and in the theater of war... ischemia , which in turn leads to neuronal cell death (El-Remessy et al., 2006). Under these conditions, normally quiescent microglial cells become

  15. Exploring an interaction of adenosine A2A receptor variability with coffee and tea intake in Parkinson's disease.

    Science.gov (United States)

    Tan, E K; Lu, Z Y; Fook-Chong, S M C; Tan, E; Shen, H; Chua, E; Yih, Y; Teo, Y Y; Zhao, Y

    2006-09-05

    Caffeine is an adenosine receptor A1 and A2A receptor antagonist and a putative functional genetic variant of the A2A receptor (2592C > Tins) mediates caffeine-induced anxiety. Here we investigated the potential interaction of this A2A genetic variant with the quantity of coffee and tea intake and their relationship with the risk of PD. A total of 441 subjects consisting of 222 PD and 219 race, gender and age matched controls were included. A multivariate analysis of the variables including the 2592C > Tins A2A genotypes, age of onset, gender, and the quantity of tea and coffee intake, interaction of the A2A genotypes with coffee intake, interaction of A2A genotypes with tea intake demonstrated the quantity of coffee intake to be significantly associated with PD (P coffee and tea intake in modulating the risk of PD. The dose dependent protective effect of coffee intake in PD was independent of the 2592C > Tins A2A genotype suggesting that the pharmacogenetic action of caffeine in PD may be mediated differently from other caffeine-induced neurologic syndromes.

  16. Role of adenosine A2A receptor signaling in the nicotine-evoked attenuation of reflex cardiac sympathetic control

    International Nuclear Information System (INIS)

    El-Mas, Mahmoud M.; El-gowilly, Sahar M.; Fouda, Mohamed A.; Saad, Evan I.

    2011-01-01

    Baroreflex dysfunction contributes to increased cardiovascular risk in cigarette smokers. Given the importance of adenosinergic pathways in baroreflex control, the hypothesis was tested that defective central adenosinergic modulation of cardiac autonomic activity mediates the nicotine-baroreflex interaction. Baroreflex curves relating changes in heart rate (HR) to increases or decreases in blood pressure (BP) evoked by i.v. doses (1-16 μg/kg) of phenylephrine (PE) and sodium nitroprusside (SNP), respectively, were constructed in conscious rats; slopes of the curves were taken as measures of baroreflex sensitivity (BRS). Nicotine (25 and 100 μg/kg i.v.) dose-dependently reduced BRS SNP in contrast to no effect on BRS PE . BRS SNP was also attenuated after intracisternal (i.c.) administration of nicotine. Similar reductions in BRS SNP were observed in rats pretreated with atropine or propranolol. The combined treatment with nicotine and atropine produced additive inhibitory effects on BRS, an effect that was not demonstrated upon concurrent exposure to nicotine and propranolol. BRS SNP was reduced in preparations treated with i.c. 8-phenyltheophylline (8-PT, nonselective adenosine receptor antagonist), 8-(3-Chlorostyryl) caffeine (CSC, A 2A antagonist), or VUF5574 (A 3 antagonist). In contrast, BRS SNP was preserved after blockade of A 1 (DPCPX) or A 2B (alloxazine) receptors or inhibition of adenosine uptake by dipyridamole. CSC or 8-PT abrogated the BRS SNP depressant effect of nicotine whereas other adenosinergic antagonists were without effect. Together, nicotine preferentially impairs reflex tachycardia via disruption of adenosine A 2A receptor-mediated facilitation of reflex cardiac sympathoexcitation. Clinically, the attenuation by nicotine of compensatory sympathoexcitation may be detrimental in conditions such as hypothalamic defense response, posture changes, and ventricular rhythms. - Research highlights: → The role of central adenosinergic sites in

  17. Insulin-Increased L-Arginine Transport Requires A2A Adenosine Receptors Activation in Human Umbilical Vein Endothelium

    Science.gov (United States)

    Guzmán-Gutiérrez, Enrique; Westermeier, Francisco; Salomón, Carlos; González, Marcelo; Pardo, Fabián; Leiva, Andrea; Sobrevia, Luis

    2012-01-01

    Adenosine causes vasodilation of human placenta vasculature by increasing the transport of arginine via cationic amino acid transporters 1 (hCAT-1). This process involves the activation of A2A adenosine receptors (A2AAR) in human umbilical vein endothelial cells (HUVECs). Insulin increases hCAT-1 activity and expression in HUVECs, and A2AAR stimulation increases insulin sensitivity in subjects with insulin resistance. However, whether A2AAR plays a role in insulin-mediated increase in L-arginine transport in HUVECs is unknown. To determine this, we first assayed the kinetics of saturable L-arginine transport (1 minute, 37°C) in the absence or presence of nitrobenzylthioinosine (NBTI, 10 µmol/L, adenosine transport inhibitor) and/or adenosine receptors agonist/antagonists. We also determined hCAT-1 protein and mRNA expression levels (Western blots and quantitative PCR), and SLC7A1 (for hCAT-1) reporter promoter activity. Insulin and NBTI increased the extracellular adenosine concentration, the maximal velocity for L-arginine transport without altering the apparent K m for L-arginine transport, hCAT-1 protein and mRNA expression levels, and SLC7A1 transcriptional activity. An A2AAR antagonist ZM-241385 blocked these effects. ZM241385 inhibited SLC7A1 reporter transcriptional activity to the same extent in cells transfected with pGL3-hCAT-1−1606 or pGL3-hCAT-1−650 constructs in the presence of NBTI + insulin. However, SLC7A1 reporter activity was increased by NBTI only in cells transfected with pGL3-hCAT-1−1606, and the ZM-241385 sensitive fraction of the NBTI response was similar in the absence or in the presence of insulin. Thus, insulin modulation of hCAT-1 expression and activity requires functional A2AAR in HUVECs, a mechanism that may be applicable to diseases associated with fetal insulin resistance, such as gestational diabetes. PMID:22844517

  18. Insulin-increased L-arginine transport requires A(2A adenosine receptors activation in human umbilical vein endothelium.

    Directory of Open Access Journals (Sweden)

    Enrique Guzmán-Gutiérrez

    Full Text Available Adenosine causes vasodilation of human placenta vasculature by increasing the transport of arginine via cationic amino acid transporters 1 (hCAT-1. This process involves the activation of A(2A adenosine receptors (A(2AAR in human umbilical vein endothelial cells (HUVECs. Insulin increases hCAT-1 activity and expression in HUVECs, and A(2AAR stimulation increases insulin sensitivity in subjects with insulin resistance. However, whether A(2AAR plays a role in insulin-mediated increase in L-arginine transport in HUVECs is unknown. To determine this, we first assayed the kinetics of saturable L-arginine transport (1 minute, 37°C in the absence or presence of nitrobenzylthioinosine (NBTI, 10 µmol/L, adenosine transport inhibitor and/or adenosine receptors agonist/antagonists. We also determined hCAT-1 protein and mRNA expression levels (Western blots and quantitative PCR, and SLC7A1 (for hCAT-1 reporter promoter activity. Insulin and NBTI increased the extracellular adenosine concentration, the maximal velocity for L-arginine transport without altering the apparent K(m for L-arginine transport, hCAT-1 protein and mRNA expression levels, and SLC7A1 transcriptional activity. An A2AAR antagonist ZM-241385 blocked these effects. ZM241385 inhibited SLC7A1 reporter transcriptional activity to the same extent in cells transfected with pGL3-hCAT-1(-1606 or pGL3-hCAT-1(-650 constructs in the presence of NBTI + insulin. However, SLC7A1 reporter activity was increased by NBTI only in cells transfected with pGL3-hCAT-1(-1606, and the ZM-241385 sensitive fraction of the NBTI response was similar in the absence or in the presence of insulin. Thus, insulin modulation of hCAT-1 expression and activity requires functional A(2AAR in HUVECs, a mechanism that may be applicable to diseases associated with fetal insulin resistance, such as gestational diabetes.

  19. Adenosine A(2A) receptor gene (ADORA2A) variants may increase autistic symptoms and anxiety in autism spectrum disorder.

    Science.gov (United States)

    Freitag, Christine M; Agelopoulos, Konstantin; Huy, Ellen; Rothermundt, Matthias; Krakowitzky, Petra; Meyer, Jobst; Deckert, Jürgen; von Gontard, Alexander; Hohoff, Christa

    2010-01-01

    Autism spectrum disorders (ASDs) are heterogeneous disorders presenting with increased rates of anxiety. The adenosine A(2A) receptor gene (ADORA2A) is associated with panic disorder and is located on chromosome 22q11.23. Its gene product, the adenosine A(2A) receptor, is strongly expressed in the caudate nucleus, which also is involved in ASD. As autistic symptoms are increased in individuals with 22q11.2 deletion syndrome, and large 22q11.2 deletions and duplications have been observed in ASD individuals, in this study, 98 individuals with ASD and 234 control individuals were genotyped for eight single-nucleotide polymorphisms in ADORA2A. Nominal association with the disorder was observed for rs2236624-CC, and phenotypic variability in ASD symptoms was influenced by rs3761422, rs5751876 and rs35320474. In addition, association of ADORA2A variants with anxiety was replicated for individuals with ASD. Findings point toward a possible mediating role of ADORA2A variants on phenotypic expression in ASD that need to be replicated in a larger sample.

  20. Selective Activation of Adenosine A2A Receptors on Immune Cells by a CD73-Dependent Prodrug Suppresses Joint Inflammation in Experimental Rheumatoid Arthritis.

    NARCIS (Netherlands)

    Flogel, U.; Burghoff, S.; Lent, P.L.E.M. van; Temme, S.; Galbarz, L.; Ding, Z.; El-Tayeb, A.; Huels, S.; Bonner, F.; Borg, N. van den; Jacoby, C.; Muller, C.E.; Berg, W.B. van den; Schrader, J.

    2012-01-01

    Adenosine A(2A) receptor (A(2A)R) agonists are both highly effective anti-inflammatory agents and potent vasodilators. To separate these two activities, we have synthesized phosphorylated A(2A)R agonists (prodrugs) that require the presence of ecto-5'-nucleotidase (CD73) to become activated. In the

  1. The importance of the adenosine A(2A) receptor-dopamine D(2) receptor interaction in drug addiction.

    Science.gov (United States)

    Filip, M; Zaniewska, M; Frankowska, M; Wydra, K; Fuxe, K

    2012-01-01

    Drug addiction is a serious brain disorder with somatic, psychological, psychiatric, socio-economic and legal implications in the developed world. Illegal (e.g., psychostimulants, opioids, cannabinoids) and legal (alcohol, nicotine) drugs of abuse create a complex behavioral pattern composed of drug intake, withdrawal, seeking and relapse. One of the hallmarks of drugs that are abused by humans is that they have different mechanisms of action to increase dopamine (DA) neurotransmission within the mesolimbic circuitry of the brain and indirectly activate DA receptors. Among the DA receptors, D(2) receptors are linked to drug abuse and addiction because their function has been proven to be correlated with drug reinforcement and relapses. The recognition that D(2) receptors exist not only as homomers but also can form heteromers, such as with the adenosine (A)(2A) receptor, that are pharmacologically and functionally distinct from their constituent receptors, has significantly expanded the range of potential drug targets and provided new avenues for drug design in the search for novel drug addiction therapies. The aim of this review is to bring current focus on A(2A) receptors, their physiology and pharmacology in the central nervous system, and to discuss the therapeutic relevance of these receptors to drug addiction. We concentrate on the contribution of A(2A) receptors to the effects of different classes of drugs of abuse examined in preclinical behavioral experiments carried out with pharmacological and genetic tools. The consequences of chronic drug treatment on A(2A) receptor-assigned functions in preclinical studies are also presented. Finally, the neurochemical mechanism of the interaction between A(2A) receptors and drugs of abuse in the context of the heteromeric A(2A)-D(2) receptor complex is discussed. Taken together, a significant amount of experimental analyses provide evidence that targeting A(2A) receptors may offer innovative translational strategies

  2. Structure-Activity Relationships of Truncated C2- or C8-Substituted Adenosine Derivatives as Dual Acting A2A and A3 Adenosine Receptor Ligands

    Science.gov (United States)

    Hou, Xiyan; Majik, Mahesh S.; Kim, Kyunglim; Pyee, Yuna; Lee, Yoonji; Alexander, Varughese; Chung, Hwa-Jin; Lee, Hyuk Woo; Chandra, Girish; Lee, Jin Hee; Park, Seul-gi; Choi, Won Jun; Kim, Hea Ok; Phan, Khai; Gao, Zhan-Guo; Jacobson, Kenneth A.; Choi, Sun; Lee, Sang Kook; Jeong, Lak Shin

    2011-01-01

    Truncated N6-substituted-4′-oxo- and 4′-thioadenosine derivatives with C2 or C8 substitution were studied as dual acting A2A and A3 adenosine receptor (AR) ligands. The lithiation-mediated stannyl transfer and palladium-catalyzed cross coupling reactions were utilized for functionalization of the C2 position of 6-chloropurine nucleosides. An unsubstituted 6-amino group and a hydrophobic C2 substituent were required for high affinity at the hA2AAR, but hydrophobic C8 substitution abolished binding at the hA2AAR. However, most of synthesized compounds displayed medium to high binding affinity at the hA3AR, regardless of C2 or C8 substitution, and low efficacy in a functional cAMP assay. Several compounds tended to be full hA2AAR agonists. C2 substitution probed geometrically through hA2AAR-docking, was important for binding in order of hexynyl > hexenyl > hexanyl. Compound 4g was the most potent ligand acting dually as hA2AAR agonist and hA3AR antagonist, which might be useful for treatment of asthma or other inflammatory diseases. PMID:22142423

  3. Adenosine A2A Receptor Up-Regulates Retinal Wave Frequency via Starburst Amacrine Cells in the Developing Rat Retina

    Science.gov (United States)

    Huang, Pin-Chien; Hsiao, Yu-Tien; Kao, Shao-Yen; Chen, Ching-Feng; Chen, Yu-Chieh; Chiang, Chung-Wei; Lee, Chien-fei; Lu, Juu-Chin; Chern, Yijuang; Wang, Chih-Tien

    2014-01-01

    Background Developing retinas display retinal waves, the patterned spontaneous activity essential for circuit refinement. During the first postnatal week in rodents, retinal waves are mediated by synaptic transmission between starburst amacrine cells (SACs) and retinal ganglion cells (RGCs). The neuromodulator adenosine is essential for the generation of retinal waves. However, the cellular basis underlying adenosine's regulation of retinal waves remains elusive. Here, we investigated whether and how the adenosine A2A receptor (A2AR) regulates retinal waves and whether A2AR regulation of retinal waves acts via presynaptic SACs. Methodology/Principal Findings We showed that A2AR was expressed in the inner plexiform layer and ganglion cell layer of the developing rat retina. Knockdown of A2AR decreased the frequency of spontaneous Ca2+ transients, suggesting that endogenous A2AR may up-regulate wave frequency. To investigate whether A2AR acts via presynaptic SACs, we targeted gene expression to SACs by the metabotropic glutamate receptor type II promoter. Ca2+ transient frequency was increased by expressing wild-type A2AR (A2AR-WT) in SACs, suggesting that A2AR may up-regulate retinal waves via presynaptic SACs. Subsequent patch-clamp recordings on RGCs revealed that presynaptic A2AR-WT increased the frequency of wave-associated postsynaptic currents (PSCs) or depolarizations compared to the control, without changing the RGC's excitability, membrane potentials, or PSC charge. These findings suggest that presynaptic A2AR may not affect the membrane properties of postsynaptic RGCs. In contrast, by expressing the C-terminal truncated A2AR mutant (A2AR-ΔC) in SACs, the wave frequency was reduced compared to the A2AR-WT, but was similar to the control, suggesting that the full-length A2AR in SACs is required for A2AR up-regulation of retinal waves. Conclusions/Significance A2AR up-regulates the frequency of retinal waves via presynaptic SACs, requiring its full

  4. Adenosine A(2A receptor up-regulates retinal wave frequency via starburst amacrine cells in the developing rat retina.

    Directory of Open Access Journals (Sweden)

    Pin-Chien Huang

    Full Text Available BACKGROUND: Developing retinas display retinal waves, the patterned spontaneous activity essential for circuit refinement. During the first postnatal week in rodents, retinal waves are mediated by synaptic transmission between starburst amacrine cells (SACs and retinal ganglion cells (RGCs. The neuromodulator adenosine is essential for the generation of retinal waves. However, the cellular basis underlying adenosine's regulation of retinal waves remains elusive. Here, we investigated whether and how the adenosine A(2A receptor (A(2AR regulates retinal waves and whether A(2AR regulation of retinal waves acts via presynaptic SACs. METHODOLOGY/PRINCIPAL FINDINGS: We showed that A(2AR was expressed in the inner plexiform layer and ganglion cell layer of the developing rat retina. Knockdown of A(2AR decreased the frequency of spontaneous Ca²⁺ transients, suggesting that endogenous A(2AR may up-regulate wave frequency. To investigate whether A(2AR acts via presynaptic SACs, we targeted gene expression to SACs by the metabotropic glutamate receptor type II promoter. Ca²⁺ transient frequency was increased by expressing wild-type A(2AR (A2AR-WT in SACs, suggesting that A(2AR may up-regulate retinal waves via presynaptic SACs. Subsequent patch-clamp recordings on RGCs revealed that presynaptic A(2AR-WT increased the frequency of wave-associated postsynaptic currents (PSCs or depolarizations compared to the control, without changing the RGC's excitability, membrane potentials, or PSC charge. These findings suggest that presynaptic A(2AR may not affect the membrane properties of postsynaptic RGCs. In contrast, by expressing the C-terminal truncated A(2AR mutant (A(2AR-ΔC in SACs, the wave frequency was reduced compared to the A(2AR-WT, but was similar to the control, suggesting that the full-length A(2AR in SACs is required for A(2AR up-regulation of retinal waves. CONCLUSIONS/SIGNIFICANCE: A(2AR up-regulates the frequency of retinal waves via

  5. Caffeine acts through neuronal adenosine A2A receptors to prevent mood and memory dysfunction triggered by chronic stress.

    Science.gov (United States)

    Kaster, Manuella P; Machado, Nuno J; Silva, Henrique B; Nunes, Ana; Ardais, Ana Paula; Santana, Magda; Baqi, Younis; Müller, Christa E; Rodrigues, Ana Lúcia S; Porciúncula, Lisiane O; Chen, Jiang Fan; Tomé, Ângelo R; Agostinho, Paula; Canas, Paula M; Cunha, Rodrigo A

    2015-06-23

    The consumption of caffeine (an adenosine receptor antagonist) correlates inversely with depression and memory deterioration, and adenosine A2A receptor (A2AR) antagonists emerge as candidate therapeutic targets because they control aberrant synaptic plasticity and afford neuroprotection. Therefore we tested the ability of A2AR to control the behavioral, electrophysiological, and neurochemical modifications caused by chronic unpredictable stress (CUS), which alters hippocampal circuits, dampens mood and memory performance, and enhances susceptibility to depression. CUS for 3 wk in adult mice induced anxiogenic and helpless-like behavior and decreased memory performance. These behavioral changes were accompanied by synaptic alterations, typified by a decrease in synaptic plasticity and a reduced density of synaptic proteins (synaptosomal-associated protein 25, syntaxin, and vesicular glutamate transporter type 1), together with an increased density of A2AR in glutamatergic terminals in the hippocampus. Except for anxiety, for which results were mixed, CUS-induced behavioral and synaptic alterations were prevented by (i) caffeine (1 g/L in the drinking water, starting 3 wk before and continued throughout CUS); (ii) the selective A2AR antagonist KW6002 (3 mg/kg, p.o.); (iii) global A2AR deletion; and (iv) selective A2AR deletion in forebrain neurons. Notably, A2AR blockade was not only prophylactic but also therapeutically efficacious, because a 3-wk treatment with the A2AR antagonist SCH58261 (0.1 mg/kg, i.p.) reversed the mood and synaptic dysfunction caused by CUS. These results herald a key role for synaptic A2AR in the control of chronic stress-induced modifications and suggest A2AR as candidate targets to alleviate the consequences of chronic stress on brain function.

  6. An A2A adenosine receptor agonist, ATL313, reduces inflammation and improves survival in murine sepsis models

    Directory of Open Access Journals (Sweden)

    Linden Joel

    2008-10-01

    Full Text Available Abstract Background The pathophysiology of sepsis is due in part to early systemic inflammation. Here we describe molecular and cellular responses, as well as survival, in A2A adenosine receptor (AR agonist treated and untreated animals during experimental sepsis. Methods Sepsis was induced in mice by intraperitoneal inoculation of live bacteria (Escherichia coli or Staphylococcus aureus or lipopolysaccharide (LPS. Mice inoculated with live bacteria were treated with an A2A AR agonist (ATL313 or phosphate buffered saline (PBS, with or without the addition of a dose of ceftriaxone. LPS inoculated mice were treated with ATL313 or PBS. Serum cytokines and chemokines were measured sequentially at 1, 2, 4, 8, and 24 hours after LPS was administered. In survival studies, mice were followed until death or for 7 days. Results There was a significant survival benefit in mice infected with live E. coli (100% vs. 20%, p = 0.013 or S. aureus (60% vs. 20%, p = 0.02 when treated with ATL313 in conjunction with an antibiotic versus antibiotic alone. ATL313 also improved survival from endotoxic shock when compared to PBS treatment (90% vs. 40%, p = 0.005. The serum concentrations of TNF-α, MIP-1α, MCP-1, IFN-γ, and IL-17 were decreased by ATL313 after LPS injection (p p p Conclusion Further studies are warranted to determine the clinical utility of ATL313 as a novel treatment for sepsis.

  7. Resetting microbiota by Lactobacillus reuteri inhibits T reg deficiency–induced autoimmunity via adenosine A2A receptors

    Science.gov (United States)

    Hoang, Thomas K.; Tian, Xiangjun; Luo, Meng; Zhou, Jain; Tatevian, Nina; Molina, Jose G.; Blackburn, Michael R.; Gomez, Thomas H.

    2017-01-01

    Regulatory T (T reg) cell deficiency causes lethal, CD4+ T cell–driven autoimmune diseases. Stem cell transplantation is used to treat these diseases, but this procedure is limited by the availability of a suitable donor. The intestinal microbiota drives host immune homeostasis by regulating the differentiation and expansion of T reg, Th1, and Th2 cells. It is currently unclear if T reg cell deficiency–mediated autoimmune disorders can be treated by targeting the enteric microbiota. Here, we demonstrate that Foxp3+ T reg cell deficiency results in gut microbial dysbiosis and autoimmunity over the lifespan of scurfy (SF) mouse. Remodeling microbiota with Lactobacillus reuteri prolonged survival and reduced multiorgan inflammation in SF mice. L. reuteri changed the metabolomic profile disrupted by T reg cell deficiency, and a major effect was to restore levels of the purine metabolite inosine. Feeding inosine itself prolonged life and inhibited multiorgan inflammation by reducing Th1/Th2 cells and their associated cytokines. Mechanistically, the inhibition of inosine on the differentiation of Th1 and Th2 cells in vitro depended on adenosine A2A receptors, which were also required for the efficacy of inosine and of L. reuteri in vivo. These results reveal that the microbiota–inosine–A2A receptor axis might represent a potential avenue for combatting autoimmune diseases mediated by T reg cell dysfunction. PMID:27994068

  8. Lumbar sympathectomy reduces vascular permeability, possibly through decreased adenosine receptor A2a expression in the hind plantar skin of rats.

    Science.gov (United States)

    Zheng, Zhifang; Liu, Yishu; Zhu, Lulu; Tang, Jianbing; Huang, Wenhua; Cheng, Biao

    2018-01-01

    The effect of lumbar sympathectomy for the treatment of lower limb ischemia remains a matter of controversy. Sprague-Dawley rats were subjected to lumbar sympathectomy, after which Evans blue dye was injected into the hind plantar skin. Extravasation of dye was measured and compared with rats undergoing sham operation. Hind plantar skin was processed for HE staining, immunohistochemistry, and Western blot. In sympathectomized rats, blue stained areas in hind plantar skin and concentrations of Evans blue were significantly less than that of sham sympathectomy (control) rats, both 2 weeks and 3 months after surgery. Expression of prostaglandin E2, bradykinin, bradykinin B2 receptor, and adenosine triphosphate were not significantly different between the sympathectomized and control groups. Adenosine receptor A2a expression was significantly reduced in the sympathectomized group both 2 weeks and 3 months after surgery. Vascular permeability in the hind plantar skin of rats decreases following lumbar sympathectomy, possibly via reduced expression of adenosine receptor A2a.

  9. Adenosine A2A Receptors Control Glutamatergic Synaptic Plasticity in Fast Spiking Interneurons of the Prefrontal Cortex

    Directory of Open Access Journals (Sweden)

    Amber Kerkhofs

    2018-03-01

    Full Text Available Adenosine A2A receptors (A2AR are activated upon increased synaptic activity to assist in the implementation of long-term plastic changes at synapses. While it is reported that A2AR are involved in the control of prefrontal cortex (PFC-dependent behavior such as working memory, reversal learning and effort-based decision making, it is not known whether A2AR control glutamatergic synapse plasticity within the medial PFC (mPFC. To elucidate that, we tested whether A2AR blockade affects long-term plasticity (LTP of excitatory post-synaptic potentials in pyramidal neurons and fast spiking (FS interneurons in layer 5 of the mPFC and of population spikes. Our results show that A2AR are enriched at mPFC synapses, where their blockade reversed the direction of plasticity at excitatory synapses onto layer 5 FS interneurons from LTP to long-term depression, while their blockade had no effect on the induction of LTP at excitatory synapses onto layer 5 pyramidal neurons. At the network level, extracellularly induced LTP of population spikes was reduced by A2AR blockade. The interneuron-specificity of A2AR in controlling glutamatergic synapse LTP may ensure that during periods of high synaptic activity, a proper excitation/inhibition balance is maintained within the mPFC.

  10. Inhibition of A2A Adenosine Receptor Signaling in Cancer Cells Proliferation by the Novel Antagonist TP455

    Directory of Open Access Journals (Sweden)

    Stefania Gessi

    2017-12-01

    Full Text Available Several evidences indicate that the ubiquitous nucleoside adenosine, acting through A1, A2A, A2B, and A3 receptor (AR subtypes, plays crucial roles in tumor development. Adenosine has contrasting effects on cell proliferation depending on the engagement of different receptor subtypes in various tumors. The involvement of A2AARs in human A375 melanoma, as well as in human A549 lung and rat MRMT1 breast carcinoma proliferation has been evaluated in view of the availability of a novel A2AAR antagonist, with high affinity and selectivity, named as 2-(2-furanyl-N5-(2-methoxybenzyl[1,3]thiazolo[5,4-d]pyrimidine-5,7-diammine (TP455. Specifically, the signaling pathways triggered in the cancer cells of different origin and the antagonist effect of TP455 were investigated. The A2AAR protein expression was evaluated through receptor binding assays. Furthermore, the effect of A2AAR activation on cell proliferation at 24, 48 and 72 hours was studied. The selective A2AAR agonist 2-p-(2-carboxyethylphenethylamino-5′-N-ethylcarboxamidoadenosine hydrochloride (CGS21680, concentration-dependently induced cell proliferation in A375, A549, and MRMT1 cancer cells and the effect was potently antagonized by the A2AAR antagonist TP455, as well as by the reference A2AAR blocker 4-(2-[7-amino-2-(2-furyl[1,2,4]triazolo[2,3-a][1,3,5]triazin-5-ylamino]ethylphenol (ZM241385. As for the signaling pathway recruited in this response we demonstrated that, by using the specific inhibitors of signal transduction pathways, the effect of A2AAR stimulation was induced through phospholipase C (PLC and protein kinase C-delta (PKC-δ. In addition, we evaluated, through the AlphaScreen SureFire phospho(p protein assay, the kinases enrolled by A2AAR to stimulate cell proliferation and we found the involvement of protein kinase B (AKT, extracellular regulated kinases (ERK1/2, and c-Jun N-terminal kinases (JNKs. Indeed, we demonstrated that the CGS21680 stimulatory effect on kinases was

  11. Greater adenosine A2A receptor densities in cardiac and skeletal muscle in endurance-trained men: a [11C]TMSX PET study

    International Nuclear Information System (INIS)

    Mizuno, Masaki; Kimura, Yuichi; Tokizawa, Ken; Ishii, Kenji; Oda, Keiichi; Sasaki, Toru; Nakamura, Yoshio; Muraoka, Isao; Ishiwata, Kiichi

    2005-01-01

    We examined the densities of adenosine A 2A receptors in cardiac and skeletal muscles between untrained and endurance-trained subjects using positron emission tomography (PET) and [7-methyl- 11 C]-(E)-8-(3,4,5-trimethoxystyryl)-1,3,7-trimethylxanthine ([ 11 C]TMSX), a newly developed radioligand for mapping adenosine A 2A receptors. Five untrained and five endurance-trained subjects participated in this study. The density of adenosine A 2A receptors was evaluated as the distribution volume of [ 11 C]TMSX in cardiac and triceps brachii muscles in the resting state using PET. The distribution volume of [ 11 C]TMSX in the myocardium was significantly greater than in the triceps brachii muscle in both groups. Further, distribution volumes [ 11 C]TMSX in the trained subjects were significantly grater than those in untrained subjects (myocardium, 3.6±0.3 vs. 3.1±0.4 ml g -1 ; triceps brachii muscle, 1.7±0.3 vs. 1.2±0.2 ml g -1 , respectively). These results indicate that the densities of adenosine A 2A receptors in the cardiac and skeletal muscles are greater in the endurance-trained men than in the untrained men

  12. Activation of Adenosine Receptor A2A Increases HSC Proliferation and Inhibits Death and Senescence by Down-regulation of p53 and Rb

    Directory of Open Access Journals (Sweden)

    Md. Kaimul eAhsan

    2014-04-01

    Full Text Available Background & Aims: During fibrosis hepatic stellate cells (HSC undergo activation, proliferation and senescence but the regulation of these important processes is poorly understood. The adenosine A2A receptor (A2A is known to be present on HSC, and its activation results in liver fibrosis. In this study, we tested if A2A has a role in the regulation of HSC proliferation, apoptosis, senescence, and the relevant molecular mechanism.Methods: The ability of adenosine to regulate p53 and Rb protein levels, proliferation, apoptosis and senescence was tested in the human HSC cell line LX-2 and rat primary HSC.Results: Adenosine receptor activation down-regulates p53 and Rb protein levels, increases BrdU incorporation and increases cell survival in LX-2 cells and in primary rat HSC. These effects of NECA were reproduced by an adenosine A2A receptor specific agonist (CGS21680 and blocked by a specific antagonist (ZM241385. By day twenty-one of culture primary rat HSC entered senescence and expressed -gal which was significantly inhibited by NECA. Furthermore, NECA induced down regulation of p53 and Rb and Rac1, and decreased phosphorylation of p44-42 MAP Kinase in LX-2 cells and primary rat HSC. These effects were reproduced by the cAMP analog 8-Bromo-cAMP, and the adenylyl cyclase activator forskolin, and were blocked by PKA inhibitors.Conclusions: These results demonstrate that A2A receptor regulates a number of HSC fate decisions and induces greater HSC proliferation, reduces apoptosis and senescence by decreasing p53 and Rb through cAMP-PKA/Rac1/p38 MAPK pathway. This provides a mechanism for adenosine induced HSC regulation and liver fibrosis.

  13. Adenosine A2A receptor blockade Prevents Rotenone-Induced Motor Impairment in a Rat Model of Parkinsonism

    Directory of Open Access Journals (Sweden)

    Ahmed M Fathalla

    2016-02-01

    Full Text Available Pharmacological studies implicate the blockade of adenosine receptorsas an effective strategy for reducing Parkinson's disease (PD symptoms. The objective of this study is to elucidate the possible protective effects of ZM241385 and 8-cyclopentyl-1,3-dipropylxanthine, two selective A2Aand A1 receptor antagonists, on a rotenone rat model of PD. Rats were split into four groups: vehicle control (1 ml/kg/48 h, rotenone(1.5 mg/kg/48 h, s.c., ZM241385 (3.3 mg/kg/day, i.p and 8-cyclopentyl-1,3-dipropylxanthine (5 mg/kg/day, i.p. After that, animals were subjected to behavioral (stride length and grid walking and biochemical (measuring concentration of dopamine levels using high performance liquid chromatography. In the rotenone group, rats displayed a reduced motor activity and disturbed movement coordination in the behavioral tests and a decreased dopamine concentration as foundby high performance liquid chromatography. The effect of rotenone was partially preventedin the ZM241385 group, but not with 8-cyclopentyl-1,3-dipropylxanthine administration. The administration of ZM241385 has led toan improvement improved of motor function and movement coordination (a partial increase of stride length and partial decrease in the number of foot slips and an increase in dopamine concentration in the rotenone-injected rats. However, the 8-cyclopentyl-1,3-dipropylxanthine and rotenone groups were not significantly different. These results indicate that selective A2Areceptor blockade by ZM241385, but not A1receptor blockadeby 8-cyclopentyl-1,3-dipropylxanthine, may treat PD motor symptoms. This reinforces the potential use of A2A receptor antagonists as a treatment strategy for PD patients.. This may provide a more selective treatment strategy for PD patients.

  14. Quantification of adenosine A2A receptors in the human brain using [11C]TMSX and positron emission tomography

    International Nuclear Information System (INIS)

    Naganawa, Mika; Kimura, Yuichi; Oda, Keiichi; Ishii, Kenji; Ishiwata, Kiichi; Mishina, Masahiro; Manabe, Yoshitsugu; Chihara, Kunihiro

    2007-01-01

    [7-methyl- 11 C]-(E)-8-(3,4,5-trimethoxystyryl)-1,3,7-trimethylxanthine ([ 11 C]TMSX) is a positron-emitting adenosine A 2A receptor (A2AR) antagonist for visualisation of A2AR distribution by positron emission tomography (PET). The aims of this paper were to use a kinetic model to analyse the behaviour of [ 11 C]TMSX in the brain and to examine the applicability of the Logan plot. We also studied the applicability of a simplified Logan plot by omitting metabolite correction and arterial blood sampling. The centrum semiovale was used as a reference region on the basis of a post-mortem study showing that it has a negligibly low density of A2ARs. Compartmental analysis was performed in five normal subjects. Parametric images of A2AR binding potential (BP) were also generated using a Logan plot with or without metabolite correction and with or without arterial blood sampling. To omit arterial blood sampling, we applied a method to extract the plasma-related information using independent component analysis (EPICA). The estimated K 1 /k 2 was confirmed to be common in the centrum semiovale and main cortices. The three-compartment model was well fitted to the other regions using the fixed value of K 1 /k 2 estimated from the centrum semiovale. The estimated BPs using the Logan plot matched those derived from compartment analysis. Without the metabolite correction, the estimate of BP underestimated the true value by 5%. The estimated BPs agreed regardless of arterial blood sampling. A three-compartment model with a reference region, the centrum semiovale, describes the kinetic behaviour of [ 11 C]TMSX PET images. A2ARs in the human brain can be visualised as a BP image using [ 11 C]TMSX PET without arterial blood sampling. (orig.)

  15. Dialysis delivery of an adenosine A2A agonist into the pontine reticular formation of C57BL/6J mouse increases pontine acetylcholine release and sleep.

    Science.gov (United States)

    Coleman, Christal G; Baghdoyan, Helen A; Lydic, Ralph

    2006-03-01

    In vivo microdialysis in C57BL/6J (B6) mouse was used to test the hypothesis that activating adenosine A(2A) receptors in the pontine reticular formation (PRF) increases acetylcholine (ACh) release and rapid eye movement (REM) sleep. Eight concentrations of the adenosine A(2A) receptor agonist 2-p-(2-carboxyethyl)phenethylamino-5'-N-ethylcarboxamidoadenosine hydrochloride (CGS 21680; CGS) were delivered to the PRF and ACh in the PRF was quantified. ACh release was significantly increased by dialysis with 3 mum CGS and significantly decreased by dialysis with 10 and 100 microm CGS. Co-administration of the adenosine A(2A) receptor antagonist 4-(2-[7-amino-2-(2-furyl)[1,2,4]triazolo[2,3-a][1,3,5]triazin-5-ylamino]ethyl)phenol (ZM 241385; 30 nM) blocked the CGS-induced increase in ACh release. In a second series of experiments, CGS (3 microm) was delivered by dialysis to the PRF for 2 h while recording sleep and wakefulness. CGS significantly decreased time in wakefulness (-51% in h 1; -54% in h 2), increased time in non-rapid eye movement (NREM) sleep (90% in h 1; 151% in h 2), and increased both time in REM sleep (331% in h 2) and the number of REM sleep episodes (488% in h 2). The enhancement of REM sleep is consistent with the interpretation that adenosine A(2A) receptors in the PRF of the B6 mouse contribute to REM sleep regulation, in part, by increasing ACh release in the PRF. A(2A) receptor activation may promote NREM sleep via GABAergic inhibition of arousal promoting neurons in the PRF.

  16. Adenosine A2A receptor-dependent proliferation of pulmonary endothelial cells is mediated through calcium mobilization, PI3-kinase and ERK1/2 pathways

    International Nuclear Information System (INIS)

    Ahmad, Aftab; Schaack, Jerome B.; White, Carl W.; Ahmad, Shama

    2013-01-01

    Highlights: •A 2A receptor-induced pulmonary endothelial growth is mediated by PI3K and ERK1/2. •Cytosolic calcium mobilization is also critical for pulmonary endothelial growth. •Effectors of A 2A receptor, like tyrosine kinases and cAMP increase PI3K/Akt signaling. •Activation of A 2A receptor can contribute to vascular remodeling. -- Abstract: Hypoxia and HIF-2α-dependent A 2A receptor expression and activation increase proliferation of human lung microvascular endothelial cells (HLMVECs). This study was undertaken to investigate the signaling mechanisms that mediate the proliferative effects of A 2A receptor. A 2A receptor-mediated proliferation of HLMVECs was inhibited by intracellular calcium chelation, and by specific inhibitors of ERK1/2 and PI3-kinase (PI3K). The adenosine A 2A receptor agonist CGS21680 caused intracellular calcium mobilization in controls and, to a greater extent, in A 2A receptor-overexpressing HLMVECs. Adenoviral-mediated A 2A receptor overexpression as well as receptor activation by CGS21680 caused increased PI3K activity and Akt phosphorylation. Cells overexpressing A 2A receptor also manifested enhanced ERK1/2 phosphorylation upon CGS21680 treatment. A 2A receptor activation also caused enhanced cAMP production. Likewise, treatment with 8Br-cAMP increased PI3K activity. Hence A 2A receptor-mediated cAMP production and PI3K and Akt phosphorylation are potential mediators of the A 2A -mediated proliferative response of HLMVECs. Cytosolic calcium mobilization and ERK1/2 phosphorylation are other critical effectors of HLMVEC proliferation and growth. These studies underscore the importance of adenosine A 2A receptor in activation of survival and proliferative pathways in pulmonary endothelial cells that are mediated through PI3K/Akt and ERK1/2 pathways

  17. A1 not A2A adenosine receptors play a role in cortical epileptic afterdischarges in immature rats

    Czech Academy of Sciences Publication Activity Database

    Mareš, Pavel

    2014-01-01

    Roč. 121, č. 11 (2014), s. 1329-1336 ISSN 0300-9564 R&D Projects: GA MŠk(CZ) LH11015 Institutional support: RVO:67985823 Keywords : adenosine receptors * epileptic afterdischarges * cerebral cortex * ontogeny * rat Subject RIV: FH - Neurology Impact factor: 2.402, year: 2014

  18. A genetic variation in the adenosine A2A receptor gene (ADORA2A) contributes to individual sensitivity to caffeine effects on sleep.

    Science.gov (United States)

    Rétey, J V; Adam, M; Khatami, R; Luhmann, U F O; Jung, H H; Berger, W; Landolt, H-P

    2007-05-01

    Caffeine is the most widely used stimulant in Western countries. Some people voluntarily reduce caffeine consumption because it impairs the quality of their sleep. Studies in mice revealed that the disruption of sleep after caffeine is mediated by blockade of adenosine A2A receptors. Here we show in humans that (1) habitual caffeine consumption is associated with reduced sleep quality in self-rated caffeine-sensitive individuals, but not in caffeine-insensitive individuals; (2) the distribution of distinct c.1083T>C genotypes of the adenosine A2A receptor gene (ADORA2A) differs between caffeine-sensitive and -insensitive adults; and (3) the ADORA2A c.1083T>C genotype determines how closely the caffeine-induced changes in brain electrical activity during sleep resemble the alterations observed in patients with insomnia. These data demonstrate a role of adenosine A2A receptors for sleep in humans, and suggest that a common variation in ADORA2A contributes to subjective and objective responses to caffeine on sleep.

  19. BDNF prevents NMDA-induced toxicity in models of Huntington's disease: the effects are genotype specific and adenosine A2A receptor is involved.

    Science.gov (United States)

    Martire, Alberto; Pepponi, Rita; Domenici, Maria Rosaria; Ferrante, Antonella; Chiodi, Valentina; Popoli, Patrizia

    2013-04-01

    NMDA receptor-mediated excitotoxicity is thought to play a pivotal role in the pathogenesis of Huntington's disease (HD). The neurotrophin brain-derived neurotrophic factor (BDNF), which is also highly involved in HD and whose effects are modulated by adenosine A2 ARs, influences the activity and expression of striatal NMDA receptors. In electrophysiology experiments, we investigated the role of BDNF toward NMDA-induced effects in HD models, and the possible involvement of A2ARs. In corticostriatal slices from wild-type mice and age-matched symptomatic R6/2 mice (a model of HD), NMDA application (75 μM) induced a transient or a permanent (i.e., toxic) reduction of field potential amplitude, respectively. BDNF (10 ng/mL) potentiated NMDA effects in wild-type, while it protected from NMDA toxicity in R6/2 mice. Both effects of BDNF were prevented by A2 AR blockade. The protective effect of BDNF against NMDA-induced toxicity was reproduced in a cellular model of HD. These findings may have very important implications for the neuroprotective potential of BDNF and A2 AR ligands in HD. © 2013 International Society for Neurochemistry.

  20. A Novel Antagonist of the Immune Checkpoint Protein Adenosine A2a Receptor Restores Tumor-Infiltrating Lymphocyte Activity in the Context of the Tumor Microenvironment

    Directory of Open Access Journals (Sweden)

    Melanie Mediavilla-Varela

    2017-07-01

    Full Text Available BACKGROUND: Therapeutic strategies targeting immune checkpoint proteins have led to significant responses in patients with various tumor types. The success of these studies has led to the development of various antibodies/inhibitors for the different checkpoint proteins involved in immune evasion of the tumor. Adenosine present in high concentrations in the tumor microenvironment activates the immune checkpoint adenosine A2a receptor (A2aR, leading to the suppression of antitumor responses. Inhibition of this checkpoint has the potential to enhance antitumor T-cell responsiveness. METHODS: We developed a novel A2aR antagonist (PBF-509 and tested its antitumor response in vitro, in a mouse model, and in non-small cell lung cancer patient samples. RESULTS: Our studies showed that PBF-509 is highly specific to the A2aR as well as inhibitory of A2aR function in an in vitro model. In a mouse model, we found that lung metastasis was decreased after treatment with PBF-509 compared with its control. Furthermore, freshly resected tumor-infiltrating lymphocytes from lung cancer patients showed increased A2aR expression in CD4+ cells and variable expression in CD8+ cells. Ex vivo studies showed an increased responsiveness of human tumor-infiltrating lymphocytes when PBF-509 was combined with anti-PD-1 or anti-PD-L1. CONCLUSIONS: Our studies demonstrate that inhibition of the A2aR using the novel inhibitor PBF-509 could lead to novel immunotherapeutic strategies in non-small cell lung cancer.

  1. Discovery of indolylpiperazinylpyrimidines with dual-target profiles at adenosine A2A and dopamine D2 receptors for Parkinson's disease treatment.

    Directory of Open Access Journals (Sweden)

    Yi-Ming Shao

    Full Text Available Parkinson's disease (PD is a neurodegenerative disorder characterized by progressive loss of dopaminergic neurons in the substantia nigra of the human brain, leading to depletion of dopamine production. Dopamine replacement therapy remains the mainstay for attenuation of PD symptoms. Nonetheless, the potential benefit of current pharmacotherapies is mostly limited by adverse side effects, such as drug-induced dyskinesia, motor fluctuations and psychosis. Non-dopaminergic receptors, such as human A2A adenosine receptors, have emerged as important therapeutic targets in potentiating therapeutic effects and reducing the unwanted side effects. In this study, new chemical entities targeting both human A2A adenosine receptor and dopamine D2 receptor were designed and evaluated. Two computational methods, namely support vector machine (SVM models and Tanimoto similarity-based clustering analysis, were integrated for the identification of compounds containing indole-piperazine-pyrimidine (IPP scaffold. Subsequent synthesis and testing resulted in compounds 5 and 6, which acted as human A2A adenosine receptor binders in the radioligand competition assay (Ki = 8.7-11.2 μM as well as human dopamine D2 receptor binders in the artificial cell membrane assay (EC50 = 22.5-40.2 μM. Moreover, compound 5 showed improvement in movement and mitigation of the loss of dopaminergic neurons in Drosophila models of PD. Furthermore, in vitro toxicity studies on compounds 5 and 6 did not reveal any mutagenicity (up to 100 μM, hepatotoxicity (up to 30 μM or cardiotoxicity (up to 30 μM.

  2. 3H-[1,2,4]-Triazolo[5,1-i]purin-5-amine derivatives as adenosine A2A antagonists.

    Science.gov (United States)

    Silverman, Lisa S; Caldwell, John P; Greenlee, William J; Kiselgof, Eugenia; Matasi, Julius J; Tulshian, Deen B; Arik, Leyla; Foster, Carolyn; Bertorelli, Rosalia; Monopoli, Angela; Ongini, Ennio

    2007-03-15

    A novel series of 3-substituted-8-aryl-[1,2,4]-triazolo[5,1-i]purin-5-amine analogs related to Sch 58261 was synthesized in order to identify potent adenosine A(2A) receptor antagonists with improved selectivity over the A(1) receptor, physiochemical properties, and pharmacokinetic profiles as compared to those of Sch 58261. As a result of structural modifications, numerous analogs with excellent in vitro binding affinities and selectivities were identified. Moreover, compound 27 displayed both superior in vitro and highly promising in vivo profiles.

  3. Cardioprotection of controlled and cardiac-specific over-expression of A(2A-adenosine receptor in the pressure overload.

    Directory of Open Access Journals (Sweden)

    Eman A Hamad

    Full Text Available Adenosine binds to three G protein-coupled receptors (R located on the cardiomyocyte (A(1-R, A(2A-R and A(3-R and provides cardiac protection during both ischemic and load-induced stress. While the role of adenosine receptor-subtypes has been well defined in the setting of ischemia-reperfusion, far less is known regarding their roles in protecting the heart during other forms of cardiac stress. Because of its ability to increase cardiac contractility and heart rate, we hypothesized that enhanced signaling through A(2A-R would protect the heart during the stress of transverse aortic constriction (TAC. Using a cardiac-specific and inducible promoter, we selectively over-expressed A(2A-R in FVB mice. Echocardiograms were obtained at baseline, 2, 4, 8, 12, 14 weeks and hearts were harvested at 14 weeks, when WT mice developed a significant decrease in cardiac function, an increase in end systolic and diastolic dimensions, a higher heart weight to body weight ratio (HW/BW, and marked fibrosis when compared with sham-operated WT. More importantly, these changes were significantly attenuated by over expression of the A(2A-R. Furthermore, WT mice also demonstrated marked increases in the hypertrophic genes β-myosin heavy chain (β-MHC, and atrial natriuretic factor (ANF--changes that are mediated by activation of the transcription factor GATA-4. Levels of the mRNAs encoding β-MHC, ANP, and GATA-4 were significantly lower in myocardium from A(2A-R TG mice after TAC when compared with WT and sham-operated controls. In addition, three inflammatory factors genes encoding cysteine dioxygenase, complement component 3, and serine peptidase inhibitor, member 3N, were enhanced in WT TAC mice, but their expression was suppressed in A(2A-R TG mice. A(2A-R over-expression is protective against pressure-induced heart failure secondary to TAC. These cardioprotective effects are associated with attenuation of GATA-4 expression and inflammatory factors. The A(2A

  4. Leishmania infantum Parasites Subvert the Host Inflammatory Response through the Adenosine A2A Receptor to Promote the Establishment of Infection

    Directory of Open Access Journals (Sweden)

    Mikhael H. F. Lima

    2017-07-01

    Full Text Available Adenosine is an endogenously released purine nucleoside that signals through four widely expressed G protein-coupled receptors: A1, A2A, A2B, and A3. Of these, A2AR is recognized as mediating major adenosine anti-inflammatory activity. During cutaneous leishmaniasis, adenosine induces immunosuppression, which promotes the establishment of infection. Herein, we demonstrated that A2AR signaling is exploited by Leishmania infantum parasites, the etiologic agent that causes Visceral Leishmaniasis, to successfully colonize the vertebrate host. A2AR gene-deleted mice exhibited a well-developed cellular reaction with a strong Th1 immune response in the parasitized organs. An intense infiltration of activated neutrophils into the disease-target organs was observed in A2AR−/− mice. These cells were characterized by high expression of CXCR2 and CD69 on their cell surfaces and increased cxcl1 expression. Interestingly, this phenotype was mediated by IFN-γ on the basis that a neutralizing antibody specific to this cytokine prevented neutrophilic influx into parasitized organs. In evaluating the immunosuppressive effects, we identified a decreased number of CD4+ FOXP3+ T cells and reduced il10 expression in A2AR−/− infected mice. During ex vivo cell culture, A2AR−/− splenocytes produced smaller amounts of IL-10. In conclusion, we demonstrated that the A2AR signaling pathway is detrimental to development of Th1-type adaptive immunity and that this pathway could be associated with the regulatory process. In particular, it promotes parasite surveillance.

  5. [The regulative effcets of A2a adenosine receptor on expression of SOCS-3 in rats of hypoxic pulmonary hypertension].

    Science.gov (United States)

    Fan, R; Huang, X Y; Du, K Y; Fan, Y F; Wang, L X

    2016-06-01

    To study the regulative effects and mechanism of A2aAR on expression of suppressor of cytokinesignaling-3(SOCS-3) in hypoxic pulmonary hypertension rats. Sprague-Daeley rats were randomly divided into 3 groups: a normal control group, a hypoxia group, and a hypoxia with selective agonists of A2aAR group. Animals in the hypoxia groups were housed in a chamber with 8%- 11% O2 and 1%-3% CO2 for 8 hours (8: 00 AM to 4: 00 PM) daily for 28 days. They were treated intraperitoneally with either 4 ml/kg weight of normal saline or 0.2 mg/kg weight of CGS-21680 30 minutes before exposure to hypoxia. Four weeks later, mean pulmonary artery pressure (mPAP), mean carotid arterial pressure (mCAP) and right ventricular rate [RV/(LV+ S)] were measured. The expression of A2aAR and SOCS-3 in pulmonary arterioles was measured by immunohistochemistry. The expression of A2aAR mRNA and SOCS-3 mRNA in lung tissues were measured by real time RT-PCR. The expression of A2aAR protein and SOCS-3 protein in lung tissues were measured by Western blot. The mPAP in the hypoxia group was [(20.9±3.9)mmHg, 1 mmHg=0.133 kPa], significantly higher than the normal control group [(12.6±6.6)mmHg](Ppulmonary arterioles in the hypoxia group were (0.134±0.034) and (0.119±0.011), both significantly higher than the normal group(Prats further increased the expression levels of A2aAR and SOCS-3 to about 2-fold higher than the normal controls. Furthermore, protein levels of A2aAR and SOCS-3 in the lung tissue were determined using Western blot. A similar increase was observed in hypoxia-induced pulmonary hypertension, and CGS-21680 treatment group showed the highest levels of these 2 proteins. A2aAR activation prevents hypoxia-induced pulmonary hypertension, and its mechanisms are related to the activation of A2aAR SOCS-3 signaling pathway.

  6. Role of Adenosine A2A Receptors in Modulating Synaptic Functions and Brain Levels of BDNF: a Possible Key Mechanism in the Pathophysiology of Huntington's Disease

    Directory of Open Access Journals (Sweden)

    Maria Teresa Tebano

    2010-01-01

    Full Text Available In the last few years, accumulating evidence has shown the existence of an important cross-talk between adenosine A2A receptors (A2ARs and brain-derived neurotrophic factor (BDNF. Not only are A2ARs involved in the mechanism of transactivation of BDNF receptor TrkB, they also modulate the effect of BDNF on synaptic transmission, playing a facilitatory and permissive role. The cAMP-PKA pathway, the main transduction system operated by A2ARs, is involved in such effects. Furthermore, a basal tonus of A2ARs is required to allow the regulation of BDNF physiological levels in the brain, as demonstrated by the reduced protein levels measured in A2ARs KO mice. The crucial role of adenosine A2ARs in the maintenance of synaptic functions and BDNF levels will be reviewed here and discussed in the light of possible implications for Huntington's disease therapy, in which a joint impairment of BDNF and A2ARs seems to play a pathogenetic role.

  7. Ex vivo lung perfusion with adenosine A2A receptor agonist allows prolonged cold preservation of lungs donated after cardiac death.

    Science.gov (United States)

    Wagner, Cynthia E; Pope, Nicolas H; Charles, Eric J; Huerter, Mary E; Sharma, Ashish K; Salmon, Morgan D; Carter, Benjamin T; Stoler, Mark H; Lau, Christine L; Laubach, Victor E; Kron, Irving L

    2016-02-01

    Ex vivo lung perfusion has been successful in the assessment of marginal donor lungs, including donation after cardiac death (DCD) donor lungs. Ex vivo lung perfusion also represents a unique platform for targeted drug delivery. We sought to determine whether ischemia-reperfusion injury would be decreased after transplantation of DCD donor lungs subjected to prolonged cold preservation and treated with an adenosine A2A receptor agonist during ex vivo lung perfusion. Porcine DCD donor lungs were preserved at 4°C for 12 hours and underwent ex vivo lung perfusion for 4 hours. Left lungs were then transplanted and reperfused for 4 hours. Three groups (n = 4/group) were randomized according to treatment with the adenosine A2A receptor agonist ATL-1223 or the dimethyl sulfoxide vehicle: Infusion of dimethyl sulfoxide during ex vivo lung perfusion and reperfusion (DMSO), infusion of ATL-1223 during ex vivo lung perfusion and dimethyl sulfoxide during reperfusion (ATL-E), and infusion of ATL-1223 during ex vivo lung perfusion and reperfusion (ATL-E/R). Final Pao2/Fio2 ratios (arterial oxygen partial pressure/fraction of inspired oxygen) were determined from samples obtained from the left superior and inferior pulmonary veins. Final Pao2/Fio2 ratios in the ATL-E/R group (430.1 ± 26.4 mm Hg) were similar to final Pao2/Fio2 ratios in the ATL-E group (413.6 ± 18.8 mm Hg), but both treated groups had significantly higher final Pao2/Fio2 ratios compared with the dimethyl sulfoxide group (84.8 ± 17.7 mm Hg). Low oxygenation gradients during ex vivo lung perfusion did not preclude superior oxygenation capacity during reperfusion. After prolonged cold preservation, treatment of DCD donor lungs with an adenosine A2A receptor agonist during ex vivo lung perfusion enabled Pao2/Fio2 ratios greater than 400 mm Hg after transplantation in a preclinical porcine model. Pulmonary function during ex vivo lung perfusion was not predictive of outcomes after transplantation. Copyright

  8. A Meta-Analysis of Adenosine A2A Receptor Antagonists on Levodopa-Induced Dyskinesia In Vivo

    Directory of Open Access Journals (Sweden)

    Wen-Wen Wang

    2017-12-01

    Full Text Available BackgroundLong-term use of levodopa (l-dopa is inevitably complicated with highly disabling fluctuations and drug-induced dyskinesias, which pose major challenges to the existing drug therapy of Parkinson’s disease.MethodsIn this study, we conducted a systematic review and meta-analysis to assess the efficacy of A2A receptor antagonists on reducing l-dopa-induced dyskinesias (LID.ResultsNine studies with a total of 152 animals were included in this meta-analysis. Total abnormal involuntary movements (AIM score, locomotor activity, and motor disability were reported as outcome measures in 5, 5, and 3 studies, respectively. Combined standardized mean difference (SMD estimates were calculated using a random-effects model. We pooled the whole data and found that, when compared to l-dopa alone, A2A receptor antagonists plus l-dopa treatment showed no effect on locomotor activity (SMD −0.00, 95% confidence interval (CI: −2.52 to 2.52, p = 1.0, superiority in improvement of motor disability (SMD −5.06, 95% CI: −9.25 to −0.87, p = 0.02 and more effective in control of AIM (SMD −1.82, 95% CI: −3.38 to −0.25, p = 0.02.ConclusionTo sum up, these results demonstrated that A2A receptor antagonists appear to have efficacy in animal models of LID. However, large randomized clinical trials testing the effects of A2A receptor antagonists in LID patients are always warranted.

  9. Andrographolide protects liver cells from H2O2 induced cell death by upregulation of Nrf-2/HO-1 mediated via adenosine A2a receptor signalling.

    Science.gov (United States)

    Mittal, Smriti P K; Khole, Swati; Jagadish, Nidhi; Ghosh, Debjani; Gadgil, Vijay; Sinkar, Vilas; Ghaskadbi, Saroj S

    2016-11-01

    Andrographolide, principle constituent of Andrographis paniculata Nees is used in traditional medicine in Southeast Asia and is known to exhibit various biological activities. Its antioxidant activity is due to its ability to activate one of the antioxidant enzymes, heme oxygenase-1 (HO-1) which is regulated transcriptionally through Nrf-2. However, molecular mechanism underlying activation of Nrf-2/HO-1 has not yet been clearly understood. Protective effect of andrographolide against H2O2 induced cell death, reactive oxygen species and lipid peroxidation was observed in HepG2 cells. Ability of andrographolide to modulate G-protein coupled receptor (GPCR) mediated signalling was determined using in silico docking and gene expression was analyzed by qRT-PCR, confocal microscopy and western blot analysis. We clearly show that andrographolide via adenosine A2A receptor signalling leads to activation of p38 MAP kinase, resulting in upregulation of Nrf-2, its translocation to nucleus and activation of HO-1. Additionally, it activates adenylate cyclase resulting in cAMP formation which in turn activates protein kinase A leading to inhibition of GSK-3β by phosphorylation. Inactivated GSK-3β leads to retention of Nrf-2 in the nucleus leading to sustained expression of HO-1 by binding to its antioxidant response element (ARE). Thus, andrographolide probably by binding to adenosine A2a receptor activates Nrf-2 transcription and also inhibits its exclusion from the nucleus by inactivating GSK-3β, together resulting in activation of HO-1. We speculate that andrographolide can be used as a therapeutic drug to combat oxidative stress implicated in pathogenesis of various diseases such as diabetes, osteoporosis, neurodegenerative diseases etc. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. 2',3'-cAMP, 3'-AMP, 2'-AMP and adenosine inhibit TNF-α and CXCL10 production from activated primary murine microglia via A2A receptors.

    Science.gov (United States)

    Newell, Elizabeth A; Exo, Jennifer L; Verrier, Jonathan D; Jackson, Travis C; Gillespie, Delbert G; Janesko-Feldman, Keri; Kochanek, Patrick M; Jackson, Edwin K

    2015-01-12

    Some cells, tissues and organs release 2',3'-cAMP (a positional isomer of 3',5'-cAMP) and convert extracellular 2',3'-cAMP to 2'-AMP plus 3'-AMP and convert these AMPs to adenosine (called the extracellular 2',3'-cAMP-adenosine pathway). Recent studies show that microglia have an extracellular 2',3'-cAMP-adenosine pathway. The goal of the present study was to investigate whether the extracellular 2',3'-cAMP-adenosine pathway could have functional consequences on the production of cytokines/chemokines by activated microglia. Experiments were conducted in cultures of primary murine microglia. In the first experiment, the effect of 2',3'-cAMP, 3'-AMP, 2'-AMP and adenosine on LPS-induced TNF-α and CXCL10 production was determined. In the next experiment, the first protocol was replicated but with the addition of 1,3-dipropyl-8-p-sulfophenylxanthine (DPSPX) (0.1 μM; antagonist of adenosine receptors). The last experiment compared the ability of 2-chloro-N(6)-cyclopentyladenosine (CCPA) (10 μM; selective A1 agonist), 5'-N-ethylcarboxamide adenosine (NECA) (10 μM; agonist for all adenosine receptor subtypes) and CGS21680 (10 μM; selective A2A agonist) to inhibit LPS-induced TNF-α and CXCL10 production. (1) 2',3'-cAMP, 3'-AMP, 2'-AMP and adenosine similarly inhibited LPS-induced TNF-α and CXCL10 production; (2) DPSPX nearly eliminated the inhibitory effects of 2',3'-cAMP, 3'-AMP, 2'-AMP and adenosine on LPS-induced TNF-α and CXCL10 production; (3) CCPA did not affect LPS-induced TNF-α and CXCL10; (4) NECA and CGS21680 similarly inhibited LPS-induced TNF-α and CXCL10 production. 2',3'-cAMP and its metabolites (3'-AMP, 2'-AMP and adenosine) inhibit LPS-induced TNF-α and CXCL10 production via A2A-receptor activation. Adenosine and its precursors, via A2A receptors, likely suppress TNF-α and CXCL10 production by activated microglia in brain diseases. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. 2’,3’-cAMP, 3’-AMP, 2’-AMP and Adenosine Inhibit TNF-α and CXCL10 Production From Activated Primary Murine Microglia via A2A Receptors

    Science.gov (United States)

    Newell, Elizabeth A.; Exo, Jennifer L.; Verrier, Jonathan D.; Jackson, Travis C.; Gillespie, Delbert G.; Janesko-Feldman, Keri; Kochanek, Patrick M.

    2014-01-01

    Background Some cells, tissues and organs release 2’,3’-cAMP (a positional isomer of 3’,5’-cAMP) and convert extracellular 2’,3’-cAMP to 2’-AMP plus 3’-AMP and convert these AMPs to adenosine (called the extracellular 2’,3’-cAMP-adenosine pathway). Recent studies show that microglia have an extracellular 2’,3’-cAMP-adenosine pathway. The goal of the present study was to investigate whether the extracellular 2’,3’-cAMP-adenosine pathway could have functional consequences on the production of cytokines/chemokines by activated microglia. Methods Experiments were conducted in cultures of primary murine microglia. In the first experiment, the effect of 2’,3’-cAMP, 3’-AMP, 2’-AMP and adenosine on LPS-induced TNF-α and CXCL10 production was determined. In the next experiment, the first protocol was replicated but with the addition of 1,3-dipropyl-8-p-sulfophenylxanthine (DPSPX) (0.1 µM; antagonist of adenosine receptors). The last experiment compared the ability of 2-chloro-N6-cyclopentyladenosine (CCPA) (10 µM; selective A1 agonist), 5’-N-ethylcarboxamide adenosine (NECA) (10 µM; agonist for all adenosine receptor subtypes) and CGS21680 (10 µM; selective A2A agonist) to inhibit LPS-induced TNF-α and CXCL10 production. Results 1) 2’,3’-cAMP, 3’-AMP, 2’-AMP and adenosine similarly inhibited LPS-induced TNF-α and CXCL10 production; 2) DPSPX nearly eliminated the inhibitory effects of 2’,3’-cAMP, 3’-AMP, 2’-AMP and adenosine on LPS-induced TNF-α and CXCL10 production; 3) CCPA did not affect LPS-induced TNF-α and CXCL10; 4) NECA and CGS21680 similarly inhibited LPS-induced TNF-α and CXCL10 production. Conclusions 2’,3’-cAMP and its metabolites (3’-AMP, 2’-AMP and adenosine) inhibit LPS-induced TNF-α and CXCL10 production via A2A-receptor activation. Adenosine and its precursors, via A2A receptors, likely suppress TNF-α and CXCL10 production by activated microglia in brain diseases. PMID:25451117

  12. Novel Alexa Fluor-488 labeled antagonist of the A(2A) adenosine receptor: Application to a fluorescence polarization-based receptor binding assay.

    Science.gov (United States)

    Kecskés, Miklós; Kumar, T Santhosh; Yoo, Lena; Gao, Zhan-Guo; Jacobson, Kenneth A

    2010-08-15

    Fluorescence polarization (FP) assay has many advantages over the traditional radioreceptor binding studies. We developed an A(2A) adenosine receptor (AR) FP assay using a newly synthesized fluorescent antagonist of the A(2A)AR (MRS5346), a pyrazolo[4,3-e][1,2,4]triazolo[1,5-c]pyrimidin-5-amine derivative conjugated to the fluorescent dye Alexa Fluor-488. MRS5346 displayed a K(i) value of 111+/-16nM in radioligand binding using [(3)H]CGS21680 and membranes prepared from HEK293 cells stably expressing the human A(2A)AR. In a cyclic AMP functional assay, MRS5346 was shown to be an A(2A)AR antagonist. MRS5346 did not show any effect on A(1) and A(3) ARs in binding or the A(2B)AR in a cyclic AMP assay at 10microM. Its suitability as a fluorescent tracer was indicated in an initial observation of an FP signal following A(2A)AR binding. The FP signal was optimal with 20nM MRS5346 and 150microg protein/mL HEK293 membranes. The association and dissociation kinetic parameters were readily determined using this FP assay. The K(d) value of MRS5346 calculated from kinetic parameters was 16.5+/-4.7nM. In FP competition binding experiments using MRS5346 as a tracer, K(i) values of known AR agonists and antagonists consistently agreed with K(i) values from radioligand binding. Thus, this FP assay, which eliminates using radioisotopes, appears to be appropriate for both routine receptor binding and high-throughput screening with respect to speed of analysis, displaceable signal and precision. The approach used in the present study could be generally applicable to other GPCRs. Published by Elsevier Inc.

  13. Projections of nucleus accumbens adenosine A2A receptor neurons in the mouse brain and their implications in mediating sleep-wake regulation

    Directory of Open Access Journals (Sweden)

    Jianping eZhang

    2013-12-01

    Full Text Available Adenosine A2A receptors (A2ARs in the nucleus accumbens (Acb have been demonstrated to play an important role in the arousal effect of adenosine receptor antagonist caffeine, and may be involved in physiological sleep. To better understand the functions of these receptors in sleep, projections of A2AR neurons were mapped utilizing adeno-associated virus (AAV encoding humanized Renilla green fluorescent protein (hrGFP as a tracer for long axonal pathways. The Cre-dependent AAV was injected into the core (AcbC and shell (AcbSh of the Acb in A2AR-Cre mice. Immunohistochemistry was then used to visualize hrGFP, highlighting the perikarya of the A2AR neurons in the injection sites, and their axons in projection regions. The data revealed that A2AR neurons exhibit medium-sized and either round or elliptic perikarya with their processes within the Acb. Moreover, the projections from the Acb distributed to nuclei in the forebrain, diencephalon, and brainstem. In the forebrain, A2AR neurons from all Acb sub-regions jointly projected to the ventral pallidum, the nucleus of the diagonal band, and the substantia innominata. Heavy projections from the AcbC and the ventral AcbSh, and weaker projections from the medial AcbSh, were observed in the lateral hypothalamus and lateral preoptic area. In the brainstem, the Acb projections were found in the ventral tegmental area, while AcbC and ventral AcbSh also projected to the median raphe nucleus, the dorsal raphe nucleus, and the ventrolateral periaqueductal gray. The results supply a solid base for understanding the roles of the A2AR and A2AR neurons in the Acb, especially in the regulation of sleep.

  14. Adenosine A2A receptor blockade prevents synaptotoxicity and memory dysfunction caused by beta-amyloid peptides via p38 mitogen-activated protein kinase pathway.

    Science.gov (United States)

    Canas, Paula M; Porciúncula, Lisiane O; Cunha, Geanne M A; Silva, Carla G; Machado, Nuno J; Oliveira, Jorge M A; Oliveira, Catarina R; Cunha, Rodrigo A

    2009-11-25

    Alzheimer's disease (AD) is characterized by memory impairment, neurochemically by accumulation of beta-amyloid peptide (namely Abeta(1-42)) and morphologically by an initial loss of nerve terminals. Caffeine consumption prevents memory dysfunction in different models, which is mimicked by antagonists of adenosine A(2A) receptors (A(2A)Rs), which are located in synapses. Thus, we now tested whether A(2A)R blockade prevents the early Abeta(1-42)-induced synaptotoxicity and memory dysfunction and what are the underlying signaling pathways. The intracerebral administration of soluble Abeta(1-42) (2 nmol) in rats or mice caused, 2 weeks later, memory impairment (decreased performance in the Y-maze and object recognition tests) and a loss of nerve terminal markers (synaptophysin, SNAP-25) without overt neuronal loss, astrogliosis, or microgliosis. These were prevented by pharmacological blockade [5-amino-7-(2-phenylethyl)-2-(2-furyl)-pyrazolo[4,3-e]-1,2,4-triazolo[1,5-c]pyrimidine (SCH58261); 0.05 mg . kg(-1) . d(-1), i.p.; for 15 d] in rats, and genetic inactivation of A(2A)Rs in mice. Moreover, these were synaptic events since purified nerve terminals acutely exposed to Abeta(1-42) (500 nm) displayed mitochondrial dysfunction, which was prevented by A(2A)R blockade. SCH58261 (50 nm) also prevented the initial synaptotoxicity (loss of MAP-2, synaptophysin, and SNAP-25 immunoreactivity) and subsequent loss of viability of cultured hippocampal neurons exposed to Abeta(1-42) (500 nm). This A(2A)R-mediated control of neurotoxicity involved the control of Abeta(1-42)-induced p38 phosphorylation and was independent from cAMP/PKA (protein kinase A) pathway. Together, these results show that A(2A)Rs play a crucial role in the development of Abeta-induced synaptotoxicity leading to memory dysfunction through a p38 MAPK (mitogen-activated protein kinase)-dependent pathway and provide a molecular basis for the benefits of caffeine consumption in AD.

  15. Imidazo[2,1-i]purin-5-ones and related tricyclic water-soluble purine derivatives: potent A(2A)- and A(3)-adenosine receptor antagonists.

    Science.gov (United States)

    Müller, Christa E; Thorand, Mark; Qurishi, Ramatullah; Diekmann, Martina; Jacobson, Kenneth A; Padgett, William L; Daly, John W

    2002-08-01

    A series of tricyclic imidazo[2,1-i]purinones and ring-enlarged analogues derived from xanthine derivatives have been prepared as adenosine receptor (AR) antagonists. In comparison with xanthines, the tricyclic compounds exhibit increased water solubility due to a basic nitrogen atom, which can be protonated under physiological conditions. Substituents were introduced that confer high affinity for A(2A) or A(3) ARs, respectively. A new capillary electrophoresis method was developed for the determination of the enantiomeric purity of selected chiral products using native and modified beta-cyclodextrins as chiral discriminators. The compounds were investigated in radioligand binding assays at rat brain A(1) and A(2A) ARs. Selected compounds were additionally investigated in radioligand binding assays at human recombinant A(3) ARs and in functional studies (adenylate cyclase assays) at A(1) ARs of rat fat cell membranes, A(2A) ARs of rat PC 12 cell membranes, and mouse A(2B) ARs of NIH 3T3 cell membranes. Structure-activity relationships were similar to those of corresponding xanthine derivatives. The 2-styrylimidazopurinones were less potent at A(2A) ARs as compared to 8-styrylxanthine derivatives. The most potent compound at A(2A) ARs was (S)-1,4-dimethyl-8-ethyl-2-styryl-imidazo[2,1-i]purinone (S-25) exhibiting a K(i) value of 424 nM at rat A(2A) ARs. The compound was highly selective for A(2A) receptors vs A(1) and A(3) ARs. Selectivity vs A(2B) ARs, however, was low. Among the 1-unsubstituted 2-phenyl-imidazo[2,1-i]purin-5-one derivatives, very potent and highly selective antagonists for human A(3) ARs were identified. The most potent A(3) antagonist of the present series was (R)-4-methyl-8-ethyl-2-phenyl-imidazo[2,1-i]purin-5-one (R-24) exhibiting a K(i) value of 2.3 nM and high selectivity for A(3) receptors vs all other AR subtypes.

  16. The effect of caffeine to increase reaction time in the rat during a test of attention is mediated through antagonism of adenosine A2A receptors.

    Science.gov (United States)

    Higgins, Guy A; Grzelak, Michael E; Pond, Annamarie J; Cohen-Williams, Mary E; Hodgson, Robert A; Varty, Geoffrey B

    2007-12-11

    Caffeine produces effects on cognitive function particularly relating to aspects of attention such as reaction time. Considering the plasma exposure levels following regular caffeine intake, and the affinity of caffeine for known protein targets, these effects are likely mediated by either the adenosine A(1) or A(2A) receptor. In the present studies, two rat strains [Long-Evans (LE) and CD] were trained to asymptote performance in a test of selective attention, the 5-choice serial reaction time task (5-CSRTT). Next, the effects of caffeine were compared to the selective A(2A) antagonists, SCH 412348 and KW-6002 (Istradefylline), and the A(1) antagonist, DPCPX. Further studies compared the psychostimulant effects of each drug. Finally, we tested the A(2A) agonist, CGS-21680, on 5-CSRTT performance and given the antipsychotic potential of this drug class, studied the interaction between CGS-21680 and amphetamine in this task. Caffeine (3-10mg/kg IP) increased reaction time in both LE and CD rats, with no effect on accuracy, an effect replicated by SCH 412348 (0.1-1mg/kg PO) and KW-6002 (1-3mg/kg PO), but not DPCPX (3-30 mg/kg PO). At least with SCH 412348, these effects were at doses that were not overtly psychostimulant. In contrast, CGS-21680 (0.03-0. 3mg/kg IP) slowed reaction speed and increased omissions. Interestingly, at a comparatively low dose of 0.03 mg/kg, CGS-21680 attenuated the increased premature responding produced by amphetamine (1mg/kg IP). The present results suggest that the attention-enhancing effects of caffeine are mediated through A(2A) receptor blockade, and selective A(2A) receptor antagonists may have potential as therapies for attention-related disorders. Furthermore, the improvement in response control in amphetamine-treated rats following CGS-21680 pretreatment supports the view that A(2A) agonists have potential as novel antipsychotics.

  17. Chronic methamphetamine treatment induces oxytocin receptor up-regulation in the amygdala and hypothalamus via an adenosine A2A receptor-independent mechanism.

    Science.gov (United States)

    Zanos, Panos; Wright, Sherie R; Georgiou, Polymnia; Yoo, Ji Hoon; Ledent, Catherine; Hourani, Susanna M; Kitchen, Ian; Winsky-Sommerer, Raphaelle; Bailey, Alexis

    2014-04-01

    There is mounting evidence that the neuropeptide oxytocin is a possible candidate for the treatment of drug addiction. Oxytocin was shown to reduce methamphetamine self-administration, conditioned place-preference, hyperactivity and reinstatement in rodents, highlighting its potential for the management of methamphetamine addiction. Thus, we hypothesised that the central endogenous oxytocinergic system is dysregulated following chronic methamphetamine administration. We tested this hypothesis by examining the effect of chronic methamphetamine administration on oxytocin receptor density in mice brains with the use of quantitative receptor autoradiographic binding. Saline (4ml/kg/day, i.p.) or methamphetamine (1mg/kg/day, i.p.) was administered daily for 10 days to male, CD1 mice. Quantitative autoradiographic mapping of oxytocin receptors was carried out with the use of [(125)I]-vasotocin in brain sections of these animals. Chronic methamphetamine administration induced a region specific upregulation of oxytocin receptor density in the amygdala and hypothalamus, but not in the nucleus accumbens and caudate putamen. As there is evidence suggesting an involvement of central adenosine A2A receptors on central endogenous oxytocinergic function, we investigated whether these methamphetamine-induced oxytocinergic neuroadaptations are mediated via an A2A receptor-dependent mechanism. To test this hypothesis, autoradiographic oxytocin receptor binding was carried out in brain sections of male CD1 mice lacking A2A receptors which were chronically treated with methamphetamine (1mg/kg/day, i.p. for 10 days) or saline. Similar to wild-type animals, chronic methamphetamine administration induced a region-specific upregulation of oxytocin receptor binding in the amygdala and hypothalamus of A2A receptor knockout mice and no genotype effect was observed. These results indicate that chronic methamphetamine use can induce profound neuroadaptations of the oxytocinergic receptor

  18. 2-n-Butyl-9-methyl-8-[1,2,3]triazol-2-yl-9H-purin-6-ylamine and analogues as A2A adenosine receptor antagonists. Design, synthesis, and pharmacological characterization.

    Science.gov (United States)

    Minetti, Patrizia; Tinti, Maria Ornella; Carminati, Paolo; Castorina, Massimo; Di Cesare, Maria Assunta; Di Serio, Stefano; Gallo, Grazia; Ghirardi, Orlando; Giorgi, Fabrizio; Giorgi, Luca; Piersanti, Giovanni; Bartoccini, Francesca; Tarzia, Giorgio

    2005-11-03

    Two types of adenosine receptor ligands were designed, i.e., 9H-purine and 1H-imidazo[4,5-c]pyridines, to obtain selective A(2A) antagonists, and we report here their synthesis and binding affinities for the four adenosine receptor subtypes A(1), A(2A), A(2B) and A(3). The design was carried out on the basis of the molecular modeling of a number of potent adenosine receptor antagonists described in the literature. Three compounds (25b-d) showed an interesting affinity and selectivity for the A(2A) subtype. One of them, i.e., ST1535 (2-n-butyl-9-methyl-8-[1,2,3]triazol-2-yl-9H-purin-6-ylamine, 25b) (K(i) A(2A) = 6.6 nM, K(i) A(1)/A(2A) = 12; K(i) A(2B)/A(2A) = 58; K(i) A(3)/A(2A) > 160), was selected for in vivo study and shown to induce a dose-related increase in locomotor activity, suggestive of an A(2A) antagonist type of activity.

  19. Major dorsoventral differences in the modulation of the local CA1 hippocampal network by NMDA, mGlu5, adenosine A2A and cannabinoid CB1 receptors.

    Science.gov (United States)

    Kouvaros, S; Papatheodoropoulos, C

    2016-03-11

    Recent research points to diversification in the local neuronal circuitry between dorsal (DH) and ventral (VH) hippocampus that may be involved in the large-scale functional segregation along the long axis of the hippocampus. Here, using CA1 field recordings from rat hippocampal slices, we show that activation of N-methyl-d-aspartate receptors (NMDARs) reduced excitatory transmission more in VH than in DH, with an adenosine A1 receptor-independent mechanism, and reduced inhibition and enhanced postsynaptic excitability only in DH. Strikingly, co-activation of metabotropic glutamate receptor-5 (mGluR5) with NMDAR, by CHPG and NMDA respectively, strongly potentiated the effects of NMDAR in DH but had not any potentiating effect in VH. Furthermore, the synergistic actions in DH were occluded by blockade of adenosine A2A receptors (A2ARs) by their antagonist ZM 241385 demonstrating a tonic action of these receptors in DH. Exogenous activation of A2ARs by 4-[2-[[6-amino-9-(N-ethyl-β-D-ribofuranuronamidosyl)-9H-purin-2-yl]amino]ethyl]benzenepropanoic acid hydrochloride (CGS 21680) did not change the effects of mGluR5-NMDAR co-activation in either hippocampal pole. Importantly, blockade of cannabinoid CB1 receptors (CB1Rs) by their antagonist 1-(2,4-dichlorophenyl)-5-(4-iodophenyl)-4-methyl-N-4-morpholinyl-1H-pyrazole-3-carboxamide (AM 281) restricted the synergistic actions of mGluR5-NMDARs on excitatory synaptic transmission and postsynaptic excitability and abolished their effect on inhibition. Furthermore, AM 281 increased the excitatory transmission only in DH indicating that CB1Rs were tonically active in DH but not VH. Removing the magnesium ions from the perfusion medium neither stimulated the interaction between mGluR5 and NMDAR in VH nor augmented the synergy of the two receptors in DH. These findings show that the NMDAR-dependent modulation of fundamental parameters of the local neuronal network, by mGluR5, A2AR and CB1R, markedly differs between DH and VH. We

  20. Adenosine–cannabinoid receptor interactions. Implications for striatal function

    Science.gov (United States)

    Ferré, Sergi; Lluís, Carme; Justinova, Zuzana; Quiroz, César; Orru, Marco; Navarro, Gemma; Canela, Enric I; Franco, Rafael; Goldberg, Steven R

    2010-01-01

    Adenosine and endocannabinoids are very ubiquitous non-classical neurotransmitters that exert a modulatory role on the transmission of other more ‘classical’ neurotransmitters. In this review we will focus on their common role as modulators of dopamine and glutamate neurotransmission in the striatum, the main input structure of the basal ganglia. We will pay particular attention to the role of adenosine A2A receptors and cannabinoid CB1 receptors. Experimental results suggest that presynaptic CB1 receptors interacting with A2A receptors in cortico-striatal glutamatergic terminals that make synaptic contact with dynorphinergic medium-sized spiny neurons (MSNs) are involved in the motor-depressant and addictive effects of cannabinoids. On the other hand, postsynaptic CB1 receptors interacting with A2A and D2 receptors in the dendritic spines of enkephalinergic MSNs and postsynaptic CB1 receptors in the dendritic spines of dynorphinergic MSN are probably involved in the cataleptogenic effects of cannabinoids. These receptor interactions most probably depend on the existence of a variety of heteromers of A2A, CB1 and D2 receptors in different elements of striatal spine modules. Drugs selective for the different striatal A2A and CB1 receptor heteromers could be used for the treatment of neuropsychiatric disorders and drug addiction and they could provide effective drugs with fewer side effects than currently used drugs. This article is part of a themed issue on Cannabinoids. To view the editorial for this themed issue visit http://dx.doi.org/10.1111/j.1476-5381.2010.00831.x PMID:20590556

  1. Excitatory effect of the A2A adenosine receptor agonist CGS-21680 on spontaneous and K+-evoked acetylcholine release at the mouse neuromuscular junction.

    Science.gov (United States)

    Palma, A G; Muchnik, S; Losavio, A S

    2011-01-13

    The mechanism of action of the A2A adenosine receptor agonist 2-p-(2-carboxyethyl) phenethylamino-5'-N-ethylcarboxamidoadenosine hydrochloride (CGS-21680) in the facilitation of spontaneous (isotonic and hypertonic condition) and K+-evoked acetylcholine (ACh) release was investigated in the mouse diaphragm muscles. At isotonic condition, the CGS-21680-induced excitatory effect on miniature end-plate potential (MEPP) frequency was not modified in the presence of CdCl2 and in a medium free of Ca2+ (0Ca2+-EGTA), but it was abolished after buffering the rise of intracellular Ca2+ with 1,2-bis-(2-aminophenoxy)-ethane-N,N,N',N'-tetraacetic acid tetra(acetoxy-methyl) (BAPTA-AM) and when the Ca2+-ATPase inhibitor thapsigargin was used to deplete intracellular Ca2+ stores. CGS-21680 did not have a direct effect on the Ca2+-independent neurotransmitter-releasing machinery, since the modulatory effect on the hypertonic response was also occluded by BAPTA-AM and thapsigargin. CGS-21680 facilitation on K+-evoked ACh release was not altered by the P/Q-type voltage-dependent calcium channel (VDCC) blocker ω-Agatoxin IVA, but it was completely prevented by both, the L-type VDCC blocker nitrendipine (which is known to immobilize their gating charges), or thapsigargin, suggesting that the effects of CGS-21680 on L-type VDCC and thapsigargin-sensitive internal stores are associated. We found that the VDCC pore blocker Cd2+ (2 mM Ca2+ or 0Ca2+-EGTA) failed to affect the CGS-21680 effect in high K+ whereas nitrendipine in 0Ca2+-EGTA+Cd2+ occluded its action. The blockade of Ca2+ release from endoplasmic reticulum with ryanodine antagonized the facilitating effect of CGS-21680 in control and high K+ concentration. It is concluded that, at the mouse neuromuscular junction, activation of A2A receptors facilitates spontaneous and K+-evoked ACh release by an external Ca2+-independent mechanism but that involves mobilization of Ca2+ from internal stores: during spontaneous ACh release

  2. NF-κB is activated in CD4+ iNKT cells by sickle cell disease and mediates rapid induction of adenosine A2A receptors.

    Directory of Open Access Journals (Sweden)

    Gene Lin

    Full Text Available Reperfusion injury following tissue ischemia occurs as a consequence of vaso-occlusion that is initiated by activation of invariant natural killer T (iNKT cells. Sickle cell disease (SDC results in widely disseminated microvascular ischemia and reperfusion injury as a result of vaso-occlusion by rigid and adhesive sickle red blood cells. In mice, iNKT cell activation requires NF-κB signaling and can be inhibited by the activation of anti-inflammatory adenosine A2A receptors (A2ARs. Human iNKT cells are divided into subsets of CD4+ and CD4- cells. In this study we found that human CD4+ iNKT cells, but not CD4- cells undergo rapid NF-κB activation (phosphorylation of NF-κB on p65 and induction of A2ARs (detected with a monoclonal antibody 7F6-G5-A2 during SCD painful vaso-occlusive crises. These findings indicate that SCD primarily activates the CD4+ subset of iNKT cells. Activation of NF-κB and induction of A2ARs is concordant, i.e. only CD4+ iNKT cells with activated NF-κB expressed high levels of A2ARs. iNKT cells that are not activated during pVOC express low levels of A2AR immunoreactivity. These finding suggest that A2AR transcription may be induced in CD4+ iNKT cells as a result of NF-κB activation in SCD. In order to test this hypothesis further we examined cultured human iNKT cells. In cultured cells, blockade of NF-κB with Bay 11-7082 or IKK inhibitor VII prevented rapid induction of A2AR mRNA and protein upon iNKT activation. In conclusion, NF-κB-mediated induction of A2ARs in iNKT cells may serve as a counter-regulatory mechanism to limit the extent and duration of inflammatory immune responses. As activated iNKT cells express high levels of A2ARs following their activation, they may become highly sensitive to inhibition by A2AR agonists.

  3. Blockade of adenosine A2A receptors prevents interleukin-1β-induced exacerbation of neuronal toxicity through a p38 mitogen-activated protein kinase pathway

    Directory of Open Access Journals (Sweden)

    Simões Ana

    2012-08-01

    Full Text Available Abstract Background and purpose Blockade of adenosine A2A receptors (A2AR affords robust neuroprotection in a number of brain conditions, although the mechanisms are still unknown. A likely candidate mechanism for this neuroprotection is the control of neuroinflammation, which contributes to the amplification of neurodegeneration, mainly through the abnormal release of pro-inflammatory cytokines such as interleukin(IL-1β. We investigated whether A2AR controls the signaling of IL-1β and its deleterious effects in cultured hippocampal neurons. Methods Hippocampal neuronal cultures were treated with IL-1β and/or glutamate in the presence or absence of the selective A2AR antagonist, SCH58261 (50 nmol/l. The effect of SCH58261 on the IL-1β-induced phosphorylation of the mitogen-activated protein kinases (MAPKs c-Jun N-terminal kinase (JNK and p38 was evaluated by western blotting and immunocytochemistry. The effect of SCH58261 on glutamate-induced neurodegeneration in the presence or absence of IL-1β was evaluated by nucleic acid and by propidium iodide staining, and by lactate dehydrogenase assay. Finally, the effect of A2AR blockade on glutamate-induced intracellular calcium, in the presence or absence of IL-1β, was studied using single-cell calcium imaging. Results IL-1β (10 to 100 ng/ml enhanced both JNK and p38 phosphorylation, and these effects were prevented by the IL-1 type 1 receptor antagonist IL-1Ra (5 μg/ml, in accordance with the neuronal localization of IL-1 type 1 receptors, including pre-synaptically and post-synaptically. At 100 ng/ml, IL-1β failed to affect neuronal viability but exacerbated the neurotoxicity induced by treatment with 100 μmol/l glutamate for 25 minutes (evaluated after 24 hours. It is likely that this resulted from the ability of IL-1β to enhance glutamate-induced calcium entry and late calcium deregulation, both of which were unaffected by IL-1β alone. The selective A2AR antagonist, SCH58261 (50 nmol

  4. Detection of Heteromers Formed by Cannabinoid CB1, Dopamine D2, and Adenosine A2A G-Protein-Coupled Receptors by Combining Bimolecular Fluorescence Complementation and Bioluminescence Energy Transfer

    Directory of Open Access Journals (Sweden)

    Gemma Navarro

    2008-01-01

    Full Text Available Functional interactions in signaling occur between dopamine D2 (D2R and cannabinoid CB1 (CB1R receptors, between CB1R and adenosine A2A (A2AR receptors, and between D2R and A2AR. Furthermore, direct molecular interactions have been reported for the pairs CB1R-D2R, A2AR-D2R, and CB1R-A2AR. Here a combination of bimolecular fluorescence complementation and bioluminescence energy transfer techniques was used to identify the occurrence of D2R-CB1R-A2AR hetero-oligomers in living cells.

  5. Pharmacological Blockade of Adenosine A2A but Not A1 Receptors Enhances Goal-Directed Valuation in Satiety-Based Instrumental Behavior

    Directory of Open Access Journals (Sweden)

    Yan Li

    2018-04-01

    Full Text Available The balance and smooth shift between flexible, goal-directed behaviors and repetitive, habitual actions are critical to optimal performance of behavioral tasks. The striatum plays an essential role in control of goal-directed versus habitual behaviors through a rich interplay of the numerous neurotransmitters and neuromodulators to modify the input, processing and output functions of the striatum. The adenosine receptors (namely A2AR and A1R, with their high expression pattern in the striatum and abilities to interact and integrate dopamine, glutamate and cannabinoid signals in the striatum, may represent novel therapeutic targets for modulating instrumental behavior. In this study, we examined the effects of pharmacological blockade of the A2ARs and A1Rs on goal-directed versus habitual behaviors in different information processing phases of instrumental learning using a satiety-based instrumental behavior procedure. We found that A2AR antagonist acts at the coding, consolidation and expression phases of instrumental learning to modulate animals’ sensitivity to goal-directed valuation without modifying action-outcome contingency. However, pharmacological blockade and genetic knockout of A1Rs did not affect acquisition or sensitivity to goal-valuation of instrumental behavior. These findings provide pharmacological evidence for a potential therapeutic strategy to control abnormal instrumental behaviors associated with drug addiction and obsessive-compulsive disorder by targeting the A2AR.

  6. Baicalin attenuates chronic hypoxia-induced pulmonary hypertension via adenosine A2A receptor-induced SDF-1/CXCR4/PI3K/AKT signaling.

    Science.gov (United States)

    Huang, Xiaoying; Wu, Peiliang; Huang, Feifei; Xu, Min; Chen, Mayun; Huang, Kate; Li, Guo-Ping; Xu, Manhuan; Yao, Dan; Wang, Liangxing

    2017-08-03

    Baicalin, an important flavonoid in Scutellaria baicalensis Georgi extracts, exerts a variety of pharmacological effects. In this study, we explored the effects of baicalin on chronic hypoxia-induced pulmonary arterial hypertension (PAH) and investigated the mechanism underlying these effects. Moreover, we examined whether the inflammatory response was mediated by the A 2A receptor (A 2A R) and stromal cell-derived factor-1 (SDF-1)/C-X-C chemokine receptor type 4 (CXCR4)-induced phosphatidyl inositol-3-kinase (PI3K) signaling in vivo. We established a hypoxia-induced pulmonary hypertension (HPH) mouse model by subjecting wild-type (WT) and A 2A R knockout (A 2A R -/- ) animals to chronic hypoxia, and we examined the effects of a 4-week treatment with baicalin or the A 2A R agonist CGS21680 in these animals. Invasive hemodynamic parameters, the right ventricular hypertrophy index, pulmonary congestion, the pulmonary arterial remodeling index, blood gas parameters, A 2A R expression, and the expression of SDF-1/CXCR4/PI3K/protein kinase B (PKB; AKT) signaling components were measured. Compared with WT mice, A 2A R -/- mice exhibited increased right ventricular systolic pressure (RVSP), right ventricle-to-left ventricle plus septum [RV/(LV + S)] ratio, RV weight-to-body weight (RV/BW) ratio, and lung wet weight-to-body weight (Lung/BW) ratio in the absence of an altered mean carotid arterial pressure (mCAP). These changes were accompanied by increases in pulmonary artery wall area and thickness and reductions in arterial oxygen pressure (P a O 2 ) and hydrogen ion concentration (pH). In the HPH model, A 2A R -/- mice displayed increased CXCR4, SDF-1, phospho-PI3K, and phospho-AKT expression compared with WT mice. Treating WT and A 2A R -/- HPH mice with baicalin or CGS21680 attenuated the hypoxia-induced increases in RVSP, RV/(LV + S) and Lung/BW, as well as pulmonary arterial remodeling. Additionally, baicalin or CGS21680 alone could reverse the hypoxia

  7. Effects of caffeine on striatal neurotransmission: focus on cannabinoid CB1 receptors.

    Science.gov (United States)

    Rossi, Silvia; De Chiara, Valentina; Musella, Alessandra; Mataluni, Giorgia; Sacchetti, Lucia; Siracusano, Alberto; Bernardi, Giorgio; Usiello, Alessandro; Centonze, Diego

    2010-04-01

    Caffeine is the most commonly self-administered psychoactive substance worldwide. At usual doses, the effects of caffeine on vigilance, attention, mood and arousal largely depend on the modulation of central adenosine receptors. The present review article describes the action of caffeine within the striatum, to provide a possible molecular mechanism at the basis of the psychomotor and reinforcing properties of this pharmacological agent. The striatum is in fact a subcortical area involved in sensorimotor, cognitive, and emotional processes, and recent experimental findings showed that chronic caffeine consumption enhances the sensitivity of striatal GABAergic synapses to the stimulation of cannabinoid CB1 receptors. The endocannabinoid system is involved in the psychoactive effects of many compounds, and adenosine A2A receptors (the main receptor target of caffeine) elicit a permissive effect towards CB1 receptors, thus suggesting that A2A-CB1 receptor interaction plays a major role in the generation and maintenance of caffeine reinforcing behavior. Aim of this review is to describe the effects of caffeine on striatal neurotransmission with special reference to the modulation of the endocannabinoid system.

  8. Pulsed Electromagnetic Fields Increased the Anti-Inflammatory Effect of A2A and A3 Adenosine Receptors in Human T/C-28a2 Chondrocytes and hFOB 1.19 Osteoblasts

    Science.gov (United States)

    Vincenzi, Fabrizio; Targa, Martina; Corciulo, Carmen; Gessi, Stefania; Merighi, Stefania; Setti, Stefania; Cadossi, Ruggero; Goldring, Mary B.; Borea, Pier Andrea; Varani, Katia

    2013-01-01

    Adenosine receptors (ARs) have an important role in the regulation of inflammation and their activation is involved in the inhibition of pro-inflammatory cytokine release. The effects of pulsed electromagnetic fields (PEMFs) on inflammation have been reported and we have demonstrated that PEMFs increased A2A and A3AR density and functionality in different cell lines. Chondrocytes and osteoblasts are two key cell types in the skeletal system that play important role in cartilage and bone metabolism representing an interesting target to study the effect of PEMFs. The primary aim of the present study was to evaluate if PEMF exposure potentiated the anti-inflammatory effect of A2A and/or A3ARs in T/C-28a2 chondrocytes and hFOB 1.19 osteoblasts. Immunofluorescence, mRNA analysis and saturation binding assays revealed that PEMF exposure up-regulated A2A and A3AR expression. A2A and A3ARs were able to modulate cAMP production and cell proliferation. The activation of A2A and A3ARs resulted in the decrease of some of the most relevant pro-inflammatory cytokine release such as interleukin (IL)-6 and IL-8, following the treatment with IL-1β as an inflammatory stimuli. In human chondrocyte and osteoblast cell lines, the inhibitory effect of A2A and A3AR stimulation on the release of prostaglandin E2 (PGE2), an important lipid inflammatory mediator, was observed. In addition, in T/C-28a2 cells, the activation of A2A or A3ARs elicited an inhibition of vascular endothelial growth factor (VEGF) secretion. In hFOB 1.19 osteoblasts, PEMF exposure determined an increase of osteoprotegerin (OPG) production. The effect of the A2A or A3AR agonists in the examined cells was enhanced in the presence of PEMFs and completely blocked by using well-known selective antagonists. These results demonstrated that PEMF exposure significantly increase the anti-inflammatory effect of A2A or A3ARs suggesting their potential therapeutic use in the therapy of inflammatory bone and joint disorders

  9. Pharmacological characterisation and inhibitory effects of (2R,3R,4S,5R)-2-(6-amino-2-{[(1S)-2-hydroxy-1-(phenylmethyl)ethyl]amino}-9H-purin-9-yl)-5-(2-ethyl-2H-tetrazol-5-yl)tetrahydro-3,4-furandiol, a novel ligand that demonstrates both adenosine A(2A) receptor agonist and adenosine A(3) receptor antagonist activity.

    Science.gov (United States)

    Bevan, Nicola; Butchers, Peter R; Cousins, Rick; Coates, Jill; Edgar, Emma V; Morrison, Val; Sheehan, Michael J; Reeves, Julian; Wilson, David J

    2007-06-14

    The pharmacological properties of the novel ligand, (2R,3R,4S,5R)-2-(6-amino-2-{[(1S)-2-hydroxy-1-(phenylmethyl)ethyl]amino}-9H-purin-9-yl)-5-(2-ethyl-2H-tetrazol-5-yl)tetrahydro-3,4-furandiol (I), at the human adenosine receptors were investigated using Chinese hamster ovary cell lines recombinantly expressing these receptors. Functional studies were performed using a cyclic AMP-coupled reporter gene system. Binding studies were performed using membranes from these cells. The effects of ligand (I) were also determined on functional responses of human neutrophils and eosinophils. Ligand (I) had a high affinity for the adenosine A(2A) receptor (pKi 7.8+/-0.2) and was a potent agonist at this receptor (pEC(50) 9.0+/-0.2). Ligand (I) had a similar affinity for the adenosine A(3) receptor (pKi 7.8+/-0.1) but displayed no agonist activity, acting instead as a competitive antagonist (pA(2) 8.3+/-0.04). Ligand (I) had lower affinity for adenosine A(1) and A(2B) receptors (pKiadenosine A(2A) receptor antagonist 9-chloro-2-(2-furanyl)-[1,2,4]triazolo[1,5-c]quinazolin-5-amine (CGS15943) with a pA(2) value (10.03+/-0.44) consistent with an effect on adenosine A(2A) receptors. Ligand (I) also inhibited the release of granule proteins from neutrophils and eosinophils (pEC(50) 8.7 and 8.9 respectively), albeit less potently than as an inhibitor of reactive oxygen species generation. In summary, ligand (I) is a potent and selective agonist for the adenosine A(2A) receptor and a competitive antagonist at the adenosine A(3) receptor. Ligand (I) has potent anti-inflammatory effects on human

  10. Caffeine and adenosine.

    Science.gov (United States)

    Ribeiro, Joaquim A; Sebastião, Ana M

    2010-01-01

    Caffeine causes most of its biological effects via antagonizing all types of adenosine receptors (ARs): A1, A2A, A3, and A2B and, as does adenosine, exerts effects on neurons and glial cells of all brain areas. In consequence, caffeine, when acting as an AR antagonist, is doing the opposite of activation of adenosine receptors due to removal of endogenous adenosinergic tonus. Besides AR antagonism, xanthines, including caffeine, have other biological actions: they inhibit phosphodiesterases (PDEs) (e.g., PDE1, PDE4, PDE5), promote calcium release from intracellular stores, and interfere with GABA-A receptors. Caffeine, through antagonism of ARs, affects brain functions such as sleep, cognition, learning, and memory, and modifies brain dysfunctions and diseases: Alzheimer's disease, Parkinson's disease, Huntington's disease, Epilepsy, Pain/Migraine, Depression, Schizophrenia. In conclusion, targeting approaches that involve ARs will enhance the possibilities to correct brain dysfunctions, via the universally consumed substance that is caffeine.

  11. Adenosine receptor neurobiology: overview.

    Science.gov (United States)

    Chen, Jiang-Fan; Lee, Chien-fei; Chern, Yijuang

    2014-01-01

    Adenosine is a naturally occurring nucleoside that is distributed ubiquitously throughout the body as a metabolic intermediary. In the brain, adenosine functions as an important upstream neuromodulator of a broad spectrum of neurotransmitters, receptors, and signaling pathways. By acting through four G-protein-coupled receptors, adenosine contributes critically to homeostasis and neuromodulatory control of a variety of normal and abnormal brain functions, ranging from synaptic plasticity, to cognition, to sleep, to motor activity to neuroinflammation, and cell death. This review begun with an overview of the gene and genome structure and the expression pattern of adenosine receptors (ARs). We feature several new developments over the past decade in our understanding of AR functions in the brain, with special focus on the identification and characterization of canonical and noncanonical signaling pathways of ARs. We provide an update on functional insights from complementary genetic-knockout and pharmacological studies on the AR control of various brain functions. We also highlight several novel and recent developments of AR neurobiology, including (i) recent breakthrough in high resolution of three-dimension structure of adenosine A2A receptors (A2ARs) in several functional status, (ii) receptor-receptor heterodimerization, (iii) AR function in glial cells, and (iv) the druggability of AR. We concluded the review with the contention that these new developments extend and strengthen the support for A1 and A2ARs in brain as therapeutic targets for neurologic and psychiatric diseases. © 2014 Elsevier Inc. All rights reserved.

  12. Hydrogen sulfide inhibits A2A adenosine receptor agonist induced β-amyloid production in SH-SY5Y neuroblastoma cells via a cAMP dependent pathway.

    Directory of Open Access Journals (Sweden)

    Bhushan Vijay Nagpure

    Full Text Available Alzheimer's disease (AD is the leading cause of senile dementia in today's society. Its debilitating symptoms are manifested by disturbances in many important brain functions, which are influenced by adenosine. Hence, adenosinergic system is considered as a potential therapeutic target in AD treatment. In the present study, we found that sodium hydrosulfide (NaHS, an H2S donor, 100 µM attenuated HENECA (a selective A2A receptor agonist, 10-200 nM induced β-amyloid (1-42 (Aβ42 production in SH-SY5Y cells. NaHS also interfered with HENECA-stimulated production and post-translational modification of amyloid precursor protein (APP by inhibiting its maturation. Measurement of the C-terminal APP fragments generated from its enzymatic cleavage by β-site amyloid precursor protein cleaving enzyme 1 (BACE1 showed that NaHS did not have any significant effect on β-secretase activity. However, the direct measurements of HENECA-elevated γ-secretase activity and mRNA expressions of presenilins suggested that the suppression of Aβ42 production in NaHS pretreated cells was mediated by inhibiting γ-secretase. NaHS induced reductions were accompanied by similar decreases in intracellular cAMP levels and phosphorylation of cAMP responsive element binding protein (CREB. NaHS significantly reduced the elevated cAMP and Aβ42 production caused by forskolin (an adenylyl cyclase, AC agonist alone or forskolin in combination with IBMX (a phosphodiesterase inhibitor, but had no effect on those caused by IBMX alone. Moreover, pretreatment with NaHS significantly attenuated HENECA-elevated AC activity and mRNA expressions of various AC isoforms. These data suggest that NaHS may preferentially suppress AC activity when it was stimulated. In conclusion, H2S attenuated HENECA induced Aβ42 production in SH-SY5Y neuroblastoma cells through inhibiting γ-secretase via a cAMP dependent pathway.

  13. Presynaptic muscarinic acetylcholine autoreceptors (M1, M2 and M4 subtypes), adenosine receptors (A1 and A2A) and tropomyosin-related kinase B receptor (TrkB) modulate the developmental synapse elimination process at the neuromuscular junction.

    Science.gov (United States)

    Nadal, Laura; Garcia, Neus; Hurtado, Erica; Simó, Anna; Tomàs, Marta; Lanuza, Maria A; Santafé, Manel; Tomàs, Josep

    2016-06-23

    The development of the nervous system involves an initially exuberant production of neurons that make an excessive number of synaptic contacts. The initial overproduction of synapses promotes connectivity. Hebbian competition between axons with different activities (the least active are punished) leads to the loss of roughly half of the overproduced elements and this refines connectivity and increases specificity. The neuromuscular junction is innervated by a single axon at the end of the synapse elimination process and, because of its relative simplicity, has long been used as a model for studying the general principles of synapse development. The involvement of the presynaptic muscarinic ACh autoreceptors may allow for the direct competitive interaction between nerve endings through differential activity-dependent acetylcholine release in the synaptic cleft. Then, the most active ending may directly punish the less active ones. Our previous results indicate the existence in the weakest axons on the polyinnervated neonatal NMJ of an ACh release inhibition mechanism based on mAChR coupled to protein kinase C and voltage-dependent calcium channels. We suggest that this mechanism plays a role in the elimination of redundant neonatal synapses. Here we used confocal microscopy and quantitative morphological analysis to count the number of brightly fluorescent axons per endplate in P7, P9 and P15 transgenic B6.Cg-Tg (Thy1-YFP)16 Jrs/J mice. We investigate the involvement of individual mAChR M1-, M2- and M4-subtypes in the control of axonal elimination after the Levator auris longus muscle had been exposed to agonist and antagonist in vivo. We also analysed the role of adenosine receptor subtypes (A1 and A2A) and the tropomyosin-related kinase B receptor. The data show that postnatal axonal elimination is a regulated multireceptor mechanism that guaranteed the monoinnervation of the neuromuscular synapses. The three receptor sets considered (mAChR, AR and TrkB receptors

  14. Fractalkine (CX3CL1) enhances hippocampal N-methyl-d-aspartate receptor (NMDAR) function via d-serine and adenosine receptor type A2 (A2AR) activity

    Science.gov (United States)

    2013-01-01

    Background N-Methyl-d-aspartate receptors (NMDARs) play fundamental roles in basic brain functions such as excitatory neurotransmission and learning and memory processes. Their function is largely regulated by factors released by glial cells, including the coagonist d-serine. We investigated whether the activation of microglial CX3CR1 induces the release of factors that modulate NMDAR functions. Methods We recorded the NMDAR component of the field excitatory postsynaptic potentials (NMDA-fEPSPs) elicited in the CA1 stratum radiatum of mouse hippocampal slices by Shaffer collateral stimulation and evaluated d-serine content in the extracellular medium of glial primary cultures by mass spectrometry analysis. Results We demonstrated that CX3CL1 increases NMDA-fEPSPs by a mechanism involving the activity of the adenosine receptor type A2 (A2AR) and the release of the NMDAR coagonist d-serine. Specifically (1) the selective A2AR blocker 7-(2-phenylethyl)-5-amino-2-(2-furyl)-pyrazolo-[4,3-e]-1,2,4-triazolo[1,5-c]pyrimidine (SCH58261) and the genetic ablation of A2AR prevent CX3CL1 action while the A2AR agonist 5-(6-amino-2-(phenethylthio)-9H-purin-9-yl)-N-ethyl-3,4-dihydroxytetrahydrofuran-2-carboxamide (VT7) mimics CX3CL1 effect, and (2) the selective blocking of the NMDAR glycine (and d-serine) site by 5,7-dicholorokynurenic acid (DCKA), the enzymatic degradation of d-serine by d-amino acid oxidase (DAAO) and the saturation of the coagonist site by d-serine, all block the CX3CL1 effect. In addition, mass spectrometry analysis demonstrates that stimulation of microglia and astrocytes with CX3CL1 or VT7 increases d-serine release in the extracellular medium. Conclusions CX3CL1 transiently potentiates NMDAR function though mechanisms involving A2AR activity and the release of d-serine. PMID:23981568

  15. Adenosine A2A receptor signaling affects IL-21/IL-22 cytokines and GATA3/T-bet transcription factor expression in CD4+T cells from a BTBR T+Itpr3tf/J mouse model of autism.

    Science.gov (United States)

    Ahmad, Sheikh F; Ansari, Mushtaq A; Nadeem, Ahmed; Bakheet, Saleh A; Almutairi, Mashal M; Attia, Sabry M

    2017-10-15

    Autism is a complex heterogeneous neurodevelopmental disorder; previous studies have identified altered immune responses among individuals diagnosed with autism. An imbalance in the production of pro- and anti-inflammatory cytokines and transcription factors plays a role in neurodevelopmental behavioral and autism disorders. BTBR T + Itpr3tf/J (BTBR) mice are used as a model for autism, as they exhibit social deficits, communication deficits, and repetitive behaviors compared with C57BL/6J (B6) mice. The adenosine A2A receptor (A2AR) appears to be a potential target for the improvement of behavioral, inflammatory, immune, and neurological disorders. We investigated the effects of the A2AR antagonist SCH 5826 (SCH) and agonist CGS 21680 (CGS) on IL-21, IL-22, T-bet, T-box transcription factor (T-bet), GATA3 (GATA Binding Protein 3), and CD152 (CTLA-4) expression in BTBR mice. Our results showed that BTBR mice treated with SCH had increased CD4 + IL-21 + , CD4 + IL-22 + , CD4 + GATA3 + , and CD4 + T-bet + and decreased CD4 + CTLA-4 + expression in spleen cells compared with BTBR control mice. Moreover, CGS efficiently decreased CD4 + IL-21 + , CD4 + IL-22 + , CD4 + GATA3 + , and CD4 + T-bet + and increased CD4 + CTLA-4 production in spleen cells compared with SCH-treated and BTBR control mice. Additionally, SCH treatment significantly increased the mRNA and protein expression levels of IL-21, IL-22, GATA3, and T-bet in brain tissue compared with CGS-treated and BTBR control mice. The augmented levels of IL-21/IL-22 and GATA3/T-bet could be due to altered A2AR signaling. Our results indicate that A2AR agonists may represent a new class of compounds that can be developed for use in the treatment of autistic and neuroimmune dysfunctions. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Animal models of Parkinson׳s disease: Effects of two adenosine A2A receptor antagonists ST4206 and ST3932, metabolites of 2-n-Butyl-9-methyl-8-[1,2,3]triazol-2-yl-9H-purin-6-ylamine (ST1535).

    Science.gov (United States)

    Stasi, Maria Antonietta; Minetti, Patrizia; Lombardo, Katia; Riccioni, Teresa; Caprioli, Antonio; Vertechy, Mario; Di Serio, Stefano; Pace, Silvia; Borsini, Franco

    2015-08-15

    Antagonism of the adenosine A2A receptor represents a promising strategy for non-dopaminergic treatment of Parkinson׳s disease (PD). Previously, the adenosine A2A receptor antagonist ST1535 was shown to possess potential beneficial effects in animal models of PD. Two metabolites of ST1535, namely ST3932 and ST4206, were tested in vitro to assess their affinity and activity on cloned human A2A adenosine receptors, and their metabolic profile. Additionally, ST3932 and ST4206 were investigated in vivo in animal models of PD following oral/intraperitoneal administration of 10, 20 and 40mg/kg using ST1535 as a reference compound. ST3932 and ST4206 displayed high affinity and antagonist behaviour for cloned human adenosine A2A receptors. The Ki values for ST1535, ST3932 and ST4206 were 8, 8 and 12nM, respectively, and their IC50 values on cyclic AMP were 427, 450 and 990nM, respectively. ST1535, ST3932 and ST4206 antagonized (orally) haloperidol-induced catalepsy in mice, potentiated (intraperitoneally) the number of contralateral rotations induced by l-3,4-dihydroxyphenylalanine (l-DOPA) (3mg/kg) plus benserazide (6mg/kg) in 6-Hydroxydopamine hydrobromide (6-OHDA)-lesioned rats, and increased mouse motor activity by oral route. Thus, ST3932 and ST4206, two ST1535 metabolites, show a pharmacological activity similar to ST1535, both in vitro and in vivo, and may be regarded as an interesting pharmacological alternative to ST1535. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Adenosine A1, A2a, A2B, and A3 receptors in hematopoiesis. 2. Expression of receptor mRNA in resting and lipopolysaccharide-activated mouse RAW 264.7 macrophages

    Czech Academy of Sciences Publication Activity Database

    Štreitová, Denisa; Hofer, Michal; Holá, Jiřina; Vacek, Antonín; Pospíšil, Milan

    2010-01-01

    Roč. 59, č. 1 (2010), s. 139-144 ISSN 0862-8408 R&D Projects: GA ČR(CZ) GA305/06/0015; GA ČR(CZ) GA305/08/0158 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : adenosine receptors * macrophage * mRNA expression Subject RIV: BO - Biophysics Impact factor: 1.646, year: 2010

  18. Adenosine receptors as markers of brain iron deficiency: Implications for Restless Legs Syndrome

    Science.gov (United States)

    Quiroz, César; Gulyani, Seema; Ruiqian, Wan; Bonaventura, Jordi; Cutler, Roy; Pearson, Virginia; Allen, Richard P.; Earley, Christopher J.; Mattson, Mark P.; Ferré, Sergi

    2016-01-01

    Deficits of sensorimotor integration with periodic limb movements during sleep (PLMS) and hyperarousal and sleep disturbances in Restless Legs Syndrome (RLS) constitute two pathophysiologically distinct but interrelated clinical phenomena, which seem to depend mostly on alterations in dopaminergic and glutamatergic neurotransmission, respectively. Brain iron deficiency is considered as a main pathogenetic mechanism in RLS. Rodents with brain iron deficiency represent a valuable pathophysiological model of RLS, although they do not display motor disturbances. Nevertheless, they develop the main neurochemical dopaminergic changes found in RLS, such as decrease in striatal dopamine D2 receptor density. On the other hand, brain iron deficient mice exhibit the characteristic pattern of hyperarousal in RLS, providing a tool to find the link between brain iron deficiency and sleep disturbances in RLS. The present study provides evidence for a role of the endogenous sleep-promoting factor adenosine. Three different experimental preparations, long-term (22 weeks) severe or moderate iron-deficient (ID) diets (3- or 7-ppm iron diet) in mice and short-term (3 weeks) severe ID diet (3-ppm iron diet) in rats, demonstrated a significant downregulation (Western blotting in mouse and radioligand binding saturation experiments in rat brain tissue) of adenosine A1 receptors (A1R) in the cortex and striatum, concomitant to striatal D2R downregulation. On the other hand, the previously reported upregulation of adenosine A2A receptors (A2AR) was only observed with severe ID in both mice and rats. The results suggest a key role for A1R downregulation in the PLMS and hyperarousal in RLS. PMID:27600688

  19. Adenosine receptors as markers of brain iron deficiency: Implications for Restless Legs Syndrome.

    Science.gov (United States)

    Quiroz, César; Gulyani, Seema; Ruiqian, Wan; Bonaventura, Jordi; Cutler, Roy; Pearson, Virginia; Allen, Richard P; Earley, Christopher J; Mattson, Mark P; Ferré, Sergi

    2016-12-01

    Deficits of sensorimotor integration with periodic limb movements during sleep (PLMS) and hyperarousal and sleep disturbances in Restless Legs Syndrome (RLS) constitute two pathophysiologically distinct but interrelated clinical phenomena, which seem to depend mostly on alterations in dopaminergic and glutamatergic neurotransmission, respectively. Brain iron deficiency is considered as a main pathogenetic mechanism in RLS. Rodents with brain iron deficiency represent a valuable pathophysiological model of RLS, although they do not display motor disturbances. Nevertheless, they develop the main neurochemical dopaminergic changes found in RLS, such as decrease in striatal dopamine D 2 receptor density. On the other hand, brain iron deficient mice exhibit the characteristic pattern of hyperarousal in RLS, providing a tool to find the link between brain iron deficiency and sleep disturbances in RLS. The present study provides evidence for a role of the endogenous sleep-promoting factor adenosine. Three different experimental preparations, long-term (22 weeks) severe or moderate iron-deficient (ID) diets (3- or 7-ppm iron diet) in mice and short-term (3 weeks) severe ID diet (3-ppm iron diet) in rats, demonstrated a significant downregulation (Western blotting in mouse and radioligand binding saturation experiments in rat brain tissue) of adenosine A 1 receptors (A1R) in the cortex and striatum, concomitant to striatal D2R downregulation. On the other hand, the previously reported upregulation of adenosine A 2A receptors (A2AR) was only observed with severe ID in both mice and rats. The results suggest a key role for A1R downregulation in the PLMS and hyperarousal in RLS. Published by Elsevier Ltd.

  20. Parsing Heterogeneous Striatal Activity

    Directory of Open Access Journals (Sweden)

    Kae Nakamura

    2017-05-01

    Full Text Available The striatum is an input channel of the basal ganglia and is well known to be involved in reward-based decision making and learning. At the macroscopic level, the striatum has been postulated to contain parallel functional modules, each of which includes neurons that perform similar computations to support selection of appropriate actions for different task contexts. At the single-neuron level, however, recent studies in monkeys and rodents have revealed heterogeneity in neuronal activity even within restricted modules of the striatum. Looking for generality in the complex striatal activity patterns, here we briefly survey several types of striatal activity, focusing on their usefulness for mediating behaviors. In particular, we focus on two types of behavioral tasks: reward-based tasks that use salient sensory cues and manipulate outcomes associated with the cues; and perceptual decision tasks that manipulate the quality of noisy sensory cues and associate all correct decisions with the same outcome. Guided by previous insights on the modular organization and general selection-related functions of the basal ganglia, we relate striatal activity patterns on these tasks to two types of computations: implementation of selection and evaluation. We suggest that a parsing with the selection/evaluation categories encourages a focus on the functional commonalities revealed by studies with different animal models and behavioral tasks, instead of a focus on aspects of striatal activity that may be specific to a particular task setting. We then highlight several questions in the selection-evaluation framework for future explorations.

  1. Mast cell adenosine receptors function: a focus on the A3 adenosine receptor and inflammation

    Directory of Open Access Journals (Sweden)

    Noam eRudich

    2012-06-01

    Full Text Available Adenosine is a metabolite, which has long been implicated in a variety of inflammatory processes. Inhaled adenosine provokes bronchoconstriction in asthmatics or chronic obstructive pulmonary disease (COPD patients, but not in non-asthmatics. This hyper responsiveness to adenosine appears to be mediated by mast cell activation. These observations have marked the receptor that mediates the bronchoconstrictor effect of adenosine on mast cells, as an attractive drug candidate. Four subtypes (A1, A2a, A2b and A3 of adenosine receptors have been cloned and shown to display distinct tissue distributions and functions. Animal models have firmly established the ultimate role of the A3 adenosine receptor (A3R in mediating hyper responsiveness to adenosine in mast cells, although the influence of the A2b adenosine receptor was confirmed as well. In contrast, studies of the A3R in humans have been controversial. In this review, we summarize data on the role of different adenosine receptors in mast cell regulation of inflammation and pathology, with a focus on the common and distinct functions of the A3R in rodent and human mast cells. The relevance of mouse studies to the human is discussed.

  2. Immune Alterations in CD8+T Cells Are Associated with Neuronal C-C and C-X-C Chemokine Receptor Regulation Through Adenosine A2A Receptor Signaling in a BTBR T+Itpr3tf/J Autistic Mouse Model.

    Science.gov (United States)

    Ahmad, Sheikh F; Ansari, Mushtaq A; Nadeem, Ahmed; Bakheet, Saleh A; Mohammad, Raish; Attia, Sabry M

    2018-03-01

    Associative studies on a range of neurodevelopmental disorders have identified relationships between behavioral deficits and immune system function. The BTBR T + Itpr3 tf /J (BTBR) mouse strain displays aberrant characteristics in its social behavior and immune responses, providing a significant opportunity to examine the relationship between behavior and the immune system. This study investigated the influence of adenosine A2A receptor activity on C-C and C-X-C chemokine receptors involved in autism in the BTBR mouse model. A2A receptors have previously been targeted in clinical trials by potential therapeutics with neuroprotective, immunomodulatory, and analgesic properties. In this study, we examined the effects of A2A receptor antagonist SCH5826 (SCH) and A2A receptor agonist CGS21680 (CGS) on C-C and C-X-C chemokine receptors (CCR3, CCR4, CCR5, CCR6, CCR7, CXCR3, CXCR4, and CXCR5) on splenic CD8 + T cells in the BTBR autistic mouse model. We also assessed the C-C and C-X-C chemokine receptors mRNA levels in brain tissue. Our results showed that CCR3 + , CCR4 + , CCR5 + , CCR6 + , CCR7 + , CXCR3 + , CXCR4 + , and CXCR5 + production in splenic CD8 + T cells decreased significantly in BTBR-CGS-treated mice in comparison with that in BTBR control and BTBR-SCH-treated mice. In addition, RT-PCR analysis revealed decreased gene expression levels for C-C and C-X-C chemokine receptors in the brain tissue of BTBR-CGS-treated mice, whereas these levels were significantly increased in BTBR control and BTBR-SCH-treated mice. Our results suggest that treating BTBR mice with CGS decreases C-C and C-X-C chemokine receptor signaling and might therefore provide a unique avenue for developing future therapies for autism and neuroimmunological disorders.

  3. Adenosine and preeclampsia.

    Science.gov (United States)

    Salsoso, Rocío; Farías, Marcelo; Gutiérrez, Jaime; Pardo, Fabián; Chiarello, Delia I; Toledo, Fernando; Leiva, Andrea; Mate, Alfonso; Vázquez, Carmen M; Sobrevia, Luis

    2017-06-01

    Adenosine is an endogenous nucleoside with pleiotropic effects in different physiological processes including circulation, renal blood flow, immune function, or glucose homeostasis. Changes in adenosine membrane transporters, adenosine receptors, and corresponding intracellular signalling network associate with development of pathologies of pregnancy, including preeclampsia. Preeclampsia is a cause of maternal and perinatal morbidity and mortality affecting 3-5% of pregnancies. Since the proposed mechanisms of preeclampsia development include adenosine-dependent biological effects, adenosine membrane transporters and receptors, and the associated signalling mechanisms might play a role in the pathophysiology of preeclampsia. Preeclampsia associates with increased adenosine concentration in the maternal blood and placental tissue, likely due to local hypoxia and ischemia (although not directly demonstrated), microthrombosis, increased catecholamine release, and platelet activation. In addition, abnormal expression and function of equilibrative nucleoside transporters is described in foetoplacental tissues from preeclampsia; however, the role of adenosine receptors in the aetiology of this disease is not well understood. Adenosine receptors activation may be related to abnormal trophoblast invasion, angiogenesis, and ischemia/reperfusion mechanisms in the placenta from preeclampsia. These mechanisms may explain only a low fraction of the associated abnormal transformation of spiral arteries in preeclampsia, triggering cellular stress and inflammatory mediators release from the placenta to the maternal circulation. Although increased adenosine concentration in preeclampsia may be a compensatory or adaptive mechanism favouring placental angiogenesis, a poor angiogenic state is found in preeclampsia. Thus, preeclampsia-associated complications might affect the cell response to adenosine due to altered expression and activity of adenosine receptors, membrane transporters

  4. Huntington's Disease and Striatal Signaling

    Directory of Open Access Journals (Sweden)

    Emmanuel eRoze

    2011-08-01

    Full Text Available Huntington’s Disease (HD is the most frequent neurodegenerative disease caused by an expansion of polyglutamines (CAG. The main clinical manifestations of HD are chorea, cognitive impairment and psychiatric disorders. The transmission of HD is autosomal dominant with a complete penetrance. HD has a single genetic cause, a well-defined neuropathology, and informative pre-manifest genetic testing of the disease is available. Striatal atrophy begins as early as 15 years before disease onset and continues throughout the period of manifest illness. Therefore, patients could theoretically benefit from therapy at early stages of the disease. One important characteristic of HD is the striatal vulnerability to neurodegeneration, despite similar expression of the protein in other brain areas. Aggregation of the mutated Huntingtin (HTT, impaired axonal transport, excitotoxicity, transcriptional dysregulation as well as mitochondrial dysfunction and energy deficits, are all part of the cellular events that underlie neuronal dysfunction and striatal death. Among these non-exclusive mechanisms, an alteration of striatal signaling is thought to orchestrate the downstream events involved in the cascade of striatal dysfunction.

  5. Adenosine and dialysis hypotension

    NARCIS (Netherlands)

    Franssen, CMF

    In this issue, Imai et al. report the results of a double-blind placebo-controlled study on the effect of an adenosine A1 receptor antagonist, FK352, on the incidence of dialysis hypotension in hypotension-prone patients. This Commentary discusses the use of selective adenosine A1 receptor

  6. Involvement of adenosine in the antiinflammatory action of ketamine.

    Science.gov (United States)

    Mazar, Julia; Rogachev, Boris; Shaked, Gad; Ziv, Nadav Y; Czeiger, David; Chaimovitz, Cidio; Zlotnik, Moshe; Mukmenev, Igor; Byk, Gerardo; Douvdevani, Amos

    2005-06-01

    Ketamine is an anesthetic drug. Subanesthetic doses of ketamine have been shown to reduce interleukin-6 concentrations after surgery and to reduce mortality and the production of tumor necrosis factor alpha and interleukin 6 in septic animals. Similarly, adenosine was shown to reduce tumor necrosis factor alpha and mortality of septic animals. The aim of this study was to determine whether adenosine mediates the antiinflammatory effects of ketamine. Sepsis was induced in mice by lipopolysaccharide or Escherichia coli inoculation. Leukocyte recruitment and cytokine concentrations were used as inflammation markers. Adenosine concentrations were assayed by high-performance liquid chromatography, and the involvement of adenosine in the effects of ketamine was demonstrated by adenosine receptor agonists and antagonists. Ketamine markedly reduced mortality from sepsis, leukocyte recruitment, and tumor necrosis factor-alpha and interleukin-6 concentrations. Ketamine administration in mice and rats was associated with a surge at 20-35 min of adenosine in serum (up to 5 microm) and peritoneal fluid. The adenosine A2A receptor agonist CGS-21680 mimicked the effect of ketamine in peritonitis, whereas the A2A receptor antagonists DMPX and ZM 241385 blocked its antiinflammatory effects. In contrast, A1 and A3 receptor antagonists had no effect. ZM 241385 reversed the beneficial effect of ketamine on survival from bacterial sepsis. The current data suggest that the sepsis-protective antiinflammatory effects of ketamine are mediated by the release of adenosine acting through the A2A receptor.

  7. Structural Mapping of Adenosine Receptor Mutations

    DEFF Research Database (Denmark)

    Jespers, Willem; Schiedel, Anke C; Heitman, Laura H

    2018-01-01

    The four adenosine receptors (ARs), A1, A2A, A2B, and A3, constitute a subfamily of G protein-coupled receptors (GPCRs) with exceptional foundations for structure-based ligand design. The vast amount of mutagenesis data, accumulated in the literature since the 1990s, has been recently supplemente...

  8. Pivotal Role of Adenosine Neurotransmission in Restless Legs Syndrome

    Science.gov (United States)

    Ferré, Sergi; Quiroz, César; Guitart, Xavier; Rea, William; Seyedian, Arta; Moreno, Estefanía; Casadó-Anguera, Verònica; Díaz-Ríos, Manuel; Casadó, Vicent; Clemens, Stefan; Allen, Richard P.; Earley, Christopher J.; García-Borreguero, Diego

    2018-01-01

    The symptomatology of Restless Legs Syndrome (RLS) includes periodic leg movements during sleep (PLMS), dysesthesias, and hyperarousal. Alterations in the dopaminergic system, a presynaptic hyperdopaminergic state, seem to be involved in PLMS, while alterations in glutamatergic neurotransmission, a presynaptic hyperglutamatergic state, seem to be involved in hyperarousal and also PLMS. Brain iron deficiency (BID) is well-recognized as a main initial pathophysiological mechanism of RLS. BID in rodents have provided a pathogenetic model of RLS that recapitulates the biochemical alterations of the dopaminergic system of RLS, although without PLMS-like motor abnormalities. On the other hand, BID in rodents reproduces the circadian sleep architecture of RLS, indicating the model could provide clues for the hyperglutamatergic state in RLS. We recently showed that BID in rodents is associated with changes in adenosinergic transmission, with downregulation of adenosine A1 receptors (A1R) as the most sensitive biochemical finding. It was hypothesized that A1R downregulation leads to hypersensitive striatal glutamatergic terminals and facilitation of striatal dopamine release. Hypersensitivity of striatal glutamatergic terminals was demonstrated by an optogenetic-microdialysis approach in the rodent with BID, indicating that it could represent a main pathogenetic factor that leads to PLMS in RLS. In fact, the dopaminergic agonists pramipexole and ropinirole and the α2δ ligand gabapentin, used in the initial symptomatic treatment of RLS, completely counteracted optogenetically-induced glutamate release from both normal and BID-induced hypersensitive corticostriatal glutamatergic terminals. It is a main tenet of this essay that, in RLS, a single alteration in the adenosinergic system, downregulation of A1R, disrupts the adenosine-dopamine-glutamate balance uniquely controlled by adenosine and dopamine receptor heteromers in the striatum and also the A1R-mediated inhibitory

  9. Pivotal Role of Adenosine Neurotransmission in Restless Legs Syndrome

    Directory of Open Access Journals (Sweden)

    Sergi Ferré

    2018-01-01

    Full Text Available The symptomatology of Restless Legs Syndrome (RLS includes periodic leg movements during sleep (PLMS, dysesthesias, and hyperarousal. Alterations in the dopaminergic system, a presynaptic hyperdopaminergic state, seem to be involved in PLMS, while alterations in glutamatergic neurotransmission, a presynaptic hyperglutamatergic state, seem to be involved in hyperarousal and also PLMS. Brain iron deficiency (BID is well-recognized as a main initial pathophysiological mechanism of RLS. BID in rodents have provided a pathogenetic model of RLS that recapitulates the biochemical alterations of the dopaminergic system of RLS, although without PLMS-like motor abnormalities. On the other hand, BID in rodents reproduces the circadian sleep architecture of RLS, indicating the model could provide clues for the hyperglutamatergic state in RLS. We recently showed that BID in rodents is associated with changes in adenosinergic transmission, with downregulation of adenosine A1 receptors (A1R as the most sensitive biochemical finding. It was hypothesized that A1R downregulation leads to hypersensitive striatal glutamatergic terminals and facilitation of striatal dopamine release. Hypersensitivity of striatal glutamatergic terminals was demonstrated by an optogenetic-microdialysis approach in the rodent with BID, indicating that it could represent a main pathogenetic factor that leads to PLMS in RLS. In fact, the dopaminergic agonists pramipexole and ropinirole and the α2δ ligand gabapentin, used in the initial symptomatic treatment of RLS, completely counteracted optogenetically-induced glutamate release from both normal and BID-induced hypersensitive corticostriatal glutamatergic terminals. It is a main tenet of this essay that, in RLS, a single alteration in the adenosinergic system, downregulation of A1R, disrupts the adenosine-dopamine-glutamate balance uniquely controlled by adenosine and dopamine receptor heteromers in the striatum and also the A1R

  10. Adenosine signaling in normal and sickle erythrocytes and beyond.

    Science.gov (United States)

    Zhang, Yujin; Xia, Yang

    2012-08-01

    Sickle cell disease (SCD) is a debilitating hemolytic genetic disorder with high morbidity and mortality affecting millions of individuals worldwide. Although SCD was discovered more than a century ago, no effective mechanism-based prevention and treatment are available due to poorly understood molecular basis of sickling, the fundamental pathogenic process of the disease. SCD patients constantly face hypoxia. One of the best-known signaling molecules to be induced under hypoxic conditions is adenosine. Recent studies demonstrate that hypoxia-mediated elevated adenosine signaling plays an important role in normal erythrocyte physiology. In contrast, elevated adenosine signaling contributes to sickling and multiple life threatening complications including tissue damage, pulmonary dysfunction and priapism. Here, we summarize recent research on the role of adenosine signaling in normal and sickle erythrocytes, progression of the disease and therapeutic implications. In normal erythrocytes, both genetic and pharmacological studies demonstrate that adenosine can enhance 2,3-bisphosphoglycerate (2,3-BPG) production via A(2B) receptor (ADORA2B) activation, suggesting that elevated adenosine has an unrecognized role in normal erythrocytes to promote O(2) release and prevent acute ischemic tissue injury. However, in sickle erythrocytes, the beneficial role of excessive adenosine-mediated 2,3-BPG induction becomes detrimental by promoting deoxygenation, polymerization of sickle hemoglobin and subsequent sickling. Additionally, adenosine signaling via the A(2A) receptor (ADORA2A) on invariant natural killer T (iNKT) cells inhibits iNKT cell activation and attenuates pulmonary dysfunction in SCD mice. Finally, elevated adenosine coupled with ADORA2BR activation is responsible for priapism, a dangerous complication seen in SCD. Overall, the research reviewed here reveals a differential role of elevated adenosine in normal erythrocytes, sickle erythrocytes, iNK cells and

  11. Dopamine D1-like receptors depress excitatory synaptic transmissions in striatal neurons after transient forebrain ischemia.

    Science.gov (United States)

    Zhang, Yuchun; Deng, Ping; Ruan, Yiwen; Xu, Zao C

    2008-08-01

    Spiny neurons in the neostriatum are highly vulnerable to ischemia. Despite an enormous body of research suggesting that dopamine is involved in ischemia-induced neuronal loss in the striatum, it remains unclear how dopamine interacts with the glutamatergic excitotoxicity that is widely accepted as a major cause of ischemic cell death. Our study was designed to investigate the effects of dopamine D1 receptor (D1R) activation on excitatory neurotransmission in postischemic striatal neurons. We used the 4-vessel occlusion ischemia model and brain slice preparations. Whole-cell voltage-clamp recording was performed on striatal neurons to measure excitatory postsynaptic currents (EPSCs). Systemic administration of a D1R agonist after ischemia and hematoxylin/eosin staining were performed to evaluate the effects of D1R activation on ischemia-induced neuronal degeneration in the striatum. D1R activation depressed EPSCs in postischemic striatal neurons. The depression was attributable to inhibition of presynaptic release. An activator of cAMP-dependent protein kinase A (PKA) mimicked the depressive effects of D1R activation. Bath application of a PKA inhibitor blocked the depression of EPSCs, whereas intracellular postsynaptic application of the PKA inhibitor had no effect. The D1R agonist failed to reduce EPSC amplitude in the presence of an adenosine A1 receptor antagonist. Systemic administration of a D1R agonist after ischemia significantly attenuated ischemia-induced cell death in the striatum. These results indicate that D1R activation presynaptically depresses excitatory synaptic transmission in striatal neurons after ischemia through activation of PKA and adenosine A1 receptors and thus demonstrate a novel mechanism of D1R-mediated protection against ischemia.

  12. Adenosine and sleep

    Energy Technology Data Exchange (ETDEWEB)

    Yanik, G.M. Jr.

    1987-01-01

    Behavioral and biochemical approaches have been used to determine the relative contribution of endogenous adenosine and adenosine receptors to the sleep-wake cycle in the rat. Adenosine concentrations in specific areas of the rat brain were not affected by 24 hours of total sleep deprivation, or by 24 or 48 hours of REM sleep deprivation. In order to assess the effect of REM sleep deprivation on adenosine A/sub 1/ receptors, /sup 3/H-L-PIA binding was measured. The Bmax values for /sup 3/H-L-PIA binding to membrane preparations of the cortices and corpus striata from 48 hour REM sleep-deprived animals were increased 14.8% and 23%, respectively. These increases were not maintained following the cessation of sleep deprivation and recovered within 2 hours. The results of a 96 hour REM deprivation experiment were similar to those of the 48 hour REM sleep deprivation experiment. However, these increases were not evident in similar structures taken from stress control animals, and conclusively demonstrated that the changes in /sup 3/H-L-PIA binding resulted from REM sleep deprivation and not from stress.

  13. Adenosine and sleep

    International Nuclear Information System (INIS)

    Yanik, G.M. Jr.

    1987-01-01

    Behavioral and biochemical approaches have been used to determine the relative contribution of endogenous adenosine and adenosine receptors to the sleep-wake cycle in the rat. Adenosine concentrations in specific areas of the rat brain were not affected by 24 hours of total sleep deprivation, or by 24 or 48 hours of REM sleep deprivation. In order to assess the effect of REM sleep deprivation on adenosine A 1 receptors, 3 H-L-PIA binding was measured. The Bmax values for 3 H-L-PIA binding to membrane preparations of the cortices and corpus striata from 48 hour REM sleep-deprived animals were increased 14.8% and 23%, respectively. These increases were not maintained following the cessation of sleep deprivation and recovered within 2 hours. The results of a 96 hour REM deprivation experiment were similar to those of the 48 hour REM sleep deprivation experiment. However, these increases were not evident in similar structures taken from stress control animals, and conclusively demonstrated that the changes in 3 H-L-PIA binding resulted from REM sleep deprivation and not from stress

  14. Striatal mechanisms underlying movement, reinforcement, and punishment.

    Science.gov (United States)

    Kravitz, Alexxai V; Kreitzer, Anatol C

    2012-06-01

    Direct and indirect pathway striatal neurons are known to exert opposing control over motor output. In this review, we discuss a hypothetical extension of this framework, in which direct pathway striatal neurons also mediate reinforcement and reward, and indirect pathway neurons mediate punishment and aversion.

  15. Striatal Mechanisms Underlying Movement, Reinforcement, and Punishment

    OpenAIRE

    Kravitz, Alexxai V.; Kreitzer, Anatol C.

    2012-01-01

    Direct and indirect pathway striatal neurons are known to exert opposing control over motor output. In this review, we discuss a hypothetical extension of this framework, in which direct pathway striatal neurons also mediate reinforcement and reward, and indirect pathway neurons mediate punishment and aversion.

  16. Molecular Evidence of Adenosine Deaminase Linking Adenosine A2AReceptor and CD26 Proteins.

    Science.gov (United States)

    Moreno, Estefanía; Canet, Júlia; Gracia, Eduard; Lluís, Carme; Mallol, Josefa; Canela, Enric I; Cortés, Antoni; Casadó, Vicent

    2018-01-01

    Adenosine is an endogenous purine nucleoside that acts in all living systems as a homeostatic network regulator through many pathways, which are adenosine receptor (AR)-dependent and -independent. From a metabolic point of view, adenosine deaminase (ADA) is an essential protein in the regulation of the total intracellular and extracellular adenosine in a tissue. In addition to its cytosolic localization, ADA is also expressed as an ecto-enzyme on the surface of different cells. Dipeptidyl peptidase IV (CD26) and some ARs act as binding proteins for extracellular ADA in humans. Since CD26 and ARs interact with ADA at opposite sites, we have investigated if ADA can function as a cell-to-cell communication molecule by bridging the anchoring molecules CD26 and A 2A R present on the surfaces of the interacting cells. By combining site-directed mutagenesis of ADA amino acids involved in binding to A 2A R and a modification of the bioluminescence resonance energy transfer (BRET) technique that allows detection of interactions between two proteins expressed in different cell populations with low steric hindrance (NanoBRET), we show direct evidence of the specific formation of trimeric complexes CD26-ADA-A 2A R involving two cells. By dynamic mass redistribution assays and ligand binding experiments, we also demonstrate that A 2A R-NanoLuc fusion proteins are functional. The existence of this ternary complex is in good agreement with the hypothesis that ADA could bridge T-cells (expressing CD26) and dendritic cells (expressing A 2A R). This is a new metabolic function for ecto-ADA that, being a single chain protein, it has been considered as an example of moonlighting protein, because it performs more than one functional role (as a catalyst, a costimulator, an allosteric modulator and a cell-to-cell connector) without partitioning these functions in different subunits.

  17. Activation of Adenylyl Cyclase Causes Stimulation of Adenosine Receptors

    Directory of Open Access Journals (Sweden)

    Thomas Pleli

    2018-03-01

    Full Text Available Background/Aims: Signaling of Gs protein-coupled receptors (GsPCRs is accomplished by stimulation of adenylyl cyclase, causing an increase of the intracellular cAMP concentration, activation of the intracellular cAMP effectors protein kinase A (PKA and Epac, and an efflux of cAMP, the function of which is still unclear. Methods: Activation of adenylyl cyclase by GsPCR agonists or cholera toxin was monitored by measurement of the intracellular cAMP concentration by ELISA, anti-phospho-PKA substrate motif phosphorylation by immunoblotting, and an Epac-FRET assay in the presence and absence of adenosine receptor antagonists or ecto-nucleotide phosphodiesterase/pyrophosphatase2 (eNPP2 inhibitors. The production of AMP from cAMP by recombinant eNPP2 was measured by HPLC. Extracellular adenosine was determined by LC-MS/MS, extracellular ATP by luciferase and LC-MS/MS. The expression of eNPP isoenzymes 1-3 was examined by RT-PCR. The expression of multidrug resistance protein 4 was suppressed by siRNA. Results: Here we show that the activation of GsPCRs and the GsPCRs-independent activation of Gs proteins and adenylyl cyclase by cholera toxin induce stimulation of cell surface adenosine receptors (A2A or A2B adenosine receptors. In PC12 cells stimulation of adenylyl cyclase by GsPCR or cholera toxin caused activation of A2A adenosine receptors by an autocrine signaling pathway involving cAMP efflux through multidrug resistance protein 4 and hydrolysis of released cAMP to AMP by eNPP2. In contrast, in PC3 cells cholera toxin- and GsPCR-induced stimulation of adenylyl cyclase resulted in the activation of A2B adenosine receptors. Conclusion: Our findings show that stimulation of adenylyl cyclase causes a remarkable activation of cell surface adenosine receptors.

  18. Amyotrophic Lateral Sclerosis (ALS and Adenosine Receptors

    Directory of Open Access Journals (Sweden)

    Ana M. Sebastião

    2018-04-01

    Full Text Available In the present review we discuss the potential involvement of adenosinergic signaling, in particular the role of adenosine receptors, in amyotrophic lateral sclerosis (ALS. Though the literature on this topic is not abundant, the information so far available on adenosine receptors in animal models of ALS highlights the interest to continue to explore the role of these receptors in this neurodegenerative disease. Indeed, all motor neurons affected in ALS are responsive to adenosine receptor ligands but interestingly, there are alterations in pre-symptomatic or early symptomatic stages that mirror those in advanced disease stages. Information starts to emerge pointing toward a beneficial role of A2A receptors (A2AR, most probably at early disease states, and a detrimental role of caffeine, in clear contrast with what occurs in other neurodegenerative diseases. However, some evidence also exists on a beneficial action of A2AR antagonists. It may happen that there are time windows where A2AR prove beneficial and others where their blockade is required. Furthermore, the same changes may not occur simultaneously at the different synapses. In line with this, it is not fully understood if ALS is a dying back disease or if it propagates in a centrifugal way. It thus seems crucial to understand how motor neuron dysfunction occurs, how adenosine receptors are involved in those dysfunctions and whether the early changes in purinergic signaling are compensatory or triggers for the disease. Getting this information is crucial before starting the design of purinergic based strategies to halt or delay disease progression.

  19. Extrasynaptic neurotransmission in the modulation of brain function. Focus on the striatal neuronal-glial networks

    Directory of Open Access Journals (Sweden)

    Kjell eFuxe

    2012-06-01

    Full Text Available Extrasynaptic neurotransmission is an important short distance form of volume transmission (VT and describes the extracellular diffusion of transmitters and modulators after synaptic spillover or extrasynaptic release in the local circuit regions binding to and activating mainly extrasynaptic neuronal and glial receptors in the neuroglial networks of the brain. Receptor-receptor interactions in G protein-coupled receptor (GPCR heteromers play a major role, on dendritic spines and nerve terminals including glutamate synapses, in the integrative processes of the extrasynaptic signaling. Heteromeric complexes between GPCR and ion-channel receptors play a special role in the integration of the synaptic and extrasynaptic signals. Changes in extracellular concentrations of the classical synaptic neurotransmitters glutamate and GABA found with microdialysis is likely an expression of the activity of the neuron-astrocyte unit of the brain and can be used as an index of VT-mediated actions of these two neurotransmitters in the brain. Thus, the activity of neurons may be functionally linked to the activity of astrocytes, which may release glutamate and GABA to the extracellular space where extrasynaptic glutamate and GABA receptors do exist. Wiring transmission (WT and VT are fundamental properties of all neurons of the CNS but the balance between WT and VT varies from one nerve cell population to the other. The focus is on the striatal cellular networks, and the WT and VT and their integration via receptor heteromers are described in the GABA projection neurons, the glutamate, dopamine, 5-hydroxytryptamine (5-HT and histamine striatal afferents, the cholinergic interneurons and different types of GABA interneurons. In addition, the role in these networks of VT signaling of the energy-dependent modulator adenosine and of endocannabinoids mainly formed in the striatal projection neurons will be underlined to understand the communication in the striatal

  20. Striatal cholinergic interneuron regulation and circuit effects

    Directory of Open Access Journals (Sweden)

    Sean Austin Lim

    2014-10-01

    Full Text Available The striatum plays a central role in motor control and motor learning. Appropriate responses to environmental stimuli, including pursuit of reward or avoidance of aversive experience all require functional striatal circuits. These pathways integrate synaptic inputs from limbic and cortical regions including sensory, motor and motivational information to ultimately connect intention to action. Although many neurotransmitters participate in striatal circuitry, one critically important player is acetylcholine (ACh. Relative to other brain areas, the striatum contains exceptionally high levels of ACh, the enzymes that catalyze its synthesis and breakdown, as well as both nicotinic and muscarinic receptor types that mediate its postsynaptic effects. The principal source of striatal ACh is the cholinergic interneuron (ChI, which comprises only about 1-2% of all striatal cells yet sends dense arbors of projections throughout the striatum. This review summarizes recent advances in our understanding of the factors affecting the excitability of these neurons through acute effects and long term changes in their synaptic inputs. In addition, we discuss the physiological effects of ACh in the striatum, and how changes in ACh levels may contribute to disease states during striatal dysfunction.

  1. Huntington’s Disease and Striatal Signaling

    Science.gov (United States)

    Roze, Emmanuel; Cahill, Emma; Martin, Elodie; Bonnet, Cecilia; Vanhoutte, Peter; Betuing, Sandrine; Caboche, Jocelyne

    2011-01-01

    Huntington’s Disease (HD) is the most frequent neurodegenerative disease caused by an expansion of polyglutamines (CAG). The main clinical manifestations of HD are chorea, cognitive impairment, and psychiatric disorders. The transmission of HD is autosomal dominant with a complete penetrance. HD has a single genetic cause, a well-defined neuropathology, and informative pre-manifest genetic testing of the disease is available. Striatal atrophy begins as early as 15 years before disease onset and continues throughout the period of manifest illness. Therefore, patients could theoretically benefit from therapy at early stages of the disease. One important characteristic of HD is the striatal vulnerability to neurodegeneration, despite similar expression of the protein in other brain areas. Aggregation of the mutated Huntingtin (HTT), impaired axonal transport, excitotoxicity, transcriptional dysregulation as well as mitochondrial dysfunction, and energy deficits, are all part of the cellular events that underlie neuronal dysfunction and striatal death. Among these non-exclusive mechanisms, an alteration of striatal signaling is thought to orchestrate the downstream events involved in the cascade of striatal dysfunction. PMID:22007160

  2. Dopamine/adenosine interactions involved in effort-related aspects of food motivation.

    Science.gov (United States)

    Salamone, John D; Correa, Merce

    2009-12-01

    Nucleus accumbens dopamine (DA) is involved in effort-related aspects of food motivation. Accumbens DA depletions reduce the tendency of rats to work for food, and alter effort-related choice, but leave other aspects of food motivation and appetite intact. DA and adenosine receptors interact to regulate effort-related processes. Adenosine A(2A) antagonists can reverse the effects of DA D(2) antagonists on effort-related choice, and intra-accumbens injections of a adenosine A(2A) agonist produce effects that are similar to those produced by accumbens DA depletion or antagonism. These studies have implications for understanding the neurochemical interactions that underlie activational aspects of motivation.

  3. Dopamine/adenosine interactions involved in effort-related aspects of food motivation

    OpenAIRE

    Salamone, John D.; Correa, Merce

    2009-01-01

    Nucleus accumbens dopamine (DA) is involved in effort-related aspects of food motivation. Accumbens DA depletions reduce the tendency of rats to work for food, and alter effort-related choice, but leave other aspects of food motivation and appetite intact. DA and adenosine receptors interact to regulate effort-related processes. Adenosine A2A antagonists can reverse the effects of DA D2 antagonists on effort-related choice, and intra-accumbens injections of a adenosine A2A agonist produce eff...

  4. Extracellular adenosine controls NKT-cell-dependent hepatitis induction.

    Science.gov (United States)

    Subramanian, Meenakshi; Kini, Radhika; Madasu, Manasa; Ohta, Akiko; Nowak, Michael; Exley, Mark; Sitkovsky, Michail; Ohta, Akio

    2014-04-01

    Extracellular adenosine regulates inflammatory responses via the A2A adenosine receptor (A2AR). A2AR deficiency results in much exaggerated acute hepatitis, indicating nonredundancy of adenosine-A2AR pathway in inhibiting immune activation. To identify a critical target of immunoregulatory effect of extracellular adenosine, we focused on NKT cells, which play an indispensable role in hepatitis. An A2AR agonist abolished NKT-cell-dependent induction of acute hepatitis by concanavalin A (Con A) or α-galactosylceramide in mice, corresponding to downregulation of activation markers and cytokines in NKT cells and of NK-cell co-activation. These results show that A2AR signaling can downregulate NKT-cell activation and suppress NKT-cell-triggered inflammatory responses. Next, we hypothesized that NKT cells might be under physiological control of the adenosine-A2AR pathway. Indeed, both Con A and α-galactosylceramide induced more severe hepatitis in A2AR-deficient mice than in WT controls. Transfer of A2AR-deficient NKT cells into A2AR-expressing recipients resulted in exaggeration of Con A-induced liver damage, suggesting that NKT-cell activation is controlled by endogenous adenosine via A2AR, and this physiological regulatory mechanism of NKT cells is critical in the control of tissue-damaging inflammation. The current study suggests the possibility to manipulate NKT-cell activity in inflammatory disorders through intervention to the adenosine-A2AR pathway. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Some neural effects of adenosin.

    Science.gov (United States)

    Haulică, I; Brănişteanu, D D; Petrescu, G H

    1978-01-01

    The possible neural effects of adenosine were investigated by using electrophysiological techniques at the level of some central and peripheral synapses. The evoked potentials in the somatosensorial cerebral cortex are influenced according to both the type of administration and the level of the electrical stimulation. While the local application does not induce significant alterations, the intrathalamic injections and the perfusion of the IIIrd cerebral ventricle do change the distribution of activated units at the level of different cortical layers especially during the peripheral stimulation. The frequency of spontaneous miniature discharges intracellularly recorded in the neuromuscular junction (mepp) is significantly depressed by adenosine. This effect is calcium- and dose-dependent. The end plate potentials (EPP) were also depressed. The statistical binomial analysis of the phenomenon indicated that adenosine induces a decrease if the presynaptic pool of the available transmitter. The data obtained demonstrate a presynaptic inhibitory action of adenosine beside its known vascular and metaholic effects.

  6. A2A Receptor Antagonism and Dyskinesia in Parkinson's Disease

    Science.gov (United States)

    Morelli, Micaela; Blandini, Fabio; Simola, Nicola; Hauser, Robert A.

    2012-01-01

    Dyskinesia, a major complication of treatment of Parkinson's disease (PD), involves two phases: induction, which is responsible for dyskinesia onset, and expression, which underlies its clinical manifestation. The unique cellular and regional distribution of adenosine A2A receptors in basal ganglia areas that are richly innervated by dopamine, and their antagonistic role towards dopamine receptor stimulation, have positioned A2A receptor antagonists as an attractive nondopaminergic target to improve the motor deficits that characterize PD. In this paper, we describe the biochemical characteristics of A2A receptors and the effects of adenosine A2A antagonists in rodent and primate models of PD on L-DOPA-induced dyskinesia, together with relevant biomarker studies. We also review clinical trials of A2A antagonists as adjuncts to L-DOPA in PD patients with motor fluctuations. These studies have generally demonstrated that the addition of an A2A antagonist to a stable L-DOPA regimen reduces OFF time and mildly increases dyskinesia. However, limited clinical data suggest that the addition of an A2A antagonist along with a reduction of L-DOPA might maintain anti-Parkinsonian benefit and reduce dyskinesia. Whether A2A antagonists might reduce the development of dyskinesia has not yet been tested clinically. PMID:22754707

  7. Adenosine receptor agonists modulate visceral hyperalgesia in the rat.

    Science.gov (United States)

    Sohn, Chong-Il; Park, Hyo Jin; Gebhart, G F

    2008-06-01

    Adenosine is an endogenous modulator of nociception. Its role in visceral nociception, particularly in visceral hyperalgesia, has not been studied. The aim of this study was to determine the effects of adenosine receptor agonists in a model of visceral hyperalgesia. The visceromotor response (VMR) in rats to colorectal distension (CRD; 80 mmHg, 20 seconds) was quantified by electromyographic recordings from the abdominal musculature. Three hours after the intracolonic administration of zymosan (25 mg/mL, 1 mL), VMRs to CRD were measured before and after either subcutaneous or intrathecal administration of an adenosine receptor agonist. Subcutaneous injection of 5'-N-ethylcarboxyamidoadenosine (NECA; an A1 and A2 receptor agonist), R(-)-N6-(2-phenylisopropyl)-adenosine (R-PIA; a selective A1 receptor agonist), or CGS-21680 hydrochloride (a selective A2a receptor agonist) dose-dependently (10-100 mg/kg) attenuated the VMR to CRD, although hindlimb weakness occurred at the higher doses tested. Intrathecal administration of NECA or R-PIA dose-dependently (0.1-1.0 microg/kg) decreased the VMR, whereas CGS-21680 hydrochloride was ineffective over the same concentration range. Higher intrathecal doses of the A1/A2 receptor agonist NECA produced motor weakness. Adenosine receptor agonists are antihyperalgesic, but also produce motor weakness at high doses. However, activation of the spinal A1 receptor significantly attenuates the VMR to CRD without producing motor weakness.

  8. Synthesis and biological evaluation of metabolites of 2-n-butyl-9-methyl-8-[1,2,3]triazol-2-yl-9H-purin-6-ylamine (ST1535), a potent antagonist of the A2A adenosine receptor for the treatment of Parkinson's disease.

    Science.gov (United States)

    Piersanti, Giovanni; Bartoccini, Francesca; Lucarini, Simone; Cabri, Walter; Stasi, Maria Antonietta; Riccioni, Teresa; Borsini, Franco; Tarzia, Giorgio; Minetti, Patrizia

    2013-07-11

    The synthesis and preliminary in vitro evaluation of five metabolites of the A2A antagonist ST1535 (1) are reported. The metabolites, originating in vivo from enzymatic oxidation of the 2-butyl group of the parent compound, were synthesized from 6-chloro-2-iodo-9-methyl-9H-purine (2) by selective C-C bond formation via halogen/magnesium exchange reaction and/or palladium-catalyzed reactions. The metabolites behaved in vitro as antagonist ligands of cloned human A2A receptor with affinities (Ki 7.5-53 nM) comparable to that of compound 1 (Ki 10.7 nM), thus showing that the long duration of action of 1 could be in part due to its metabolites. General behavior after oral administration in mice was also analyzed.

  9. A2A receptor ligands: past, present and future trends.

    Science.gov (United States)

    Clementina, Manera; Giuseppe, Saccomanni

    2010-01-01

    The adenosine A(2A) receptor is a member of the G protein-coupled receptor family and mediates multiple physiological effects of adenosine, both at the central nervous system and at peripheral tissues. Increasing evidence relates the A(2A) receptor with several pathological conditions such as neurodegenerative disorders, inflammation, pharmacological stress, and wound healing renewing the interest in A(2A) receptor agonists and antagonists as promising leads for drugs. However some of them initially tested in clinical trials presented several side effects, short half-life, lower solubility, and in some cases a lack of effects, perhaps attributable to receptor desensitization or to low receptor density in the targeted tissue. For these reasons it is evident that additional rational chemical modifications of the existing A(2A) receptor ligands to improve their affinity/selectivity and bioavailability as well as further studies to get new template for A(2A)AR ligands are necessary. The purpose of this review is to analyze and summarize the past and the present aspects related to the medicinal chemistry of A(2A) receptor ligands. Moreover their current and possible therapeutic applications have been also highlighted.

  10. De Novo Mutations in PDE10A Cause Childhood-Onset Chorea with Bilateral Striatal Lesions.

    Science.gov (United States)

    Mencacci, Niccolò E; Kamsteeg, Erik-Jan; Nakashima, Kosuke; R'Bibo, Lea; Lynch, David S; Balint, Bettina; Willemsen, Michèl A A P; Adams, Matthew E; Wiethoff, Sarah; Suzuki, Kazunori; Davies, Ceri H; Ng, Joanne; Meyer, Esther; Veneziano, Liana; Giunti, Paola; Hughes, Deborah; Raymond, F Lucy; Carecchio, Miryam; Zorzi, Giovanna; Nardocci, Nardo; Barzaghi, Chiara; Garavaglia, Barbara; Salpietro, Vincenzo; Hardy, John; Pittman, Alan M; Houlden, Henry; Kurian, Manju A; Kimura, Haruhide; Vissers, Lisenka E L M; Wood, Nicholas W; Bhatia, Kailash P

    2016-04-07

    Chorea is a hyperkinetic movement disorder resulting from dysfunction of striatal medium spiny neurons (MSNs), which form the main output projections from the basal ganglia. Here, we used whole-exome sequencing to unravel the underlying genetic cause in three unrelated individuals with a very similar and unique clinical presentation of childhood-onset chorea and characteristic brain MRI showing symmetrical bilateral striatal lesions. All individuals were identified to carry a de novo heterozygous mutation in PDE10A (c.898T>C [p.Phe300Leu] in two individuals and c.1000T>C [p.Phe334Leu] in one individual), encoding a phosphodiesterase highly and selectively present in MSNs. PDE10A contributes to the regulation of the intracellular levels of cyclic adenosine monophosphate (cAMP) and cyclic guanosine monophosphate (cGMP). Both substitutions affect highly conserved amino acids located in the regulatory GAF-B domain, which, by binding to cAMP, stimulates the activity of the PDE10A catalytic domain. In silico modeling showed that the altered residues are located deep in the binding pocket, where they are likely to alter cAMP binding properties. In vitro functional studies showed that neither substitution affects the basal PDE10A activity, but they severely disrupt the stimulatory effect mediated by cAMP binding to the GAF-B domain. The identification of PDE10A mutations as a cause of chorea further motivates the study of cAMP signaling in MSNs and highlights the crucial role of striatal cAMP signaling in the regulation of basal ganglia circuitry. Pharmacological modulation of this pathway could offer promising etiologically targeted treatments for chorea and other hyperkinetic movement disorders. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  11. The Role of Adenosine Receptors in Psychostimulant Addiction

    Directory of Open Access Journals (Sweden)

    Inmaculada Ballesteros-Yáñez

    2018-01-01

    Full Text Available Adenosine receptors (AR are a family of G-protein coupled receptors, comprised of four members, named A1, A2A, A2B, and A3 receptors, found widely distributed in almost all human body tissues and organs. To date, they are known to participate in a large variety of physiopathological responses, which include vasodilation, pain, and inflammation. In particular, in the central nervous system (CNS, adenosine acts as a neuromodulator, exerting different functions depending on the type of AR and consequent cellular signaling involved. In terms of molecular pathways and second messengers involved, A1 and A3 receptors inhibit adenylyl cyclase (AC, through Gi/o proteins, while A2A and A2B receptors stimulate it through Gs proteins. In the CNS, A1 receptors are widely distributed in the cortex, hippocampus, and cerebellum, A2A receptors are localized mainly in the striatum and olfactory bulb, while A2B and A3 receptors are found at low levels of expression. In addition, AR are able to form heteromers, both among themselves (e.g., A1/A2A, as well as with other subtypes (e.g., A2A/D2, opening a whole range of possibilities in the field of the pharmacology of AR. Nowadays, we know that adenosine, by acting on adenosine A1 and A2A receptors, is known to antagonistically modulate dopaminergic neurotransmission and therefore reward systems, being A1 receptors colocalized in heteromeric complexes with D1 receptors, and A2A receptors with D2 receptors. This review documents the present state of knowledge of the contribution of AR, particularly A1 and A2A, to psychostimulants-mediated effects, including locomotor activity, discrimination, seeking and reward, and discuss their therapeutic relevance to psychostimulant addiction. Studies presented in this review reinforce the potential of A1 agonists as an effective strategy to counteract psychostimulant-induced effects. Furthermore, different experimental data support the hypothesis that A2A/D2 heterodimers are

  12. Molecular Regulation of Striatal Development: A Review

    Directory of Open Access Journals (Sweden)

    A. E. Evans

    2012-01-01

    Full Text Available The central nervous system is composed of the brain and the spinal cord. The brain is a complex organ that processes and coordinates activities of the body in bilaterian, higher-order animals. The development of the brain mirrors its complex function as it requires intricate genetic signalling at specific times, and deviations from this can lead to brain malformations such as anencephaly. Research into how the CNS is specified and patterned has been studied extensively in chick, fish, frog, and mice, but findings from the latter will be emphasised here as higher-order mammals show most similarity to the human brain. Specifically, we will focus on the embryonic development of an important forebrain structure, the striatum (also known as the dorsal striatum or neostriatum. Over the past decade, research on striatal development in mice has led to an influx of new information about the genes involved, but the precise orchestration between the genes, signalling molecules, and transcription factors remains unanswered. We aim to summarise what is known to date about the tightly controlled network of interacting genes that control striatal development. This paper will discuss early telencephalon patterning and dorsal ventral patterning with specific reference to the genes involved in striatal development.

  13. The adenosine A2B receptor is involved in anion secretion in human pancreatic duct Capan-1 epithelial cells

    DEFF Research Database (Denmark)

    Hayashi, M.; Inagaki, A.; Novak, Ivana

    2016-01-01

    Adenosine modulates a wide variety of biological processes via adenosine receptors. In the exocrine pancreas, adenosine regulates transepithelial anion secretion in duct cells and is considered to play a role in acini-to-duct signaling. To identify the functional adenosine receptors and Cl...... by CFTRinh-172, a cystic fibrosis transmembrane conductance regulator (CFTR) Cl− channel inhibitor. The adenosine A2B receptor agonist, BAY 60-6583, increased Isc and whole-cell Cl− currents through CFTR Cl− channels, whereas the A2A receptor agonist, CGS 21680, had negligible effects. The A2B receptor....... These results demonstrate that luminal adenosine regulates anion secretion by activating CFTR Cl− channels via adenosine A2B receptors on the luminal membranes of Capan-1 cells. The present study endorses that purinergic signaling is important in the regulation of pancreatic secretion....

  14. Identification of the A2 adenosine receptor binding subunit by photoaffinity crosslinking

    International Nuclear Information System (INIS)

    Barrington, W.W.; Jacobson, K.A.; Hutchison, A.J.; Williams, M.; Stiles, G.L.

    1989-01-01

    A high-affinity iodinated agonist radioligand for the A2 adenosine receptor has been synthesized to facilitate studies of the A2 adenosine receptor binding subunit. The radioligand 125I-labeled PAPA-APEC (125I-labeled 2-[4-(2-[2-[(4- aminophenyl)methylcarbonylamino]ethylaminocarbonyl]- ethyl)phenyl]ethylamino-5'-N-ethylcarboxamidoadenosine) was synthesized and found to bind to the A2 adenosine receptor in bovine striatal membranes with high affinity (Kd = 1.5 nM) and A2 receptor selectivity. Competitive binding studies reveal the appropriate A2 receptor pharmacologic potency order with 5'-N-ethylcarboxamidoadenosine (NECA) greater than (-)-N6-[(R)-1-methyl- 2-phenylethyl]adenosine (R-PIA) greater than (+)-N6-[(S)-1-methyl-2- phenylethyl]adenosine (S-PIA). Adenylate cyclase assays, in human platelet membranes, demonstrate a dose-dependent stimulation of cAMP production. PAPA-APEC (1 microM) produces a 43% increase in cAMP production, which is essentially the same degree of increase produced by 5'-N- ethylcarboxamidoadenosine (the prototypic A2 receptor agonist). These findings combined with the observed guanine nucleotide-mediated decrease in binding suggest that PAPA-APEC is a full A2 agonist. The A2 receptor binding subunit was identified by photoaffinity-crosslinking studies using 125I-labeled PAPA-APEC and the heterobifunctional crosslinking agent N-succinimidyl 6-(4'-azido-2'-nitrophenylamino)hexanoate (SANPAH). After covalent incorporation, a single specifically radiolabeled protein with an apparent molecular mass of 45 kDa was observed on NaDodSO4/PAGE/autoradiography. Incorporation of 125I-labeled PAPA-APEC into this polypeptide is blocked by agonists and antagonists with the expected potency for A2 receptors and is decreased in the presence of 10(-4) M guanosine 5'-[beta, gamma-imido]triphosphate

  15. Striatal dopamine transporter binding correlates with serum BDNF levels in patients with striatal dopaminergic neurodegeneration

    DEFF Research Database (Denmark)

    Ziebell, Morten; Khalid, Usman; Klein, Anders B

    2012-01-01

    BDNF levels in patients with parkinsonism. Twenty-one patients with abnormal in vivo striatal dopamine transporter (DAT) binding as evidenced with [(123)I]PE2I SPECT brain scanning were included. Samples for serum BDNF levels were collected at the time of the SPECT scanning, and BDNF was measured...

  16. Purine molecules as hypnogenic factors role of adenosine, ATP, and caffeine.

    Science.gov (United States)

    Díaz-Muñoz, M; Salín-Pascual, R

    2010-12-01

    Purines are ubiquitous molecules with important roles in the regulation of metabolic networks and signal transduction events. In the central nervous system, adenosine and ATP modulate the sleep-wake cycle, acting as ligands of specific transmembrane receptors and as allosteric effectors of key intracellular enzymes for brain energy expenditure. Two types of adenosine receptors seem to be relevant to the sleep function, A1 and A2A. Caffeine, an antagonist of adenosine receptors, has been used as a tool in some of the studies reviewed in the present chapter. Possible changes in adenosine functioning due to the aging process have been observed in animal models and abnormalities in the adenosine system could also explain primary insomnia or the reduced amount of delta sleep and increased sensitivity to caffeine in some subjects with sleep deficits. Caffeine is a methylated-derivate of xanthine with profound effects on the onset and quality of sleep episodes. This purine acts principally as an antagonist of the A2A receptors. Adenosine and ATP in the nervous system are the bridge between metabolic activity, recovery function, and purinergic transmission that underlies the daily wake-sleep cycle in mammals. Modulators of purine actions have the potential to alleviate insomnia and other sleep disorders based on their physiopathological role during the sleep process.

  17. Potentiation of adenosine triphosphate-induced contractile responses of the guinea-pig isolated vas deferens by adenosine monophosphate and adenosine 5'-monophosphorothioate.

    OpenAIRE

    Fedan, J. S.

    1987-01-01

    The effects of incubating the guinea-pig isolated vas deferens in the presence of adenine nucleotides (adenosine triphosphate, ATP; adenosine diphosphate, ADP; and adenosine monophosphate, AMP), or in the presence of their phosphorothioate analogues (adenosine 5'-O-(3-thiotriphosphate), ATP gamma S; adenosine 5'-O-(2-thiodiphosphate), ADP beta S; and adenosine 5'-monophosphorothioate, AMP alpha S), on contractile responses to ATP were compared. After challenge with a low (1 microM) or high (3...

  18. Intravenous adenosine SPECT thallium imaging

    International Nuclear Information System (INIS)

    Joyce, J.M.; Grossman, S.J.; Garrett, J.S.; Sharma, B.; Geller, M.; Sweeney, P.J.

    1991-01-01

    This paper determines the safety and efficacy of intravenous (IV) adenosine in females for the evaluation of coronary artery disease, since only limited data are available. Eighty consecutive studies of 78 female subjects (aged 43-83 years) using IV adenosine (0.14 mg/kg per minute) with T1-201 SPECT imaging were reviewed. Fifty-eight (73%) had mild symptoms; mild dyspnea (24%), flushing (23%), chest pain (23%), headache (11%), dizziness (11%), weakness (9%), nausea (8%), abdominal pain (8%), arm pain (6%), chest tightness (4%), neck tightness (4%), dry mouth (4%), and dropped P waves (4%). Four had moderate symptoms: dyspnea requiring Proventil or aminophylline (2%), significant hypotension (1%), and third-degree atrioventicular heart block (1%). Two had severe symptoms (ventricular tachycardia requiring cardioversion (1%) and severe dyspnea requiring epinephrine (1%). Twenty-two (28%) underwent cardiac catheterization that demonstrated coronary artery disease or postangioplasty results. The thallium SPECT images were 94% sensitive and 100% specific in detecting significant disease. The one false-negative result was in a subject who experienced no symptoms for ECG changes during adenosine infusion. Ischemic ECG changes were 35% sensitive and 100% specific. Chest pain was 53% sensitive and 60% specific

  19. Synthesis, biological evaluation, and molecular modeling of ribose-modified adenosine analogues as adenosine receptor agonists.

    Science.gov (United States)

    Cappellacci, Loredana; Franchetti, Palmarisa; Pasqualini, Michela; Petrelli, Riccardo; Vita, Patrizia; Lavecchia, Antonio; Novellino, Ettore; Costa, Barbara; Martini, Claudia; Klotz, Karl-Norbert; Grifantini, Mario

    2005-03-10

    A number of 3'-C-methyl analogues of selective adenosine receptor agonists such as CPA, CHA, CCPA, 2'-Me-CCPA, NECA, and IB-MECA was synthesized to further investigate the subdomain of the receptor that binds the ribose moiety of the ligands. Affinity data at A(1), A(2A), and A(3) receptors in bovine brain membranes showed that the 3'-C-modification in adenosine resulted in a decrease of the affinity at all three receptor subtypes. When this modification was combined with N(6)-substitution with groups that induce high potency and selectivity at A(1) receptor, the affinity and selectivity were increased. However, all 3'-C-methyl derivatives proved to be very less active than the corresponding 2'-C-methyl analogues. The most active compound was found to be 3'-Me-CPA which displayed a K(i) value of 0.35 microM at A(1) receptor and a selectivity for A(1) vs A(2A) and A(3) receptors higher than 28-fold. 2'-Me-CCPA was confirmed to be the most selective, high affinity agonist so far known also at human A(1) receptor with a K(i) value of 3.3 nM and 2903- and 341-fold selective vs human A(2A) and A(3) receptors, respectively. In functional assay, 3'-Me-CPA, 3'-Me-CCPA, and 2-Cl-3'-Me-IB-MECA inhibited forskolin-stimulated adenylyl cyclase activity with IC(50) values ranging from 0.3 to 4.9 microM, acting as full agonists. A rhodopsin-based model of the bovine A(1)AR was built to rationalize the higher affinity and selectivity of 2'-C-methyl derivatives of N(6)-substituted-adenosine compared to that of 3'-C-methyl analogues. In the docking exploration, it was found that 2'-Me-CCPA was able to form a number of interactions with several polar residues in the transmembrane helices TM-3, TM-6, and TM-7 of bA(1)AR which were not preserved in the molecular dynamics simulation of 3'-Me-CCPA/bA(1)AR complex.

  20. Role of Adenosine Receptor A2A in Traumatic Optic Neuropathies

    Science.gov (United States)

    2015-02-01

    CAT GGC CTC CAA GGA GTAAGA GAG GGA GAT GCT CAG TGT TGG M32599 18S AGT GCG GGT CAT AAG CTT GC GGG CCT CAC TAA ACC ATC CA NR_003278 55S. Ahmad et al...CAT GGC CTC CAA GGA GTAAGA M32599 GAG GGA GAT GCT CAG TGTTGG 185 AGT GCG GGT CAT MG CTT GC NR...003278 GGG CCT CACTAA ACCATCCA MD) counter stained...TAGTCCTTCCTACCCCAATTTCC TTGGTCCTTAGCCACTCCTTC NM_031168.1 GAPDH CAT GGC CTC CAA GGA GTAAGAGAG GGA GAT GCT CAG TGT TGG M32599 18S AGT GCG GGT CAT AAG CTT GC GGG CCT

  1. Targeting Adenosine A2A Receptors in Parkinson’s Disease

    Science.gov (United States)

    2006-11-01

    NCT) is commonly used to treat apnea of prematurity in clinics. We recently demonstrated that NCT persistently augments the ventilatory response to...comparatively low dose of 0.03 mg/kg, CGS-21680 attenuated the increased premature responding produced by amphetamine (1 mg/kg). Conclusion: The present

  2. Extracellular adenosine-induced Rac1 activation in pulmonary endothelium: Molecular mechanisms and barrier-protective role.

    Science.gov (United States)

    Kovacs-Kasa, Anita; Kim, Kyung Mi; Cherian-Shaw, Mary; Black, Stephen M; Fulton, David J; Verin, Alexander D

    2018-08-01

    We have previously shown that Gs-coupled adenosine receptors (A2a) are primarily involved in adenosine-induced human pulmonary artery endothelial cell (HPAEC) barrier enhancement. However, the downstream events that mediate the strengthening of the endothelial cell (EC) barrier via adenosine signaling are largely unknown. In the current study, we tested the overall hypothesis that adenosine-induced Rac1 activation and EC barrier enhancement is mediated by Gs-dependent stimulation of cAMP-dependent Epac1-mediated signaling cascades. Adenoviral transduction of HPAEC with constitutively-active (C/A) Rac1 (V12Rac1) significantly increases transendothelial electrical resistance (TER) reflecting an enhancement of the EC barrier. Conversely, expression of an inactive Rac1 mutant (N17Rac1) decreases TER reflecting a compromised EC barrier. The adenosine-induced increase in TER was accompanied by activation of Rac1, decrease in contractility (MLC dephosphorylation), but not Rho inhibition. Conversely, inhibition of Rac1 activity attenuates adenosine-induced increase in TER. We next examined the role of cAMP-activated Epac1 and its putative downstream targets Rac1, Vav2, Rap1, and Tiam1. Depletion of Epac1 attenuated the adenosine-induced Rac1 activation and the increase in TER. Furthermore, silencing of Rac1 specific guanine nucleotide exchange factors (GEFs), Vav2 and Rap1a expression significantly attenuated adenosine-induced increases in TER and activation of Rac1. Depletion of Rap1b only modestly impacted adenosine-induced increases in TER and Tiam1 depletion had no effect on adenosine-induced Rac1 activation and TER. Together these data strongly suggest that Rac1 activity is required for adenosine-induced EC barrier enhancement and that the activation of Rac1 and ability to strengthen the EC barrier depends, at least in part, on cAMP-dependent Epac1/Vav2/Rap1-mediated signaling. © 2017 Wiley Periodicals, Inc.

  3. Partial separation of platelet and placental adenosine receptors from adenosine A2-like binding protein

    International Nuclear Information System (INIS)

    Zolnierowicz, S.; Work, C.; Hutchison, K.; Fox, I.H.

    1990-01-01

    The ubiquitous adenosine A2-like binding protein obscures the binding properties of adenosine receptors assayed with 5'-N-[ 3 H]ethylcarboxamidoadenosine [( 3 H]NECA). To solve this problem, we developed a rapid and simple method to separate adenosine receptors from the adenosine A2-like binding protein. Human platelet and placental membranes were solubilized with 1% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate. The soluble platelet extract was precipitated with polyethylene glycol and the fraction enriched in adenosine receptors was isolated from the precipitate by differential centrifugation. The adenosine A2-like binding protein was removed from the soluble placental extract with hydroxylapatite and adenosine receptors were precipitated with polyethylene glycol. The specificity of the [ 3 H]NECA binding is typical of an adenosine A2 receptor for platelets and an adenosine A1 receptor for placenta. This method leads to enrichment of adenosine A2 receptors for platelets and adenosine A1 receptors for placenta. This provides a useful preparation technique for pharmacologic studies of adenosine receptors

  4. Assessment of striatal & postural deformities in patients with Parkinson's disease

    Directory of Open Access Journals (Sweden)

    Sanjay Pandey

    2016-01-01

    Interpretation & conclusions: Our results showed that striatal and postural deformities were common and present in about half of the patients with PD. These deformities we more common in patients with advanced stage of PD.

  5. Prefrontal cortex and striatal activation by feedback in Parkinson's disease

    NARCIS (Netherlands)

    Keitz, Martijn; Koerts, Janneke; Kortekaas, Rudie; Renken, Remco; de Jong, Bauke M.; Leenders, Klaus L.

    2008-01-01

    Positive feedbacks reinforce goal-directed behavior and evoke pleasure. in Parkinson's disease (PD) the striatal dysfunction impairs motor performance, but also may lead to decreased positive feedback (reward) processing. This study investigates two types of positive feedback processing (monetary

  6. Striatal dysfunction in attention deficit and hyperkinetic disorder

    Energy Technology Data Exchange (ETDEWEB)

    Lou, H.C.; Henriksen, L.; Bruhn, P.; Borner, H.; Nielsen, J.B.

    1989-01-01

    We have previously reported that periventricular structures are hypoperfused in attention deficit and hyperactivity disorder (ADHD). This study has expanded the number of patients, who were divided into two groups: six patients with pure ADHD, and 13 patients with ADHD in combination with other neurologic symptoms. By using xenon 133 inhalation and emission tomography, the regional cerebral blood flow distribution was determined and compared with a control group. Striatal regions were found to be hypoperfused and, by inference, hypofunctional in both groups. This hypoperfusion was statistically significant in the right striatum in ADHD, and in both striatal regions in ADHD with other neuropsychologic and neurologic symptoms. The primary sensory and sensorimotor cortical regions were highly perfused. Methylphenidate increased flow to striatal and posterior periventricular regions, and tended to decrease flow to primary sensory regions. Low striatal activity, partially reversible with methylphenidate, appears to be a cardinal feature in ADHD.

  7. Striatal dysfunction in attention deficit and hyperkinetic disorder

    International Nuclear Information System (INIS)

    Lou, H.C.; Henriksen, L.; Bruhn, P.; Borner, H.; Nielsen, J.B.

    1989-01-01

    We have previously reported that periventricular structures are hypoperfused in attention deficit and hyperactivity disorder (ADHD). This study has expanded the number of patients, who were divided into two groups: six patients with pure ADHD, and 13 patients with ADHD in combination with other neurologic symptoms. By using xenon 133 inhalation and emission tomography, the regional cerebral blood flow distribution was determined and compared with a control group. Striatal regions were found to be hypoperfused and, by inference, hypofunctional in both groups. This hypoperfusion was statistically significant in the right striatum in ADHD, and in both striatal regions in ADHD with other neuropsychologic and neurologic symptoms. The primary sensory and sensorimotor cortical regions were highly perfused. Methylphenidate increased flow to striatal and posterior periventricular regions, and tended to decrease flow to primary sensory regions. Low striatal activity, partially reversible with methylphenidate, appears to be a cardinal feature in ADHD

  8. High salt diet exacerbates vascular contraction in the absence of adenosine A₂A receptor.

    Science.gov (United States)

    Pradhan, Isha; Zeldin, Darryl C; Ledent, Catherine; Mustafa, Jamal S; Falck, John R; Nayeem, Mohammed A

    2014-05-01

    High salt (4% NaCl, HS) diet modulates adenosine-induced vascular response through adenosine A(2A) receptor (A(2A)AR). Evidence suggests that A(2A)AR stimulates cyp450-epoxygenases, leading to epoxyeicosatrienoic acids (EETs) generation. The aim of this study was to understand the vascular reactivity to HS and underlying signaling mechanism in the presence or absence of A(2A)AR. Therefore, we hypothesized that HS enhances adenosine-induced relaxation through EETs in A(2A)AR⁺/⁺, but exaggerates contraction in A(2A)AR⁻/⁻. Organ bath and Western blot experiments were conducted in HS and normal salt (NS, 0.18% NaCl)-fed A(2A)AR⁺/⁺ and A(2A)AR⁻/⁻ mice aorta. HS produced concentration-dependent relaxation to non-selective adenosine analog, NECA in A(2A)AR⁺/⁺, whereas contraction was observed in A(2A)AR⁻/⁻ mice and this was attenuated by A₁AR antagonist (DPCPX). CGS 21680 (selective A(2A)AR agonist) enhanced relaxation in HS-A(2A)AR⁺/⁺ versus NS-A(2A)AR⁺/⁺, which was blocked by EETs antagonist (14,15-EEZE). Compared with NS, HS significantly upregulated the expression of vasodilators A(2A)AR and cyp2c29, whereas vasoconstrictors A₁AR and cyp4a in A(2A)AR⁺/⁺ were downregulated. In A(2A)AR⁻/⁻ mice, however, HS significantly downregulated the expression of cyp2c29, whereas A₁AR and cyp4a were upregulated compared with A(2A)AR⁺/⁺ mice. Hence, our data suggest that in A(2A)AR⁺/⁺, HS enhances A(2A)AR-induced relaxation through increased cyp-expoxygenases-derived EETs and decreased A₁AR levels, whereas in A(2A)AR⁻/⁻, HS exaggerates contraction through decreased cyp-epoxygenases and increased A₁AR levels.

  9. Striatal grafts in a rat model of Huntington's disease

    DEFF Research Database (Denmark)

    Guzman, R; Meyer, M; Lövblad, K O

    1999-01-01

    Survival and integration into the host brain of grafted tissue are crucial factors in neurotransplantation approaches. The present study explored the feasibility of using a clinical MR scanner to study striatal graft development in a rat model of Huntington's disease. Rat fetal lateral ganglionic...... eminences grown as free-floating roller-tube cultures can be successfully grafted in a rat Huntington model and that a clinical MR scanner offers a useful noninvasive tool for studying striatal graft development....

  10. Striatal direct and indirect pathways control decision-making behavior

    OpenAIRE

    Macpherson, Tom; Morita, Makiko; Hikida, Takatoshi

    2014-01-01

    Despite our ever-changing environment, animals are remarkably adept at selecting courses of action that are predictive of optimal outcomes. While requiring the contribution of a number of brain regions, a vast body of evidence implicates striatal mechanisms of associative learning and action selection to be critical to this ability. While numerous models of striatal-based decision-making have been developed, it is only recently that we have begun to understand the precise contributions of spe...

  11. Inhibition of synaptically evoked cortical acetylcholine release by adenosine: an in vivo microdialysis study in the rat.

    Science.gov (United States)

    Materi, L M; Rasmusson, D D; Semba, K

    2000-01-01

    The release of cortical acetylcholine from the intracortical axonal terminals of cholinergic basal forebrain neurons is closely associated with electroencephalographic activity. One factor which may act to reduce cortical acetylcholine release and promote sleep is adenosine. Using in vivo microdialysis, we examined the effect of adenosine and selective adenosine receptor agonists and antagonists on cortical acetylcholine release evoked by electrical stimulation of the pedunculopontine tegmental nucleus in urethane anesthetized rats. All drugs were administered locally within the cortex by reverse dialysis. None of the drugs tested altered basal release of acetylcholine in the cortex. Adenosine significantly reduced evoked cortical acetylcholine efflux in a concentration-dependent manner. This was mimicked by the adenosine A(1) receptor selective agonist N(6)-cyclopentyladenosine and blocked by the selective A(1) receptor antagonist 8-cyclopentyl-1,3-dipropylxanthine (DPCPX). The A(2A) receptor agonist 2-[p-(2-carboxyethyl)-phenethylamino]-5'-N-ethylcarboxamidoadenosi ne hydrochloride (CGS 21680) did not alter evoked cortical acetylcholine release even in the presence of DPCPX. Administered alone, neither DPCPX nor the non-selective adenosine receptor antagonist caffeine affected evoked cortical acetylcholine efflux. Simultaneous delivery of the adenosine uptake inhibitors dipyridamole and S-(4-nitrobenzyl)-6-thioinosine significantly reduced evoked cortical acetylcholine release, and this effect was blocked by the simultaneous administration of caffeine. These data indicate that activation of the A(1) adenosine receptor inhibits acetylcholine release in the cortex in vivo while the A(2A) receptor does not influence acetylcholine efflux. Such inhibition of cortical acetylcholine release by adenosine may contribute to an increased propensity to sleep during prolonged wakefulness.

  12. Cocaine exposure modulates dopamine and adenosine signaling in the fetal brain

    Science.gov (United States)

    Kubrusly, Regina C. C.; Bhide, Pradeep G.

    2009-01-01

    Exposure to cocaine during the fetal period can produce significant lasting changes in the structure and function of the brain. Cocaine exerts its effects on the developing brain by blocking monoamine transporters and impairing monoamine receptor signaling. Dopamine is a major central target of cocaine. In a mouse model, we show that cocaine exposure from embryonic day 8 (E8) to E14 produces significant reduction in dopamine transporter activity, attenuation of dopamine D1-receptor function and upregulation of dopamine D2-receptor function. Cocaine’s effects on the D1-receptor are at the level of protein expression as well as activity. The cocaine exposure also produces significant increases in basal cAMP levels in the striatum and cerebral cortex. The increase in the basal cAMP levels was independent of dopamine receptor activity. In contrast, blocking the adenosine A2a receptor downregulated of the basal cAMP levels in the cocaine-exposed brain to physiological levels, suggesting the involvement of adenosine receptors in mediating cocaine’s effects on the embryonic brain. In support of this suggestion, we found that the cocaine exposure downregulated adenosine transporter function. We also found that dopamine D2- and adenosine A2a-receptors antagonize each other’s function in the embryonic brain in a manner consistent with their interactions in the mature brain. Thus, our data show that prenatal cocaine exposure produces direct effects on both the dopamine and adenosine systems. Furthermore, the dopamine D2 and adenosine A2a receptor interactions in the embryonic brain discovered in this study unveil a novel substrate for cocaine’s effects on the developing brain. PMID:19765599

  13. Repeated administration of adenosine increases its cardiovascular effects in rats.

    Science.gov (United States)

    Vidrio, H; García-Márquez, F; Magos, G A

    1987-01-20

    Hypotensive and negative chronotropic responses to adenosine in anesthetized rats increased after previous administration of the nucleoside. Bradycardia after adenosine in the isolated perfused rat heart was also potentiated after repeated administration at short intervals. This self-potentiation could be due to extracellular accumulation of adenosine and persistent stimulation of receptors caused by saturation or inhibition of cellular uptake of adenosine.

  14. Ribose-modified nucleosides as ligands for adenosine receptors: synthesis, conformational analysis, and biological evaluation of 1'-C-methyl adenosine analogues.

    Science.gov (United States)

    Cappellacci, Loredana; Barboni, Grazia; Palmieri, Micaela; Pasqualini, Michela; Grifantini, Mario; Costa, Barbara; Martini, Claudia; Franchetti, Palmarisa

    2002-03-14

    1'-C-Methyl analogues of adenosine and selective adenosine A(1) receptor agonists, such as N-[(1R)-1-methyl-2-phenylethyl]adenosine ((R)-PIA) and N(6)-cyclopentyladenosine, were synthesized to further investigate the subdomain that binds the ribose moiety. Binding affinities of these new compounds at A(1) and A(2A) receptors in rat brain membranes and at A(3) in rat testis membranes were determined and compared. It was found that the 1'-C-methyl modification in adenosine resulted in a decrease of affinity, particularly at A(1) and A(2A) receptors. When this modification was combined with N(6) substitutions with groups that induce high potency and selectivity at A(1) receptors, the high affinity was in part restored and the selectivity was increased. The most potent compound proved to be the 1'-C-methyl analogue of (R)-PIA with a K(i) of 23 nM for the displacement of [(3)H]CHA binding from rat brain A(1) receptors and a > 435-fold selectivity over A(2A) receptors. In functional assays, these compounds inhibited forskolin-stimulated adenylate cyclase with IC(50) values ranging from 0.065 to 3.4 microM, acting as full agonists. Conformational analysis based on vicinal protonminus signproton J-coupling constants and molecular mechanics calculations using the MM2 force field proved that the methyl group on C1' in adenosine has a pronounced impact on the furanose conformation by driving its conformational equilibrium toward the north, gamma+, syn form.

  15. Role of adenosine receptors in caffeine tolerance

    International Nuclear Information System (INIS)

    Holtzman, S.G.; Mante, S.; Minneman, K.P.

    1991-01-01

    Caffeine is a competitive antagonist at adenosine receptors. Receptor up-regulation during chronic drug treatment has been proposed to be the mechanism of tolerance to the behavioral stimulant effects of caffeine. This study reassessed the role of adenosine receptors in caffeine tolerance. Separate groups of rats were given scheduled access to drinking bottles containing plain tap water or a 0.1% solution of caffeine. Daily drug intake averaged 60-75 mg/kg and resulted in complete tolerance to caffeine-induced stimulation of locomotor activity, which could not be surmounted by increasing the dose of caffeine. 5'-N-ethylcarboxamidoadenosine (0.001-1.0 mg/kg) dose dependently decreased the locomotor activity of caffeine-tolerant rats and their water-treated controls but was 8-fold more potent in the latter group. Caffeine (1.0-10 mg/kg) injected concurrently with 5-N-ethylcarboxamidoadenosine antagonized the decreases in locomotor activity comparably in both groups. Apparent pA2 values for tolerant and control rats also were comparable: 5.05 and 5.11. Thus, the adenosine-antagonist activity of caffeine was undiminished in tolerant rats. The effects of chronic caffeine administration on parameters of adenosine receptor binding and function were measured in cerebral cortex. There were no differences between brain tissue from control and caffeine-treated rats in number and affinity of adenosine binding sites or in receptor-mediated increases (A2 adenosine receptor) and decreases (A1 adenosine receptor) in cAMP accumulation. These results are consistent with theoretical arguments that changes in receptor density should not affect the potency of a competitive antagonist. Experimental evidence and theoretical considerations indicate that up-regulation of adenosine receptors is not the mechanism of tolerance to caffeine-induced stimulation of locomotor activity

  16. Calcium modulates calmodulin/α-actinin 1 interaction with and agonist-dependent internalization of the adenosine A2Areceptor.

    Science.gov (United States)

    Piirainen, Henni; Taura, Jaume; Kursula, Petri; Ciruela, Francisco; Jaakola, Veli-Pekka

    2017-04-01

    Adenosine receptors are G protein-coupled receptors that sense extracellular adenosine to transmit intracellular signals. One of the four adenosine receptor subtypes, the adenosine A 2A receptor (A 2A R), has an exceptionally long intracellular C terminus (A 2A R-ct) that mediates interactions with a large array of proteins, including calmodulin and α-actinin. Here, we aimed to ascertain the α-actinin 1/calmodulin interplay whilst binding to A 2A R and the role of Ca 2+ in this process. First, we studied the A 2A R-α-actinin 1 interaction by means of native polyacrylamide gel electrophoresis, isothermal titration calorimetry, and surface plasmon resonance, using purified recombinant proteins. α-Actinin 1 binds the A 2A R-ct through its distal calmodulin-like domain in a Ca 2+ -independent manner with a dissociation constant of 5-12μM, thus showing an ~100 times lower affinity compared to the A 2A R-calmodulin/Ca 2+ complex. Importantly, calmodulin displaced α-actinin 1 from the A 2A R-ct in a Ca 2+ -dependent fashion, disrupting the A 2A R-α-actinin 1 complex. Finally, we assessed the impact of Ca 2+ on A 2A R internalization in living cells, a function operated by the A 2A R-α-actinin 1 complex. Interestingly, while Ca 2+ influx did not affect constitutive A 2A R endocytosis, it abolished agonist-dependent internalization. In addition, we demonstrated that the A 2A R/α-actinin interaction plays a pivotal role in receptor internalization and function. Overall, our results suggest that the interplay of A 2A R with calmodulin and α-actinin 1 is fine-tuned by Ca 2+ , a fact that might power agonist-mediated receptor internalization and function. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Does human presynaptic striatal dopamine function predict social conformity?

    Science.gov (United States)

    Stokes, Paul R A; Benecke, Aaf; Puraite, Julita; Bloomfield, Michael A P; Shotbolt, Paul; Reeves, Suzanne J; Lingford-Hughes, Anne R; Howes, Oliver; Egerton, Alice

    2014-03-01

    Socially desirable responding (SDR) is a personality trait which reflects either a tendency to present oneself in an overly positive manner to others, consistent with social conformity (impression management (IM)), or the tendency to view one's own behaviour in an overly positive light (self-deceptive enhancement (SDE)). Neurochemical imaging studies report an inverse relationship between SDR and dorsal striatal dopamine D₂/₃ receptor availability. This may reflect an association between SDR and D₂/₃ receptor expression, synaptic dopamine levels or a combination of the two. In this study, we used a [¹⁸F]-DOPA positron emission tomography (PET) image database to investigate whether SDR is associated with presynaptic dopamine function. Striatal [¹⁸F]-DOPA uptake, (k(i)(cer), min⁻¹), was determined in two independent healthy participant cohorts (n=27 and 19), by Patlak analysis using a cerebellar reference region. SDR was assessed using the revised Eysenck Personality Questionnaire (EPQ-R) Lie scale, and IM and SDE were measured using the Paulhus Deception Scales. No significant associations were detected between Lie, SDE or IM scores and striatal [¹⁸F]-DOPA k(i)(cer). These results indicate that presynaptic striatal dopamine function is not associated with social conformity and suggests that social conformity may be associated with striatal D₂/₃ receptor expression rather than with synaptic dopamine levels.

  18. A2A Receptor Antagonism and Dyskinesia in Parkinson’s Disease

    Directory of Open Access Journals (Sweden)

    Micaela Morelli

    2012-01-01

    Full Text Available Dyskinesia, a major complication of treatment of Parkinson’s disease (PD, involves two phases: induction, which is responsible for dyskinesia onset, and expression, which underlies its clinical manifestation. The unique cellular and regional distribution of adenosine A2A receptors in basal ganglia areas that are richly innervated by dopamine, and their antagonistic role towards dopamine receptor stimulation, have positioned A2A receptor antagonists as an attractive nondopaminergic target to improve the motor deficits that characterize PD. In this paper, we describe the biochemical characteristics of A2A receptors and the effects of adenosine A2A antagonists in rodent and primate models of PD on L-DOPA-induced dyskinesia, together with relevant biomarker studies. We also review clinical trials of A2A antagonists as adjuncts to L-DOPA in PD patients with motor fluctuations. These studies have generally demonstrated that the addition of an A2A antagonist to a stable L-DOPA regimen reduces OFF time and mildly increases dyskinesia. However, limited clinical data suggest that the addition of an A2A antagonist along with a reduction of L-DOPA might maintain anti-Parkinsonian benefit and reduce dyskinesia. Whether A2A antagonists might reduce the development of dyskinesia has not yet been tested clinically.

  19. Adenosine receptors in rat and human pancreatic ducts stimulate chloride transport

    DEFF Research Database (Denmark)

    Novak, Ivana; Hede, Susanne; Hansen, Mette

    2007-01-01

    adenocarcinoma lines showed that they express A(1), A(2A), A(2B), and A(3) receptors. Real-time PCR revealed relatively low messenger RNA levels of adenosine receptors compared to beta-actin; the rank order for the receptors was A(2A) > A(2B) >/= A(3) >> A(1) for rat pancreas and A(2B) > A(2A) >> A(3) >/= A(1......) for duct cell lines. Whole-cell patch-clamp recordings on rat pancreatic ducts showed that, in about half of the recordings, adenosine depolarized the membrane voltage, and this was because of the opening of Cl(-) channels. Using a Cl(-)-sensitive fluorophore and single-cell imaging on duct cell lines...

  20. Striatal dopamine release codes uncertainty in pathological gambling

    DEFF Research Database (Denmark)

    Linnet, Jakob; Mouridsen, Kim; Peterson, Ericka

    2012-01-01

    Two mechanisms of midbrain and striatal dopaminergic projections may be involved in pathological gambling: hypersensitivity to reward and sustained activation toward uncertainty. The midbrain—striatal dopamine system distinctly codes reward and uncertainty, where dopaminergic activation is a linear...... dopamine release, and we used performance on the Iowa Gambling Task (IGT) to determine overall reward and uncertainty. We hypothesized that we would find a linear function between dopamine release and IGT performance, if dopamine release coded reward in pathological gambling. If, on the other hand......, dopamine release coded uncertainty, we would find an inversely U-shaped function. The data supported an inverse U-shaped relation between striatal dopamine release and IGT performance if the pathological gambling group, but not in the healthy control group. These results are consistent with the hypothesis...

  1. Re-emergence of striatal cholinergic interneurons in movement disorders.

    Science.gov (United States)

    Pisani, Antonio; Bernardi, Giorgio; Ding, Jun; Surmeier, D James

    2007-10-01

    Twenty years ago, striatal cholinergic neurons were central figures in models of basal ganglia function. But since then, they have receded in importance. Recent studies are likely to lead to their re-emergence in our thinking. Cholinergic interneurons have been implicated as key players in the induction of synaptic plasticity and motor learning, as well as in motor dysfunction. In Parkinson's disease and dystonia, diminished striatal dopaminergic signalling leads to increased release of acetylcholine by interneurons, distorting network function and inducing structural changes that undoubtedly contribute to the symptoms. By contrast, in Huntington's disease and progressive supranuclear palsy, there is a fall in striatal cholinergic markers. This review gives an overview of these recent experimental and clinical studies, placing them within the context of the pathogenesis of movement disorders.

  2. Reduced striatal D2 receptor binding in myoclonus-dystonia

    International Nuclear Information System (INIS)

    Beukers, R.J.; Weisscher, N.; Tijssen, M.A.J.; Booij, J.; Zijlstra, F.; Amelsvoort, T.A.M.J. van

    2009-01-01

    To study striatal dopamine D 2 receptor availability in DYT11 mutation carriers of the autosomal dominantly inherited disorder myoclonus-dystonia (M-D). Fifteen DYT11 mutation carriers (11 clinically affected) and 15 age- and sex-matched controls were studied using 123 I-IBZM SPECT. Specific striatal binding ratios were calculated using standard templates for striatum and occipital areas. Multivariate analysis with corrections for ageing and smoking showed significantly lower specific striatal to occipital IBZM uptake ratios (SORs) both in the left and right striatum in clinically affected patients and also in all DYT11 mutation carriers compared to control subjects. Our findings are consistent with the theory of reduced dopamine D 2 receptor (D2R) availability in dystonia, although the possibility of increased endogenous dopamine, and consequently, competitive D2R occupancy cannot be ruled out. (orig.)

  3. Adenosine stress protocols for myocardial perfusion imaging

    Directory of Open Access Journals (Sweden)

    Baškot Branislav

    2008-01-01

    Full Text Available Background/Aim. Treadmill test combined with myocardial perfusion scintigraphy (MPS is a commonly used technique in the assessment of coronary artery disease. There are many patients, however, who may not be able to undergo treadmill test. Such patients would benefit from pharmacological stress procedures combined with MPS. The most commonly used pharmacological agents for cardiac stress are coronary vasodilatators (adenosine, dipyridamol and catecholamines. Concomitant low-level treadmill exercise with adenosine pharmacologic stress (AdenoEX during MPS has become commonly used in recent years. A number of studies have demonstrated a beneficial impact of AdenoEX protocol. The aim of the study was, besides introducing into practice the two types of protocols of pharmatological stress test with adenosine, as a preparation for MPS, to compare and monitor the frequency of their side effects to quality, acquisition, as well as to standardize the onset time of acquisition (diagnostic imaging for both protocols. Methods. A total of 130 patients underwent pharmacological stress test with adenosine (vasodilatator. In 108 of the patients we performed concomitant exercise (AdenoEX of low level (50W by a bicycle ergometar. In 28 of the patients we performed Adenosine abbreviated protocol (AdenoSCAN. Side effects of adenosine were followed and compared between the two kinds of protocols AdenoEX and AdenoSCAN. Also compared were image quality and suggested time of acquisition after the stress test. Results. Numerous side effects were found, but being short-lived they did not require any active interventions. The benefit of AdenoEX versus AdenoSCAN included decreased side effects (62% vs 87%, improved safety and patients tolerance, improved target-to-background ratios because of less subdiaphragmatic activity, earlier acquisition, and improved sensitivity. Conclusion. The safety and efficacy of adenosine pharmacological stress is even better with concomitant

  4. Impairment of striatal mitochondrial function by acute paraquat poisoning.

    Science.gov (United States)

    Czerniczyniec, Analía; Lanza, E M; Karadayian, A G; Bustamante, J; Lores-Arnaiz, S

    2015-10-01

    Mitochondria are essential for survival. Their primary function is to support aerobic respiration and to provide energy for intracellular metabolic pathways. Paraquat is a redox cycling agent capable of generating reactive oxygen species. The aim of the present study was to evaluate changes in cortical and striatal mitochondrial function in an experimental model of acute paraquat toxicity and to compare if the brain areas and the molecular mechanisms involved were similar to those observed after chronic exposure. Sprague-Dawley rats received paraquat (25 mg/Kg i.p.) or saline and were sacrificed after 24 h. Paraquat treatment decreased complex I and IV activity by 37 and 21 % respectively in striatal mitochondria. Paraquat inhibited striatal state 4 and state 3 KCN-sensitive respiration by 80 % and 62 % respectively, indicating a direct effect on respiratory chain. An increase of 2.2 fold in state 4 and 2.3 fold in state 3 in KCN-insensitive respiration was observed in striatal mitochondria from paraquat animals, suggesting that paraquat redox cycling also consumed oxygen. Paraquat treatment increased hydrogen peroxide production (150 %), TBARS production (42 %) and cardiolipin oxidation/depletion (12 %) in striatal mitochondria. Also, changes in mitochondrial polarization was induced after paraquat treatment. However, no changes were observed in any of these parameters in cortical mitochondria from paraquat treated-animals. These results suggest that paraquat treatment induced a clear striatal mitochondrial dysfunction due to both paraquat redox cycling reactions and impairment of the mitochondrial electron transport, causing oxidative damage. As a consequence, mitochondrial dysfunction could probably lead to alterations in cellular bioenergetics.

  5. Proteostasis in striatal cells and selective neurodegeneration in Huntington's disease.

    Science.gov (United States)

    Margulis, Julia; Finkbeiner, Steven

    2014-01-01

    Selective neuronal loss is a hallmark of neurodegenerative diseases, including Huntington's disease (HD). Although mutant huntingtin, the protein responsible for HD, is expressed ubiquitously, a subpopulation of neurons in the striatum is the first to succumb. In this review, we examine evidence that protein quality control pathways, including the ubiquitin proteasome system, autophagy, and chaperones, are significantly altered in striatal neurons. These alterations may increase the susceptibility of striatal neurons to mutant huntingtin-mediated toxicity. This novel view of HD pathogenesis has profound therapeutic implications: protein homeostasis pathways in the striatum may be valuable targets for treating HD and other misfolded protein disorders.

  6. Inhibition of the adenosine-5'-phosphosulfate-sulfotransferase activity from spinach, maize, and Chlorella by adenosine-5'-monophosphate.

    Science.gov (United States)

    Schmidt, A

    1975-01-01

    Adenosin-5'-phosphosulfate (APS) sulfotransferase from higher plants and algae seems to be regulated by adenosine-5'-monophosphate, an endproduct of the APS-sulfotransferase reaction. This was found in crude extracts of Spinacea oleracea L. and Zea mays L. and with partially purified APS-sulfotransferase fractions from Chlorella pyrenoidosa. Half-maximal inhibition with adenosine-5'-monophosphate, was found to be (a) 1.3 mM for Spinacea; (b) 1.3 mM for Zea; and (c) 1.6 mM for Chlorella. This inhibition is specific for adenosine-5'-monophosphate, adenosine and adenosine-3'-monophosphate having no inhibitory effect.

  7. Effect of caffeine on ischemia detection by adenosine single-photon emission computed tomography perfusion imaging.

    Science.gov (United States)

    Zoghbi, Gilbert J; Htay, Thien; Aqel, Raed; Blackmon, Linda; Heo, Jaekyeong; Iskandrian, Ami E

    2006-06-06

    The purpose of this research was to study the effect of one cup of coffee taken 1 h before adenosine stress on the results of myocardial perfusion imaging. Caffeine is believed to attenuate the coronary hyperemic response to adenosine by competitive blockade of the A2a receptor. Caffeine is commonly withheld before adenosine single-photon emission computed tomography (SPECT) perfusion imaging so as not to mask ischemia detection. We studied the effect of one 8-oz cup of coffee taken 1 h before adenosine stress in patients who had demonstrable reversible defects on adenosine SPECT perfusion imaging performed while off caffeine. There were 22 men and 8 women, age 64 +/- 9 years. The blood level of caffeine 1 h after intake was 3.1 +/- 1.6 mg/l. There were two patients with ST-segment depression before and one after caffeine intake (p = NS). The summed stress score (SSS) based on 17 segments (scale of 0 to 3, 3 being normal) was 44 +/- 5 before and 45 +/- 5 after caffeine (p = NS). The summed difference score was 3.8 +/- 1.9 before and. 3.9 +/- 2.3 after caffeine (p = NS), reflecting that around 50% of the perfusion abnormality was reversible before and after caffeine. Using polar maps, the perfusion abnormality was 12 +/- 10% at baseline and 12 +/- 10% after caffeine (p = NS) in agreement with SSS. The left ventricular ejection fraction by gated SPECT was 50 +/- 13% at baseline and 51 +/- 13 % after caffeine (p = NS). A cup of coffee does not mask the presence or severity of reversible defects induced by adenosine SPECT imaging.

  8. Dysregulation of striatal projection neurons in Parkinson's disease.

    Science.gov (United States)

    Beck, Goichi; Singh, Arun; Papa, Stella M

    2018-03-01

    The loss of nigrostriatal dopamine (DA) is the primary cause of motor dysfunction in Parkinson's disease (PD), but the underlying striatal mechanisms remain unclear. In spite of abundant literature portraying structural, biochemical and plasticity changes of striatal projection neurons (SPNs), in the past there has been a data vacuum from the natural human disease and its close model in non-human primates. Recently, single-cell recordings in advanced parkinsonian primates have generated new insights into the altered function of SPNs. Currently, there are also human data that provide direct evidence of profoundly dysregulated SPN activity in PD. Here, we review primate recordings that are impacting our understanding of the striatal dysfunction after DA loss, particularly through the analysis of physiologic correlates of parkinsonian motor behaviors. In contrast to recordings in rodents, data obtained in primates and patients demonstrate similar major abnormalities of the spontaneous SPN firing in the alert parkinsonian state. Furthermore, these studies also show altered SPN responses to DA replacement in the advanced parkinsonian state. Clearly, there is yet much to learn about the striatal discharges in PD, but studies using primate models are contributing unique information to advance our understanding of pathophysiologic mechanisms.

  9. Striatal volume predicts level of video game skill acquisition.

    Science.gov (United States)

    Erickson, Kirk I; Boot, Walter R; Basak, Chandramallika; Neider, Mark B; Prakash, Ruchika S; Voss, Michelle W; Graybiel, Ann M; Simons, Daniel J; Fabiani, Monica; Gratton, Gabriele; Kramer, Arthur F

    2010-11-01

    Video game skills transfer to other tasks, but individual differences in performance and in learning and transfer rates make it difficult to identify the source of transfer benefits. We asked whether variability in initial acquisition and of improvement in performance on a demanding video game, the Space Fortress game, could be predicted by variations in the pretraining volume of either of 2 key brain regions implicated in learning and memory: the striatum, implicated in procedural learning and cognitive flexibility, and the hippocampus, implicated in declarative memory. We found that hippocampal volumes did not predict learning improvement but that striatal volumes did. Moreover, for the striatum, the volumes of the dorsal striatum predicted improvement in performance but the volumes of the ventral striatum did not. Both ventral and dorsal striatal volumes predicted early acquisition rates. Furthermore, this early-stage correlation between striatal volumes and learning held regardless of the cognitive flexibility demands of the game versions, whereas the predictive power of the dorsal striatal volumes held selectively for performance improvements in a game version emphasizing cognitive flexibility. These findings suggest a neuroanatomical basis for the superiority of training strategies that promote cognitive flexibility and transfer to untrained tasks.

  10. Dorsal striatal dopamine, food preference and health perception in humans

    NARCIS (Netherlands)

    Wallace, D.L.; Aarts, E.; Dang, L.C.; Greer, S.M.; Jagust, W.J.; D'Esposito, M.

    2014-01-01

    To date, few studies have explored the neurochemical mechanisms supporting individual differences in food preference in humans. Here we investigate how dorsal striatal dopamine, as measured by the positron emission tomography (PET) tracer [(18)F]fluorometatyrosine (FMT), correlates with food-related

  11. Adenosine and its Related Nucleotides may Modulate Gastric Acid ...

    African Journals Online (AJOL)

    Studies on lumen-perfused rat isolated stomachs showed that adenosine, adenosine monophosphate (AMP) and reduced nicotinamide adenine dinucleotide (NADH) inhibited histamine-induced gastric acid secretion. The inhibitions and the calcium levels of the serosal solution exhibited inverse relationship. Adenosine ...

  12. Estrogen stimulates adenosine receptor expression subtypes in human breast cancer MCF-7 cell line.

    Science.gov (United States)

    Mohamadi, Azam; Aghaei, Mahmoud; Panjehpour, Mojtaba

    2018-02-01

    Estrogen is a steroid hormone that plays a key role in the development and regulation of reproductive system. It has been shown that estrogen is related to breast cancer development through binding to its receptors. In order to uncover the estrogen effects on adenosine receptor expression, estrogen-positive MCF-7 cells were used to treat with agonist and antagonist of estrogen and then the mRNA expression of adenosine receptor subtypes were evaluated. Estrogen-positive MCF-7 cells were treated with various concentrations of 17β estradiol (E2) as an estrogen agonist, and ICI 182,780 as an estrogen antagonist. The gene expression of adenosine receptor subtypes were detected by real time RT-PCR. The results of MTT assay showed that E2 increased cell viability in a dose dependent manner. The expression pattern of all adenosine receptor subtypes are as follow; A2b > A1 > A2a > A3 in untreated MCF-7 cells. Obtained results showed that E2 incubation at 0.001-0.01 μM led to up-regulation of A1ARs, A2aARs and A3ARs dose dependently. E2 at 0.001 μM also had no significant effect on A2bARs expression but, at higher doses induced a considerable decrease in mRNA A2bARs expression. Treatment with antagonist confirmed that up-regulation of these receptors is mediated by estrogen receptor. Taken together, our results indicate that treatment of MCF-7 cells with E2 led to up-regulation of adenosine receptors. However, these effects were partially restored by treatment with antagonist suggesting that such effects are mediated by estrogen receptors.

  13. Adenosine A{sub 2A} receptor imaging with [{sup 11}C]KF18446 PET in the rat brain after quinolinic acid lesion. Comparison with the dopamine receptor imaging

    Energy Technology Data Exchange (ETDEWEB)

    Ishiwata, Kiichi; Ogi, Nobuo; Hayakawa, Nobutaka [Tokyo Metropolitan Inst. of Gerontology, Tokyo (Japan). Positron Medical Center] [and others

    2002-11-01

    We proposed [{sup 11}C]KF18446 as a selective radioligand for mapping the adenosine A{sub 2A} receptors being highly enriched in the striatum by positron emission tomography (PET). In the present study, we investigated whether [{sup 11}C]KF18446 PET can detect the change in the striatal adenosine A{sub 2A} receptors in the rat after unilateral injection of an excitotoxin quinolinic acid into the striatum, a Huntington's disease model, to demonstrate the usefulness of [{sup 11}C]KF18446. The extent of the striatal lesion was identified based on MRI, to which the PET was co-registered. The binding potential of [{sup 11}C]KF18446 significantly decreased in the quinolinic acid-lesioned striatum. The decrease was comparable to the decrease in the potential of [{sup 11}C] raclopride binding to dopamine D{sub 2} receptors in the lesioned striatum, but seemed to be larger than the decrease in the potential of [{sup 11}C]SCH23390 binding to dopamine D{sub 1} receptors. Ex vivo and in vitro autoradiography validated the PET signals. We concluded that [{sup 11}C]KF18446 PET can detect change in the adenosine A{sub 2A} receptors in the rat model, and will provide a new diagnostic tool for characterizing post-synaptic striatopallidal neurons in the stratum. (author)

  14. AMP and adenosine are both ligands for adenosine 2B receptor signaling.

    Science.gov (United States)

    Holien, Jessica K; Seibt, Benjamin; Roberts, Veena; Salvaris, Evelyn; Parker, Michael W; Cowan, Peter J; Dwyer, Karen M

    2018-01-15

    Adenosine is considered the canonical ligand for the adenosine 2B receptor (A 2B R). A 2B R is upregulated following kidney ischemia augmenting post ischemic blood flow and limiting tubular injury. In this context the beneficial effect of A 2B R signaling has been attributed to an increase in the pericellular concentration of adenosine. However, following renal ischemia both kidney adenosine monophosphate (AMP) and adenosine levels are substantially increased. Using computational modeling and calcium mobilization assays, we investigated whether AMP could also be a ligand for A 2B R. The computational modeling suggested that AMP interacts with more favorable energy to A 2B R compared with adenosine. Furthermore, AMPαS, a non-hydrolyzable form of AMP, increased calcium uptake by Chinese hamster ovary (CHO) cells expressing the human A 2B R, indicating preferential signaling via the G q pathway. Therefore, a putative AMP-A 2B R interaction is supported by the computational modeling data and the biological results suggest this interaction involves preferential G q activation. These data provide further insights into the role of purinergic signaling in the pathophysiology of renal IRI. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. A2BR adenosine receptor modulates sweet taste in circumvallate taste buds.

    Directory of Open Access Journals (Sweden)

    Shinji Kataoka

    Full Text Available In response to taste stimulation, taste buds release ATP, which activates ionotropic ATP receptors (P2X2/P2X3 on taste nerves as well as metabotropic (P2Y purinergic receptors on taste bud cells. The action of the extracellular ATP is terminated by ectonucleotidases, ultimately generating adenosine, which itself can activate one or more G-protein coupled adenosine receptors: A1, A2A, A2B, and A3. Here we investigated the expression of adenosine receptors in mouse taste buds at both the nucleotide and protein expression levels. Of the adenosine receptors, only A2B receptor (A2BR is expressed specifically in taste epithelia. Further, A2BR is expressed abundantly only in a subset of taste bud cells of posterior (circumvallate, foliate, but not anterior (fungiform, palate taste fields in mice. Analysis of double-labeled tissue indicates that A2BR occurs on Type II taste bud cells that also express Gα14, which is present only in sweet-sensitive taste cells of the foliate and circumvallate papillae. Glossopharyngeal nerve recordings from A2BR knockout mice show significantly reduced responses to both sucrose and synthetic sweeteners, but normal responses to tastants representing other qualities. Thus, our study identified a novel regulator of sweet taste, the A2BR, which functions to potentiate sweet responses in posterior lingual taste fields.

  16. AMP is an adenosine A1 receptor agonist.

    Science.gov (United States)

    Rittiner, Joseph E; Korboukh, Ilia; Hull-Ryde, Emily A; Jin, Jian; Janzen, William P; Frye, Stephen V; Zylka, Mark J

    2012-02-17

    Numerous receptors for ATP, ADP, and adenosine exist; however, it is currently unknown whether a receptor for the related nucleotide adenosine 5'-monophosphate (AMP) exists. Using a novel cell-based assay to visualize adenosine receptor activation in real time, we found that AMP and a non-hydrolyzable AMP analog (deoxyadenosine 5'-monophosphonate, ACP) directly activated the adenosine A(1) receptor (A(1)R). In contrast, AMP only activated the adenosine A(2B) receptor (A(2B)R) after hydrolysis to adenosine by ecto-5'-nucleotidase (NT5E, CD73) or prostatic acid phosphatase (PAP, ACPP). Adenosine and AMP were equipotent human A(1)R agonists in our real-time assay and in a cAMP accumulation assay. ACP also depressed cAMP levels in mouse cortical neurons through activation of endogenous A(1)R. Non-selective purinergic receptor antagonists (pyridoxalphosphate-6-azophenyl-2',4'-disulfonic acid and suramin) did not block adenosine- or AMP-evoked activation. Moreover, mutation of His-251 in the human A(1)R ligand binding pocket reduced AMP potency without affecting adenosine potency. In contrast, mutation of a different binding pocket residue (His-278) eliminated responses to AMP and to adenosine. Taken together, our study indicates that the physiologically relevant nucleotide AMP is a full agonist of A(1)R. In addition, our study suggests that some of the physiological effects of AMP may be direct, and not indirect through ectonucleotidases that hydrolyze this nucleotide to adenosine.

  17. Effects of adenosine infusion into renal interstitium on renal hemodynamics

    International Nuclear Information System (INIS)

    Pawlowska, D.; Granger, J.P.; Knox, F.G.

    1987-01-01

    This study was designed to investigate the hemodynamic effects of exogenous adenosine in the interstitium of the rat kidney. Adenosine or its analogues were infused into the renal interstitium by means of chronically implanted capsules. In fusion of adenosine decreased glomerular filtration rate (GFR) from 0.81 +/- 0.06 to 0.37 +/- 0.06 ml/min while having no effect on renal blood flow (RBF). The metabolically stable analogue, 2-chloradenosine (2-ClAdo), decreased GFR from 0.73 +/- 0.07 to 021 +/- 0.06 ml/min. Interstitial infusion of theophylline, an adenosine receptor antagonist, completely abolished the effects of adenosine and 2-ClAdo on GFR. The distribution of adenosine, when infused into the renal interstitium, was determined using radiolabeled 5'-(N-ethyl)-carboxamidoadenosine (NECA), a metabolically stable adenosine agonist. After continuous infusion, [ 3 H]NECA was distributed throughout the kidney. The effects of NECA to reduce GFR were similar to those of adenosine and 2-ClAdo. They conclude that increased levels of adenosine in the renal interstitium markedly decrease GFR without affecting RBF in steady-state conditions. The marked effects of adenosine agonists during their infusion into the renal interstitium and the complete blockade of these effects by theophylline suggest an extracellular action of adenosine

  18. Mucosal adenosine stimulates chloride secretion in canine tracheal epithelium

    Energy Technology Data Exchange (ETDEWEB)

    Pratt, A.D.; Clancy, G.; Welsh, M.J.

    1986-08-01

    Adenosine is a local regulator of a variety of physiological functions in many tissues and has been observed to stimulate secretion in several Cl-secreting epithelia. In canine tracheal epithelium the authors found that adenosine stimulates Cl secretion from both the mucosal and submucosal surfaces. Addition of adenosine, or its analogue 2-chloroadenosine, to the mucosal surface potently stimulated Cl secretion with no effect on the rate of Na absorption. Stimulation resulted from an interaction of adenosine with adenosine receptors, because it was blocked by the adenosine receptor blocker, 8-phenyltheophylline. The adenosine receptor was a stimulatory receptor as judged by the rank-order potency of adenosine and its analogues and by the increase in cellular adenosine 3',5'-cyclic monophosphate levels produced by 2-chloroadenosine. Adenosine also stimulated Cl secretion when it was added to the submucosal surface, although the maximal increase in secretion was less and it was much less potent. The observation that mucosal 8-phenyletheophylline blocked the effect of submucosal 2-chloroadenosine, whereas submucosal 8-phenyltheophylline did not prevent a response to mucosal or submucosal 2-chloroadenosine, suggests that adenosine receptors are located on the mucosal surface. Thus submucosal adenosine may stimulate secretion by crossing the epithelium and interacting with receptors located on the mucosal surface. Because adenosine can be released from mast cells located in the airway lumen in response to inhaled material, and because adenosine stimulated secretion from the mucosal surface, it may be in a unique position to control the epithelium on a regional level.

  19. Striatal Vulnerability in Huntington’s Disease: Neuroprotection Versus Neurotoxicity

    Directory of Open Access Journals (Sweden)

    Ryoma Morigaki

    2017-06-01

    Full Text Available Huntington’s disease (HD is an autosomal dominant neurodegenerative disease caused by the expansion of a CAG trinucleotide repeat encoding an abnormally long polyglutamine tract (PolyQ in the huntingtin (Htt protein. In HD, striking neuropathological changes occur in the striatum, including loss of medium spiny neurons and parvalbumin-expressing interneurons accompanied by neurodegeneration of the striosome and matrix compartments, leading to progressive impairment of reasoning, walking and speaking abilities. The precise cause of striatal pathology in HD is still unknown; however, accumulating clinical and experimental evidence suggests multiple plausible pathophysiological mechanisms underlying striatal neurodegeneration in HD. Here, we review and discuss the characteristic neurodegenerative patterns observed in the striatum of HD patients and consider the role of various huntingtin-related and striatum-enriched proteins in neurotoxicity and neuroprotection.

  20. Striatal dopamine release codes uncertainty in pathological gambling

    DEFF Research Database (Denmark)

    Linnet, Jakob; Mouridsen, Kim; Peterson, Ericka

    2012-01-01

    Two mechanisms of midbrain and striatal dopaminergic projections may be involved in pathological gambling: hypersensitivity to reward and sustained activation toward uncertainty. The midbrain—striatal dopamine system distinctly codes reward and uncertainty, where dopaminergic activation is a linear...... function of expected reward and an inverse U-shaped function of uncertainty. In this study, we investigated the dopaminergic coding of reward and uncertainty in 18 pathological gambling sufferers and 16 healthy controls. We used positron emission tomography (PET) with the tracer [11C]raclopride to measure...... dopamine release, and we used performance on the Iowa Gambling Task (IGT) to determine overall reward and uncertainty. We hypothesized that we would find a linear function between dopamine release and IGT performance, if dopamine release coded reward in pathological gambling. If, on the other hand...

  1. Endocannabinoid-dopamine interactions in striatal synaptic plasticity

    Directory of Open Access Journals (Sweden)

    Brian Neil Mathur

    2012-04-01

    Full Text Available The nigrostriatal dopaminergic system is implicated in action control and learning. A large body of work has focused on the contribution of this system to modulation of the corticostriatal synapse, the predominant synapse type in the striatum. Signaling through the D2 dopamine receptor is necessary for endocannabinoid-mediated depression of corticostriatal glutamate release. Here we review the known details of this mechanism and discuss newly discovered signaling pathways interacting with this system that ultimately exert dynamic control of cortical input to the striatum and striatal output. This topic is timely with respect to Parkinson’s disease given recent data indicating changes in the striatal endocannabinoid system in patients with this disorder.

  2. The Cognitive Architecture of Spatial Navigation: Hippocampal and Striatal Contributions.

    Science.gov (United States)

    Chersi, Fabian; Burgess, Neil

    2015-10-07

    Spatial navigation can serve as a model system in cognitive neuroscience, in which specific neural representations, learning rules, and control strategies can be inferred from the vast experimental literature that exists across many species, including humans. Here, we review this literature, focusing on the contributions of hippocampal and striatal systems, and attempt to outline a minimal cognitive architecture that is consistent with the experimental literature and that synthesizes previous related computational modeling. The resulting architecture includes striatal reinforcement learning based on egocentric representations of sensory states and actions, incidental Hebbian association of sensory information with allocentric state representations in the hippocampus, and arbitration of the outputs of both systems based on confidence/uncertainty in medial prefrontal cortex. We discuss the relationship between this architecture and learning in model-free and model-based systems, episodic memory, imagery, and planning, including some open questions and directions for further experiments. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. Centrality of striatal cholinergic transmission in basal ganglia function

    Directory of Open Access Journals (Sweden)

    Paola eBonsi

    2011-02-01

    Full Text Available Work over the past two decades revealed a previously unexpected role for striatal cholinergic interneurons in the context of basal ganglia function. The recognition that these interneurons are essential in synaptic plasticity and motor learning represents a significant step ahead in deciphering how the striatum processes cortical inputs, and why pathological circumstances cause motor dysfunction.Loss of the reciprocal modulation between dopaminergic inputs and the intrinsic cholinergic innervation within the striatum appears to be the trigger for pathophysiological changes occurring in basal ganglia disorders. Accordingly, there is now compelling evidence showing profound changes in cholinergic markers in these disorders, in particular Parkinson’s disease and dystonia.Based on converging experimental and clinical evidence, we provide an overview of the role of striatal cholinergic transmission in physiological and pathological conditions, in the context of the pathogenesis of movement disorders.

  4. Motor tics evoked by striatal disinhibition in the rat

    Science.gov (United States)

    Bronfeld, Maya; Yael, Dorin; Belelovsky, Katya; Bar-Gad, Izhar

    2013-01-01

    Motor tics are sudden, brief, repetitive movements that constitute the main symptom of Tourette syndrome (TS). Multiple lines of evidence suggest the involvement of the cortico-basal ganglia system, and in particular the basal ganglia input structure—the striatum in tic formation. The striatum receives somatotopically organized cortical projections and contains an internal GABAergic network of interneurons and projection neurons' collaterals. Disruption of local striatal GABAergic connectivity has been associated with TS and was found to induce abnormal movements in model animals. We have previously described the behavioral and neurophysiological characteristics of motor tics induced in monkeys by local striatal microinjections of the GABAA antagonist bicuculline. In the current study we explored the abnormal movements induced by a similar manipulation in freely moving rats. We targeted microinjections to different parts of the dorsal striatum, and examined the effects of this manipulation on the induced tic properties, such as latency, duration, and somatic localization. Tics induced by striatal disinhibition in monkeys and rats shared multiple properties: tics began within several minutes after microinjection, were expressed solely in the contralateral side, and waxed and waned around a mean inter-tic interval of 1–4 s. A clear somatotopic organization was observed only in rats, where injections to the anterior or posterior striatum led to tics in the forelimb or hindlimb areas, respectively. These results suggest that striatal disinhibition in the rat may be used to model motor tics such as observed in TS. Establishing this reliable and accessible animal model could facilitate the study of the neural mechanisms underlying motor tics, and the testing of potential therapies for tic disorders. PMID:24065893

  5. Neuroglial plasticity at striatal glutamatergic synapses in Parkinson's disease

    Directory of Open Access Journals (Sweden)

    Rosa M Villalba

    2011-08-01

    Full Text Available Striatal dopamine denervation is the pathological hallmark of Parkinson’s disease (PD. Another major pathological change described in animal models and PD patients is a significant reduction in the density of dendritic spines on medium spiny striatal projection neurons. Simultaneously, the ultrastructural features of the neuronal synaptic elements at the remaining corticostriatal and thalamostriatal glutamatergic axo-spinous synapses undergo complex ultrastructural remodeling consistent with increased synaptic activity (Villalba et al., 2011. The concept of tripartite synapses (TS was introduced a decade ago, according to which astrocytes process and exchange information with neuronal synaptic elements at glutamatergic synapses (Araque et al., 1999a. Although there has been compelling evidence that astrocytes are integral functional elements of tripartite glutamatergic synaptic complexes in the cerebral cortex and hippocampus, their exact functional role, degree of plasticity and preponderance in other CNS regions remain poorly understood. In this review, we discuss our recent findings showing that neuronal elements at cortical and thalamic glutamatergic synapses undergo significant plastic changes in the striatum of MPTP-treated parkinsonian monkeys. We also present new ultrastructural data that demonstrate a significant expansion of the astrocytic coverage of striatal TS synapses in the parkinsonian state, providing further evidence for ultrastructural compensatory changes that affect both neuronal and glial elements at TS. Together with our limited understanding of the mechanisms by which astrocytes respond to changes in neuronal activity and extracellular transmitter homeostasis, the role of both neuronal and glial components of excitatory synapses must be considered, if one hopes to take advantage of glia-neuronal communication knowledge to better understand the pathophysiology of striatal processing in parkinsonism, and develop new PD

  6. Motor tics evoked by striatal disinhibition in the rat

    Directory of Open Access Journals (Sweden)

    Maya eBronfeld

    2013-09-01

    Full Text Available Motor tics are sudden, brief, repetitive movements that constitute the main symptom of Tourette syndrome (TS. Multiple lines of evidence suggest the involvement of the cortico-basal ganglia system, and in particular the basal ganglia input structure – the striatum in tic formation. The striatum receives somatotopically organized cortical projections and contains an internal GABAergic network of interneurons and projection neurons collaterals. Disruption of local striatal GABAergic connectivity has been associated with TS and was found to induce abnormal movements in model animals. We have previously described the behavioral and neurophysiological characteristics of motor tics induced in monkeys by local striatal microinjections of the GABAA antagonist bicuculline. In the current study we explored the abnormal movements induced by a similar manipulation in freely moving rats. We targeted microinjections to different parts of the dorsal striatum, and examined the effects of this manipulation on the induced tic properties, such as latency, duration and somatic localization. Tics induced by striatal disinhibition in monkeys and rats shared multiple properties: tics began within several minutes after microinjection, were expressed solely in the contralateral side, and waxed and waned around a mean inter-tic interval of 1-4 s. A clear somatotopic organization was observed only in rats, where injections to the anterior or posterior striatum led to tics in the forelimb or hindlimb areas, respectively. These results suggest that striatal disinhibition in the rat may be used to model motor tics such as observed in TS. Establishing this reliable and accessible animal model could facilitate the study of the neural mechanisms underlying motor tics, and the testing of potential therapies for tic disorders.

  7. In vivo neurochemical characterization of clothianidin induced striatal dopamine release.

    Science.gov (United States)

    Faro, L R F; Oliveira, I M; Durán, R; Alfonso, M

    2012-12-16

    Clothianidin (CLO) is a neonicotinoid insecticide with selective action on nicotinic acetylcholine receptors. The aim of this study was to determine the neurochemical basis for CLO-induced striatal dopamine release using the microdialysis technique in freely moving and conscious rats. Intrastriatal administration of CLO (3.5mM), produced an increase in both spontaneous (2462 ± 627% with respect to basal values) and KCl-evoked (4672 ± 706% with respect to basal values) dopamine release. This effect was attenuated in Ca(2+)-free medium, and was prevented in reserpine pre-treated animals or in presence of tetrodotoxin (TTX). To investigate the involvement of dopamine transporter (DAT), the effect of CLO was observed in presence of nomifensine. The coadministration of CLO and nomifensine produced an additive effect on striatal dopamine release. The results suggest that the effect of CLO on striatal dopamine release is predominantly mediated by an exocytotic mechanism, Ca(2+), vesicular and TTX-dependent and not by a mechanism mediated by dopamine transporter. Published by Elsevier Ireland Ltd.

  8. Neuroinflammation alters voltage-dependent conductance in striatal astrocytes

    Science.gov (United States)

    Karpuk, Nikolay; Burkovetskaya, Maria

    2012-01-01

    Neuroinflammation has the capacity to alter normal central nervous system (CNS) homeostasis and function. The objective of the present study was to examine the effects of an inflammatory milieu on the electrophysiological properties of striatal astrocyte subpopulations with a mouse bacterial brain abscess model. Whole cell patch-clamp recordings were performed in striatal glial fibrillary acidic protein (GFAP)-green fluorescent protein (GFP)+ astrocytes neighboring abscesses at postinfection days 3 or 7 in adult mice. Cell input conductance (Gi) measurements spanning a membrane potential (Vm) surrounding resting membrane potential (RMP) revealed two prevalent astrocyte subsets. A1 and A2 astrocytes were identified by negative and positive Gi increments vs. Vm, respectively. A1 and A2 astrocytes displayed significantly different RMP, Gi, and cell membrane capacitance that were influenced by both time after bacterial exposure and astrocyte proximity to the inflammatory site. Specifically, the percentage of A1 astrocytes was decreased immediately surrounding the inflammatory lesion, whereas A2 cells were increased. These changes were particularly evident at postinfection day 7, revealing increased cell numbers with an outward current component. Furthermore, RMP was inversely modified in A1 and A2 astrocytes during neuroinflammation, and resting Gi was increased from 21 to 30 nS in the latter. In contrast, gap junction communication was significantly decreased in all astrocyte populations associated with inflamed tissues. Collectively, these findings demonstrate the heterogeneity of striatal astrocyte populations, which experience distinct electrophysiological modifications in response to CNS inflammation. PMID:22457466

  9. Transient and steady-state selection in the striatal microcircuit

    Directory of Open Access Journals (Sweden)

    Adam eTomkins

    2014-01-01

    Full Text Available Although the basal ganglia have been widely studied and implicated in signal processing and action selection, little information is known about the active role the striatal microcircuit plays in action selection in the basal ganglia-thalamo-cortical loops. To address this knowledge gap we use a large scale three dimensional spiking model of the striatum, combined with a rate coded model of the basal ganglia-thalamo-cortical loop, to asses the computational role the striatum plays in action selection. We identify a robust transient phenomena generated by the striatal microcircuit, which temporarily enhances the difference between two competing cortical inputs. We show that this transient is sufficient to modulate decision making in the basal ganglia-thalamo-cortical circuit. We also find that the transient selection originates from a novel adaptation effect in single striatal projection neurons, which is amenable to experimental testing. Finally, we compared transient selection with models implementing classical steady-state selection. We challenged both forms of model to account for recent reports of paradoxically enhanced response selection in Huntington's Disease patients. We found that steady-state selection was uniformly impaired under all simulated Huntington's conditions, but transient selection was enhanced given a sufficient Huntington's-like increase in NMDA receptor sensitivity. Thus our models provide an intriguing hypothesis for the mechanisms underlying the paradoxical cognitive improvements in manifest Huntington's patients.

  10. Fractal analysis of striatal dopamine re-uptake sites

    International Nuclear Information System (INIS)

    Kuikka, J.T.; Bergstroem, K.A.; Tiihonen, J.; Raesaenen, P.; Karhu, J.

    1997-01-01

    Spatial variation in regional blood flow, metabolism and receptor density within the brain and in other organs is measurable even with a low spatial resolution technique such as emission tomography. It has been previously shown that the observed variance increases with increasing number of subregions in the organ/tissue studied. This resolution-dependent variance can be described by fractal analysis. We studied striatal dopamine re-uptake sites in 39 healthy volunteers with high-resolution single-photon emission tomography using iodine-123 labelled 2β-carbomethoxy-3β-(4-iodophenyl)tropane ([ 123 I]β-CIT). The mean fractal dimension was 1.15±0.07. The results indicate that regional striatal dopamine re-uptake sites involve considerable spatial heterogeneity which is higher than the uniform density (dimension=1.00) but much lower than complete randomness (dimension=1.50). There was a gender difference, with females having a higher heterogeneity in both the left and the right striatum. In addition, we found striatal asymmetry (left-to-right heterogeneity ratio of 1.19±0.15; P<0.001), suggesting functional hemispheric lateralization consistent with the control of motor behaviour and integrative functions. (orig.). With 5 figs., 1 tab

  11. Adenosine, caffeine, and performance: from cognitive neuroscience of sleep to sleep pharmacogenetics.

    Science.gov (United States)

    Urry, Emily; Landolt, Hans-Peter

    2015-01-01

    An intricate interplay between circadian and sleep-wake homeostatic processes regulate cognitive performance on specific tasks, and individual differences in circadian preference and sleep pressure may contribute to individual differences in distinct neurocognitive functions. Attentional performance appears to be particularly sensitive to time of day modulations and the effects of sleep deprivation. Consistent with the notion that the neuromodulator, adenosine , plays an important role in regulating sleep pressure, pharmacologic and genetic data in animals and humans demonstrate that differences in adenosinergic tone affect sleepiness, arousal and vigilant attention in rested and sleep-deprived states. Caffeine--the most often consumed stimulant in the world--blocks adenosine receptors and normally attenuates the consequences of sleep deprivation on arousal, vigilance, and attention. Nevertheless, caffeine cannot substitute for sleep, and is virtually ineffective in mitigating the impact of severe sleep loss on higher-order cognitive functions. Thus, the available evidence suggests that adenosinergic mechanisms, in particular adenosine A2A receptor-mediated signal transduction, contribute to waking-induced impairments of attentional processes, whereas additional mechanisms must be involved in higher-order cognitive consequences of sleep deprivation. Future investigations should further clarify the exact types of cognitive processes affected by inappropriate sleep. This research will aid in the quest to better understand the role of different brain systems (e.g., adenosine and adenosine receptors) in regulating sleep, and sleep-related subjective state, and cognitive processes. Furthermore, it will provide more detail on the underlying mechanisms of the detrimental effects of extended wakefulness, as well as lead to the development of effective, evidence-based countermeasures against the health consequences of circadian misalignment and chronic sleep restriction.

  12. [3H]Dopamine accumulation and release from striatal slices in young, mature and senescent rats

    International Nuclear Information System (INIS)

    Thompson, J.M.

    1981-01-01

    Examinations of [ 3 H]dopamine ([ 3 H]DA) release following KCl or amphetamine administration in striatal slices from young (7 month), mature (12 month) and senescent (24 month) Wistar rats showed no age-related changes. Further, the amount of [ 3 H]DA accumulated in the striatal slices showed no changes with age. Thus, previously reported age-related deficits in motor behavior (i.e. rotational) are not produced by changes in striatal DA accumulation or release. (Auth.)

  13. Stimulation of Glia Reveals Modulation of Mammalian Spinal Motor Networks by Adenosine.

    Science.gov (United States)

    Acton, David; Miles, Gareth B

    2015-01-01

    Despite considerable evidence that glia can release modulators to influence the excitability of neighbouring neurons, the importance of gliotransmission for the operation of neural networks and in shaping behaviour remains controversial. Here we characterise the contribution of glia to the modulation of the mammalian spinal central pattern generator for locomotion, the output of which is directly relatable to a defined behaviour. Glia were stimulated by specific activation of protease-activated receptor-1 (PAR1), an endogenous G-protein coupled receptor preferentially expressed by spinal glia during ongoing activity of the spinal central pattern generator for locomotion. Selective activation of PAR1 by the agonist TFLLR resulted in a reversible reduction in the frequency of locomotor-related bursting recorded from ventral roots of spinal cord preparations isolated from neonatal mice. In the presence of the gliotoxins methionine sulfoximine or fluoroacetate, TFLLR had no effect, confirming the specificity of PAR1 activation to glia. The modulation of burst frequency upon PAR1 activation was blocked by the non-selective adenosine-receptor antagonist theophylline and by the A1-receptor antagonist 8-cyclopentyl-1,3-dipropylxanthine, but not by the A2A-receptor antagonist SCH5826, indicating production of extracellular adenosine upon glial stimulation, followed by A1-receptor mediated inhibition of neuronal activity. Modulation of network output following glial stimulation was also blocked by the ectonucleotidase inhibitor ARL67156, indicating glial release of ATP and its subsequent degradation to adenosine rather than direct release of adenosine. Glial stimulation had no effect on rhythmic activity recorded following blockade of inhibitory transmission, suggesting that glial cell-derived adenosine acts via inhibitory circuit components to modulate locomotor-related output. Finally, the modulation of network output by endogenous adenosine was found to scale with the

  14. Stimulation of Glia Reveals Modulation of Mammalian Spinal Motor Networks by Adenosine.

    Directory of Open Access Journals (Sweden)

    David Acton

    Full Text Available Despite considerable evidence that glia can release modulators to influence the excitability of neighbouring neurons, the importance of gliotransmission for the operation of neural networks and in shaping behaviour remains controversial. Here we characterise the contribution of glia to the modulation of the mammalian spinal central pattern generator for locomotion, the output of which is directly relatable to a defined behaviour. Glia were stimulated by specific activation of protease-activated receptor-1 (PAR1, an endogenous G-protein coupled receptor preferentially expressed by spinal glia during ongoing activity of the spinal central pattern generator for locomotion. Selective activation of PAR1 by the agonist TFLLR resulted in a reversible reduction in the frequency of locomotor-related bursting recorded from ventral roots of spinal cord preparations isolated from neonatal mice. In the presence of the gliotoxins methionine sulfoximine or fluoroacetate, TFLLR had no effect, confirming the specificity of PAR1 activation to glia. The modulation of burst frequency upon PAR1 activation was blocked by the non-selective adenosine-receptor antagonist theophylline and by the A1-receptor antagonist 8-cyclopentyl-1,3-dipropylxanthine, but not by the A2A-receptor antagonist SCH5826, indicating production of extracellular adenosine upon glial stimulation, followed by A1-receptor mediated inhibition of neuronal activity. Modulation of network output following glial stimulation was also blocked by the ectonucleotidase inhibitor ARL67156, indicating glial release of ATP and its subsequent degradation to adenosine rather than direct release of adenosine. Glial stimulation had no effect on rhythmic activity recorded following blockade of inhibitory transmission, suggesting that glial cell-derived adenosine acts via inhibitory circuit components to modulate locomotor-related output. Finally, the modulation of network output by endogenous adenosine was found to

  15. Adenosine deaminase activity of erythrocytes in hyperuricemia

    International Nuclear Information System (INIS)

    Krueger, W.; Richter, V.; Beenken, O.; Weinhold, D.; Hirschberg, K.; Rotzsch, W.; Akademie der Wissenschaften der DDR, Leipzig. Zentralinstitut fuer Isotopen- und Strahlenforschung)

    1982-01-01

    Erythrocytic adenosine deaminase (ADA) activity was determined in 55 patients with primary hyperuricemia and in 37 healthy control persons. Unlike the controls, the ADA activity in the patient group showed a two-peak response. Hyperuricemia patients with high ADA activity also exhibited increased uric acid excretion and elevated 15 N incorporation into uric acid. High activity values of erythrocytic ADA can be interpreted as an uric acid overproduction, giving hints for a therapeutic plan. (author)

  16. Chemoelectrical energy conversion of adenosine triphosphate

    Science.gov (United States)

    Sundaresan, Vishnu Baba; Sarles, Stephen Andrew; Leo, Donald J.

    2007-04-01

    Plant and animal cell membranes transport charged species, neutral molecules and water through ion pumps and channels. The energy required for moving species against established concentration and charge gradients is provided by the biological fuel - adenosine triphosphate (ATP) -synthesized within the cell. The adenosine triphosphatase (ATPases) in a plant cell membrane hydrolyze ATP in the cell cytoplasm to pump protons across the cell membrane. This establishes a proton gradient across the membrane from the cell exterior into the cell cytoplasm. This proton motive force stimulates ion channels that transport nutrients and other species into the cell. This article discusses a device that converts the chemical energy stored in adenosine triphosphate into electrical power using a transporter protein, ATPase. The V-type ATPase proteins used in our prototype are extracted from red beet(Beta vulgaris) tonoplast membranes and reconstituted in a bilayer lipid membrane or BLM formed from POPC and POPS lipids. A pH7 medium that can support ATP hydrolysis is provided on both sides of the membrane and ATP is dissolved in the pH7 buffer on one side of the membrane. Hydrolysis of ATP results in the formation of a phosphate ion and adenosine diphosphate. The energy from the reaction activates ATPase in the BLM and moves a proton across the membrane. The charge gradient established across the BLM due to the reaction and ion transport is converted into electrical current by half-cell reference electrodes. The prototype ATPase cell with an effective BLM area of 4.15 mm2 carrying 15 μl of ATPase proteins was observed to develop a steady state peak power output of 70 nW, which corresponds to a specific power of 1.69 μW/cm2 and a current density of 43.4 μA/cm2 of membrane area.

  17. Low, but not high, dose caffeine is a readily available probe for adenosine actions.

    Science.gov (United States)

    Fredholm, Bertil B; Yang, Jiangning; Wang, Yingqing

    2017-06-01

    Caffeine is very widely used and knowledge of its mode of action can be used to gain an understanding of basal physiological regulation. This review makes the point that caffeine is - in low doses - an antagonist of adenosine acting at A 1 , A 2A and A 2B receptors. We use published and unpublished data to make the point that high dose effects of caffeine are not only qualitatively different but have a different underlying mechanism. Therefore one must be careful in only using epidemiological or experimental data where rather low doses of caffeine are used to draw conclusions about the physiology and pathophysiology of adenosine. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Hypoxia/reoxygenation impairs memory formation via adenosine-dependent activation of caspase 1.

    Science.gov (United States)

    Chiu, Gabriel S; Chatterjee, Diptaman; Darmody, Patrick T; Walsh, John P; Meling, Daryl D; Johnson, Rodney W; Freund, Gregory G

    2012-10-03

    After hypoxia, a critical adverse outcome is the inability to create new memories. How anterograde amnesia develops or resolves remains elusive, but a link to brain-based IL-1 is suggested due to the vital role of IL-1 in both learning and brain injury. We examined memory formation in mice exposed to acute hypoxia. After reoxygenation, memory recall recovered faster than memory formation, impacting novel object recognition and cued fear conditioning but not spatially cued Y-maze performance. The ability of mice to form new memories after hypoxia/reoxygenation was accelerated in IL-1 receptor 1 knockout (IL-1R1 KO) mice, in mice receiving IL-1 receptor antagonist (IL-1RA), and in mice given the caspase 1 inhibitor Ac-YVAD-CMK. Mechanistically, hypoxia/reoxygenation more than doubled caspase 1 activity in the brain, which was localized to the amygdala compared to the hippocampus. This reoxygenation-dependent activation of caspase 1 was prevented by broad-spectrum adenosine receptor (AR) antagonism with caffeine and by targeted A1/A2A AR antagonism with 8-cyclopentyl-1,3-dipropylxanthine plus 3,7-dimethyl-1-propargylxanthine. Additionally, perfusion of adenosine activated caspase 1 in the brain, while caffeine blocked this action by adenosine. Finally, resolution of anterograde amnesia was improved by both caffeine and by targeted A1/A2A AR antagonism. These findings indicate that amygdala-based anterograde amnesia after hypoxia/reoxygenation is sustained by IL-1β generated through adenosine-dependent activation of caspase 1 after reoxygenation.

  19. Anticonvulsant activity of B2, an adenosine analog, on chemical convulsant-induced seizures.

    Directory of Open Access Journals (Sweden)

    Min Li

    Full Text Available Epilepsy is a chronic neurological disorder characterized by recurrent seizures. However, approximately one-third of epilepsy patients still suffer from uncontrolled seizures. Effective treatments for epilepsy are yet to be developed. N (6-(3-methoxyl-4-hydroxybenzyl adenine riboside (B2 is a N(6-substitued adenosine analog. Here we describe an investigation of the effects and mechanisms of B2 on chemical convulsant-induced seizures. Seizures were induced in mice by administration of 4-aminopyridine (4-AP, pentylenetetrazol (PTZ, picrotoxin, kainite acid (KA, or strychnine. B2 has a dose-related anticonvulsant effect in these chemical-induced seizure models. The protective effects of B2 include increased latency of seizure onset, decreased seizure occurrence, shorter seizure duration and reduced mortality rate. Radioligand binding and cAMP accumulation assays indicated that B2 might be a functional ligand for both adenosine A1 and A2A receptors. Furthermore, DPCPX, a selective A1 receptor antagonist, but not SCH58261, a selective A2A receptor antagonist, blocked the anticonvulsant effect of B2 on PTZ-induced seizure. c-Fos is a cellular marker for neuronal activity. Immunohistochemical and western blot analyses indicated that B2 significantly reversed PTZ-induced c-Fos expression in the hippocampus. Together, these results indicate that B2 has significant anticonvulsant effects. The anticonvulsant effects of B2 may be attributed to adenosine A1 receptor activation and reduced neuronal excitability in the hippocampus. These observations also support that the use of adenosine receptor agonist may be a promising approach for the treatment of epilepsy.

  20. Cultured astrocytes do not release adenosine during hypoxic conditions

    OpenAIRE

    Fujita, Takumi; Williams, Erika K; Jensen, Tina K; Smith, Nathan A; Takano, Takahiro; Tieu, Kim; Nedergaard, Maiken

    2011-01-01

    Recent reports based on a chemiluminescent enzymatic assay for detection of adenosine conclude that cultured astrocytes release adenosine during mildly hypoxic conditions. If so, astrocytes may suppress neural activity in early stages of hypoxia. The aim of this study was to reevaluate the observation using high-performance liquid chromatography (HPLC). The HPLC analysis showed that exposure to 20 or 120 minutes of mild hypoxia failed to increase release of adenosine triphosphate (ATP), adeno...

  1. Measurement of plasma adenosine concentration: methodological and physiological considerations

    International Nuclear Information System (INIS)

    Gewirtz, H.; Brown, P.; Most, A.S.

    1987-01-01

    This study tested the hypothesis that measurements of plasma adenosine concentration made on samples of blood obtained in dipyridamole and EHNA (i.e., stopping solution) may be falsely elevated as a result of ongoing in vitro production and accumulation of adenosine during sample processing. Studies were performed with samples of anticoagulated blood obtained from anesthesized domestic swine. Adenosine concentration of ultra filtrated plasma was determined by HPLC. The following parameters were evaluated: (i) rate of clearance of [ 3 H]adenosine added to plasma, (ii) endogenous adenosine concentration of matched blood samples obtained in stopping solution alone, stopping solution plus EDTA, and perchloric acid (PCA), (iii) plasma and erythrocyte endogenous adenosine concentration in nonhemolyzed samples, and (iv) plasma adenosine concentration of samples hemolyzed in the presence of stopping solution alone or stopping solution plus EDTA. We observed that (i) greater than or equal to 95% of [ 3 H]adenosine added to plasma is removed from it by formed elements of the blood in less than 20 s, (ii) plasma adenosine concentration of samples obtained in stopping solution alone is generally 10-fold greater than that of matched samples obtained in stopping solution plus EDTA, (iii) deliberate mechanical hemolysis of blood samples obtained in stopping solution alone resulted in substantial augmentation of plasma adenosine levels in comparison with matched nonhemolyzed specimens--addition of EDTA to stopping solution prevented this, and (iv) adenosine content of blood samples obtained in PCA agreed closely with the sum of plasma and erythrocyte adenosine content of samples obtained in stopping solution plus EDTA

  2. Primary adenosine monophosphate (AMP) deaminase deficiency in a hypotonic infant.

    Science.gov (United States)

    Castro-Gago, Manuel; Gómez-Lado, Carmen; Pérez-Gay, Laura; Eirís-Puñal, Jesús; Martínez, Elena Pintos; García-Consuegra, Inés; Martín, Miguel Angel

    2011-06-01

    The spectrum of the adenosine monophosphate (AMP) deaminase deficiency ranges from asymptomatic carriers to patients who manifest exercise-induced muscle pain, occasionally rhabdomyolysis, and idiopathic hyperCKemia. However, previous to the introduction of molecular techniques, rare cases with congenital weakness and hypotonia have also been reported. We report a 6-month-old girl with the association of congenital muscle weakness and hypotonia, muscle deficiency of adenosine monophosphate deaminase, and the homozygous C to T mutation at nucleotide 34 of the adenosine monophosphate deaminase-1 gene. This observation indicates the possible existence of a primary adenosine monophosphate deaminase deficiency manifested by congenital muscle weakness and hypotonia.

  3. Cardioprotection with adenosine: 'a riddle wrapped in a mystery'.

    Science.gov (United States)

    Przyklenk, Karin; Whittaker, Peter

    2005-07-01

    Review of the published literature on adenosine and cardioprotection could lead one to paraphrase the famous words of Sir Winston Churchill (Radio broadcast, 1 October 1939 (in reference to Russia)) and conclude: 'I cannot forecast to you the action of adenosine. It is a riddle wrapped in a mystery inside an enigma'. That is, although it is well-established that adenosine can render cardiomyocytes resistant to lethal ischemia/reperfusion-induced injury, new and intriguing insights continue to emerge as to the mechanisms by which adenosine might limit myocardial infarct size.

  4. Adenosine contribution to normal renal physiology and chronic kidney disease.

    Science.gov (United States)

    Oyarzún, Carlos; Garrido, Wallys; Alarcón, Sebastián; Yáñez, Alejandro; Sobrevia, Luis; Quezada, Claudia; San Martín, Rody

    2017-06-01

    Adenosine is a nucleoside that is particularly interesting to many scientific and clinical communities as it has important physiological and pathophysiological roles in the kidney. The distribution of adenosine receptors has only recently been elucidated; therefore it is likely that more biological roles of this nucleoside will be unveiled in the near future. Since the discovery of the involvement of adenosine in renal vasoconstriction and regulation of local renin production, further evidence has shown that adenosine signaling is also involved in the tubuloglomerular feedback mechanism, sodium reabsorption and the adaptive response to acute insults, such as ischemia. However, the most interesting finding was the increased adenosine levels in chronic kidney diseases such as diabetic nephropathy and also in non-diabetic animal models of renal fibrosis. When adenosine is chronically increased its signaling via the adenosine receptors may change, switching to a state that induces renal damage and produces phenotypic changes in resident cells. This review discusses the physiological and pathophysiological roles of adenosine and pays special attention to the mechanisms associated with switching homeostatic nucleoside levels to increased adenosine production in kidneys affected by CKD. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Crystal structure of the adenosine A2A receptor bound to an antagonist reveals a potential allosteric pocket

    OpenAIRE

    Sun, Bingfa; Bachhawat, Priti; Chu, Matthew Ling-Hon; Wood, Martyn; Ceska, Tom; Sands, Zara A.; Mercier, Joel; Lebon, Florence; Kobilka, Tong Sun; Kobilka, Brian K.

    2017-01-01

    The A2AR is a G protein-coupled receptor (GPCR) that plays important roles in cardiovascular physiology and immune function. The A2AR is also a target for the treatment of Parkinson?s disease, where A2AR antagonists have been shown to enhance signaling through the D2 dopamine receptor. Here we present the crystal structure of the A2AR bound to a novel bitopic antagonist. As a result of structural changes needed to accommodate the bound antagonist, crystals could not be grown in lipidic cubic ...

  6. 3-Nitropropionic acid neurotoxicity in organotypic striatal and corticostriatal slice cultures is dependent on glucose and glutamate

    DEFF Research Database (Denmark)

    Storgaard, J; Kornblit, B T; Zimmer, J

    2000-01-01

    Mitochondrial inhibition by 3-nitropropionic acid (3-NPA) causes striatal degeneration reminiscent of Huntington's disease. We studied 3-NPA neurotoxicity and possible indirect excitotoxicity in organotypic striatal and corticostriatal slice cultures. Neurotoxicity was quantified by assay...

  7. Striatal degeneration impairs language learning: evidence from Huntington's disease.

    Science.gov (United States)

    De Diego-Balaguer, R; Couette, M; Dolbeau, G; Dürr, A; Youssov, K; Bachoud-Lévi, A-C

    2008-11-01

    Although the role of the striatum in language processing is still largely unclear, a number of recent proposals have outlined its specific contribution. Different studies report evidence converging to a picture where the striatum may be involved in those aspects of rule-application requiring non-automatized behaviour. This is the main characteristic of the earliest phases of language acquisition that require the online detection of distant dependencies and the creation of syntactic categories by means of rule learning. Learning of sequences and categorization processes in non-language domains has been known to require striatal recruitment. Thus, we hypothesized that the striatum should play a prominent role in the extraction of rules in learning a language. We studied 13 pre-symptomatic gene-carriers and 22 early stage patients of Huntington's disease (pre-HD), both characterized by a progressive degeneration of the striatum and 21 late stage patients Huntington's disease (18 stage II, two stage III and one stage IV) where cortical degeneration accompanies striatal degeneration. When presented with a simplified artificial language where words and rules could be extracted, early stage Huntington's disease patients (stage I) were impaired in the learning test, demonstrating a greater impairment in rule than word learning compared to the 20 age- and education-matched controls. Huntington's disease patients at later stages were impaired both on word and rule learning. While spared in their overall performance, gene-carriers having learned a set of abstract artificial language rules were then impaired in the transfer of those rules to similar artificial language structures. The correlation analyses among several neuropsychological tests assessing executive function showed that rule learning correlated with tests requiring working memory and attentional control, while word learning correlated with a test involving episodic memory. These learning impairments significantly

  8. Mechanisms mediating parallel action monitoring in fronto-striatal circuits.

    Science.gov (United States)

    Beste, Christian; Ness, Vanessa; Lukas, Carsten; Hoffmann, Rainer; Stüwe, Sven; Falkenstein, Michael; Saft, Carsten

    2012-08-01

    Flexible response adaptation and the control of conflicting information play a pivotal role in daily life. Yet, little is known about the neuronal mechanisms mediating parallel control of these processes. We examined these mechanisms using a multi-methodological approach that integrated data from event-related potentials (ERPs) with structural MRI data and source localisation using sLORETA. Moreover, we calculated evoked wavelet oscillations. We applied this multi-methodological approach in healthy subjects and patients in a prodromal phase of a major basal ganglia disorder (i.e., Huntington's disease), to directly focus on fronto-striatal networks. Behavioural data indicated, especially the parallel execution of conflict monitoring and flexible response adaptation was modulated across the examined cohorts. When both processes do not co-incide a high integrity of fronto-striatal loops seems to be dispensable. The neurophysiological data suggests that conflict monitoring (reflected by the N2 ERP) and working memory processes (reflected by the P3 ERP) differentially contribute to this pattern of results. Flexible response adaptation under the constraint of high conflict processing affected the N2 and P3 ERP, as well as their delta frequency band oscillations. Yet, modulatory effects were strongest for the N2 ERP and evoked wavelet oscillations in this time range. The N2 ERPs were localized in the anterior cingulate cortex (BA32, BA24). Modulations of the P3 ERP were localized in parietal areas (BA7). In addition, MRI-determined caudate head volume predicted modulations in conflict monitoring, but not working memory processes. The results show how parallel conflict monitoring and flexible adaptation of action is mediated via fronto-striatal networks. While both, response monitoring and working memory processes seem to play a role, especially response selection processes and ACC-basal ganglia networks seem to be the driving force in mediating parallel conflict

  9. Dysregulation of Striatal Dopamine Receptor Binding in Suicide.

    Science.gov (United States)

    Fitzgerald, Megan L; Kassir, Suham A; Underwood, Mark D; Bakalian, Mihran J; Mann, J John; Arango, Victoria

    2017-03-01

    Inconsistent evidence implicates disruptions of striatal dopaminergic indices in suicide and major depression. To determine whether there are alterations in the striatal dopamine system in suicide, we conducted a quantitative autoradiographic survey of dopamine transporter (DAT; [ 3 H]mazindol), D1 receptor ([ 3 H]SCH23390), and D2 receptor ([ 3 H]sulpiride) binding in the dorsal striatum postmortem from matched suicides and controls. Axis I and axis II psychiatric diagnosis, recent treatment history, and early life adversity (ELA) were determined by psychological autopsy. Mean DAT, D2, and D1 receptor binding did not differ in suicide. However, there was a positive correlation between D1 and D2 receptor binding in the dorsal striatum of control subjects (R 2 =0.31, p<0.05) that was not present in suicides (R 2 =0.00, p=0.97). In suicides and controls with reported ELA, there was no correlation between striatal DAT and D1 receptor binding (R 2 =0.07, p=0.33), although DAT and D1 receptor binding was positively correlated in subjects with no report of ELA (R 2 =0.32, p<0.05). After controlling for age, there were no significant ELA-related mean differences. Binding of D1 receptors and DAT throughout the striatum correlated negatively with age (D1 receptor: R 2 =0.12, p<0.05; DAT: R 2 =0.36, p<0.001). There appears to be an imbalance in dopaminergic receptor and transporter expression related to suicide that differs from that associated with ELA or age.

  10. Neuroinflammation alters voltage-dependent conductance in striatal astrocytes.

    Science.gov (United States)

    Karpuk, Nikolay; Burkovetskaya, Maria; Kielian, Tammy

    2012-07-01

    Neuroinflammation has the capacity to alter normal central nervous system (CNS) homeostasis and function. The objective of the present study was to examine the effects of an inflammatory milieu on the electrophysiological properties of striatal astrocyte subpopulations with a mouse bacterial brain abscess model. Whole cell patch-clamp recordings were performed in striatal glial fibrillary acidic protein (GFAP)-green fluorescent protein (GFP)(+) astrocytes neighboring abscesses at postinfection days 3 or 7 in adult mice. Cell input conductance (G(i)) measurements spanning a membrane potential (V(m)) surrounding resting membrane potential (RMP) revealed two prevalent astrocyte subsets. A1 and A2 astrocytes were identified by negative and positive G(i) increments vs. V(m), respectively. A1 and A2 astrocytes displayed significantly different RMP, G(i), and cell membrane capacitance that were influenced by both time after bacterial exposure and astrocyte proximity to the inflammatory site. Specifically, the percentage of A1 astrocytes was decreased immediately surrounding the inflammatory lesion, whereas A2 cells were increased. These changes were particularly evident at postinfection day 7, revealing increased cell numbers with an outward current component. Furthermore, RMP was inversely modified in A1 and A2 astrocytes during neuroinflammation, and resting G(i) was increased from 21 to 30 nS in the latter. In contrast, gap junction communication was significantly decreased in all astrocyte populations associated with inflamed tissues. Collectively, these findings demonstrate the heterogeneity of striatal astrocyte populations, which experience distinct electrophysiological modifications in response to CNS inflammation.

  11. Impaired striatal Akt signaling disrupts dopamine homeostasis and increases feeding.

    Directory of Open Access Journals (Sweden)

    Nicole Speed

    Full Text Available The prevalence of obesity has increased dramatically worldwide. The obesity epidemic begs for novel concepts and therapeutic targets that cohesively address "food-abuse" disorders. We demonstrate a molecular link between impairment of a central kinase (Akt involved in insulin signaling induced by exposure to a high-fat (HF diet and dysregulation of higher order circuitry involved in feeding. Dopamine (DA rich brain structures, such as striatum, provide motivation stimuli for feeding. In these central circuitries, DA dysfunction is posited to contribute to obesity pathogenesis. We identified a mechanistic link between metabolic dysregulation and the maladaptive behaviors that potentiate weight gain. Insulin, a hormone in the periphery, also acts centrally to regulate both homeostatic and reward-based HF feeding. It regulates DA homeostasis, in part, by controlling a key element in DA clearance, the DA transporter (DAT. Upon HF feeding, nigro-striatal neurons rapidly develop insulin signaling deficiencies, causing increased HF calorie intake.We show that consumption of fat-rich food impairs striatal activation of the insulin-activated signaling kinase, Akt. HF-induced Akt impairment, in turn, reduces DAT cell surface expression and function, thereby decreasing DA homeostasis and amphetamine (AMPH-induced DA efflux. In addition, HF-mediated dysregulation of Akt signaling impairs DA-related behaviors such as (AMPH-induced locomotion and increased caloric intake. We restored nigro-striatal Akt phosphorylation using recombinant viral vector expression technology. We observed a rescue of DAT expression in HF fed rats, which was associated with a return of locomotor responses to AMPH and normalization of HF diet-induced hyperphagia.Acquired disruption of brain insulin action may confer risk for and/or underlie "food-abuse" disorders and the recalcitrance of obesity. This molecular model, thus, explains how even short-term exposure to "the fast food

  12. Effects of high doses of intracoronary adenosine on the assessment of fractional flow reserve

    Directory of Open Access Journals (Sweden)

    Ahmed Khashaba

    2014-03-01

    Conclusions: Intracoronary adenosine, at doses higher than currently suggested, lows obtaining FFR values similar to IV adenosine. Intravenous adenosine, which remains the gold standard, might thus be reserved for those lesions with equivocal FFR values.

  13. Adenosine deaminase-related growth factors stimulate cell proliferation in Drosophila by depleting extracellular adenosine

    Czech Academy of Sciences Publication Activity Database

    Žurovec, Michal; Doležal, Tomáš; Gaži, Michal; Pavlová, Eva; Bryant, P. J.

    2002-01-01

    Roč. 99, č. 7 (2002), s. 4403-4408 ISSN 0027-8424 R&D Projects: GA ČR GA204/01/1022; GA AV ČR IAA5007107 Institutional research plan: CEZ:AV0Z5007907 Keywords : adenosine daminase * minimal medium Subject RIV: CE - Biochemistry Impact factor: 10.701, year: 2002

  14. Cognitive emotion regulation modulates the balance of competing influences on ventral striatal aversive prediction error signals.

    Science.gov (United States)

    Mulej Bratec, Satja; Xie, Xiyao; Wang, Yijun; Schilbach, Leonhard; Zimmer, Claus; Wohlschläger, Afra M; Riedl, Valentin; Sorg, Christian

    2017-02-15

    Cognitive emotion regulation (CER) is a critical human ability to face aversive emotional stimuli in a flexible way, via recruitment of specific prefrontal brain circuits. Animal research reveals a central role of ventral striatum in emotional behavior, for both aversive conditioning, with striatum signaling aversive prediction errors (aPE), and for integrating competing influences of distinct striatal inputs from regions such as the prefrontal cortex (PFC), amygdala, hippocampus and ventral tegmental area (VTA). Translating these ventral striatal findings from animal research to human CER, we hypothesized that successful CER would affect the balance of competing influences of striatal afferents on striatal aPE signals, in a way favoring PFC as opposed to 'subcortical' (i.e., non-isocortical) striatal inputs. Using aversive Pavlovian conditioning with and without CER during fMRI, we found that during CER, superior regulators indeed reduced the modulatory impact of 'subcortical' striatal afferents (hippocampus, amygdala and VTA) on ventral striatal aPE signals, while keeping the PFC impact intact. In contrast, inferior regulators showed an opposite pattern. Our results demonstrate that ventral striatal aPE signals and associated competing modulatory inputs are critical mechanisms underlying successful cognitive regulation of aversive emotions in humans. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Fronto-striatal atrophy correlates of neuropsychiatric dysfunction in frontotemporal dementia (FTD and Alzheimer's disease (AD

    Directory of Open Access Journals (Sweden)

    Dong Seok Yi

    Full Text Available ABSTRACT Behavioural disturbances in frontotemporal dementia (FTD are thought to reflect mainly atrophy of cortical regions. Recent studies suggest that subcortical brain regions, in particular the striatum, are also significantly affected and this pathology might play a role in the generation of behavioural symptoms. Objective: To investigate prefrontal cortical and striatal atrophy contributions to behavioural symptoms in FTD. Methods: One hundred and eighty-two participants (87 FTD patients, 39 AD patients and 56 controls were included. Behavioural profiles were established using the Cambridge Behavioural Inventory Revised (CBI-R and Frontal System Behaviour Scale (FrSBe. Atrophy in prefrontal (VMPFC, DLPFC and striatal (caudate, putamen regions was established via a 5-point visual rating scale of the MRI scans. Behavioural scores were correlated with atrophy rating scores. Results: Behavioural and atrophy ratings demonstrated that patients were significantly impaired compared to controls, with bvFTD being most severely affected. Behavioural-anatomical correlations revealed that VMPFC atrophy was closely related to abnormal behaviour and motivation disturbances. Stereotypical behaviours were associated with both VMPFC and striatal atrophy. By contrast, disturbance of eating was found to be related to striatal atrophy only. Conclusion: Frontal and striatal atrophy contributed to the behavioural disturbances seen in FTD, with some behaviours related to frontal, striatal or combined fronto-striatal pathology. Consideration of striatal contributions to the generation of behavioural disturbances should be taken into account when assessing patients with potential FTD.

  16. Reciprocal influences of nigral cells and striatal patch neurons in dissociated co-cultures

    NARCIS (Netherlands)

    Aronica, E.; Costantini, L. C.; Snyder-Keller, A.

    1996-01-01

    Our previous work has shown that the functional efficacy of nigral tissue transplants into dopamine (DA)-depleted rats is increased when embryonic striatal tissue is included (Costantini et al.: Exp Neurol 127:219-231, 1994). To examine further the influence of striatal patch neurons in this regard,

  17. GABAERGIC MODULATION OF STRIATAL CHOLINERGIC INTERNEURONS - AN IN-VIVO MICRODIALYSIS STUDY

    NARCIS (Netherlands)

    DEBOER, P; WESTERINK, BHC

    Striatal cholinergic interneurons have been shown to receive input from striatal gamma-aminobutyric acid (GABA)-containing cell elements. GABA is known to act on two different types of receptors, the GABA(A) and the GABA(B) receptor. Using in vivo microdialysis, we have studied the effect of

  18. No association between striatal dopamine transporter binding and body mass index

    DEFF Research Database (Denmark)

    van de Giessen, Elsmarieke; Hesse, Swen; Caan, Matthan W A

    2013-01-01

    Dopamine is one among several neurotransmitters that regulate food intake and overeating. Thus, it has been linked to the pathophysiology of obesity and high body mass index (BMI). Striatal dopamine D(2) receptor availability is lower in obesity and there are indications that striatal dopamine tr...

  19. AMP Is an Adenosine A1 Receptor Agonist*

    Science.gov (United States)

    Rittiner, Joseph E.; Korboukh, Ilia; Hull-Ryde, Emily A.; Jin, Jian; Janzen, William P.; Frye, Stephen V.; Zylka, Mark J.

    2012-01-01

    Numerous receptors for ATP, ADP, and adenosine exist; however, it is currently unknown whether a receptor for the related nucleotide adenosine 5′-monophosphate (AMP) exists. Using a novel cell-based assay to visualize adenosine receptor activation in real time, we found that AMP and a non-hydrolyzable AMP analog (deoxyadenosine 5′-monophosphonate, ACP) directly activated the adenosine A1 receptor (A1R). In contrast, AMP only activated the adenosine A2B receptor (A2BR) after hydrolysis to adenosine by ecto-5′-nucleotidase (NT5E, CD73) or prostatic acid phosphatase (PAP, ACPP). Adenosine and AMP were equipotent human A1R agonists in our real-time assay and in a cAMP accumulation assay. ACP also depressed cAMP levels in mouse cortical neurons through activation of endogenous A1R. Non-selective purinergic receptor antagonists (pyridoxalphosphate-6-azophenyl-2′,4′-disulfonic acid and suramin) did not block adenosine- or AMP-evoked activation. Moreover, mutation of His-251 in the human A1R ligand binding pocket reduced AMP potency without affecting adenosine potency. In contrast, mutation of a different binding pocket residue (His-278) eliminated responses to AMP and to adenosine. Taken together, our study indicates that the physiologically relevant nucleotide AMP is a full agonist of A1R. In addition, our study suggests that some of the physiological effects of AMP may be direct, and not indirect through ectonucleotidases that hydrolyze this nucleotide to adenosine. PMID:22215671

  20. Elevated placental adenosine signaling contributes to the pathogenesis of preeclampsia.

    Science.gov (United States)

    Iriyama, Takayuki; Sun, Kaiqi; Parchim, Nicholas F; Li, Jessica; Zhao, Cheng; Song, Anren; Hart, Laura A; Blackwell, Sean C; Sibai, Baha M; Chan, Lee-Nien L; Chan, Teh-Sheng; Hicks, M John; Blackburn, Michael R; Kellems, Rodney E; Xia, Yang

    2015-02-24

    Preeclampsia is a prevalent hypertensive disorder of pregnancy and a leading cause of maternal and neonatal morbidity and mortality worldwide. This pathogenic condition is speculated to be caused by placental abnormalities that contribute to the maternal syndrome. However, the specific factors and signaling pathways that lead to impaired placentas and maternal disease development remain elusive. Using 2 independent animal models of preeclampsia (genetically engineered pregnant mice with elevated adenosine exclusively in placentas and a pathogenic autoantibody-induced preeclampsia mouse model), we demonstrated that chronically elevated placental adenosine was sufficient to induce hallmark features of preeclampsia, including hypertension, proteinuria, small fetuses, and impaired placental vasculature. Genetic and pharmacological approaches revealed that elevated placental adenosine coupled with excessive A₂B adenosine receptor (ADORA2B) signaling contributed to the development of these features of preeclampsia. Mechanistically, we provided both human and mouse evidence that elevated placental CD73 is a key enzyme causing increased placental adenosine, thereby contributing to preeclampsia. We determined that elevated placental adenosine signaling is a previously unrecognized pathogenic factor for preeclampsia. Moreover, our findings revealed the molecular basis underlying the elevation of placental adenosine and the detrimental role of excess placental adenosine in the pathophysiology of preeclampsia, and thereby, we highlight novel therapeutic targets. © 2014 American Heart Association, Inc.

  1. Vasoconstrictor and vasodilator effects of adenosine in the kidney

    DEFF Research Database (Denmark)

    Hansen, Pernille B; Schnermann, Jurgen

    2003-01-01

    Adenosine is an ATP breakdown product that in most vessels causes vasodilatation and that contributes to the metabolic control of organ perfusion, i.e., to the match between oxygen demand and oxygen delivery. In the renal vasculature, in contrast, adenosine can produce vasoconstriction, a respons...

  2. Modulation of innate immunity by adenosine receptor stimulation

    NARCIS (Netherlands)

    Ramakers, B.P.C.; Riksen, N.P.; Hoeven, J.G. van der; Smits, P.; Pickkers, P.

    2011-01-01

    In the past decades, increased concentrations of the signaling molecule adenosine have been shown to play an important role in the prevention of tissue damage evoked by several stressful circumstances. During systemic inflammation, the circulating adenosine concentration increases rapidly, even up

  3. Adenosine deaminase activities and fasting blood glucose in obesity ...

    African Journals Online (AJOL)

    Background: A complex relationship seems to exist between adenosine deaminase (ADA) and insulin in obesity. Through its effect on adenosine, the enzyme can modulate the action of insulin and affect blood glucose while the administration of insulin is said to decrease the activities of the enzyme. Aim: To investigate the ...

  4. Endogenous adenosine curtails lipopolysaccharide-stimulated tumour necrosis factor synthesis

    NARCIS (Netherlands)

    Eigler, A; Greten, T F; Sinha, B; Haslberger, C; Sullivan, G W; Endres, S

    Recent studies have demonstrated the inhibitory effect of exogenous adenosine on TNF production. During inflammation endogenous adenosine levels are elevated and may be one of several anti-inflammatory mediators that reduce TNF synthesis. In the present study the authors investigated this role of

  5. Norepinephrines effect on adenosine transport in the proximal straight tubule

    International Nuclear Information System (INIS)

    Barfuss, D.W.; McCann, W.P.; Katholi, R.E.

    1986-01-01

    The effect of norepinephrine on C 14 -adenosine transport in the rabbit proximal tubule (S 2 ) was studied. The transepithelial transport of adenosine (0.02 mM0 from lumin to bathing solution was measured by its rate of appearance (J/sub A/) in the bathing solution and by its disappearances (J/sub D/) from the luminal fluid. Norepinephrine (0.24 μM) was added to the bathing solution after a control flux period. After three samples from the experiment period the tubules were quickly harvested and the cellular concentration of C 14 -adenosine was determined. The high cellular adenosine concentration and th marked difference in adenosine appearance rate in the bathing solution compared to the luminal disappearance rate indicates the absorbed adenosine is trapped in the cells. This trapping may be due to adenosine metabolism or difficulty of crossing the basolateral membrane. Whichever is the case, norepinephrine appears to stimulate movement of adenosine or its metabolites into the bathing solution across the basolateral membrane

  6. Adenosine Deaminase Activity in Subjects with Normal Pregnancy ...

    African Journals Online (AJOL)

    BACKGROUND: Both pregnancy and adenosine deaminase (ADA) are associated with depressed cellular mediated immunity. There is little information on ADA activity in pregant Africans. OBJECTIVE: To determine the serum levels of adenosine deaminase (ADA) in normal pregnancy and pregnancy complicated by ...

  7. Cordycepin Increases Nonrapid Eye Movement Sleep via Adenosine Receptors in Rats

    Directory of Open Access Journals (Sweden)

    Zhenzhen Hu

    2013-01-01

    Full Text Available Cordycepin (3′-deoxyadenosine is a naturally occurring adenosine analogue and one of the bioactive constituents isolated from Cordyceps militaris/Cordyceps sinensis, species of the fungal genus Cordyceps. It has traditionally been a prized Chinese folk medicine for the human well-being. Because of similarity of chemical structure of adenosine, cordycepin has been focused on the diverse effects of the central nervous systems (CNSs, like sleep regulation. Therefore, this study was undertaken to know whether cordycepin increases the natural sleep in rats, and its effect is mediated by adenosine receptors (ARs. Sleep was recorded using electroencephalogram (EEG for 4 hours after oral administration of cordycepin in rats. Sleep architecture and EEG power spectra were analyzed. Cordycepin reduced sleep-wake cycles and increased nonrapid eye movement (NREM sleep. Interestingly, cordycepin increased θ (theta waves power density during NREM sleep. In addition, the protein levels of AR subtypes (A1, A2A, and A2B were increased after the administration of cordycepin, especially in the rat hypothalamus which plays an important role in sleep regulation. Therefore, we suggest that cordycepin increases theta waves power density during NREM sleep via nonspecific AR in rats. In addition, this experiment can provide basic evidence that cordycepin may be helpful for sleep-disturbed subjects.

  8. Cordycepin Increases Nonrapid Eye Movement Sleep via Adenosine Receptors in Rats.

    Science.gov (United States)

    Hu, Zhenzhen; Lee, Chung-Il; Shah, Vikash Kumar; Oh, Eun-Hye; Han, Jin-Yi; Bae, Jae-Ryong; Lee, Kinam; Chong, Myong-Soo; Hong, Jin Tae; Oh, Ki-Wan

    2013-01-01

    Cordycepin (3'-deoxyadenosine) is a naturally occurring adenosine analogue and one of the bioactive constituents isolated from Cordyceps militaris/Cordyceps sinensis, species of the fungal genus Cordyceps. It has traditionally been a prized Chinese folk medicine for the human well-being. Because of similarity of chemical structure of adenosine, cordycepin has been focused on the diverse effects of the central nervous systems (CNSs), like sleep regulation. Therefore, this study was undertaken to know whether cordycepin increases the natural sleep in rats, and its effect is mediated by adenosine receptors (ARs). Sleep was recorded using electroencephalogram (EEG) for 4 hours after oral administration of cordycepin in rats. Sleep architecture and EEG power spectra were analyzed. Cordycepin reduced sleep-wake cycles and increased nonrapid eye movement (NREM) sleep. Interestingly, cordycepin increased θ (theta) waves power density during NREM sleep. In addition, the protein levels of AR subtypes (A1, A2A, and A2B) were increased after the administration of cordycepin, especially in the rat hypothalamus which plays an important role in sleep regulation. Therefore, we suggest that cordycepin increases theta waves power density during NREM sleep via nonspecific AR in rats. In addition, this experiment can provide basic evidence that cordycepin may be helpful for sleep-disturbed subjects.

  9. The A1 adenosine receptor as a new player in microglia physiology.

    Science.gov (United States)

    Luongo, L; Guida, F; Imperatore, R; Napolitano, F; Gatta, L; Cristino, L; Giordano, C; Siniscalco, D; Di Marzo, V; Bellini, G; Petrelli, R; Cappellacci, L; Usiello, A; de Novellis, V; Rossi, F; Maione, S

    2014-01-01

    The purinergic system is highly involved in the regulation of microglial physiological processes. In addition to the accepted roles for the P2 X4,7 and P2 Y12 receptors activated by adenosine triphosphate (ATP) and adenosine diphosphate, respectively, recent evidence suggests a role for the adenosine A2A receptor in microglial cytoskeletal rearrangements. However, the expression and function of adenosine A1 receptor (A1AR) in microglia is still unclear. Several reports have demonstrated possible expression of A1AR in microglia, but a new study has refuted such evidence. In this study, we investigated the presence and function of A1AR in microglia using biomolecular techniques, live microscopy, live calcium imaging, and in vivo electrophysiological approaches. The aim of this study was to clarify the expression of A1AR in microglia and to highlight its possible roles. We found that microglia express A1AR and that it is highly upregulated upon ATP treatment. Moreover, we observed that selective stimulation of A1AR inhibits the morphological activation of microglia, possibly by suppressing the Ca(2+) influx induced by ATP treatment. Finally, we recorded the spontaneous and evoked activity of spinal nociceptive-specific neuron before and after application of resting or ATP-treated microglia, with or without preincubation with a selective A1AR agonist. We found that the microglial cells, pretreated with the A1AR agonist, exhibit lower capability to facilitate the nociceptive neurons, as compared with the cells treated with ATP alone. Copyright © 2013 Wiley Periodicals, Inc.

  10. Crystal structure of the adenosine A2Areceptor bound to an antagonist reveals a potential allosteric pocket.

    Science.gov (United States)

    Sun, Bingfa; Bachhawat, Priti; Chu, Matthew Ling-Hon; Wood, Martyn; Ceska, Tom; Sands, Zara A; Mercier, Joel; Lebon, Florence; Kobilka, Tong Sun; Kobilka, Brian K

    2017-02-21

    The adenosine A 2A receptor (A 2A R) has long been implicated in cardiovascular disorders. As more selective A 2A R ligands are being identified, its roles in other disorders, such as Parkinson's disease, are starting to emerge, and A 2A R antagonists are important drug candidates for nondopaminergic anti-Parkinson treatment. Here we report the crystal structure of A 2A receptor bound to compound 1 (Cmpd-1), a novel A 2A R/ N -methyl d-aspartate receptor subtype 2B (NR2B) dual antagonist and potential anti-Parkinson candidate compound, at 3.5 Å resolution. The A 2A receptor with a cytochrome b562-RIL (BRIL) fusion (A 2A R-BRIL) in the intracellular loop 3 (ICL3) was crystallized in detergent micelles using vapor-phase diffusion. Whereas A 2A R-BRIL bound to the antagonist ZM241385 has previously been crystallized in lipidic cubic phase (LCP), structural differences in the Cmpd-1-bound A 2A R-BRIL prevented formation of the lattice observed with the ZM241385-bound receptor. The crystals grew with a type II crystal lattice in contrast to the typical type I packing seen from membrane protein structures crystallized in LCP. Cmpd-1 binds in a position that overlaps with the native ligand adenosine, but its methoxyphenyl group extends to an exosite not previously observed in other A 2A R structures. Structural analysis revealed that Cmpd-1 binding results in the unique conformations of two tyrosine residues, Tyr9 1.35 and Tyr271 7.36 , which are critical for the formation of the exosite. The structure reveals insights into antagonist binding that are not observed in other A 2A R structures, highlighting flexibility in the binding pocket that may facilitate the development of A 2A R-selective compounds for the treatment of Parkinson's disease.

  11. Adenosine signaling in reserpine-induced depression in rats.

    Science.gov (United States)

    Minor, Thomas R; Hanff, Thomas C

    2015-06-01

    A single, 6 mg/kg intraperitoneal injection of reserpine increased floating time during forced swim testing 24h after administration in rats in five experiments. Although such behavioral depression traditionally is attributed to drug-induced depletion of brain monoamines, we examined the potential contribution of adenosine signaling, which is plausibly activated by reserpine treatment and contributes to behavioral depression in other paradigms. Whereas peripheral administration of the highly selective A1 receptor antagonist 8-cyclopentyl-1,3-dipropylxanthine (0.5, 1.0, or 5.0mg/kg i.p.) 15 min before swim testing failed to improve performance in reserpine-treated rats, swim deficits were completely reversed by 7 mg/kg of the nonselective receptor antagonist caffeine. Performance deficits were also reversed by the nonselective A2 antagonist 3,7-dimethylxanthine (0, 0.5, 1.0mg/kg i.p.), and the highly selective A2A receptor antagonist (CSC: 8-(3 chlorostyral)caffeine) (0.01, 0.1, or 1.0mg/kg i.p.) in a dose-dependent manner. The highly selective A2B antagonist alloxazine had no beneficial effect on swim performance at any dose under study (0.1, 1.0, and 5.0mg/kg i.p.). Copyright © 2015 Elsevier B.V. All rights reserved.

  12. N6-Cycloalkyl- and N6-bicycloalkyl-C5'(C2')-modified adenosine derivatives as high-affinity and selective agonists at the human A1 adenosine receptor with antinociceptive effects in mice.

    Science.gov (United States)

    Franchetti, Palmarisa; Cappellacci, Loredana; Vita, Patrizia; Petrelli, Riccardo; Lavecchia, Antonio; Kachler, Sonja; Klotz, Karl-Norbert; Marabese, Ida; Luongo, Livio; Maione, Sabatino; Grifantini, Mario

    2009-04-23

    To further investigate new potent and selective human A(1) adenosine receptor agonists, we have synthesized a series of 5'-chloro-5'-deoxy- and 5'-(2-fluorophenylthio)-5'-deoxy-N(6)-cycloalkyl(bicycloalkyl)-substituted adenosine and 2'-C-methyladenosine derivatives. These compounds were evaluated for affinity and efficacy at human A(1), A(2A), A(2B), and A(3) adenosine receptors. In the series of N(6)-cyclopentyl- and N(6)-(endo-norborn-2-yl)adenosine derivatives, 5'-chloro-5'-deoxy-CPA (1) and 5'-chloro-5'-deoxy-(+/-)-ENBA (3) displayed the highest affinity in the subnanomolar range and relevant selectivity for hA(1) vs the other human receptor subtypes. The higher affinity and selectivity of 5'-chloro-5'-deoxyribonucleoside derivatives 1 and 3 for hA(1) AR vs hA(3) AR compared to that of the parent 5'-hydroxy compounds CPA and (+/-)-ENBA was rationalized by a molecular modeling analysis. 5'-Chloro-5'-deoxy-(+/-)-ENBA, evaluated for analgesic activity in the formalin test in mice, was found to inhibit the first or the second phases of the nocifensive response induced by intrapaw injection of formalin at doses ranging between 1 and 2 mg/kg i.p.

  13. Measurement of striatal dopamine metabolism with 6-[18F]-fluoro-L-dopa and PET

    International Nuclear Information System (INIS)

    Kuwabara, Y.; Otsuka, M.; Ichiya, Y.; Yoshikai, T.; Fukumura, T.; Masuda, K.; Kato, M.; Taniwaki, T.

    1992-01-01

    Striatal dopamine metabolism was studied with 6-[ 18 F]-fluoro-L-dopa ( 18 F-DOPA) and PET. The subjects were normal controls, and patients with Parkinson's disease (PD), parkinsonism, multiple system atrophy (MSA), progressive supranuclear palsy (PSP), Alzheimer's disease (AD), Huntington's disease (HD) and other cerebral disorders. Cerebral glucose metabolism (CMRGlc) was also measured in these patients. Striatal dopamine metabolism was evaluated by the relative striatal uptake of 18 F-DOPA referring cerebellum (S/C ratio). In normal controls, the S/C ratio was 2.82 ± 0.32 (n = 6, mean ± SD) at 120 min after injection of 18 F-DOPA. The S/C ratio was low in patients with PD, parkinsonism, MSA and PSP compared to the normal controls and thus coincident with the symptoms of parkinsonism due to decrease in striatal dopamine concentration. The decrease in the striatal CMRGlc was also observed in patients with parkinsonism and PSP, and it was preserved in patients with PD, thus representing that more neurons were damaged in patients with parkinsonism and PSP than in patients with PD. A patient with AD having symptoms of parkinsonism also showed a decrease in S/C ratio. In a patient with HD, the striatal CMRGlc sharply decreased, but the S/C ratio was normal. The measurements of striatal dopamine and glucose metabolism with PET may be useful for studying the pathophysiological mechanism in patients with cerebral disorders. (author)

  14. Adenosine Receptors As Drug Targets for Treatment of Pulmonary Arterial Hypertension

    Directory of Open Access Journals (Sweden)

    Allan K. N. Alencar

    2017-12-01

    Full Text Available Pulmonary arterial hypertension (PAH is a clinical condition characterized by pulmonary arterial remodeling and vasoconstriction, which promote chronic vessel obstruction and elevation of pulmonary vascular resistance. Long-term right ventricular (RV overload leads to RV dysfunction and failure, which are the main determinants of life expectancy in PAH subjects. Therapeutic options for PAH remain limited, despite the introduction of prostacyclin analogs, endothelin receptor antagonists, phosphodiesterase type 5 inhibitors, and soluble guanylyl cyclase stimulators within the last 15 years. Through addressing the pulmonary endothelial and smooth muscle cell dysfunctions associated with PAH, these interventions delay disease progression but do not offer a cure. Emerging approaches to improve treatment efficacy have focused on beneficial actions to both the pulmonary vasculature and myocardium, and several new targets have been investigated and validated in experimental PAH models. Herein, we review the effects of adenosine and adenosine receptors (A1, A2A, A2B, and A3 on the cardiovascular system, focusing on the A2A receptor as a pharmacological target. This receptor induces pulmonary vascular and heart protection in experimental models, specifically models of PAH. Targeting the A2A receptor could potentially serve as a novel and efficient approach for treating PAH and concomitant RV failure. A2A receptor activation induces pulmonary endothelial nitric oxide synthesis, smooth muscle cell hyperpolarization, and vasodilation, with important antiproliferative activities through the inhibition of collagen deposition and vessel wall remodeling in the pulmonary arterioles. The pleiotropic potential of A2A receptor activation is highlighted by its additional expression in the heart tissue, where it participates in the regulation of intracellular calcium handling and maintenance of heart chamber structure and function. In this way, the activation of A2A

  15. Adenosine Receptors As Drug Targets for Treatment of Pulmonary Arterial Hypertension.

    Science.gov (United States)

    Alencar, Allan K N; Montes, Guilherme C; Barreiro, Eliezer J; Sudo, Roberto T; Zapata-Sudo, Gisele

    2017-01-01

    Pulmonary arterial hypertension (PAH) is a clinical condition characterized by pulmonary arterial remodeling and vasoconstriction, which promote chronic vessel obstruction and elevation of pulmonary vascular resistance. Long-term right ventricular (RV) overload leads to RV dysfunction and failure, which are the main determinants of life expectancy in PAH subjects. Therapeutic options for PAH remain limited, despite the introduction of prostacyclin analogs, endothelin receptor antagonists, phosphodiesterase type 5 inhibitors, and soluble guanylyl cyclase stimulators within the last 15 years. Through addressing the pulmonary endothelial and smooth muscle cell dysfunctions associated with PAH, these interventions delay disease progression but do not offer a cure. Emerging approaches to improve treatment efficacy have focused on beneficial actions to both the pulmonary vasculature and myocardium, and several new targets have been investigated and validated in experimental PAH models. Herein, we review the effects of adenosine and adenosine receptors (A 1 , A 2A , A 2B , and A 3 ) on the cardiovascular system, focusing on the A 2A receptor as a pharmacological target. This receptor induces pulmonary vascular and heart protection in experimental models, specifically models of PAH. Targeting the A 2A receptor could potentially serve as a novel and efficient approach for treating PAH and concomitant RV failure. A 2A receptor activation induces pulmonary endothelial nitric oxide synthesis, smooth muscle cell hyperpolarization, and vasodilation, with important antiproliferative activities through the inhibition of collagen deposition and vessel wall remodeling in the pulmonary arterioles. The pleiotropic potential of A 2A receptor activation is highlighted by its additional expression in the heart tissue, where it participates in the regulation of intracellular calcium handling and maintenance of heart chamber structure and function. In this way, the activation of A 2A

  16. Theacrine: A purine alkaloid from Camellia assamica var. kucha with a hypnotic property via the adenosine system.

    Science.gov (United States)

    Qiao, Haoyi; Ye, Xiansheng; Bai, Xiaoyu; He, Jun; Li, Tingli; Zhang, Jia; Zhang, Weiku; Xu, Jiekun

    2017-10-17

    Theacrine (l,3,7,9-tetramethyluric acid), a purine alkaloid from Camellia assamica var. kucha, has diverse pharmacological properties, including sedative and hypnotic activities, anti-inflammatory and analgesic activities, antidepressant effects, and a protective effect against stress-provoked liver damage. The present study aims to investigate the possible mechanism of the hypnotic activity of theacrine. The results revealed that theacrine significantly enhanced pentobarbital-induced sleep at a dose of 3.0mg/kg (i.g.) in mice. Sleep parameter analysis by EEG and EMG showed that theacrine obviously shortened wake time and increased NREM sleep time and that theacrine almost had no effect on REM sleep. Meanwhile, theacrine markedly attenuated caffeine (a nonselective antagonist of adenosine receptor)-induced insomnia. In pretreatment with the adenosine A 1 receptor antagonist DPCPX and the A 2A receptor antagonist SCH 58261, theacrine significantly reversed the decrease in sleeping time in pentobarbital-treated mice. In addition, theacrine also markedly increased the adenosine content in the hippocampus of rats. These results suggested that theacrine might mediate the adenosine system to augment pentobarbital-induced sleep. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Temporal variations of adenosine metabolism in human blood.

    Science.gov (United States)

    Chagoya de Sánchez, V; Hernández-Muñoz, R; Suárez, J; Vidrio, S; Yáñez, L; Aguilar-Roblero, R; Oksenberg, A; Vega-González, A; Villalobos, L; Rosenthal, L; Fernández-Cancino, F; Drucker-Colín, R; Díaz-Muñoz, M

    1996-08-01

    Eight diurnally active (06:00-23:00 h) subjects were adapted for 2 days to the room conditions where the experiments were performed. Blood sampling for adenosine metabolites and metabolizing enzymes was done hourly during the activity span and every 30 min during sleep. The results showed that adenosine and its catabolites (inosine, hypoxanthine, and uric acid), adenosine synthesizing (S-adenosylhomocysteine hydrolase and 5'-nucleotidase), degrading (adenosine deaminase) and nucleotide-forming (adenosine kinase) enzymes as well as adenine nucleotides (AMP, ADP, and ATP) undergo statistically significant fluctuations (ANOVA) during the 24 h. However, energy charge was invariable. Glucose and lactate chronograms were determined as metabolic indicators. The same data analyzed by the chi-square periodogram and Fourier series indicated ultradian oscillatory periods for all the metabolites and enzymatic activities determined, and 24-h oscillatory components for inosine, hypoxanthine, adenine nucleotides, glucose, and the activities of SAH-hydrolase, 5'-nucleotidase, and adenosine kinase. The single cosinor method showed significant oscillatory components exclusively for lactate. As a whole, these results suggest that adenosine metabolism may play a role as a biological oscillator coordinating and/or modulating the energy homeostasis and physiological status of erythrocytes in vivo and could be an important factor in the distribution of purine rings for the rest of the organism.

  18. Characteristic molecular vibrations of adenosine receptor ligands.

    Science.gov (United States)

    Chee, Hyun Keun; Yang, Jin-San; Joung, Je-Gun; Zhang, Byoung-Tak; Oh, S June

    2015-02-13

    Although the regulation of membrane receptor activation is known to be crucial for molecular signal transduction, the molecular mechanism underlying receptor activation is not fully elucidated. Here we study the physicochemical nature of membrane receptor behavior by investigating the characteristic molecular vibrations of receptor ligands using computational chemistry and informatics methods. By using information gain, t-tests, and support vector machines, we have identified highly informative features of adenosine receptor (AdoR) ligand and corresponding functional amino acid residues such as Asn (6.55) of AdoR that has informative significance and is indispensable for ligand recognition of AdoRs. These findings may provide new perspectives and insights into the fundamental mechanism of class A G protein-coupled receptor activation. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  19. Striatal dopamine release induced by repetitive transcranial magnetic stimulation over dorsolateral prefrontal cortex: effect of aging

    Energy Technology Data Exchange (ETDEWEB)

    Bang, Seong Ae; Cho, Sang Soo; Yoon, Eun Jin; Kim, Ji Sun; Lee, Byung Chul; Kim, Yu Kyeong; Kim, Sang Eun [Seoul National Univ. College of Medicine, Seoul (Korea, Republic of)

    2007-07-01

    We previously demonstrated dopamine (DA) release in the bilateral striatal regions following prefrontal repetitive transcranial magnetic stimulation (rTMS) in young subjects. Several lines of evidence support substantial age-related changes in human dopaminergic neurotransmission. One possible explanation is alteration of cortico striatal neural connection with aging. Therefore, we investigated how frontal activation by rTMS influences striatal DA release in the elderly with SPECT measurements of striatal binding of [123I]iodobenzamide (lBZM), a DA D2 receptor radioligand that is sensitive to endogenous DA. Five healthy elderly male subjects (age, 64 3 y) were studied with brain [123I]IBZM SPECT under three conditions (resting, sham stimulation, and active rTMS over left dorsolateral prefrontal cortex (DLPFC)), while receiving a bolus plus constant infusion of [123I]IBZM. rTMS session consisted of three blocks. In each block, 15 trains of 2 sec duration were delivered with 10 Hz stimulation frequency and 100% motor threshold. Striatal V3', calculated as (striatal - occipital)/occipital radioactivity, was measured under equilibrium condition at baseline and after sham and active rTMS. Sham stimulation did not affect striatal V3'. rTMS over left DLPFC induced no significant change in V3' in the right striatum compared with baseline condition (0.91 0.25 vs. 0.96 0.25, P = NS). Interestingly, left striatal V3' showed a significant increase after rTMS over left DLPFC compared with sham condition (1.09 0.33 vs. 0.93 0.27, P < 0.05; 17.0 11.1% increase). These results are discrepant from previous ones from young subjects, who showed frontal rTMS-induced reduction of striatal V3', indicating rTMS-induced striatal DA release. We found no significant striatal DA release induced by rTMS over DLPFC in healthy elderly subjects using in vivo binding competition techniques. These results may support an altered cortico striatal circuit in normal aging.

  20. Regulation of drugs affecting striatal cholinergic activity by corticostriatal projections

    International Nuclear Information System (INIS)

    Ladinsky, H.

    1986-01-01

    Research demonstrates that the chronic degeneration of the corticostriatal excitatory pathway makes the cholinergic neurons of the striatum insensitive to the neuropharmacological action of a number of different drugs. Female rats were used; they were killed and after the i.v. infusion of tritium-choline precursor, choline acetyltransferase activity was measured. Striatal noradrenaline, dopamine and serotonin content was measured by electrochemical detection coupled with high pressure liquid chromatography. Uptake of tritium-glutamic acid was estimated. The data were analyzed statistically. It is shown that there is evidence that the effects of a number of drugs capable of depressing cholinergic activity through receptor-mediated responses are operative only if the corticostriatal pathway is integral. Neuropharmacological responses in the brain appear to be the result of an interaction between several major neurotransmitter systems

  1. Striatal grafts in a rat model of Huntington's disease

    DEFF Research Database (Denmark)

    Guzman, R; Meyer, M; Lövblad, K O

    1999-01-01

    , which was found unaltered for the first 21 days posttransplantation, whereas a hypointense graft signal was detected at 99 days posttransplantation. At 2 days posttransplantation, T2-weighted images showed the graft region as a hyperintense area surrounded by a rim of low signal intensity but at later...... time-points graft location could not be further verified. Measures for graft size and ventricle size obtained from MR images highly correlated with measures obtained from histologically processed sections (R = 0.8, P ...Survival and integration into the host brain of grafted tissue are crucial factors in neurotransplantation approaches. The present study explored the feasibility of using a clinical MR scanner to study striatal graft development in a rat model of Huntington's disease. Rat fetal lateral ganglionic...

  2. Astrocytosis in parkinsonism: considering tripartite striatal synapses in physiopathology?

    Science.gov (United States)

    Charron, Giselle; Doudnikoff, Evelyne; Canron, Marie-Helene; Li, Qin; Véga, Céline; Marais, Sebastien; Baufreton, Jérôme; Vital, Anne; Oliet, Stéphane H R; Bezard, Erwan

    2014-01-01

    The current concept of basal ganglia organization and function in physiological and pathophysiological conditions excludes the most numerous cells in the brain, i.e., the astrocytes, present with a ratio of 10:1 neuron. Their role in neurodegenerative condition such as Parkinson's disease (PD) remains to be elucidated. Before embarking into physiological investigations of the yet-to-be-identified "tripartite" synapses in the basal ganglia in general and the striatum in particular, we therefore characterized anatomically the PD-related modifications in astrocytic morphology, the changes in astrocytic network connections and the consequences on the spatial relationship between astrocytic processes and asymmetric synapses in normal and PD-like conditions in experimental and human PD. Our results unravel a dramatic regulation of striatal astrocytosis supporting the hypothesis of a key role in (dys) regulating corticostriatal transmission. Astrocytes and their various properties might thus represent a therapeutic target in PD.

  3. Astrocytosis in parkinsonism: considering tripartite striatal synapses in physiopathology?

    Directory of Open Access Journals (Sweden)

    Giselle eCharron

    2014-09-01

    Full Text Available The current concept of basal ganglia organization and function in physiological and pathophysiological conditions excludes the most numerous cells in the brain, i.e. the astrocytes, present with a ratio of 10:1 neuron. Their role in neurodegenerative condition such as Parkinson’s disease (PD remains to be elucidated. Before embarking into physiological investigations of the yet-to-be-identified tripartite synapses in the basal ganglia in general and the striatum in particular, we therefore characterized anatomically the PD-related modifications in astrocytic morphology, the changes in astrocytic network connections and the consequences on the spatial relationship between astrocytic processes and asymmetric synapses in normal and PD-like conditions in experimental and human PD. Our results unravel a dramatic regulation of striatal astrocytosis supporting the hypothesis of a key role in (dysregulating corticostriatal transmission. Astrocytes and their various properties might thus represent a therapeutic target in PD.

  4. Regulation of bat echolocation pulse acoustics by striatal dopamine.

    Science.gov (United States)

    Tressler, Jedediah; Schwartz, Christine; Wellman, Paul; Hughes, Samuel; Smotherman, Michael

    2011-10-01

    The ability to control the bandwidth, amplitude and duration of echolocation pulses is a crucial aspect of echolocation performance but few details are known about the neural mechanisms underlying the control of these voice parameters in any mammal. The basal ganglia (BG) are a suite of forebrain nuclei centrally involved in sensory-motor control and are characterized by their dependence on dopamine. We hypothesized that pharmacological manipulation of brain dopamine levels could reveal how BG circuits might influence the acoustic structure of bat echolocation pulses. A single intraperitoneal injection of a low dose (5 mg kg(-1)) of the neurotoxin 1-methyl-4-phenylpyridine (MPTP), which selectively targets dopamine-producing cells of the substantia nigra, produced a rapid degradation in pulse acoustic structure and eliminated the bat's ability to make compensatory changes in pulse amplitude in response to background noise, i.e. the Lombard response. However, high-performance liquid chromatography (HPLC) measurements of striatal dopamine concentrations revealed that the main effect of MPTP was a fourfold increase rather than the predicted decrease in striatal dopamine levels. After first using autoradiographic methods to confirm the presence and location of D(1)- and D(2)-type dopamine receptors in the bat striatum, systemic injections of receptor subtype-specific agonists showed that MPTP's effects on pulse acoustics were mimicked by a D(2)-type dopamine receptor agonist (Quinpirole) but not by a D(1)-type dopamine receptor agonist (SKF82958). The results suggest that BG circuits have the capacity to influence echolocation pulse acoustics, particularly via D(2)-type dopamine receptor-mediated pathways, and may therefore represent an important mechanism for vocal control in bats.

  5. Neonatal exposure to antiepileptic drugs disrupts striatal synaptic development.

    Science.gov (United States)

    Forcelli, Patrick A; Janssen, Megan J; Vicini, Stefano; Gale, Karen

    2012-09-01

    Drug exposure during critical periods of brain development may adversely affect nervous system function, posing a challenge for treating infants. This is of particular concern for treating neonatal seizures, as early life exposure to drugs such as phenobarbital is associated with adverse neurological outcomes in patients and induction of neuronal apoptosis in animal models. The functional significance of the preclinical neurotoxicity has been questioned due to the absence of evidence for functional impairment associated with drug-induced developmental apoptosis. We used patch-clamp recordings to examine functional synaptic maturation in striatal medium spiny neurons from neonatal rats exposed to antiepileptic drugs with proapoptotic action (phenobarbital, phenytoin, lamotrigine) and without proapoptotic action (levetiracetam). Phenobarbital-exposed rats were also assessed for reversal learning at weaning. Recordings from control animals revealed increased inhibitory and excitatory synaptic connectivity between postnatal day (P)10 and P18. This maturation was absent in rats exposed at P7 to a single dose of phenobarbital, phenytoin, or lamotrigine. Additionally, phenobarbital exposure impaired striatal-mediated behavior on P25. Neuroprotective pretreatment with melatonin, which prevents drug-induced neurodevelopmental apoptosis, prevented the drug-induced disruption in maturation. Levetiracetam was found not to disrupt synaptic development. Our results provide the first evidence that exposure to antiepileptic drugs during a sensitive postnatal period impairs physiological maturation of synapses in neurons that survive the initial drug insult. These findings suggest a mechanism by which early life exposure to antiepileptic drugs can impact cognitive and behavioral outcomes, underscoring the need to identify therapies that control seizures without compromising synaptic maturation. Copyright © 2012 American Neurological Association.

  6. Speech-induced striatal dopamine release is left lateralized and coupled to functional striatal circuits in healthy humans: A combined PET, fMRI and DTI study

    Science.gov (United States)

    Simonyan, Kristina; Herscovitch, Peter; Horwitz, Barry

    2013-01-01

    Considerable progress has been recently made in understanding the brain mechanisms underlying speech and language control. However, the neurochemical underpinnings of normal speech production remain largely unknown. We investigated the extent of striatal endogenous dopamine release and its influences on the organization of functional striatal speech networks during production of meaningful English sentences using a combination of positron emission tomography (PET) with the dopamine D2/D3 receptor radioligand [11C]raclopride and functional MRI (fMRI). In addition, we used diffusion tensor tractography (DTI) to examine the extent of dopaminergic modulatory influences on striatal structural network organization. We found that, during sentence production, endogenous dopamine was released in the ventromedial portion of the dorsal striatum, in its both associative and sensorimotor functional divisions. In the associative striatum, speech-induced dopamine release established a significant relationship with neural activity and influenced the left-hemispheric lateralization of striatal functional networks. In contrast, there were no significant effects of endogenous dopamine release on the lateralization of striatal structural networks. Our data provide the first evidence for endogenous dopamine release in the dorsal striatum during normal speaking and point to the possible mechanisms behind the modulatory influences of dopamine on the organization of functional brain circuits controlling normal human speech. PMID:23277111

  7. Possible mechanism of adenosine protection in carbon tetrachloride acute hepatotoxicity. Role of adenosine by-products and glutathione peroxidase.

    Science.gov (United States)

    Chagoya de Sánchez, V; Hernández-Muñoz, R; Yáñez, L; Vidrio, S; Díaz-Muñoz, M

    1995-02-01

    Adenosine proved to be an effective hepatoprotector increasing the survival rate of rats receiving lethal doses of CCl4. Searching for the mechanism of action, we found that adenosine transiently prevents the necrotic liver damage associated to an acute CCl4 treatment. The antilipoperoxidative action of the nucleoside was evidenced by a decrease of TBA-reactive products and the diene conjugates elicited by the hepatotoxin. Adenosine's protective effect was demonstrated by reverting the decrease of cytochrome P-450 while preserved intact the activity of the microsomal enzyme glucose-6-phosphatase. CCl4 promoted an increase in the oxidant stress through an enhancement in oxidized glutathione levels. This action was also completely counteracted by the nucleoside. Adenosine was unable to prevent CCl4 activation and, even, increased .CCl3 formation in the presence of PBN in vivo. However, in the presence of the nucleoside, irreversible binding of 14CCl4 to the microsomal lipid fraction of the treated animals was decreased. These results suggest that adenosine protective action might be exerted at the level of the propagation reaction following CCl4 activation. Two possible mechanisms were associated to the nucleoside protection: (1) the peroxide-metabolyzed enzymes, GSH-per, showed a marked increase after 30 minutes of adenosine treatment, which was potentiated by the hepatotoxin, suggesting an important role of this enzyme in the nucleoside's action; (2) the adenosine catabolism induced an increase in uric acid level, and allopurinol, a purine metabolism inhibitor, prevented such elevation as well as the antilipoperoxidative action of adenosine and the increase of GSH-per associated with the nucleoside treatment. These facts strongly suggest that the protective effect elicited by adenosine is not a direct one, but rather is related to its catabolic products, such as uric acid, which has been recognized as a free radical scavenger.

  8. Striatal and extra-striatal dopamine transporter in cannabis and tobacco addiction: a high resolution PET study

    International Nuclear Information System (INIS)

    Leroy, C.; Martinot, J.L.; Duchesnay, E.; Artiges, E.; Ribeiro, M.J.; Trichard, Ch.; Karila, L.; Lukasiewicz, M.; Benyamina, A.; Reynaud, M.; Martinot, J.L.; Duchesnay, E.; Artiges, E.; Comtat, C.; Artiges, E.; Trichard, Ch.

    2011-01-01

    The dopamine (DA) system is known to be involved in the reward and dependence mechanisms of addiction. However, modifications in dopaminergic neurotransmission associated with long-term tobacco and cannabis use have been poorly documented in vivo. In order to assess striatal and extra-striatal dopamine transporter (DAT) availability in tobacco and cannabis addiction, three groups of male age-matched subjects were compared: 11 healthy non-smoker subjects, 14 tobacco-dependent smokers (17.6 ± 5.3 cigarettes/day for 12.1 ± 8.5 years) and 13 cannabis and tobacco smokers (CTS) (4.8 ± 5.3 cannabis joints/day for 8.7 ± 3.9 years). DAT availability was examined in positron emission tomography (HRRT) with a high resolution research tomograph after injection of [ 11 C]PE2I, a selective DAT radioligand. Region of interest and voxel-by-voxel approaches using a simplified reference tissue model were performed for the between-group comparison of DAT availability. Measurements in the dorsal striatum from both analyses were concordant and showed a mean 20% lower DAT availability in drug users compared with controls. Whole-brain analysis also revealed lower DAT availability in the ventral striatum, the midbrain, the middle cingulate and the thalamus (ranging from -15 to -30%). The DAT availability was slightly lower in all regions in CTS than in subjects who smoke tobacco only, but the difference does not reach a significant level. These results support the existence of a decrease in DAT availability associated with tobacco and cannabis addictions involving all dopaminergic brain circuits. These findings are consistent with the idea of a global decrease in cerebral DA activity in dependent subjects. (authors)

  9. Photoreaction of 4,5',8-trimethylpsoralen with adenosine

    International Nuclear Information System (INIS)

    Sangchul Shim; Seungju Choi

    1990-01-01

    The near-UV induced photoreaction of 4,5',8-trimethylpsoralen (TMP) with adenosine was investigated in a dry film state. Four major photoadducts were isolated and purified by reverse-phase liquid chromatography. The structures of the photoproducts were elucidated on the basis of spectroscopic methods, including UV, FT-IR, mass spectrometry (FAB and EI methods) and 1 H-NMR analysis. These photoproducts were characterized to be TMP-adenosine 1:1 adducts, which resulted from the covalent bond formation between the carbon C(4) of TMP and ribose 1' or 5' carbon of adenosine. Of the photoadducts, one photoadduct (V) was the major product, reflecting some selectivity in the photoreaction of TMP with adenosine in the solid state. (author)

  10. Metformin prevents myocardial reperfusion injury by activating the adenosine receptor.

    NARCIS (Netherlands)

    Paiva, M.; Riksen, N.P.; Davidson, S.M.; Hausenloy, D.J.; Monteiro, P.; Goncalves, L.; Providencia, L.; Rongen, G.A.P.J.M.; Smits, P.; Mocanu, M.M.; Yellon, D.M.

    2009-01-01

    Metformin improves cardiovascular outcomes in patients with type 2 diabetes compared with other glucose-lowering drugs. Experimental studies have shown that metformin can increase the intracellular concentration of adenosine monophosphate, which is a major determinant of the intracellular formation

  11. Adenosine monophosphate-activated protein kinase from the mud ...

    Indian Academy of Sciences (India)

    2016-12-01

    Hochachka and Somero 2002). Therefore, some animals have to initiate anaerobic metabolism to meet part of energy needs (Costanzo et al. 2004; Colson-Proch et al. 2009). Adenosine monophosphate-activated protein kinase.

  12. Adenosine-deaminase (ADA activity in Psoriasis (A Preliminary Study

    Directory of Open Access Journals (Sweden)

    S D Chaudhry

    1988-01-01

    Full Text Available Study of adenosine-deaminase activity ′in 23 patients hav-mg psoriasis compared with an equal number of healthy controls revealed significantly high ADA-activity in the psotiatic patients.

  13. The effects of caffeine on sleep in Drosophila require PKA activity, but not the adenosine receptor.

    Science.gov (United States)

    Wu, Mark N; Ho, Karen; Crocker, Amanda; Yue, Zhifeng; Koh, Kyunghee; Sehgal, Amita

    2009-09-02

    Caffeine is one of the most widely consumed stimulants in the world and has been proposed to promote wakefulness by antagonizing function of the adenosine A2A receptor. Here, we show that chronic administration of caffeine reduces and fragments sleep in Drosophila and also lengthens circadian period. To identify the mechanisms underlying these effects of caffeine, we first generated mutants of the only known adenosine receptor in flies (dAdoR), which by sequence is most similar to the mammalian A2A receptor. Mutants lacking dAdoR have normal amounts of baseline sleep, as well as normal homeostatic responses to sleep deprivation. Surprisingly, these mutants respond normally to caffeine. On the other hand, the effects of caffeine on sleep and circadian rhythms are mimicked by a potent phosphodiesterase inhibitor, IBMX (3-isobutyl-1-methylxanthine). Using in vivo fluorescence resonance energy transfer imaging, we find that caffeine induces widespread increase in cAMP levels throughout the brain. Finally, the effects of caffeine on sleep are blocked in flies that have reduced neuronal PKA activity. We suggest that chronic administration of caffeine promotes wakefulness in Drosophila, at least in part, by inhibiting cAMP phosphodiesterase activity.

  14. Anti-nociceptive properties of the xanthine oxidase inhibitor allopurinol in mice: role of A1 adenosine receptors

    Science.gov (United States)

    Schmidt, AP; Böhmer, AE; Antunes, C; Schallenberger, C; Porciúncula, LO; Elisabetsky, E; Lara, DR; Souza, DO

    2009-01-01

    Background and purpose Allopurinol is a potent inhibitor of the enzyme xanthine oxidase, used primarily in the treatment of hyperuricemia and gout. It is well known that purines exert multiple effects on pain transmission. We hypothesized that the inhibition of xanthine oxidase by allopurinol, thereby reducing purine degradation, could be a valid strategy to enhance purinergic activity. The aim of this study was to investigate the anti-nociceptive profile of allopurinol on chemical and thermal pain models in mice. Experimental approach Mice received an intraperitoneal (i.p.) injection of vehicle (Tween 10%) or allopurinol (10–400 mg kg−1). Anti-nociceptive effects were measured with intraplantar capsaicin, intraplantar glutamate, tail-flick or hot-plate tests. Key results Allopurinol presented dose-dependent anti-nociceptive effects in all models. The opioid antagonist naloxone did not affect these anti-nociceptive effects. The non-selective adenosine-receptor antagonist caffeine and the selective A1 adenosine-receptor antagonist, DPCPX, but not the selective A2A adenosine-receptor antagonist, SCH58261, completely prevented allopurinol-induced anti-nociception. No obvious motor deficits were produced by allopurinol, at doses up to 200 mg kg−1. Allopurinol also caused an increase in cerebrospinal fluid levels of purines, including the nucleosides adenosine and guanosine, and decreased cerebrospinal fluid concentration of uric acid. Conclusions and implications Allopurinol-induced anti-nociception may be related to adenosine accumulation. Allopurinol is an old and extensively used compound and seems to be well tolerated with no obvious central nervous system toxic effects at high doses. This drug may be useful to treat pain syndromes in humans. PMID:19133997

  15. Cortico-Striatal Spike-Timing Dependent Plasticity After Activation of Subcortical Pathways

    OpenAIRE

    Schulz, Jan M.; Redgrave, Peter; Reynolds, John N. J.

    2010-01-01

    Cortico-striatal spike-timing dependent plasticity (STDP) is modulated by dopamine in vitro. The present study investigated STDP in vivo using alternative procedures for modulating dopaminergic inputs. Postsynaptic potentials (PSP) were evoked in intracellularly recorded spiny neurons by electrical stimulation of the contralateral motor cortex. PSPs often consisted of up to three distinct components, likely representing distinct cortico-striatal pathways. After baseline recording, bicucullin...

  16. A negative relationship between ventral striatal loss anticipation response and impulsivity in borderline personality disorder

    OpenAIRE

    Herbort, Maike C.; Soch, Joram; W?stenberg, Torsten; Krauel, Kerstin; Pujara, Maia; Koenigs, Michael; Gallinat, J?rgen; Walter, Henrik; Roepke, Stefan; Schott, Bj?rn H.

    2016-01-01

    Patients with borderline personality disorder (BPD) frequently exhibit impulsive behavior, and self-reported impulsivity is typically higher in BPD patients when compared to healthy controls. Previous functional neuroimaging studies have suggested a link between impulsivity, the ventral striatal response to reward anticipation, and prediction errors. Here we investigated the striatal neural response to monetary gain and loss anticipation and their relationship with impulsivity in 21 female BP...

  17. Opposite Effects of Stimulant and Antipsychotic Drugs on Striatal Fast-Spiking Interneurons

    OpenAIRE

    Wiltschko, Alexander B; Pettibone, Jeffrey R; Berke, Joshua D

    2010-01-01

    Psychomotor stimulants and typical antipsychotic drugs have powerful but opposite effects on mood and behavior, largely through alterations in striatal dopamine signaling. Exactly how these drug actions lead to behavioral change is not well understood, as previous electrophysiological studies have found highly heterogeneous changes in striatal neuron firing. In this study, we examined whether part of this heterogeneity reflects the mixture of distinct cell types present in the striatum, by di...

  18. Adenosine deaminase organic effect in normal and abnormal cerebrospinal fluid

    International Nuclear Information System (INIS)

    Hamad, A.M.; Samarai, M.A.

    2007-01-01

    To study the effect of the organic substances on adenosine deaminase (ADA) activity in normal and abnormal cerebrospinal fluid (CSF). Various concentrations of 2-mercaptopurine, Ame-tycine, Adenosine analogues (Guanine, Thymine) and ATP were tested to see their effect on ADA activity in normal and abnormal CSF. ADA activity in normal and abnormal CSF was remarkably decreased with the increasing of concentrations of substances tested. These effects may have important therapeutic implications. (author)

  19. The Role of Adenosine A2BR in Metastatic Melanoma

    Science.gov (United States)

    2017-07-01

    tumors were harvested, digested in collagenase I with DNAse 1 and stained with antibodies for immune cells markers and analyzed on a BD LSR Fortessa...Evidence indicates that adenosine receptor A2AR plays a role in inhibiting immune cells whereas A2BR is likely most critical on tumor cells and tumor ...endothelium. We propose that elimination of adenosine A2B receptor signaling in endothelial cells and tumor cells will result in a decrease of primary

  20. Corticostriatal interactions in the generation of tic-like behaviors after local striatal disinhibition

    Science.gov (United States)

    Pogorelov, Vladimir; Xu, Meiyu; Smith, Haleigh R.; Buchanan, Gordon F.; Pittenger, Christopher

    2015-01-01

    The pathophysiology of the tics that define Gilles de la Tourette syndrome (TS) is not well understood. Local disinhibition within the striatum has been hypothesized to play a pathogenic role. In support of this, experimental disinhibition by local antagonism of GABA-A receptors within the striatum produces tic-like phenomenology in monkey and rat. We replicated this effect in mice via local picrotoxin infusion into the dorsal striatum. Infusion of picrotoxin into sensorimotor cortex produced similar movements, accompanied by signs of behavioral activation; higher-dose picrotoxin in the cortex produced seizures. Striatal inhibition with local muscimol completely abolished tic-like movements after either striatal or cortical picrotoxin, confirming their dependence on the striatal circuitry; in contrast, cortical muscimol attenuated but did not abolish movements produced by striatal picrotoxin. Striatal glutamate blockade eliminated tic-like movements after striatal picrotoxin, indicating that glutamatergic afferents are critical for their generation. These studies replicate and extend previous work in monkey and rat, providing additional validation for the local disinhibition model of tic generation. Our results reveal a key role for corticostriatal glutamatergic afferents in the generation of tic-like movements in this model. PMID:25597650

  1. Serial imaging of bilateral striatal necrosis associated with acidaemia in adults

    International Nuclear Information System (INIS)

    Kamei, S.; Takasu, T.; Mori, N.; Yoshihashi, K.; Shikata, E.

    1996-01-01

    Bilateral striatal necrosis in acute encephalopathy has been reported in a small number of adults with methanol or cyanide intoxication, hypoxic encephalopathy or haemolytic-uraemic syndrome. Acute encephalopathy with bilateral striatal necrosis has been reported in infants and children. However, the pathogenesis of the necrosis remains unclear. This is the first report of serial imaging from the very early yo chronic stage in two acute encephalopathic adults with bilateral striatal necrosis. A clinicoradiological study is presented for clarification of the pathological process and pathogenesis. Striatal lesions were not detected in the very early stages, but only thereafter. Serial studies suggested that the lesions were caused by delayed neuronal death. These patients had severe lactic acidosis, near the limit for survival. There hav ebeen few reports of adults with acute encephalopathy and bilateral striatal necrosis in whom arterial pH was described; all these exhibited marked acidosis. The common pathophysiological condition among these encephalopathies with bilateral striatal necrosis could be lactic acidosis elicited by impairnment of ATP generation through the Krebs cycle. The striatum might represent one of the target areas of Krebs-cycle blockade. (orig.)

  2. Adenosine A1 receptors promote vasa vasorum endothelial cell barrier integrity via Gi and Akt-dependent actin cytoskeleton remodeling.

    Directory of Open Access Journals (Sweden)

    Siddaramappa Nagavedi Umapathy

    Full Text Available In a neonatal model of hypoxic pulmonary hypertension, a dramatic pulmonary artery adventitial thickening, accumulation of inflammatory cells in the adventitial compartment, and angiogenic expansion of the vasa vasorum microcirculatory network are observed. These pathophysiological responses suggest that rapidly proliferating vasa vasorum endothelial cells (VVEC may exhibit increased permeability for circulating blood cells and macromolecules. However, the molecular mechanisms underlying these observations remain unexplored. Some reports implicated extracellular adenosine in the regulation of vascular permeability under hypoxic and inflammatory conditions. Thus, we aimed to determine the role of adenosine in barrier regulation of VVEC isolated from the pulmonary arteries of normoxic (VVEC-Co or chronically hypoxic (VVEC-Hyp neonatal calves.We demonstrate via a transendothelial electrical resistance measurement that exogenous adenosine significantly enhanced the barrier function in VVEC-Co and, to a lesser extent, in VVEC-Hyp. Our data from a quantitative reverse transcription polymerase chain reaction show that both VVEC-Co and VVEC-Hyp express all four adenosine receptors (A1, A2A, A2B, and A3, with the highest expression level of A1 receptors (A1Rs. However, A1R expression was significantly lower in VVEC-Hyp compared to VVEC-Co. By using an A1R-specific agonist/antagonist and siRNA, we demonstrate that A1Rs are mostly responsible for adenosine-induced enhancement in barrier function. Adenosine-induced barrier integrity enhancement was attenuated by pretreatment of VVEC with pertussis toxin and GSK690693 or LY294002, suggesting the involvement of Gi proteins and the PI3K-Akt pathway. Moreover, we reveal a critical role of actin cytoskeleton in VVEC barrier regulation by using specific inhibitors of actin and microtubule polymerization. Further, we show that adenosine pretreatment blocked the tumor necrosis factor alpha (TNF

  3. Adenosine A1 Receptors Promote Vasa Vasorum Endothelial Cell Barrier Integrity via Gi and Akt-Dependent Actin Cytoskeleton Remodeling

    Science.gov (United States)

    Siddaramappa Umapathy, Nagavedi; Kaczmarek, Elzbieta; Fatteh, Nooreen; Burns, Nana; Lucas, Rudolf; Stenmark, Kurt R.; Verin, Alexander D.; Gerasimovskaya, Evgenia V.

    2013-01-01

    Background In a neonatal model of hypoxic pulmonary hypertension, a dramatic pulmonary artery adventitial thickening, accumulation of inflammatory cells in the adventitial compartment, and angiogenic expansion of the vasa vasorum microcirculatory network are observed. These pathophysiological responses suggest that rapidly proliferating vasa vasorum endothelial cells (VVEC) may exhibit increased permeability for circulating blood cells and macromolecules. However, the molecular mechanisms underlying these observations remain unexplored. Some reports implicated extracellular adenosine in the regulation of vascular permeability under hypoxic and inflammatory conditions. Thus, we aimed to determine the role of adenosine in barrier regulation of VVEC isolated from the pulmonary arteries of normoxic (VVEC-Co) or chronically hypoxic (VVEC-Hyp) neonatal calves. Principal Findings We demonstrate via a transendothelial electrical resistance measurement that exogenous adenosine significantly enhanced the barrier function in VVEC-Co and, to a lesser extent, in VVEC-Hyp. Our data from a quantitative reverse transcription polymerase chain reaction show that both VVEC-Co and VVEC-Hyp express all four adenosine receptors (A1, A2A, A2B, and A3), with the highest expression level of A1 receptors (A1Rs). However, A1R expression was significantly lower in VVEC-Hyp compared to VVEC-Co. By using an A1R-specific agonist/antagonist and siRNA, we demonstrate that A1Rs are mostly responsible for adenosine-induced enhancement in barrier function. Adenosine-induced barrier integrity enhancement was attenuated by pretreatment of VVEC with pertussis toxin and GSK690693 or LY294002, suggesting the involvement of Gi proteins and the PI3K-Akt pathway. Moreover, we reveal a critical role of actin cytoskeleton in VVEC barrier regulation by using specific inhibitors of actin and microtubule polymerization. Further, we show that adenosine pretreatment blocked the tumor necrosis factor alpha (TNF

  4. Graft versus host disease: New insights into A2A receptor agonist therapy

    Directory of Open Access Journals (Sweden)

    Karlie R. Jones

    2015-01-01

    Full Text Available Allogeneic transplantation can cure many disorders, including sickle cell disease, chronic granulomatous disease (CGD, severe combined immunodeficiency (SCID and many types of cancers. However, there are several associated risks that can result in severe immunological reactions and, in some cases, death. Much of this morbidity is related to graft versus host disease (GVHD [1]. GVHD is an immune mediated reaction in which donor T cells recognize the host as antigenically foreign, causing donor T cells to expand and attack host tissues. The current method of treating recent transplant patients with immunosuppressants to prevent this reaction has met with only partial success, emphasizing a need for new methods of GVHD treatment and prevention. Recently, a novel strategy has emerged targeting adenosine A2A receptors (A2AR through the use of adenosine agonists. These agonists have been shown in vitro to increase the TGFβ-induced generation of FoxP3+ regulatory T cells (Tregs and in vivo to improve weight gain and mortality as well as inhibit the release of pro-inflammatory cytokines in GVHD murine models [2,3]. Positive results involving A2AR agonists in vitro and in vivo are promising, suggesting that A2AR agonists should be a part of the management of clinical GvHD.

  5. LASSBio-897 Reduces Lung Injury Induced by Silica Particles in Mice: Potential Interaction with the A2A Receptor

    Science.gov (United States)

    Carvalho, Vinicius F.; Ferreira, Tatiana P. T.; de Arantes, Ana C. S.; Noël, François; Tesch, Roberta; Sant’Anna, Carlos M. R.; Barreiro, Eliezer J. L.; Fraga, Carlos A. M.; Rodrigues e Silva, Patrícia M.; Martins, Marco A.

    2017-01-01

    Silicosis is a lethal fibro-granulomatous pulmonary disease highly prevalent in developing countries, for which no proper therapy is available. Among a small series of N-acylhydrazones, the safrole-derived compound LASSBio-897 (3-thienylidene-3, 4-methylenedioxybenzoylhydrazide) raised interest due to its ability to bind to the adenosine A2A receptor. Here, we evaluated the anti-inflammatory and anti-fibrotic potential of LASSBio-897, exploring translation to a mouse model of silicosis and the A2A receptor as a site of action. Pulmonary mechanics, inflammatory, and fibrotic changes were assessed 28 days after intranasal instillation of silica particles in Swiss–Webster mice. Glosensor cAMP HEK293G cells, CHO cells stably expressing human adenosine receptors and ligand binding assay were used to evaluate the pharmacological properties of LASSBio-897 in vitro. Molecular docking studies of LASSBio-897 were performed using the genetic algorithm software GOLD 5.2. We found that the interventional treatment with the A2A receptor agonist CGS 21680 reversed silica particle-induced airway hyper-reactivity as revealed by increased responses of airway resistance and lung elastance following aerosolized methacholine. LASSBio-897 (2 and 5 mg/kg, oral) similarly reversed pivotal lung pathological features of silicosis in this model, reducing levels of airway resistance and lung elastance, granuloma formation and collagen deposition. In competition assays, LASSBio-897 decreased the binding of the selective A2A receptor agonist [3H]-CGS21680 (IC50 = 9.3 μM). LASSBio-897 (50 μM) induced modest cAMP production in HEK293G cells, but it clearly synergized the cAMP production by adenosine in a mechanism sensitive to the A2A antagonist SCH 58261. This synergism was also seen in CHO cells expressing the A2A, but not those expressing A2B, A1 or A3 receptors. Based on the evidence that LASSBio-897 binds to A2A receptor, molecular docking studies were performed using the A2A receptor

  6. LASSBio-897 Reduces Lung Injury Induced by Silica Particles in Mice: Potential Interaction with the A2A Receptor

    Directory of Open Access Journals (Sweden)

    Vinicius F. Carvalho

    2017-10-01

    Full Text Available Silicosis is a lethal fibro-granulomatous pulmonary disease highly prevalent in developing countries, for which no proper therapy is available. Among a small series of N-acylhydrazones, the safrole-derived compound LASSBio-897 (3-thienylidene-3, 4-methylenedioxybenzoylhydrazide raised interest due to its ability to bind to the adenosine A2A receptor. Here, we evaluated the anti-inflammatory and anti-fibrotic potential of LASSBio-897, exploring translation to a mouse model of silicosis and the A2A receptor as a site of action. Pulmonary mechanics, inflammatory, and fibrotic changes were assessed 28 days after intranasal instillation of silica particles in Swiss–Webster mice. Glosensor cAMP HEK293G cells, CHO cells stably expressing human adenosine receptors and ligand binding assay were used to evaluate the pharmacological properties of LASSBio-897 in vitro. Molecular docking studies of LASSBio-897 were performed using the genetic algorithm software GOLD 5.2. We found that the interventional treatment with the A2A receptor agonist CGS 21680 reversed silica particle-induced airway hyper-reactivity as revealed by increased responses of airway resistance and lung elastance following aerosolized methacholine. LASSBio-897 (2 and 5 mg/kg, oral similarly reversed pivotal lung pathological features of silicosis in this model, reducing levels of airway resistance and lung elastance, granuloma formation and collagen deposition. In competition assays, LASSBio-897 decreased the binding of the selective A2A receptor agonist [3H]-CGS21680 (IC50 = 9.3 μM. LASSBio-897 (50 μM induced modest cAMP production in HEK293G cells, but it clearly synergized the cAMP production by adenosine in a mechanism sensitive to the A2A antagonist SCH 58261. This synergism was also seen in CHO cells expressing the A2A, but not those expressing A2B, A1 or A3 receptors. Based on the evidence that LASSBio-897 binds to A2A receptor, molecular docking studies were performed using the

  7. Adenosine-5?-phosphosulfate ? a multifaceted modulator of bifunctional 3?-phospho-adenosine-5?-phosphosulfate synthases and related enzymes

    OpenAIRE

    Mueller, Jonathan W; Shafqat, Naeem

    2013-01-01

    All sulfation reactions rely on active sulfate in the form of 3?-phospho-adenosine-5?-phosphosulfate (PAPS). In fungi, bacteria, and plants, the enzymes responsible for PAPS synthesis, ATP sulfurylase and adenosine-5?-phosphosulfate (APS) kinase, reside on separate polypeptide chains. In metazoans, however, bifunctional PAPS synthases catalyze the consecutive steps of sulfate activation by converting sulfate to PAPS via the intermediate APS. This intricate molecule and the related nucleotides...

  8. Adenosine receptors and muscarinic receptors cooperate in acetylcholine release modulation in the neuromuscular synapse.

    Science.gov (United States)

    Santafe, M M; Priego, M; Obis, T; Garcia, N; Tomàs, M; Lanuza, M A; Tomàs, J

    2015-07-01

    Adenosine receptors (ARs) are present in the motor terminals at the mouse neuromuscular junction. ARs and the presynaptic muscarinic acetylcholine receptors (mAChRs) share the functional control of the neuromuscular junction. We analysed their mutual interaction in transmitter release modulation. In electrophysiological experiments with unaltered synaptic transmission (muscles paralysed by blocking the voltage-dependent sodium channel of the muscle cells with μ-conotoxin GIIIB), we found that: (i) a collaborative action between different AR subtypes reduced synaptic depression at a moderate activity level (40 Hz); (ii) at high activity levels (100 Hz), endogenous adenosine production in the synaptic cleft was sufficient to reduce depression through A1 -type receptors (A1 Rs) and A2 A-type receptors (A2 A Rs); (iii) when the non-metabolizable 2-chloroadenosine (CADO) agonist was used, both the quantal content and depression were reduced; (iv) the protective effect of CADO on depression was mediated by A1 Rs, whereas A2 A Rs seemed to modulate A1 Rs; (v) ARs and mAChRs absolutely depended upon each other for the modulation of evoked and spontaneous acetylcholine release in basal conditions and in experimental conditions with CADO stimulation; (vi) the purinergic and muscarinic mechanisms cooperated in the control of depression by sharing a common pathway although the purinergic control was more powerful than the muscarinic control; and (vii) the imbalance of the ARs created by using subtype-selective and non-selective inhibitory and stimulatory agents uncoupled protein kinase C from evoked transmitter release. In summary, ARs (A1 Rs, A2 A Rs) and mAChRs (M1 , M2 ) cooperated in the control of activity-dependent synaptic depression and may share a common protein kinase C pathway. © 2015 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

  9. Free radical production induced by methamphetamine in rat striatal synaptosomes.

    Science.gov (United States)

    Pubill, David; Chipana, Carlos; Camins, Antonio; Pallàs, Mercè; Camarasa, Jordi; Escubedo, Elena

    2005-04-01

    The pro-oxidative effect of methamphetamine (METH) in dopamine terminals was studied in rat striatal synaptosomes. Flow cytometry analysis showed increased production of reactive oxygen species (ROS) in METH-treated synaptosomes, without reduction in the density of dopamine transporters. In synaptosomes from dopamine (DA)-depleted animals, METH did not induce ROS production. Reserpine, in vitro, completely inhibited METH-induced ROS production. These results point to endogenous DA as the main source of ROS induced by METH. Antioxidants and inhibitors of neuronal nitric oxide synthase and protein kinase C (PKC) prevented the METH-induced oxidative effect. EGTA and the specific antagonist methyllycaconitine (MLA, 50 microM) prevented METH-induced ROS production, thus implicating calcium and alpha7 nicotinic receptors in such effect. Higher concentrations of MLA (>100 microM) showed nonspecific antioxidant effect. Preincubation of synaptosomes with METH (1 microM) for 30 min reduced [(3)H]DA uptake by 0%. The METH effect was attenuated by MLA and EGTA and potentiated by nicotine, indicating that activation of alpha(7) nicotinic receptors and Ca(2+) entry are necessary and take place before DAT inhibition. From these findings, it can be postulated that, in our model, METH induces DA release from synaptic vesicles to the cytosol. Simultaneously, METH activates alpha(7) nicotinic receptors, probably inducing depolarization and an increase in intrasynaptosomal Ca(2+). This would lead to DAT inhibition and NOS and PKC activation, initiating oxidation of cytosolic DA.

  10. Reduced Striatal Dopamine Transporters in People with Internet Addiction Disorder

    Directory of Open Access Journals (Sweden)

    Haifeng Hou

    2012-01-01

    Full Text Available In recent years, internet addiction disorder (IAD has become more prevalent worldwide and the recognition of its devastating impact on the users and society has rapidly increased. However, the neurobiological mechanism of IAD has not bee fully expressed. The present study was designed to determine if the striatal dopamine transporter (DAT levels measured by T99mc-TRODAT-1 single photon emission computed tomography (SPECT brain scans were altered in individuals with IAD. SPECT brain scans were acquired on 5 male IAD subjects and 9 healthy age-matched controls. The volume (V and weight (W of bilateral corpus striatum as well as the T99mc-TRODAT-1 uptake ratio of corpus striatum/the whole brain (Ra were calculated using mathematical models. It was displayed that DAT expression level of striatum was significantly decreased and the V, W, and Ra were greatly reduced in the individuals with IAD compared to controls. Taken together, these results suggest that IAD may cause serious damages to the brain and the neuroimaging findings further illustrate IAD is associated with dysfunctions in the dopaminergic brain systems. Our findings also support the claim that IAD may share similar neurobiological abnormalities with other addictive disorders.

  11. Frontal and striatal alterations associated with psychopathic traits in adolescents

    Science.gov (United States)

    Yang, Yaling; Narr, Katherine L.; Baker, Laura A.; Joshi, Shantanu H.; Jahanshad, Neda; Raine, Adrian; Thompson, Paul M.

    2016-01-01

    Neuroimaging research has demonstrated a range of structural deficits in adults with psychopathy, but little is known about structural correlates of psychopathic tendencies in adolescents. Here we examined structural magnetic resonance imaging (sMRI) data obtained from 14-year-old adolescents (n=108) using tensor-based morphometry (TBM) to isolate global and localized differences in brain tissue volumes associated with psychopathic traits in this otherwise healthy developmental population. We found that greater levels of psychopathic traits were correlated with increased brain tissue volumes in the left putamen, left ansa peduncularis, right superiomedial prefrontal cortex, left inferior frontal cortex, right orbitofrontal cortex, and right medial temporal regions and reduced brain tissues volumes in the right middle frontal cortex, left superior parietal lobule, and left inferior parietal lobule. Post hoc analyses of parcellated regional volumes also showed putamen enlargements to correlate with increased psychopathic traits. Consistent with earlier studies, findings suggest poor decision-making and emotional dysregulation associated with psychopathy may be due, in part, to structural anomalies in frontal and temporal regions whereas striatal structural variations may contribute to sensation-seeking and reward-driven behavior in psychopathic individuals. Future studies will help clarify how disturbances in brain maturational processes might lead to the developmental trajectory from psychopathic tendencies in adolescents to adult psychopathy. PMID:25676553

  12. Inhibition of the striatal specific phosphodiesterase PDE10A ameliorates striatal and cortical pathology in R6/2 mouse model of Huntington's disease.

    Directory of Open Access Journals (Sweden)

    Carmela Giampà

    2010-10-01

    Full Text Available Huntington's disease is a devastating neurodegenerative condition for which there is no therapy to slow disease progression. The particular vulnerability of striatal medium spiny neurons to Huntington's pathology is hypothesized to result from transcriptional dysregulation within the cAMP and CREB signaling cascades in these neurons. To test this hypothesis, and a potential therapeutic approach, we investigated whether inhibition of the striatal-specific cyclic nucleotide phosphodiesterase PDE10A would alleviate neurological deficits and brain pathology in a highly utilized model system, the R6/2 mouse.R6/2 mice were treated with the highly selective PDE10A inhibitor TP-10 from 4 weeks of age until euthanasia. TP-10 treatment significantly reduced and delayed the development of the hind paw clasping response during tail suspension, deficits in rotarod performance, and decrease in locomotor activity in an open field. Treatment prolonged time to loss of righting reflex. These effects of PDE10A inhibition on neurological function were reflected in a significant amelioration in brain pathology, including reduction in striatal and cortical cell loss, the formation of striatal neuronal intranuclear inclusions, and the degree of microglial activation that occurs in response to the mutant huntingtin-induced brain damage. Striatal and cortical levels of phosphorylated CREB and BDNF were significantly elevated.Our findings provide experimental support for targeting the cAMP and CREB signaling pathways and more broadly transcriptional dysregulation as a therapeutic approach to Huntington's disease. It is noteworthy that PDE10A inhibition in the R6/2 mice reduces striatal pathology, consistent with the localization of the enzyme in medium spiny neurons, and also cortical pathology and the formation of neuronal nuclear inclusions. These latter findings suggest that striatal pathology may be a primary driver of these secondary pathological events. More

  13. Regioselective 1-N-Alkylation and Rearrangement of Adenosine Derivatives.

    Science.gov (United States)

    Oslovsky, Vladimir E; Drenichev, Mikhail S; Mikhailov, Sergey N

    2015-01-01

    Several methods for the preparation of some N(6)-substituted adenosines based on selective 1-N-alkylation with subsequent Dimroth rearrangement were developed. The proposed methods seem to be effective for the preparation of natural N(6)-isopentenyl- and N(6)-benzyladenosines, which are known to possess pronounced biological activities. Direct 1-N-alkylation of 2',3',5'-tri-O-acetyladenosine and 3',5'-di-O-acetyl-2'-deoxyadenosine with alkyl halides in N,N-dimethylformamide (DMF) in the presence of BaCO3 and KI gave 1-N-substituted derivatives with quantitative yields, whereas 1-N-alkylation of adenosine was accompanied by significant O-alkylation. Moreover, the reaction of trimethylsilyl derivatives of N(6)-acetyl-2',3',5'-tri-O-acetyladenosine and N(6)-acetyl-3',5'-di-O-acetyl-2'-deoxyadenosine with alkyl halides leads to the formation of the stable 1-N-substituted adenosines. Dimroth rearrangement of 1-N-substituted adenosines in aqueous ammonia yields pure N(6)-substituted adenosines.

  14. Cortico–Amygdala–Striatal Circuits Are Organized as Hierarchical Subsystems through the Primate Amygdala

    Science.gov (United States)

    Cho, Youngsun T.; Ernst, Monique

    2013-01-01

    The prefrontal and insula cortex, amygdala, and striatum are key regions for emotional processing, yet the amygdala's role as an interface between the cortex and striatum is not well understood. In the nonhuman primate (Macaque fascicularis), we analyzed a collection of bidirectional tracer injections in the amygdala to understand how cortical inputs and striatal outputs are organized to form integrated cortico–amygdala–striatal circuits. Overall, diverse prefrontal and insular cortical regions projected to the basal and accessory basal nuclei of the amygdala. In turn, these amygdala regions projected to widespread striatal domains extending well beyond the classic ventral striatum. Analysis of the cases in aggregate revealed a topographic colocalization of cortical inputs and striatal outputs in the amygdala that was additionally distinguished by cortical cytoarchitecture. Specifically, the degree of cortical laminar differentiation of the cortical inputs predicted amygdalostriatal targets, and distinguished three main cortico–amygdala–striatal circuits. These three circuits were categorized as “primitive,” “intermediate,” and “developed,” respectively, to emphasize the relative phylogenetic and ontogenetic features of the cortical inputs. Within the amygdala, these circuits appeared arranged in a pyramidal-like fashion, with the primitive circuit found in all examined subregions, and subsequent circuits hierarchically layered in discrete amygdala subregions. This arrangement suggests a stepwise integration of the functions of these circuits across amygdala subregions, providing a potential mechanism through which internal emotional states are managed with external social and sensory information toward emotionally informed complex behaviors. PMID:23986238

  15. Altered resting state cortico-striatal connectivity in mild to moderate stage Parkinson’s disease

    Directory of Open Access Journals (Sweden)

    Youngbin Kwak

    2010-09-01

    Full Text Available Parkinson’s disease (PD is a progressive neurodegenerative disorder that is characterized by dopamine depletion in the striatum. One consistent pathophysiological hallmark of PD is an increase in spontaneous oscillatory activity in the basal ganglia thalamocortical networks. We evaluated these effects using resting state functional connectivity MRI (fcMRI in mild to moderate stage Parkinson’s patients on and off L-DOPA and age-matched controls using six different striatal seed regions. We observed an overall increase in the strength of cortico-striatal functional connectivity in PD patients off L-DOPA compared to controls. This enhanced connectivity was down-regulated by L-DOPA as shown by an overall decrease in connectivity strength, particularly within motor cortical regions. We also performed a frequency content analysis of the BOLD signal time course extracted from the six striatal seed regions. PD off L-DOPA exhibited increased power in the frequency band 0.02 – 0.05 Hz compared to controls and to PD on L-DOPA. The L-DOPA associated decrease in the power of this frequency range modulated the L-DOPA associated decrease in connectivity strength between striatal seeds and the thalamus. In addition, the L-DOPA associated decrease in power in this frequency band also correlated with the L-DOPA associated improvement in cognitive performance. Our results demonstrate that PD and L-DOPA modulate striatal resting state BOLD signal oscillations and corticostriatal network coherence.

  16. Altered resting-state functional connectivity of striatal-thalamic circuit in bipolar disorder.

    Directory of Open Access Journals (Sweden)

    Shin Teng

    Full Text Available Bipolar disorder is characterized by internally affective fluctuations. The abnormality of inherently mental state can be assessed using resting-state fMRI data without producing task-induced biases. In this study, we hypothesized that the resting-state connectivity related to the frontal, striatal, and thalamic regions, which were associated with mood regulations and cognitive functions, can be altered for bipolar disorder. We used the Pearson's correlation coefficients to estimate functional connectivity followed by the hierarchical modular analysis to categorize the resting-state functional regions of interest (ROIs. The selected functional connectivities associated with the striatal-thalamic circuit and default mode network (DMN were compared between bipolar patients and healthy controls. Significantly decreased connectivity in the striatal-thalamic circuit and between the striatal regions and the middle and posterior cingulate cortex was observed in the bipolar patients. We also observed that the bipolar patients exhibited significantly increased connectivity between the thalamic regions and the parahippocampus. No significant changes of connectivity related to the frontal regions in the DMN were observed. The changed resting-state connectivity related to the striatal-thalamic circuit might be an inherent basis for the altered emotional and cognitive processing in the bipolar patients.

  17. Striatal lesions produce distinctive impairments in reaction time performance in two different operant chambers.

    Science.gov (United States)

    Brasted, P J; Döbrössy, M D; Robbins, T W; Dunnett, S B

    1998-08-01

    The dorsal striatum plays a crucial role in mediating voluntary movement. Excitotoxic striatal lesions in rats have previously been shown to impair the initiation but not the execution of movement in a choice reaction time task in an automated lateralised nose-poke apparatus (the "nine-hole box"). Conversely, when a conceptually similar reaction time task has been applied in a conventional operant chamber (or "Skinner box"), striatal lesions have been seen to impair the execution rather than the initiation of the lateralised movement. The present study was undertaken to compare directly these two results by training the same group of rats to perform a choice reaction time task in the two chambers and then comparing the effects of a unilateral excitotoxic striatal lesion in both chambers in parallel. Particular attention was paid to adopting similar parameters and contingencies in the control of the task in the two test chambers. After striatal lesions, the rats showed predominantly contralateral impairments in both tasks. However, they showed a deficit in reaction time in the nine-hole box but an apparent deficit in response execution in the Skinner box. This finding confirms the previous studies and indicates that differences in outcome are not simply attributable to procedural differences in the lesions, training conditions or tasks parameters. Rather, the pattern of reaction time deficit after striatal lesions depends critically on the apparatus used and the precise response requirements for each task.

  18. Structural Probing and Molecular Modeling of the A₃ Adenosine Receptor: A Focus on Agonist Binding.

    Science.gov (United States)

    Ciancetta, Antonella; Jacobson, Kenneth A

    2017-03-11

    Adenosine is an endogenous modulator exerting its functions through the activation of four adenosine receptor (AR) subtypes, termed A₁, A 2A , A 2B and A₃, which belong to the G protein-coupled receptor (GPCR) superfamily. The human A₃AR (hA₃AR) subtype is implicated in several cytoprotective functions. Therefore, hA₃AR modulators, and in particular agonists, are sought for their potential application as anti-inflammatory, anticancer, and cardioprotective agents. Structure-based molecular modeling techniques have been applied over the years to rationalize the structure-activity relationships (SARs) of newly emerged A₃AR ligands, guide the subsequent lead optimization, and interpret site-directed mutagenesis (SDM) data from a molecular perspective. In this review, we showcase selected modeling-based and guided strategies that were applied to elucidate the binding of agonists to the A₃AR and discuss the challenges associated with an accurate prediction of the receptor extracellular vestibule through homology modeling from the available X-ray templates.

  19. Structural Probing and Molecular Modeling of the A3 Adenosine Receptor: A Focus on Agonist Binding

    Science.gov (United States)

    Ciancetta, Antonella; Jacobson, Kenneth A.

    2017-01-01

    Adenosine is an endogenous modulator exerting its functions through the activation of four adenosine receptor (AR) subtypes, termed A1, A2A, A2B and A3, which belong to the G protein-coupled receptor (GPCR) superfamily. The human A3AR (hA3AR) subtype is implicated in several cytoprotective functions. Therefore, hA3AR modulators, and in particular agonists, are sought for their potential application as anti-inflammatory, anticancer, and cardioprotective agents. Structure-based molecular modeling techniques have been applied over the years to rationalize the structure-activity relationships (SARs) of newly emerged A3AR ligands, guide the subsequent lead optimization, and interpret site-directed mutagenesis (SDM) data from a molecular perspective. In this review, we showcase selected modeling-based and guided strategies that were applied to elucidate the binding of agonists to the A3AR and discuss the challenges associated with an accurate prediction of the receptor extracellular vestibule through homology modeling from the available X-ray templates. PMID:28287473

  20. Structural Probing and Molecular Modeling of the A3 Adenosine Receptor: A Focus on Agonist Binding

    Directory of Open Access Journals (Sweden)

    Antonella Ciancetta

    2017-03-01

    Full Text Available Adenosine is an endogenous modulator exerting its functions through the activation of four adenosine receptor (AR subtypes, termed A1, A2A, A2B and A3, which belong to the G protein-coupled receptor (GPCR superfamily. The human A3AR (hA3AR subtype is implicated in several cytoprotective functions. Therefore, hA3AR modulators, and in particular agonists, are sought for their potential application as anti-inflammatory, anticancer, and cardioprotective agents. Structure-based molecular modeling techniques have been applied over the years to rationalize the structure–activity relationships (SARs of newly emerged A3AR ligands, guide the subsequent lead optimization, and interpret site-directed mutagenesis (SDM data from a molecular perspective. In this review, we showcase selected modeling-based and guided strategies that were applied to elucidate the binding of agonists to the A3AR and discuss the challenges associated with an accurate prediction of the receptor extracellular vestibule through homology modeling from the available X-ray templates.

  1. Correlation between blood adenosine metabolism and sleep in humans.

    Science.gov (United States)

    Díaz-Muñoz, M; Hernández-Muñoz, R; Suárez, J; Vidrio, S; Yááñez, L; Aguilar-Roblero, R; Rosenthal, L; Villalobos, L; Fernández-Cancino, F; Drucker-Colín, R; Chagoya De Sanchez, V

    1999-01-01

    Blood adenosine metabolism, including metabolites and metabolizing enzymes, was studied during the sleep period in human volunteers. Searching for significant correlations among biochemical parameters found: adenosine with state 1 of slow-wave sleep (SWS); activity of 5'-nucleotidase with state 2 of SWS; inosine and AMP with state 3-4 of SWS; and activity of 5'-nucleotidase and lactate with REM sleep. The correlations were detected in all of the subjects that presented normal hypnograms, but not in those who had fragmented sleep the night of the experiment. The data demonstrate that it is possible to obtain information of complex brain operations such as sleep by measuring biochemical parameters in blood. The results strengthen the notion of a role played by adenosine, its metabolites and metabolizing enzymes, during each of the stages that constitute the sleep process in humans.

  2. Expressions of adenosine A2Areceptors in coronary arteries and peripheral blood mononuclear cells are correlated in coronary artery disease patients.

    Science.gov (United States)

    Gariboldi, Vlad; Vairo, Donato; Guieu, Régis; Marlingue, Marion; Ravis, Eléonore; Lagier, David; Mari, Alissa; Thery, Elsa; Collart, Frédéric; Gaudry, Marine; Bonello, Laurent; Paganelli, Franck; Condo, Jocelyne; Kipson, Nathalie; Fenouillet, Emmanuel; Ruf, Jean; Mottola, Giovanna

    2017-03-01

    Altered coronary blood flow occurs in patients with coronary artery disease (CAD). Adenosine strongly impacts blood flow mostly via adenosine A 2A receptor (A 2A R) expressed in coronary tissues. As part of a systemic regulation of the adenosinergic system, we compared A 2A R expression in situ, and on peripheral blood mononuclear cells (PBMC) in CAD patients. Aortic and coronary tissues, and PBMC were sampled in 20 CAD patients undergoing coronary artery bypass surgery and consecutively included. Controls were PBMC obtained from 15 healthy subjects. Expression and activity of A 2A R were studied by Western blotting and cAMP measurement, respectively. A 2A R expression on PBMC was lower in patients than in controls (0.83±0.31 vs 1.2±0.35 arbitrary units; pcoronary and aortic tissues (Pearson's r: 0.77 and 0.59, pcoronary artery and aortic tissues in CAD patients, A 2A R activity of PBMC matched that observed in aorta, and A 2A R expression and activity in PBMC were found reduced as compared to controls. Measuring the expression level of A 2A R on PBMC represents a good tool to address in situ expression in coronary tissues of CAD patients. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  3. Fractional Flow Reserve: Intracoronary versus intravenous adenosine induced maximal coronary hyperemia

    Directory of Open Access Journals (Sweden)

    P.S. Sandhu

    2013-03-01

    Conclusions: This study suggests that IC adenosine is equivalent to IV infusion for the determination of FFR. The administration of IC adenosine is easy to use, cost effective, safe and associated with fewer systemic events.

  4. Investigating real-time activation of adenosine receptors by bioluminescence resonance energy transfer technique

    Science.gov (United States)

    Huang, Yimei; Yang, Hongqin; Zheng, Liqin; Chen, Jiangxu; Wang, Yuhua; Li, Hui; Xie, Shusen

    2013-02-01

    Adenosine receptors play important roles in many physiological and pathological processes, for example regulating myocardial oxygen consumption and the release of neurotransmitters. The activations of adenosine receptors have been studied by some kinds of techniques, such as western blot, immunohistochemistry, etc. However, these techniques cannot reveal the dynamical response of adenosine receptors under stimulation. In this paper, bioluminescence resonance energy transfer technique was introduced to study the real-time activation of adenosine receptors by monitoring the dynamics of cyclic adenosine monophosphate (cAMP) level. The results showed that there were significant differences between adenosine receptors on real-time responses under stimulation. Moreover, the dynamics of cAMP level demonstrated that competition between adenosine receptors existed. Taken together, our study indicates that monitoring the dynamics of cAMP level using bioluminescence resonance energy transfer technique could be one potential approach to investigate the mechanism of competitions between adenosine receptors.

  5. Tween 20-stabilized gold nanoparticles combined with adenosine triphosphate-BODIPY conjugates for the fluorescence detection of adenosine with more than 1000-fold selectivity

    International Nuclear Information System (INIS)

    Hung, Szu-Ying; Shih, Ya-Chen; Tseng, Wei-Lung

    2015-01-01

    Graphical abstract: A simple, enzyme-free, label-free, sensitive and selective system was developed for detecting adenosine based on the use of Tween 20-stabilized gold nanoparticles as an efficient quencher for boron dipyrromethene-conjugated adenosine 5′-triphosphate and as a recognition element for adenosine. - Highlights: • The proposed method can detect adenosine with more than 1000-fold selectivity. • The analysis of adenosine is rapid (∼6 min) using the proposed method. • This method provided better sensitivity for adenosine as compared to aptamer-based sensors. • This method can be applied for the determination of adenosine in urine. - Abstract: This study describes the development of a simple, enzyme-free, label-free, sensitive, and selective system for detecting adenosine based on the use of Tween 20-stabilized gold nanoparticles (Tween 20-AuNPs) as an efficient fluorescence quencher for boron dipyrromethene-conjugated adenosine 5′-triphosphate (BODIPY-ATP) and as a recognition element for adenosine. BODIPY-ATP can interact with Tween 20-AuNPs through the coordination between the adenine group of BODIPY-ATP and Au atoms on the NP surface, thereby causing the fluorescence quenching of BODIPY-ATP through the nanometal surface energy transfer (NSET) effect. When adenosine attaches to the NP surface, the attached adenosine exhibits additional electrostatic attraction to BODIPY-ATP. As a result, the presence of adenosine enhances the efficiency of AuNPs in fluorescence quenching of BODIPY-ATP. The AuNP-induced fluorescence quenching of BODIPY-ATP progressively increased with an increase in the concentration of adenosine; the detection limit at a signal-to-noise ratio of 3 for adenosine was determined to be 60 nM. The selectivity of the proposed system was more than 1000-fold for adenosine over any adenosine analogs and other nucleotides. The proposed system combined with a phenylboronic acid-containing column was successfully applied to the

  6. Intravenous adenosine for surgical management of penetrating heart wounds.

    Science.gov (United States)

    Kokotsakis, John; Hountis, Panagiotis; Antonopoulos, Nikolaos; Skouteli, Elian; Athanasiou, Thanos; Lioulias, Achilleas

    2007-01-01

    Accurate suturing of penetrating cardiac injuries is difficult. Heart motion, ongoing blood loss, arrhythmias due to heart manipulation, and the near-death condition of the patient can all affect the outcome. Rapid intravenous injection of adenosine induces temporary asystole that enables placement of sutures in a motionless surgical field. Use of this technique improves surgical conditions, and it is faster than other methods. Herein, we describe our experience with the use of intravenous adenosine to successfully treat 3 patients who had penetrating heart wounds.

  7. Adenosine as an endogenous immunoregulator in cancer pathogenesis: where to go?

    OpenAIRE

    Kumar, V.

    2012-01-01

    Cancer is a chronic disease and its pathogenesis is well correlated with infection and inflammation. Adenosine is a purine nucleoside, which is produced under metabolic stress like hypoxic conditions. Acute or chronic inflammatory conditions lead to the release of precursor adenine nucleotides (adenosine triphosphate (ATP), adenosien diphosphate (ADP) and adenosine monophosphate (AMP)) from cells, which are extracellularly catabolized into adenosine by extracellular ectonucleotidases, i.e., C...

  8. Decreased spontaneous eye blink rates in chronic cannabis users: evidence for striatal cannabinoid-dopamine interactions.

    Directory of Open Access Journals (Sweden)

    Mikael A Kowal

    Full Text Available Chronic cannabis use has been shown to block long-term depression of GABA-glutamate synapses in the striatum, which is likely to reduce the extent to which endogenous cannabinoids modulate GABA- and glutamate-related neuronal activity. The current study aimed at investigating the effect of this process on striatal dopamine levels by studying the spontaneous eye blink rate (EBR, a clinical marker of dopamine level in the striatum. 25 adult regular cannabis users and 25 non-user controls matched for age, gender, race, and IQ were compared. Results show a significant reduction in EBR in chronic users as compared to non-users, suggesting an indirect detrimental effect of chronic cannabis use on striatal dopaminergic functioning. Additionally, EBR correlated negatively with years of cannabis exposure, monthly peak cannabis consumption, and lifetime cannabis consumption, pointing to a relationship between the degree of impairment of striatal dopaminergic transmission and cannabis consumption history.

  9. Contribution of vesicular and cytosolic dopamine to the increased striatal dopamine efflux elicited by intrastriatal injection of SKF38393.

    NARCIS (Netherlands)

    Saigusa, T.; Aono, Y.; Sekino, R.; Uchida, T.; Takada, K.; Oi, Y.; Koshikawa, N.; Cools, A.R.

    2009-01-01

    Like dexamphetamine, SKF38393 induces an increase in striatal dopamine efflux which is insensitive for tetrodotoxin, Ca(2+) independent and prevented by a dopamine transporter inhibitor. The dexamphetamine-induced striatal dopamine efflux originates from both the reserpine-sensitive vesicular

  10. Elevated Adenosine Induces Placental DNA Hypomethylation Independent of A2B Receptor Signaling in Preeclampsia.

    Science.gov (United States)

    Huang, Aji; Wu, Hongyu; Iriyama, Takayuki; Zhang, Yujin; Sun, Kaiqi; Song, Anren; Liu, Hong; Peng, Zhangzhe; Tang, Lili; Lee, Minjung; Huang, Yun; Ni, Xin; Kellems, Rodney E; Xia, Yang

    2017-07-01

    Preeclampsia is a prevalent pregnancy hypertensive disease with both maternal and fetal morbidity and mortality. Emerging evidence indicates that global placental DNA hypomethylation is observed in patients with preeclampsia and is linked to altered gene expression and disease development. However, the molecular basis underlying placental epigenetic changes in preeclampsia remains unclear. Using 2 independent experimental models of preeclampsia, adenosine deaminase-deficient mice and a pathogenic autoantibody-induced mouse model of preeclampsia, we demonstrate that elevated placental adenosine not only induces hallmark features of preeclampsia but also causes placental DNA hypomethylation. The use of genetic approaches to express an adenosine deaminase minigene specifically in placentas, or adenosine deaminase enzyme replacement therapy, restored placental adenosine to normal levels, attenuated preeclampsia features, and abolished placental DNA hypomethylation in adenosine deaminase-deficient mice. Genetic deletion of CD73 (an ectonucleotidase that converts AMP to adenosine) prevented the elevation of placental adenosine in the autoantibody-induced preeclampsia mouse model and ameliorated preeclampsia features and placental DNA hypomethylation. Immunohistochemical studies revealed that elevated placental adenosine-mediated DNA hypomethylation predominantly occurs in spongiotrophoblasts and labyrinthine trophoblasts and that this effect is independent of A2B adenosine receptor activation in both preeclampsia models. Extending our mouse findings to humans, we used cultured human trophoblasts to demonstrate that adenosine functions intracellularly and induces DNA hypomethylation without A2B adenosine receptor activation. Altogether, both mouse and human studies reveal novel mechanisms underlying placental DNA hypomethylation and potential therapeutic approaches for preeclampsia. © 2017 American Heart Association, Inc.

  11. Comparison of the novel vasodilator uridine triphosphate and adenosine for the measurement of fractional flow reserve

    DEFF Research Database (Denmark)

    Sivertsen, Jacob; Jensen, Jan Skov; Galatius, Søren

    2014-01-01

    and IC infusion (using a microcatheter in the coronary ostium). Standard IV adenosine infusion (140 μg/kg/min) was compared to 8 equimolar incremental doses of IC UTP and IC adenosine (20, 40, 60, 80, 160, 240, 320 and 640 μg/min) in a randomized order. Across all doses, ΔFFR[IC UTP - IC adenosine...

  12. The role of glial adenosine receptors in neural resilience and the neurobiology of mood disorders

    NARCIS (Netherlands)

    Calker, D; Biber, K

    2005-01-01

    Adenosine receptors were classified into A(1)- and A(2)-receptors in the laboratory of Bernd Hamprecht more than 25 years ago. Adenosine receptors are instrumental to the neurotrophic effects of glia cells. Both microglia and astrocytes release after stimulation via adenosine receptors factors that

  13. Effects of tianeptine on onset time of pentylenetetrazole-induced seizures in mice: possible role of adenosine A1 receptors.

    Science.gov (United States)

    Uzbay, Tayfun I; Kayir, Hakan; Ceyhan, Mert

    2007-02-01

    Depression is a common psychiatric problem in epileptic patients. Thus, it is important that an antidepressant agent has anticonvulsant activity. This study was organized to investigate the effects of tianeptine, an atypical antidepressant, on pentylenetetrazole (PTZ)-induced seizure in mice. A possible contribution of adenosine receptors was also evaluated. Adult male Swiss-Webster mice (25-35 g) were subjects. PTZ (80 mg/kg, i.p.) was injected to mice 30 min after tianeptine (2.5-80 mg/kg, i.p.) or saline administration. The onset times of 'first myoclonic jerk' (FMJ) and 'generalized clonic seizures' (GCS) were recorded. Duration of 600 s was taken as a cutoff time in calculation of the onset time of the seizures. To evaluate the contribution of adenosine receptors in the effect of tianeptine, a nonspecific adenosine receptor antagonist caffeine, a specific A1 receptor antagonist 8-cyclopentyl-1,3-dipropylxanthine (DPCPX), a specific A2A receptor antagonist 8-(3-chlorostyryl) caffeine (CSC) or their vehicles were administered to the mice 15 min before tianeptine (80 mg/kg) or saline treatments. Tianeptine (40 and 80 mg/kg) pretreatment significantly delayed the onset time of FMJ and GCS. Caffeine (10-60 mg/kg, i.p.) dose-dependently blocked the retarding effect of tianeptine (80 mg/kg) on the onset times of FMJ and GCS. DPCPX (20 mg/kg) but not CSC (1-8 mg/kg) blocked the effect of tianeptine (80 mg/kg) on FMJ. Our results suggest that tianeptine delayed the onset time of PTZ-induced seizures via adenosine A1 receptors in mice. Thus, this drug may be a useful choice for epileptic patients with depression.

  14. Striatal dopamine in Parkinson disease: A meta-analysis of imaging studies.

    Science.gov (United States)

    Kaasinen, Valtteri; Vahlberg, Tero

    2017-12-01

    A meta-analysis of 142 positron emission tomography and single photon emission computed tomography studies that have investigated striatal presynaptic dopamine function in Parkinson disease (PD) was performed. Subregional estimates of striatal dopamine metabolism are presented. The aromatic L-amino-acid decarboxylase (AADC) defect appears to be consistently smaller than the dopamine transporter and vesicular monoamine transporter 2 defects, suggesting upregulation of AADC function in PD. The correlation between disease severity and dopamine loss appears linear, but the majority of longitudinal studies point to a negative exponential progression pattern of dopamine loss in PD. Ann Neurol 2017;82:873-882. © 2017 American Neurological Association.

  15. Proteostasis in striatal cells and selective neurodegeneration in Huntington’s disease

    Science.gov (United States)

    Margulis, Julia; Finkbeiner, Steven

    2014-01-01

    Selective neuronal loss is a hallmark of neurodegenerative diseases, including Huntington’s disease (HD). Although mutant huntingtin, the protein responsible for HD, is expressed ubiquitously, a subpopulation of neurons in the striatum is the first to succumb. In this review, we examine evidence that protein quality control pathways, including the ubiquitin proteasome system, autophagy, and chaperones, are significantly altered in striatal neurons. These alterations may increase the susceptibility of striatal neurons to mutant huntingtin-mediated toxicity. This novel view of HD pathogenesis has profound therapeutic implications: protein homeostasis pathways in the striatum may be valuable targets for treating HD and other misfolded protein disorders. PMID:25147502

  16. Nucleus accumbens neurotransmission and effort-related choice behavior in food motivation: effects of drugs acting on dopamine, adenosine, and muscarinic acetylcholine receptors.

    Science.gov (United States)

    Nunes, Eric J; Randall, Patrick A; Podurgiel, Samantha; Correa, Mercè; Salamone, John D

    2013-11-01

    Mesolimbic dopamine (DA) is a critical component of the brain circuitry regulating behavioral activation and effort-related processes. Although nucleus accumbens (NAc) DA depletions or antagonism leave aspects of appetite and primary food motivation intact, rats with impaired DA transmission reallocate their instrumental behavior away from food-reinforced tasks with high response requirements, and instead select less effortful food-seeking behaviors. Previous work showed that adenosine A2A antagonists can reverse the effects of DA D2 antagonists on effort-related choice, and that stimulation of adenosine A2A receptors produces behavioral effects that are similar to those induced by DA antagonism. The present review summarizes the literature on the role of NAc DA and adenosine in effort-related processes, and also presents original data on the effects of local stimulation of muscarinic acetylcholine receptors in NAc core. Local injections of the muscarinic agonist pilocarpine directly into NAc core produces shifts in effort-related choice behavior similar to those induced by DA antagonism or A2A receptor stimulation, decreasing lever pressing but increasing chow intake in rats responding on a concurrent fixed ratio/chow feeding choice task. In contrast, injections into a neostriatal control site dorsal to the NAc were ineffective. The actions of pilocarpine on this task were attenuated by co-administration of the muscarinic antagonist scopolamine. Thus, drugs that act on DA, adenosine A2A, and muscarinic receptors regulate effort-related choice behavior, which may have implications for the treatment of psychiatric symptoms such as psychomotor slowing, fatigue or anergia that can be observed in depression and other disorders. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. Striatal lesions in delusional parasitosis revealed by magnetic resonance imaging.

    Science.gov (United States)

    Huber, Markus; Karner, Martin; Kirchler, Erwin; Lepping, Peter; Freudenmann, Roland W

    2008-12-12

    Delusional parasitosis (DP) is a syndrome characterized by the firm conviction that small living beings infest the skin. The etiology can be primary and secondary. Structural brain abnormalities in DP have only been reported in case reports often subcortical vascular encephalopathy and right-hemisphere strokes in the temporo-parietal cortex. Systematic brain imaging studies are lacking. We aimed to identify a brain region with structural lesions in patients with DP in order to better understand the pathophysiology of DP. Nine consecutive patients with DP in a psychiatric outpatient department were assessed clinically and by means of cranial magnetic resonance imaging (MRI). Five of the nine cases were diagnosed as having DP as psychotic disorders due to a general medical condition while three had DP arising from pre-existing psychiatric illness and one suffered from a delusional disorder, somatic type (primary form). Four of the five DP cases secondary to a general medical condition (one case could not be analyzed) had striatal lesions predominantly in the putamen. Thalamic or cortical lesions were found in one case, respectively. In the primary DP case and all cases secondary to another psychiatric disorder basal ganglia and subcortical gray matter lesions were absent. In all medical (secondary) DP cases subcortical white matter lesions were found mainly in the centrum semiovale. Three of the five medical DP cases showed severe generalized brain atrophy which was absent in the primary DP case and in the cases secondary to other psychiatric disorders. We present the findings of the first structural MRI study in DP. Our results suggest a possible relevance of structural lesions in the striatum, predominantly the putamen, in the medical (secondary) DP-subgroup. Our findings are in line with other studies demonstrating that the putamen, in addition to its role in motor regulation, represents a brain area that mediates visuo-tactile perception. Disturbed functioning of

  18. Multiple effects of adenosine in the arterially perfused mammalian eye. Possible mechanisms for the neuroprotective function of adenosine in the retina.

    Science.gov (United States)

    Macaluso, Claudio; Frishman, Laura J; Frueh, Beatrice; Kaelin-Lang, Alain; Onoe, Shoken; Niemeyer, Günter

    2003-01-01

    It has been postulated that the major physiological role of adenosine is protection of the central nervous system in conditions such as ischemia, hypoxia, or prolonged neuronal excitation. Under these conditions adenosine is released, and exerts multiple effects, including vasodilation, inhibition of neuronal activity, and enhancement of glycogenolysis, resulting in neuroprotection. In this article, published as well as unpublished data on the multiple effects of exogenous adenosine and application of adenosine-related agents, performed using the arterially perfused cat eye, will be reviewed and discussed within the framework of the neuroprotective role of adenosine. The isolated, arterially perfused eye preparation has the advantage of combining integrity of the eye structure, exact control of arterial concentration and timing of applied pharmacological agents, and access to electrophysiological parameters of both retina and optic nerve, as well as the ability to control and monitor perfusate flow. The absence of red blood cells in the perfusate prevents adenosine from being metabolized prior to reaching the eye.

  19. Safety of adenosine in stress cerebral perfusion imaging

    International Nuclear Information System (INIS)

    Hu Pengcheng; Gu Yushen; Liu Wenguan; Xiu Yan; Zhu Weimin; Chen Shuguang; Shi Hongcheng

    2009-01-01

    Objective: To evaluate the safety of adenosine as pharmacological stress agents in stress cerebral perfusion imaging. Methods: Eighty patients under investigation for suspected cerebral vessel disease were recruited. Each had a resting scan and a stress scan on different days. The adenosine stress protocol was as same as the protocol used in adenosine stress myocardial perfusion imaging. Subjective and objective side-effects were investigated during pharmacological stress procedure. Results: All patients completed the 6 min infusion protocol without premature termination on safety criteria or due to intolerable symptoms. 46 patients had mild side effects. 20 patients (25%) had dizziness, 12 patients (15%) had palpitation, 1 patient (1%) was hypotensive, 7 patients (9%) had dyspnoea, 4 patients (5%) felt hot, 3 patients (4%) had sweat, 4 patients (5%) had nausea, 6 patients (8%) had flushing, 19 patients (24%) had chest pain, 6 patients (8%) had abdomen pain, 3 patients (4%) had abnormal taste and 1 patient (1%) were thirsty. Transient ST change occurred in only 1 patient. Conclusion: Adenosine stress cerebral perfusion imaging is a safe diagnostic method with mild side effects. (authors)

  20. Adenosine Deaminase Activity in Diabetic and Obese Patients ...

    African Journals Online (AJOL)

    Adenosine deaminase (ADA) commonly associated with severe combined immunodeficiency disease believed to be an important enzyme for the modulation of bioactivity of insulin. The clinical significance in Metabolic Diseases patients in South Eastern Nigeria was studied. Body Mass Index (BMI), Fating Blood Glucose, ...

  1. Spectral studies of lanthanide-nucleic acid component interaction: complexes of adenine, adenosine, adenosine 5'-mono-, adenosine 5'-di- and adenosine 5' tri-phosphates with praseodymium(III)

    International Nuclear Information System (INIS)

    Joseph, George; Anjaiah, K.; Misra, S.N.

    1990-01-01

    The interactions of adenine, adenosine, adenosine 5'-mono-, adenosine 5'-di-and adenosine 5'-tri-phosphates with praseodymium(III) have been studied in different stoichiometries and at varying hydrogen ion concentrations by absorption spectral studies. The sharp bands in the spectra have been individually analysed by Gaussian curve analysis, and various spectral parameters have been computed using partial and multiple regression methods on an HP-1000/45 computer. The changes in and the magnitudes of these parameters have been correlated with the degrees of outer- and inner-sphere coordination around praseodymium(III). Crystalline complexes of the type: Pr(nucleotide) 2 (H 2 O) 2 (where nucleotide = AMP, ADP and ATP) have been characterized on the basis of analytical, IR and 1 H NMR spectral data. These studies indicate that the binding of the nucleotide is through phosphoric oxygen. These complexes in aqueous medium show significant ionization which supports the observed weak 4f-4f bands, lower values of nephelauxetic effect and the parameters derived from coulombic and spin-orbit interactions. (author). 3 t abs., 28 refs

  2. Gene expression profiles in adenosine-treated human mast cells ...

    African Journals Online (AJOL)

    The role of mast cells in allergic diseases and innate immunity has been widely researched and much is known about the expression profiles of immune-related genes in mast cells after bacterial challenges. However, little is known about the gene expression profiles of mast cells in response to adenosine. Herein, we ...

  3. Plasma Adenosine Deaminase Enzyme Reduces with Treatment of ...

    African Journals Online (AJOL)

    olayemitoyin

    Plasma Adenosine Deaminase Enzyme Reduces with Treatment of Pulmonary Tuberculosis in Nigerian Patients: Indication for. Diagnosis and Treatment Monitoring. Ige O.a, Edem V.F.b and Arinola O.G.b,*. aDepartment of Medicine, University of Ibadan, Ibadan, Nigeria b Department of Chemical Pathology,. University of ...

  4. Myocardial glucose uptake and breakdown during adenosine-induced vasodilation.

    Science.gov (United States)

    Turnheim, K; Donath, R; Weissel, M; Kolassa, N

    1976-09-30

    In isolated K+ (16.2 mM)-arrested cat hearts perfused at constant pressure adenosine infusions (0.8 mumoles - min-1 - 100 g-1 for 10 min) caused an increase in myocardial 14C-glucose uptake and release of 14CO2 + H14CO3- AND 14C-lactate simultaneously with a rise in coronary flow. The ratio of the release of 14CO2 + H14CO3- to that of 14C-lactate and the specific activity of lactate in the effuate were not altered. In K+ -arrested hearts perfused with constant volume neither glucose uptake nor glucose breakdown were influenced by 0.8 or 100 mumoles - min-1 - 100 g-1 adenosine with 0.1 - 5 mM glucose in the perfusion medium. It is concluded that adenosine does not affect directly the myocardial glucose carrier system, aerobic or anaerobic glucose breakdown or glycogenolysis, but enhances glucose uptake secondarily by increasing coronary flow. This interpretation is substantiated by the finding that mechanically produced increases in perfusion volume caused similar increases in myocardial glucose uptake as were observed with comparable adenosine-induced coronary flow increments.

  5. Adenosine monophosphate-activated protein kinase from the mud ...

    Indian Academy of Sciences (India)

    2016-12-01

    Dec 1, 2016 ... ... Journal of Genetics; Volume 95; Issue 4. Adenosine monophosphate-activated protein kinase from the mud crab, Scylla paramamosain: cDNA cloning and profiles under cold stress. CHENCUI HUANG KUN YU HUIYANG HUANG HAIHUI YE. RESEARCH ARTICLE Volume 95 Issue 4 December 2016 pp ...

  6. Validity of serum Adenosine deaminase in diagnosis of tuberculosis ...

    African Journals Online (AJOL)

    Introduction: Tuberculosis is one of the most important infectious causes of death worldwide. Ziehl-Neelsen staining of sputum has high specificity in tuberculosis endemic countries, but modest sensitivity which varies among laboratories. This study was set up to investigate the diagnostic value of serum Adenosine ...

  7. Adenosine monophosphate-activated protein kinase from the mud ...

    Indian Academy of Sciences (India)

    CHENCUI HUANG

    Adenosine monophosphate-activated protein kinase from the mud crab, Scylla paramamosain: cDNA cloning and profiles under cold stress. CHENCUI HUANG1, KUN YU1, HUIYANG HUANG1,2 and HAIHUI YE1,2∗. 1College of Ocean and Earth Sciences, Xiamen University, Xiamen 361102, People's Republic of China.

  8. Adenosine monophosphate-activated protein kinase from the mud ...

    Indian Academy of Sciences (India)

    2016-12-01

    Dec 1, 2016 ... to the understanding of the molecular mechanism of acclimation to cold hardiness in S. paramamosain. [Huang C., Yu K., Huang H. and Ye H. 2016 Adenosine monophosphate-activated protein kinase from the mud crab, Scylla paramamosain: cDNA cloning and profiles under cold stress. J. Genet.

  9. Contributory role of adenosine deaminase in metabolic syndrome ...

    African Journals Online (AJOL)

    Adenosine deaminase (ADA) is an enzyme of purine metabolism commonly associated with severe combined immunodeficiency disease and believed to modulate bioactivity of insulin. Its contributory role in patients with metabolic syndrome (having features such as obesity, insulin resistance, fasting hyperglycaemia, lipid ...

  10. Respiratory gating in cardiac PET: Effects of adenosine and dipyridamole.

    Science.gov (United States)

    Lassen, Martin Lyngby; Rasmussen, Thomas; Christensen, Thomas E; Kjær, Andreas; Hasbak, Philip

    2017-12-01

    Respiratory motion due to breathing during cardiac positron emission tomography (PET) results in spatial blurring and erroneous tracer quantification. Respiratory gating might represent a solution by dividing the PET coincidence dataset into smaller respiratory phase subsets. The aim of our study was to compare the resulting imaging quality by the use of a time-based respiratory gating system in two groups administered either adenosine or dipyridamole as the pharmacological stress agent. Forty-eight patients were randomized to adenosine or dipyridamole cardiac stress 82 RB-PET. Respiratory rates and depths were measured by a respiratory gating system in addition to registering actual respiratory rates. Patients undergoing adenosine stress showed a decrease in measured respiratory rate from initial to later scan phase measurements [12.4 (±5.7) vs 5.6 (±4.7) min -1 , P PET, a dipyridamole stress protocol is recommended as it, compared to adenosine, causes a more uniform respiration and results in a higher frequency of successful respiratory gating and thereby superior imaging quality.

  11. Identification of separate receptors for adenosine and adenosine 5'-triphosphate in causing relaxations of the isolated taenia of the guinea-pig caecum.

    Science.gov (United States)

    Spedding, M; Weetman, D F

    1976-01-01

    1 The mechanisms by which adenosine 5'-triphosphate (ATP), adenosine 5'-diphosphate (ADP), adenosine 5'-monophosphate (AMP) and adenosine relax the taenia caecum preparation of the guineapig have been studied. ATP and ADP produced similar effects which were qualitatively different from those of AMP and adenosine. 2 2-2'Pyridylisatogen tosylate (PIT: 50 muM for 30 min) blocked the effects of ATP and ADP, but exhibited weak activity against AMP and failed to antagonize the effects of adenosine. The action of PIT was unaffected by the inclusion of dipyridamole (2muM) in the bathing fluid. 3 There was a significant correlation between the sensitivity of individual preparations to ATP or ADP and the blocking potency of PIT. 4 The presence of adenosine in the bathing fluid (2 mM for greater than 30 min) desensitized the taenia to subsequent applications of adenosine. The effects of ATP were increased by this procedure. 5 The results indicate that ATP and adenosine relax the taenia by different mechanisms. PMID:938799

  12. Mechanism of A2 adenosine receptor activation. I. Blockade of A2 adenosine receptors by photoaffinity labeling

    International Nuclear Information System (INIS)

    Lohse, M.J.; Klotz, K.N.; Schwabe, U.

    1991-01-01

    It has previously been shown that covalent incorporation of the photoreactive adenosine derivative (R)-2-azido-N6-p-hydroxy-phenylisopropyladenosine [(R)-AHPIA] into the A1 adenosine receptor of intact fat cells leads to a persistent activation of this receptor, resulting in a reduction of cellular cAMP levels. In contrast, covalent incorporation of (R)-AHPIA into human platelet membranes, which contain only stimulatory A2 adenosine receptors, reduces adenylate cyclase stimulation via these receptors. This effect of (R)-AHPIA is specific for the A2 receptor and can be prevented by the adenosine receptor antagonist theophylline. Binding studies indicate that up to 90% of A2 receptors can be blocked by photoincorporation of (R)-AHPIA. However, the remaining 10-20% of A2 receptors are sufficient to mediate an adenylate cyclase stimulation of up to 50% of the control value. Similarly, the activation via these 10-20% of receptors occurs with a half-life that is only 2 times longer than that in control membranes. This indicates the presence of a receptor reserve, with respect to both the extent and the rate of adenylate cyclase stimulation. These observations require a modification of the models of receptor-adenylate cyclase coupling

  13. Metabolic changes of cultured DRG neurons induced by adenosine using confocal microscopy imaging

    Science.gov (United States)

    Zheng, Liqin; Huang, Yimei; Chen, Jiangxu; Wang, Yuhua; Yang, Hongqin; Zhang, Yanding; Xie, Shusen

    2012-12-01

    Adenosine exerts multiple effects on pain transmission in the peripheral nervous system. This study was performed to use confocal microscopy to evaluate whether adenosine could affect dorsal root ganglia (DRG) neurons in vitro and test which adenosine receptor mediates the effect of adenosine on DRG neurons. After adding adenosine with different concentration, we compared the metabolic changes by the real time imaging of calcium and mitochondria membrane potential using confocal microscopy. The results showed that the effect of 500 μM adenosine on the metabolic changes of DRG neurons was more significant than others. Furthermore, four different adenosine receptor antagonists were used to study which receptor mediated the influences of adenosine on the cultured DRG neurons. All adenosine receptor antagonists especially A1 receptor antagonist (DPCPX) had effect on the Ca2+ and mitochondria membrane potential dynamics of DRG neurons. The above studies demonstrated that the effect of adenosine which may be involved in the signal transmission on the sensory neurons was dose-dependent, and all the four adenosine receptors especially the A1R may mediate the transmission.

  14. Fronto-striatal glutamate in children with Tourette's disorder and attention-deficit/hyperactivity disorder

    Directory of Open Access Journals (Sweden)

    Jilly Naaijen

    2017-01-01

    Conclusion: We found no evidence for glutamatergic neuropathology in TD or ADHD within the fronto-striatal circuits. However, the correlation of OC-symptoms with ACC glutamate concentrations suggests that altered glutamatergic transmission is involved in OC-symptoms within TD, but this needs further investigation.

  15. Agonist-selective effects of opioid receptor ligands on cytosolic calcium concentration in rat striatal neurons.

    Science.gov (United States)

    Brailoiu, G Cristina; Deliu, Elena; Hooper, Robert; Dun, Nae J; Undieh, Ashiwel S; Adler, Martin W; Benamar, Khalid; Brailoiu, Eugen

    2012-06-01

    Buprenorphine is an opioid receptor ligand whose mechanism of action is incompletely understood. Using Ca(2+) imaging, we assessed the effects of buprenorphine, β-endorphin, and morphine on cytosolic Ca(2+) concentration [Ca(2+)](i), in rat striatal neurons. Buprenorphine (0.01-1 μM) increased [Ca(2+)](i) in a dose-dependent manner in a subpopulation of rat striatal neurons. The effect of buprenorphine was largely reduced by naloxone, a non-selective opioid receptor antagonist, but not by μ, κ, δ or NOP-selective antagonists. β-Endorphin (0.1 μM) increased [Ca(2+)](i) with a lower amplitude and slower time course than buprenorphine. Similar to buprenorphine, the effect of β-endorphin was markedly decreased by naloxone, but not by opioid-selective antagonists. Morphine (0.1-10 μM), did not affect [Ca(2+)](i) in striatal neurons. Our results suggest that buprenorphine and β-endorphin act on a distinct type/subtype of plasmalemmal opioid receptors or activate intracellular opioid-like receptor(s) in rat striatal neurons. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  16. Human striatal recordings reveal abnormal discharge of projection neurons in Parkinson's disease.

    Science.gov (United States)

    Singh, Arun; Mewes, Klaus; Gross, Robert E; DeLong, Mahlon R; Obeso, José A; Papa, Stella M

    2016-08-23

    Circuitry models of Parkinson's disease (PD) are based on striatal dopamine loss and aberrant striatal inputs into the basal ganglia network. However, extrastriatal mechanisms have increasingly been the focus of attention, whereas the status of striatal discharges in the parkinsonian human brain remains conjectural. We now report the activity pattern of striatal projection neurons (SPNs) in patients with PD undergoing deep brain stimulation surgery, compared with patients with essential tremor (ET) and isolated dystonia (ID). The SPN activity in ET was very low (2.1 ± 0.1 Hz) and reminiscent of that found in normal animals. In contrast, SPNs in PD fired at much higher frequency (30.2 ± 1.2 Hz) and with abundant spike bursts. The difference between PD and ET was reproduced between 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine-treated and normal nonhuman primates. The SPN activity was also increased in ID, but to a lower level compared with the hyperactivity observed in PD. These results provide direct evidence that the striatum contributes significantly altered signals to the network in patients with PD.

  17. Striatal dopamine D2 receptors, metabolism, and volume in preclinical Huntington disease

    NARCIS (Netherlands)

    van Oostrom, JCH; Maguire, RP; Verschuuren-Bemelmans, CC; van der Duin, LV; Pruim, J; Roos, RAC; Leenders, KL

    2005-01-01

    Among 27 preclinical carriers of the Huntington disease mutation (PMC), the authors found normal striatal values for MRI volumetry in 88% and for fluorodesoxyglucose PET metabolic index in 67%. Raclopride PET binding potential (RAC-BP) was decreased in 50% and correlated with increases in the

  18. Reduced striatal dopamine D2/3 receptor availability in Body Dysmorphic Disorder

    NARCIS (Netherlands)

    Vulink, Nienke C; Planting, Robin S; Figee, Martijn; Booij, Jan; Denys, D.

    Though the dopaminergic system is implicated in Obsessive Compulsive and Related Disorders (OCRD), the dopaminergic system has never been investigated in-vivo in Body Dysmorphic Disorder (BDD). In line with consistent findings of reduced striatal dopamine D2/3 receptor availability in Obsessive

  19. Reduced striatal dopamine D2/3 receptor availability in Body Dysmorphic Disorder

    NARCIS (Netherlands)

    Vulink, Nienke C.; Planting, Robin S.; Figee, Martijn; Booij, Jan; Denys, Damiaan

    2016-01-01

    Though the dopaminergic system is implicated in Obsessive Compulsive and Related Disorders (OCRD), the dopaminergic system has never been investigated in-vivo in Body Dysmorphic Disorder (BDD). In line with consistent findings of reduced striatal dopamine D2/3 receptor availability in Obsessive

  20. Synthesis and binding to striatal membranes of non carrier added I-123 labeled 4'-iodococaine

    International Nuclear Information System (INIS)

    Metwally, S.A.M.; Gatley, S.J.; Wolf, A.P.; Yu, D.-W.

    1992-01-01

    An 123 I labeled cocaine analog, 4'-[ 123 I]iodococaine, has been prepared by oxidative destannylation of the tributyltin analog and shown to interact with cocaine binding sites in rat brain striatal membranes. It may thus be a suitable SPECT radiotracer for studies of the dopamine reuptake site in neurodegenerative diseases. (Author)

  1. Repeated cocaine administration results in supersensitivity of striatal D-2 dopamine autoreceptors to pergolide

    International Nuclear Information System (INIS)

    Dwoskin, L.P.; Peris, J.; Yasuda, R.P.; Philpott, K.; Zahniser, N.R.

    1988-01-01

    Groups of rats administered cocaine-HCl (10 mg/kg, i.p.) or saline either acutely or once daily for 8 or 14 days were killed 24 hrs after the last dose. In striatal slices prelabelled with [ 3 H]DA, modulation of [ 3 H]-overflow by pergolide was used to measure D-2 autoreceptor activity. Compared to the contemporaneous control group pergolide produced a greater inhibition only in striatal slices from rats treated repeatedly with cocaine. In radioligand binding studies using striatal membranes from control rats, pergolide had a 500-fold greater affinity for the D-2, as opposed to the D-1, dopamine (DA) receptor subtype. These results indicate that repeated treatment with cocaine produces supersensitive striatal D-2 release-modulating autoreceptors consistent with a compensatory change to diminish the effect of elevated synaptic concentrations of DA produced by cocaine. In contrast, supersensitivity of D-2 receptors was not detected in [ 3 H]spiperone binding assays. 31 references, 2 figures, 1 table

  2. Ciliary neurotrophic factor protects striatal neurons against excitotoxicity by enhancing glial glutamate uptake.

    Directory of Open Access Journals (Sweden)

    Corinne Beurrier

    Full Text Available Ciliary neurotrophic factor (CNTF is a potent neuroprotective cytokine in different animal models of glutamate-induced excitotoxicity, although its action mechanisms are still poorly characterized. We tested the hypothesis that an increased function of glial glutamate transporters (GTs could underlie CNTF-mediated neuroprotection. We show that neuronal loss induced by in vivo striatal injection of the excitotoxin quinolinic acid (QA was significantly reduced (by approximately 75% in CNTF-treated animals. In striatal slices, acute QA application dramatically inhibited corticostriatal field potentials (FPs, whose recovery was significantly higher in CNTF rats compared to controls (approximately 40% vs. approximately 7%, confirming an enhanced resistance to excitotoxicity. The GT inhibitor DL-threo-beta-benzyloxyaspartate greatly reduced FP recovery in CNTF rats, supporting the role of GT in CNTF-mediated neuroprotection. Whole-cell patch-clamp recordings from striatal medium spiny neurons showed no alteration of basic properties of striatal glutamatergic transmission in CNTF animals, but the increased effect of a low-affinity competitive glutamate receptor antagonist (gamma-D-glutamylglycine also suggested an enhanced GT function. These data strongly support our hypothesis that CNTF is neuroprotective via an increased function of glial GTs, and further confirms the therapeutic potential of CNTF for the clinical treatment of progressive neurodegenerative diseases involving glutamate overflow.

  3. Striatal Dopamine Transporter Binding Does Not Correlate with Clinical Severity in Dementia with Lewy Bodies

    DEFF Research Database (Denmark)

    Ziebell, Morten; Andersen, Birgitte B; Pinborg, Lars H

    2013-01-01

    cognitively evaluated with the Mini Mental State Examination. RESULTS: There was no correlation between Mini Mental State Examination, Hoehn and Yahr score, fluctuations or hallucinations, and striatal DAT availability as measured with (123)I-PE2I and SPECT. CONCLUSION: In patients with newly diagnosed DLB...

  4. Aberrant local striatal functional connectivity in attention-deficit/hyperactivity disorder

    NARCIS (Netherlands)

    Rhein, D.T. von; Oldehinkel, M.; Beckmann, C.F.; Oosterlaan, J.; Heslenfeld, D.; Hartman, C.A.; Hoekstra, P.J.; Franke, B.; Cools, R.; Buitelaar, J.K.; Mennes, M.

    2016-01-01

    BACKGROUND: Task-based and resting-state functional Magnetic Resonance Imaging (fMRI) studies report attention-deficit/hyperactivity disorder (ADHD)-related alterations in brain regions implicated in cortico-striatal networks. We assessed whether ADHD is associated with changes in the brain's global

  5. Aberrant local striatal functional connectivity in attention-deficit/hyperactivity disorder

    NARCIS (Netherlands)

    von Rhein, Daniel; Oldehinkel, Marianne; Beckmann, Christian F.; Oosterlaan, Jaap; Heslenfeld, Dirk; Hartman, Catharina A.; Hoekstra, Pieter J.; Franke, Barbara; Cools, Roshan; Buitelaar, Jan K.; Mennes, Maarten

    Background: Task-based and resting-state functional Magnetic Resonance Imaging (fMRI) studies report attention-deficit/hyperactivity disorder (ADHD)-related alterations in brain regions implicated in cortico-striatal networks. We assessed whether ADHD is associated with changes in the brain's global

  6. Fronto-striatal glutamate in autism spectrum disorder and obsessive compulsive disorder

    NARCIS (Netherlands)

    Naaijen, Jilly; Zwiers, Marcel P.; Amiri, Houshang; Williams, Steven C R; Durston, Sarah; Oranje, Bob; Brandeis, Daniel; Boecker-Schlier, Regina; Ruf, Matthias; Wolf, Isabella; Banaschewski, Tobias; Glennon, Jeffrey C.; Franke, Barbara; Buitelaar, Jan K.; Lythgoe, David J

    2017-01-01

    Autism spectrum disorders (ASDs) and obsessive compulsive disorder (OCD) are often comorbid with the overlap based on compulsive behaviors. Although previous studies suggest glutamatergic deficits in fronto-striatal brain areas in both disorders, this is the first study to directly compare the

  7. Fronto-striatal glutamate in children with Tourette's disorder and attention-deficit/hyperactivity disorder

    NARCIS (Netherlands)

    Naaijen, J.; Forde, N.J.; Lythgoe, D.J.; Akkermans, S.E.A.; Openneer, T.J.; Dietrich, A.; Zwiers, M.P.; Hoekstra, P.J.; Buitelaar, J.K.

    2017-01-01

    OBJECTIVE: Both Tourette's disorder (TD) and attention-deficit/hyperactivity disorder (ADHD) have been related to abnormalities in glutamatergic neurochemistry in the fronto-striatal circuitry. TD and ADHD often co-occur and the neural underpinnings of this co-occurrence have been insufficiently

  8. Fronto-striatal glutamate in children with Tourette's disorder and attention-deficit/hyperactivity disorder

    NARCIS (Netherlands)

    Naaijen, Jilly; Forde, Natalie J.; Lythgoe, David J.; Akkermans, Sophie E. A.; Openneer, Thaira J. C.; Dietrich, Andrea; Zwiers, Marcel P.; Hoekstra, Pieter J.; Buitelaar, Jan K.

    2017-01-01

    Objective: Both Tourette's disorder (TD) and attention-deficit/hyperactivity disorder (ADHD) have been related to abnormalities in glutamatergic neurochemistry in the fronto-striatal circuitry. TD and ADHD often co-occur and the neural underpinnings of this co-occurrence have been insufficiently

  9. De Novo Mutations in PDE10A Cause Childhood-Onset Chorea with Bilateral Striatal Lesions

    NARCIS (Netherlands)

    Mencacci, N.E.; Kamsteeg, E.J.; Nakashima, K.; R'Bibo, L.; Lynch, D.S.; Balint, B.; Willemsen, M.A.A.P.; Adams, M.E.; Wiethoff, S.; Suzuki, K.; Davies, C.H.; Ng, J.; Meyer, E.; Veneziano, L.; Giunti, P.; Hughes, D.; Raymond, F.L.; Carecchio, M.; Zorzi, G.; Nardocci, N.; Barzaghi, C.; Garavaglia, B.; Salpietro, V.; Hardy, J.; Pittman, A.M.; Houlden, H.; Kurian, M.A.; Kimura, H.; Vissers, L.E.L.M.; Wood, N.W.; Bhatia, K.P.

    2016-01-01

    Chorea is a hyperkinetic movement disorder resulting from dysfunction of striatal medium spiny neurons (MSNs), which form the main output projections from the basal ganglia. Here, we used whole-exome sequencing to unravel the underlying genetic cause in three unrelated individuals with a very

  10. Cannabinoid-1 receptor antagonist rimonabant (SR141716) increases striatal dopamine D2 receptor availability

    NARCIS (Netherlands)

    Crunelle, Cleo L.; van de Giessen, Elsmarieke; Schulz, Sybille; Vanderschuren, Louk J. M. J.; de Bruin, Kora; van den Brink, Wim; Booij, Jan

    2013-01-01

    The cannabinoid 1 receptor antagonist rimonabant (SR141716) alters rewarding properties and intake of food and drugs. Additionally, striatal dopamine D2 receptor (DRD2) availability has been implicated in reward function. This study shows that chronic treatment of rats with rimonabant (1.0 and

  11. Writer's cramp: restoration of striatal D2-binding after successful biofeedback-based sensorimotor training.

    NARCIS (Netherlands)

    Berger, H.J.C.; Werf, S.P. van der; Horstink, C.A.; Cools, A.R.; Oyen, W.J.G.; Horstink, M.W.I.M.

    2007-01-01

    INTRODUCTION: Previous studies of writer's cramp have detected cerebral sensorimotor abnormalities in this disorder and, more specifically, a reduced striatal D2-binding as assessed by [(123)I]IBZM SPECT. However, empirical data were lacking about the influence of effective biofeedback-based

  12. Apathy and striatal dopamine defects in non-demented patients with Parkinson's disease.

    Science.gov (United States)

    Chung, Su Jin; Lee, Jae Jung; Ham, Jee Hyun; Lee, Phil Hyu; Sohn, Young H

    2016-02-01

    Apathy is a common, disabling symptom in Parkinson's disease (PD). The mechanisms underlying apathy in PD are still unclear, although they may be related to dysfunction in the meso-cortico-limbic circuit, including the ventral striatum. Thus, we performed this study to investigate whether dopamine depletion in the ventral striatum contributes to apathy in PD. We conducted a survey of the degree of apathy (using the Korean version of the Apathy Evaluation Scale, AES-S) in 108 non-demented patients with PD who underwent dopamine transporter (DAT) positron emission tomography scans as an initial diagnostic work-up. Patients with AES-S scores of 37 or higher were defined as having apathetic PD. The Beck Depression Inventory (BDI) was administered to assess the severity of depression. Patients with BDI scores of 15 or higher were regarded as having depression. Apathetic patients (n = 34) tended to exhibit higher BDI scores than non-apathetic patients (n = 74); however, other clinical variables were comparable between the two groups. DAT activity in the striatal sub-regions was also similar between the two groups. Selecting only non-depressed patients, including 20 apathetic and 47 non-apathetic patients, did not alter the results. This study demonstrated that the pattern of striatal dopamine depletion does not contribute to the degree of apathy in early PD. Apathy in PD may be associated with extra-striatal lesions that accompany PD rather than striatal dopaminergic deficits. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Apathy and striatal dopamine transporter levels in de-novo, untreated Parkinson's disease patients.

    Science.gov (United States)

    Santangelo, Gabriella; Vitale, Carmine; Picillo, Marina; Cuoco, Sofia; Moccia, Marcello; Pezzella, Domenica; Erro, Roberto; Longo, Katia; Vicidomini, Caterina; Pellecchia, Maria Teresa; Amboni, Marianna; Brunetti, Arturo; Salvatore, Marco; Barone, Paolo; Pappatà, Sabina

    2015-05-01

    Apathy is a neuropsychiatric symptom in Parkinson's Disease (PD) which has a negative impact on quality of life and might be related in part to damage of presynaptic dopaminergic system. Little is known about relationship between striatal dopamine levels and apathy in PD patients without dementia and/or depression. The aim of the present study was to investigate the relationship between "pure apathy" and striatal dopamine uptake in untreated, drug-naïve PD patients without clinically significant dementia and/or depression. Fourteen PD patients with pure apathy and 14 PD patients without apathy, matched for age, side of motor symptoms at onset, motor disability and disease duration, underwent both neuropsychological and behavioral examination including self-rated version of the Apathy Evaluation Scale (AES-S). All patients underwent 123 I-FP-CIT (DaT-SCAN) SPECT to assess dopamine transporter (DAT) striatal uptake. PD patients with apathy showed lower DAT levels in the striatum than non-apathetic patients. After Bonferroni correction the difference between groups was significant in the right caudate. Apathy is associated with reduced striatal dopamine transporter levels, independent of motor disability and depression in non-demented PD patients. These findings suggest that dysfunction of dopaminergic innervation in the striatum and particularly in the right caudate may contribute to development of apathy in early PD. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Frizzled3 controls axonal polarity and intermediate target entry during striatal pathway development

    NARCIS (Netherlands)

    Morello, Francesca; Prasad, Asheeta A.; Rehberg, Kati; Baptista Vieira de Sá, Renata; Antón-Bolaños, Noelia; Leyva-Diaz, Eduardo; Adolfs, Youri; Tissir, Fadel; López-Bendito, Guillermina; Pasterkamp, R. Jeroen

    2015-01-01

    The striatum is a large brain nucleus with an important role in the control of movement and emotions.Mediumspiny neurons (MSNs) are striatal output neurons forming prominent descending axon tracts that target different brain nuclei. However, how MSN axon tracts in the forebrain develop remains

  15. Environmental enrichment enhances synaptic plasticity by internalization of striatal dopamine transporters

    Science.gov (United States)

    Kim, Myung-Sun; Yu, Ji Hea; Kim, Chul Hoon; Choi, Jae Yong; Seo, Jung Hwa; Lee, Min-Young; Yi, Chi Hoon; Choi, Tae Hyun; Ryu, Young Hoon; Lee, Jong Eun; Lee, Bae Hwan; Kim, Hyongbum

    2015-01-01

    Environmental enrichment (EE) with a complex combination of physical, cognitive and social stimulations enhances synaptic plasticity and behavioral function. However, the mechanism remains to be elucidated in detail. We aimed to investigate dopamine-related synaptic plasticity underlying functional improvement after EE. For this, six-week-old CD-1 mice were randomly allocated to EE or standard conditions for two months. EE significantly enhanced behavioral functions such as rotarod and ladder walking tests. In a [18F]FPCIT positron emission tomography scan, binding values of striatal DAT were significantly decreased approximately 18% in the EE mice relative to the control mice. DAT inhibitor administrated to establish the relationship of the DAT down-regulation to the treatment effects also improved rotarod performances, suggesting that DAT inhibition recapitulated EE-mediated treatment benefits. Next, EE-induced internalization of DAT was confirmed using a surface biotinylation assay. In situ proximity ligation assay and immunoprecipitation demonstrated that EE significantly increased the phosphorylation of striatal DAT as well as the levels of DAT bound with protein kinase C (PKC). In conclusion, we suggest that EE enables phosphorylation of striatal DAT via a PKC-mediated pathway and causes DAT internalization. This is the first report to suggest an EE-mediated mechanism of synaptic plasticity by internalization of striatal DAT. PMID:26661218

  16. Different correlation patterns of cholinergic and GABAergic interneurons with striatal projection neurons

    Directory of Open Access Journals (Sweden)

    Avital eAdler

    2013-09-01

    Full Text Available The striatum is populated by a single projection neuron group, the medium spiny neurons (MSNs, and several groups of interneurons. Two of the electrophysiologically well-characterized striatal interneuron groups are the tonically active neurons (TANs, which are presumably cholinergic interneurons, and the fast spiking interneurons (FSIs, presumably parvalbumin (PV expressing GABAergic interneurons. To better understand striatal processing it is thus crucial to define the functional relationship between MSNs and these interneurons in the awake and behaving animal. We used multiple electrodes and standard physiological methods to simultaneously record MSN spiking activity and the activity of TANs or FSIs from monkeys engaged in a classical conditioning paradigm. All three cell populations were highly responsive to the behavioral task. However, they displayed different average response profiles and a different degree of response synchronization (signal correlation. TANs displayed the most transient and synchronized response, MSNs the most diverse and sustained response and FSIs were in between on both parameters. We did not find evidence for direct monosynaptic connectivity between the MSNs and either the TANs or the FSIs. However, while the cross correlation histograms of TAN to MSN pairs were flat, those of FSI to MSN displayed positive asymmetrical broad peaks. The FSI-MSN correlogram profile implies that the spikes of MSNs follow those of FSIs and both are driven by a common, most likely cortical, input. Thus, the two populations of striatal interneurons are probably driven by different afferents and play complementary functional roles in the physiology of the striatal microcircuit.

  17. Glutamine triggers long-lasting increase in striatal network activity in vitro.

    Science.gov (United States)

    Fleischer, Wiebke; Theiss, Stephan; Schnitzler, Alfons; Sergeeva, Olga

    2017-04-01

    Accumulation of ammonium and glutamine in blood and brain is a key factor in hepatic encephalopathy (HE) - a neuropsychiatric syndrome characterized by various cognitive and motor deficits. MRI imaging identified abnormalities notably in the basal ganglia of HE patients, including its major input station, the striatum. While neurotoxic effects of ammonia have been extensively studied, glutamine is primarily perceived as "detoxified" form of ammonia. We applied ammonium and glutamine to striatal and cortical cells from newborn rats cultured on microelectrode arrays. Glutamine, but not ammonium significantly increased spontaneous spike rate with a long-lasting excitation outlasting washout. This effect was more prominent in striatal than in cortical cultures. Calcium imaging revealed that glutamine application caused a rise in intracellular calcium that depended both on system A amino acid transport and activation of ionotropic glutamate receptors. This pointed to downstream glutamate release that was triggered by intracellular glutamine. Using an enzymatic assay kit we confirmed glutamine-provoked glutamate release from striatal cells. Real-time PCR and immunocytochemistry demonstrated the presence of vesicular glutamate transporters (VGLUT1 and VGLUT2) necessary for synaptic glutamate release in striatal neurons. We conclude that extracellular glutamine is taken up by neurons, triggers synaptic release of glutamate which is then taken up by astrocytes and again converted to glutamine. This feedback-loop causes a sustained long-lasting excitation of network activity. Thus, apart from ammonia also its "detoxified" form glutamine might be responsible for the neuropsychiatric symptoms in HE. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Creative cognition and dopaminergic modulation of fronto-striatal networks: Integrative review and research agenda.

    Science.gov (United States)

    Boot, Nathalie; Baas, Matthijs; van Gaal, Simon; Cools, Roshan; De Dreu, Carsten K W

    2017-07-01

    Creative cognition is key to human functioning yet the underlying neurobiological mechanisms are sparsely addressed and poorly understood. Here we address the possibility that creative cognition is a function of dopaminergic modulation in fronto-striatal brain circuitries. It is proposed that (i) creative cognition benefits from both flexible and persistent processing, (ii) striatal dopamine and the integrity of the nigrostriatal dopaminergic pathway is associated with flexible processing, while (iii) prefrontal dopamine and the integrity of the mesocortical dopaminergic pathway is associated with persistent processing. We examine this possibility in light of studies linking creative ideation, divergent thinking, and creative problem-solving to polymorphisms in dopamine receptor genes, indirect markers and manipulations of the dopaminergic system, and clinical populations with dysregulated dopaminergic activity. Combined, studies suggest a functional differentiation between striatal and prefrontal dopamine: moderate (but not low or high) levels of striatal dopamine benefit creative cognition by facilitating flexible processes, and moderate (but not low or high) levels of prefrontal dopamine enable persistence-driven creativity. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Diversity in Long-Term Synaptic Plasticity at Inhibitory Synapses of Striatal Spiny Neurons

    Science.gov (United States)

    Rueda-Orozco, Pavel E.; Mendoza, Ernesto; Hernandez, Ricardo; Aceves, Jose J.; Ibanez-Sandoval, Osvaldo; Galarraga, Elvira; Bargas, Jose

    2009-01-01

    Procedural memories and habits are posited to be stored in the basal ganglia, whose intrinsic circuitries possess important inhibitory connections arising from striatal spiny neurons. However, no information about long-term plasticity at these synapses is available. Therefore, this work describes a novel postsynaptically dependent long-term…

  20. Adenosine A1 receptors in human sleep regulation studied by electroencephalography (EEG) and positron emission tomography (PET)

    International Nuclear Information System (INIS)

    Geissler, E.

    2007-01-01

    Sleep is an essential physiological process. However, the functions of sleep and the endogenous mechanisms involved in sleep regulation are only partially understood. Convergent lines of evidence support the hypothesis that the build-up of sleep propensity during wakefulness and its decline during sleep are associated with alterations in brain adenosine levels and adenosine receptor concentrations. The non-selective A 1 and A 2A adenosine receptor antagonist caffeine stimulates alertness and is known to attenuate changes in the waking and sleep electroencephalogram (EEG) typically observed after prolonged waking. Several findings point to an important function of the adenosine A 1 receptor (A 1 AR) in the modulation of vigilance states. The A 1 AR is densely expressed in brain regions involved in sleep regulation, and pharmacological manipulations affecting the A 1 AR were shown to influence sleep propensity and sleep depth. However, an involvement of the A 2A adenosine receptor (A 2A AR) is also assumed. The distinct functions of the A 1 and A 2A receptor subtypes in sleep-wake regulation and in mediating the effects of caffeine have not been identified so far. The selective adenosine A 1 receptor antagonist, 8-cyclopentyl-3-(3- 18 Ffluoropropyl)- 1-propylxanthine ( 18 F-CPFPX), offers the opportunity to get further insights into adenosinergic mechanisms by in vivo imaging of the A 1 AR subtype with positron emission tomography (PET). The aim of this thesis was to elucidate the role of adenosine A 1 receptors in human sleep regulation, combining 18 F-CPFPX PET brain imaging and EEG recordings, the gold standard in sleep research. It was hypothesized that sleep deprivation would induce adenosine accumulation and/or changes in A 1 AR density. Thus, the question was addressed whether these effects of prolonged wakefulness can be visualized by altered 18 F-CPFPX binding. Moreover, it was investigated whether radioligand uptake might be influenced by caffeine, since

  1. 2'-C-Methyl analogues of selective adenosine receptor agonists: synthesis and binding studies.

    Science.gov (United States)

    Franchetti, P; Cappellacci, L; Marchetti, S; Trincavelli, L; Martini, C; Mazzoni, M R; Lucacchini, A; Grifantini, M

    1998-05-07

    2'-C-Methyl analogues of selective adenosine receptor agonists such as (R)-PIA, CPA, CCPA, NECA, and IB-MECA were synthesized in order to further investigate the subdomain that binds the ribose moiety. Binding affinities of these new compounds at A1 and A2A receptors in bovine brain membranes and at A3 in rat testis membranes were determined and compared. It was found that the 2'-C-methyl modification resulted in a decrease of the affinity, particularly at A2A and A3 receptors. When such modification was combined with N6-substitutions with groups which induce high potency and selectivity at A1 receptors, the high affinity was retained and the selectivity was increased. Thus, 2-chloro-2'-C-methyl-N6-cyclopentyladenosine (2'-Me-CCPA), which displayed a Ki value of 1.8 nM at A1 receptors, was selective for A1 vs A2A and A3 receptors by 2166- and 2777-fold, respectively, resulting in one of the most potent and A1-selective agonists so far known. In functional assay, this compound inhibited forskolin-stimulated adenylyl cyclase activity with an IC50 value of 13.1 nM, acting as a full agonist.

  2. Impaired dual tasking in Parkinson's disease is associated with reduced focusing of cortico-striatal activity.

    Science.gov (United States)

    Nieuwhof, Freek; Bloem, Bastiaan R; Reelick, Miriam F; Aarts, Esther; Maidan, Inbal; Mirelman, Anat; Hausdorff, Jeffrey M; Toni, Ivan; Helmich, Rick C

    2017-05-01

    See Bell et al. (doi:10.1093/awx063) for a scientific commentary on this article. Impaired dual tasking, namely the inability to concurrently perform a cognitive and a motor task (e.g. 'stops walking while talking'), is a largely unexplained and frequent symptom of Parkinson's disease. Here we consider two circuit-level accounts of how striatal dopamine depletion might lead to impaired dual tasking in patients with Parkinson's disease. First, the loss of segregation between striatal territories induced by dopamine depletion may lead to dysfunctional overlaps between the motor and cognitive processes usually implemented in parallel cortico-striatal circuits. Second, the known dorso-posterior to ventro-anterior gradient of dopamine depletion in patients with Parkinson's disease may cause a funnelling of motor and cognitive processes into the relatively spared ventro-anterior putamen, causing a neural bottleneck. Using functional magnetic resonance imaging, we measured brain activity in 19 patients with Parkinson's disease and 26 control subjects during performance of a motor task (auditory-cued ankle movements), a cognitive task (implementing a switch-stay rule), and both tasks simultaneously (dual task). The distribution of task-related activity respected the known segregation between motor and cognitive territories of the putamen in both groups, with motor-related responses in the dorso-posterior putamen and task switch-related responses in the ventro-anterior putamen. During dual task performance, patients made more motor and cognitive errors than control subjects. They recruited a striatal territory (ventro-posterior putamen) not engaged during either the cognitive or the motor task, nor used by controls. Relatively higher ventro-posterior putamen activity in controls was associated with worse dual task performance. These observations suggest that dual task impairments in Parkinson's disease are related to reduced spatial focusing of striatal activity. This

  3. Decoupling of Sleepiness from Sleep Time and Intensity during Chronic Sleep Restriction: Evidence for a Role of the Adenosine System

    Science.gov (United States)

    Kim, Youngsoo; Bolortuya, Yunren; Chen, Lichao; Basheer, Radhika; McCarley, Robert W.; Strecker, Robert E.

    2012-01-01

    Study Objective: Sleep responses to chronic sleep restriction (CSR) might be very different from those observed after short-term total sleep deprivation. For example, after sleep restriction continues for several consecutive days, animals no longer express compensatory increases in daily sleep time and sleep intensity. However, it is unknown if these allostatic, or adaptive, sleep responses to CSR are paralleled by behavioral and neurochemical measures of sleepiness. Design: This study was designed to investigate CSR-induced changes in (1) sleep time and intensity as a measure of electrophysiological sleepiness, (2) sleep latency as a measure of behavioral sleepiness, and (3) brain adenosine A1 (A1R) and A2a receptor (A2aR) mRNA levels as a putative neurochemical correlate of sleepiness. Subjects: Male Sprague-Dawley rats Interventions: A 5-day sleep restriction (SR) protocol consisting of 18-h sleep deprivation and 6-h sleep opportunity each day. Measurement and Results: Unlike the first SR day, rats did not sleep longer or deeper on days 2 through 5, even though they exhibited significant elevations of behavioral sleepiness throughout all 5 SR days. For all SR days and recovery day 1, A1R mRNA in the basal forebrain was maintained at elevated levels, whereas A2aR mRNA in the frontal cortex was maintained at reduced levels. Conclusion: CSR leads to a decoupling of sleepiness from sleep time and sleep intensity, suggesting that there are at least two different sleep regulatory systems: one mediating sleepiness (homeostatic) and the other mediating sleep time/intensity (allostatic). The time course of changes observed in adenosine receptor mRNA levels suggests that the basal forebrain and cortical adenosine system might mediate sleepiness rather than sleep time or intensity. Citation: Kim Y; Bolortuya Y; Chen L; Basheer R; McCarley RW; Strecker RE. Decoupling of sleepiness from sleep time and intensity during chronic sleep restriction: evidence for a role of the

  4. Striatal dopamine transmission is subtly modified in human A53Tα-synuclein overexpressing mice.

    Directory of Open Access Journals (Sweden)

    Nicola J Platt

    Full Text Available Mutations in, or elevated dosage of, SNCA, the gene for α-synuclein (α-syn, cause familial Parkinson's disease (PD. Mouse lines overexpressing the mutant human A53Tα-syn may represent a model of early PD. They display progressive motor deficits, abnormal cellular accumulation of α-syn, and deficits in dopamine-dependent corticostriatal plasticity, which, in the absence of overt nigrostriatal degeneration, suggest there are age-related deficits in striatal dopamine (DA signalling. In addition A53Tα-syn overexpression in cultured rodent neurons has been reported to inhibit transmitter release. Therefore here we have characterized for the first time DA release in the striatum of mice overexpressing human A53Tα-syn, and explored whether A53Tα-syn overexpression causes deficits in the release of DA. We used fast-scan cyclic voltammetry to detect DA release at carbon-fibre microelectrodes in acute striatal slices from two different lines of A53Tα-syn-overexpressing mice, at up to 24 months. In A53Tα-syn overexpressors, mean DA release evoked by a single stimulus pulse was not different from wild-types, in either dorsal striatum or nucleus accumbens. However the frequency responsiveness of DA release was slightly modified in A53Tα-syn overexpressors, and in particular showed slight deficiency when the confounding effects of striatal ACh acting at presynaptic nicotinic receptors (nAChRs were antagonized. The re-release of DA was unmodified after single-pulse stimuli, but after prolonged stimulation trains, A53Tα-syn overexpressors showed enhanced recovery of DA release at old age, in keeping with elevated striatal DA content. In summary, A53Tα-syn overexpression in mice causes subtle changes in the regulation of DA release in the striatum. While modest, these modifications may indicate or contribute to striatal dysfunction.

  5. The basal ganglia matching tools package for striatal uptake semi-quantification: description and validation

    International Nuclear Information System (INIS)

    Calvini, Piero; Rodriguez, Guido; Nobili, Flavio; Inguglia, Fabrizio; Mignone, Alessandro; Guerra, Ugo P.

    2007-01-01

    To design a novel algorithm (BasGan) for automatic segmentation of striatal 123 I-FP-CIT SPECT. The BasGan algorithm is based on a high-definition, three-dimensional (3D) striatal template, derived from Talairach's atlas. A blurred template, obtained by convolving the former with a 3D Gaussian kernel (FWHM = 10 mm), approximates striatal activity distribution. The algorithm performs translations and scale transformation on the bicommissural aligned image to set the striatal templates with standard size in an appropriate initial position. An optimization protocol automatically performs fine adjustments in the positioning of blurred templates to best match the radioactive counts, and locates an occipital ROI for background evaluation. Partial volume effect correction is included in the process of uptake computation of caudate, putamen and background. Experimental validation was carried out by means of six acquisitions of an anthropomorphic striatal phantom. The BasGan software was applied to a first set of patients with Parkinson's disease (PD) versus patients affected by essential tremor. A highly significant correlation was achieved between true binding potential and measured 123 I activity from the phantom. 123 I-FP-CIT uptake was significantly lower in all basal ganglia in the PD group versus controls with both BasGan and a conventional ROI method used for comparison, but particularly with the former. Correlations with the motor UPDRS score were far more significant with the BasGan. The novel BasGan algorithm automatically performs the 3D segmentation of striata. Because co-registered MRI is not needed, it can be used by all nuclear medicine departments, since it is freely available on the Web. (orig.)

  6. Youth at risk for obesity show greater activation of striatal and somatosensory regions to food.

    Science.gov (United States)

    Stice, Eric; Yokum, Sonja; Burger, Kyle S; Epstein, Leonard H; Small, Dana M

    2011-03-23

    Obese humans, compared with normal-weight humans, have less striatal D2 receptors and striatal response to food intake; weaker striatal response to food predicts weight gain for individuals at genetic risk for reduced dopamine (DA) signaling, consistent with the reward-deficit theory of obesity. Yet these may not be initial vulnerability factors, as overeating reduces D2 receptor density, D2 sensitivity, reward sensitivity, and striatal response to food. Obese humans also show greater striatal, amygdalar, orbitofrontal cortex, and somatosensory region response to food images than normal-weight humans do, which predicts weight gain for those not at genetic risk for compromised dopamine signaling, consonant with the reward-surfeit theory of obesity. However, after pairings of palatable food intake and predictive cues, DA signaling increases in response to the cues, implying that eating palatable food contributes to increased responsivity. Using fMRI, we tested whether normal-weight adolescents at high- versus low-risk for obesity showed aberrant activation of reward circuitry in response to receipt and anticipated receipt of palatable food and monetary reward. High-risk youth showed greater activation in the caudate, parietal operculum, and frontal operculum in response to food intake and in the caudate, putamen, insula, thalamus, and orbitofrontal cortex in response to monetary reward. No differences emerged in response to anticipated food or monetary reward. Data indicate that youth at risk for obesity show elevated reward circuitry responsivity in general, coupled with elevated somatosensory region responsivity to food, which may lead to overeating that produces blunted dopamine signaling and elevated responsivity to food cues.

  7. Functional role for cortical-striatal circuitry in modulating alcohol self-administration.

    Science.gov (United States)

    Jaramillo, Anel A; Randall, Patrick A; Stewart, Spencer; Fortino, Brayden; Van Voorhies, Kalynn; Besheer, Joyce

    2018-03-01

    The cortical-striatal brain circuitry is heavily implicated in drug-use. As such, the present study investigated the functional role of cortical-striatal circuitry in modulating alcohol self-administration. Given that a functional role for the nucleus accumbens core (AcbC) in modulating alcohol-reinforced responding has been established, we sought to test the role of cortical brain regions with afferent projections to the AcbC: the medial prefrontal cortex (mPFC) and the insular cortex (IC). Long-Evans rats were trained to self-administer alcohol (15% alcohol (v/v)+2% sucrose (w/v)) during 30 min sessions. To test the functional role of the mPFC or IC, we utilized a chemogenetic technique (hM4D i -Designer Receptors Activation by Designer Drugs) to silence neuronal activity prior to an alcohol self-administration session. Additionally, we chemogenetically silenced mPFC→AcbC or IC→AcbC projections, to investigate the role of cortical-striatal circuitry in modulating alcohol self-administration. Chemogenetically silencing the mPFC decreased alcohol self-administration, while silencing the IC increased alcohol self-administration, an effect absent in mCherry-Controls. Interestingly, silencing mPFC→AcbC projections had no effect on alcohol self-administration. In contrast, silencing IC→AcbC projections decreased alcohol self-administration, in a reinforcer-specific manner as there was no effect in rats trained to self-administer sucrose (0.8%, w/v). Additionally, no change in self-administration was observed in the mCherry-Controls. Together these data demonstrate the complex role of the cortical-striatal circuitry while implicating a role for the insula-striatal circuit in modulating ongoing alcohol self-administration. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Adenosine A2Areceptor involves in neuroinflammation-mediated cognitive decline through activating microglia under acute hypobaric hypoxia.

    Science.gov (United States)

    Chen, Peng-Zhi; He, Wen-Juan; Zhu, Zhi-Ru; E, Guo-Ji; Xu, Gang; Chen, De-Wei; Gao, Yu-Qi

    2018-03-06

    Hypobaric hypoxia (HH) at high altitudes leads to a wide range of cognitive impairments which can handicap human normal activities and performances. However, the underlying mechanism is still unclear. Adenosine A 2A receptors (A 2A Rs) of the brain are pivotal to synaptic plasticity and cognition. Besides, insult-induced up-regulation of A 2A R regulates neuroinflammation and therefore induces brain damages in various neuropathological processes. The present study was designed to determine whether A 2A R-mediate neuroinflammation involves in cognitive impairments under acute HH. A 2A R knock-out and wild-type male mice were exposed to a simulated altitude of 8000 m for 7 consecutive days in a hypobaric chamber and simultaneously received behavioral tests including Morris water maze test and open filed test. A 2A R expression, the activation of microglia and the production of TNF-α were evaluated in the hippocampus by immunohistochemistry and ELISA, respectively. Behavioral tests showed that acute HH exposure caused the dysfunction of spatial memory and mood, while genetic inactivation of A 2A R attenuated the impairment of spatial memory but not that of mood. Double-labeled immunofluorescence showed that A 2A Rs were mainly expressed on microglia and up-regulated in the hippocampus of acute HH model mice. Acute HH also induced the accumulation of microglia and increased production of TNF-α in the hippocampus, which could be markedly inhibited by A 2A R inactivation. These findings indicate that microglia-mediated neuroinflammation triggered by A 2A R activation involves in acute HH-induced spatial memory impairment and that A 2A R could be a new target for the pharmacotherapy of cognitive dysfunction at high altitudes. Copyright © 2018. Published by Elsevier B.V.

  9. Genome Editing in Neuroepithelial Stem Cells to Generate Human Neurons with High Adenosine-Releasing Capacity.

    Science.gov (United States)

    Poppe, Daniel; Doerr, Jonas; Schneider, Marion; Wilkens, Ruven; Steinbeck, Julius A; Ladewig, Julia; Tam, Allison; Paschon, David E; Gregory, Philip D; Reik, Andreas; Müller, Christa E; Koch, Philipp; Brüstle, Oliver

    2018-03-28

    As a powerful regulator of cellular homeostasis and metabolism, adenosine is involved in diverse neurological processes including pain, cognition, and memory. Altered adenosine homeostasis has also been associated with several diseases such as depression, schizophrenia, or epilepsy. Based on its protective properties, adenosine has been considered as a potential therapeutic agent for various brain disorders. Since systemic application of adenosine is hampered by serious side effects such as vasodilatation and cardiac suppression, recent studies aim at improving local delivery by depots, pumps, or cell-based applications. Here, we report on the characterization of adenosine-releasing human embryonic stem cell-derived neuroepithelial stem cells (long-term self-renewing neuroepithelial stem [lt-NES] cells) generated by zinc finger nuclease (ZFN)-mediated knockout of the adenosine kinase (ADK) gene. ADK-deficient lt-NES cells and their differentiated neuronal and astroglial progeny exhibit substantially elevated release of adenosine compared to control cells. Importantly, extensive adenosine release could be triggered by excitation of differentiated neuronal cultures, suggesting a potential activity-dependent regulation of adenosine supply. Thus, ZFN-modified neural stem cells might serve as a useful vehicle for the activity-dependent local therapeutic delivery of adenosine into the central nervous system. Stem Cells Translational Medicine 2018. © 2018 The Authors Stem Cells Translational Medicine published by Wiley Periodicals, Inc. on behalf of AlphaMed Press.

  10. Adenosine versus intravenous calcium channel antagonists for supraventricular tachycardia.

    Science.gov (United States)

    Alabed, Samer; Sabouni, Ammar; Providencia, Rui; Atallah, Edmond; Qintar, Mohammed; Chico, Timothy Ja

    2017-10-12

    People with supraventricular tachycardia (SVT) frequently are symptomatic and present to the emergency department for treatment. Although vagal manoeuvres may terminate SVT, they often fail, and subsequently adenosine or calcium channel antagonists (CCAs) are administered. Both are known to be effective, but both have a significant side effect profile. This is an update of a Cochrane review previously published in 2006. To review all randomised controlled trials (RCTs) that compare effects of adenosine versus CCAs in terminating SVT. We identified studies by searching CENTRAL, MEDLINE, Embase, and two trial registers in July 2017. We checked bibliographies of identified studies and applied no language restrictions. We planned to include all RCTs that compare adenosine versus a CCA for patients of any age presenting with SVT. We used standard methodological procedures as expected by Cochrane. Two review authors independently checked results of searches to identify relevant studies and resolved differences by discussion with a third review author. At least two review authors independently assessed each included study and extracted study data. We entered extracted data into Review Manager 5. Primary outcomes were rate of reversion to sinus rhythm and major adverse effects of adenosine and CCAs. Secondary outcomes were rate of recurrence, time to reversion, and minor adverse outcomes. We measured outcomes by calculating odds ratios (ORs) and assessed the quality of primary outcomes using the GRADE approach through the GRADEproGDT website. We identified two new studies for inclusion in the review update; the review now includes seven trials with 622 participants who presented to an emergency department with SVT. All included studies were RCTs, but only three described the randomisation process, and none had blinded participants, personnel, or outcome assessors to the intervention given. Moderate-quality evidence shows no differences in the number of people reverting to

  11. 5'-C-Ethyl-tetrazolyl-N(6)-substituted adenosine and 2-chloro-adenosine derivatives as highly potent dual acting A1 adenosine receptor agonists and A3 adenosine receptor antagonists.

    Science.gov (United States)

    Petrelli, Riccardo; Torquati, Ilaria; Kachler, Sonja; Luongo, Livio; Maione, Sabatino; Franchetti, Palmarisa; Grifantini, Mario; Novellino, Ettore; Lavecchia, Antonio; Klotz, Karl-Norbert; Cappellacci, Loredana

    2015-03-12

    A series of N(6)-substituted-5'-C-(2-ethyl-2H-tetrazol-5-yl)-adenosine and 2-chloro-adenosine derivatives was synthesized as novel, highly potent dual acting hA1AR agonists and hA3AR antagonists, potentially useful in the treatment of glaucoma and other diseases. The best affinity and selectivity profiles were achieved by N(6)-substitution with a 2-fluoro-4-chloro-phenyl- or a methyl- group. Through an in silico receptor-driven approach, the molecular bases of the hA1- and hA3AR recognition and activation of this series of 5'-C-ethyl-tetrazolyl derivatives were explained.

  12. Adenosine receptors regulate gap junction coupling of the human cerebral microvascular endothelial cells hCMEC/D3 by Ca2+influx through cyclic nucleotide-gated channels.

    Science.gov (United States)

    Bader, Almke; Bintig, Willem; Begandt, Daniela; Klett, Anne; Siller, Ina G; Gregor, Carola; Schaarschmidt, Frank; Weksler, Babette; Romero, Ignacio; Couraud, Pierre-Olivier; Hell, Stefan W; Ngezahayo, Anaclet

    2017-04-15

    Gap junction channels are essential for the formation and regulation of physiological units in tissues by allowing the lateral cell-to-cell diffusion of ions, metabolites and second messengers. Stimulation of the adenosine receptor subtype A 2B increases the gap junction coupling in the human blood-brain barrier endothelial cell line hCMEC/D3. Although the increased gap junction coupling is cAMP-dependent, neither the protein kinase A nor the exchange protein directly activated by cAMP were involved in this increase. We found that cAMP activates cyclic nucleotide-gated (CNG) channels and thereby induces a Ca 2+ influx, which leads to the increase in gap junction coupling. The report identifies CNG channels as a possible physiological link between adenosine receptors and the regulation of gap junction channels in endothelial cells of the blood-brain barrier. The human cerebral microvascular endothelial cell line hCMEC/D3 was used to characterize the physiological link between adenosine receptors and the gap junction coupling in endothelial cells of the blood-brain barrier. Expressed adenosine receptor subtypes and connexin (Cx) isoforms were identified by RT-PCR. Scrape loading/dye transfer was used to evaluate the impact of the A 2A and A 2B adenosine receptor subtype agonist 2-phenylaminoadenosine (2-PAA) on the gap junction coupling. We found that 2-PAA stimulated cAMP synthesis and enhanced gap junction coupling in a concentration-dependent manner. This enhancement was accompanied by an increase in gap junction plaques formed by Cx43. Inhibition of protein kinase A did not affect the 2-PAA-related enhancement of gap junction coupling. In contrast, the cyclic nucleotide-gated (CNG) channel inhibitor l-cis-diltiazem, as well as the chelation of intracellular Ca 2+ with BAPTA, or the absence of external Ca 2+ , suppressed the 2-PAA-related enhancement of gap junction coupling. Moreover, we observed a 2-PAA-dependent activation of CNG channels by a combination of

  13. The Effects of the Adenosine Receptor Antagonists on the Reverse of Cardiovascular Toxic Effects Induced by Citalopram In-Vivo Rat Model of Poisoning

    Directory of Open Access Journals (Sweden)

    Müjgan Büyükdeligöz

    2015-09-01

    Full Text Available Background: Citalopram is a selective serotonin reuptake inhibitor that requires routine cardiac monitoring to prevent a toxic dose. Prolongation of the QT interval has been observed in acute citalopram poisoning. Our previous experimental study showed that citalopram may be lead to QT prolongation by stimulating adenosine A1 receptors without affecting the release of adenosine. Aims: We examined the effects of adenosine receptor antagonists in reversing the cardiovascular toxic effects induced by citalopram in rats. Study Design: Animal experimentation. Methods: Rats were divided into three groups randomly (n=7 for each group. Sodium cromoglycate (20 mg/kg was administered to all rats to inhibit adenosine A3 receptor mast cell activation. Citalopram toxicity was achieved by citalopram infusion (4 mg/kg/min for 20 minutes. After citalopram infusion, in the control group (Group 1, rats were given an infusion of dextrose solution for 60 minutes. In treatment groups, the selective adenosine A1 antagonist DPCPX (Group 2, 8-cyclopentyl-1,3-dipropylxanthine, 20 μg/kg/min or the selective A2a antagonist CSC (Group 3, 8-(3-chlorostyrylcaffeine, 24 μg/kg/min was infused for 60 minutes. Mean arterial pressure (MAP, heart rate (HR, QRS duration and QT interval measurements were followed during the experiment period. Statistical analysis was performed by ANOVA followed by Tukey’s multiple comparison tests. Results: Citalopram infusion reduced MAP and HR and prolonged the QT interval. It did not cause any significant difference in QRS duration in any group. When compared to the control group, DPCPX after citalopram infusion shortened the prolongation of the QT interval after 40, 50 and 60 minutes (p<0.01. DPCPX infusion shortened the prolongation of the QT interval at 60 minutes compared with the CSC group (p<0.05. CSC infusion shortened the prolongation of the QT at 60 minutes compared with the control group (p<0.05. Conclusion: DPCPX improved QT

  14. Adenosine receptor antagonist and augmented vasodilation during hypoxic exercise.

    Science.gov (United States)

    Casey, Darren P; Madery, Brandon D; Pike, Tasha L; Eisenach, John H; Dietz, Niki M; Joyner, Michael J; Wilkins, Brad W

    2009-10-01

    We tested the hypothesis that adenosine contributes to augmented skeletal muscle vasodilation during hypoxic exercise. In separate protocols, subjects performed incremental rhythmic forearm exercise (10% and 20% of maximum) during normoxia and normocapnic hypoxia (80% arterial O2 saturation). In protocol 1 (n = 8), subjects received an intra-arterial administration of saline (control) and aminophylline (adenosine receptor antagonist). In protocol 2 (n = 10), subjects received intra-arterial phentolamine (alpha-adrenoceptor antagonist) and combined phentolamine and aminophylline administration. Forearm vascular conductance (FVC; in ml x min(-1).100 mmHg(-1)) was calculated from forearm blood flow (in ml/min) and blood pressure (in mmHg). In protocol 1, the change in FVC (DeltaFVC; change from normoxic baseline) during hypoxic exercise with saline was 172 +/- 29 and 314 +/- 34 ml x min(-1) x 100 mmHg(-1) (10% and 20%, respectively). Aminophylline administration did not affect DeltaFVC during hypoxic exercise at 10% (190 +/- 29 ml x min(-1)x100 mmHg(-1), P = 0.4) or 20% (287 +/- 48 ml x min(-1) x 100 mmHg(-1), P = 0.3). In protocol 2, DeltaFVC due to hypoxic exercise with phentolamine infusion was 313 +/- 30 and 453 +/- 41 ml x min(-1) x 100 mmHg(-1) (10% and 20% respectively). DeltaFVC was similar at 10% (352 +/- 39 ml min(-1) x 100 mmHg(-1), P = 0.8) and 20% (528 +/- 45 ml x min(-1) x 100 mmHg(-1), P = 0.2) hypoxic exercise with combined phentolamine and aminophylline. In contrast, DeltaFVC to exogenous adenosine was reduced by aminophylline administration in both protocols (P < 0.05 for both). These observations suggest that adenosine receptor activation is not obligatory for the augmented hyperemia during hypoxic exercise in humans.

  15. Synthesis of adenosine triphosphate tritiated in position 2 and 8

    International Nuclear Information System (INIS)

    Cossery, Jean-Michel

    1986-01-01

    Adenosine triphosphate or ATP is an important molecule present at the cellular level in many fundamental biochemical mechanism, and the study of its metabolism is therefore of particular interest. In this thesis for pharmacy graduation, the author first describes the different steps of synthesis and purification leading to chloride-2-ATP, a precursor of the final tritiated molecule. Then, the author explains the tritiation of this molecule to obtain an ATP tritiated in position 2 and in position 8 [fr

  16. Moonlighting adenosine deaminase: a target protein for drug development.

    Science.gov (United States)

    Cortés, Antoni; Gracia, Eduard; Moreno, Estefania; Mallol, Josefa; Lluís, Carme; Canela, Enric I; Casadó, Vicent

    2015-01-01

    Interest in adenosine deaminase (ADA) in the context of medicine has mainly focused on its enzymatic activity. This is justified by the importance of the reaction catalyzed by ADA not only for the intracellular purine metabolism, but also for the extracellular purine metabolism as well, because of its capacity as a regulator of the concentration of extracellular adenosine that is able to activate adenosine receptors (ARs). In recent years, other important roles have been described for ADA. One of these, with special relevance in immunology, is the capacity of ADA to act as a costimulator, promoting T-cell proliferation and differentiation mainly by interacting with the differentiation cluster CD26. Another role is the ability of ADA to act as an allosteric modulator of ARs. These receptors have very general physiological implications, particularly in the neurological system where they play an important role. Thus, ADA, being a single chain protein, performs more than one function, consistent with the definition of a moonlighting protein. Although ADA has never been associated with moonlighting proteins, here we consider ADA as an example of this family of multifunctional proteins. In this review, we discuss the different roles of ADA and their pathological implications. We propose a mechanism by which some of their moonlighting functions can be coordinated. We also suggest that drugs modulating ADA properties may act as modulators of the moonlighting functions of ADA, giving them additional potential medical interest. © 2014 Wiley Periodicals, Inc.

  17. The impact of adenosine pharmacologic stress combined with low-level exercise in patients undergoing myocardial perfusion imaging (BIWAKO adenosine-Ex trial)

    International Nuclear Information System (INIS)

    Monzen, Hajime; Hara, Masatake; Hirata, Makoto

    2011-01-01

    The combination of adenosine infusion with low-level exercise has become a common approach for inducing stress during stress myocardial perfusion imaging (MPI). We investigated stress MPI performed by combined low-level exercise and adenosine infusion. This combined protocol can decrease adverse reactions and reduce the effect of scattered rays from the liver. Subjects were clinically referred for a 53-min rest-stress Tc-99m Sestamibi MPI procedure using BIWAKO PROTOCOL. Ninety-eight patients (44.5%) underwent adenosine infusion with ergometer exercise testing and 122 patients (55.5%) underwent adenosine infusion without exercise testing. We evaluated the liver/heart (L/H) uptake ratio, background activity in the upper mediastinum, and adverse reactions. The L/H ratio and background activity were lower in the adenosine-exercise group than in the adenosine-non-exercise group (1.8±0.54 vs. 2.1±0.62, P<0.0056; 43.1±12.2 vs. 61.5±15.4, P<0.0001). The adenosine-exercise group had fewer adverse reactions than the adenosine-non-exercise group (11.2 vs. 19.7%). All of the adverse reactions were minor, with the exception of severe back pain in one case. The incidence of adverse reactions in our study was lower than that in previous studies for unknown reason. Adenosine infusion in combination with low-level exercise seems to result in higher-quality images and fewer adverse reactions than adenosine infusion without exercise. The combined protocol decreases adverse reactions and improves the quality of myocardial perfusion images by decreasing background activity. (author)

  18. Imaging of striatal dopamine transporters in rat brain with single pinhole SPECT and co-aligned MRI is highly reproducible

    International Nuclear Information System (INIS)

    Booij, Jan; Bruin, Kora de; Win, Maartje M.L. de; Lavini, Cristina Mphil; Heeten, Gerard J. den; Habraken, Jan

    2003-01-01

    A recently developed pinhole high-resolution SPECT system was used to measure striatal to non-specific binding ratios in rats (n = 9), after injection of the dopamine transporter ligand 123 I-FP-CIT, and to assess its test/retest reproducibility. For co-alignment purposes, the rat brain was imaged on a 1.5 Tesla clinical MRI scanner using a specially developed surface coil. The SPECT images showed clear striatal uptake. On the MR images, cerebral and extra-cerebral structures could be easily delineated. The mean striatal to non-specific [ 123 I]FP-CIT binding ratios of the test/retest studies were 1.7 ± 0.2 and 1.6 ± 0.2, respectively. The test/retest variability was approximately 9%. We conclude that the assessment of striatal [ 123 I]FP-CIT binding ratios in rats is highly reproducible

  19. Gain in Body Fat Is Associated with Increased Striatal Response to Palatable Food Cues, whereas Body Fat Stability Is Associated with Decreased Striatal Response

    Science.gov (United States)

    Yokum, Sonja

    2016-01-01

    Cross-sectional brain-imaging studies reveal that obese versus lean humans show greater responsivity of reward and attention regions to palatable food cues, but lower responsivity of reward regions to palatable food receipt. However, these individual differences in responsivity may result from a period of overeating. We conducted a repeated-measures fMRI study to test whether healthy weight adolescent humans who gained body fat over a 2 or 3 year follow-up period show an increase in responsivity of reward and attention regions to a cue signaling impending milkshake receipt and a simultaneous decrease in responsivity of reward regions to milkshake receipt versus adolescents who showed stability of or loss of body fat. Adolescents who gained body fat, who largely remained in a healthy weight range, showed increases in activation in the putamen, mid-insula, Rolandic operculum, and precuneus to a cue signaling impending milkshake receipt versus those who showed stability of or loss of body fat, though these effects were partially driven by reductions in responsivity among the latter groups. Adolescents who gained body fat reported significantly greater milkshake wanting and milkshake pleasantness ratings at follow-up compared to those who lost body fat. Adolescents who gained body fat did not show a reduction in responsivity of reward regions to milkshake receipt or changes in responsivity to receipt and anticipated receipt of monetary reward. Data suggest that initiating a prolonged period of overeating may increase striatal responsivity to food cues, and that maintaining a balance between caloric intake and expenditure may reduce striatal, insular, and Rolandic operculum responsivity. SIGNIFICANCE STATEMENT This novel, repeated-measures brain-imaging study suggests that adolescents who gained body fat over our follow-up period experienced an increase in striatal responsivity to cues for palatable foods compared to those who showed stability of or loss of body fat

  20. Does interstitial adenosine mediate acute hibernation of guinea pig myocardium?

    Science.gov (United States)

    Gao, Z P; Downey, H F; Fan, W L; Mallet, R T

    1995-06-01

    The aim was to test the role of interstitial adenosine in protective downregulation of myocardial energy demand during myocardial hibernation. Isolated working guinea pig hearts, perfused with glucose fortified Krebs-Henseleit, were subjected to 60 min global low flow ischaemia followed by 30 min reperfusion. Left ventricular performance was assessed from heart rate-developed pressure product and pressure-volume work. Cytosolic energy level was indexed by creatine phosphate and ATP phosphorylation potentials measured in snap frozen myocardium. Lactate and purine nucleosides (adenosine, inosine) were measured in venous effluent. When coronary flow was lowered by 80% for 60 min, heart rate-pressure product and pressure-volume work fell 87% and 75%, respectively, and stabilised at these low levels, but fully recovered when flow was restored. Myocardial ATP phosphorylation potential fell by 67% during the first 10 min of ischaemia, but subsequently recovered to preischaemic levels despite continuing ischaemia, indicating down-regulation of myocardial energy demand. Lactate release increased about 10-fold during ischaemia and remained increased until reperfusion. Purine nucleoside release varied reciprocally with phosphorylation potential, peaking at 10 min of ischaemia, then gradually returning to the preischaemic level during the subsequent 50 min of ischaemia. The ecto 5'-nucleotidase inhibitor alpha,beta-methylene adenosine 5'-diphosphonate (50 microM) decreased ischaemic purine nucleoside release by 41%, but did not attenuate postischaemic contractile recovery. The unspecific adenosine receptor antagonist 8-p-sulphophenyl theophylline (8-SPT, 20 microM) doubled ischaemic lactate release and lowered coronary venous purine nucleoside release by 21%. 8-SPT increased phosphorylation potential at 10 min ischaemia relative to untreated hearts, but blunted the subsequent rebound of phosphorylation potential. 8-SPT treatment during ischaemia resulted in a significantly

  1. Contraction induced secretion of VEGF from skeletal muscle cells is mediated by adenosine

    DEFF Research Database (Denmark)

    Høier, Birgitte; Olsen, Karina; Nyberg, Michael Permin

    2010-01-01

    The role of adenosine and contraction for secretion of VEGF in skeletal muscle was investigated in human subjects and rat primary skeletal muscle cells. Microdialysis probes were inserted into the thigh muscle of seven male subjects and dialysate was collected at rest, during infusion of adenosine...... and contraction caused secretion of VEGF (pcontraction induced secretion of VEGF protein was abolished by the A(2B) antagonist enprofyllin and markedly reduced by inhibition of PKA or MAPK. The results demonstrate that adenosine causes secretion of VEGF from human skeletal muscle cells...... and that the contraction induced secretion of VEGF is partially mediated via adenosine acting on A(2B) adenosine receptors. Moreover, the contraction induced secretion of VEGF protein from muscle is dependent on both PKA and MAPK activation, but only the MAPK pathway appears to be adenosine dependent....

  2. Construction of the subtracted cDNA library of striatal neurons treated with long-term morphine.

    Science.gov (United States)

    Bai, Bo; Liu, Hai-qing; Chen, Jing; Li, Ya-lin; Du, Hui; Lu, Hai; Yu, Peng-li

    2011-03-01

    To construct a morphine tolerance model in primarily cultured striatal neurons, and screen the differentially expressed genes in this model using suppression subtractive hybridization (SSH). Sbtracted cDNA libraries were constructed using SSH from normal primarily cultured striatal neurons and long-term morphine treated striatal neurons (10-5 mol/L for 72 hours). To check reliability of the cell culture model, RT-PCR was performed to detect the cAMP-responsive element-binding protein (CREB) mRNA expression. The subtracted clones were prescreened by PCR. The clones containing inserted fragments from forward libraries were sequenced and submitted to GenBank for homology analysis. And the expression levels of genes of interest were confirmed by RT-PCR. Results CREB mRNA expression showed a significant increase in morphine treated striatal neurons (62.85 ± 1.98) compared with normal striatal neurons (28.43 ± 1.46, P library of striatal neurons treated with long-term morphine is constructed. Mtch1 and Akt1 might be the candidate genes for the development of morphine tolerance.

  3. Traditional Acupuncture Triggers a Local Increase in Adenosine in Human Subjects

    OpenAIRE

    Takano, Takahiro; Chen, Xiaolin; Luo, Fang; Fujita, Takumi; Ren, Zeguang; Goldman, Nanna; Zhao, Yuanli; Markman, John D.; Nedergaard, Maiken

    2012-01-01

    Acupuncture is a form of Eastern medicine that has been practiced for centuries. Despite its long history and worldwide application, the biological mechanisms of acupuncture in relieving pain have been poorly defined. Recent studies in mice, however, demonstrate that acupuncture triggers increases in interstitial adenosine, which reduces the severity of chronic pain through adenosine A1 receptors, suggesting that adenosine-mediated antinociception contributes to the clinical benefits of acupu...

  4. Molecular Vibration-Activity Relationship in the Agonism of Adenosine Receptors

    OpenAIRE

    Chee, Hyun Keun; Oh, S. June

    2013-01-01

    The molecular vibration-activity relationship in the receptor-ligand interaction of adenosine receptors was investigated by structure similarity, molecular vibration, and hierarchical clustering in a dataset of 46 ligands of adenosine receptors. The resulting dendrogram was compared with those of another kind of fingerprint or descriptor. The dendrogram result produced by corralled intensity of molecular vibrational frequency outperformed four other analyses in the current study of adenosine ...

  5. Populations of striatal medium spiny neurons encode vibrotactile frequency in rats: modulation by slow wave oscillations.

    Science.gov (United States)

    Hawking, Thomas G; Gerdjikov, Todor V

    2013-01-01

    Dorsolateral striatum (DLS) is implicated in tactile perception and receives strong projections from somatosensory cortex. However, the sensory representations encoded by striatal projection neurons are not well understood. Here we characterized the contribution of DLS to the encoding of vibrotactile information in rats by assessing striatal responses to precise frequency stimuli delivered to a single vibrissa. We applied stimuli in a frequency range (45-90 Hz) that evokes discriminable percepts and carries most of the power of vibrissa vibration elicited by a range of complex fine textures. Both medium spiny neurons and evoked potentials showed tactile responses that were modulated by slow wave oscillations. Furthermore, medium spiny neuron population responses represented stimulus frequency on par with previously reported behavioral benchmarks. Our results suggest that striatum encodes frequency information of vibrotactile stimuli which is dynamically modulated by ongoing brain state.

  6. Striatal μ-opioid receptor availability predicts cold pressor pain threshold in healthy human subjects

    DEFF Research Database (Denmark)

    Hagelberg, Nora; Aalto, Sargo; Tuominen, Lauri

    2012-01-01

    the potential associations between μ-opioid receptor BP(ND) and psychophysical measures. The results show that striatal μ-opioid receptor BP(ND) predicts cold pressor pain threshold, but not cold pressor pain tolerance or tactile sensitivity. This finding suggests that striatal μ-opioid receptor density......Previous PET studies in healthy humans have shown that brain μ-opioid receptor activation during experimental pain is associated with reductions in the sensory and affective ratings of the individual pain experience. The aim of this study was to find out whether brain μ-opioid receptor binding...... at the resting state, in absence of painful stimulation, can be a long-term predictor of experimental pain sensitivity. We measured μ-opioid receptor binding potential (BP(ND)) with μ-opioid receptor selective radiotracer [(11)C]carfentanil and positron emission tomography (PET) in 12 healthy male subjects...

  7. Overeating Behavior and Striatal Dopamine with 6-[18F]-Fluoro-L--Tyrosine PET

    Directory of Open Access Journals (Sweden)

    Claire E. Wilcox

    2010-01-01

    Full Text Available Eating behavior may be affected by dopamine synthesis capacity. In this study, 6-[18F]-fluoro-L--tyrosine (FMT positron emission tomography (PET uptake in striatal subregions was correlated with BMI (kg/m2 and an estimate of the frequency of prior weight loss attempts in 15 healthy subjects. BMI was negatively correlated with FMT uptake in the dorsal caudate. Although the association between BMI and FMT uptake in the dorsal caudate was not significant upon correction for age and sex, the association fell within the range of a statistical trend. Weight loss attempts divided by years trying was also negatively correlated with FMT uptake in the dorsal putamen (=.05. These results suggest an association between low dorsal striatal presynaptic dopamine synthesis capacity and overeating behavior.

  8. Effects of the modern food environment on striatal function, cognition and regulation of ingestive behavior.

    Science.gov (United States)

    Burke, Mary V; Small, Dana M

    2016-06-01

    Emerging evidence from human and animal studies suggest that consumption of palatable foods rich in fat and/or carbohydrates may produce deleterious influences on brain function independently of body weight or metabolic disease. Here we consider two mechanisms by which diet can impact striatal circuits to amplify food cue reactivity and impair inhibitory control. First, we review findings demonstrating that the energetic properties of foods regulate nucleus accumbens food cue reactivity, a demonstrated predictor of weight gain susceptibility, which is then sensitized by chronic consumption of an energy dense diet. Second, we consider evidence for diet-induced adaptations in dorsal striatal dopamine signaling that is associated with impaired inhibitory control and negative outcome learning.

  9. Prolonged striatal disinhibition as a chronic animal model of tic disorders.

    Science.gov (United States)

    Vinner, Esther; Israelashvili, Michal; Bar-Gad, Izhar

    2017-12-01

    Experimental findings and theoretical models have associated Tourette syndrome with abnormal striatal inhibition. The expression of tics, the hallmark symptom of this disorder, has been transiently induced in non-human primates and rodents by the injection of GABA A antagonists into the striatum, leading to temporary disinhibition. The novel chronic model of tic expression utilizes mini-osmotic pumps implanted subcutaneously in the rat's back for prolonged infusion of bicuculline into the dorsolateral striatum. Tics were expressed on the contralateral side to the infusion over a period of multiple days. Tic expression was stable, and maintained similar properties throughout the infusion period. Electrophysiological recordings revealed the existence of tic-related local field potential spikes and individual neuron activity changes that remained stable throughout the infusion period. The striatal disinhibition model provides a unique combination of face validity (tic expression) and construct validity (abnormal striatal inhibition) but is limited to sub-hour periods. The new chronic model extends the period of tic expression to multiple days and thus enables the study of tic dynamics and the effects of behavior and pharmacological agents on tic expression. The chronic model provides similar behavioral and neuronal correlates of tics as the acute striatal disinhibition model but over prolonged periods of time, thus providing a unique, basal ganglia initiated model of tic expression. Chronic expression of symptoms is the key to studying the time varying properties of Tourette syndrome and the effects of multiple internal and external factors on this disorder. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Chronic exposure to dopamine agonists affects the integrity of striatal D2 receptors in Parkinson's patients

    Directory of Open Access Journals (Sweden)

    Marios Politis

    2017-01-01

    Full Text Available We aimed to investigate the integrity and clinical relevance of striatal dopamine receptor type-2 (D2R availability in Parkinson's disease (PD patients. We studied 68 PD patients, spanning from early to advanced disease stages, and 12 healthy controls. All participants received one [11C]raclopride PET scan in an OFF medication condition for quantification of striatal D2R availability in vivo. Parametric images of [11C]raclopride non-displaceable binding potential were generated from the dynamic [11C]raclopride scans using implementation of the simplified reference tissue model with cerebellum as the reference tissue. PET data were interrogated for correlations with clinical data related to disease burden and dopaminergic treatment. PD patients showed a mean 16.7% decrease in caudate D2R and a mean 3.5% increase in putaminal D2R availability compared to healthy controls. Lower caudate [11C]raclopride BPND correlated with longer PD duration. PD patients on dopamine agonist treatment had 9.2% reduced D2R availability in the caudate and 12.8% in the putamen compared to PD patients who never received treatment with dopamine agonists. Higher amounts of lifetime dopamine agonist therapy correlated with reduced D2Rs availability in both caudate and putamen. No associations between striatal D2R availability and levodopa treatment and dyskinesias were found. In advancing PD the caudate and putamen D2R availability are differentially affected. Chronic exposure to treatment with dopamine agonists, but no levodopa, suppresses striatal D2R availability, which may have relevance to output signaling to frontal lobes and the occurrence of executive deficits, but not dyskinesias.

  11. Basal ganglia disorders associated with imbalances in the striatal striosome and matrix compartments

    Directory of Open Access Journals (Sweden)

    Jill R. Crittenden

    2011-09-01

    Full Text Available The striatum is composed principally of GABAergic, medium spiny projection neurons (MSNs that can be categorized based on their gene expression, electrophysiological profiles and input-output circuits. Major subdivisions of MSN populations include 1 those in ventromedial and dorsolateral striatal regions, 2 those giving rise to the direct and indirect pathways, and 3 those that lie in the striosome and matrix compartments. The first two classificatory schemes have enabled advances in understanding of how basal ganglia circuits contribute to disease. However, despite the large number of molecules that are differentially expressed in the striosomes or the extra-striosomal matrix, and the evidence that these compartments have different input-output connections, our understanding of how this compartmentalization contributes to striatal function is still not clear. A broad view is that the matrix contains the direct and indirect pathway MSNs that form parts of sensorimotor and associative circuits, whereas striosomes contain MSNs that receive input from parts of limbic cortex and project directly or indirectly to the dopamine-containing neurons of the substantia nigra, pars compacta. Striosomes are widely distributed within the striatum and are thought to exert global, as well as local, influences on striatal processing by exchanging information with the surrounding matrix, including through interneurons that send processes into both compartments. It has been suggested that striosomes exert and maintain limbic control over behaviors driven by surrounding sensorimotor and associative parts of the striatal matrix. Consistent with this possibility, imbalances between striosome and matrix functions have been reported in relation to neurological disorders, including Huntington’s disease, L-DOPA-induced dyskinesias, dystonia and drug addiction. Here, we consider how signaling imbalances between the striosomes and matrix might relate to symptomatology in

  12. Distinct roles for direct and indirect pathway striatal neurons in reinforcement.

    Science.gov (United States)

    Kravitz, Alexxai V; Tye, Lynne D; Kreitzer, Anatol C

    2012-06-01

    Dopamine signaling is implicated in reinforcement learning, but the neural substrates targeted by dopamine are poorly understood. We bypassed dopamine signaling itself and tested how optogenetic activation of dopamine D1 or D2 receptor–expressing striatal projection neurons influenced reinforcement learning in mice. Stimulating D1 receptor–expressing neurons induced persistent reinforcement, whereas stimulating D2 receptor–expressing neurons induced transient punishment, indicating that activation of these circuits is sufficient to modify the probability of performing future actions.

  13. Quinolinic acid induces disrupts cytoskeletal homeostasis in striatal neurons. Protective role of astrocyte-neuron interaction.

    Science.gov (United States)

    Pierozan, Paula; Ferreira, Fernanda; de Lima, Bárbara Ortiz; Pessoa-Pureur, Regina

    2015-02-01

    Quinolinic acid (QUIN) is an endogenous metabolite of the kynurenine pathway involved in several neurological disorders. Among the several mechanisms involved in QUIN-mediated toxicity, disruption of the cytoskeleton has been demonstrated in striatally injected rats and in striatal slices. The present work searched for the actions of QUIN in primary striatal neurons. Neurons exposed to 10 µM QUIN presented hyperphosphorylated neurofilament (NF) subunits (NFL, NFM, and NFH). Hyperphosphorylation was abrogated in the presence of protein kinase A and protein kinase C inhibitors H89 (20 μM) and staurosporine (10 nM), respectively, as well as by specific antagonists to N-methyl-D-aspartate (50 µM DL-AP5) and metabotropic glutamate receptor 1 (100 µM MPEP). Also, intra- and extracellular Ca(2+) chelators (10 µM BAPTA-AM and 1 mM EGTA, respectively) and Ca(2+) influx through L-type voltage-dependent Ca(2+) channel (10 µM verapamil) are implicated in QUIN-mediated effects. Cells immunostained for the neuronal markers βIII-tubulin and microtubule-associated protein 2 showed altered neurite/neuron ratios and neurite outgrowth. NF hyperphosphorylation and morphological alterations were totally prevented by conditioned medium from QUIN-treated astrocytes. Cocultured astrocytes and neurons interacted with one another reciprocally, protecting them against QUIN injury. Cocultured cells preserved their cytoskeletal organization and cell morphology together with unaltered activity of the phosphorylating system associated with the cytoskeleton. This article describes cytoskeletal disruption as one of the most relevant actions of QUIN toxicity in striatal neurons in culture with soluble factors secreted by astrocytes, with neuron-astrocyte interaction playing a role in neuroprotection. © 2014 Wiley Periodicals, Inc.

  14. The hippocampal-striatal circuit for goal-directed and habitual choice

    OpenAIRE

    Chersi, Fabian

    2014-01-01

    It is now widely accepted that one of the roles of the hippocampus is to maintain episodic spatial representations, while parallel striatal pathways contribute to both declarative and procedural value computations by encoding different input-specific outcome predictions. In this paper we investigate the use of these brain mechanisms for action selection, linking them to model-based and model-free controllers for decision making. To this aim we propose a biologically inspired computational mod...

  15. Ventral striatal dopamine synthesis capacity predicts financial extravagance in Parkinson’s Disease

    Directory of Open Access Journals (Sweden)

    Andrew David Lawrence

    2013-02-01

    Full Text Available Impulse control disorders (ICDs, including disordered gambling, can occur in a significant number of patients with Parkinson’s disease (PD receiving dopaminergic therapy. The neurobiology underlying susceptibility to such problems is unclear, but risk likely results from an interaction between dopaminergic medication and a pre-existing trait vulnerability. Impulse control and addictive disorders form part of a broader psychopathological spectrum of disorders, which share a common underlying genetic vulnerability, referred to as externalizing. The broad externalizing risk factor is a continuously varying trait reflecting vulnerability to various impulse control problems, manifested at the overt level by disinhibitory symptoms and at the personality level by antecedent traits such as impulsivity and novelty/sensation seeking. Trait ‘disinhibition’ is thus a core endophenotype of ICDs, and a key target for neurobiological investigation. The ventral striatal dopamine system has been hypothesized to underlie individual variation in behavioural disinhibition. Here, we examined whether individual differences in ventral striatal dopamine synthesis capacity predicted individual variation in disinhibitory temperament traits in individuals with PD. Eighteen early-stage male PD patients underwent 6-[18F]Fluoro-L-DOPA (FDOPA positron emission tomography (PET scanning to measure striatal dopamine synthesis capacity, and completed a measure of disinhibited personality. Consistent with our predictions, we found that levels of ventral, but not dorsal, striatal dopamine synthesis capacity predicted disinhibited personality, particularly a propensity for financial extravagance. Our results are consistent with recent preclinical models of vulnerability to behavioural disinhibition and addiction proneness, and provide novel insights into the neurobiology of potential vulnerability to impulse control problems in PD and other disorders.

  16. Liquid computing on and off the edge of chaos with a striatal microcircuit

    Directory of Open Access Journals (Sweden)

    Carlos eToledo-Suárez

    2014-11-01

    Full Text Available In reinforcement learning theories of the basal ganglia, there is a need for the expected rewards corresponding to relevant environmental states to be maintained and modified during the learning process. However, the representation of these states that allows them to be associated with reward expectations remains unclear. Previous studies have tended to rely on pre-defined partitioning of states encoded by disjunct neuronal groups or sparse topological drives. A more likely scenario is that striatal neurons are involved in the encoding of multiple different states through their spike patterns, and that an appropriate partitioning of an environment is learned on the basis of task constraints, thus minimizing the number of states involved in solving a particular task. Here we show that striatal activity is sufficient to implement a liquid state, an important prerequisite for such a computation, whereby transient patterns of striatal activity are mapped onto the relevant states. We develop a simple small scale model of the striatum which can reproduce key features of the experimentally observed activity of the major cell types of the striatum. We then use the activity of this network as input for the supervised training of four simple linear readouts to learn three different functions on a plane, where the network is stimulated with the spike coded position of the agent. We discover that the network configuration that best reproduces striatal activity statistics lies on the edge of chaos and has good performance on all three tasks, but that in general, the edge of chaosis a poor predictor of network performance.

  17. The Fast Spiking Subpopulation of Striatal Neurons Coding for Temporal Cognition of Movements

    Directory of Open Access Journals (Sweden)

    Bo Shen

    2017-12-01

    Full Text Available Background: Timing dysfunctions occur in a number of neurological and psychiatric disorders such as Parkinson’s disease, obsessive-compulsive disorder, autism and attention-deficit-hyperactivity disorder. Several lines of evidence show that disrupted timing processing is involved in specific fronto-striatal abnormalities. The striatum encodes reinforcement learning and procedural motion, and consequently is required to represent temporal information precisely, which then guides actions in proper sequence. Previous studies highlighted the temporal scaling property of timing-relevant striatal neurons; however, it is still unknown how this is accomplished over short temporal latencies, such as the sub-seconds to seconds range.Methods: We designed a task with a series of timing behaviors that required rats to reproduce a fixed duration with robust action. Using chronic multichannel electrode arrays, we recorded neural activity from dorso-medial striatum in 4 rats performing the task and identified modulation response of each neuron to different events. Cell type classification was performed according to a multi-criteria clustering analysis.Results: Dorso-medial striatal neurons (n = 557 were recorded, of which 113 single units were considered as timing-relevant neurons, especially the fast-spiking subpopulation that had trial–to–trial ramping up or ramping down firing modulation during the time estimation period. Furthermore, these timing-relevant striatal neurons had to calibrate the spread of their firing pattern by rewarded experience to express the timing behavior accurately.Conclusion: Our data suggests that the dynamic activities of timing-relevant units encode information about the current duration and recent outcomes, which is needed to predict and drive the following action. These results reveal the potential mechanism of time calibration in a short temporal resolution, which may help to explain the neural basis of motor coordination

  18. DISC1 and striatal volume: a potential risk phenotype for mental illness

    Directory of Open Access Journals (Sweden)

    M. Mallar eChakravarty

    2012-06-01

    Full Text Available Disrupted-in-schizophrenia 1 was originally discovered in a large Scottish family with abnormally high rates of severe mental illness, including schizophrenia, bipolar disorder, and depression. An accumulating body of evidence from genetic, postmortem, and animal data supports a role for DISC1 in different forms of mental illness. DISC1 may play an important role in determining structure and function of several brain regions. One brain region of particular importance for several mental disorders is the striatum, and DISC1 mutant mice have demonstrated an increase in dopamine (D2 receptors in this structure. However, association between DISC1 functional polymorphisms and striatal structure have not been examined in humans to our knowledge. We, therefore hypothesized that there would be a relationship between human striatal volume and DISC1 genotype, specifically in the Leu607Phe (rs6675281 and Ser704Cys (rs821618 single nucleotide polymorphisms. We tested our hypothesis by automatically identifying the striatum in fifty-four healthy volunteers recruited for this study. We also performed an exploratory analysis of cortical thickness, cortical surface area, and structure volume. Our results demonstrate that Phe allele carriers have larger striatal volume bilaterally (left striatum: p=0.017; right striatum: p=0.016. From the exploratory analyses we found that Phe carriers also had larger right hemisphere volumes and right occipital lobe surface area (p=0.014 compared to LeuLeu homozygotes (p=0.0074. However, these exploratory findings do not survive a conservative correction for multiple comparisons. Our findings demonstrate that a functional DISC1 variant influences striatal volumes. Taken together with animal data that this gene influences D2 receptor levels in striatum, a key risk pathway for mental illnesses such as schizophrenia and bipolar disorder may be conferred via DISC1’s effects on the striatum .

  19. A direct ROI quantification method for inherent PVE correction: accuracy assessment in striatal SPECT measurements

    Energy Technology Data Exchange (ETDEWEB)

    Vanzi, Eleonora; De Cristofaro, Maria T.; Sotgia, Barbara; Mascalchi, Mario; Formiconi, Andreas R. [University of Florence, Clinical Pathophysiology, Florence (Italy); Ramat, Silvia [University of Florence, Neurological and Psychiatric Sciences, Florence (Italy)

    2007-09-15

    The clinical potential of striatal imaging with dopamine transporter (DAT) SPECT tracers is hampered by the limited capability to recover activity concentration ratios due to partial volume effects (PVE). We evaluated the accuracy of a least squares method that allows retrieval of activity in regions of interest directly from projections (LS-ROI). An Alderson striatal phantom was filled with striatal to background ratios of 6:1, 9:1 and 28:1; the striatal and background ROIs were drawn on a coregistered X-ray CT of the phantom. The activity ratios of these ROIs were derived both with the LS-ROI method and with conventional SPECT EM reconstruction (EM-SPECT). Moreover, the two methods were compared in seven patients with motor symptoms who were examined with N-3-fluoropropyl-2-{beta}-carboxymethoxy-3-{beta}-(4-iodophenyl) (FP-CIT) SPECT, calculating the binding potential (BP). In the phantom study, the activity ratios obtained with EM-SPECT were 3.5, 5.3 and 17.0, respectively, whereas the LS-ROI method resulted in ratios of 6.2, 9.0 and 27.3, respectively. With the LS-ROI method, the BP in the seven patients was approximately 60% higher than with EM-SPECT; a linear correlation between the LS-ROI and the EM estimates was found (r = 0.98, p = 0.03). The LS-ROI PVE correction capability is mainly due to the fact that the ill-conditioning of the LS-ROI approach is lower than that of the EM-SPECT one. The LS-ROI seems to be feasible and accurate in the examination of the dopaminergic system. This approach can be fruitful in monitoring of disease progression and in clinical trials of dopaminergic drugs. (orig.)

  20. Cortico-striatal spike-timing dependent plasticity after activation of subcortical pathways

    Directory of Open Access Journals (Sweden)

    Jan M Schulz

    2010-07-01

    Full Text Available Cortico-striatal spike-timing dependent plasticity (STDP is modulated by dopamine in vitro. The present study investigated STDP in vivo using alternative procedures for modulating dopaminergic inputs. Postsynaptic potentials (PSP were evoked in intracellularly recorded spiny neurons by electrical stimulation of the contralateral motor cortex. PSPs often consisted of up to three distinct components, likely representing distinct cortico-striatal pathways. After baseline recording, bicuculline (BIC was ejected into the superior colliculus (SC to disinhibit visual pathways to the dopamine cells and striatum. Repetitive cortical stimulation (~60; 0.2 Hz was then paired with postsynaptic spike discharge induced by an intracellular current pulse, with each pairing followed 250 ms later by a light flash to the contralateral eye (n=13. Changes in PSPs, measured as the maximal slope normalised to 5 min pre, ranged from potentiation (~120% to depression (~80%. The determining factor was the relative timing between PSP components and spike: PSP components coinciding or closely following the spike tended towards potentiation, whereas PSP components preceding the spike were depressed. Importantly, STDP was only seen in experiments with successful BIC-mediated disinhibition (n=10. Cortico-striatal high-frequency stimulation (50 pulses at 100 Hz followed 100 ms later by a light flash did not induce more robust synaptic plasticity (n=9. However, an elevated post-light spike rate correlated with depression across plasticity protocols (R2=0.55, p=0.009, n=11 active neurons. These results confirm that the direction of cortico-striatal plasticity is determined by the timing of pre- and postsynaptic activity and that synaptic modification is dependent on the activation of additional subcortical inputs.

  1. Striatal connectivity changes following gambling wins and near-misses: Associations with gambling severity

    Directory of Open Access Journals (Sweden)

    Ruth J. van Holst

    2014-01-01

    These findings corroborate the ‘non-categorical’ nature of reward processing in gambling: near-misses and full-misses are objectively identical outcomes that are processed differentially. Ventral striatal connectivity with the insula correlated positively with gambling severity in the illusion of control contrast, which could be a risk factor for the cognitive distortions and loss-chasing that are characteristic of problem gambling.

  2. Striatal activation by optogenetics induces dyskinesias in the 6-hydroxydopamine rat model of Parkinson disease.

    Science.gov (United States)

    F Hernández, Ledia; Castela, Ivan; Ruiz-DeDiego, Irene; Obeso, Jose A; Moratalla, Rosario

    2017-04-01

    Long-term levodopa (l-dopa) treatment is associated with the development of l-dopa-induced dyskinesias in the majority of patients with Parkinson disease (PD). The etiopathogonesis and mechanisms underlying l-dopa-induced dyskinesias are not well understood. We used striatal optogenetic stimulation to induce dyskinesias in a hemiparkinsonian model of PD in rats. Striatal dopamine depletion was induced unilaterally by 6-hydroxydopamine injection into the medial forebrain bundle. For the optogenetic manipulation, we injected adeno-associated virus particles expressing channelrhodopsin to stimulate striatal medium spiny neurons with a laser source. Simultaneous optical activation of medium spiny neurons of the direct and indirect striatal pathways in the 6-hydroxydopamine lesion but l-dopa naïve rats induced involuntary movements similar to l-dopa-induced dyskinesias, labeled here as optodyskinesias. Noticeably, optodyskinesias were facilitated by l-dopa in animals that did not respond initially to the laser stimulation. In general, optodyskinesias lasted while the laser stimulus was applied, but in some instances remained ongoing for a few seconds after the laser was off. Postmortem tissue analysis revealed increased FosB expression, a molecular marker of l-dopa-induced dyskinesias, primarily in medium spiny neurons of the direct pathway in the dopamine-depleted hemisphere. Selective optogenetic activation of the dorsolateral striatum elicits dyskinesias in the 6-hydroxydopamine rat model of PD. This effect was associated with a preferential activation of the direct striato-nigral pathway. These results potentially open new avenues in the understanding of mechanisms involved in l-dopa-induced dyskinesias. © 2017 International Parkinson and Movement Disorder Society. © 2017 International Parkinson and Movement Disorder Society.

  3. Increased TRPC5 glutathionylation contributes to striatal neuron loss in Huntington's disease.

    Science.gov (United States)

    Hong, Chansik; Seo, Hyemyung; Kwak, Misun; Jeon, Jeha; Jang, Jihoon; Jeong, Eui Man; Myeong, Jongyun; Hwang, Yu Jin; Ha, Kotdaji; Kang, Min Jueng; Lee, Kyu Pil; Yi, Eugene C; Kim, In-Gyu; Jeon, Ju-Hong; Ryu, Hoon; So, Insuk

    2015-10-01

    Aberrant glutathione or Ca(2+) homeostasis due to oxidative stress is associated with the pathogenesis of neurodegenerative disorders. The Ca(2+)-permeable transient receptor potential cation (TRPC) channel is predominantly expressed in the brain, which is sensitive to oxidative stress. However, the role of the TRPC channel in neurodegeneration is not known. Here, we report a mechanism of TRPC5 activation by oxidants and the effect of glutathionylated TRPC5 on striatal neurons in Huntington's disease. Intracellular oxidized glutathione leads to TRPC5 activation via TRPC5 S-glutathionylation at Cys176/Cys178 residues. The oxidized glutathione-activated TRPC5-like current results in a sustained increase in cytosolic Ca(2+), activated calmodulin-dependent protein kinase and the calpain-caspase pathway, ultimately inducing striatal neuronal cell death. We observed an abnormal glutathione pool indicative of an oxidized state in the striatum of Huntington's disease transgenic (YAC128) mice. Increased levels of endogenous TRPC5 S-glutathionylation were observed in the striatum in both transgenic mice and patients with Huntington's disease. Both knockdown and inhibition of TRPC5 significantly attenuated oxidation-induced striatal neuronal cell death. Moreover, a TRPC5 blocker improved rearing behaviour in Huntington's disease transgenic mice and motor behavioural symptoms in littermate control mice by increasing striatal neuron survival. Notably, low levels of TRPC1 increased the formation of TRPC5 homotetramer, a highly Ca(2+)-permeable channel, and stimulated Ca(2+)-dependent apoptosis in Huntington's disease cells (STHdh(Q111/111)). Taken together, these novel findings indicate that increased TRPC5 S-glutathionylation by oxidative stress and decreased TRPC1 expression contribute to neuronal damage in the striatum and may underlie neurodegeneration in Huntington's disease. © The Author (2015). Published by Oxford University Press on behalf of the Guarantors of Brain

  4. Increased TRPC5 glutathionylation contributes to striatal neuron loss in Huntington’s disease

    Science.gov (United States)

    Hong, Chansik; Seo, Hyemyung; Kwak, Misun; Jeon, Jeha; Jang, Jihoon; Jeong, Eui Man; Myeong, Jongyun; Hwang, Yu Jin; Ha, Kotdaji; Kang, Min Jueng; Lee, Kyu Pil; Yi, Eugene C.; Kim, In-Gyu; Jeon, Ju-Hong

    2015-01-01

    Aberrant glutathione or Ca2+ homeostasis due to oxidative stress is associated with the pathogenesis of neurodegenerative disorders. The Ca2+-permeable transient receptor potential cation (TRPC) channel is predominantly expressed in the brain, which is sensitive to oxidative stress. However, the role of the TRPC channel in neurodegeneration is not known. Here, we report a mechanism of TRPC5 activation by oxidants and the effect of glutathionylated TRPC5 on striatal neurons in Huntington’s disease. Intracellular oxidized glutathione leads to TRPC5 activation via TRPC5 S-glutathionylation at Cys176/Cys178 residues. The oxidized glutathione-activated TRPC5-like current results in a sustained increase in cytosolic Ca2+, activated calmodulin-dependent protein kinase and the calpain-caspase pathway, ultimately inducing striatal neuronal cell death. We observed an abnormal glutathione pool indicative of an oxidized state in the striatum of Huntington’s disease transgenic (YAC128) mice. Increased levels of endogenous TRPC5 S-glutathionylation were observed in the striatum in both transgenic mice and patients with Huntington’s disease. Both knockdown and inhibition of TRPC5 significantly attenuated oxidation-induced striatal neuronal cell death. Moreover, a TRPC5 blocker improved rearing behaviour in Huntington’s disease transgenic mice and motor behavioural symptoms in littermate control mice by increasing striatal neuron survival. Notably, low levels of TRPC1 increased the formation of TRPC5 homotetramer, a highly Ca2+-permeable channel, and stimulated Ca2+-dependent apoptosis in Huntington’s disease cells (STHdhQ111/111). Taken together, these novel findings indicate that increased TRPC5 S-glutathionylation by oxidative stress and decreased TRPC1 expression contribute to neuronal damage in the striatum and may underlie neurodegeneration in Huntington’s disease. PMID:26133660

  5. Alterations in Striatal Synaptic Transmission are Consistent across Genetic Mouse Models of Huntington's Disease

    Directory of Open Access Journals (Sweden)

    Damian M Cummings

    2010-05-01

    Full Text Available Since the identification of the gene responsible for HD (Huntington's disease, many genetic mouse models have been generated. Each employs a unique approach for delivery of the mutated gene and has a different CAG repeat length and background strain. The resultant diversity in the genetic context and phenotypes of these models has led to extensive debate regarding the relevance of each model to the human disorder. Here, we compare and contrast the striatal synaptic phenotypes of two models of HD, namely the YAC128 mouse, which carries the full-length huntingtin gene on a yeast artificial chromosome, and the CAG140 KI*** (knock-in mouse, which carries a human/mouse chimaeric gene that is expressed in the context of the mouse genome, with our previously published data obtained from the R6/2 mouse, which is transgenic for exon 1 mutant huntingtin. We show that striatal MSNs (medium-sized spiny neurons in YAC128 and CAG140 KI mice have similar electrophysiological phenotypes to that of the R6/2 mouse. These include a progressive increase in membrane input resistance, a reduction in membrane capacitance, a lower frequency of spontaneous excitatory postsynaptic currents and a greater frequency of spontaneous inhibitory postsynaptic currents in a subpopulation of striatal neurons. Thus, despite differences in the context of the inserted gene between these three models of HD, the primary electrophysiological changes observed in striatal MSNs are consistent. The outcomes suggest that the changes are due to the expression of mutant huntingtin and such alterations can be extended to the human condition.

  6. Concomitant Appearance of Pisa Syndrome and Striatal Hand in Parkinson’s Disease

    Directory of Open Access Journals (Sweden)

    Sanjay Pandey

    2011-10-01

    Full Text Available Pisa syndrome is (PS usually seen in patients receiving antipsychotic drugs and characterised by lateral flexion of trunk and axial dystonia. It is believed that antipsychotic drugs lead to dopamine blockage causing PS. We describe a Parkinson’s disease patient who was doing well with levodopa/carbidopa for 3 years and developed lateral flexion of trunk. His abnormal posture used to completely improve upon lying down position. He also had striatal hand deformity suggestive of focal dystonia.

  7. Molecular vibration-activity relationship in the agonism of adenosine receptors.

    Science.gov (United States)

    Chee, Hyun Keun; Oh, S June

    2013-12-01

    The molecular vibration-activity relationship in the receptor-ligand interaction of adenosine receptors was investigated by structure similarity, molecular vibration, and hierarchical clustering in a dataset of 46 ligands of adenosine receptors. The resulting dendrogram was compared with those of another kind of fingerprint or descriptor. The dendrogram result produced by corralled intensity of molecular vibrational frequency outperformed four other analyses in the current study of adenosine receptor agonism and antagonism. The tree that was produced by clustering analysis of molecular vibration patterns showed its potential for the functional classification of adenosine receptor ligands.

  8. Molecular Vibration-Activity Relationship in the Agonism of Adenosine Receptors

    Directory of Open Access Journals (Sweden)

    Hyun Keun Chee

    2013-12-01

    Full Text Available The molecular vibration-activity relationship in the receptor-ligand interaction of adenosine receptors was investigated by structure similarity, molecular vibration, and hierarchical clustering in a dataset of 46 ligands of adenosine receptors. The resulting dendrogram was compared with those of another kind of fingerprint or descriptor. The dendrogram result produced by corralled intensity of molecular vibrational frequency outperformed four other analyses in the current study of adenosine receptor agonism and antagonism. The tree that was produced by clustering analysis of molecular vibration patterns showed its potential for the functional classification of adenosine receptor ligands.

  9. Contribution of fronto-striatal regions to emotional valence and repetition under cognitive conflict.

    Science.gov (United States)

    Chun, Ji-Won; Park, Hae-Jeong; Kim, Dai Jin; Kim, Eosu; Kim, Jae-Jin

    2017-07-01

    Conflict processing mediated by fronto-striatal regions may be influenced by emotional properties of stimuli. This study aimed to examine the effects of emotion repetition on cognitive control in a conflict-provoking situation. Twenty-one healthy subjects were scanned using functional magnetic resonance imaging while performing a sequential cognitive conflict task composed of emotional stimuli. The regional effects were analyzed according to the repetition or non-repetition of cognitive congruency and emotional valence between the preceding and current trials. Post-incongruence interference in error rate and reaction time was significantly smaller than post-congruence interference, particularly under repeated positive and non-repeated positive, respectively, and post-incongruence interference, compared to post-congruence interference, increased activity in the ACC, DLPFC, and striatum. ACC and DLPFC activities were significantly correlated with error rate or reaction time in some conditions, and fronto-striatal connections were related to the conflict processing heightened by negative emotion. These findings suggest that the repetition of emotional stimuli adaptively regulates cognitive control and the fronto-striatal circuit may engage in the conflict adaptation process induced by emotion repetition. Both repetition enhancement and repetition suppression of prefrontal activity may underlie the relationship between emotion and conflict adaptation. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Reduced amygdala and ventral striatal activity to happy faces in PTSD is associated with emotional numbing.

    Directory of Open Access Journals (Sweden)

    Kim L Felmingham

    Full Text Available There has been a growing recognition of the importance of reward processing in PTSD, yet little is known of the underlying neural networks. This study tested the predictions that (1 individuals with PTSD would display reduced responses to happy facial expressions in ventral striatal reward networks, and (2 that this reduction would be associated with emotional numbing symptoms. 23 treatment-seeking patients with Posttraumatic Stress Disorder were recruited from the treatment clinic at the Centre for Traumatic Stress Studies, Westmead Hospital, and 20 trauma-exposed controls were recruited from a community sample. We examined functional magnetic resonance imaging responses during the presentation of happy and neutral facial expressions in a passive viewing task. PTSD participants rated happy facial expression as less intense than trauma-exposed controls. Relative to controls, PTSD participants revealed lower activation to happy (-neutral faces in ventral striatum and and a trend for reduced activation in left amygdala. A significant negative correlation was found between emotional numbing symptoms in PTSD and right ventral striatal regions after controlling for depression, anxiety and PTSD severity. This study provides initial evidence that individuals with PTSD have lower reactivity to happy facial expressions, and that lower activation in ventral striatal-limbic reward networks may be associated with symptoms of emotional numbing.

  11. Reduced striatal dopamine D2/3 receptor availability in Body Dysmorphic Disorder.

    Science.gov (United States)

    Vulink, Nienke C; Planting, Robin S; Figee, Martijn; Booij, Jan; Denys, Damiaan

    2016-02-01

    Though the dopaminergic system is implicated in Obsessive Compulsive and Related Disorders (OCRD), the dopaminergic system has never been investigated in-vivo in Body Dysmorphic Disorder (BDD). In line with consistent findings of reduced striatal dopamine D2/3 receptor availability in Obsessive Compulsive Disorder (OCD), we hypothesized that the dopamine D2/3 receptor availability in the striatum will be lower in patients with BDD in comparison to healthy subjects. Striatal dopamine D2/3 receptor Binding Potential (BPND) was examined in 12 drug-free BDD patients and 12 control subjects pairwise matched by age, sex, and handedness using [(123)I]iodobenzamide Single Photon Emission Computed Tomography (SPECT; bolus/constant infusion technique). Regions of interest were the caudate nucleus and the putamen. BPND was calculated as the ratio of specific striatal to binding in the occipital cortex (representing nonspecific binding). Compared to controls, dopamine D2/3 receptor BPND was significantly lower in BDD, both in the putamen (p=0.017) and caudate nucleus (p=0.022). This study provides the first evidence of a disturbed dopaminergic system in BDD patients. Although previously BDD was classified as a separate disorder (somatoform disorder), our findings give pathophysiological support for the recent reclassification of BDD to the OCRD in DSM-5. Copyright © 2015 Elsevier B.V. and ECNP. All rights reserved.

  12. Beyond Neuronal Activity Markers: Select Immediate Early Genes in Striatal Neuron Subtypes Functionally Mediate Psychostimulant Addiction

    Directory of Open Access Journals (Sweden)

    Ramesh Chandra

    2017-06-01

    Full Text Available Immediate early genes (IEGs were traditionally used as markers of neuronal activity in striatum in response to stimuli including drugs of abuse such as psychostimulants. Early studies using these neuronal activity markers led to important insights in striatal neuron subtype responsiveness to psychostimulants. Such studies have helped identify striatum as a critical brain center for motivational, reinforcement and habitual behaviors in psychostimulant addiction. While the use of IEGs as neuronal activity markers in response to psychostimulants and other stimuli persists today, the functional role and implications of these IEGs has often been neglected. Nonetheless, there is a subset of research that investigates the functional role of IEGs in molecular, cellular and behavioral alterations by psychostimulants through striatal medium spiny neuron (MSN subtypes, the two projection neuron subtypes in striatum. This review article will address and highlight the studies that provide a functional mechanism by which IEGs mediate psychostimulant molecular, cellular and behavioral plasticity through MSN subtypes. Insight into the functional role of IEGs in striatal MSN subtypes could provide improved understanding into addiction and neuropsychiatric diseases affecting striatum, such as affective disorders and compulsive disorders characterized by dysfunctional motivation and habitual behavior.

  13. Dermatoglyphic asymmetries and fronto-striatal dysfunction in young-adults reporting non-clinical psychosis

    Science.gov (United States)

    Mittal, Vijay A.; Dean, Derek J.; Pelletier, Andrea

    2012-01-01

    Objective Growing evidence indicates that non-clinical psychotic-like experiences occur in otherwise healthy individuals, suggesting that psychosis may occur on a continuum. However, little is know about how the diathesis for formal psychosis maps on to individuals at the non-clinical side of this continuum. Our current understanding of the pathophysiology of schizophrenia implicates certain key factors such as early developmental abnormalities and fronto-striatal dysfunction. To date, no studies have examined these core factors in the context of non-clinical psychosis. Method A total of 221 young adults were assessed for distressing attenuated positive symptoms (DAPS), dermatoglyphic asymmetries (a marker of early developmental insult), and procedural memory (a proxy for fronto-striatal function). Results Participants reporting DAPS (n=16; 7.2%) and no-DAPS (n=205; 92.7%) were split into two groups. The DAPS group showed significantly elevated depression, elevated dermatoglyphic asymmetries, and a pattern of procedural learning consistent with other studies with formally psychotic patients. Conclusion The results indicate that the non-clinical side of the psychosis continuum also shares key vulnerability factors implicated in schizophrenia, suggesting that both early developmental disruption and abnormalities in fronto-striatal function are core aspects underlying the disorder. PMID:22519833

  14. Dermatoglyphic asymmetries and fronto-striatal dysfunction in young adults reporting non-clinical psychosis.

    Science.gov (United States)

    Mittal, V A; Dean, D J; Pelletier, A

    2012-10-01

    Growing evidence indicates that non-clinical psychotic-like experiences occur in otherwise healthy individuals, suggesting that psychosis may occur on a continuum. However, little is known about how the diathesis for formal psychosis maps on to individuals at the non-clinical side of this continuum. Our current understanding of the pathophysiology of schizophrenia implicates certain key factors such as early developmental abnormalities and fronto-striatal dysfunction. To date, no studies have examined these core factors in the context of non-clinical psychosis. A total of 221 young adults were assessed for distressing attenuated positive symptoms (DAPS), dermatoglyphic asymmetries (a marker of early developmental insult), and procedural memory (a proxy for fronto-striatal function). Participants reporting DAPS (n = 16; 7.2%) and no-DAPS (n = 205; 92.7%) were split into two groups. The DAPS group showed significantly elevated depression, elevated dermatoglyphic asymmetries, and a pattern of procedural learning consistent with other studies with formally psychotic patients. The results indicate that the non-clinical side of the psychosis continuum also shares key vulnerability factors implicated in schizophrenia, suggesting that both early developmental disruption and abnormalities in fronto-striatal function are core aspects underlying the disorder. © 2012 John Wiley & Sons A/S.

  15. A negative relationship between ventral striatal loss anticipation response and impulsivity in borderline personality disorder.

    Science.gov (United States)

    Herbort, Maike C; Soch, Joram; Wüstenberg, Torsten; Krauel, Kerstin; Pujara, Maia; Koenigs, Michael; Gallinat, Jürgen; Walter, Henrik; Roepke, Stefan; Schott, Björn H

    2016-01-01

    Patients with borderline personality disorder (BPD) frequently exhibit impulsive behavior, and self-reported impulsivity is typically higher in BPD patients when compared to healthy controls. Previous functional neuroimaging studies have suggested a link between impulsivity, the ventral striatal response to reward anticipation, and prediction errors. Here we investigated the striatal neural response to monetary gain and loss anticipation and their relationship with impulsivity in 21 female BPD patients and 23 age-matched female healthy controls using functional magnetic resonance imaging (fMRI). Participants performed a delayed monetary incentive task in which three categories of objects predicted a potential gain, loss, or neutral outcome. Impulsivity was assessed using the Barratt Impulsiveness Scale (BIS-11). Compared to healthy controls, BPD patients exhibited significantly reduced fMRI responses of the ventral striatum/nucleus accumbens (VS/NAcc) to both reward-predicting and loss-predicting cues. BIS-11 scores showed a significant positive correlation with the VS/NAcc reward anticipation responses in healthy controls, and this correlation, while also nominally positive, failed to reach significance in BPD patients. BPD patients, on the other hand, exhibited a significantly negative correlation between ventral striatal loss anticipation responses and BIS-11 scores, whereas this correlation was significantly positive in healthy controls. Our results suggest that patients with BPD show attenuated anticipation responses in the VS/NAcc and, furthermore, that higher impulsivity in BPD patients might be related to impaired prediction of aversive outcomes.

  16. Disrupted functional connectivity of striatal sub-regions in Bell's palsy patients

    Directory of Open Access Journals (Sweden)

    Wenwen Song

    2017-01-01

    Full Text Available The striatum plays an important role in controlling motor function in humans, and its degeneration has the ability to cause severe motor disorders. More specifically, previous studies have demonstrated a disruption in the connectivity of the cortico-striatal loop in patients suffering from motor disorders caused by dopamine dysregulation, such as Parkinson's disease. However, little is known about striatal functional connectivity in patients with motor dysfunction not caused by dopamine dysregulation. In this study, we used early-state Bell's palsy (BP patients (within 14 days of onset to investigate how functional connectivity between the striatum and motor cortex is affected by peripheral nerve injury in which the dopamine system remains fully functional. We found a significant increase in the connectivity between the contralateral putamen, and the ipsilateral primary sensory (S1 and motor cortex (M1 in BP patients compared to healthy controls. We also found increased connectivity between the ventral striatum and supplementary motor area (SMA, and the dorsal caudate and medial prefrontal lobe in BP patients compared to healthy controls. Our results demonstrate that the entirety of the striatum is affected following acute peripheral nerve injury, and suggests that this disrupted striatal functional connectivity may reflect a compensatory mechanism for the sensory-motor mismatch caused by BP.

  17. Rapid eye movement sleep behaviour disorder and striatal dopamine depletion in patients with Parkinson's disease.

    Science.gov (United States)

    Chung, S J; Lee, Y; Lee, J J; Lee, P H; Sohn, Y H

    2017-10-01

    Rapid eye movement sleep behaviour disorder (RBD) is related to striatal dopamine depletion. This study was performed to confirm whether clinically probable RBD (cpRBD) in patients with Parkinson's disease (PD) is associated with a specific pattern of striatal dopamine depletion. A prospective survey was conducted using the RBD Screening Questionnaire (RBDSQ) in 122 patients with PD who had undergone dopamine transporter (DAT) positron emission tomography scan. Patients with cpRBD (RBDSQ ≥ 7) exhibited greater motor deficits, predominantly in the less-affected side and axial symptoms, and were prescribed higher levodopa-equivalent doses at follow-up than those without cpRBD (RBDSQ ≤ 4), despite their similar disease and treatment durations. Compared to patients without cpRBD, those with cpRBD showed lower DAT activities in the putamen, particularly in the less-affected side in all putaminal subregions, and a tendency to be lower in the ventral striatum. In addition, greater motor deficits in patients with cpRBD than in those without cpRBD remained significant after controlling for DAT binding in the putamen and other confounding variables. These results demonstrated that the presence of RBD in patients with PD is associated with different patterns of both motor deficit distribution and striatal DAT depletion, suggesting that the presence of RBD represents a distinct PD subtype with a malignant motor parkinsonism. © 2017 EAN.

  18. Tamoxifen counteracts estradiol induced effects on striatal and hypophyseal dopamine receptors

    International Nuclear Information System (INIS)

    Ferretti, C.; Blengio, M.; Ghi, P.; Racca, S.; Genazzani, E.; Portaleone, P.

    1988-01-01

    We investigated the ability of Tamoxifen (TAM), an antiestrogen drug, to counteract the modification induced by estrogens on dopamine (DA) receptors on striatum and on adenohypophysis of ovex female rats. Subacute treatment with 17β-estradiol (E 2 ) at both low (0.1 μg/kg) and high (20 μg/kg) doses confirmed its ability to increase the number of striatal 3 H-Spiperone ( 3 H-SPI) binding sites in a dose dependent manner. By contrast in the pituitary, only high doses of estrogen were effective in reducing the number of DA receptors. We treated ovex female rats for 15 days with TAM alone or associated with E 2 , to see if these estrogenic effects could be suppressed by an antiestrogenic drug. TAM did not affect the number of striatal DA receptors, but significantly increased the adenohypophy-seal DA binding sites, without varying their affinity. No changes were observed in pituitary and striatal DA receptor density, even when TAM was injected in association with estradiol. In conclusions: TAM is able to counteract the effects estrogens have on DA receptors. However there is some evidence that it could influence the pituitary DA systems independently of it antiestrogenic activity

  19. Tamoxifen counteracts estradiol induced effects on striatal and hypophyseal dopamine receptors

    Energy Technology Data Exchange (ETDEWEB)

    Ferretti, C.; Blengio, M.; Ghi, P.; Racca, S.; Genazzani, E.; Portaleone, P.

    1988-01-01

    We investigated the ability of Tamoxifen (TAM), an antiestrogen drug, to counteract the modification induced by estrogens on dopamine (DA) receptors on striatum and on adenohypophysis of ovex female rats. Subacute treatment with 17..beta..-estradiol (E/sub 2/) at both low (0.1 ..mu..g/kg) and high (20 ..mu..g/kg) doses confirmed its ability to increase the number of striatal /sup 3/H-Spiperone (/sup 3/H-SPI) binding sites in a dose dependent manner. By contrast in the pituitary, only high doses of estrogen were effective in reducing the number of DA receptors. We treated ovex female rats for 15 days with TAM alone or associated with E/sub 2/, to see if these estrogenic effects could be suppressed by an antiestrogenic drug. TAM did not affect the number of striatal DA receptors, but significantly increased the adenohypophy-seal DA binding sites, without varying their affinity. No changes were observed in pituitary and striatal DA receptor density, even when TAM was injected in association with estradiol. In conclusions: TAM is able to counteract the effects estrogens have on DA receptors. However there is some evidence that it could influence the pituitary DA systems independently of it antiestrogenic activity.

  20. Postural & striatal deformities in Parkinson`s disease: Are these rare?

    Directory of Open Access Journals (Sweden)

    Sanjay Pandey

    2016-01-01

    Full Text Available Parkinson`s disease (PD is the most common neurodegenerative disease and is characterized by tremor, rigidity and akinesia. Diagnosis is clinical in the majority of the patients. Patients with PD may have stooped posture but some of them develop different types of postural and striatal deformities. Usually these deformities are more common in atypical parkinsonian disorders such as progressive supranuclear palsy and multisystem atrophy. But in many studies it has been highlighted that these may also be present in approximately one third of PD patients leading to severe disability. These include antecollis or dropped head, camptocormia, p0 isa syndrome, scoliosis, striatal hands and striatal toes. The pathogenesis of these deformities is a complex combination of central and peripheral influences such as rigidity, dystonia and degenerative skeletal changes. Duration of parkinsonism symptoms is an important risk factor and in majority of the patients these deformities are seen in advanced statge of the disease. The patients with such symptoms may initially respond to dopaminergic medications but if not intervened they may become fixed and difficult to treat. Pain and restriction of movement are most common clinical manifestations and these may mimick symptoms of musculoskeletal disorders like rheumatoid arthritis. Early diagnosis is important as the patients may respond to adjustment in dopaminergic medications. Recent advances such as deep brain stimulation (DBS and ultrasound guided botulinum toxin injection are helpful in management of these deformities in patients with PD.

  1. Striatal dopamine D2/3 receptor availability in treatment resistant depression.

    Directory of Open Access Journals (Sweden)

    Bart P de Kwaasteniet

    Full Text Available Several studies demonstrated improvement of depressive symptoms in treatment resistant depression (TRD after administering dopamine agonists which suggest abnormal dopaminergic neurotransmission in TRD. However, the role of dopaminergic signaling through measurement of striatal dopamine D(2/3 receptor (D2/3R binding has not been investigated in TRD subjects. We used [(123I]IBZM single photon emission computed tomography (SPECT to investigate striatal D2/3R binding in TRD. We included 6 severe TRD patients, 11 severe TRD patients on antipsychotics (TRD AP group and 15 matched healthy controls. Results showed no significant difference (p = 0.75 in striatal D2/3R availability was found between TRD patients and healthy controls. In the TRD AP group D2/3R availability was significantly decreased (reflecting occupancy of D2/3Rs by antipsychotics relative to TRD patients and healthy controls (p<0.001 but there were no differences in clinical symptoms between TRD AP and TRD patients. This preliminary study therefore does not provide evidence for large differences in D2/3 availability in severe TRD patients and suggests this TRD subgroup is not characterized by altered dopaminergic transmission. Atypical antipsychotics appear to have no clinical benefit in severe TRD patients who remain depressed, despite their strong occupancy of D2/3Rs.

  2. In Vitro Manganese Exposure Disrupts MAPK Signaling Pathways in Striatal and Hippocampal Slices from Immature Rats

    Directory of Open Access Journals (Sweden)

    Tanara Vieira Peres

    2013-01-01

    Full Text Available The molecular mechanisms mediating manganese (Mn-induced neurotoxicity, particularly in the immature central nervous system, have yet to be completely understood. In this study, we investigated whether mitogen-activated protein kinases (MAPKs and tyrosine hydroxylase (TH could represent potential targets of Mn in striatal and hippocampal slices obtained from immature rats (14 days old. The aim of this study was to evaluate if the MAPK pathways are modulated after subtoxic Mn exposure, which do not significantly affect cell viability. The concentrations of manganese chloride (MnCl2; 10–1,000 μM caused no change in cell viability in slices exposed for 3 or 6 hours. However, Mn exposure significantly increased extracellular signal-regulated kinase (ERK 1/2, as well as c-Jun N-terminal kinase (JNK 1/2/3 phosphorylation at both 3 and 6 hours incubations, in both brain structures. Furthermore, Mn exposure did not change the total content or phosphorylation of TH at the serine 40 site in striatal slices. Thus, Mn at concentrations that do not disrupt cell viability causes activation of MAPKs (ERK1/2 and JNK1/2/3 in immature hippocampal and striatal slices. These findings suggest that altered intracellular MAPKs signaling pathways may represent an early event concerning the effects of Mn in the immature brain.

  3. A negative relationship between ventral striatal loss anticipation response and impulsivity in borderline personality disorder

    Directory of Open Access Journals (Sweden)

    Maike C. Herbort

    2016-01-01

    Full Text Available Patients with borderline personality disorder (BPD frequently exhibit impulsive behavior, and self-reported impulsivity is typically higher in BPD patients when compared to healthy controls. Previous functional neuroimaging studies have suggested a link between impulsivity, the ventral striatal response to reward anticipation, and prediction errors. Here we investigated the striatal neural response to monetary gain and loss anticipation and their relationship with impulsivity in 21 female BPD patients and 23 age-matched female healthy controls using functional magnetic resonance imaging (fMRI. Participants performed a delayed monetary incentive task in which three categories of objects predicted a potential gain, loss, or neutral outcome. Impulsivity was assessed using the Barratt Impulsiveness Scale (BIS-11. Compared to healthy controls, BPD patients exhibited significantly reduced fMRI responses of the ventral striatum/nucleus accumbens (VS/NAcc to both reward-predicting and loss-predicting cues. BIS-11 scores showed a significant positive correlation with the VS/NAcc reward anticipation responses in healthy controls, and this correlation, while also nominally positive, failed to reach significance in BPD patients. BPD patients, on the other hand, exhibited a significantly negative correlation between ventral striatal loss anticipation responses and BIS-11 scores, whereas this correlation was significantly positive in healthy controls. Our results suggest that patients with BPD show attenuated anticipation responses in the VS/NAcc and, furthermore, that higher impulsivity in BPD patients might be related to impaired prediction of aversive outcomes.

  4. Phasic Dopamine Modifies Sensory-Driven Output of Striatal Neurons through Synaptic Plasticity.

    Science.gov (United States)

    Wieland, Sebastian; Schindler, Sebastian; Huber, Cathrin; Köhr, Georg; Oswald, Manfred J; Kelsch, Wolfgang

    2015-07-08

    Animals are facing a complex sensory world in which only few stimuli are relevant to guide behavior. Value has to be assigned to relevant stimuli such as odors to select them over concurring information. Phasic dopamine is involved in the value assignment to stimuli in the ventral striatum. The underlying cellular mechanisms are incompletely understood. In striatal projection neurons of the ventral striatum in adult mice, we therefore examined the features and dynamics of phasic dopamine-induced synaptic plasticity and how this plasticity may modify the striatal output. Phasic dopamine is predicted to tag inputs that occur in temporal proximity. Indeed, we observed D1 receptor-dependent synaptic potentiation only when odor-like bursts and optogenetically evoked phasic dopamine release were paired within a time window of synaptic potentiation persisted after the phasic dopamine signal had ceased, but gradually reversed when odor-like bursts continued to be presented. The synaptic plasticity depended on the sensory input rate and was input specific. Importantly, synaptic plasticity amplified the firing response to a given olfactory input as the dendritic integration and the firing threshold remained unchanged during synaptic potentiation. Thus, phasic dopamine-induced synaptic plasticity can change information transfer through dynamic increases of the output of striatal projection neurons to specific sensory inputs. This plasticity may provide a neural substrate for dynamic value assignment in the striatum. Copyright © 2015 the authors 0270-6474/15/359946-11$15.00/0.

  5. The 22G>A polymorphism in the adenosine deaminase gene impairs catalytic function but does not affect reactive hyperaemia in humans in vivo.

    NARCIS (Netherlands)

    Riksen, N.P.; Franke, B.; Broek, P. van den; Naber, M.; Smits, P.; Rongen, G.A.P.J.M.

    2008-01-01

    OBJECTIVES: During ischaemia, the extracellular concentration of the endogenous nucleoside adenosine increases rapidly. Subsequent adenosine receptor stimulation induces various effects, including vasodilation, which can protect the tissue against the ischaemic insult. Adenosine deaminase (ADA) is

  6. A simple algorithm for subregional striatal uptake analysis with partial volume correction in dopaminergic PET imaging

    International Nuclear Information System (INIS)

    Lue Kunhan; Lin Hsinhon; Chuang Kehshih; Kao Chihhao, K.; Hsieh Hungjen; Liu Shuhsin

    2014-01-01

    In positron emission tomography (PET) of the dopaminergic system, quantitative measurements of nigrostriatal dopamine function are useful for differential diagnosis. A subregional analysis of striatal uptake enables the diagnostic performance to be more powerful. However, the partial volume effect (PVE) induces an underestimation of the true radioactivity concentration in small structures. This work proposes a simple algorithm for subregional analysis of striatal uptake with partial volume correction (PVC) in dopaminergic PET imaging. The PVC algorithm analyzes the separate striatal subregions and takes into account the PVE based on the recovery coefficient (RC). The RC is defined as the ratio of the PVE-uncorrected to PVE-corrected radioactivity concentration, and is derived from a combination of the traditional volume of interest (VOI) analysis and the large VOI technique. The clinical studies, comprising 11 patients with Parkinson's disease (PD) and 6 healthy subjects, were used to assess the impact of PVC on the quantitative measurements. Simulations on a numerical phantom that mimicked realistic healthy and neurodegenerative situations were used to evaluate the performance of the proposed PVC algorithm. In both the clinical and the simulation studies, the striatal-to-occipital ratio (SOR) values for the entire striatum and its subregions were calculated with and without PVC. In the clinical studies, the SOR values in each structure (caudate, anterior putamen, posterior putamen, putamen, and striatum) were significantly higher by using PVC in contrast to those without. Among the PD patients, the SOR values in each structure and quantitative disease severity ratings were shown to be significantly related only when PVC was used. For the simulation studies, the average absolute percentage error of the SOR estimates before and after PVC were 22.74% and 1.54% in the healthy situation, respectively; those in the neurodegenerative situation were 20.69% and 2

  7. Is there a relation between novelty seeking, striatal dopamine release and frontal cortical thickness?

    Directory of Open Access Journals (Sweden)

    Natalia Jaworska

    Full Text Available Novelty-seeking (NS and impulsive personality traits have been proposed to reflect an interplay between fronto-cortical and limbic systems, including the limbic striatum (LS. Although neuroimaging studies have provided some evidence for this, most are comprised of small samples and many report surprisingly large effects given the challenges of trying to relate a snapshot of brain function or structure to an entity as complex as personality. The current work tested a priori hypotheses about associations between striatal dopamine (DA release, cortical thickness (CT, and NS in a large sample of healthy adults.Fifty-two healthy adults (45M/7F; age: 23.8±4.93 underwent two positron emission tomography scans with [11C]raclopride (specific for striatal DA D2/3 receptors with or without amphetamine (0.3 mg/kg, p.o.. Structural magnetic resonance image scans were acquired, as were Tridimensional Personality Questionnaire data. Amphetamine-induced changes in [11C]raclopride binding potential values (ΔBPND were examined in the limbic, sensorimotor (SMS and associative (AST striatum. CT measures, adjusted for whole brain volume, were extracted from the dorsolateral sensorimotor and ventromedial/limbic cortices.BPND values were lower in the amphetamine vs. no-drug sessions, with the largest effect in the LS. When comparing low vs. high LS ΔBPND groups (median split, higher NS2 (impulsiveness scores were found in the high ΔBPND group. Partial correlations (age and gender as covariates yielded a negative relation between ASTS ΔBPND and sensorimotor CT; trends for inverse associations existed between ΔBPND values in other striatal regions and frontal CT. In other words, the greater the amphetamine-induced striatal DA response, the thinner the frontal cortex.These data expand upon previously reported associations between striatal DA release in the LS and both NS related impulsiveness and CT in the largest sample reported to date. The findings add to the

  8. Dopamine D(1) receptor-mediated control of striatal acetylcholine release by endogenous dopamine.

    Science.gov (United States)

    Acquas, E; Di Chiara, G

    1999-10-27

    The role of dopamine D(1) and D(2) receptors in the control of acetylcholine release in the dorsal striatum by endogenous dopamine was investigated by monitoring with microdialysis the effect of the separate or combined administration of the dopamine D(1) receptor antagonist, SCH 39166 ¿(-)-trans-6,7,7a,8,9, 13b-exahydro-3-chloro-2-hydroxy-N-methyl-5H-benzo-[d]-nap hto-[2, 1b]-azepine hydrochloride¿ (50 microg/kg subcutaneous (s.c.)), of the dopamine D(2)/D(3) receptor agonist, quinpirole (trans-(-)-4aR, 4a,5,6,7,8,8a,9-octahydro-5-propyl-1H-pyrazolo-(3,4-g)-quinoline hydrochloride) (5 and 10 microg/kg s.c.), and of the D(3) receptor selective agonist, PD 128,907 [S(+)-(4aR,10bR)-3,4,4a, 10b-tetrahydro-4-propyl-2H,5H-[1]benzopyrano-[4,3-b]-1,4-oxazin -9-ol hydrochloride] (50 microg/kg s.c.), on in vivo dopamine and acetylcholine release. Microdialysis was performed with a Ringer containing low concentrations (0.01 microM) of the acetylcholinesterase inhibitor, neostigmine. Quinpirole (10 microg/kg s.c.) decreased striatal dopamine and acetylcholine release. Administration of PD 128,907 (50 microg/kg) decreased dopamine but failed to affect acetylcholine release. SCH 39166 (50 microg/kg s.c.) stimulated dopamine release and reduced acetylcholine release. Pretreatment with quinpirole reduced (5 microg/kg s.c.) or completely prevented (10 microg/kg s.c.) the stimulation of dopamine release elicited by SCH 39166 (50 microg/kg s.c.); on the other hand, pretreatment with quinpirole (5 and 10 microg/kg) potentiated the reduction of striatal acetylcholine release induced by SCH 39166 (50 microg/kg s.c.). Similarly, pretreatment with PD 128,907 (50 microg/kg) which prevented the increase of dopamine release induced by SCH 39166 (50 microg/kg), potentiated the reduction of striatal acetylcholine transmission elicited by SCH 39166. Thus, pretreatment with low doses of quinpirole or PD 128,907 influences in opposite manner the effect of SCH 39166 on striatal dopamine and

  9. A Population of Indirect Pathway Striatal Projection Neurons Is Selectively Entrained to Parkinsonian Beta Oscillations.

    Science.gov (United States)

    Sharott, Andrew; Vinciati, Federica; Nakamura, Kouichi C; Magill, Peter J

    2017-10-11

    Classical schemes of basal ganglia organization posit that parkinsonian movement difficulties presenting after striatal dopamine depletion stem from the disproportionate firing rates of spiny projection neurons (SPNs) therein. There remains, however, a pressing need to elucidate striatal SPN firing in the context of the synchronized network oscillations that are abnormally exaggerated in cortical-basal ganglia circuits in parkinsonism. To address this, we recorded unit activities in the dorsal striatum of dopamine-intact and dopamine-depleted rats during two brain states, respectively defined by cortical slow-wave activity (SWA) and activation. Dopamine depletion escalated striatal net output but had contrasting effects on "direct pathway" SPNs (dSPNs) and "indirect pathway" SPNs (iSPNs); their firing rates became imbalanced, and they disparately engaged in network oscillations. Disturbed striatal activity dynamics relating to the slow (∼1 Hz) oscillations prevalent during SWA partly generalized to the exaggerated beta-frequency (15-30 Hz) oscillations arising during cortical activation. In both cases, SPNs exhibited higher incidences of phase-locked firing to ongoing cortical oscillations, and SPN ensembles showed higher levels of rhythmic correlated firing, after dopamine depletion. Importantly, in dopamine-depleted striatum, a widespread population of iSPNs, which often displayed excessive firing rates and aberrant phase-locked firing to cortical beta oscillations, preferentially and excessively synchronized their firing at beta frequencies. Conversely, dSPNs were neither hyperactive nor synchronized to a large extent during cortical activation. These data collectively demonstrate a cell type-selective entrainment of SPN firing to parkinsonian beta oscillations. We conclude that a population of overactive, excessively synchronized iSPNs could orchestrate these pathological rhythms in basal ganglia circuits. SIGNIFICANCE STATEMENT Chronic depletion of dopamine

  10. Striatal hypometabolism in premanifest and manifest Huntington's disease patients

    Energy Technology Data Exchange (ETDEWEB)

    Lopez-Mora, Diego Alfonso; Camacho, Valle; Fernandez, Alejandro; Montes, Alberto; Carrio, Ignasi [Autonomous University of Barcelona, Nuclear Medicine Department, Hospital Sant Pau, Barcelona (Spain); Perez-Perez, Jesus; Martinez-Horta, Sauel; Kulisevsky, Jaime [Autonomous University of Barcelona, Movement Disorders Unit, Neurology Department, Hospital Sant Pau, Barcelona (Spain); Sampedro, Frederic [University of Barcelona, Barcelona (Spain); Lozano-Martinez, Gloria Andrea; Gomez-Anson, Beatriz [Autonomous University of Barcelona, Neuroradiology, Radiology Department, Hospital Sant Pau, Barcelona (Spain)

    2016-11-15

    To assess metabolic changes in cerebral {sup 18}F-FDG PET/CT in premanifest and manifest Huntington's disease (HD) subjects compared to a control group and to correlate {sup 18}F-FDG uptake patterns with different disease stages. Thirty-three gene-expanded carriers (Eight males; mean age: 43 y/o; CAG > 39) were prospectively included. Based on the Unified Huntington's Disease Rating Scale Total Motor Score and the Total Functional Capacity, subjects were classified as premanifest (preHD = 15) and manifest (mHD = 18). Estimated time disease-onset was calculated using the Langbehn formula, which allowed classifying preHD as far-to (preHD-A) and close-to (PreHD-B) disease-onset. Eighteen properly matched participants were included as a control group (CG). All subjects underwent brain {sup 18}F-FDG PET/CT and MRI. {sup 18}F-FDG PET/CT were initially assessed by two nuclear medicine physicians identifying qualitative metabolic changes in the striatum. Quantitative analysis was performed using SPM8 with gray matter atrophy correction using the BPM toolbox. Visual analysis showed a marked striatal hypometabolism in mHD. A normal striatal distribution of {sup 18}F-FDG uptake was observed for most of the preHD subjects. Quantitative analysis showed a significant striatal hypometabolism in mHD subjects compared to CG (p < 0.001 uncorrected, k = 50 voxels). In both preHD groups we observed a significant striatal hypometabolism with respect to CG (p < 0.001 uncorrected, k = 50 voxels). In mHD subjects we observed a significant striatal hypometabolism with respect to both preHD groups (p < 0.001 uncorrected, k = 50 voxels). {sup 18}F-FDG PET/CT might be a helpful tool to identify patterns of glucose metabolism in the striatum across the stages of HD and might be relevant in assessing the clinical status of gene-expanded HD carriers due to the fact that dysfunctional glucose metabolism begins at early preHD stages of the disease. {sup 18}F-FDG PET/CT appears as a

  11. Adenosine and extracellular volume in radiocontrast media-induced nephropathy.

    Science.gov (United States)

    Erley, C M; Heyne, N; Rossmeier, S; Vogel, T; Risler, T; Osswald, H

    1998-09-01

    Renal hemodynamic changes could play a key role in radiocontrast media-induced nephropathy (RCIN), although the pathophysiological mechanisms are unclear. We investigated the role of adenosine in RCIN caused by sodium diatrizoate (Urografin, 3 ml/kg) in nitro-L-Arg methyl ester (L-NAME)-hypertensive rats in different hydration states [eight weeks of L-NAME (50 mg/liter) in drinking water; high or low sodium intake for the last two weeks]. In clearance experiments under thiobutabarbital anesthesia in these previously mentioned animals, glomerular filtration rate (GFR), renal blood flow (RBF), and mean arterial pressure (MAP) were measured in the presence or absence of the adenosine A1-receptor antagonist 8-cyclopropyl-1,3-dipropylxanthine (DPCPX, 100 microg/kg bolus plus 10 microg/kg/hr). DPCPX or pretreatment did not change control hemodynamics. Contrast medium caused GFR and RBF to fall significantly in volume-depleted rats (from 0.29 +/- 0.02 to 0.21 +/- 0.02 ml/min/100 g and 5.4 +/- 0.3 to 4.0 +/- 0.4 ml/min, respectively) without change in MAP. In volume-expanded rats, changes were not significant (0.25 +/- 0.01 to 0.24 +/- 0.02 ml/min/100 g and 5.6 +/- 0.3 to 5.3 +/- 0.4 ml/min, respectively). In the volume-depleted rats, changes were prevented by DPCPX (0.27 +/- 0.02 to 0.24 +/- 0.02 ml/min/100 g and 4.8 +/- 0.1 to 5.0 +/- 0.1 ml/min, respectively). The acute hemodynamic effects elicited by contrast medium in L-NAME hypertensive rats thus can be prevented by volume expansion. Adenosine, via A1-receptors, contributes to the adverse effects of contrast media.

  12. Adenosine Inhibits the Excitatory Synaptic Inputs to Basal Forebrain Cholinergic, GABAergic and Parvalbumin Neurons in mice

    Directory of Open Access Journals (Sweden)

    Chun eYang

    2013-06-01

    Full Text Available Coffee and tea contain the stimulants caffeine and theophylline. These compounds act as antagonists of adenosine receptors. Adenosine promotes sleep and its extracellular concentration rises in association with prolonged wakefulness, particularly in the basal forebrain (BF region involved in activating the cerebral cortex. However, the effect of adenosine on identified BF neurons, especially non-cholinergic neurons, is incompletely understood. Here we used whole-cell patch-clamp recordings in mouse brain slices prepared from two validated transgenic mouse lines with fluorescent proteins expressed in GABAergic or parvalbumin (PV neurons to determine the effect of adenosine. Whole-cell recordings were made BF cholinergic neurons and from BF GABAergic & PV neurons with the size (>20 µm and intrinsic membrane properties (prominent H-currents corresponding to cortically projecting neurons. A brief (2 min bath application of adenosine (100 μM decreased the frequency but not the amplitude of spontaneous excitatory postsynaptic currents in all groups of BF cholinergic, GABAergic and PV neurons we recorded. In addition, adenosine decreased the frequency of miniature EPSCs in BF cholinergic neurons. Adenosine had no effect on the frequency of spontaneous inhibitory postsynaptic currents in cholinergic neurons or GABAergic neurons with large H-currents but reduced them in a group of GABAergic neurons with smaller H-currents. All effects of adenosine were blocked by a selective, adenosine A1 receptor antagonist, cyclopentyltheophylline (CPT, 1 μM. Adenosine had no postsynaptic effects. Taken together, our work suggests that adenosine promotes sleep by an A1-receptor mediated inhibition of glutamatergic inputs to cortically-projecting cholinergic and GABA/PV neurons. Conversely, caffeine and theophylline promote attentive wakefulness by inhibiting these A1 receptors in BF thereby promoting the high-frequency oscillations in the cortex required for

  13. Activation of A2aR attenuates bleomycin-induced pulmonary fibrosis via the SDF-1/CXCR4 axis-related pathway.

    Science.gov (United States)

    Chen, Yanfan; Yu, Xiaoming; He, Yicheng; Zhang, Lin; Huang, Xiaoying; Xu, Xiaomei; Chen, Mayun; Chen, Xiang; Wang, Liangxing

    2017-01-01

    Previous studies in our lab have demonstrated that Adenosine A2a receptor (A 2a R) gene-knockout mice were vulnerable to pulmonary fibrosis induced by bleomycin (BLM). Inhibition of the SDF-1/CXCR4 axis has been reported to protect the lungs from fibrogenesis in BLM-exposed mice. Little is yet known about the relationships between A 2a R and the SDF-1/CXCR4 axis in idiopathic pulmonary fibrosis (IPF). This study probes the role of A 2a R in the fibrotic process and explores the relationship between A 2a R and the SDF-1/CXCR4 axis in BLM-induced pulmonary fibrosis in mice. In the study, A 2a R-/- and A 2a R+/+ BALB/c mice were exposed to BLM by intratracheal instillation, and CGS-21680 (CGS), an A 2a R agonist, was administered daily for 28 days to the A 2a R+/+ mice in the BLM-induced fibrosis group. Activation of A 2a R produced an anti-fibrotic effect as indicated by the evaluations of the lung architecture, microstructure and ultrastructure. The quantitative analysis indicated that treatment with CGS significantly reduced the collagen content in lungs. To explore the potential mechanisms, the expression levels of A 2a R, SDF-1, and CXCR4 were subsequently determined using ELISA, in situ hybridization (ISH), immunohistochemical staining and western blotting techniques. Administration of CGS markedly suppressed the elevated expression levels of SDF-1 and CXCR4. Moreover, the A 2a R-/- mice developed more severe pulmonary fibrosis than the normal mice when exposed to BLM. Furthermore, the SDF-1/CXCR4 axis was aberrantly uninhibited in the knockout mice. Together, these findings indicated that A 2a R alleviated BLM-induced lung fibrosis, at least partially via the SDF-1/CXCR4 pathway, which could be a potential therapeutic target for the treatment of IPF.

  14. Differential response of Drosophila cell lines to extracellular adenosine

    Czech Academy of Sciences Publication Activity Database

    Fleischmannová, J.; Kučerová, Lucie; Šandová, Kateřina; Steinbauerová, Veronika; Brož, Václav; Šimek, Petr; Žurovec, Michal

    2012-01-01

    Roč. 42, č. 5 (2012), s. 321-331 ISSN 0965-1748 R&D Projects: GA MŠk(CZ) LC06077 Grant - others:AV ČR(CZ) KJB501410801; European Community´s Seventh Framwork Programme (FP7/2007-2013)(CZ) 229518 Institutional research plan: CEZ:AV0Z50070508 Institutional support: RVO:60077344 Keywords : adenosine recycling * nucleoside transport * Mbn2 Subject RIV: CE - Biochemistry Impact factor: 3.234, year: 2012 http://www.sciencedirect.com/science/article/pii/S0965174812000033

  15. ADENOSINE RECEPTOR STIMULATION BY POLYDEOXYRIBONUCLEOTIDE IMPROVES TISSUE REPAIR AND SYMPTOMOLOGY IN EXPERIMENTAL COLITIS.

    Directory of Open Access Journals (Sweden)

    Giovanni Pallio

    2016-08-01

    Full Text Available Activation of the adenosine receptor pathway has been demonstrated to be effective in improving tissue remodelling and blunting the inflammatory response. Active colitis is characterized by an intense inflammatory reaction resulting in extensive tissue damage. Symptomatic improvement requires both control of the inflammatory process and repair and remodelling of damaged tissues. We investigated the ability of an A2A receptor agonist, polydeoxyribonucleotide (PDRN, to restore tissue structural integrity in two experimental colitis models using male Sprague-Dawley rats. In the first model, colitis was induced with a single intra-colonic instillation of dinitro-benzene-sulfonic acid (DNBS, 25mg diluted in 0.8ml 50% ethanol. After 6 hrs, animals were randomized to receive either PDRN (8mg/kg/i.p., or PDRN + the A2A antagonist (DMPX; 10mg/kg/i.p., or vehicle (0.8 ml saline solution daily. In the second model, dextran sodium sulphate (DSS was dissolved in drinking water at a concentration of 8%. Control animals received standard drinking water. After 24 hrs animals were randomized to receive PDRN or PDRN+DMPX as described above. Rats were sacrificed 7 days after receiving DNBS or 5 days after DSS. In both experimental models of colitis, PDRN ameliorated the clinical symptoms and weight loss associated with disease as well as promoted the histological repair of damaged tissues. Moreover, PDRN reduced expression of inflammatory cytokines, myeloperoxydase activity, and malondialdheyde. All these effects were abolished by the concomitant administration of the A2a antagonist DMPX. Our study suggests that PDRN may represent a promising treatment for improving tissue repair during inflammatory bowel diseases.

  16. Synthesis, biological and modeling studies of 1,3-di-n-propyl-2,4-dioxo-6-methyl-8-(substituted) 1,2,3,4-tetrahydro [1,2,4]-triazolo [3,4-f]-purines as adenosine receptor antagonists.

    Science.gov (United States)

    Pastorin, G; Bolcato, C; Cacciari, B; Kachler, S; Klotz, K-N; Montopoli, C; Moro, S; Spalluto, G

    2005-08-01

    A new series of potential adenosine receptor antagonists with a [1,2,4]-triazolo-[3,4-f]-purine structure bearing at the 1 and 3 position n-propyl groups have been synthesized, and their affinities at the four human adenosine receptor subtypes (A(1), A(2A), A(2B) and A(3)) have been evaluated. In this case the presence of n-propyl groups seems to induce potency at the A(2A) and A(3) adenosine receptor subtypes as opposed to our previously reported series bearing methyl substituents at the 1 and 3 positions. In particular the non-acylated derivative 17 showed affinity at these two receptor subtypes in the micromolar range. Indeed, preliminary molecular modeling investigations according to the experimental binding data indicate a modest steric and electrostatic antagonist-receptor complementarity.

  17. Further human evidence for striatal dopamine release induced by administration of ∆9-tetrahydrocannabinol (THC): selectivity to limbic striatum.

    Science.gov (United States)

    Bossong, Matthijs G; Mehta, Mitul A; van Berckel, Bart N M; Howes, Oliver D; Kahn, René S; Stokes, Paul R A

    2015-08-01

    Elevated dopamine function is thought to play a key role in both the rewarding effects of addictive drugs and the pathophysiology of schizophrenia. Accumulating epidemiological evidence indicates that cannabis use is a risk factor for the development of schizophrenia. However, human neurochemical imaging studies that examined the impact of ∆9-tetrahydrocannabinol (THC), the main psychoactive component in cannabis, on striatal dopamine release have provided inconsistent results. The objective of this study is to assess the effect of a THC challenge on human striatal dopamine release in a large sample of healthy participants. We combined human neurochemical imaging data from two previous studies that used [(11)C]raclopride positron emission tomography (PET) (n = 7 and n = 13, respectively) to examine the effect of THC on striatal dopamine neurotransmission in humans. PET images were re-analysed to overcome differences in PET data analysis. THC administration induced a significant reduction in [(11)C]raclopride binding in the limbic striatum (-3.65 %, from 2.39 ± 0.26 to 2.30 ± 0.23, p = 0.023). This is consistent with increased dopamine levels in this region. No significant differences between THC and placebo were found in other striatal subdivisions. In the largest data set of healthy participants so far, we provide evidence for a modest increase in human striatal dopamine transmission after administration of THC compared to other drugs of abuse. This finding suggests limited involvement of the endocannabinoid system in regulating human striatal dopamine release and thereby challenges the hypothesis that an increase in striatal dopamine levels after cannabis use is the primary biological mechanism underlying the associated higher risk of schizophrenia.

  18. Growth hormone (GH) is a survival rather than a proliferative factor for embryonic striatal neural precursor cells.

    Science.gov (United States)

    Regalado-Santiago, Citlalli; López-Meraz, María Leonor; Santiago-García, Juan; Fernández-Pomares, Cynthia; Juárez-Aguilar, Enrique

    2013-10-01

    A possible role of GH during central nervous system (CNS) development has been suggested by the presence of this hormone and its receptor in brain areas before its production by the pituitary gland. Although several effects have been reported for GH, the specific role of this hormone during CNS development remains unclear. Here, we examined the effect of GH on proliferation, survival and neurosphere formation in primary cultures of striatal tissue from 14-day-old (E14) mouse embryos. GH receptor gene expression was confirmed by RT-PCR. Primary cultures of embryonic striatal cells were treated with different doses of GH in serum free media, then the number of neurospheres was determined. To examine the GH effect on proliferation and survival of the striatal primary cultures, bromodeoxyuridine (BrdU) and TUNEL immunoreactivity was conducted. In the presence of the epidermal growth factor (EGF), GH increased the formation of neurospheres, with a maximal response at 10 ng/ml, higher doses were inhibitory. In absence of EGF, GH failed to stimulate neurosphere formation. Proliferation rate in the primary striatal cultures was inhibited by 24 or 48 h incubation with GH. However, in the absence of EGF, GH increased BrdU incorporation. GH treatment decreases the rate of apoptosis of nestin and GFAP positive cells in the primary striatal cultures, enhancing neurosphere formation. Our in vitro data demonstrate that GH plays a survival role on the original population of embryonic striatal cells, improving Neural Precursor Cells (NPCs) expansion. We suggest that this GH action could be predominant during striatal neurodevelopment. © 2013.

  19. Effect of Exercise Training on Striatal Dopamine D2/D3 Receptors in Methamphetamine Users during Behavioral Treatment.

    Science.gov (United States)

    Robertson, Chelsea L; Ishibashi, Kenji; Chudzynski, Joy; Mooney, Larissa J; Rawson, Richard A; Dolezal, Brett A; Cooper, Christopher B; Brown, Amira K; Mandelkern, Mark A; London, Edythe D

    2016-05-01

    Methamphetamine use disorder is associated with striatal dopaminergic deficits that have been linked to poor treatment outcomes, identifying these deficits as an important therapeutic target. Exercise attenuates methamphetamine-induced neurochemical damage in the rat brain, and a preliminary observation suggests that exercise increases striatal D2/D3 receptor availability (measured as nondisplaceable binding potential (BPND)) in patients with Parkinson's disease. The goal of this study was to evaluate whether adding an exercise training program to an inpatient behavioral intervention for methamphetamine use disorder reverses deficits in striatal D2/D3 receptors. Participants were adult men and women who met DSM-IV criteria for methamphetamine dependence and were enrolled in a residential facility, where they maintained abstinence from illicit drugs of abuse and received behavioral therapy for their addiction. They were randomized to a group that received 1 h supervised exercise training (n=10) or one that received equal-time health education training (n=9), 3 days/week for 8 weeks. They came to an academic research center for positron emission tomography (PET) using [(18)F]fallypride to determine the effects of the 8-week interventions on striatal D2/D3 receptor BPND. At baseline, striatal D2/D3 BPND did not differ between groups. However, after 8 weeks, participants in the exercise group displayed a significant increase in striatal D2/D3 BPND, whereas those in the education group did not. There were no changes in D2/D3 BPND in extrastriatal regions in either group. These findings suggest that structured exercise training can ameliorate striatal D2/D3 receptor deficits in methamphetamine users, and warrants further evaluation as an adjunctive treatment for stimulant dependence.

  20. Locomotor activation by theacrine, a purine alkaloid structurally similar to caffeine: involvement of adenosine and dopamine receptors.

    Science.gov (United States)

    Feduccia, Allison A; Wang, Yuanyuan; Simms, Jeffrey A; Yi, Henry Y; Li, Rui; Bjeldanes, Leonard; Ye, Chuangxing; Bartlett, Selena E

    2012-08-01

    Purine compounds, such as caffeine, have many health-promoting properties and have proven to be beneficial in treating a number of different conditions. Theacrine, a purine alkaloid structurally similar to caffeine and abundantly present in Camellia kucha, has recently become of interest as a potential therapeutic compound. In the present study, theacrine was tested using a rodent behavioral model to investigate the effects of the drug on locomotor activity. Long Evans rats were injected with theacrine (24 or 48 mg/kg, i.p.) and activity levels were measured. Results showed that the highest dose of theacrine (48 mg/kg, i.p.) significantly increased locomotor activity compared to control animals and activity remained elevated throughout the duration of the session. To test for the involvement of adenosine receptors underlying theacrine's motor-activating properties, rats were administered a cocktail of the adenosine A₁ agonist, N⁶-cyclopentyladenosine (CPA; 0.1 mg/kg, i.p.) and A(2A) receptor agonist 2-p-(2-carboxyethyl)phenethylamino-5'-N-ethylcarboxamidoadenosine (CGS-21680; 0.2 mg/kg, i.p.). Pre-treatment with theacrine significantly attenuated the motor depression induced by the adenosine receptor agonists, indicating that theacrine is likely acting as an adenosine receptor antagonist. Next, we examined the role of DA D₁ and D₂ receptor antagonism on theacrine-induced hyperlocomotion. Both antagonists, D₁R SCH23390 (0.1 or 0.05 mg/kg, i.p.) and D₂R eticlopride (0.1 mg/kg, i.p.), significantly reduced theacrine-stimulated activity indicating that this behavioral response, at least in part, is mediated by DA receptors. In order to investigate the brain region where theacrine may be acting, the drug (10 or 20 μg) was infused bilaterally into nucleus accumbens (NAc). Theacrine enhanced activity levels in a dose-dependent manner, implicating a role of the NAc in modulating theacrine's effects on locomotion. In addition, theacrine did not induce locomotor

  1. DMPD: Shaping of monocyte and macrophage function by adenosine receptors. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 17056121 Shaping of monocyte and macrophage function by adenosine receptors. Hasko ...G, Pacher P, Deitch EA, Vizi ES. Pharmacol Ther. 2007 Feb;113(2):264-75. Epub 2006 Sep 14. (.png) (.svg) (.html) (.csml) Show Shapi...ng of monocyte and macrophage function by adenosine receptors. PubmedID 17056121 Title Shapi

  2. Hyaluronidase treatment of coronary glycocalyx increases reactive hyperemia but not adenosine hyperemia in dog hearts

    NARCIS (Netherlands)

    VanTeeffelen, Jurgen W. G. E.; Dekker, Simone; Fokkema, Dirk S.; Siebes, Maria; Vink, Hans; Spaan, Jos A. E.

    2005-01-01

    Because adenosine is commonly used for inducing maximal coronary hyperemia in the clinic, it is imperative that adenosine- induced hyperemia ( AH) resembles coronary hyperemia that can be attained by endogenous stimuli. In the present study we hypothesized that coronary reactive hyperemia ( RH) is

  3. Adenosine dry powder inhalation for bronchial challenge testing, part 2 : Proof of concept in asthmatic subjects

    NARCIS (Netherlands)

    Lexmond, Anne J.; van der Wiel, Erica; Hagedoorn, Paul; Bult, Wouter; Frijlink, Henderik W.; ten Hacken, Nick H. T.; de Boer, Anne H.

    Adenosine is an indirect stimulus to assess bronchial hyperresponsiveness (BHR2) in asthma. Bronchial challenge tests are usually performed with nebulised solutions of adenosine 5′-monophosphate (AMP3). The nebulised AMP test has several disadvantages, like long administration times and a

  4. Comparison of exogenous adenosine and voluntary exercise on human skeletal muscle perfusion and perfusion heterogeneity

    DEFF Research Database (Denmark)

    Heinonen, Ilkka H.A.; Kemppainen, Jukka; Kaskinoro, Kimmo

    2010-01-01

    Adenosine is a widely used pharmacological agent to induce a 'high flow' control condition to study the mechanisms of exercise hyperemia, but it is not known how well adenosine infusion depicts exercise-induced hyperemia especially in terms of blood flow distribution at the capillary level in hum...

  5. Non-ribose ligands for the human adenosine A1 receptor

    NARCIS (Netherlands)

    Klaasse, Elisabeth Cornelia

    2008-01-01

    This thesis describes new, non-ribose ligands for the human Adenosine A1 Receptor (hA1R). An introduction to the four adenosine receptors subtypes, their history and cloning, occurrence, functioning, trafficking and therapeutic potential is given in Chapter 1. The process of desensitization and

  6. Lack of adenosine A(3) receptors causes defects in mouse peripheral blood parameters

    Czech Academy of Sciences Publication Activity Database

    Hofer, Michal; Pospíšil, Milan; Dušek, L.; Hoferová, Zuzana; Komůrková, Denisa

    2014-01-01

    Roč. 10, č. 3 (2014), s. 509-514 ISSN 1573-9538 R&D Projects: GA ČR(CZ) GAP303/11/0128 Institutional support: RVO:68081707 Keywords : Adenosine A(3) receptor * Adenosine A(3) receptor knockout mice * Hematopoiesis Subject RIV: BO - Biophysics Impact factor: 3.886, year: 2014

  7. Modulation of gene expression of adenosine and metabotropic glutamate receptors in rat's neuronal cells exposed to L-glutamate and [60]fullerene.

    Science.gov (United States)

    Giust, Davide; Da Ros, Tatiana; Martín, Mairena; Albasanz, José Luis

    2014-08-01

    L-Glutamate (L-Glu) has been often associated not only to fundamental physiological roles, as learning and memory, but also to neuronal cell death and the genesis and development of important neurodegenerative diseases. Herein we studied the variation in the adenosine and metabotropic glutamate receptors expression induced by L-Glu treatment in rat's cortical neurons. The possibility to have structural alteration of the cells induced by L-Glu (100 nM, 1 and 10 microM) has been addressed, studying the modulation of microtubule associated protein-2 (MAP-2) and neurofilament heavy polypeptide (NEFH), natively associated proteins to the dendritic shape maintenance. Results showed that the proposed treatments were not destabilizing the cells, so the L-Glu concentrations were acceptable to investigate fluctuation in receptors expression, which were studied by RT-PCR. Interestingly, C60 fullerene derivative t3ss elicited a protective effect against glutamate toxicity, as demonstrated by MTT assay. In addition, t3ss compound exerted a different effect on the adenosine and metabotropic glutamate receptors analyzed. Interestingly, A(2A) and mGlu1 mRNAs were significantly decreased in conditions were t3ss neuroprotected cortical neurons from L-Glu toxicity. In summary, t3ss protects neurons from glutamate toxicity in a process that appears to be associated with the modulation of the gene expression of adenosine and metabotropic glutamate receptors.

  8. Alkaline Phosphatase, Soluble Extracellular Adenine Nucleotides, and Adenosine Production after Infant Cardiopulmonary Bypass.

    Science.gov (United States)

    Davidson, Jesse A; Urban, Tracy; Tong, Suhong; Twite, Mark; Woodruff, Alan; Wischmeyer, Paul E; Klawitter, Jelena

    2016-01-01

    Decreased alkaline phosphatase activity after infant cardiac surgery is associated with increased post-operative cardiovascular support requirements. In adults undergoing coronary artery bypass grafting, alkaline phosphatase infusion may reduce inflammation. Mechanisms underlying these effects have not been explored but may include decreased conversion of extracellular adenine nucleotides to adenosine. 1) Evaluate the association between alkaline phosphatase activity and serum conversion of adenosine monophosphate to adenosine after infant cardiac surgery; 2) assess if inhibition/supplementation of serum alkaline phosphatase modulates this conversion. Pre/post-bypass serum samples were obtained from 75 infants alkaline phosphatase and CD73. Low and high concentration 13C5-adenosine monophosphate (simulating normal/stress concentrations) were used. Effects of alkaline phosphatase supplementation on adenosine monophosphate clearance were also assessed. Changes in serum alkaline phosphatase activity were strongly correlated with changes in 13C5-adenosine production with or without CD73 inhibition (r = 0.83; palkaline phosphatase activity (≤80 U/L) generated significantly less 13C5-adenosine, particularly in the presence of high concentration 13C5-adenosine monophosphate (10.4μmol/L vs 12.9μmol/L; p = 0.0004). Inhibition of alkaline phosphatase led to a marked decrease in 13C5-adenosine production (11.9μmol/L vs 2.7μmol/L; palkaline phosphatase or high dose bovine intestinal alkaline phosphatase doubled 13C5-adenosine monophosphate conversion to 13C5-adenosine (pAlkaline phosphatase represents the primary serum ectonucleotidase after infant cardiac surgery and low post-operative alkaline phosphatase activity leads to impaired capacity to clear adenosine monophosphate. AP supplementation improves serum clearance of adenosine monophosphate to adenosine. These findings represent a potential therapeutic mechanism for alkaline phosphatase infusion during cardiac

  9. Diagnostic significance of adenosine deaminase in pleural tuberculosis

    International Nuclear Information System (INIS)

    Khurshid, R.; Shore, N.; Saleem, M.; Zameer, N.

    2009-01-01

    Tuberculosis (TB) is a major cause of pleural effusion, which in TB usually has lymphocytic and exudative characteristics. Analysis of adenosine deaminase (ADA) activity is a very useful diagnostic approach to achieve a more rapid and precise diagnosis in cases of Pleural TB (pTB). Fifty male and fifty female patients presenting with tuberculosis pleural effusion was included in the study. The patients were taken from the medical ward of Sir Ganga Ram Hospital between September 2001 and September 2002. Activity of Adenosine Deaminase (ADA) was estimated by the technique of Sodium dodecyl sulphate electrophoresis (SDS-EF) using 10% polyacrylamide gel. Mean age of males was 45.72+-19.22 years and of female was 43.74+-16.09 years. Mean protein level was 3.39+-0.24 g/dl in males, and it was 3.02+-0.26 g/dl in females. Mean specific gravity both in males and females was 1.020+-0.01. The results show an increased level of enzyme ADA in patients as compared to normal subjects. Estimation of ADA activity may provide basis for rapid and efficient diagnosis of pleural TB in different clinical settings. However study should be extended to larger number of patients to reach a better conclusion. (author)

  10. Evaluation of usefulness of pleural fluid adenosine deaminase in diagnosing tuberculous pleural effusion from empyema

    Directory of Open Access Journals (Sweden)

    Vijetha Shenoy

    2014-02-01

    Full Text Available Objective: To evaluate the utility of adenosine deaminase activity in the pleural fluid for the diagnosis of tuberculous pleural effusion from empyema of non-tubercular origin. Method: A retrospective analysis of data was performed on patients who were diagnosed to have tuberculous pleural effusion and empyema of non tubercular origin. Among 46 patients at Kasturba Hospital, Manipal University, Manipal, Karnataka, India, from November 201 2 to February 2013 who underwent pleural fluid adenosine deaminase estimation, 25 patients with tuberculous pleural effusion and 21 patients with empyema were diagnosed respectively. Adenosine deaminase in pleural fluid is estimated using colorimetric, Galanti and Guisti method. Results: Pleural fluid Adenosine Deaminase levels among tuberculous pleural effusion(109.38依 53.83 , empyema (141.20依71.69 with P=0.27. Conclusion: Pleural fluid adenosine deaminase alone cannot be used as a marker for the diagnosis of tuberculous pleural effusion.

  11. Longitudinal study of striatal activation to reward and loss anticipation from mid-adolescence into late adolescence/early adulthood.

    Science.gov (United States)

    Lamm, C; Benson, B E; Guyer, A E; Perez-Edgar, K; Fox, N A; Pine, D S; Ernst, M

    2014-08-01

    Adolescent risk-taking behavior has been associated with age-related changes in striatal activation to incentives. Previous cross-sectional studies have shown both increased and decreased striatal activation to incentives for adolescents compared to adults. The monetary incentive delay (MID) task, designed to assess functional brain activation in anticipation of reward, has been used extensively to examine striatal activation in both adult and adolescent populations. The current study used this task with a longitudinal approach across mid-adolescence and late adolescence/early adulthood. Twenty-two participants (13 male) were studied using the MID task at two time-points, once in mid-adolescence (mean age=16.11; SD=1.44) and a second time in late adolescence/early adulthood (mean age=20.14; SD=.67). Results revealed greater striatal activation with increased age in high- compared to low-incentive contexts (incentive magnitude), for gain as well as for loss trials (incentive valence). Results extend cross-sectional findings and show reduced striatal engagement in adolescence compared to adulthood during preparation for action in an incentive context. Copyright © 2013 Elsevier Inc. All rights reserved.

  12. Overexpression, purification and crystallographic analysis of a unique adenosine kinase from Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Wang, Yimin; Long, Mary C.; Ranganathan, Senthil; Escuyer, Vincent; Parker, William B.; Li, Rongbao

    2005-01-01

    Adenosine kinase from M. tuberculosis has been overexpressed, purified and crystallized in the presence of adenosine. Structure determination using molecular replacement with diffraction data collected at 2.2 Å reveals a dimeric structure. Adenosine kinase from Mycobacterium tuberculosis is the only prokaryotic adenosine kinase that has been isolated and characterized. The enzyme catalyzes the phosphorylation of adenosine to adenosine monophosphate and is involved in the activation of 2-methyladenosine, a compound that has demonstrated selective activity against M. tuberculosis. The mechanism of action of 2-methyladenosine is likely to be different from those of current tuberculosis treatments and this compound (or other adenosine analogs) may prove to be a novel therapeutic intervention for this disease. The M. tuberculosis adenosine kinase was overexpressed in Escherichia coli and the enzyme was purified with activity comparable to that reported previously. The protein was crystallized in the presence of adenosine using the vapour-diffusion method. The crystals diffracted X-rays to high resolution and a complete data set was collected to 2.2 Å using synchrotron radiation. The crystal belonged to space group P3 1 21, with unit-cell parameters a = 70.2, c = 111.6 Å, and contained a single protein molecule in the asymmetric unit. An initial structural model of the protein was obtained by the molecular-replacement method, which revealed a dimeric structure. The monomers of the dimer were related by twofold crystallographic symmetry. An understanding of how the M. tuberculosis adenosine kinase differs from the human homolog should aid in the design of more potent and selective antimycobacterial agents that are selectively activated by this enzyme

  13. Presynaptic inhibition of GABAergic synaptic transmission by adenosine in mouse hypothalamic hypocretin neurons.

    Science.gov (United States)

    Xia, J X; Xiong, J X; Wang, H K; Duan, S M; Ye, J N; Hu, Z A

    2012-01-10

    Hypocretin neurons in the lateral hypothalamus, a new wakefulness-promoting center, have been recently regarded as an important target involved in endogenous adenosine-regulating sleep homeostasis. The GABAergic synaptic transmissions are the main inhibitory afferents to hypocretin neurons, which play an important role in the regulation of excitability of these neurons. The inhibitory effect of adenosine, a homeostatic sleep-promoting factor, on the excitatory glutamatergic synaptic transmissions in hypocretin neurons has been well documented, whether adenosine also modulates these inhibitory GABAergic synaptic transmissions in these neurons has not been investigated. In this study, the effect of adenosine on inhibitory postsynaptic currents (IPSCs) in hypocr