Influence of constitutive phenolic compounds on the response of grapevine (Vitis vinifera L.) leaves to infection by Plasmopara viticola.

Science.gov (United States)

Latouche, Gwendal; Bellow, Sébastien; Poutaraud, Anne; Meyer, Sylvie; Cerovic, Zoran G

2013-01-01

Flavonols and hydroxycinnamic acids are known to contribute to plant resistance against pathogens, but there are few reports on the implication of flavonols in the resistance of grapevine against Plasmopara viticola, and none on the involvement of hydroxycinnamic acids. In order to analyze the effect of flavonols on P. viticola infection, variable amounts of flavonols were induced by different light conditions in otherwise phenologically identical leaves. Differences in content of leaf hydroxycinnamic acids were induced at the same time. A non-invasive monitoring of flavonols and hydroxycinnamic acids was performed with Dualex leaf-clip optical sensors. Whatever the light condition, there were no significant changes in flavonol or in hydroxycinnamic acid contents for control and inoculated leaves during the development of P. viticola until 6 days after inoculation. The violet-blue autofluorescence of stilbenes, the main phytoalexins of grapevine that accumulate in inoculated leaves, was used as an indicator of infection by P. viticola. The implication of leaf constitutive flavonols and hydroxycinnamic acids in the defence of Vitis vinifera against P. viticola could be investigated in vivo thanks to this indicator. The increase in stilbene violet-blue autofluorescence started earlier for leaves with low flavonol content than for leaves with higher content, suggesting that constitutive flavonols are able to slow down the infection by P. viticola. On the contrary, constitutive hydroxycinnamic acids did not seem to play a role in defence against P. viticola. The non-destructive nature of the methods used alleviates the major problem of destructive experiments: the large variability in leaf phenolic contents.

Elimination of Grapevine leafroll associated virus-3, Grapevine rupestris stem pitting associated virus and Grapevine virus A from a Tunisian Cultivar by Somatic Embryogenesis and Characterization of the Somaclones Using Ampelographic Descriptors.

Science.gov (United States)

Bouamama-Gzara, Badra; Selmi, Ilhem; Chebil, Samir; Melki, Imene; Mliki, Ahmed; Ghorbel, Abdelwahed; Carra, Angela; Carimi, Francesco; Mahfoudhi, Naima

2017-12-01

Prospecting of local grapevine ( Vitis vinifera L.) germplasm revealed that Tunisia possesses a rich patrimony which presents diversified organoleptic characteristics. However, viral diseases seriously affect all local grapevine cultivars which risk a complete extinction. Sanitation programs need to be established to preserve and exploit, as a gene pool, the Tunisian vineyards areas. The presence of the Grapevine leafroll associated virus-3 (GLRaV-3), Grapevine stem pitting associated virus (GRSPaV) and Grapevine virus A (GVA), were confirmed in a Tunisian grapevine cultivar using serological and molecular analyses. The association between GRSPaV and GVA viruses induces more rugose wood symptoms and damages. For this reason the cleansing of the infected cultivar is highly advisable. Direct and recurrent somatic embryos of cv. 'Hencha' were successfully induced from filament, when cultured on Chée and Pool (1987). based-medium, enriched with 2 mg 1 -1 of 2,4-dichlorophenoxyacetic acid and 2.5 mg 1 -1 of Thidiazuron, after 36 weeks of culture. After six months of acclimatization, RT-PCR carried on 50 somaplants confirmed the absence of GVA, GRSPa-V as well as GLRaV-3 viruses in all somaplants. Ampelographic analysis, based on eight OIV descriptors, was carried out on two years acclimated somaplants, compared to the mother plant. Results demonstrated that the shape and contours of 46 somaclones leaves are identical to mother plant leaves and four phenotypically off-type plants were observed. The healthy state of 100% 'Hencha' somaclones and the high percentage of phenotypically true-to-type plants demonstrate that somatic embryogenesis is a promising technique to adopt for grapevine viruses elimination.

Elimination of Grapevine leafroll associated virus-3, Grapevine rupestris stem pitting associated virus and Grapevine virus A from a Tunisian Cultivar by Somatic Embryogenesis and Characterization of the Somaclones Using Ampelographic Descriptors

Directory of Open Access Journals (Sweden)

Badra Bouamama-Gzara

2017-12-01

Full Text Available Prospecting of local grapevine (Vitis vinifera L. germplasm revealed that Tunisia possesses a rich patrimony which presents diversified organoleptic characteristics. However, viral diseases seriously affect all local grapevine cultivars which risk a complete extinction. Sanitation programs need to be established to preserve and exploit, as a gene pool, the Tunisian vineyards areas. The presence of the Grapevine leafroll associated virus-3 (GLRaV-3, Grapevine stem pitting associated virus (GRSPaV and Grapevine virus A (GVA, were confirmed in a Tunisian grapevine cultivar using serological and molecular analyses. The association between GRSPaV and GVA viruses induces more rugose wood symptoms and damages. For this reason the cleansing of the infected cultivar is highly advisable. Direct and recurrent somatic embryos of cv. ‘Hencha’ were successfully induced from filament, when cultured on Chée and Pool (1987. based-medium, enriched with 2 mg 1−1 of 2,4-dichlorophenoxyacetic acid and 2.5 mg 1−1 of Thidiazuron, after 36 weeks of culture. After six months of acclimatization, RT-PCR carried on 50 somaplants confirmed the absence of GVA, GRSPa-V as well as GLRaV-3 viruses in all somaplants. Ampelographic analysis, based on eight OIV descriptors, was carried out on two years acclimated somaplants, compared to the mother plant. Results demonstrated that the shape and contours of 46 somaclones leaves are identical to mother plant leaves and four phenotypically off-type plants were observed. The healthy state of 100% ‘Hencha’ somaclones and the high percentage of phenotypically true-to-type plants demonstrate that somatic embryogenesis is a promising technique to adopt for grapevine viruses elimination.

Effect of osmotic stress and post-stress recovery on the content of phenolics and properties of antioxidants in germinating seeds of grapevine Vitis californica

Directory of Open Access Journals (Sweden)

Stanisław Weidner

2011-05-01

Full Text Available The tested material consisted of grapevine Vitis californica stratified seeds germinated under optimum conditions (+25°C in water, under osmotic stress (-0.2 MPa in PEG solution and submitted to recovery after stress (+25°C in water. The germinating seeds were determined to contain tannins, catechins and the following phenolic acids: gallic, caffeic, p-coumaric and ferulic. The acids occurred in free, ester- and glycoside-bound forms. The dominant form of phenolic acids was the ester-bound fraction. Gallic acid was the most abundant phenolic acid in germinating seeds, while ferulic acid appeared in the smallest amounts. Our analysis of tannins demonstrated that osmotic stress depressed their concentration. Presence of catechin group compounds such as catechin and epicatechin was also determined. In each sample epicatechin was dominant. The total concentration of catechin increased under stress conditions and declined during post-stress recovery. Catechins are a constituent of tannins and their increase under osmotic stress is most probably caused by the breakdown of some tannins in seeds germinating under stress conditions. Samples submitted to osmotic stress were also found to contain less of total phenolic compounds, whereas in samples which underwent post-stress recovery the total level of phenolic compounds increased. Compared to extracts from seeds germinating under optimum conditions, osmotic stress depressed the capacity of extract to scavenge DPPH● (2,2-diphenyl-1-picrylhydrazyl and ABTS●+ – 2,2-Azino-bis (3-etylbenzothiazoline-6-sulfonic acid free radicals, but the antioxidant activity rose in seeds submitted to recovery after stress. Positive correlation was therefore demonstrated between the total content of phenolic acids in germinating grapevine seeds and the reducing power of extracts obtained from these seeds and their free radical scavenging activity. The results suggest that osmotic stress inhibits the activity of

Pyrosequencing detects human and animal pathogenic taxa in the grapevine endosphere.

Science.gov (United States)

Yousaf, Sohail; Bulgari, Daniela; Bergna, Alessandro; Pancher, Michael; Quaglino, Fabio; Casati, Paola; Campisano, Andrea

2014-01-01

Generally, plants are not considered as hosts for human and animal pathogens (HAP). The recent produce-associated outbreaks of food-borne diseases have drawn attention toward significant deficiencies in our understanding of the ecology of HAP, and their potential for interkingdom transfer. To examine the association of microorganisms classified as HAP with plants, we surveyed the presence and distribution of HAP bacterial taxa (henceforth HAPT, for brevity's sake) in the endosphere of grapevine (Vitis vinifera L.) both in the plant stems and leaves. An enrichment protocol was used on leaves to detect taxa with very low abundance in undisturbed tissues. We used pyrosequencing and phylogenetic analyses of the 16S rDNA gene. We identified several HAPT, and focused on four genera (Propionibacterium, Staphylococcus, Clostridium, and Burkholderia). The majority of the bacterial sequences in the genus Propionibacterium, from grapevine leaf and stem, were identified as P. acnes. Clostridia were detected in leaves and stems, but their number was much higher in leaves after enrichment. HAPT were indentified both in leaves and wood of grapevines. This depicts the ability of these taxa to be internalized within plant tissues and maintain their population levels in a variety of environments. Our analysis highlighted the presence of HAPT in the grapevine endosphere and unexpected occurrence of these bacterial taxa in this atypical environment.

Grapevine (Vitis vinifera L.).

Science.gov (United States)

Torregrosa, Laurent; Vialet, Sandrine; Adivèze, Angélique; Iocco-Corena, Pat; Thomas, Mark R

2015-01-01

Grapevine (Vitis) is considered to be one of the major fruit crops in the world based on hectares cultivated and economic value. Grapes are used not only for wine but also for fresh fruit, dried fruit, and juice production. Wine is by far the major product of grapes, and the focus of this chapter is on wine grape cultivars. Grapevine cultivars of Vitis vinifera L. have a reputation for producing premium quality wines. These premium quality wines are produced from a small number of cultivars that enjoy a high level of consumer acceptance and are firmly entrenched in the market place because of varietal name branding and the association of certain wine styles and regions with specific cultivars. In light of this situation, grapevine improvement by a transgenic approach is attractive when compared to a classical breeding approach. The transfer of individual traits as single genes with a minimum disruption to the original genome would leave the traditional characteristics of the cultivar intact. However, a reliable transformation system is required for a successful transgenic approach to grapevine improvement. There are three criteria for achieving an efficient Agrobacterium-mediated transformation system: (1) the production of highly regenerative transformable tissue, (2) optimal cocultivation conditions for both grapevine tissue and Agrobacterium, and (3) an efficient selection regime for transgenic plant regeneration. In this chapter, we describe a grapevine transformation system that meets these criteria. We also describe a protocol for the production of transformed roots suitable for functional gene studies and for the production of semi-transgenic grafted plants.

Follow-up of fluorine pollution effect on grapevine

Directory of Open Access Journals (Sweden)

Ferjani Ben Abdallah

2004-12-01

By another way, our results seem to show that full mature grapevine leaves may constitute an efficient tool to assess fluorine pollution impact. Berries contamination seems to be affected directly by the factory smoke, there is no endogenous supply. Likewise, by its characteristic necrosis in the leaf boundaries, grapevine may be considered as a bioindicator variety of fluorine pollution which can be used in mapping polluted areas.

Day and night heat stress trigger different transcriptomic responses in green and ripening grapevine (vitis vinifera) fruit.

Science.gov (United States)

Rienth, Markus; Torregrosa, Laurent; Luchaire, Nathalie; Chatbanyong, Ratthaphon; Lecourieux, David; Kelly, Mary T; Romieu, Charles

2014-04-28

Global climate change will noticeably affect plant vegetative and reproductive development. The recent increase in temperatures has already impacted yields and composition of berries in many grapevine-growing regions. Physiological processes underlying temperature response and tolerance of the grapevine fruit have not been extensively investigated. To date, all studies investigating the molecular regulation of fleshly fruit response to abiotic stress were only conducted during the day, overlooking possible critical night-specific variations. The present study explores the night and day transcriptomic response of grapevine fruit to heat stress at several developmental stages. Short heat stresses (2 h) were applied at day and night to vines bearing clusters sequentially ordered according to the developmental stages along their vertical axes. The recently proposed microvine model (DRCF-Dwarf Rapid Cycling and Continuous Flowering) was grown in climatic chambers in order to circumvent common constraints and biases inevitable in field experiments with perennial macrovines. Post-véraison berry heterogeneity within clusters was avoided by constituting homogenous batches following organic acids and sugars measurements of individual berries. A whole genome transcriptomic approach was subsequently conducted using NimbleGen 090818 Vitis 12X (30 K) microarrays. Present work reveals significant differences in heat stress responsive pathways according to day or night treatment, in particular regarding genes associated with acidity and phenylpropanoid metabolism. Precise distinction of ripening stages led to stage-specific detection of malic acid and anthocyanin-related transcripts modulated by heat stress. Important changes in cell wall modification related processes as well as indications for heat-induced delay of ripening and sugar accumulation were observed at véraison, an effect that was reversed at later stages. This first day - night study on heat stress adaption of the

Water stress exacerbates the severity of Botryosphaeria dieback in grapevines infected by Neofusicoccum parvum

Science.gov (United States)

Botryosphaeria dieback (causal fungus Neofusicoccum parvum) is a detrimental grapevine trunk disease, causing internal wood degradation, killing shoots, and reducing yields. We examined the interactive effects of drought and N. parvum infection, common vineyard stresses, on wood-lesion development. ...

Abiotic stresses affect Trichoderma harzianum T39-induced resistance to downy mildew in grapevine.

Science.gov (United States)

Roatti, Benedetta; Perazzolli, Michele; Gessler, Cesare; Pertot, Ilaria

2013-12-01

Enhancement of plant defense through the application of resistance inducers seems a promising alternative to chemical fungicides for controlling crop diseases but the efficacy can be affected by abiotic factors in the field. Plants respond to abiotic stresses with hormonal signals that may interfere with the mechanisms of induced systemic resistance (ISR) to pathogens. In this study, we exposed grapevines to heat, drought, or both to investigate the effects of abiotic stresses on grapevine resistance induced by Trichoderma harzianum T39 (T39) to downy mildew. Whereas the efficacy of T39-induced resistance was not affected by exposure to heat or drought, it was significantly reduced by combined abiotic stresses. Decrease of leaf water potential and upregulation of heat-stress markers confirmed that plants reacted to abiotic stresses. Basal expression of defense-related genes and their upregulation during T39-induced resistance were attenuated by abiotic stresses, in agreement with the reduced efficacy of T39. The evidence reported here suggests that exposure of crops to abiotic stress should be carefully considered to optimize the use of resistance inducers, especially in view of future global climate changes. Expression analysis of ISR marker genes could be helpful to identify when plants are responding to abiotic stresses, in order to optimize treatments with resistance inducers in field.

The Impact of Phaeomoniella chlamydospora Infection on the Grapevine's Physiological Response to Water Stress - Part 2 : Cabernet Sauvignon and Chardonnay

Directory of Open Access Journals (Sweden)

J. Edwards

2007-04-01

Full Text Available Phaeomoniella chlamydospora is a vascular pathogen that colonises the xylem tissues of the grapevine. It is associated with the diseases, esca and Petri disease, often considered to be ‘stress-related’ diseases. In glasshouse experiments using Cabernet Sauvignon and Chardonnay, stomatal conductance was higher in infected plants, implying that infection interferes with stomatal control. In Cabernet Sauvignon, leaf water potentials were lower in infected plants subjected to water stress, indicating that infection made it more difficult for the vine to get water to the leaf. This was less apparent in Chardonnay. Clearly, infection alters the grapevine response to water stress and some cultivars are affected more than others.

Protective, curative and eradicative activities of fungicides against grapevine rust

Directory of Open Access Journals (Sweden)

Francislene Angelotti

2014-01-01

Full Text Available The protective, eradicative and curative activities of the fungicides azoxystrobin, tebuconazole, pyraclostrobin+metiram, and ciproconazole against grapevine rust, were determined in greenhouse. To evaluate the protective activity, leaves of potted ´Niagara´ (Vitis labrusca vines were artificially inoculated with an urediniospore suspension of Phakopsora euvitis four, eight or forteen days after fungicidal spray; and to evaluate the curative and eradicative activities, leaves were sprayed with fungicides two, four or eight days after inoculation. Disease severity was assessed 14 days after each inoculation. All tested fungicides present excellent preventive activity against grapevine rust; however, tebuconazole and ciproconazole provide better curative activity than azoxystrobin and pyraclostrobin+metiram. It was observed also that all tested fungicides significantly reduced the germination of urediniospore produced on sprayed leaves.

Estimation of water content in the leaves of fruit trees using infra-red images

International Nuclear Information System (INIS)

Muramatsu, N.; Hiraoka, K.

2006-01-01

A method was developed to evaluate water contents of fruit trees using infra-red photography. The irrigation of potted satsuma mandarin trees and grapevines was suppressed to induce water stress. During the drought treatment the leaf edges of basal parts of the shoots of grapevines became necrotic and the area of necrosis extended as the duration of stress increased. Necrosis was clearly distinguished from the viable areas on infra-red images. In satsuma mandarin, an abscission layer formed at the basal part of the petiole, then the leaves fell. Thus, detailed analysis was indispensable for detecting of the leaf water content. After obtaining infra-red images of satsuma mandarin leaves with or without water stress, a background treatment (subtraction of the background image) was performed on the images, then the average brightness of the leaf was determined using image analyzing software (Image Pro-plus). Coefficient correlation between the water status index using the infra-red camera and water content determined from dry weight and fresh weight of leaves was significant (r = 0.917 for adaxial surface data and r = 0.880 for abaxial surface data). These data indicate that infra-red photography is useful for detecting the degree of plant water stress

Phenolic compounds and properties of antioxidants in grapevine roots (Vitis vinifera L. under low-temperature stress followed by recovery

Directory of Open Access Journals (Sweden)

Stanisław Weidner

2011-01-01

Full Text Available The research has been performed on roots of Vitis vinifera, cv. Himrod, obtained from seedlings grown under chill stress conditions (+10oC in the day and +7oC at night, under optimum conditions (+25oC in the day and +18oC at night and from seedling which underwent a recover period after the chill stress treatment. The purpose of the study has been to determine quantitative and qualitative changes in phenolic compounds as well as to demonstrate changes in antiradical properties of extracts from grapevine roots, which appeared as a result of chill stress and during recovery under the optimum conditions following the stress. Phenolic compounds from grapevine roots were extracted using 80% acetone. The total content of phenolics was determined by colorimetry. The content of tannins was tested by precipitation with bovine serum albumin. The reducing power as well as DPPH• free radical and ABTS+• cation radical scavenging activity of the extracts were also tested. In order to identify phenolic compounds present in the extracts the RP-HPLC technique was employed. The tested material was found to contain tannins and three identified phenolic acids: ferulic, caffeic and p-coumaric ones. The latter occurred in the highest concentrations (from 4.46 to 6.28 µg/g fresh matter. Ferulic acid appeared in smaller amounts (from 1.68 to 2.65 µg/g fresh matter, followed by caffeic acid (from 0.87 to 1.55 µg/g fresh matter. Significantly less total phenolic compounds occurred in roots of seedlings subjected to chill stress. However, the total content of these compounds increased significantly in roots of plants which underwent recovery after chill stress. Concentration of tannins was determined by two methods. The content of condensed tannins was depressed in roots as a result of low temperature stress, whereas the content of condensed and hydrolysing tannins (determined via the BSA method rose under chill stress conditions. A significant increase in tannins

Ecophysiological modeling of grapevine water stress in Burgundy terroirs by a machine-learning approach

Directory of Open Access Journals (Sweden)

Luca eBrillante

2016-06-01

Full Text Available In a climate change scenario, successful modeling of the relationships between plant-soil-meteorology is crucial for a sustainable agricultural production, especially for perennial crops. Grapevines (Vitis vinifera L. cv Chardonnay located in eight experimental plots (Burgundy, France along a hillslope were monitored weekly for three years for leaf water potentials, both at predawn (Ψpd and at midday (Ψstem. The water stress experienced by grapevine was modeled as a function of meteorological data (minimum and maximum temperature, rainfall and soil characteristics (soil texture, gravel content, slope by a gradient boosting machine. Model performance was assessed by comparison with carbon isotope discrimination (δ13C of grape sugars at harvest and by the use of a test-set. The developed models reached outstanding prediction performance (RMSE < 0.08 MPa for Ψstem and < 0.06 MPa for Ψpd, comparable to measurement accuracy. Model predictions at a daily time step improved correlation with δ13C data, respect to the observed trend at a weekly time scale. The role of each predictor in these models was described in order to understand how temperature, rainfall, soil texture, gravel content and slope affect the grapevine water status in the studied context. This work proposes a straight-forward strategy to simulate plant water stress in field condition, at a local scale; to investigate ecological relationships in the vineyard and adapt cultural practices to future conditions.

Ecophysiological Modeling of Grapevine Water Stress in Burgundy Terroirs by a Machine-Learning Approach.

Science.gov (United States)

Brillante, Luca; Mathieu, Olivier; Lévêque, Jean; Bois, Benjamin

2016-01-01

In a climate change scenario, successful modeling of the relationships between plant-soil-meteorology is crucial for a sustainable agricultural production, especially for perennial crops. Grapevines (Vitis vinifera L. cv Chardonnay) located in eight experimental plots (Burgundy, France) along a hillslope were monitored weekly for 3 years for leaf water potentials, both at predawn (Ψpd) and at midday (Ψstem). The water stress experienced by grapevine was modeled as a function of meteorological data (minimum and maximum temperature, rainfall) and soil characteristics (soil texture, gravel content, slope) by a gradient boosting machine. Model performance was assessed by comparison with carbon isotope discrimination (δ(13)C) of grape sugars at harvest and by the use of a test-set. The developed models reached outstanding prediction performance (RMSE < 0.08 MPa for Ψstem and < 0.06 MPa for Ψpd), comparable to measurement accuracy. Model predictions at a daily time step improved correlation with δ(13)C data, respect to the observed trend at a weekly time scale. The role of each predictor in these models was described in order to understand how temperature, rainfall, soil texture, gravel content and slope affect the grapevine water status in the studied context. This work proposes a straight-forward strategy to simulate plant water stress in field condition, at a local scale; to investigate ecological relationships in the vineyard and adapt cultural practices to future conditions.

Physiological behaviors and recovery responses of four galician grapevine (Vitis vinifera L. cultivars under water stress

Directory of Open Access Journals (Sweden)

Islam M. T.

2012-11-01

Full Text Available Gas exchange parameters and chlorophyll fluorescence of four pot grown Galician grapevines (Vitis vinifera L. cv. Albariño, Brancellao, Godello and Treixadura were examined under different levels of water stress in greenhouse. After extreme stress, gas exchange recovery responses were evaluated. Average ΨPD for control and stressed plants were -0.4MPa and -1.45MPa respectively. All varieties showed gradual declining of all gas exchange parameters (gs, E and A with increasing of stress periods. Under stressed conditions, Albariño and Godello showed higher CO2 assimilation rate. At the end of stress period leaf defoliation was found in Albariño and Brancellao. Gas exchange recovery was higher for both Godello and Treixadura. A better response of auxiliary bud recovery was present in Albariño than in Brancellao. Close correlations between water stress and gas exchange parameters were found and it varies on genotype. Albariño, Godello and Treixadura followed same diurnal patterns of gas exchange rate for control and stressed plant respectively. Diurnal pattern of CO2 assimilation rate of all tested varieties followed gs and E. Only Brancellao showed treatment effect on mid-day Fv/Fm. Among four varieties photoinhibition was only found in Brancellao. At stressed condition physiological responses of grapevines were genotype depended.

Physiological behaviors and recovery responses of four Galician grapevine (Vitis vinifera L. ) cultivars under water stress

OpenAIRE

Islam, M.; Berrios, J.

2012-01-01

Gas exchange parameters and chlorophyll fluorescence of four pot grown Galician grapevines (Vitis vinifera L. cv. Albariño, Brancellao, Godello and Treixadura) were examined under different levels of water stress in greenhouse. After extreme stress, gas exchange recovery responses were evaluated. Average ΨPD for control and stressed plants were -0.4MPa and -1.45MPa respectively. All varieties showed gradual declining of all gas exchange parameters (gs, E and A) with increasing of stress perio...

ABA and GA3 regulate the synthesis of primary and secondary metabolites related to alleviation from biotic and abiotic stresses in grapevine.

Science.gov (United States)

Murcia, Germán; Fontana, Ariel; Pontin, Mariela; Baraldi, Rita; Bertazza, Gianpaolo; Piccoli, Patricia N

2017-03-01

Plants are able to synthesize a large number of organic compounds. Among them, primary metabolites are known to participate in plant growth and development, whereas secondary metabolites are mostly involved in defense and other facultative processes. In grapevine, one of the major fruit crops in the world, secondary metabolites, mainly polyphenols, are of great interest for the wine industry. Even though there is an extensive literature on the content and profile of those compounds in berries, scarce or no information is available regarding polyphenols in other organs. In addition, little is known about the effect of plant growth regulators (PGRs), ABA and GA 3 (extensively used in table grapes) on the synthesis of primary and secondary metabolites in wine grapes. In table grapes, cultural practices include the use of GA 3 sprays shortly before veraison, to increase berry and bunch size, and sugar content in fruits. Meanwhile, ABA applications to the berries on pre-veraison improve the skin coloring and sugar accumulation, anticipating the onset of veraison. Accordingly, the aim of this study was to assess and characterize primary and secondary metabolites in leaves, berries and roots of grapevine plants cv. Malbec at veraison, and changes in compositions after ABA and GA 3 aerial sprayings. Metabolic profiling was conducted using GC-MS, GC-FID and HPLC-MWD. A large set of metabolites was identified: sugars, alditols, organic acids, amino acids, polyphenols (flavonoids and non-flavonoids) and terpenes (mono-, sesqui-, di- and triterpenes). The obtained results showed that ABA applications elicited synthesis of mono- and sesquiterpenes in all assessed tissues, as well as L-proline, acidic amino acids and anthocyanins in leaves. Additionally, applications with GA 3 elicited synthesis of L-proline in berries, and mono- and sesquiterpenes in all the tissues. However, treatment with GA 3 seemed to block polyphenol synthesis, mainly in berries. In conclusion, ABA and GA

A Comparison of Petiole Hydraulics and Aquaporin Expression in an Anisohydric and Isohydric Cultivar of Grapevine in Response to Water-Stress Induced Cavitation.

Science.gov (United States)

Shelden, Megan C; Vandeleur, Rebecca; Kaiser, Brent N; Tyerman, Stephen D

2017-01-01

We report physiological, anatomical and molecular differences in two economically important grapevine ( Vitis vinifera L.) cultivars cv. Grenache (near-isohydric) and Chardonnay (anisohydric) in their response to water-stress induced cavitation. The aim of the study was to compare organ vulnerability (petiole and stem) to cavitation by measuring ultrasonic acoustic emissions (UAE) and percent loss of conductance of potted grapevines subject to the onset of water-stress. Leaf (ψ L ) and stem water potential (ψ S ), stomatal conductance ( g s ), transpiration ( E ), petiole hydraulics ( K Pet ), and xylem diameter were also measured. Chardonnay displayed hydraulic segmentation based on UAE, with cavitation occurring at a less negative ψ L in the petiole than in the stem. Vulnerability segmentation was not observed in Grenache, with both petioles and stems equally vulnerable to cavitation. Leaf water potential that induced 50% of maximum UAE was significantly different between petioles and stems in Chardonnay (ψ 50Petiole = -1.14 and ψ 50Stem = -2.24 MPa) but not in Grenache (ψ 50Petiole = -0.73 and ψ 50Stem = -0.78 MPa). Grenache stems appeared more susceptible to water-stress induced cavitation than Chardonnay stems. Grenache displayed (on average) a higher K Pet likely due to the presence of larger xylem vessels. A close relationship between petiole hydraulic properties and vine water status was observed in Chardonnay but not in Grenache. Transcriptional analysis of aquaporins in the petioles and leaves ( VvPIP1;1, VvPIP2;1, VvPIP2;2 VvPIP2;3, VvTIP1;1 , and VvTIP2;1 ) showed differential regulation diurnally and in response to water-stress. VvPIP2;1 showed strong diurnal regulation in the petioles and leaves of both cultivars with expression highest predawn. Expression of VvPIP2;1 and VvPIP2;2 responded to ψ L and ψ S in both cultivars indicating the expression of these two genes are closely linked to vine water status. Expression of several aquaporin

The grapevine VvCAX3 is a cation/H+ exchanger involved in vacuolar Ca2+ homeostasis.

Science.gov (United States)

Martins, Viviana; Carneiro, Filipa; Conde, Carlos; Sottomayor, Mariana; Gerós, Hernâni

2017-12-01

The grapevine VvCAX3 mediates calcium transport in the vacuole and is mostly expressed in green grape berries and upregulated by Ca 2+ , Na + and methyl jasmonate. Calcium is an essential plant nutrient with important regulatory and structural roles in the berries of grapevine (Vitis vinifera L.). On the other hand, the proton-cation exchanger CAX proteins have been shown to impact Ca 2+ homeostasis with important consequences for fruit integrity and resistance to biotic/abiotic stress. Here, the CAX gene found in transcriptomic databases as having one of the highest expressions in grapevine tissues, VvCAX3, was cloned and functionally characterized. Heterologous expression in yeast showed that a truncated version of VvCAX3 lacking its NNR autoinhibitory domain (sCAX3) restored the ability of the yeast strain to grow in 100-200 mM Ca 2+ , demonstrating a role in Ca 2+ transport. The truncated VvCAX3 was further shown to be involved in the transport of Na + , Li + , Mn 2+ and Cu 2+ in yeast cells. Subcellular localization studies using fluorescently tagged proteins confirmed VvCAX3 as a tonoplast transporter. VvCAX3 is expressed in grapevine stems, leaves, roots, and berries, especially at pea size, decreasing gradually throughout development, in parallel with the pattern of calcium accumulation in the fruit. The transcript abundance of VvCAX3 was shown to be regulated by methyl jasmonate (MeJA), Ca 2+ , and Na + in grape cell suspensions, and the VvCAX3 promotor contains several predicted cis-acting elements related to developmental and stress response processes. As a whole, the results obtained add new insights on the mechanisms involved in calcium homeostasis and intracellular compartmentation in grapevine, and indicate that VvCAX3 may be an interesting target towards the development of strategies for enhancement of grape berry properties.

Method validation for determination of metals in Vitis labrusca L. grapevine leaf extracts by inductively coupled plasma mass spectrometry (ICP-MS

Directory of Open Access Journals (Sweden)

LIANE V.V. BOKOWSKI

Full Text Available ABSTRACT Vitis labrusca L. is the main species used for wine and juice production in Brazil. The grapevine leaves can be used both as functional foods and as cheapest sources for the extraction of phenolic compounds. Besides the antioxidant activity, grapevine leaves exhibited significant anti-inflammatory activity. Therefore, the aim of this study was to develop and validate an analytical methodology to determine the metals selenium (96Se, chromium (53Cr, nickel (62Ni, cadmium (111Cd and lead (206Pb in 30 samples of grapevine leaf extracts (Vitis labrusca, Bordo cultivar using inductively coupled plasma mass spectrometry (ICP-MS. To obtain the grapevine leaf extracts the samples were milled, weighed and digested in microwave oven with nitric acid. The method showed linearity, precision, accuracy and limits of quantification and detection acceptable for INMETRO protocol validation of analytical methods. Therefore, the method using ICP-MS was developed and validated to determine metals concentrations in grapevine leaves of Vitis labrusca L. and the proposed method could be applied in routine analytical laboratory.

Grapevine fruit extract protects against radiation-induced oxidative stress and apoptosis in human lymphocyte

International Nuclear Information System (INIS)

Singha, Indrani; Das, Subir Kumar

2015-01-01

Ionizing radiation (IR) causes oxidative stress through overwhelming generation of reactive oxygen species (ROS) in the living cells leading the oxidative damage further to biomolecules. Grapevine (Vitis vinifera L.) posses several bioactive phytochemicals and is the richest source of antioxidants. In this study, we investigated V. vinifera for its phytochemical content, enzymes profile and, ROS-and oxidant-scavenging activities. We have also studied the fruit extract of four different grapevine viz., Thompson seedless, Flame seedless, Kishmish chorni and Red globe for their radioprotective actions in human lymphocytes. The activities of ascorbic acid oxidase and catalase significantly (P < 0.01) differed among extracts within the same cultivar, while that of peroxidase and polyphenol oxidase did not differ significantly. The superoxide radical-scavenging activity was higher in the seed as compared to the skin or pulp of the same cultivar. Pretreatment with grape extracts attenuated the oxidative stress induced by 4 Gy γ-radiation in human lymphocytes in vitro. Further, γ-radiation-induced increase in caspase 3/7 activity was significantly attenuated by grape extracts. These results suggest that grape extract serve as a potential source of natural antioxidants against the IR-induced oxidative stress and also inhibit apoptosis. Furthermore, the protective action of grape depends on the source of extract (seed, skin or pulp) and type of the cultivars. (author)

A water stress index based on water balance modelling for discrimination of grapevine quality and yield

Directory of Open Access Journals (Sweden)

Rémi Gaudin

2014-01-01

Significance and impact of the study: This water stress index is a valuable tool for explaining the variations in grape yield and quality among various locations and years because it reflects the vineyard water stress history in relation to rainfall regime and soil conditions. Improvement would come from the simulation of FTSW during winter, notably for soils of high Total Transpirable Soil Water. One potential application is the quantification of water stress change brought by irrigation in Mediterranean vineyards, and its relation to grapevine production.

Genes expressed in grapevine leaves reveal latent wood infection by the fungal pathogen Neofusicoccum parvum.

Directory of Open Access Journals (Sweden)

Stefan Czemmel

Full Text Available Some pathogenic species of the Botryosphaeriaceae have a latent phase, colonizing woody tissues while perennial hosts show no apparent symptoms until conditions for disease development become favorable. Detection of these pathogens is often limited to the later pathogenic phase. The latent phase is poorly characterized, despite the need for non-destructive detection tools and effective quarantine strategies, which would benefit from identification of host-based markers in leaves. Neofusicoccum parvum infects the wood of grapevines and other horticultural crops, killing the fruit-bearing shoots. We used light microscopy and high-resolution computed tomography (HRCT to examine the spatio-temporal relationship between pathogen colonization and anatomical changes in stem sections. To identify differentially-expressed grape genes, leaves from inoculated and non-inoculated plants were examined using RNA-Seq. The latent phase occurred between 0 and 1.5 months post-inoculation (MPI, during which time the pathogen did not spread significantly beyond the inoculation site nor were there differences in lesion lengths between inoculated and non-inoculated plants. The pathogenic phase occurred between 1.5 and 2 MPI, when recovery beyond the inoculation site increased and lesion lengths of inoculated plants tripled. By 2 MPI, inoculated plants also had decreased starch content in xylem fibers and rays, and increased levels of gel-occluded xylem vessels, the latter of which HRCT revealed at a higher frequency than microscopy. RNA-Seq and screening of 21 grape expression datasets identified 20 candidate genes that were transcriptionally-activated by infection during the latent phase, and confirmed that the four best candidates (galactinol synthase, abscisic acid-induced wheat plasma membrane polypeptide-19 ortholog, embryonic cell protein 63, BURP domain-containing protein were not affected by a range of common foliar and wood pathogens or abiotic stresses

The sulfated laminarin triggers a stress transcriptome before priming the SA- and ROS-dependent defenses during grapevine's induced resistance against Plasmopara viticola.

Directory of Open Access Journals (Sweden)

Adrien Gauthier

Full Text Available Grapevine (Vitis vinifera is susceptible to many pathogens which cause significant losses to viticulture worldwide. Chemical control is available, but agro-ecological concerns have raised interest in alternative methods, especially in triggering plant immunity by elicitor treatments. The β-glucan laminarin (Lam and its sulfated derivative (PS3 have been previously demonstrated to induce resistance in grapevine against downy mildew (Plasmopara viticola. However, if Lam elicits classical grapevine defenses such as oxidative burst, pathogenesis-related (PR-proteins and phytoalexin production, PS3 triggered grapevine resistance via a poorly understood priming phenomenon. The aim of this study was to identify the molecular mechanisms of the PS3-induced resistance. For this purpose we studied i the signaling events and transcriptome reprogramming triggered by PS3 treatment on uninfected grapevine, ii grapevine immune responses primed by PS3 during P. viticola infection. Our results showed that i PS3 was unable to elicit reactive oxygen species (ROS production, cytosolic Ca(2+ concentration variations, mitogen-activated protein kinase (MAPK activation but triggered a long lasting plasma membrane depolarization in grapevine cells, ii PS3 and Lam shared a common stress-responsive transcriptome profile that partly overlapped the salicylate- (SA and jasmonate-(JA-dependent ones. After P. viticola inoculation, PS3 specifically primed the SA- and ROS-dependent defense pathways leading to grapevine induced resistance against this biotroph. Interestingly pharmacological approaches suggested that the plasma membrane depolarization and the downstream ROS production are key events of the PS3-induced resistance.

Genome-wide analysis of the grapevine stilbene synthase multigenic family: genomic organization and expression profiles upon biotic and abiotic stresses

Directory of Open Access Journals (Sweden)

Vannozzi Alessandro

2012-08-01

Full Text Available Abstract Background Plant stilbenes are a small group of phenylpropanoids, which have been detected in at least 72 unrelated plant species and accumulate in response to biotic and abiotic stresses such as infection, wounding, UV-C exposure and treatment with chemicals. Stilbenes are formed via the phenylalanine/polymalonate-route, the last step of which is catalyzed by the enzyme stilbene synthase (STS, a type III polyketide synthase (PKS. Stilbene synthases are closely related to chalcone synthases (CHS, the key enzymes of the flavonoid pathway, as illustrated by the fact that both enzymes share the same substrates. To date, STSs have been cloned from peanut, pine, sorghum and grapevine, the only stilbene-producing fruiting-plant for which the entire genome has been sequenced. Apart from sorghum, STS genes appear to exist as a family of closely related genes in these other plant species. Results In this study a complete characterization of the STS multigenic family in grapevine has been performed, commencing with the identification, annotation and phylogenetic analysis of all members and integration of this information with a comprehensive set of gene expression analyses including healthy tissues at differential developmental stages and in leaves exposed to both biotic (downy mildew infection and abiotic (wounding and UV-C exposure stresses. At least thirty-three full length sequences encoding VvSTS genes were identified, which, based on predicted amino acid sequences, cluster in 3 principal groups designated A, B and C. The majority of VvSTS genes cluster in groups B and C and are located on chr16 whereas the few gene family members in group A are found on chr10. Microarray and mRNA-seq expression analyses revealed different patterns of transcript accumulation between the different groups of VvSTS family members and between VvSTSs and VvCHSs. Indeed, under certain conditions the transcriptional response of VvSTS and VvCHS genes appears to be

Effects of Bois noir on carbon assimilation, transpiration, stomatal conductance of leaves and yield of grapevine (Vitis vinifera) cv. Chardonnay.

Science.gov (United States)

Endeshaw, Solomon T; Murolo, Sergio; Romanazz, Gianfranco; Neri, Davide

2012-06-01

Bois noir (BN) is one of the main phytoplasma diseases of grapevine (Vitis vinifera). It is widespread, and can cause severe losses in European vineyards. The infective agent colonizes phloem elements and induces visible symptoms of leaf yellowing or reddening after a relatively long incubation period. As the most sensitive cultivars to BN, Chardonnay plants were grouped as healthy or symptomatic in spring, based on the records from the previous year. Leaf gas exchange and chlorophyll a fluorescence were measured weekly from July to September in healthy plants, and in symptomatic and asymptomatic leaves from symptomatic plants. The midday relative water content (mRWC) was measured once per month. The detection of phytoplasma DNA by nested-polymerase chain reaction revealed BN infection in symptomatic leaf samples at the end of September. A significant decrease in pigment content and maximum quantum efficiency of photosystem II (Fv/Fm) of these symptomatic leaves was detected from July to September, although in the asymptomatic leaves of the symptomatic plants the net photosynthesis (Pn) decrease was not significant. In the leaves from the healthy plants, Pn and transpiration were relatively stable. Of note, in July, an initially healthy plant showed a strong Pn reduction that was followed by visible leaf yellowing symptoms only in August. The phytoplasma infection also stimulated significant reductions in mRWC of the symptomatic leaves, with a final large decrease in yield.

Selection of grapevine leaf varieties for culinary process based on phytochemical composition and antioxidant properties.

Science.gov (United States)

Lima, Adriano; Bento, Albino; Baraldi, Ilton; Malheiro, Ricardo

2016-12-01

Grapevine leaves are an abundant sub-product of vineyards which is devalued in many regions. The objective of this work is to study the antioxidant activity and phytochemical composition of ten grapevine leaf varieties (four red varieties: Tinta Amarela, Tinta Roriz, Touriga Franca, and Touriga Nacional; and six white varieties: Côdega do Larinho, Fernão Pires, Gouveio, Malvasia Fina, Rabigato, and Viosinho) to select varieties to be used as food ingredients. White grapevine leaves revealed higher antioxidant potential. Malvasia Fina reported better antioxidant properties contrasting with Touriga Franca. Phenolic content varied between 112 and 150mgGAEg(-1) of extract (gallic acid equivalents), hydroxycinnamic acid derivatives and flavonols varied between 76 and 108mgCAEg(-1) of extract (caffeic acid equivalents) and 39 and 54mgQEg(-1) of extract (quercetin equivalents). Malvasia Fina is a good candidate for culinary treatment due to its antioxidant properties and composition in bioactive compounds. Copyright © 2016 Elsevier Ltd. All rights reserved.

Nitrogen metabolism in a grapevine in vitro system

Directory of Open Access Journals (Sweden)

Nuria Llorens

2002-09-01

Full Text Available Ammonium, nitrate, nitrite, protein and individual and total amino acid contents were determined in grapevine (cv Sauvignon cultured in vitro. The enzyme activities of nitrate and nitrite reductases, glutamine synthetase, glutamate synthetase and dehydrogenase were also determined. The nitrogen taken up by the plants was 70% of the total nitrogen in the medium after 75 days of in vitro culture. Most of the nitrogen taken up was recovered in the leaves, yet only ammonia and amino acid concentrations were significantly higher in leaves. In roots, glutamine was the most abundant amino acid. In leaves, the most abundant amino acids were aspartate, glutamate, glutamine, alanine, arginine and g-aminobutirate. All enzyme activities were higher in roots than in leaves. These results suggest that both roots and leaves incorporate inorganic nitrogen into organic forms.

Localization and subcellular association of Grapevine Pinot Gris Virus in grapevine leaf tissues.

Science.gov (United States)

Tarquini, Giulia; Ermacora, Paolo; Bianchi, Gian Luca; De Amicis, Francesca; Pagliari, Laura; Martini, Marta; Loschi, Alberto; Saldarelli, Pasquale; Loi, Nazia; Musetti, Rita

2018-05-01

Despite the increasing impact of Grapevine Pinot gris disease (GPG-disease) worldwide, etiology about this disorder is still uncertain. The presence of the putative causal agent, the Grapevine Pinot Gris Virus (GPGV), has been reported in symptomatic grapevines (presenting stunting, chlorotic mottling, and leaf deformation) as well as in symptom-free plants. Moreover, information on virus localization in grapevine tissues and virus-plant interactions at the cytological level is missing at all. Ultrastructural and cytochemical investigations were undertaken to detect virus particles and the associated cytopathic effects in field-grown grapevine showing different symptom severity. Asymptomatic greenhouse-grown grapevines, which tested negative for GPGV by real time RT-PCR, were sampled as controls. Multiplex real-time RT-PCR and ELISA tests excluded the presence of viruses included in the Italian certification program both in field-grown and greenhouse-grown grapevines. Conversely, evidence was found for ubiquitous presence of Grapevine Rupestris Stem Pitting-associated Virus (GRSPaV), Hop Stunt Viroid (HSVd), and Grapevine Yellow Speckle Viroid 1 (GYSVd-1) in both plant groups. Moreover, in every field-grown grapevine, GPGV was detected by real-time RT-PCR. Ultrastructural observations and immunogold labelling assays showed filamentous flexuous viruses in the bundle sheath cells, often located inside membrane-bound organelles. No cytological differences were observed among field-grown grapevine samples showing different symptom severity. GPGV localization and associated ultrastructural modifications are reported and discussed, in the perspective of assisting management and control of the disease.

A multimodal image sensor system for identifying water stress in grapevines

Science.gov (United States)

Zhao, Yong; Zhang, Qin; Li, Minzan; Shao, Yongni; Zhou, Jianfeng; Sun, Hong

2012-11-01

Water stress is one of the most common limitations of fruit growth. Water is the most limiting resource for crop growth. In grapevines, as well as in other fruit crops, fruit quality benefits from a certain level of water deficit which facilitates to balance vegetative and reproductive growth and the flow of carbohydrates to reproductive structures. A multi-modal sensor system was designed to measure the reflectance signature of grape plant surfaces and identify different water stress levels in this paper. The multi-modal sensor system was equipped with one 3CCD camera (three channels in R, G, and IR). The multi-modal sensor can capture and analyze grape canopy from its reflectance features, and identify the different water stress levels. This research aims at solving the aforementioned problems. The core technology of this multi-modal sensor system could further be used as a decision support system that combines multi-modal sensory data to improve plant stress detection and identify the causes of stress. The images were taken by multi-modal sensor which could output images in spectral bands of near-infrared, green and red channel. Based on the analysis of the acquired images, color features based on color space and reflectance features based on image process method were calculated. The results showed that these parameters had the potential as water stress indicators. More experiments and analysis are needed to validate the conclusion.

Investigation of Catalase, Proxidase and Total Protein Level in Some Cold Treated Grapevine Cultivars Cold Stress Response

Directory of Open Access Journals (Sweden)

M. Karimi Alavijeh

2016-02-01

Full Text Available Chilling is an important environmental stress that influences the yield and quality of many agricultural crops. Different plants use different systems to endure this stress and minimize its effects. One of these systems is enzymatic reaction. To find out more about responses of different grapevine species and cultivars to the low temperature conditions, their enzymatic changes were evaluated in a factorial experiment based on randomized complete design with 3 replication during different periods after chilling stress. Leaf samples of plants under cold stress had been taken and maintained in -80 °C until enzyme extraction. Low temperature around 4 °C is sufficient to induce genes that produce chilling acclimatization proteins. In the present study, leaf samples were collected from the plants that were kept at 4 °C during different time intervals, and then total proteins as well as two main antioxidant enzymes (catalase and guaiacolperoxidase activities were measured. Results showed that as temperature decreased, enzymatic activities were increased in six Iranian grapevine cultivars (‘Atabaki’, ‘Khalili-Danedar’, ‘Shahroodi’, ‘Rajabi-Siah’, ‘Askari’ and ‘Bidane-Sefid’ as well as ‘Riparia’, an American species. The highest enzymatic activities of catalase and ceroxidase were recorded in ‘Khalili-Danedar’ and ‘Riparia’. However,the lowest activities were recorded in ‘Rajabi-Siah’, ‘Bidane-Sefid’ and ‘Shahroodi’. For all studied cultivars, peroxidase showed its highest activity at 12 h after chilling stress, then remained constant, while, the highest activity of catalase were recorded at 8 h. In addition, cold stress increased the total protein content for all studied cultivars, in which ‘Khalili-Danedar’ had the highest protein content amongstudied cultivars. Also, the highest proteins content were recorded at 12 h after exposing plants to cold.

Hydraulics and gas exchange recover more rapidly from severe drought stress in small pot-grown grapevines than in field-grown plants.

Science.gov (United States)

Romero, Pascual; Botía, Pablo; Keller, Markus

2017-09-01

Modifications of plant hydraulics and shoot resistances (R shoot ) induced by water withholding followed by rewatering, and their relationships with plant water status, leaf gas exchange and water use efficiency at the leaf level, were investigated in pot-grown and field-grown, own-rooted Syrah grapevines in an arid climate. Water stress induced anisohydric behavior, gradually reducing stomatal conductance (g s ) and leaf photosynthesis (A) in response to decreasing midday stem water potential (Ψ s ). Water stress also rapidly increased intrinsic water-use efficiency (A/g s ); this effect persisted for many days after rewatering. Whole-plant (K plant ), canopy (K canopy ), shoot (K shoot ) and leaf (K leaf ) hydraulic conductances decreased during water stress, in tune with the gradual decrease in Ψ s , leaf gas exchange and whole plant water use. Water-stressed vines also had a lower Ψ gradient between stem and leaf (ΔΨ l ), which was correlated with lower leaf transpiration rate (E). E and ΔΨ l increased with increasing vapour pressure deficit (VPD) in non-stressed control vines but not in stressed vines. Perfusion of xylem-mobile dye showed that water flow to petioles and leaves was substantially reduced or even stopped under moderate and severe drought stress. Leaf blade hydraulic resistance accounted for most of the total shoot resistance. However, hydraulic conductance of the whole root system (K root ) was not significantly reduced until water stress became very severe in pot-grown vines. Significant correlations between K plant , K canopy and Ψ s , K canopy and leaf gas exchange, K leaf and Ψ s , and K leaf and A support a link between water supply, leaf water status and gas exchange. Upon re-watering, Ψ s recovered faster than gas exchange and leaf-shoot hydraulics. A gradual recovery of hydraulic functionality of plant organs was also observed, the leaves being the last to recover after rewatering. In pot-grown vines, K canopy recovered rather

Grapevine fruiting cuttings: validation of an experimental system to study grapevine physiology. I. Main vegetative characteristics

Directory of Open Access Journals (Sweden)

Nathalie Ollat

1998-03-01

Full Text Available A method for producing fruiting cuttings of grapevine cv. Cabernet Sauvignon is described. The main developmental features of these cuttings are presented. The clusters reach maturity after 5 months and the period of cluster development is not shortened. Before flowering, a careful control of stem and leaf growth improves the partitioning of stored carbon towards the roots and the cluster. Vegetative growth occurs mainly between fruit set and veraison. During ripening, the leaf to fruit ratio is between 20 and 30 cm2 of leaf area per gram of fruit. In the cuttings as well as in grapevines from the vineyard, free polyamine content in the leafblade does not change during development. Conjugate polyamine content does not evolve in the same way. It peaks at veraison for vineyard leaves but decreases continuously for cuttings. A proper nutrient solution provides a minerai composition in accordance with viticultural requirements. The cuttings also behave like vineyard plants in response to different levels of potassium in the nutrient solution.

Downy mildew resistance induced by Trichoderma harzianum T39 in susceptible grapevines partially mimics transcriptional changes of resistant genotypes

Science.gov (United States)

2012-01-01

Background Downy mildew, caused by Plasmopara viticola, is one of the most severe diseases of grapevine and is commonly controlled by fungicide treatments. The beneficial microorganism Trichoderma harzianum T39 (T39) can induce resistance to downy mildew, although the molecular events associated with this process have not yet been elucidated in grapevine. A next generation RNA sequencing (RNA-Seq) approach was used to study global transcriptional changes associated with resistance induced by T39 in Vitis vinifera Pinot Noir leaves. The long-term aim was to develop strategies to optimize the use of this agent for downy mildew control. Results More than 14.8 million paired-end reads were obtained for each biological replicate of T39-treated and control leaf samples collected before and 24 h after P. viticola inoculation. RNA-Seq analysis resulted in the identification of 7,024 differentially expressed genes, highlighting the complex transcriptional reprogramming of grapevine leaves during resistance induction and in response to pathogen inoculation. Our data show that T39 has a dual effect: it directly modulates genes related to the microbial recognition machinery, and it enhances the expression of defence-related processes after pathogen inoculation. Whereas several genes were commonly affected by P. viticola in control and T39-treated plants, opposing modulation of genes related to responses to stress and protein metabolism was found. T39-induced resistance partially inhibited some disease-related processes and specifically activated defence responses after P. viticola inoculation, causing a significant reduction of downy mildew symptoms. Conclusions The global transcriptional analysis revealed that defence processes known to be implicated in the reaction of resistant genotypes to downy mildew were partially activated by T39-induced resistance in susceptible grapevines. Genes identified in this work are an important source of markers for selecting novel

Melatonin-producing endophytic bacteria from grapevine roots promote the abiotic stress-induced production of endogenous melatonin in their hosts

Directory of Open Access Journals (Sweden)

Jian Jiao

2016-09-01

Full Text Available Endophytes form symbiotic relationships with plants and constitute an important source of phytohormones and bioactive secondary metabolites for their hosts. To date, most studies of endophytes have focused on the influence of these microorganisms on plant growth and physiology and their role in plant defenses against biotic and abiotic stressors; however, to the best of our knowledge, the ability of endophytes to produce melatonin has not been reported. In the present study, we isolated and identified root-dwelling bacteria from three grapevine varieties and found that, when cultured under laboratory conditions, some of the bacteria strains secreted melatonin and tryptophan-ethyl ester. The endophytic bacterium Bacillus amyloliquefaciens SB-9 exhibited the highest level of in vitro melatonin secretion and also produced three intermediates of the melatonin biosynthesis pathway: 5-hydroxytryptophan, serotonin, and N-acetylserotonin. After B. amyloliquefaciens SB-9 colonization, the plantlets exhibited increased plant growth. Additionally, we found that, in grapevine plantlets exposed to salt or drought stress, colonization by B. amyloliquefaciens SB-9 increased the upregulation of melatonin synthesis, as well as that of its intermediates, but reduced the upregulation of grapevine tryptophan decaboxylase genes (VvTDCs and a serotonin N-acetyltransferase gene (VvSNAT transcription, when compared to the un-inoculated control. Colonization by B. amyloliquefaciens SB-9 was also able to counteract the adverse effects of salt- and drought-induced stress by reducing the production of malondialdehyde and reactive oxygen species (H2O2 and O2− in roots. Therefore, our findings demonstrate the occurrence of melatonin biosynthesis in endophytic bacteria and provide evidence for a novel form of communication between beneficial endophytes and host plants via melatonin.

Drought adaptation strategies of four grapevine cultivars (Vitis vinifera L.: modification of the properties of the leaf area

Directory of Open Access Journals (Sweden)

María Gómez-del-Campo

2003-09-01

Full Text Available This essay studies the morphological and anatomical properties of the leaves of Garnacha tinta, Tempranillo, Chardonnay and Airén grapevines in order to discover the drought adaptation strategies present in Vitis vinifera L. The grapevines were grown under two water availability conditions: water limitation and non-water limitation. There was a significantly lower development of leaf area under conditions of water limitation compared to non-water limitation due to a reduction in the size of main and lateral shoot leaves, and a smaller number of leaves on lateral shoots. The development of the leaf area under water limitation conditions occurred on earlier dates than under non-water limitation conditions. Significantly lower stomatal density was observed under water limitation conditions rather than non-water limitation conditions exclusively in the Airén cultivar.

Antioxidant Activity of Grapevine Leaf Extracts against Oxidative Stress Induced by Carbon Tetrachloride in Cerebral Cortex, Hippocampus and Cerebellum of Rats

Directory of Open Access Journals (Sweden)

Mariane Wohlenberg

2014-04-01

Full Text Available In recent years, it has become increasingly important to study the beneficial properties of derivatives of grapes and grapevine. The objective of this study was to determine the antioxidant activity of Vitis labrusca leaf extracts, comparing conventional and organic grapevines, in different brain areas of rats. We used male Wistar rats treated with grapevine leaf extracts for a period of 14 days, and on the 15th day, we administered in half of the rats, mineral oil and the other half, carbon tetrachloride (CCl4. The animals were euthanized by decapitation and the cerebral cortex, hippocampus and cerebellum were removed to assess oxidative stress parameters and the activity of antioxidant enzymes. Lipid peroxidation levels (TBARS were unchanged. However, CCl4 induced oxidative damage to proteins in all tissues studied, and this injury was prevented by both extracts. Superoxide dismutase (SOD activity was increased by CCl4 in the cerebral cortex and decreased in other tissues. However, CCl4 increased catalase (CAT activity in the cerebellum and decreased it in the cerebral cortex. The SOD/CAT ratio was restored in the cerebellum by both extracts and only in the cerebral cortex by the organic extract.

General properties of grapevine viruses occurring in Hungary

Directory of Open Access Journals (Sweden)

Eszter Cseh

2012-03-01

Full Text Available The past fifty years important advances have been made in the field of grapevine virus research, including characterization of pathogens and control measurements. Still the occurrence of Grapevine fanleaf virus (GFLV, Arabis mosaic virus (ArMV, Tomato black ring virus (TBRV, Grapevine chrome mosaic virus (GCMV, Alfalfa mosaic virus (AMV, Grapevine Bulgarian latent virus (GBLV, Grapevine fleck virus (GFkV, Grapevine leafroll- associated viruses (GLRaV1-4, Grapevine virus A (GVA, Grapevine virus B (GVB and Grapevine rupestris stem pitting- associated virus (GRSPaV have been reported in Hungary and characterized by conventional methods as woody indexing, herbaceous indexing and serological methods. Among grapevine viruses the Grapevine line pattern virus (GLPV seems to be uncial; because it was reported only in Hungary. Causal agents of several grapevine diseases, like enation, vein necrosis and vein mosaic remained undiscovered. These virus-like diseases occurred only sporadically, without economic importance.

Identification and Prevalence of Grapevine fanleaf virus in Khorasan-Razavi Vineyards

Directory of Open Access Journals (Sweden)

Z. Gholampour

2016-02-01

phosphate buffer. Total plant RNA were extracted from fresh leaves using silicon dioxide (Boom et al. 1990. The cDNA strand was synthesized using Moloney murine leukemia virus (MMuLV reverse transcriptase. The partial length of coat protein gene of GFLV isolates was further amplified using DetF (CGGCAGACTGGCAAGCTGT and DetR (GGTCCAGTTTAATTGCCATCCA specific primer pair by RT-PCR in leaf samples that were positive in DAS-ELISA. PCR products were run on 1% agarose gel containing 0.5 µg/ml DNA Green Viewer, and visualized under UV irradiation. The PCR products were purified using the Qiaquick PCR purification kit (Qiagen, then were sequenced bidirectionally using DetF/DetRspecific primer pair. Consensus sequences were verified using the BLAST program in NCBI database. Multiple sequence alignments of the nucleotide sequences of the coat protein gene Phylogenetic analysis were carried out by the Neighbour-joining method implemented in MEGA v.5 Results and Discussion: 187 out of 280 samples were found to be infected with GFLV in indirect ELISA. Based on ELISA results, GFLV infection rate in Khorasan-Razavi ranging from 32% to 63%. Kashmar had the most infected vineyards with the prevalence of the virus in 90% of the samples. GFLV induced yellow mosaic and vein banding in infected leaves. Shorten internode, the zigzag growth of stem and double nude were observed in infected grapevines, however, most of the GFLV infected vines were symptomless. Mechanical inoculation with sap extracts from the GFLV positive leaf samples, induced chlorotic local lesions followed by vein clearing in systemic leaves of Chenopodium quinoa two weeks post inoculation. RT-PCR using specific primers amplify 1000 bp fragment corresponding to the GFLV coat protein gene. No fragment was observed in healthy control. Pairwise comparisons of the coat protein gene of four Iranian isolates showed 89%–97% nucleotide sequence identity and 90%–92% identity at the amino acid level with those of previously

General properties of grapevine viruses occurring in Hungary

OpenAIRE

Eszter Cseh; András Takács; László Kocsis; Richard Gáborjányi

2012-01-01

The past fifty years important advances have been made in the field of grapevine virus research, including characterization of pathogens and control measurements. Still the occurrence of Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Tomato black ring virus (TBRV), Grapevine chrome mosaic virus (GCMV), Alfalfa mosaic virus (AMV), Grapevine Bulgarian latent virus (GBLV), Grapevine fleck virus (GFkV), Grapevine leafroll- associated viruses (GLRaV1-4), Grapevine virus A (GVA), Grape...

Forest management guidelines for controlling wild grapevines

Science.gov (United States)

H. Clay Smith

1984-01-01

Grapevines (Vitis spp.) are becoming a major problem to forest managers in the Appalachians, especially when clearcutting is done on highly productive hardwood sites. Where present, grapevines can reduce tree quality and growth, and eventually kill the tree. Silvical characteristics of grapevines are discussed as background for grapevine control....

Identification of Eutypa lata, a Grapevine Parasite

Directory of Open Access Journals (Sweden)

Goran Delibašić

2006-01-01

Full Text Available The phytopathogenic fungus Eutypa lata (Pers.: Fr. Tul. and C. Tul., the causing agent of eutypa dieback, has been increasingly often identified in recent times as a cause of grapevine disease. It was first discovered and identified in Australian vineyards (Carter,1973, where it represented one of the most dangerous fungus pathogens of this plant. A few years later it was discovered in European vineyards as well. This polyfagous fungus,known originally as E. armeniaca (Honsf. & Carter, was first discovered on apricot, on which it caused the “gummosis disease”.In Serbia, Eutypa lata has not been determined officially. However, bearing in mind the form of its spreading (anemochory, as well as the fact that our country is a major producer of grape and fruit, we need to pay special attention to this dangerous pathogen since thereare indications that it is already present in our vineyards.During the period between 2003 and 2005, an inspection of a great number of vineyards in the areas of Vršac, Fruška Gora and Kruševac, was conducted. Many of them had grapevines with typical eutypa dieback symptoms. The aim of the inspection was to find grapevines with this disease, to mark them and take samples for laboratory analysis. Marking suspicious grapevines enabled us to monitor the volume of symptoms, as well as other changes on grapevines. Different colours were used for markings, according to the principle “same colour – same year” The procedure revealed that the average periodbetween early and mild disease symptoms and extreme changes, including withering of entire vines, was 2 to 3 years.The signs of eutypa dieback on diseased grapevines are manifested: on leaves in the form of chlorosis, twisting, necrosis of the edges, drying out and falling off; on shoots,where the shortening of internodia is noticable, as well as colour change and “zig-zag” distribution of internodes; on blossoms and clusters, where absence of flowering, partial

Inspection of the grapevine BURP superfamily highlights an expansion of RD22 genes with distinctive expression features in berry development and ABA-mediated stress responses.

Science.gov (United States)

Matus, José Tomás; Aquea, Felipe; Espinoza, Carmen; Vega, Andrea; Cavallini, Erika; Dal Santo, Silvia; Cañón, Paola; Rodríguez-Hoces de la Guardia, Amparo; Serrano, Jennifer; Tornielli, Giovanni Battista; Arce-Johnson, Patricio

2014-01-01

The RESPONSIVE TO DEHYDRATION 22 (RD22) gene is a molecular link between abscisic acid (ABA) signalling and abiotic stress responses. Its expression has been used as a reliable ABA early response marker. In Arabidopsis, the single copy RD22 gene possesses a BURP domain also located at the C-terminus of USP embryonic proteins and the beta subunit of polygalacturonases. In grapevine, a RD22 gene has been identified but putative paralogs are also found in the grape genome, possibly forming a large RD22 family in this species. In this work, we searched for annotations containing BURP domains in the Vitis vinifera genome. Nineteen proteins were defined by a comparative analysis between the two genome predictions and RNA-Seq data. These sequences were compared to other plant BURPs identified in previous genome surveys allowing us to reconceive group classifications based on phylogenetic relationships and protein motif occurrence. We observed a lineage-specific evolution of the RD22 family, with the biggest expansion in grapevine and poplar. In contrast, rice, sorghum and maize presented highly expanded monocot-specific groups. The Vitis RD22 group may have expanded from segmental duplications as most of its members are confined to a region in chromosome 4. The inspection of transcriptomic data revealed variable expression of BURP genes in vegetative and reproductive organs. Many genes were induced in specific tissues or by abiotic and biotic stresses. Three RD22 genes were further studied showing that they responded oppositely to ABA and to stress conditions. Our results show that the inclusion of RNA-Seq data is essential while describing gene families and improving gene annotations. Robust phylogenetic analyses including all BURP members from other sequenced species helped us redefine previous relationships that were erroneously established. This work provides additional evidence for RD22 genes serving as marker genes for different organs or stresses in grapevine.

Interaction of Ulocladium atrum, a Potential Biological Control Agent, with Botrytis cinerea and Grapevine Plantlets

Directory of Open Access Journals (Sweden)

Sébastien Ronseaux

2013-09-01

Full Text Available The effectiveness of biological control agent, Ulocladium atrum (isolates U13 and U16 in protecting Vitis vinifera L. cv. Chardonnay against gray mold disease caused by Botrytis cinerea, and simulation of the foliar defense responses was investigated. A degraded mycelium structure during cultural assay on potato dextrose agar revealed that U. atrum isolates U13 and U16 were both antagonistic to B. cinerea, mainly when isolates were inoculated two days before Botrytis. Under in vitro conditions, foliar application of U. atrum protected grapevine leaves against gray mold disease. An increase in chitinase activity was induced by the presence of U. atrum isolates indicating that the biological control agents triggered plant defense mechanisms. Moreover, U13 has the potential to colonize the grapevine plantlets and to improve their growth. The ability of U. atrum isolates to exhibit an antagonistic effect against B. cinerea in addition to their aptitude to induce plant resistance and to promote grapevine growth may explain a part of their biological activity. Hence, this study suggests that U. atrum provides a suitable biocontrol agent against gray mold in grapevines.

Wild grapevine management

Science.gov (United States)

H. Clay Smith

1989-01-01

Wild grapevines are a problem for forest managers in many areas of the central hardwood forests. The vines grow on a wide range of soil and site conditions but usually are more concentrated on good sites (northern red oak site index 70 and above), on the faster growing more valuable timber. Presently there is more interest and concern in controlling grapevine for the...

Grapevine fatty acid hydroperoxide lyase generates actin-disrupting volatiles and promotes defence-related cell death

Science.gov (United States)

Wang, Hao; Claudel, Patricia; Riemann, Michael; Hause, Bettina; Hugueney, Philippe; Nick, Peter

2018-01-01

Abstract Fatty acid hydroperoxides can generate short-chained volatile aldehydes that may participate in plant defence. A grapevine hydroperoxide lyase (VvHPL1) clustering to the CYP74B class was functionally characterized with respect to a role in defence. In grapevine leaves, transcripts of this gene accumulated rapidly to high abundance in response to wounding. Cellular functions of VvHPL1 were investigated upon heterologous expression in tobacco BY-2 cells. A C-terminal green fluorescent protein (GFP) fusion of VvHPL1 was located in plastids. The overexpression lines were found to respond to salinity stress or the bacterial elicitor harpin by increasing cell death. This signal-dependent mortality response was mitigated either by addition of exogenous jasmonic acid or by treatment with diphenyleneiodonium (DPI), an inhibitor of NADPH oxidases. By feeding different substrates to recombinantly expressed enzyme, VvHPL1 could also be functionally classified as true 13-HPL. The cognate products generated by this 13-HPL were cis-3-hexenal and trans-2-hexenal. Using a GFP-tagged actin marker line, one of these isomeric products, cis-3-hexenal, was found specifically to elicit a rapid disintegration of actin filaments. This response was not only observed in the heterologous system (tobacco BY-2), but also in a grapevine cell strain expressing this marker, as well as in leaf discs from an actin marker grape used as a homologous system. These results are discussed in the context of a role for VvHPL1 in a lipoxygenase-dependent signalling pathway triggering cell death-related defence that bifurcates from jasmonate-dependent basal immunity. PMID:29659985

Cyclic lipopeptides from Bacillus subtilis activate distinct patterns of defence responses in grapevine.

Science.gov (United States)

Farace, Giovanni; Fernandez, Olivier; Jacquens, Lucile; Coutte, François; Krier, François; Jacques, Philippe; Clément, Christophe; Barka, Essaid Ait; Jacquard, Cédric; Dorey, Stéphan

2015-02-01

Non-self-recognition of microorganisms partly relies on the perception of microbe-associated molecular patterns (MAMPs) and leads to the activation of an innate immune response. Bacillus subtilis produces three main families of cyclic lipopeptides (LPs), namely surfactins, iturins and fengycins. Although LPs are involved in induced systemic resistance (ISR) activation, little is known about defence responses induced by these molecules and their involvement in local resistance to fungi. Here, we showed that purified surfactin, mycosubtilin (iturin family) and plipastatin (fengycin family) are perceived by grapevine plant cells. Although surfactin and mycosubtilin stimulated grapevine innate immune responses, they differentially activated early signalling pathways and defence gene expression. By contrast, plipastatin perception by grapevine cells only resulted in early signalling activation. Gene expression analysis suggested that mycosubtilin activated salicylic acid (SA) and jasmonic acid (JA) signalling pathways, whereas surfactin mainly induced an SA-regulated response. Although mycosubtilin and plipastatin displayed direct antifungal activity, only surfactin and mycosubtilin treatments resulted in a local long-lasting enhanced tolerance to the necrotrophic fungus Botrytis cinerea in grapevine leaves. Moreover, challenge with specific strains overproducing surfactin and mycosubtilin led to a slightly enhanced stimulation of the defence response compared with the LP-non-producing strain of B. subtilis. Altogether, our results provide the first comprehensive view of the involvement of LPs from B. subtilis in grapevine plant defence and local resistance against the necrotrophic pathogen Bo. cinerea. Moreover, this work is the first to highlight the ability of mycosubtilin to trigger an immune response in plants. © 2014 BSPP AND JOHN WILEY & SONS LTD.

Grapevine tissues and phenology differentially affect soluble carbohydrates determination by capillary electrophoresis.

Science.gov (United States)

Moreno, Daniela; Berli, Federico; Bottini, Rubén; Piccoli, Patricia N; Silva, María F

2017-09-01

Soluble carbohydrates distribution depends on plant physiology and, among other important factors, determines fruit yield and quality. In plant biology, the analysis of sugars is useful for many purposes, including metabolic studies. Capillary electrophoresis (CE) proved to be a powerful green separation technique with minimal sample preparation, even in complex plant tissues, that can provide high-resolution efficiency. Matrix effect refers to alterations in the analytical response caused by components of a sample other than the analyte of interest. Thus, the assessment and reduction of the matrix factor is fundamental for metabolic studies in different matrices. The present study evaluated the source and levels of matrix effects in the determination of most abundant sugars in grapevine tissues (mature and young leaves, berries and roots) at two phenological growth stages. Sucrose was the sugar that showed the least matrix effects, while fructose was the most affected analyte. Based on plant tissues, young leaves presented the smaller matrix effects, irrespectively of the phenology. These changes may be attributed to considerable differences at chemical composition of grapevine tissues with plant development. Therefore, matrix effect should be an important concern for plant metabolomics. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

The grapevine VvWRKY2 gene enhances salt and osmotic stress tolerance in transgenic Nicotiana tabacum.

Science.gov (United States)

Mzid, Rim; Zorrig, Walid; Ben Ayed, Rayda; Ben Hamed, Karim; Ayadi, Mariem; Damak, Yosra; Lauvergeat, Virginie; Hanana, Mohsen

2018-06-01

Our study aims to assess the implication of WRKY transcription factor in the molecular mechanisms of grapevine adaptation to salt and water stresses. In this respect, a full-length VvWRKY2 cDNA, isolated from a Vitis vinifera grape berry cDNA library, was constitutively over-expressed in Nicotiana tabacum seedlings. Our results showed that transgenic tobacco plants exhibited higher seed germination rates and better growth, under both salt and osmotic stress treatments, when compared to wild type plants. Furthermore, our analyses demonstrated that, under stress conditions, transgenic plants accumulated more osmolytes, such as soluble sugars and free proline, while no changes were observed regarding electrolyte leakage, H 2 O 2 , and malondialdehyde contents. The improvement of osmotic adjustment may be an important mechanism underlying the role of VvWRKY 2 in promoting tolerance and adaptation to abiotic stresses. Principal component analysis of our results highlighted a clear partition of plant response to stress. On the other hand, we observed a significant adaptation behaviour response for transgenic lines under stress. Taken together, all our findings suggest that over-expression of VvWRKY2 gene has a compelling role in abiotic stress tolerance and, therefore, would provide a useful strategy to promote abiotic stress tolerance in grape via molecular-assisted breeding and/or new biotechnology tools.

Biochemical method for fast affinity diagnosis in grape-vine transplantation

International Nuclear Information System (INIS)

Lilov, D.

1977-01-01

Long term experiments have proved the affinity of cv. Mavroud in transplantations on various root stocks. Best affinity was observed in the combination cv. Mavroud X Riparia tomanteau, followed, in a descending order, by the combinations Mavroud X Mavroud (autotransplantation), Mavroud X Berlandieri X Riparia Kobber SBB and Mavroud X Riparia 33 EM. In view to establish indices for predicting the transplantation affinity a great number of physiological-biochemical and morphological-anatomical studies were carried out. The results obtained showed that a most clearly expressed positive, statistically significant correlation exists between the amount of 15 N transported from the root stock to the scions, shoots and leaves. As a result, a biochemical method for fast affinity diagnosis in grape-vine transplantation has been developed. The reliability of the method has been checked up also with other cultivars. Up to the present no such method was known in grape-vine science and practice. (author)

Inspection of the grapevine BURP superfamily highlights an expansion of RD22 genes with distinctive expression features in berry development and ABA-mediated stress responses.

Directory of Open Access Journals (Sweden)

José Tomás Matus

Full Text Available The RESPONSIVE TO DEHYDRATION 22 (RD22 gene is a molecular link between abscisic acid (ABA signalling and abiotic stress responses. Its expression has been used as a reliable ABA early response marker. In Arabidopsis, the single copy RD22 gene possesses a BURP domain also located at the C-terminus of USP embryonic proteins and the beta subunit of polygalacturonases. In grapevine, a RD22 gene has been identified but putative paralogs are also found in the grape genome, possibly forming a large RD22 family in this species. In this work, we searched for annotations containing BURP domains in the Vitis vinifera genome. Nineteen proteins were defined by a comparative analysis between the two genome predictions and RNA-Seq data. These sequences were compared to other plant BURPs identified in previous genome surveys allowing us to reconceive group classifications based on phylogenetic relationships and protein motif occurrence. We observed a lineage-specific evolution of the RD22 family, with the biggest expansion in grapevine and poplar. In contrast, rice, sorghum and maize presented highly expanded monocot-specific groups. The Vitis RD22 group may have expanded from segmental duplications as most of its members are confined to a region in chromosome 4. The inspection of transcriptomic data revealed variable expression of BURP genes in vegetative and reproductive organs. Many genes were induced in specific tissues or by abiotic and biotic stresses. Three RD22 genes were further studied showing that they responded oppositely to ABA and to stress conditions. Our results show that the inclusion of RNA-Seq data is essential while describing gene families and improving gene annotations. Robust phylogenetic analyses including all BURP members from other sequenced species helped us redefine previous relationships that were erroneously established. This work provides additional evidence for RD22 genes serving as marker genes for different organs or stresses

Violaxanthin is an abscisic acid precursor in water-stressed dark-grown bean leaves

International Nuclear Information System (INIS)

Li, Yi; Walton, D.C.

1990-01-01

The leaves a dark-grown bean (Phaseolus vulgaris L.) seedlings accumulate considerably lower quantities of xanthophylls and carotenes than do leaves of light-grown seedlings, but they synthesize at least comparable amounts of abscisic acid (ABA) and its metabolites when water stressed. We observed a 1:1 relationship on a molar basis between the reduction in levels of ciolaxanthin, 9'-cis-neoxanthin, and 9-cis-violaxanthin and the accumulation of ABA, phaseic acid, and dihydrophaseic acid, when leaves from dark-grown plants were stressed for 7 hours. Early in the stress period, reductions in xanthophylls were greater than the accumulation of ABA and its metabolites, suggesting the accumulation of an intermediate which was subsequently converted to ABA. Leaves which were detached, but no stressed, did not accumulate ABA nor were their xanthophyll levels reduced. Leaves from plants that had been sprayed with cycloheximido did not accumulate ABA when stressed, nor were their xanthophyll levels reduced significantly. Incubation of dark-grown stressed leaves in an 18 O 2 -containing atmosphere resulted in the synthesis of ABA with levels of 18 O in the carboxyl group that were virtually identical to those observed in light-grown leaves. The results of these experiments indicate that violaxanthin is an ABA precursor in stressed dark-grown leaves, and they are used to suggest several possible pathways from violaxanthin to ABA

Violaxanthin is an abscisic acid precursor in water-stressed dark-grown bean leaves

Energy Technology Data Exchange (ETDEWEB)

Li, Yi; Walton, D.C. (State Univ. of New York, Syracuse (USA))

1990-03-01

The leaves a dark-grown bean (Phaseolus vulgaris L.) seedlings accumulate considerably lower quantities of xanthophylls and carotenes than do leaves of light-grown seedlings, but they synthesize at least comparable amounts of abscisic acid (ABA) and its metabolites when water stressed. We observed a 1:1 relationship on a molar basis between the reduction in levels of ciolaxanthin, 9{prime}-cis-neoxanthin, and 9-cis-violaxanthin and the accumulation of ABA, phaseic acid, and dihydrophaseic acid, when leaves from dark-grown plants were stressed for 7 hours. Early in the stress period, reductions in xanthophylls were greater than the accumulation of ABA and its metabolites, suggesting the accumulation of an intermediate which was subsequently converted to ABA. Leaves which were detached, but no stressed, did not accumulate ABA nor were their xanthophyll levels reduced. Leaves from plants that had been sprayed with cycloheximido did not accumulate ABA when stressed, nor were their xanthophyll levels reduced significantly. Incubation of dark-grown stressed leaves in an {sup 18}O{sub 2}-containing atmosphere resulted in the synthesis of ABA with levels of {sup 18}O in the carboxyl group that were virtually identical to those observed in light-grown leaves. The results of these experiments indicate that violaxanthin is an ABA precursor in stressed dark-grown leaves, and they are used to suggest several possible pathways from violaxanthin to ABA.

ER stress-induced protein, VIGG, disturbs plant cation homeostasis, which is correlated with growth retardation and robustness to ER stress

International Nuclear Information System (INIS)

Katoh, Hironori; Fujita, Keiko; Takuhara, Yuki; Ogawa, Atsushi; Suzuki, Shunji

2011-01-01

Highlights: → VIGG is an ER stress-induced protein in plant. → We examine the characteristics of VIGG-overexpressing Arabidopsis plants. → VIGG-overexpressing plants reveal growth retardation and robustness to ER stress. → VIGG disturbs cation homeostasis in plant. -- Abstract: VIGG is a putative endoplasmic reticulum (ER) resident protein induced by virus infection and ER stress, and is correlated with fruit quality in grapevine. The present study was undertaken to determine the biological function of VIGG in grapevine. Experiments using fluorescent protein-VIGG fusion protein demonstrated that VIGG is localized in ER and the ER targeting sequence is in the N-terminus. The overexpression of VIGG in Arabidopsis plant led to growth retardation. The rosette leaves of VIGG-overexpressing plants were smaller than those of the control plants and rolled at 42 days after seeding. VIGG-overexpressing plants revealed robustness to ER stress as well as the low expression of ER stress marker proteins, such as the luminal binding proteins. These characteristics of VIGG-overexpressing plants were supported by a microarray experiment that demonstrated the disruption of genes related to ER stress response and flowering, as well as cation mobility, in the plants. Finally, cation homeostasis in the plants was disturbed by the overexpression of VIGG. Taken together, these results suggest that VIGG may disturb cation homeostasis in plant, which is correlated with the robustness to ER stress and growth retardation.

ER stress-induced protein, VIGG, disturbs plant cation homeostasis, which is correlated with growth retardation and robustness to ER stress

Energy Technology Data Exchange (ETDEWEB)

Katoh, Hironori; Fujita, Keiko; Takuhara, Yuki [Laboratory of Fruit Genetic Engineering, The Institute of Enology and Viticulture, University of Yamanashi, Kofu, Yamanashi 400-0005 (Japan); Ogawa, Atsushi [Department of Biological Production, Akita Prefectural University, Shimosinjyou-nakano 241-438, Akita 010-0195 (Japan); Suzuki, Shunji, E-mail: suzukis@yamanashi.ac.jp [Laboratory of Fruit Genetic Engineering, The Institute of Enology and Viticulture, University of Yamanashi, Kofu, Yamanashi 400-0005 (Japan)

2011-02-18

Highlights: {yields} VIGG is an ER stress-induced protein in plant. {yields} We examine the characteristics of VIGG-overexpressing Arabidopsis plants. {yields} VIGG-overexpressing plants reveal growth retardation and robustness to ER stress. {yields} VIGG disturbs cation homeostasis in plant. -- Abstract: VIGG is a putative endoplasmic reticulum (ER) resident protein induced by virus infection and ER stress, and is correlated with fruit quality in grapevine. The present study was undertaken to determine the biological function of VIGG in grapevine. Experiments using fluorescent protein-VIGG fusion protein demonstrated that VIGG is localized in ER and the ER targeting sequence is in the N-terminus. The overexpression of VIGG in Arabidopsis plant led to growth retardation. The rosette leaves of VIGG-overexpressing plants were smaller than those of the control plants and rolled at 42 days after seeding. VIGG-overexpressing plants revealed robustness to ER stress as well as the low expression of ER stress marker proteins, such as the luminal binding proteins. These characteristics of VIGG-overexpressing plants were supported by a microarray experiment that demonstrated the disruption of genes related to ER stress response and flowering, as well as cation mobility, in the plants. Finally, cation homeostasis in the plants was disturbed by the overexpression of VIGG. Taken together, these results suggest that VIGG may disturb cation homeostasis in plant, which is correlated with the robustness to ER stress and growth retardation.

Arthropods vector grapevine trunk disease pathogens.

Science.gov (United States)

Moyo, P; Allsopp, E; Roets, F; Mostert, L; Halleen, F

2014-10-01

Arthropod-mediated dispersal of pathogens is known in many cropping systems but has never been demonstrated for grapevine trunk disease pathogens. Arthropods from vineyards were screened for the presence of pathogens associated with Petri disease and esca using cultural and molecular techniques. The ability of the most abundant pathogen-carrying species to inoculate healthy grapevine vascular tissues was also determined. Millipedes and ants were allowed to associate with a DsRed- Express-transformed Phaeomoniella chlamydospora, after which they were exposed to freshly pruned healthy grapevines under controlled conditions and wounds were monitored for subsequent infection. In addition, the possibility of millipede excreta, commonly found on pruning wounds in the field, to act as inoculum source was determined. A diverse arthropod fauna was associated with declining grapevines and many of these carried trunk disease pathogens. However, spiders, the ant Crematogaster peringueyi, and the millipede Ommattoiulus moreleti were the most abundant pathogen carriers. The ant and millipede species fed on pruning wound sap and effectively transmitted trunk disease pathogens. Millipede excreta contained viable spores of Phaeomoniella chlamydospora and may serve as an inoculum source. Numerous arthropods, including beneficial predators, are potential vectors of grapevine trunk disease pathogens. Our results highlight the need for an integrated approach, including targeted management of ants and millipedes at the time of pruning, to limit the spread of grapevine trunk diseases.

VULNERABILITY TO CAVITATION IN GRAPEVINES HAS BEEN OVERESTIMATED BY THE CENTRIFUGE TECHNIQUE

Science.gov (United States)

Grapevines are considered among the most vulnerable woody plant species to water stress-induced cavitation with embolism forming at slight tensions. However, we found that native embolism in stems of field grown Vitis vinifera cv. Chardonnay never exceeded 30% despite xylem water potentials ('x) rea...

Xanthophylls and abscisic acid biosynthesis in water-stressed bean leaves

International Nuclear Information System (INIS)

Li, Y.; Walton, D.C.

1987-01-01

Experiments were designed to obtain evidence about the possible role of xanthophylls as abscisic acid (ABA) precursors in water-stressed leaves of Phaseolus vularis L. Leaves were exposed to 14 CO 2 and the specific activities of several major leaf xanthophylls and stress-induced ABA were determined after a chase in 12 CO 2 for varying periods of time. The ABA specific radioactivities were about 30 to 70% of that of lutein and violaxanthin regardless of the chase period. The specific activity of neoxanthin, however, was only about 15% of that of ABA. The effects of fluridone on xanthophyll and ABA levels and the extent of labeling of both from 14 CO 2 were determined. Fluridone did not inhibit the accumulation of ABA when leaves were stressed once, although subsequent stresses in the presence of fluridone did lead to a reduced ABA accumulation. The incorporation of 14 C from 14 CO 2 into ABA and the xanthophylls was inhibited by fluridone and to about the same extent. The incorporation of 18 O into ABA from violaxanthin which had been labeled in situ by means of the violaxanthin cycle was measured. The results indicated that a portion of the ABA accumulated during stress was formed from violaxanthin which had been labeled with 18 O. The results of these experiments are consistent with a preformed xanthophyll(s) as the major ABA precursor in water-stressed bean leaves

Xanthophylls and abscisic acid biosynthesis in water-stressed bean leaves

Energy Technology Data Exchange (ETDEWEB)

Li, Y.; Walton, D.C.

1987-12-01

Experiments were designed to obtain evidence about the possible role of xanthophylls as abscisic acid (ABA) precursors in water-stressed leaves of Phaseolus vularis L. Leaves were exposed to /sup 14/CO/sub 2/ and the specific activities of several major leaf xanthophylls and stress-induced ABA were determined after a chase in /sup 12/CO/sub 2/ for varying periods of time. The ABA specific radioactivities were about 30 to 70% of that of lutein and violaxanthin regardless of the chase period. The specific activity of neoxanthin, however, was only about 15% of that of ABA. The effects of fluridone on xanthophyll and ABA levels and the extent of labeling of both from /sup 14/CO/sub 2/ were determined. Fluridone did not inhibit the accumulation of ABA when leaves were stressed once, although subsequent stresses in the presence of fluridone did lead to a reduced ABA accumulation. The incorporation of /sup 14/C from /sup 14/CO/sub 2/ into ABA and the xanthophylls was inhibited by fluridone and to about the same extent. The incorporation of /sup 18/O into ABA from violaxanthin which had been labeled in situ by means of the violaxanthin cycle was measured. The results indicated that a portion of the ABA accumulated during stress was formed from violaxanthin which had been labeled with /sup 18/O. The results of these experiments are consistent with a preformed xanthophyll(s) as the major ABA precursor in water-stressed bean leaves.

Response of grapevine leaves to plasmopara viticola infection by means of measurement of reflectance and fluorescence signals

Czech Academy of Sciences Publication Activity Database

Šebela, David; Olejníčková, Julie; Župčanová, A.; Sotolář, R.

2012-01-01

Roč. 27, č. 8 (2012), s. 229-237 ISSN 1211-8516 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0073 Institutional support: RVO:67179843 Keywords : Plasmopara viticola * downy mildew * grapevine * leaf tissue * susceptible varieties * chlorophyll fluorescence imaging * reflectance Subject RIV: GM - Food Processing

THE ORIGIN OF GRAPEVINE CULTIVATION IN ITALY: THE ARCHAEOBOTANICAL EVIDENCE

Directory of Open Access Journals (Sweden)

S. Marvelli

2013-04-01

Full Text Available Grapevine remains show that this plant has been important for humans since ancient times. This paper presents a synthesis of archaeobotanical studies on grapevine remains (pollen, wood, charcoal, seed/fruit and other botanical remains from Epigravettian to Bronze Age sites. Carpological remains are the most important ones, because they often allow to distinguish cultivated and wild grapevines. Grapevine findings are rare in Mesolithic sites, they increase during Neolithic period and become frequent in Bronze Age. Archaeobotanical data show that during Neolithic and in the Early Bronze Age a good level of knowledge concerning grapevine utilization was already acquired; during Middle and Late Bronze Age the grapevine diffusion increases. Based on archaeobotanical data, the wild grapevine evolution by indigenous people was probably accompanied by an input of allochtonous vines from Mycenaean world, and then from Hellenic world. Therefore, the critical period of grapevine domestication can be placed between Bronze Age and Early Iron Age.

Complete nucleotide sequence of the RNA-2 of grapevine deformation and Grapevine Anatolian ringspot viruses.

Science.gov (United States)

Ghanem-Sabanadzovic, Nina Abou; Sabanadzovic, Sead; Digiaro, Michele; Martelli, Giovanni P

2005-05-01

The nucleotide sequence of RNA-2 of Grapevine Anatolian ringspot virus (GARSV) and Grapevine deformation virus (GDefV), two recently described nepoviruses, has been determined. These RNAs are 3753 nt (GDefV) and 4607 nt (GARSV) in size and contain a single open reading frame encoding a polyprotein of 122 kDa (GDefV) and 150 kDa (GARSV). Full-length nucleotide sequence comparison disclosed 71-73% homology between GDefV RNA-2 and that of Grapevine fanleaf virus (GFLV) and Arabis mosaic virus (ArMV), and 62-64% homology between GARSV RNA-2 and that of Grapevine chrome mosaic virus (GCMV) and Tomato black ring virus (TBRV). As previously observed in other nepoviruses, the 5' non-coding regions of both RNAs are capable of forming stem-loop structures. Phylogenetic analysis of the three proteins encoded by RNA-2 (i.e. protein 2A, movement protein and coat protein) confirmed that GDefV and GARSV are distinct viruses which can be assigned as definitive species in subgroup A and subgroup B of the genus Nepovirus, respectively.

Endophytic bacterial diversity in grapevine (Vitis vinifera L.) leaves described by 16S rRNA gene sequence analysis and length heterogeneity-PCR.

Science.gov (United States)

Bulgari, Daniela; Casati, Paola; Brusetti, Lorenzo; Quaglino, Fabio; Brasca, Milena; Daffonchio, Daniele; Bianco, Piero Attilio

2009-08-01

Diversity of bacterial endophytes associated with grapevine leaf tissues was analyzed by cultivation and cultivation-independent methods. In order to identify bacterial endophytes directly from metagenome, a protocol for bacteria enrichment and DNA extraction was optimized. Sequence analysis of 16S rRNA gene libraries underscored five diverse Operational Taxonomic Units (OTUs), showing best sequence matches with gamma-Proteobacteria, family Enterobacteriaceae, with a dominance of the genus Pantoea. Bacteria isolation through cultivation revealed the presence of six OTUs, showing best sequence matches with Actinobacteria, genus Curtobacterium, and with Firmicutes genera Bacillus and Enterococcus. Length Heterogeneity-PCR (LH-PCR) electrophoretic peaks from single bacterial clones were used to setup a database representing the bacterial endophytes identified in association with grapevine tissues. Analysis of healthy and phytoplasma-infected grapevine plants showed that LH-PCR could be a useful complementary tool for examining the diversity of bacterial endophytes especially for diversity survey on a large number of samples.

The status of Botryosphaeriaceae species infecting grapevines

Directory of Open Access Journals (Sweden)

Jose Ramón URBEZ-TORRES

2011-12-01

Full Text Available Normal 0 MicrosoftInternetExplorer4 Normal 0 MicrosoftInternetExplorer4 Species in the Botryosphaeriaceae have a cosmopolitan distribution, and occur on a wide range of annual and perennial hosts including grapevines. To date, morphological and taxonomic studies, as well as analyses of nucleotide sequences of multiple genes, have allowed the identification of at least 21 different species in the Botryosphaeriaceae occurring in grapevines worldwide. Grapevine disease symptoms caused by members of this family include leaf spots, fruit rots, shoot dieback, bud necrosis, vascular discoloration of the wood, and perennial cankers, and their current status as pathogens is reviewed. Additionally, the disease name Botryosphaeria dieback is proposed here to describe the different grapevine trunk disease symptoms caused by species of Botryosphaeriaceae. Much has been written during the last decade about the association between species in the Botryosphaeriaceae and grapevine trunk diseases, which has contributed to a better understanding of the role that these fungal taxa play in grapevine diseases. Although virulence has been shown to vary between species and isolates of the same species in different countries, these fungi have become well-recognized as important grapevine pathogens worldwide. Latest and novel findings from studies conducted in different countries, on disease etiology and species distribution, epidemiology and biology are discussed. Much progress has been achieved in the development and implementation of novel diagnostic and detection techniques.Vineyard sanitation techniques, as well as chemical, biological, and cultural control strategies available at the present time to reduce the infection caused by botryosphaeriaceous fungi, are presented in this review. 

Transcriptional expression of Stilbene synthase genes are regulated developmentally and differentially in response to powdery mildew in Norton and Cabernet Sauvignon grapevine.

Science.gov (United States)

Dai, Ru; Ge, Hui; Howard, Susanne; Qiu, Wenping

2012-12-01

Stilbenic compounds are natural phytoalexins that have antimicrobial activities in plant defense against pathogens. Stilbene synthase (STS) is the key enzyme that catalyzes the biosynthesis of stilbenic compounds. Grapevine genome contains a family of preliminarily annotated 35 STS genes, the regulation of each STS gene needs to be studied to define their roles. In this study, we selected eight STS genes, STS8, STS27/31, STS16/22, STS13/17/23, and applied quantitative polymerase chain reaction (qPCR) to characterize their transcriptional expression profiles in leaf tissues upon infection by the powdery mildew fungus (PM), Erysiphe necator (Schw.) Burr. Their transcripts were also compared in young and old leaves as well as in the berry skin at five developmental stages in Vitis vinifera 'Cabernet Sauvignon' and Vitis aestivalis 'Norton'. The results showed that transcripts of selected STS genes increased significantly in Cabernet Sauvignon leaves at 24 and 48 h post inoculation with PM spores and remained unchanged in Norton leaves in response to the PM infection. Transcripts of STS8, STS27/31 and STS13/17/23 were more abundant in the old leaves of Norton than in Cabernet Sauvignon. STS genes showed lower expression levels in young leaves than in old leaves. Transcript levels of the eight STS genes increased drastically in the berry skin of Cabernet Sauvignon and Norton post véraison. In addition, the content of trans-resveratrol in the berry skin rapidly increased post véraison and reached the highest level at harvest. These assays demonstrated that individual STS genes are regulated differentially in response to PM infection and during development in the two grape varieties. The present study yields basic knowledge for further investigation of the regulation and function of each STS gene in grapevine and provides experimental evidences for the functional annotation of the STS gene family in the grapevine genome. Copyright © 2012 Elsevier Ireland Ltd. All

A complex protein derivative acts as biogenic elicitor of grapevine resistance against powdery mildew under field conditions

Directory of Open Access Journals (Sweden)

Andrea eNesler

2015-09-01

Full Text Available Powdery mildew caused by Erysiphe necator is one of the most important grapevine diseases in several viticulture areas, and high fungicide input is required to control it. However, numerous synthetic chemical pesticides are under scrutiny due to concerns about their impact on human health and the environment. Biopesticides, such as biogenic elicitors, are a promising alternative to chemical fungicides. Although several studies have reported on effective elicitors against grapevine diseases, their efficacy under field conditions has not been investigated extensively or has occurred at rather limited levels. Our goal was to examine the efficacy of a protein-based composition, namely nutrient broth (NB, against powdery mildew under field conditions and to characterize its mechanism of action. Weekly treatments with NB was highly effective in controlling powdery mildew on grapevine across seasons with different disease pressures. The level of disease control achieved with NB was comparable to standard fungicide treatments both on leaves and bunches across three different years. NB has no direct toxic effect on the germination of E. necator conidia, and it activates plant resistance with both systemic and translaminar effect in experiments with artificial inoculation under controlled conditions. NB induced the expression of defense-related genes in grapevine, demonstrating stimulation of plant defense mechanisms, prior to and in the early stages of pathogen infection. NB is a natural derivative from meat and yeast, substances that tend not to raise concerns about toxicological and ecotoxicological properties. NB represents a valid control tool for integrated plant protection programs against powdery mildew, to reduce the use of synthetic pesticides on grapevine.

A complex protein derivative acts as biogenic elicitor of grapevine resistance against powdery mildew under field conditions.

Science.gov (United States)

Nesler, Andrea; Perazzolli, Michele; Puopolo, Gerardo; Giovannini, Oscar; Elad, Yigal; Pertot, Ilaria

2015-01-01

Powdery mildew caused by Erysiphe necator is one of the most important grapevine diseases in several viticulture areas, and high fungicide input is required to control it. However, numerous synthetic chemical pesticides are under scrutiny due to concerns about their impact on human health and the environment. Biopesticides, such as biogenic elicitors, are a promising alternative to chemical fungicides. Although several studies have reported on effective elicitors against grapevine diseases, their efficacy under field conditions has not been investigated extensively or has occurred at rather limited levels. Our goal was to examine the efficacy of a protein-based composition, namely nutrient broth (NB), against powdery mildew under field conditions and to characterize its mechanism of action. Weekly treatments with NB was highly effective in controlling powdery mildew on grapevine across seasons with different disease pressures. The level of disease control achieved with NB was comparable to standard fungicide treatments both on leaves and bunches across three different years. NB has no direct toxic effect on the germination of E. necator conidia, and it activates plant resistance with both systemic and translaminar effect in experiments with artificial inoculation under controlled conditions. NB induced the expression of defense-related genes in grapevine, demonstrating stimulation of plant defense mechanisms, prior to and in the early stages of pathogen infection. NB is a natural derivative from meat and yeast, substances that tend not to raise concerns about toxicological and ecotoxicological properties. NB represents a valid control tool for integrated plant protection programs against powdery mildew, to reduce the use of synthetic pesticides on grapevine.

Temperature dependent RNA metabolism in Xylella fastidiosa during cold stress and grapevine infection

Science.gov (United States)

Re-occurrence of Pierce’s disease of grapes, caused by Xylella fastidiosa, is known to be influenced by environmental factors, particularly cold temperatures during overwintering. Grapevines in colder regions are often cured of X. fastidiosa infection over the winter season, depending on cultivar, t...

Cover crops and pruning in Bobal and Tempranillo vineyards have little influence on grapevine nutrition

Directory of Open Access Journals (Sweden)

Pedro Pérez-Bermúdez

2016-06-01

Full Text Available ABSTRACT Cover crops may improve vineyard soil properties, grapevine nutrient status and berry composition, however, factors such as cover crop type, annual rainfall, climate and irrigation may change their effects on vineyards. From 2008 to 2011, the effects of a non-permanent cover crop and two pruning techniques on soil as well as vine nutrients and grapevine performance of two vineyards (cv. Tempranillo and cv. Bobal were evaluated. For that purpose, two legumes were sown in inter-rows of hand-pruned vines in February and were tilled at flowering. Soil tillage, or cover cropping, was combined with either light pruning or severe pruning to study foliar nutrient variations. Soil N, P, K and total organic carbon (TOC were determined in samples taken from the Ap1 horizon in January prior to vine pruning. Foliar N, P, K contents were measured in leaves sampled upon grape veraison. The differences between vineyards with cover cropping and bare soils suggest that legumes positively affected soil N (1.55 vs. 1.68 g kg−1 and 1.49 vs. 1.76 g kg−1 in Bobal and Tempranillo vineyards, respectively and soil organic matter (SOM (12.5 vs. 15.5 g kg−1 and 12.9 vs. 17.2 g kg−1 in Bobal and Tempranillo vineyards, respectively. The use of cover crops did not affect grapevine yields nor quality of Bobal and Tempranillo berry . Cover crops, or light pruning, did not alter the foliar N, P, K contents of both cultivars since their concentrations were similar to those found in the leaves from vineyards with soil tillage or severe pruning.

The effect of reclaimed wastewater on the quality and growth of grapevines.

Science.gov (United States)

Mendoza-Espinosa, L G; Cabello-Pasini, A; Macias-Carranza, V; Daessle-Heuser, W; Orozco-Borbón, M V; Quintanilla-Montoya, A L

2008-01-01

The effect of the use of treated wastewater on the growth of cabernet sauvignon and merlot grapes from the Guadalupe Valley, Mexico was evaluated. Secondary advanced effluent was used to irrigate the grapevines at a rate of 66 L/vine/week. Wastewater quality results confirmed that all parameters complied with Mexican legislation for crop irrigation as well as reuse in activities in which the public would be in direct or indirect contact with the reclaimed water. Results showed that the number of leaves per shoot and the overall biomass increased in plants irrigated with wastewater and grape production per plant was 20% higher. The concentration of carbohydrates, organic acids and pH were similar in grapes from vines irrigated with wastewater to those irrigated with groundwater. Throughout the experiment, no fecal coliform bacteria were detected in the cultivated grapes. The wastewater caused an increase in the biomass of the grapevines and there was no presence of microbial indicators in the final product so a higher wine production could be achieved without an increase in health risk related problems. If 200 L/s of reclaimed wastewater would be returned to be used for grapevine irrigation in Valle de Guadalupe (the same amount that is currently being sent as drinking water to Ensenada), assuming an irrigation application of 6,000-7.500 m3/ha/year, approximately 837-1046 hectares (ha) of grapevines could be irrigated. Part of ongoing research includes an economical analysis of the best options for Ensenada and the Valle de Guadalupe in order to establish the optimum volume of water to be returned, the cost of its transportation, as well as the cost of irrigation. (c) IWA Publishing 2008.

Lasiojasmonates A-C, three jasmonic acid esters produced by Lasiodiplodia sp., a grapevine pathogen.

Science.gov (United States)

Andolfi, Anna; Maddau, Lucia; Cimmino, Alessio; Linaldeddu, Benedetto T; Basso, Sara; Deidda, Antonio; Serra, Salvatorica; Evidente, Antonio

2014-07-01

In this study, a strain (BL 101) of a species of Lasiodiplodia, not yet formally described, which was isolated from declining grapevine plants showing wedge-shaped cankers, was investigated for its ability to produce in vitro bioactive secondary metabolites. From culture filtrates of this strain three jasmonic acid esters, named lasiojasmonates A-C and 16-O-acetylbotryosphaerilactones A and C were isolated together with (1R,2R)-jasmonic acid, its methyl ester, botryosphaerilactone A, (3S,4R,5R)-4-hydroxymethyl-3,5-dimethyldihydro-2-furanone and (3R,4S)-botryodiplodin. The structures of lasiojasmonates A-C were established by spectroscopic methods as (1R*,2R*,3'S*,4'R*,5'R*)-4-hydroxymethyl-3,5-dimethyldihydro-2-furanone, (1R*,2R*,3'S*,4'R*,5'R*,10'R*,12'R*,13'R*,14'S*) and (1R*,2R*,3'S*,4'R*,5'R*,10'S*,12'R*,13'R*,14'S*)-4-(4-hydroxymethyl-3,5-dimethyltetrahydro-furan-2-yloxymethyl)-3,5-dimethyldihydro-2-furanones jasmonates (1, 4 and 5). The structures of 16-O-acetylbotryosphaerilactones A and C were determined by comparison of their spectral data with those of the corresponding acetyl derivatives obtained by acetylation of botryosphaerilactone A. The metabolites isolated, except 4 and 5, were tested at 1mg/mL on leaves of grapevine cv. Cannonau and cork oak using the leaf puncture assay. They were also tested on detached grapevine leaves at 0.5mg/mL and tomato cuttings at 0.1mg/mL. In all phytotoxic assays only jasmonic acid was found to be active. All metabolites were inactive in the zootoxic assay at 50 μg/mL. Copyright © 2014. Published by Elsevier Ltd.

Analysis of high-identity segmental duplications in the grapevine genome

Directory of Open Access Journals (Sweden)

Carelli Francesco N

2011-08-01

Full Text Available Abstract Background Segmental duplications (SDs are blocks of genomic sequence of 1-200 kb that map to different loci in a genome and share a sequence identity > 90%. SDs show at the sequence level the same characteristics as other regions of the human genome: they contain both high-copy repeats and gene sequences. SDs play an important role in genome plasticity by creating new genes and modeling genome structure. Although data is plentiful for mammals, not much was known about the representation of SDs in plant genomes. In this regard, we performed a genome-wide analysis of high-identity SDs on the sequenced grapevine (Vitis vinifera genome (PN40024. Results We demonstrate that recent SDs (> 94% identity and >= 10 kb in size are a relevant component of the grapevine genome (85 Mb, 17% of the genome sequence. We detected mitochondrial and plastid DNA and genes (10% of gene annotation in segmentally duplicated regions of the nuclear genome. In particular, the nine highest copy number genes have a copy in either or both organelle genomes. Further we showed that several duplicated genes take part in the biosynthesis of compounds involved in plant response to environmental stress. Conclusions These data show the great influence of SDs and organelle DNA transfers in modeling the Vitis vinifera nuclear DNA structure as well as the impact of SDs in contributing to the adaptive capacity of grapevine and the nutritional content of grape products through genome variation. This study represents a step forward in the full characterization of duplicated genes important for grapevine cultural needs and human health.

Support Vector Machine and Artificial Neural Network Models for the Classification of Grapevine Varieties Using a Portable NIR Spectrophotometer.

Directory of Open Access Journals (Sweden)

Salvador Gutiérrez

Full Text Available The identification of different grapevine varieties, currently attended using visual ampelometry, DNA analysis and very recently, by hyperspectral analysis under laboratory conditions, is an issue of great importance in the wine industry. This work presents support vector machine and artificial neural network's modelling for grapevine varietal classification from in-field leaf spectroscopy. Modelling was attempted at two scales: site-specific and a global scale. Spectral measurements were obtained on the near-infrared (NIR spectral range between 1600 to 2400 nm under field conditions in a non-destructive way using a portable spectrophotometer. For the site specific approach, spectra were collected from the adaxial side of 400 individual leaves of 20 grapevine (Vitis vinifera L. varieties one week after veraison. For the global model, two additional sets of spectra were collected one week before harvest from two different vineyards in another vintage, each one consisting on 48 measurement from individual leaves of six varieties. Several combinations of spectra scatter correction and smoothing filtering were studied. For the training of the models, support vector machines and artificial neural networks were employed using the pre-processed spectra as input and the varieties as the classes of the models. The results from the pre-processing study showed that there was no influence whether using scatter correction or not. Also, a second-degree derivative with a window size of 5 Savitzky-Golay filtering yielded the highest outcomes. For the site-specific model, with 20 classes, the best results from the classifiers thrown an overall score of 87.25% of correctly classified samples. These results were compared under the same conditions with a model trained using partial least squares discriminant analysis, which showed a worse performance in every case. For the global model, a 6-class dataset involving samples from three different vineyards, two years

Support Vector Machine and Artificial Neural Network Models for the Classification of Grapevine Varieties Using a Portable NIR Spectrophotometer.

Science.gov (United States)

Gutiérrez, Salvador; Tardaguila, Javier; Fernández-Novales, Juan; Diago, María P

2015-01-01

The identification of different grapevine varieties, currently attended using visual ampelometry, DNA analysis and very recently, by hyperspectral analysis under laboratory conditions, is an issue of great importance in the wine industry. This work presents support vector machine and artificial neural network's modelling for grapevine varietal classification from in-field leaf spectroscopy. Modelling was attempted at two scales: site-specific and a global scale. Spectral measurements were obtained on the near-infrared (NIR) spectral range between 1600 to 2400 nm under field conditions in a non-destructive way using a portable spectrophotometer. For the site specific approach, spectra were collected from the adaxial side of 400 individual leaves of 20 grapevine (Vitis vinifera L.) varieties one week after veraison. For the global model, two additional sets of spectra were collected one week before harvest from two different vineyards in another vintage, each one consisting on 48 measurement from individual leaves of six varieties. Several combinations of spectra scatter correction and smoothing filtering were studied. For the training of the models, support vector machines and artificial neural networks were employed using the pre-processed spectra as input and the varieties as the classes of the models. The results from the pre-processing study showed that there was no influence whether using scatter correction or not. Also, a second-degree derivative with a window size of 5 Savitzky-Golay filtering yielded the highest outcomes. For the site-specific model, with 20 classes, the best results from the classifiers thrown an overall score of 87.25% of correctly classified samples. These results were compared under the same conditions with a model trained using partial least squares discriminant analysis, which showed a worse performance in every case. For the global model, a 6-class dataset involving samples from three different vineyards, two years and leaves

Transcriptome analyses of the Dof-like gene family in grapevine reveal its involvement in berry, flower and seed development.

Science.gov (United States)

da Silva, Danielle Costenaro; da Silveira Falavigna, Vítor; Fasoli, Marianna; Buffon, Vanessa; Porto, Diogo Denardi; Pappas, Georgios Joannis; Pezzotti, Mario; Pasquali, Giancarlo; Revers, Luís Fernando

2016-01-01

The Dof (DNA-binding with one finger) protein family spans a group of plant transcription factors involved in the regulation of several functions, such as plant responses to stress, hormones and light, phytochrome signaling and seed germination. Here we describe the Dof-like gene family in grapevine (Vitis vinifera L.), which consists of 25 genes coding for Dof. An extensive in silico characterization of the VviDofL gene family was performed. Additionally, the expression of the entire gene family was assessed in 54 grapevine tissues and organs using an integrated approach with microarray (cv Corvina) and real-time PCR (cv Pinot Noir) analyses. The phylogenetic analysis comparing grapevine sequences with those of Arabidopsis, tomato, poplar and already described Dof genes in other species allowed us to identify several duplicated genes. The diversification of grapevine DofL genes during evolution likely resulted in a broader range of biological roles. Furthermore, distinct expression patterns were identified between samples analyzed, corroborating such hypothesis. Our expression results indicate that several VviDofL genes perform their functional roles mainly during flower, berry and seed development, highlighting their importance for grapevine growth and production. The identification of similar expression profiles between both approaches strongly suggests that these genes have important regulatory roles that are evolutionally conserved between grapevine cvs Corvina and Pinot Noir.

Non-destructive assessment of grapevine water status in the field using a portable NIR spectrophotometer.

Science.gov (United States)

Tardaguila, Javier; Fernández-Novales, Juan; Gutiérrez, Salvador; Diago, Maria Paz

2017-08-01

Until now, the majority of methods employed to assess grapevine water status have been destructive, time-intensive, costly and provide information of a limited number of samples, thus the ability of revealing within-field water status variability is reduced. The goal of this work was to evaluate the capability of non-invasive, portable near infrared (NIR) spectroscopy acquired in the field, to assess the grapevine water status in diverse varieties, grown under different environmental conditions, in a fast and reliable way. The research was conducted 2 weeks before harvest in 2012, in two commercial vineyards, planted with eight different varieties. Spectral measurements were acquired in the field on the adaxial and abaxial sides of 160 individual leaves (20 leaves per variety) using a commercially available handheld spectrophotometer (1600-2400 nm). Principal component analysis (PCA) and modified partial least squares (MPLS) were used to interpret the spectra and to develop reliable prediction models for stem water potential (Ψ s ) (cross-validation correlation coefficient (r cv ) ranged from 0.77 to 0.93, and standard error of cross validation (SECV) ranged from 0.10 to 0.23), and leaf relative water content (RWC) (r cv ranged from 0.66 to 0.81, and SECV between 1.93 and 3.20). The performance differences between models built from abaxial and adaxial-acquired spectra is also discussed. The capability of non-invasive NIR spectroscopy to reliably assess the grapevine water status under field conditions was proved. This technique can be a suitable and promising tool to appraise within-field variability of plant water status, helpful to define optimised irrigation strategies in the wine industry. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Distribution of Rotundone and Possible Translocation of Related Compounds Amongst Grapevine Tissues in Vitis vinifera L. cv. Shiraz

Science.gov (United States)

Zhang, Pangzhen; Fuentes, Sigfredo; Wang, Yueying; Deng, Rui; Krstic, Mark; Herderich, Markus; Barlow, Edward W. R.; Howell, Kate

2016-01-01

Rotundone is an attractive wine aroma compound, especially important for cool climate Shiraz. Its presence in wine is mainly from the grape skin, but can also be found in non-grape tissues, such as leaves and stems. Whether rotundone is produced independently within different grapevine tissues or transported amongst non-grape tissues and grape berries remains unclear. The current study investigated the distribution of this compound in different vine tissues during development and studied the most likely mode of rotundone translocation—via phloem—using stable isotope feeding. In addition, local production of rotundone induced by herbivore feeding was assessed. Results showed that rotundone was firstly detected in the petioles and peduncles/rachises within the development of Vitis vinifera L. cv. Shiraz. Different grapevine tissues had a similar pattern of rotundone production at different grape developmental stages. In the individual vine shoots, non-grape tissues contained higher concentrations and amounts of rotundone compared to berries, which showed that non-grape tissues were the larger pool of rotundone within the plant. This study confirmed the local production of rotundone in individual tissues and ruled out the possibility of phloem translocation of rotundone between different tissues. In addition, other terpenes, including one monoterpenoid (geraniol) and six sesquiterpenes (clovene, α-ylangene, β-copaene, α-muurolene, δ-cadinene, and cis/trans-calamenene) were, for the first time, detected in the ethylenediaminetetraacetic acid-facilitated petiole phloem exudates, with their originality unconfirmed. Unlike other herbivore-induced terpenes, herbivorous activity had limited influences on the concentration of rotundone in grapevine leaves. PMID:27446104

VTCdb: a gene co-expression database for the crop species Vitis vinifera (grapevine).

Science.gov (United States)

Wong, Darren C J; Sweetman, Crystal; Drew, Damian P; Ford, Christopher M

2013-12-16

) whereby the recovered sub-networks reconfirm established plant gene functions and also identify novel associations. Together, we present valuable insights into grapevine transcriptional regulation by developing network models applicable to researchers in their prioritisation of gene candidates, for on-going study of biological processes related to grapevine development, metabolism and stress responses.

Grapevine leafroll-associated virus 3

Directory of Open Access Journals (Sweden)

Hans J. Maree

2013-04-01

Full Text Available Grapevine leafroll disease (GLD is one of the most important grapevine viral diseases affecting grapevines worldwide. The impact on vine health, crop yield and quality is difficult to assess due to a high number of variables, but significant economic losses are consistently reported over the lifespan of a vineyard if intervention strategies are not implemented. Several viruses from the family Closteroviridae are associated with GLD. However, Grapevine leafroll-associated virus 3 (GLRaV-3, the type species for the genus Ampelovirus, is regarded as the most important causative agent. Here we provide a general overview on various aspects of GLRaV-3, with an emphasis on the latest advances in the characterization of the genome. The full genome of several isolates have recently been sequenced and annotated, revealing the existence of several genetic variants. The classification of these variants, based on their genome sequence, will be discussed and a guideline is presented to facilitate future comparative studies. The characterization of sgRNAs produced during the infection cycle of GLRaV-3 has given some insight into the replication strategy and the putative functionality of the ORFs. The latest nucleotide sequence based molecular diagnostic techniques were shown to be more sensitive than conventional serological assays and although ELISA is not as sensitive it remains valuable for high-throughput screening and complementary to molecular diagnostics. The application of next-generation sequencing is proving to be a valuable tool to study the complexity of viral infection as well as plant-pathogen interaction. Next-generation sequencing data can provide information regarding disease complexes, variants of viral species, and abundance of particular viruses. This information can be used to develop more accurate diagnostic assays. Reliable virus screening in support of robust grapevine certification programs remains the cornerstone of GLD management.

Comparison of ion balance and nitrogen metabolism in old and young leaves of alkali-stressed rice plants.

Science.gov (United States)

Wang, Huan; Wu, Zhihai; Han, Jiayu; Zheng, Wei; Yang, Chunwu

2012-01-01

Alkali stress is an important agricultural contaminant and has complex effects on plant metabolism. The aim of this study was to investigate whether the alkali stress has different effects on the growth, ion balance, and nitrogen metabolism in old and young leaves of rice plants, and to compare functions of both organs in alkali tolerance. The results showed that alkali stress only produced a small effect on the growth of young leaves, whereas strongly damaged old leaves. Rice protected young leaves from ion harm via the large accumulation of Na(+) and Cl(-) in old leaves. The up-regulation of OsHKT1;1, OsAKT1, OsHAK1, OsHAK7, OsHAK10 and OsHAK16 may contribute to the larger accumulation of Na(+) in old leaves under alkali stress. Alkali stress mightily reduced the NO(3)(-) contents in both organs. As old leaf cells have larger vacuole, under alkali stress these scarce NO(3)(-) was principally stored in old leaves. Accordingly, the expression of OsNRT1;1 and OsNRT1;2 in old leaves was up-regulated by alkali stress, revealing that the two genes might contribute to the accumulation of NO(3)(-) in old leaves. NO(3)(-) deficiency in young leaves under alkali stress might induce the reduction in OsNR1 expression and the subsequent lacking of NH(4)(+), which might be main reason for the larger down-regulation of OsFd-GOGAT and OsGS2 in young leaves. Our results strongly indicated that, during adaptation of rice to alkali stress, young and old leaves have distinct mechanisms of ion balance and nitrogen metabolism regulation. We propose that the comparative studies of young and old tissues may be important for abiotic stress tolerance research.

From job stress to intention to leave among hospital nurses: A structural equation modelling approach.

Science.gov (United States)

Lo, Wen-Yen; Chien, Li-Yin; Hwang, Fang-Ming; Huang, Nicole; Chiou, Shu-Ti

2018-03-01

The aim of this study was to examine the structural relationships linking job stress to leaving intentions through job satisfaction, depressed mood and stress adaptation among hospital nurses. High turnover among nurses is a global concern. Structural relationships linking job stress to leaving intentions have not been thoroughly examined. Two nationwide cross-sectional surveys of full-time hospital staff in 2011 and 2014. The study participants were 26,945 and 19,386 full-time clinical nurses in 2011 and 2014 respectively. Structural equation modelling was used to examine the interrelationships among the study variables based on the hypothesized model. We used cross-validation procedures to ensure the stability and validity of the model in the two samples. There were five main paths from job stress to intention to leave the hospital. In addition to the direct path, job stress directly affected job satisfaction and depressed mood, which in turn affected intention to leave the hospital. Stress adaptation mitigated the effects of job stress on job satisfaction and depressed mood, which led to intention to leave the hospital. Intention to leave the hospital preceded intention to leave the profession. Those variables explained about 55% of the variance in intention to leave the profession in both years. The model fit was good for both samples, suggesting validity of the model. Strategies to decrease turnover intentions among nurses could focus on creating a less stressful work environment, increasing job satisfaction and stress adaptation and decreasing depressed mood. Hospitals should cooperate in this issue to decrease nurse turnover. © 2017 John Wiley & Sons Ltd.

Tocopherol deficiency reduces sucrose export from salt-stressed potato leaves independently of oxidative stress and symplastic obstruction by callose

Science.gov (United States)

Asensi-Fabado, María Amparo; Ammon, Alexandra; Sonnewald, Uwe; Munné-Bosch, Sergi; Voll, Lars M.

2015-01-01

Tocopherol cyclase, encoded by the gene SUCROSE EXPORT DEFECTIVE1, catalyses the second step in the synthesis of the antioxidant tocopherol. Depletion of SXD1 activity in maize and potato leaves leads to tocopherol deficiency and a ‘sugar export block’ phenotype that comprises massive starch accumulation and obstruction of plasmodesmata in paraveinal tissue by callose. We grew two transgenic StSXD1:RNAi potato lines with severe tocopherol deficiency under moderate light conditions and subjected them to salt stress. After three weeks of salt exposure, we observed a strongly reduced sugar exudation rate and a lack of starch mobilization in leaves of salt-stressed transgenic plants, but not in wild-type plants. However, callose accumulation in the vasculature declined upon salt stress in all genotypes, indicating that callose plugging of plasmodesmata was not the sole cause of the sugar export block phenotype in tocopherol-deficient leaves. Based on comprehensive gene expression analyses, we propose that enhanced responsiveness of SnRK1 target genes in mesophyll cells and altered redox regulation of phloem loading by SUT1 contribute to the attenuation of sucrose export from salt-stressed SXD:RNAi source leaves. Furthermore, we could not find any indication that elevated oxidative stress may have served as a trigger for the salt-induced carbohydrate phenotype of SXD1:RNAi transgenic plants. In leaves of the SXD1:RNAi plants, sodium accumulation was diminished, while proline accumulation and pools of soluble antioxidants were increased. As supported by phytohormone contents, these differences seem to increase longevity and prevent senescence of SXD:RNAi leaves under salt stress. PMID:25428995

Bioavailability of potentially toxic elements in soil-grapevine (leaf, skin, pulp and seed) system and environmental and health risk assessment.

Science.gov (United States)

Milićević, Tijana; Urošević, Mira Aničić; Relić, Dubravka; Vuković, Gordana; Škrivanj, Sandra; Popović, Aleksandar

2018-06-01

Monitoring of potentially toxic elements in agricultural soil represents the first measure of caution regarding food safety, while research into element bioavailability should be a step forward in understanding the element transportation chain. This study was conducted in the grapevine growing area ("Oplenac Wine Route") for investigating element bioavailability in the soil-grapevine system accompanied by an assessment of the ecological implications and human health risk. Single extraction procedures (CH 3 COOH, Na 2 EDTA, CaCl 2 , NH 4 NO 3 and deionised H 2 O) and digestion were performed to estimate the bioavailability of 22 elements (Al, As, B, Ba, Be, Ca, Cd, Co, Cr, Cu, Fe, K, Li, Mg, Mn, Na, Ni, Pb, Sb, Sr, V and Zn) from the topsoil (0-30 cm) and subsoil (30-60 cm) to the grapevine parts (leaf, skin, pulp and seed) and wine. The extractants were effective comparing to the pseudo-total concentrations in following order Na 2 EDTA ˃ CH 3 COOH ˃ NH 4 NO 3  ˃ CaCl 2 , H 2 O 2 h and 16 h. The most suitable extractants for assessing the bioavailability of the elements from the soil to the grapevine parts were CaCl 2 , NH 4 NO 3 and Na 2 EDTA, but deionised H 2 O could be suitable, as well. The results showed that Ba was the most bioavailable element in the soil-grapevine system. Contamination factor implied a moderate contamination (1  1), the influence of atmospheric deposition on the aerial grapevine parts (leaves and grape skin) was observed. Nevertheless, low adverse health risk effects (HI wine consumers. Copyright © 2018 Elsevier B.V. All rights reserved.

Modeling deployment of Pierce’s disease resistant grapevines

Science.gov (United States)

Deployment of Pierce’s disease resistant grapevines is a key solution to mitigating economic losses caused by Xylella fastidiosa. While Pierce’s disease resistant grapevines under development display mild symptoms and have lower bacterial populations than susceptible varieties, all appear to remain ...

Gating in grapevine: Relationship between application of the fungicide fludioxonil and circadian rhythm on photosynthesis

Energy Technology Data Exchange (ETDEWEB)

Petit, Anne-Noelle [Laboratoire de Stress, Defenses et Reproduction des Plantes, URVVC-SE EA 2069, Universite de Reims Champagne-Ardenne, UFR Sciences Exactes et Naturelles, Batiment 18, Moulin de la Housse, BP 1039, F-51687 REIMS Cedex 2 (France)], E-mail: petit081@etudiant.univ-reims.fr; Fontaine, Florence [Laboratoire de Stress, Defenses et Reproduction des Plantes, URVVC-SE EA 2069, Universite de Reims Champagne-Ardenne, UFR Sciences Exactes et Naturelles, Batiment 18, Moulin de la Housse, BP 1039, F-51687 REIMS Cedex 2 (France)], E-mail: florence.fontaine@univ-reims.fr; Clement, Christophe [Laboratoire de Stress, Defenses et Reproduction des Plantes, URVVC-SE EA 2069, Universite de Reims Champagne-Ardenne, UFR Sciences Exactes et Naturelles, Batiment 18, Moulin de la Housse, BP 1039, F-51687 REIMS Cedex 2 (France)], E-mail: christophe.clement@univ-reims.fr; Vaillant-Gaveau, Nathalie [Laboratoire de Stress, Defenses et Reproduction des Plantes, URVVC-SE EA 2069, Universite de Reims Champagne-Ardenne, UFR Sciences Exactes et Naturelles, Batiment 18, Moulin de la Housse, BP 1039, F-51687 REIMS Cedex 2 (France)], E-mail: nathalie.vaillant-gaveau@univ-reims.fr

2009-01-15

The aim of this study was to determine the impact of the fludioxonil (fdx) fungicide on the diurnal fluctuation in grapevine photosynthesis. Therefore, fdx treatment was performed at the end of flowering, at 8 am, 12 am or 7 pm. The study was performed in experimental field and several photosynthesis parameters were followed one day after treatment. Morning fdx treatment induced (i) a significant and simultaneous drop of both photosynthesis (Pn) and stomatal conductance between 8 am and 4 pm and (ii) an increase of intercellular CO{sub 2} concentration when compared to control plants. On the contrary, evening fdx treatment did not affect Pn whereas midday treatment caused Pn increase after 4 pm. These data suggest that (i) morning fdx treatment results in a non-stomatal limitation of Pn, (ii) midday treatment is more suitable to treat grapevine with fdx and (iii) a phenomenon of gating was noticed. - The period of fdx spraying was an important parameter in stress response: the midday fdx treatment is more suitable to treat grapevine with fdx.

Gating in grapevine: Relationship between application of the fungicide fludioxonil and circadian rhythm on photosynthesis

International Nuclear Information System (INIS)

Petit, Anne-Noelle; Fontaine, Florence; Clement, Christophe; Vaillant-Gaveau, Nathalie

2009-01-01

The aim of this study was to determine the impact of the fludioxonil (fdx) fungicide on the diurnal fluctuation in grapevine photosynthesis. Therefore, fdx treatment was performed at the end of flowering, at 8 am, 12 am or 7 pm. The study was performed in experimental field and several photosynthesis parameters were followed one day after treatment. Morning fdx treatment induced (i) a significant and simultaneous drop of both photosynthesis (Pn) and stomatal conductance between 8 am and 4 pm and (ii) an increase of intercellular CO 2 concentration when compared to control plants. On the contrary, evening fdx treatment did not affect Pn whereas midday treatment caused Pn increase after 4 pm. These data suggest that (i) morning fdx treatment results in a non-stomatal limitation of Pn, (ii) midday treatment is more suitable to treat grapevine with fdx and (iii) a phenomenon of gating was noticed. - The period of fdx spraying was an important parameter in stress response: the midday fdx treatment is more suitable to treat grapevine with fdx

Characterization of an Antioxidant-Enriched Beverage from Grape Musts and Extracts of Winery and Grapevine By-Products

Directory of Open Access Journals (Sweden)

Tabita Aguilar

2018-01-01

Full Text Available The recovery of antioxidants from complex winery and grapevine by-products into Vitis vinifera must offers new opportunities for wine grapes by the development of a new, enriched fruit juice. However, this demands the search for new valorization methods to get hold of additional antioxidant compounds. The objective of this study was to find a novel functionality for grape pomace, grapevine leaves, and canes by its reuse as a functional matrix for the extraction of antioxidants into grape must. After thermomaceration, 22 polyphenols were identified by high performance liquid chromatography and mass spectrometry. Grape pomace was a good source of anthocyanins (malvidin-3-glucoside, while flavonols (quercetin-3-hexoside and phenolic acids (caftaric acid were the main phenolic compounds in leaf extracts. Catechin dimer was the only polyphenol compound present in all of the matrices. Enriched grape juice comprised by 40:20:40 (v/v/v of pomace, leaf, and cane extracts, yielded an oxygen radical absorbance capacity of pirogallol red and fluorescein ratio of 0.70, indicating that the reactivity of antioxidants present in enriched grape juice was at least as efficient as other polyphenol-rich beverages. Thus, pomace, leaves and canes supply additional polyphenols to grape must that results into a beverage with promissory antioxidant activity and potential health benefits.

Responses of grapevine rootstocks to drought through altered root system architecture and root transcriptomic regulations.

Science.gov (United States)

Yıldırım, Kubilay; Yağcı, Adem; Sucu, Seda; Tunç, Sümeyye

2018-06-01

Roots are the major interface between the plant and various stress factors in the soil environment. Alteration of root system architecture (RSA) (root length, spread, number and length of lateral roots) in response to environmental changes is known to be an important strategy for plant adaptation and productivity. In light of ongoing climate changes and global warming predictions, the breeding of drought-tolerant grapevine cultivars is becoming a crucial factor for developing a sustainable viticulture. Root-trait modeling of grapevine rootstock for drought stress scenarios, together with high-throughput phenotyping and genotyping techniques, may provide a valuable background for breeding studies in viticulture. Here, tree grafted grapevine rootstocks (110R, 5BB and 41B) having differential RSA regulations and drought tolerance were investigated to define their drought dependent root characteristics. Root area, root length, ramification and number of root tips reduced less in 110R grafted grapevines compared to 5BB and 41B grafted ones during drought treatment. Root relative water content as well as total carbohydrate and nitrogen content were found to be much higher in the roots of 110R than it was in the roots of other rootstocks under drought. Microarray-based root transcriptome profiling was also conducted on the roots of these rootstocks to identify their gene regulation network behind drought-dependent RSA alterations. Transcriptome analysis revealed totally 2795, 1196 and 1612 differentially expressed transcripts at the severe drought for the roots of 110R, 5BB and 41B, respectively. According to this transcriptomic data, effective root elongation and enlargement performance of 110R were suggested to depend on three transcriptomic regulations. First one is the drought-dependent induction in sugar and protein transporters genes (SWEET and NRT1/PTR) in the roots of 110R to facilitate carbohydrate and nitrogen accumulation. In the roots of the same rootstock

Comparing Kaolin and Pinolene to Improve Sustainable Grapevine Production during Drought

OpenAIRE

Brillante, Luca; Belfiore, Nicola; Gaiotti, Federica; Lovat, Lorenzo; Sansone, Luigi; Poni, Stefano; Tomasi, Diego

2016-01-01

Viticulture is widely practiced in dry regions, where the grapevine is greatly exposed to water stress. Optimizing plant water use efficiency (WUE) without affecting crop yield, grape and wine quality is crucial to limiting use of water for irrigation and to significantly improving viticulture sustainability. This study examines the use in vineyards of particle film technology (engineered kaolin) and compares it to a film-forming antitranspirant (pinolene), traditionally used to limit leaf wa...

Detection and Molecular Characterization of Grapevine Virus A in Jordan

Directory of Open Access Journals (Sweden)

G. Anfoka

2004-12-01

Full Text Available In a study on grapevines in Jordan conducted between 2002 and 2003, grapevine virus A (GVA was detected in all areas where grapevines were planted. DAS-ELISA analysis of samples from symptomatic trees found that 16.1% of samples were infected with GVA. Using a GVA- specific primer pair (H587/C995, a portion of the coat protein gene of the virus was amplified by IC-RT-PCR and RT-PCR, using leaf extracts and RNA extracted from infected grapevines respectively. After cloning and sequencing the coat protein gene of the Jordanian isolate of GVA (GVA-Jo, the sequence of the amplified product was compared with sequences of other GVA isolates from different countries.

Enhanced salt-induced antioxidative responses involve a contribution of polyamine biosynthesis in grapevine plants.

Science.gov (United States)

Ikbal, Fatima Ezzohra; Hernández, José Antonio; Barba-Espín, Gregorio; Koussa, Tayeb; Aziz, Aziz; Faize, Mohamed; Diaz-Vivancos, Pedro

2014-06-15

The possible involvement of polyamines in the salt stress adaptation was investigated in grapevine (Vitis vinifera L.) plantlets focusing on photosynthesis and oxidative metabolism. Salt stress resulted in the deterioration of plant growth and photosynthesis, and treatment of plantlets with methylglyoxal-bis(guanylhydrazone) (MGBG), a S-adenosylmethionine decarboxylase (SAMDC) inhibitor, enhanced the salt stress effect. A decrease in PSII quantum yield (Fv/Fm), effective PSII quantum yield (Y(II)) and coefficient of photochemical quenching (qP) as well as increases in non-photochemical quenching (NPQ) and its coefficient (qN) was observed by these treatments. Salt and/or MGBG treatments also triggered an increase in lipid peroxidation and reactive oxygen species (ROS) accumulation as well as an increase of superoxide dismutase (SOD) and peroxidase (POX) activities, but not ascorbate peroxidase (APX) activity. Salt stress also resulted in an accumulation of oxidized ascorbate (DHA) and a decrease in reduced glutathione. MGBG alone or in combination with salt stress increased monodehydroascorbate reductase (MDHAR), SOD and POX activities and surprisingly no accumulation of DHA was noticed following treatment with MGBG. These salt-induced responses correlated with the maintaining of high level of free and conjugated spermidine and spermine, whereas a reduction of agmatine and putrescine levels was observed, which seemed to be amplified by the MGBG treatment. These results suggest that maintaining polyamine biosynthesis through the enhanced SAMDC activity in grapevine leaf tissues under salt stress conditions could contribute to the enhanced ROS scavenging activity and a protection of photosynthetic apparatus from oxidative damages. Copyright © 2014 Elsevier GmbH. All rights reserved.

Respecting the Grapevine.

Science.gov (United States)

Carroll, David J.

2001-01-01

Administrators can create word-of-mouth communication that dispels negative attitudes and build good school reputations by discovering what parents and students are saying, targeting employee satisfaction and retention, providing excellent customer service, actively seeking and handling complaints, nurturing champions, and integrating "grapevine"…

Exogenous strigolactone interacts with abscisic acid-mediated accumulation of anthocyanins in grapevine berries

Czech Academy of Sciences Publication Activity Database

Ferrero, M.; Pagliarani, C.; Novák, Ondřej; Ferrandino, A.; Cardinale, F.; Visentin, I.; Schubert, A.

2018-01-01

Roč. 69, č. 9 (2018), s. 2391-2401 ISSN 0022-0957 Institutional support: RVO:61389030 Keywords : vitis-vinifera l. * cabernet-sauvignon * seed-germination * drought stress * nonclimacteric fruit * lotus-japonicus * gene-expression * plant hormones * analog gr24 * biosynthesis * ABA conjugation * ABA hydroxylases * ABA transporters * abscisic acid * anthocyanin * grapevine * gr24 * ripening * strigolactones Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 5.830, year: 2016

Effect of two doses of urea foliar application on leaves and grape nitrogen composition during two vintages.

Science.gov (United States)

Pérez-Álvarez, Eva P; Garde-Cerdán, Teresa; García-Escudero, Enrique; Martínez-Vidaurre, José María

2017-06-01

Nitrogen affects grapevine growth and also yeast metabolism, which have a direct influence on fermentation kinetics and the formation of different volatile compounds. Throughout the grapevine cycle, soil nitrogen availability and grape nitrogen composition can vary because of different factors. Nitrogen foliar applications can contribute toward enhancing grapevine nitrogen status and minimize the problem of leaching that traditional nitrogen-soil applications can provoke. The present study aimed to evaluate the influence of urea foliar applications on grapevine nitrogen status and grape amino acid content. Accordingly, two different doses of urea were applied over the leaves of a 'Tempranillo' vineyard. The highest urea doses affected nitrogen content on blade leaf tissues after veraison. Must amino acid profiles were modified by urea application and some of the compounds increased their concentrations. The effect of year on the increase of must total amino acid concentrations was more important than the effect of the doses applied. Urea foliar applications can be an interesting tool for decreasing grapevine nitrogen deficiencies. This method of nitrogen implementation in the vineyard could avoid sluggish fermentation problems during winemaking, enhance must nitrogen composition, and contribute to improving wine quality. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

14C-incorporation into sugars and organic acids of water-stressed maize leaves

International Nuclear Information System (INIS)

Becker, T.; Fock, H.

1986-01-01

The incorporation of 14 C into sugars and some organic acids of maize leaves has been studied in relation to the leaf water potential by feeding 14 CO 2 (370 ppm) for 1,2 and 4 min during steady state photosynthesis at 25 0 C (PAR = 800 μmol m -2 s -1 ). The relative specific radioactivity (RSA) of the sugars was low (0.2% after 4 min) at -0.62 MPa (control) and decreased by about 50% when psi dropped to -0.95 MPa. The authors conclude that the low rate of photosynthetic sugar synthesis in maize leaves decreased during water stress. The RSA of malate was extremely low at -0.62 MPa (0.02%). This result may be the consequence of the large pool size of malate in maize leaves. The authors presume that there are two malate pools present in maize leaves, a small metabolic pool and a larger storage pool. The RSA of malate decreased during the stress period. This is consistent with the decline in net CO 2 uptake during water stress. The pool sizes of citrate and isocitrate increased when psi dropped to -0.95 MPa. As practically no radioactivity was detected in these organic acids, they conclude that these compounds are synthesized from unlabelled precursors during water stress

Cadmium stress alters the redox reaction and hormone balance in oilseed rape (Brassica napus L.) leaves.

Science.gov (United States)

Yan, Hui; Filardo, Fiona; Hu, Xiaotao; Zhao, Xiaomin; Fu, DongHui

2016-02-01

In order to understand the physiological response of oilseed rape (Brassica napus L.) leaves to cadmium (Cd) stress and exploit the physiological mechanisms involved in Cd tolerance, macro-mineral and chlorophyll concentrations, reactive oxygen species (ROS) accumulation, activities of enzymatic antioxidants, nonenzymatic compounds metabolism, endogenous hormonal changes, and balance in leaves of oilseed rape exposed to 0, 100, or 200 μM CdSO4 were investigated. The results showed that under Cd exposure, Cd concentrations in the leaves continually increased while macro-minerals and chlorophyll concentrations decreased significantly. Meanwhile, with increased Cd stress, superoxide anion (O2(• -)) production rate and hydrogen peroxide (H2O2) concentrations in the leaves increased significantly, which caused malondialdehyde (MDA) accumulation and oxidative stress. For scavenging excess accumulated ROS and alleviating oxidative injury in the leaves, the activity of enzymatic antioxidants, such as superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT), was increased significantly at certain stress levels. However, with increased Cd stress, the antioxidant enzyme activities all showed a trend towards reduction. The nonenzymatic antioxidative compounds, such as proline and total soluble sugars, accumulated continuously with increased Cd stress to play a long-term role in scavenging ROS. In addition, ABA levels also increased continuously with Cd stress while ZR decreased and the ABA/ZR ratio increased, which might also be providing a protective role against Cd toxicity.

Over-expression of VvWRKY1 in grapevines induces expression of jasmonic acid pathway-related genes and confers higher tolerance to the downy mildew.

Directory of Open Access Journals (Sweden)

Chloé Marchive

Full Text Available Most WRKY transcription factors activate expression of defence genes in a salicylic acid- and/or jasmonic acid-dependent signalling pathway. We previously identified a WRKY gene, VvWRKY1, which is able to enhance tolerance to fungal pathogens when it is overexpressed in tobacco. The present work analyzes the effects of VvWRKY1 overexpression in grapevine. Microarray analysis showed that genes encoding defence-related proteins were up-regulated in the leaves of transgenic 35S::VvWRKY1 grapevines. Quantitative RT-PCR analysis confirmed that three genes putatively involved in jasmonic acid signalling pathway were overexpressed in the transgenic grapes. The ability of VvWRKY1 to trans-activate the promoters of these genes was demonstrated by transient expression in grape protoplasts. The resistance to the causal agent of downy mildew, Plasmopara viticola, was enhanced in the transgenic plants. These results show that VvWRKY1 can increase resistance of grapevine against the downy mildew through transcriptional reprogramming leading to activation of the jasmonic acid signalling pathway.

PLEADING FOR THE GRAPEVINE CULTURE

Directory of Open Access Journals (Sweden)

Ionela Cătălina Guţă

2012-04-01

Full Text Available The grapevine is cultivated with good results on hilly terrain, on sand and sandy soils, thus ensuring high recovery of these categories of agricultural land considered unsuitable for other crops. Vineyards, so related to people existence everywhere, became something more than just places of economic interest. What makes the viticulture to be so important is that it refers to the food value, therapeutic, recreational of grapes, must and wine, wine derived products and residues from wine, the great extent of the area occupied by vineyards, to good natural conditions (pedo-climatic existing in our country and also to the aesthetic value of the land planted with vines worldwide. The fitting of the gardens of the house, both in the countryside and in urban areas, includes in most cases the presence of grapevine plants cut in different art forms, their care being an exciting job. In general, by the presence of vines are valued the spaces next to existing buildings (house, yard, various outbuildings, along fences and roads. Grapevines location, cutting types chosen, besides beautifying the yard, must make a harmonious aspect of the whole surrounding. Chosen forms of management (arches, halfarches can protect the strong sunlight places. By the kiosks or other artistic realized forms are created spaces for rest, shade.

‘Bois noir’: new phytoplasma disease of grapevine in Iran

Directory of Open Access Journals (Sweden)

Mirchenari Seyed Mehdi

2015-01-01

Full Text Available Recently, grapevines showing symptoms suggesting the ‘bois noir’ phytoplasma disease were observed in vineyards located in several central provinces of Iran. Polymerase chain reaction assays using phytoplasma universal primer pair P1A/P7A followed by primer pair R16F2n/R16R2 in nested PCR, confirmed the association of phytoplasmas with symptomatic grapevines. The results of RFLP analyses using HpaII, HinfI, MseI, RsaI, and TaqI restriction enzymes, indicated that grapevine phytoplasma isolates in these regions could be related to the 16SrXII group. Sequence analyses of the partial 16S rRNA gene confirmed that Iranian grapevine phytoplasmas are associated with ‘Candidatus Phytoplasma solani’. This is the first report of the ‘bois noir’ disease outbreak in Iran

Control of grapevine wood fungi in commercial nurseries

Directory of Open Access Journals (Sweden)

C. Rego

2009-05-01

Full Text Available Previous surveys conducted in commercial nurseries found that different wood fungi, namely Cylindrocarpon spp., Botryosphaeriaceae, Phomopsis viticola and Phaeomoniella chlamydospora infect grapevine cuttings. Two field trials were carried out to evaluate the effectiveness of cyprodinil + fludioxonil, pyraclostrobin + metiram, fludioxonil and cyprodinil to prevent or reduce natural infections caused by such fungi. Rootstock and scion cuttings were soaked in fungicidal suspensions for 50 min prior to grafting. After callusing, the grafted cuttings were planted in two commercial field nurseries with and without a previous history of grapevine cultivation. After nine months in the nursery, the plants were uprooted and analysed for the incidence and severity of the wood fungi. Plants uprooted from the field without a previous history of grapevine cultivation were generally less strongly infected by wood fungi. Under this condition, only the mixture cyprodinil + fludioxonil simultaneously reduced the incidence of Cylindrocarpon and Botryosphaeriaceae fungi, as well as the severity of Cylindrocarpon infections. Treatments did not produce significant differences in the incidence and severity of P. viticola, and Pa. chlamydospora. For plants grown in the field with a grapevine history, all fungicides except cyprodinil significantly reduced the incidence and severity of Cylindrocarpon fungi. Also, the incidence and severity of Botryosphaeriaceae pathogens were significantly decreased both by cyprodinil + fludioxonil and by cyprodinil. No significant differences were noticed for P. viticola incidence and severity, and Pa. chlamydospora was not detected again. These results suggest that the practice of soaking grapevine cuttings in selected fungicides prior to grafting significantly reduces Cylindrocarpon spp. and Botryosphaeriaceae infections, thus improving the quality of planting material.

Developmental control of hypoxia during bud burst in grapevine.

Science.gov (United States)

Meitha, Karlia; Agudelo-Romero, Patricia; Signorelli, Santiago; Gibbs, Daniel J; Considine, John A; Foyer, Christine H; Considine, Michael J

2018-05-01

Dormant or quiescent buds of woody perennials are often dense and in the case of grapevine (Vitis vinifera L.) have a low tissue oxygen status. The precise timing of the decision to resume growth is difficult to predict, but once committed, the increase in tissue oxygen status is rapid and developmentally regulated. Here, we show that more than a third of the grapevine homologues of widely conserved hypoxia-responsive genes and nearly a fifth of all grapevine genes possessing a plant hypoxia-responsive promoter element were differentially regulated during bud burst, in apparent harmony with resumption of meristem identity and cell-cycle gene regulation. We then investigated the molecular and biochemical properties of the grapevine ERF-VII homologues, which in other species are oxygen labile and function in transcriptional regulation of hypoxia-responsive genes. Each of the 3 VvERF-VIIs were substrates for oxygen-dependent proteolysis in vitro, as a function of the N-terminal cysteine. Collectively, these data support an important developmental function of oxygen-dependent signalling in determining the timing and effective coordination bud burst in grapevine. In addition, novel regulators, including GASA-, TCP-, MYB3R-, PLT-, and WUS-like transcription factors, were identified as hallmarks of the orderly and functional resumption of growth following quiescence in buds. © 2018 John Wiley & Sons Ltd.

Biotechnology of temperate fruit trees and grapevines.

Science.gov (United States)

Laimer, Margit; Mendonça, Duarte; Maghuly, Fatemeh; Marzban, Gorji; Leopold, Stephan; Khan, Mahmood; Balla, Ildiko; Katinger, Hermann

2005-01-01

Challenges concerning fruit trees and grapevines as long lived woody perennial crops require adapted biotechnological approaches, if solutions are to be found within a reasonable time frame. These challenges are represented by the need for correct identification of genetic resources, with the foreseen use either in conservation or in breeding programmes. Molecular markers provide most accurate information and will be the major solution for questions about plant breeders rights. Providing healthy planting material and rapid detection of newly introduced pathogens by reliable methods involving serological and molecular biological tools will be a future challenge of increases importance, given the fact that plant material travels freely in the entire European Union. But also new breeding goals and transgenic solutions are part of the biotechnological benefits, e.g. resistance against biotic and abiotic stress factors, modified growth habits, modified nutritional properties and altered processing and storage qualities. The successful characterization of transgenic grapevines and stone fruit trees carrying genes of viral origin in different vectors constructed under ecological consideration, will be presented. Beyond technical feasibility, efficiency of resistance, environmental safety and Intellectual Property Rights, also public acceptance needs consideration and has been addressed in a specific project. The molecular determination of internal quality parameters of food can also be addressed by the use of biotechnological tools. Patient independent detection tools for apple allergens have been developed and should allow to compare fruits from different production systems, sites, and genotypes for their content of health threatening compounds.

Characterization of Cadophora luteo-olivacea and C. melinii isolates obtained from grapevines and environmental samples from grapevine nurseries in Spain

Directory of Open Access Journals (Sweden)

David GRAMAJE

2011-12-01

Full Text Available Fifty-eight Cadophora luteo-olivacea and three C. melinii isolates were recovered from grapevines showing black vascular streaking and decline symptoms characteristic of Petri disease, and from different stages of the grapevine nursery process in Spain. The isolates were studied by means of phenotypical characterization, DNA analysis and pathogenicity tests. The morphological characters studied included conidiophore, phialide and conidial morphology. Colony characters and pigment production on MEA, PDA and OA were also examined. Phenotypical data were subjected to cluster analysis, which clearly separated C.luteo-olivacea isolates into four groups. Mating tests were performed on all possible combinations for each Cadophora species but no sexual fruiting bodies were produced. Partial sequences of the nuclear ribosomal internal transcribed spacer (ITS, beta-tubulin (BT and the elongation factor 1a (EF were analysed, but no genetic variation occurred within the C. luteo-olivacea isolates or within the C. melinii isolates in any of the regions studied. Pathogenicity tests were conducted on 1-year-old grapevine cuttings of four different rootstocksusing four C. luteo-olivacea isolates and one isolate of C. melinii. All Cadophora isolates except the C.melinii isolate caused significantly longer lesions in the xylem of grapevine rootstocks than in the controls.

Stomatal Responses to Light and Drought Stress in Variegated Leaves of Hedera helix1

Science.gov (United States)

Aphalo, Pedro J.; Sánchez, Rodolfo A.

1986-01-01

Direct and indirect mechanisms underlying the light response of stomata were studied in variegated leaves of the juvenile phase of Hedera helix L. Dose response curves of leaf conductance were measured with blue and red light in leaves kept in normal or in an inverted position. In the green portions of the leaves, the sensitivity to blue light was nearly 100 times higher than that to red light. No response to red light was observed in the white portions of the leaves up to 90 micromoles per square meter per second. Red light indirectly affected leaf conductance while blue light had a direct effect. Leaf conductance was found to be more sensitive to drought stress and showed a more persistent aftereffect in the white portions of the leaves. A differential effect of drought stress on the responses to blue and red light was also observed. PMID:16664900

Grape yield, and must compounds of 'Cabernet Sauvignon' grapevine in sandy soil with potassium contents increasing

Directory of Open Access Journals (Sweden)

Marlise Nara Ciotta

2016-08-01

Full Text Available ABSTRACT: Content of exchangeable potassium (K in t soil may influence on its content in grapevines leaves, grape yield, as well as, in must composition. The study aimed to assess the interference of exchangeable K content in the soil on its leaf content, production and must composition of 'Cabernet Sauvignon' cultivar. In September 2011, in Santana do Livramento (RS five vineyards with increasing levels of exchangeable K in the soil were selected. In the 2012/13 and 2013/14 harvests, the grape yield, yield components, total K content in the leaves in full bloom and berries veraison were evaluated. Values of total soluble sugar (TSS, pH, total titratable acidity (TTA, total polyphenols and anthocyanins were evaluated in the must. Exchangeable K content increase in soil with sandy surface texture increased its content in leaves collected during full flowering and in berries and must pH; however, it did not affect production of the 'Cabernet Sauvignon'.

[Investigation of the hyperspectral image characteristics of wheat leaves under different stress].

Science.gov (United States)

Zhang, Dong-Yan; Zhang, Jing-Cheng; Zhu, Da-Zhou; Wang, Ji-Hua; Luo, Ju-Hua; Zhao, Jin-Ling; Huang, Wen-Jiang

2011-04-01

The diagnosis of growing status and vigor of crops under various stresses is an important step in precision agriculture. Hyperspectral imaging technology has the advantage of providing both spectral and spatial information simultaneously, and has become a research hot spot. In the present study, auto-development of the pushbroom imaging spectrometer (PIS) was utilized to collect hyperspectral images of wheat leaves which suffer from shortage of nutrient, pest and disease stress. The hyperspectral cube was processed by the method of pixel average step by step to highlight the spectral characteristics, which facilitate the analysis based on the differences of leaves reflectance. The results showed that the hyperspectra of leaves from different layers can display nutrient differences, and recognize intuitively different stress extent by imaging figures. With the 2 nanometer spectral resolution and millimeter level spatial resolution of PIS, the number of disease spot can be qualitatively calculated when crop is infected with diseases, and, the area of plant disease could also be quantitatively analyzed; when crop suffered from pest and insect, the spectral information of leaves with single aphid and aphids can be detected by PIS, which provides a new means to quantitatively detect the aphid destroying of wheat leaf. The present study demonstrated that hyperspecral imaging has a great potential in quantitative and qualitative analysis of crop growth.

Root-associated bacteria promote grapevine growth: from the laboratory to the field

KAUST Repository

Rolli, Eleonora

2016-08-18

Background and Aims: Laboratory and greenhouse experiments have shown that root-associated bacteria have beneficial effects on grapevine growth; however, these effects have not been tested in the field. Here, we aimed to demonstrate whether bacteria of different geographical origins derived from different crop plants can colonize grapevine to gain a beneficial outcome for the plant leading to promote growth at the field scale. Methods: To link the ecological functions of bacteria to the promotion of plant growth, we sorted fifteen bacterial strains from a larger isolate collection to study in vitro Plant Growth Promoting (PGP) traits. We analysed the ability of these strains to colonise the root tissues of grapevine and Arabidopsis using green-fluorescent-protein-labelled strain derivatives and a cultivation independent approach. We assessed the ability of two subsets randomly chosen from the 15 selected strains to promote grapevine growth in two field-scale experiments in north and central Italy over two years. Parameters of plant vigour were measured during the vegetative season in de novo grafted vine cuttings and adult productive plants inoculated with the bacterial strains. Results: Beneficial bacteria rapidly and intimately colonized the rhizoplane and the root system of grapevine. In the field, plants inoculated with bacteria isolated from grapevine roots out-performed untreated plants. In both the tested vineyards, bacteria-promotion effects largely rely in the formation of an extended epigeal system endowed of longer shoots with larger diameters and more nodes than non-inoculated plants. Conclusions: PGP bacteria isolated in the laboratory can be successfully used to promote growth of grapevines in the field. The resulting larger canopy potentially increased the photosynthetic surface of the grapevine, promoting growth.

Carotenoid profiling of leaves of selected eggplant accessions subjected to drought stress

Science.gov (United States)

This study focused on the quantification of carotenoids of the leaves of African eggplants commonly consumed as leafy and fruit vegetables. The results gave comparative profiles of carotenoids at different growth and developmental stages and under drought stress. Stress was achieved by limiting irri...

Jasmonic acid-isoleucine formation in grapevine (Vitis vinifera L.) by two enzymes with distinct transcription profiles.

Science.gov (United States)

Böttcher, Christine; Burbidge, Crista A; di Rienzo, Valentina; Boss, Paul K; Davies, Christopher

2015-07-01

The plant hormone jasmonic acid (JA) is essential for stress responses and the formation of reproductive organs, but its role in fruit development and ripening is unclear. Conjugation of JA to isoleucine is a crucial step in the JA signaling pathway since only JA-Ile is recognized by the jasmonate receptor. The conjugation reaction is catalyzed by JA-amido synthetases, belonging to the family of Gretchen Hagen3 (GH3) proteins. Here, in vitro studies of two grapevine (Vitis vinifera L. cv Shiraz) GH3 enzymes, VvGH3-7 and VvGH3-9, demonstrated JA-conjugating activities with an overlapping range of amino acid substrates, including isoleucine. Expression studies of the corresponding genes in grape berries combined with JA and JA-Ile measurements suggested a primary role for JA signaling in fruit set and cell division and did not support an involvement of JA in the ripening process. In response to methyl JA (MeJA) treatment, and in wounded and unwounded (distal) leaves, VvGH3-9 transcripts accumulated, indicating a participation in the JA response. In contrast, VvGH3-7 was unresponsive to MeJA and local wounding, demonstrating a differential transcriptional regulation of VvGH3-7 and VvGH3-9. The transient induction of VvGH3-7 in unwounded, distal leaves was suggestive of the involvement of an unknown mobile wound signal. © 2014 Institute of Botany, Chinese Academy of Sciences.

Resistance to Plasmopara viticola in a grapevine segregating population is associated with stilbenoid accumulation and with specific host transcriptional responses

Directory of Open Access Journals (Sweden)

Delledonne Massimo

2011-08-01

Full Text Available Abstract Background Downy mildew, caused by the oomycete Plasmopara viticola, is a serious disease in Vitis vinifera, the most commonly cultivated grapevine species. Several wild Vitis species have instead been found to be resistant to this pathogen and have been used as a source to introgress resistance into a V. vinifera background. Stilbenoids represent the major phytoalexins in grapevine, and their toxicity is closely related to the specific compound. The aim of this study was to assess the resistance response to P. viticola of the Merzling × Teroldego cross by profiling the stilbenoid content of the leaves of an entire population and the transcriptome of resistant and susceptible individuals following infection. Results A three-year analysis of the population's response to artificial inoculation showed that individuals were distributed in nine classes ranging from total resistance to total susceptibility. In addition, quantitative metabolite profiling of stilbenoids in the population, carried out using HPLC-DAD-MS, identified three distinct groups differing according to the concentrations present and the complexity of their profiles. The high producers were characterized by the presence of trans-resveratrol, trans-piceid, trans-pterostilbene and up to thirteen different viniferins, nine of them new in grapevine. Accumulation of these compounds is consistent with a resistant phenotype and suggests that they may contribute to the resistance response. A preliminary transcriptional study using cDNA-AFLP selected a set of genes modulated by the oomycete in a resistant genotype. The expression of this set of genes in resistant and susceptible genotypes of the progeny population was then assessed by comparative microarray analysis. A group of 57 genes was found to be exclusively modulated in the resistant genotype suggesting that they are involved in the grapevine-P. viticola incompatible interaction. Functional annotation of these transcripts

A molecular approach to study the arbuscular mycorrhizal fungi community in a typical Piedmont grapevine cultivar

Science.gov (United States)

Magurno, F.; Bughi Peruglia, G.; Lumini, E.; Bianciotto, V.; Balestrini, R.

2009-04-01

Viticulture and wine production represent one of the most relevant agro-food sectors for the Piedmont Region (Italy) in terms of value, with more than 400 millions € a year (12 % of total agricultural production of the Region and the 10 % of the national grape and wine production). The soil where grapevines (Vitis spp.) grow is one of the first parameters influencing the complex grapevine-wine chain. Arbuscular mycorrhizal fungi (AMFs), a main component of soil microbiota in most agrosystems, are considered crucial biomarkers of soil quality because of their biofertilisers role. As mutualistic symbionts, they colonize the roots of the majority of plants. Benefits in symbiosis are well showed as an improvement in shoot/root growth, mineral transport, water-stress tolerance and resistance to certain diseases. Grapevines roots are often heavily colonized by AMFs under field conditions and in some cases AMFs appear to be necessary for their normal growth and survival. Even so, little information are until now available about composition of AMFs communities living in the vineyards soil and in associations with grapevine roots, mainly related to morphological characterization. Vineyard of Nebbiolo, one of the most important Piedmont cultivar, was selected in order to study the AMFs community using a molecular approach. Soil samples and roots from an experimental vineyard located in Lessona (Biella, Piedmont, Italy) were analyzed using AM fungal-specific primers to partially amplify the small subunit (SSU) of the ribosomal DNA genes. Much more than 650 clones were sequenced. Phylogenetic analyses identified 32 OTUs from soil, clustered into Glomus groups Aa, Ab, Ad and B, Diversisporaceae and Gigasporaceae families. Thirteen OTUs from roots were determined, clustered into Glomus groups Ab, Ad and B, and Gigasporaceae family. In particular, Glomus group Ad was the best represented in both compartments, suggesting a correlation between intra and extra radical communities

Stress-related mental disorders with sick leave: a minimal intervention in general practice

NARCIS (Netherlands)

Bakker, I.M.

2007-01-01

1. Introduction As stated in chapter 1, this study is carried out because patients and their care-givers have much to gain by the development and implementation of effective care for patients on sick leave having stress-related mental disorders (SMDs). Most people having SMDs with sick leave consult

Nature-Based Stress Management Course for Individuals at Risk of Adverse Health Effects from Work-Related Stress—Effects on Stress Related Symptoms, Workability and Sick Leave

Directory of Open Access Journals (Sweden)

Eva Sahlin

2014-06-01

Full Text Available Sick leave due to stress-related disorders is increasing in Sweden after a period of decrease. To avoid that individuals living under heavy stress develop more severe stress-related disorders, different stress management interventions are offered. Self-assessed health, burnout-scores and well-being are commonly used as outcome measures. Few studies have used sick-leave to compare effects of stress interventions. A new approach is to use nature and garden in a multimodal stress management context. This study aimed to explore effects on burnout, work ability, stress-related health symptoms, and sick leave for 33 women participating in a 12-weeks nature based stress management course and to investigate how the nature/garden activities were experienced. A mixed method approach was used. Measures were taken at course start and three follow-ups. Results showed decreased burnout-scores and long-term sick leaves, and increased work ability; furthermore less stress-related symptoms were reported. Tools and strategies to better handle stress were achieved and were widely at use at all follow-ups. The garden and nature content played an important role for stress relief and for tools and strategies to develop. The results from this study points to beneficial effects of using garden activities and natural environments in a stress management intervention.

Nature-Based Stress Management Course for Individuals at Risk of Adverse Health Effects from Work-Related Stress—Effects on Stress Related Symptoms, Workability and Sick Leave

Science.gov (United States)

Sahlin, Eva; Ahlborg, Gunnar; Vega Matuszczyk, Josefa; Grahn, Patrik

2014-01-01

Sick leave due to stress-related disorders is increasing in Sweden after a period of decrease. To avoid that individuals living under heavy stress develop more severe stress-related disorders, different stress management interventions are offered. Self-assessed health, burnout-scores and well-being are commonly used as outcome measures. Few studies have used sick-leave to compare effects of stress interventions. A new approach is to use nature and garden in a multimodal stress management context. This study aimed to explore effects on burnout, work ability, stress-related health symptoms, and sick leave for 33 women participating in a 12-weeks nature based stress management course and to investigate how the nature/garden activities were experienced. A mixed method approach was used. Measures were taken at course start and three follow-ups. Results showed decreased burnout-scores and long-term sick leaves, and increased work ability; furthermore less stress-related symptoms were reported. Tools and strategies to better handle stress were achieved and were widely at use at all follow-ups. The garden and nature content played an important role for stress relief and for tools and strategies to develop. The results from this study points to beneficial effects of using garden activities and natural environments in a stress management intervention. PMID:25003175

Moderate water stress from regulated deficit irrigation decreases transpiration similarly to net carbon exchange in grapevine canopies

Science.gov (United States)

To determine the effects of timing and extent of regulated deficit irrigation (RDI) on grapevine (Vitis vinifera) canopies, whole-canopy transpiration (TrV) and canopy conductance to water vapor (gc) were calculated from whole-vine gas exchange near key stages of fruit development. The vines were ma...

Grapevine species from varied native habitats exhibit differences in embolism formation/repair associated with leaf gas exchange and root pressure.

Science.gov (United States)

Knipfer, Thorsten; Eustis, Ashley; Brodersen, Craig; Walker, Andrew M; McElrone, Andrew J

2015-08-01

Drought induces xylem embolism formation, but grapevines can refill non-functional vessels to restore transport capacity. It is unknown whether vulnerability to embolism formation and ability to repair differ among grapevine species. We analysed in vivo embolism formation and repair using x-ray computed microtomography in three wild grapevine species from varied native habitats (Vitis riparia, V. arizonica, V. champinii) and related responses to measurements of leaf gas exchange and root pressure. Vulnerability to embolism formation was greatest in V. riparia, intermediate in V. arizonica and lowest in V. champinii. After re-watering, embolism repair was rapid and pronounced in V. riparia and V. arizonica, but limited or negligible in V. champinii even after numerous days. Similarly, root pressure measured after re-watering was positively correlated with drought stress severity for V. riparia and V. arizonica (species exhibiting embolism repair) but not for V. champinii. Drought-induced reductions in transpiration were greatest for V. riparia and least in V. champinii. Recovery of transpiration after re-watering was delayed for all species, but was greatest for V. champinii and most rapid in V. arizonica. These species exhibit varied responses to drought stress that involve maintenance/recovery of xylem transport capacity coordinated with root pressure and gas exchange responses. © 2014 John Wiley & Sons Ltd.

Evaluation of five protocols for DNA extraction from leaves of Malus sieversii, Vitis vinifera, and Armeniaca vulgaris.

Science.gov (United States)

Aubakirova, K; Omasheva, M; Ryabushkina, N; Tazhibaev, T; Kampitova, G; Galiakparov, N

2014-02-27

Leaves of Malus sieversii, Vitis vinifera, and Armeniaca vulgaris contain substantial amounts of secondary metabolites, which limit the high-quality DNA extraction performance. In this study, five extraction protocols were compared for their ability to produce good quality DNA from fresh and dried (with silica gel) leaves of these species. The modified protocol of Dellaporta et al., using polyvinylpyrrolidone to bind the phenolic compounds and a high molar concentration of potassium acetate to inhibit co-precipitation of polysaccharides with DNA, produced the best DNA quality for all species tested. DNA extracted by this method had a 1.77-1.96 A260/280 nm ratio and successful amplification of the 18S ribosomal DNA gene. DNA concentrations of dried leaves were lower than those obtained from fresh leaves, which was likely due to aspects of the drying procedure. All five methods for grapevine produced DNA of obvious better quality from green canes compared to leaves, due to the relatively low content of secondary metabolites in the former. For grapevine and apricot, three methods can be equally used to obtain DNA of good quality: the Doyle and Doyle modified method using CTAB and high concentration of NaCl, the Jobes et al. modified method, and the sodium dodecyl sulfate mini preparation method of Edwards et al. The protocol of Jobes et al. using LiCl for RNA removal showed the best results for most of the M. sieversii samples examined.

Proline accumulation in water-stressed barley leaves in relation to translocation and the nitrogen budget

International Nuclear Information System (INIS)

Tully, R.E.; Hanson, A.D.; Nelsen, C.E.

1979-01-01

Mobilization of N from leaves of barley (Hordeum vulgare L.) during water stress, and the role of proline as a mobilized species, were examined in plants at the three-leaf stage. The plants responded to water stress by withdrawing about 25% of the total reduced N from the leaf blades via phloem translocation. Most of this N loss was during the first 2 days while translocation of 14 C-photosynthate out of the stressed blade still remained active. Free proline accumulation in the blade was initially slow, and became more rapid during the 2nd day of stress. Although a major free amino acid, proline accounted for only about 5% of the total N(soluble + insoluble) retained in severely stressed blades. When the translocation pathway in water-stressed leaves was interrupted just below the blade by a heat girdle, a cold jacket, or by blade excision, N loss from the blade was prevented and proline began to accumulate rapidly on 1st day of stress. Little free proline accumulated in the blades until after the ability to translocate was lost. Proline was, however, probably not a major species of N translocated during stress, because proline N accumulation in heat-girdled stressed leaves was five times slower than the rate of total N export from intact blades

Genomics technologies to study structural variations in the grapevine genome

Directory of Open Access Journals (Sweden)

Cardone Maria Francesca

2016-01-01

Full Text Available Grapevine is one of the most important crop plants in the world. Recently there was great expansion of genomics resources about grapevine genome, thus providing increasing efforts for molecular breeding. Current cultivars display a great level of inter-specific differentiation that needs to be investigated to reach a comprehensive understanding of the genetic basis of phenotypic differences, and to find responsible genes selected by cross breeding programs. While there have been significant advances in resolving the pattern and nature of single nucleotide polymorphisms (SNPs on plant genomes, few data are available on copy number variation (CNV. Furthermore association between structural variations and phenotypes has been described in only a few cases. We combined high throughput biotechnologies and bioinformatics tools, to reveal the first inter-varietal atlas of structural variation (SV for the grapevine genome. We sequenced and compared four table grape cultivars with the Pinot noir inbred line PN40024 genome as the reference. We detected roughly 8% of the grapevine genome affected by genomic variations. Taken into account phenotypic differences existing among the studied varieties we performed comparison of SVs among them and the reference and next we performed an in-depth analysis of gene content of polymorphic regions. This allowed us to identify genes showing differences in copy number as putative functional candidates for important traits in grapevine cultivation.

Genetic characterization of some Romanian red wine grapevine varieties

Science.gov (United States)

Ghetea, Ligia Gabriela; Motoc, Rozalia Magda; Niculescu, Ana-Maria; Litescu, Simona Carmen; Duma, Virgil-Florin; Popescu, Carmen Florentina

2008-04-01

In our study we have considered three of the most valuable Romanian red wine grapevine cultivars: Feteasca neagra, Feteasca alba and Novac. We have chosen to study grapevine because grapes and wine are an important part of a healthy diet, and because red grapes have the highest content of proanthocyanidins, that act as antioxidants (free radical scavengers) in the human body. Proanthocyanidins possess anti-mutagenic, anti-tumor, anti-viral activities and they present many other confirmed or potential benefits. Genotyping method was applied in order to asses the genetic profile at 14 microsatellite loci, for two cultivars: Feteasca neagra and Feteasca alba. In order to achieve this, the HPLC-DAD method was used. The content of anthocyans in grape skin from two cultivars - Feteasca neagra and Novac - was measured. Microsatellite markers have been certified as powerful tools for assessing genetic identities and genetic relationships between grapevine gene pools. Genetic characterization of grapevine cultivars can certify their authenticity and purity, two features that have a direct effect on the quality and value of the finished product, the wine. In our country, this is the first attempt in order to establish a genetic profile for valuable Romanian origin grapevine varieties. In some of the 14 microsatellitic loci, Feteasca neagra and Feteasca alba cultivars presented allele size variants different from the values cited in the literature, proving that these cultivars belong to a geographical distinct gene pool. The content of anthocyans in Feteasca neagra grape skin was significantly higher than in Novac.

Transcriptomic analysis of grape (Vitis vinifera L.) leaves during and after recovery from heat stress.

Science.gov (United States)

Liu, Guo-Tian; Wang, Jun-Fang; Cramer, Grant; Dai, Zhan-Wu; Duan, Wei; Xu, Hong-Guo; Wu, Ben-Hong; Fan, Pei-Ge; Wang, Li-Jun; Li, Shao-Hua

2012-09-28

Grapes are a major fruit crop around the world. Heat stress can significantly reduce grape yield and quality. Changes at the molecular level in response to heat stress and subsequent recovery are poorly understood. To elucidate the effect of heat stress and subsequent recovery on expression of genes by grape leaves representing the classic heat stress response and thermotolerance mechanisms, transcript abundance of grape (Vitis vinifera L.) leaves was quantified using the Affymetrix Grape Genome oligonucleotide microarray (15,700 transcripts), followed by quantitative Real-Time PCR validation for some transcript profiles. We found that about 8% of the total probe sets were responsive to heat stress and/or to subsequent recovery in grape leaves. The heat stress and recovery responses were characterized by different transcriptional changes. The number of heat stress-regulated genes was almost twice the number of recovery-regulated genes. The responsive genes identified in this study belong to a large number of important traits and biological pathways, including cell rescue (i.e., antioxidant enzymes), protein fate (i.e., HSPs), primary and secondary metabolism, transcription factors, signal transduction, and development. We have identified some common genes and heat shock factors (HSFs) that were modulated differentially by heat stress and recovery. Most HSP genes were upregulated by heat stress but were downregulated by the recovery. On the other hand, some specific HSP genes or HSFs were uniquely responsive to heat stress or recovery. The effect of heat stress and recovery on grape appears to be associated with multiple processes and mechanisms including stress-related genes, transcription factors, and metabolism. Heat stress and recovery elicited common up- or downregulated genes as well as unique sets of responsive genes. Moreover, some genes were regulated in opposite directions by heat stress and recovery. The results indicated HSPs, especially small HSPs

Transcriptomic analysis of grape (Vitis vinifera L. leaves during and after recovery from heat stress

Directory of Open Access Journals (Sweden)

Liu Guo-Tian

2012-09-01

Full Text Available Abstract Background Grapes are a major fruit crop around the world. Heat stress can significantly reduce grape yield and quality. Changes at the molecular level in response to heat stress and subsequent recovery are poorly understood. To elucidate the effect of heat stress and subsequent recovery on expression of genes by grape leaves representing the classic heat stress response and thermotolerance mechanisms, transcript abundance of grape (Vitis vinifera L. leaves was quantified using the Affymetrix Grape Genome oligonucleotide microarray (15,700 transcripts, followed by quantitative Real-Time PCR validation for some transcript profiles. Results We found that about 8% of the total probe sets were responsive to heat stress and/or to subsequent recovery in grape leaves. The heat stress and recovery responses were characterized by different transcriptional changes. The number of heat stress-regulated genes was almost twice the number of recovery-regulated genes. The responsive genes identified in this study belong to a large number of important traits and biological pathways, including cell rescue (i.e., antioxidant enzymes, protein fate (i.e., HSPs, primary and secondary metabolism, transcription factors, signal transduction, and development. We have identified some common genes and heat shock factors (HSFs that were modulated differentially by heat stress and recovery. Most HSP genes were upregulated by heat stress but were downregulated by the recovery. On the other hand, some specific HSP genes or HSFs were uniquely responsive to heat stress or recovery. Conclusion The effect of heat stress and recovery on grape appears to be associated with multiple processes and mechanisms including stress-related genes, transcription factors, and metabolism. Heat stress and recovery elicited common up- or downregulated genes as well as unique sets of responsive genes. Moreover, some genes were regulated in opposite directions by heat stress and recovery

Carbon Accumulation during Photosynthesis in Leaves of Nitrogen- and Phosphorus-Stressed Cotton.

Science.gov (United States)

Radin, J W; Eidenbock, M P

1986-11-01

Leaves of cotton (Gossypium hirsutum L.) accumulate considerable dry mass per unit area during photosynthesis. The percentage of C in that accumulated dry mass was estimated as the regression coefficient (slope) of a linear regression relating C per unit area to total dry mass per unit area. Plants were grown on full nutrients or on N- or P-deficient nutrient solutions. In the fully nourished controls, the mass that accumulated over a 9-hour interval beginning at dawn contained 38.6% C. N and P stress increased the C concentration of accumulated mass to 49.7% and 45.1%, respectively. Nutrient stress also increased the starch concentration of accumulated mass, but starch alone could not account for the differences in C concentration. P stress decreased the estimated rate of C export from source leaves, calculated as the difference between C assimilation and C accumulation. The effect of P stress on apparent export was very sensitive to the C concentration used in the calculation, and would not have been revealed with an assumption of unchanged C concentration in the accumulated mass.

Physiological and agronomical responses of Syrah grapevine under protected cultivation

Directory of Open Access Journals (Sweden)

Claudia Rita de Souza

2015-01-01

Full Text Available The performance of Syrah grapevine under protected cultivation with different plastic films was evaluated during 2012 and 2013 seasons in South of Minas Gerais State. Agronomical and physiological measurements were done on eight years old grapevines, grafted onto ‘1103 Paulsen’ rootstock cultivated under uncovered conditions, covered with transparent and with diffuse plastic films. Both plastic covers induced the highest shoot growth rate and specific leaf area. The diffuse plastic induced greater differences on leaf area, pruning weight and leaf chlorophyll content as compared to uncovered vines. Grapevines under diffuse plastic also had the lowest rates of photosynthesis, stomatal conductance and transpiration. Leaf starch, glucose and fructose contents were not affected by treatment, but leaf sucrose was reduced by transparent plastic. The leaf and stem water potential were higher under diffuse plastic. In 2013, grapevines under diffuse plastic showed the highest yields mainly due to decreased rot incidence and increased cluster weight. Furthermore, berries under diffuse plastic showed the highest anthocyanins concentration. The use of diffuse plastic induces more agronomical benefits to produce Syrah grape under protected cultivation.

VARYING DEGREE OF GRAFTING COMPATIBILITY BETWEEN CV. CHARDONNAY, MERLOT AND DIFFERENT GRAPEVINE ROOTSTOCKS

Directory of Open Access Journals (Sweden)

Slavica TODIĆ

2006-02-01

Full Text Available Level of affi nity between grapevine rootstock and Vitis vinifera as scion, quality of reproductive materials and technological actions in grapevine rootstock production process determine success in grapevine rootstock production in large extent. Practical training showed that difference in level of compatibility between grapevine rootstock and grafted Vitis vinifera cultivars are existing. Direct effects of these differences are unequal yield of fi rst class grafted grapevine rootlings. In this paper, level of compatibility in nursery between clones of cv. Chardonnay BCL 75, VCR4 and cv. Merlot R18, MCL 519 and grapevine rootstocks Kober 5BB (Vitis berlandieri x V. riparia, SO4 (V. berlandieri x V. riparia and 41B (Chasselas x V.berlandieri were investigated. The trial was conducted in commercial grapevine nursery located in Velika Drenova, Serbia. As an index of compatibility, grade of high quality grapevine grafted rootlings, dry matter in mature shoots and root system development were used. Grafting was done by `tongue grafting` indoor technique. Stratifi cation was done in sand, on temperature of the stratifi cation material of 26-28oC, and humidity of around 90%. Grafted cuttings were waxed twice: before stratifi cation, and before planting in the nursery. Grafted rootlings were classed in two classes according to regulations of quality, (Yugoslav Offi cial Register, 26/79. Grafted rootlings that did not satisfi ed standard criteria were discarded. Both clones of cv. Chardonnay gave the highest percentage of I class grafted rootlings on grapevine rootstock 41B: clone BCL 75 – 60% and clone VCR4 – 61%. In the same combination, those grapevine grafted rootlings had the highest weight of the root system. Lower percentage of obtained I class grafted rootlings was established on rootstock Kober 5BB, while statistically signifi cantly lower yields were obtained on grapevine rootstock SO4: clone BCL75 – 43% and clone VCR4 – 48%. Dry

Whole genome amplification and microsatellite genotyping of herbarium DNA revealed the identity of an ancient grapevine cultivar

Science.gov (United States)

Malenica, Nenad; Šimon, Silvio; Besendorfer, Višnja; Maletić, Edi; Karoglan Kontić, Jasminka; Pejić, Ivan

2011-09-01

Reconstruction of the grapevine cultivation history has advanced tremendously during the last decade. Identification of grapevine cultivars by using microsatellite DNA markers has mostly become a routine. The parentage of several renowned grapevine cultivars, like Cabernet Sauvignon and Chardonnay, has been elucidated. However, the assembly of a complete grapevine genealogy is not yet possible because missing links might no longer be in cultivation or are even extinct. This problem could be overcome by analyzing ancient DNA from grapevine herbarium specimens and other historical remnants of once cultivated varieties. Here, we present the first successful genotyping of a grapevine herbarium specimen and the identification of the corresponding grapevine cultivar. Using a set of nine grapevine microsatellite markers, in combination with a whole genome amplification procedure, we found the 90-year-old Tribidrag herbarium specimen to display the same microsatellite profile as the popular American cultivar Zinfandel. This work, together with information from several historical documents, provides a new clue of Zinfandel cultivation in Croatia as early as the beginning of fifteenth century, under the native name Tribidrag. Moreover, it emphasizes substantial information potential of existing grapevine and other herbarium collections worldwide.

Fungal Endophytes as a Metabolic Fine-Tuning Regulator for Wine Grape.

Directory of Open Access Journals (Sweden)

Ming-Zhi Yang

Full Text Available Endophytes proved to exert multiple effects on host plants, including growth promotion, stress resistance. However, whether endophytes have a role in metabolites shaping of grape has not been fully understood. Eight endophytic fungal strains which originally isolated from grapevines were re-inoculated to field-grown grapevines in this study, and their effects on both leaves and berries of grapevines at maturity stage were assessed, with special focused on secondary metabolites and antioxidant activities. High-density inoculation of all these endophytic fungal strains modified the physio-chemical status of grapevine to different degrees. Fungal inoculations promoted the content of reducing sugar (RS, total flavonoids (TF, total phenols (TPh, trans-resveratrol (Res and activities of phenylalanine ammonia-lyase (PAL, in both leaves and berries of grapevine. Inoculation of endophytic fungal strains, CXB-11 (Nigrospora sp. and CXC-13 (Fusarium sp. conferred greater promotion effects in grape metabolic re-shaping, compared to other used fungal strains. Additionally, inoculation of different strains of fungal endophytes led to establish different metabolites patterns of wine grape. The work implies the possibility of using endophytic fungi as fine-tuning regulator to shape the quality and character of wine grape.

Teor de açúcares solúveis e insolúveis em folhe de videiras, cv. syrah, em diferentes posições no ramo e épocas do ano Soluble and insoluble sugars content in cv. syrah grapevine leaves in different positions of the branch and seasons

Directory of Open Access Journals (Sweden)

Bárbara França Dantas

2007-04-01

Full Text Available Com o crescimento da área cultivada de videira para produção de vinho, tem aumentado a demanda por pesquisas para a região semi-árida do Brasil que resultem no desenvolvimento da viticultura no Vale do São Francisco. Todos os produtos da videira, como uva, vinho, passas, vinagre, têm origem nos açúcares que são produzidos nas folhas durante a fotossíntese e transportados, tanto para os frutos, na época de produção, como para troncos, raízes, folhas não expandidas na fase vegetativa. O objetivo deste trabalho é avaliar a influência da posição no ramo e da variação sazonal no teor de açúcares solúveis e insolúveis nas folhas em videiras para vinho (Vitis vinifera L., cv. Syrah, no Vale do São Francisco. Para tanto, o trabalho foi realizado em um vinhedo comercial e no Laboratório de Sementes/ Fisiologia Vegetal da Embrapa Semi-Árido. A partir dos resultados observados, conclui-se que os açúcares são produzidos em maior quantidade, a partir da quinta folha expandida e acumulam-se em folhas próximas aos cachos. O acúmulo de açúcares nas folhas aumenta após o início da maturação; no entanto, é fortemente influenciado pela temperatura, insolação e radiação.Due to the growth of grapevines cultivated areas for wine production, the requirement for viticulture researches have increased for the Brazilian semi-arid region, that could result in a great development of the viticulture at São Francisco River Valley. All commercialized products of the grapevine, as grape, wine, raisin, vinegar, have their origin in the sugars which are produced in leaves during photosynthesis and transported, in production time, to fruits, trunks, roots and leaves which do not expand in vegetative phase. The objective of this work was to evaluate the influence of the branch position and the seasonal variations in the content of soluble and insoluble sugars in 'Syrah' grapevine for wine production, cultivated at São Francisco River

Proteomic analysis of grapevine resistance induced by Trichoderma harzianum T39 reveals specific defence pathways activated against downy mildew

Science.gov (United States)

Perazzolli, Michele

2012-01-01

Downy mildew is caused by the oomycete Plasmopara viticola and is one of the most serious diseases of grapevine. The beneficial microorganism Trichoderma harzianum T39 (T39) has previously been shown to induce plant-mediated resistance and to reduce the severity of downy mildew in susceptible grapevines. In order to better understand the cellular processes associated with T39-induced resistance, the proteomic and histochemical changes activated by T39 in grapevine were investigated before and 1 day after P. viticola inoculation. A comprehensive proteomic analysis of T39-induced resistance in grapevine was performed using an eight-plex iTRAQ protocol, resulting in the identification and quantification of a total of 800 proteins. Most of the proteins directly affected by T39 were found to be involved in signal transduction, indicating activation of a complete microbial recognition machinery. Moreover, T39-induced resistance was associated with rapid accumulation of reactive oxygen species and callose at infection sites, as well as changes in abundance of proteins involved in response to stress and redox balance, indicating an active defence response to downy mildew. On the other hand, proteins affected by P. viticola in control plants mainly decreased in abundance, possibly reflecting the establishment of a compatible interaction. Finally, the high-throughput iTRAQ protocol allowed de novo peptide sequencing, which will be used to improve annotation of the Vitis vinifera cv. Pinot Noir proteome. PMID:23105132

Global gene expression in cotton (Gossypium hirsutum L. leaves to waterlogging stress.

Directory of Open Access Journals (Sweden)

Yanjun Zhang

Full Text Available Cotton is sensitive to waterlogging stress, which usually results in stunted growth and yield loss. To date, the molecular mechanisms underlying the responses to waterlogging in cotton remain elusive. Cotton was grown in a rain-shelter and subjected to 0 (control-, 10-, 15- and 20-d waterlogging at flowering stage. The fourth-leaves on the main-stem from the top were sampled and immediately frozen in liquid nitrogen for physiological measurement. Global gene transcription in the leaves of 15-d waterlogged plants was analyzed by RNA-Seq. Seven hundred and ninety four genes were up-regulated and 1018 genes were down-regulated in waterlogged cotton leaves compared with non-waterlogged control. The differentially expressed genes were mainly related to photosynthesis, nitrogen metabolism, starch and sucrose metabolism, glycolysis and plant hormone signal transduction. KEGG (Kyoto Encyclopedia of Genes and Genomes analysis indicated that most genes related to flavonoid biosynthesis, oxidative phosphorylation, amino acid metabolism and biosynthesis as well as circadian rhythm pathways were differently expressed. Waterlogging increased the expression of anaerobic fermentation related genes, such as alcohol dehydrogenase (ADH, but decreased the leaf chlorophyll concentration and photosynthesis by down-regulating the expression of photosynthesis related genes. Many genes related to plant hormones and transcription factors were differently expressed under waterlogging stress. Most of the ethylene related genes and ethylene-responsive factor-type transcription factors were up-regulated under water-logging stress, suggesting that ethylene may play key roles in the survival of cotton under waterlogging stress.

Destino do nitrogênio em videiras 'chardonnay' e 'riesling renano' quando aplicado no inchamento das gemas Nitrogen destiny in 'chardonnay' and 'riesling renano' grapevines, when applied in bud break

Directory of Open Access Journals (Sweden)

Gustavo Brunetto

2006-12-01

Chardonnay and Riesling Renano grapevines, at a Udorthent soil in, Bento Gonçalves, Southern Brazil. The vines received the application of 15.91g N plant-1, 40 kg N ha-1, with 4% atoms 15N, in bud break. The buds and leaves were collected in the central parts of the year branch eight different times in the Chardonnay grapes and seven times in the Riesling Renano grapes. The grapevines in the last collection of the leaves were separated in leaves, fruits, year branches, branches with two years and stem, and then were oven-dried, weighted and analyzed total N and 15N contents. The results showed that the larger percentage of N in the leaves of the Chardonnay and the Riesling Renano grapevines, since the beginning of the bud break until harvest is derived of different forms of N from those applied in the bud break. The highest quantity of N accumulated in the annual and perennial part of the grapevines is derived of the soil N, being very small the amounts of N applied in the bud break stored in the perennial parts.

Unraveling uranium induced oxidative stress related responses in Arabidopsis thaliana seedlings. Part II: responses in the leaves and general conclusions

Energy Technology Data Exchange (ETDEWEB)

Vanhoudt, Nathalie, E-mail: nvanhoud@sckcen.be [Belgian Nuclear Research Center (SCK-CEN), Biosphere Impact Studies, Boeretang 200, 2400 Mol (Belgium); Hasselt University, Environmental Biology, Centre for Environmental Sciences, Agoralaan Building D, 3590 Diepenbeek (Belgium); Cuypers, Ann [Hasselt University, Environmental Biology, Centre for Environmental Sciences, Agoralaan Building D, 3590 Diepenbeek (Belgium); Horemans, Nele [Belgian Nuclear Research Center (SCK-CEN), Biosphere Impact Studies, Boeretang 200, 2400 Mol (Belgium); Remans, Tony; Opdenakker, Kelly; Smeets, Karen [Hasselt University, Environmental Biology, Centre for Environmental Sciences, Agoralaan Building D, 3590 Diepenbeek (Belgium); Bello, Daniel Martinez [Hasselt University, Interuniversity Institute for Biostatistics and Statistical Bioinformatics, Agoralaan Building D, 3590 Diepenbeek (Belgium); Havaux, Michel [Commissariat a l' Energie Atomique (CEA)/Cadarache, Direction des Sciences du Vivant, Departement d' Ecophysiologie Vegetale et de Microbiologie, Laboratoire d' Ecophysiologie de la Photosynthese, 13108 Saint-Paul-lez-Durance (France); Wannijn, Jean; Van Hees, May [Belgian Nuclear Research Center (SCK-CEN), Biosphere Impact Studies, Boeretang 200, 2400 Mol (Belgium); Vangronsveld, Jaco [Hasselt University, Environmental Biology, Centre for Environmental Sciences, Agoralaan Building D, 3590 Diepenbeek (Belgium); Vandenhove, Hildegarde [Belgian Nuclear Research Center (SCK-CEN), Biosphere Impact Studies, Boeretang 200, 2400 Mol (Belgium)

2011-06-15

The cellular redox balance seems an important modulator under heavy metal stress. While for other heavy metals these processes are well studied, oxidative stress related responses are also known to be triggered under uranium stress but information remains limited. This study aimed to further unravel the mechanisms by which plants respond to uranium stress. Seventeen-day-old Arabidopsis thaliana seedlings, grown on a modified Hoagland solution under controlled conditions, were exposed to 0, 0.1, 1, 10 and 100 {mu}M uranium for 1, 3 and 7 days. While in Part I of this study oxidative stress related responses in the roots were discussed, this second Part II discusses oxidative stress related responses in the leaves and general conclusions drawn from the results of the roots and the leaves will be presented. As several responses were already visible following 1 day exposure, when uranium concentrations in the leaves were negligible, a root-to-shoot signaling system was suggested in which plastids could be important sensing sites. While lipid peroxidation, based on the amount of thiobarbituric acid reactive compounds, was observed after exposure to 100 {mu}M uranium, affecting membrane structure and function, a transient concentration dependent response pattern was visible for lipoxygenase initiated lipid peroxidation. This transient character of uranium stress responses in leaves was emphasized by results of lipoxygenase (LOX2) and antioxidative enzyme transcript levels, enzyme capacities and glutathione concentrations both in time as with concentration. The ascorbate redox balance seemed an important modulator of uranium stress responses in the leaves as in addition to the previous transient responses, the total ascorbate concentration and ascorbate/dehydroascorbate redox balance increased in a concentration and time dependent manner. This could represent either a slow transient response or a stable increase with regard to plant acclimation to uranium stress

Abscisic acid biosynthesis in water-stressed leaves

International Nuclear Information System (INIS)

Li, Yi.

1989-01-01

Although abscisic acid (ABA) was discovered 30 years ago, very little is known about its biosynthetic pathway in higher plants. Two hypotheses have been proposed: (i) a direct pathway involving only C-15 intermediates like farnesyl pyrophosphate, (ii) an indirect pathway involving C-40 intermediates like the xanthophylls. When 14 CO 2 was fed into greened bean plants, the 14 C specific activity of ABA was always lower than those in xanthophylls, such as violaxanthin and lutein, regardless of 12 CO 2 chase periods. The ABA accumulation in green leaves was not affected by fluridone when plants were stressed once, but the 14 C incorporation into ABA was inhibited to the same extent as those of xanthophylls. The incorporation of 18 O into the ABA ring when violaxanthin was labeled by 18 O in vivo via the violaxanthin cycle indicates that at least a portion of ABA was derived from 18 O-labeled violaxanthin during water stress

Abscisic acid biosynthesis in water-stressed leaves

Energy Technology Data Exchange (ETDEWEB)

Li, Yi.

1989-01-01

Although abscisic acid (ABA) was discovered 30 years ago, very little is known about its biosynthetic pathway in higher plants. Two hypotheses have been proposed: (i) a direct pathway involving only C-15 intermediates like farnesyl pyrophosphate, (ii) an indirect pathway involving C-40 intermediates like the xanthophylls. When {sup 14}CO{sub 2} was fed into greened bean plants, the {sup 14}C specific activity of ABA was always lower than those in xanthophylls, such as violaxanthin and lutein, regardless of {sup 12}CO{sub 2} chase periods. The ABA accumulation in green leaves was not affected by fluridone when plants were stressed once, but the {sup 14}C incorporation into ABA was inhibited to the same extent as those of xanthophylls. The incorporation of {sup 18}O into the ABA ring when violaxanthin was labeled by {sup 18}O in vivo via the violaxanthin cycle indicates that at least a portion of ABA was derived from {sup 18}O-labeled violaxanthin during water stress.

Betacyanin accumulation and guaiacol peroxidase activity in Beta vulgaris L. leaves following copper stress

Directory of Open Access Journals (Sweden)

Janet M. León Morales

2012-07-01

Full Text Available The effect of copper stress on betacyanin accumulation and guaiacol peroxidase (GPOD activity in leaves of different age was evaluated in red beet (Beta vulgaris L. var. Crosby Egyptian plants. In hydroponic culture, plants were treated with 0.3 μM (control, 50 μM, 100 μM, and 250 μM of CuSO4 for 6 days. Copper was taken up and accumulated in old roots but was not translocated to leaves. However in young leaves, the increase of lipid peroxidation and reduction of growth were evident from day 3 of copper exposure; whereas in old leaves, the lipid peroxidation and growth were the same from either copper-treated or control plants. In response to copper exposure, the betacyanin accumulation was evident in young leaves by day 3, and continued to increase until day 6. Betacyanin only were accumulated in old leaves until day 6, but the contents were from 4 to 5 times lower than those observed in young leaves at the same copper concentrations. GPOD activity increased 3.3- and 1.4-fold in young and old leaves from day 3 of copper treatment respectively, but only in the young leaves was sustained at the same level until day 6. Old roots shown betacyanin in the control plants, but the betacyanin level and growth were reduced with the copper exposure. In contrast, young roots emerged by copper effect also accumulated copper and showed the highest betacyanin content of all plant parts assayed. These results indicate that betacyanin accumulation and GPOD activity are defense responses to copper stress in actively growing organs.

Effects of moderate and high rates of biochar and compost on grapevine growth in a greenhouse experiment

Directory of Open Access Journals (Sweden)

Arianna Bozzolo

2017-03-01

Full Text Available Biochar is used as soil amendment and enhancer of plant growth, but the mechanisms involved in grapevine are not understood. In this study, the short-term effects of amendments were evaluated in a trial combining three substrates (biochar, compost, peat-based media with three doses (30, 70, 100% along a time sequence on 1-year-old bare root cuttings of grapevine. Amendments were analyzed for elemental composition. Soil pH, electrical conductivity (EC, chlorophyll (CHL, flavonoids (FL, anthocyans (ANT and nitrogen balance index (NBI were measured.Biochar differed from other amendments for stable C structures, where nutrients and lignin residues were high in compost. Biochar increased soil pH, whereas biochar plus compost mixture augmented EC. The amended plants had detrimental effects on root, true and lateral leaves. Nevertheless, at the lowest rate biochar increased the primary shoot and total scion to root biomass ratio. Among biochemicals, ANT and NBI were mostly affected by biochar, while compost gave only slight increments. Thus, although biochar rate was not adequate for the shedding in open field our results suggest that biochar might be useful in nursery when used at low dosages.

Reinforcement of the radiative and thermic stresses of the grapevine. Repercussions on yeast surface microflora

International Nuclear Information System (INIS)

Salmon, J.M.; Mailhac, N.; Sauvage, F.X.; Biron, M.J.; Robin, J.P.

1997-01-01

All along the ripening period, the radiative and thermic stresses of the grapevine may be reinforced by the use of a reflective soil cover (aluminized film). Such a treatment leads to repercussions on the berries, on the must composition and finally on the wine quality. During such a preliminary experiment, we demonstrated that the temperature increase and/or the reinforcement of the reflected ultraviolet radiations (measured at 254 nm) at the level of grape berries severely impaired the development of yeast cells at their surfaces. By means of an artificial inoculation of grapes at the beginning of the ripening period with a mixture of four different yeast genera (Saccharomyces cerevisiae, Hanseniaspora uvarum, Pichia fermentans and Schizosaccharomyces pombe), we demonstrated that the repartition of yeast genera amongst this population was affected by the treatment of stocks with the aluminized film: during the experiment presented in this paper, the Saccharomyces genus was favoured. One may consider by extension similar effects resulting from the reflective properties of some natural soils. Such effects may considerably influence the distribution of wild yeast flora during the spontaneous fermentation of musts. If such an hypothesis is confirmed at a local or regional level, it will represent a first significant piece of the definition of one of the aspects of the ''terroir'' effect on the characteristics of wines [fr

Genome-wide analysis of the expansin gene superfamily reveals grapevine-specific structural and functional characteristics.

Directory of Open Access Journals (Sweden)

Silvia Dal Santo

Full Text Available BACKGROUND: Expansins are proteins that loosen plant cell walls in a pH-dependent manner, probably by increasing the relative movement among polymers thus causing irreversible expansion. The expansin superfamily (EXP comprises four distinct families: expansin A (EXPA, expansin B (EXPB, expansin-like A (EXLA and expansin-like B (EXLB. There is experimental evidence that EXPA and EXPB proteins are required for cell expansion and developmental processes involving cell wall modification, whereas the exact functions of EXLA and EXLB remain unclear. The complete grapevine (Vitis vinifera genome sequence has allowed the characterization of many gene families, but an exhaustive genome-wide analysis of expansin gene expression has not been attempted thus far. METHODOLOGY/PRINCIPAL FINDINGS: We identified 29 EXP superfamily genes in the grapevine genome, representing all four EXP families. Members of the same EXP family shared the same exon-intron structure, and phylogenetic analysis confirmed a closer relationship between EXP genes from woody species, i.e. grapevine and poplar (Populus trichocarpa, compared to those from Arabidopsis thaliana and rice (Oryza sativa. We also identified grapevine-specific duplication events involving the EXLB family. Global gene expression analysis confirmed a strong correlation among EXP genes expressed in mature and green/vegetative samples, respectively, as reported for other gene families in the recently-published grapevine gene expression atlas. We also observed the specific co-expression of EXLB genes in woody organs, and the involvement of certain grapevine EXP genes in berry development and post-harvest withering. CONCLUSION: Our comprehensive analysis of the grapevine EXP superfamily confirmed and extended current knowledge about the structural and functional characteristics of this gene family, and also identified properties that are currently unique to grapevine expansin genes. Our data provide a model for the

Xylella fastidiosa requires polygalacturonase for colonization and pathogenicity in Vitis vinifera grapevines.

Science.gov (United States)

Roper, M Caroline; Greve, L Carl; Warren, Jeremy G; Labavitch, John M; Kirkpatrick, Bruce C

2007-04-01

Xylella fastidiosa is the causal agent of Pierce's disease of grape, an economically significant disease for the grape industry. X. fastidiosa systemically colonizes the xylem elements of grapevines and is able to breach the pit pore membranes separating xylem vessels by unknown mechanisms. We hypothesized that X. fastidiosa utilizes cell wall degrading enzymes to break down pit membranes, based on the presence of genes involved in plant cell wall degradation in the X. fastidiosa genome. These genes include several beta-1,4 endoglucanases, several xylanases, several xylosidases, and one polygalacturonase (PG). In this study, we demonstrated that the pglA gene encodes a functional PG. A mutant in pglA lost pathogenicity and was compromised in its ability to systemically colonize Vitis vinifera grapevines. The results indicate that PG is required for X. fastidiosa to successfully infect grapevines and is a critical virulence factor for X. fastidiosa pathogenesis in grapevine.

Species of Diatrypaceae associated with grapevine trunk diseases in Eastern Spain

Directory of Open Access Journals (Sweden)

Jordi LUQUE

2013-01-01

Full Text Available The presence and diversity of Diatrypaceae species occurring on grapevines in Eastern Spain were investigated. Several species were identified on the basis of morphological characters and phylogenetic analyses of the complete sequence of the internal transcribed spacers of the ribosomal DNA and part of the β-tubulin gene. Five species of Diatrypaceae isolated from the wood of diseased grapevines, pruning debris and/or perithecia were identified, including Anthostoma decipiens, Cryptovalsa ampelina, Eutypa lata, Eutypella citricola and Eutypella microtheca. Additionally, four taxa could not be identified to the species level but were closely related to Eutypa tetragona based on phylogenetic analyses. Eutypa lata was the most prevalent species and showed the greatest degree of genetic diversity. Cryptovalsa ampelina and E. microtheca ranked second in the frequency of isolations, while all the remaining species were less frequently isolated. Eutypella citricola and E. microtheca are reported for the first time as occurring on grapevine in Spain and this is the first report of A. decipiens occurring on grapevine.

A transient expression assay for the in planta efficacy screening of an antimicrobial peptide against grapevine bacterial pathogens.

Science.gov (United States)

Visser, M; Stephan, D; Jaynes, J M; Burger, J T

2012-06-01

Natural and synthetic antimicrobial peptides (AMPs) are of increasing interest as potential resistance conferring elements in plants against pathogen infection. The efficacy of AMPs against pathogens is prescreened by in vitro assays, and promising AMP candidates are introduced as transgenes into plants. As in vitro and in planta environments differ, a prescreening procedure of the AMP efficacy in the plant environment is desired. Here, we report the efficacy of the purified synthetic peptide D4E1 against the grapevine-infecting bacterial pathogens Agrobacterium vitis and Xylophilus ampelinus in vitro and describe for the first time an in planta prescreening procedure based on transiently expressed D4E1. The antimicrobial effect of D4E1 against Ag. vitis and X. ampelinus was shown by a reduction in colony-forming units in vitro in a traditional plate-based assay and by a reduction in bacterial titres in planta as measured by quantitative real-time PCR (qPCR) in grapevine leaves transiently expressing D4E1. A statistically significant reduction in titre was shown for X. ampelinus, but for Ag. vitis, a significant reduction in titre was only observed in a subset of plants. The titres of both grapevine-infecting bacterial pathogens were reduced in an in vitro assay and for X. ampelinus in an in planta assay by D4E1 application. This widens the applicability of D4E1 as a potential resistance-enhancing element to additional pathogens and in a novel plant species. D4E1 is a promising candidate to confer enhanced resistance against the two tested grapevine bacterial pathogens, and the applied transient expression system proved to be a valuable tool for prescreening of D4E1 efficacy in an in planta environment. The described prescreening procedure can be used for other AMPs and might be adapted to other plant species and pathogens before the expensive and tedious development of stably transgenic lines is started. © 2012 The Authors. Letters in Applied Microbiology © 2012

Effect of heavy metal stress on the catalase activity and expression of isozymes in the leaves of rice seedling

International Nuclear Information System (INIS)

Ge Cailin; Yang Xiaoyong; Zhu Hongxia; Wang Zegang; Luo Shishi; Ma Fei; Sun Jinhe

2002-01-01

The effect of heavy metal stress on the catalase (CAT) activity and expression of isozymes in the leaves of rice (Wuyujing, Yangdao 6, Shanyou 818) seedling was measured and analyzed. The results showed as follows. (1) When the concentration of Cu, Cd and Hg was in the range of 0.05-2.0 mM, the CAT activity decreased continuously with the concentration of Cu and Cd increasing. However, with the concentration of Hg increasing the CAT activity rapidly decreased first, and then increased slightly, and again decreased obviously, indicating that the Cu, Cd and Hg of 0.05-2.0 mM inhibited the CAT activity in the leaves of rice seedling. (2) The results by using polyacrylamide concentration gradient gel electrophoresis technique to analyze the CAT isozymes indicated that, on the normal condition, there were 1 to 2 CAT isozymes being expressed in the rice leaves (2 CAT isozymes being expressed in Wuyujing leaves, 1 CAT isozymes in Yangdao 6 and Shanyou 818 leaves). 0.1 mM Cd stress induced Wuyujing leaves to express 1 new CAT isozymes, 0.1 mM Cd and Hg stress also induced Yangdao 6 leaves to express 1 new CAT isozymes, but the expression of CAT isozymes, which were expressed in normal condition, were inhibited by Cu, Cd and Hg stress

SOYBEAN AND CASEIN HYDROLYSATES INDUCE GRAPEVINE IMMUNE RESPONSES AND RESISTANCE AGAINST PLASMOPARA VITICOLA

Directory of Open Access Journals (Sweden)

Nihed eLachhab

2014-12-01

Full Text Available Plasmopara viticola, the causal agent of grapevine downy mildew, is one of the most devastating grape pathogen in Europe and North America. Although phytochemicals are used to control pathogen infections, the appearance of resistant strains and the concern for possible adverse effects on environment and human health are increasing the search for alternative strategies. In the present investigation, we successfully tested two protein hydrolysates from soybean (soy and casein (cas to trigger grapevine resistance against P. viticola. On Vitis vinifera cv. Marselan plants, the application of soy and cas reduced the infected leaf surface by 76 and 63%, as compared to the control, respectively. Since both hydrolysates might trigger the plant immunity, we investigated their ability to elicit grapevine defence responses. On grapevine cell suspensions, a different free cytosolic calcium signature was recorded for each hydrolysate, whereas a similar transient phosphorylation of two MAP kinases of 45 and 49 kDa was observed. These signalling events were followed by transcriptome reprogramming, including the up-regulation of defence genes encoding pathogenesis-related (PR proteins and the stilbene synthase enzyme responsible for the biosynthesis of resveratrol, the main grapevine phytoalexin. Liquid chromatography analyses confirmed the production of resveratrol and its dimer metabolites, δ- and ε-viniferins. Overall, soy effects were more pronounced as compared to the cas one. Both hydrolysates proved to act as elicitors to enhance grapevine immunity against pathogen attack.

Effectiveness of some microorganisms in the limitation of grapevine cuttings infection by Phomopsis viticola Sacc.

Directory of Open Access Journals (Sweden)

Ewa Król

2013-12-01

Full Text Available The possibilities of using antagonistic fungi and bacteria in the limitation of grapevine stems infection by Phomopsis viticola Sacc. were studied. Trichodema koningii Oud., T.viride Persoon ex S.F.,T.harzianum Rifai, Gliocladium catenulatum Gilman and Abbott, G.fimbriatum Gilman and Abbott, Bacillus sp., Pseudomonas fluorescens and five unidentified isolates of bacteria i.e.: 22a, 35, 40, 45, 66 were estimated. It was appeared what Trichoderma spp. were the most effective in protection of grapevine stems against the infection by P.viticola. After these antagonistic fungi were used on protected grapevine canes not numerous necrosis were observed and few cultures of pathogen were reisolated from them. Moreover, Trichoderma spp. survived on the grapevine stems during the period of experiment. The abilities of other microorganisms tested to protect grapevine cuttings against P.viticola infection and to exist on the stems were less than Trichoderma spp.

The role of stress in absenteeism: cortisol responsiveness among patients on long-term sick leave.

Directory of Open Access Journals (Sweden)

Henrik B Jacobsen

Full Text Available OBJECTIVE: This study aimed to (1 See whether increased or decreased variation relate to subjective reports of common somatic and psychological symptoms for a population on long-term sick leave; and (2 See if this pattern in variation is correlated with autonomic activation and psychological appraisal. METHODS: Our participants (n = 87 were referred to a 3.5-week return-to-work rehabilitation program, and had been on paid sick leave >8 weeks due to musculoskeletal pain, fatigue and/or common mental disorders. An extensive survey was completed, addressing socio-demographics, somatic and psychological complaints. In addition, a physician and a psychologist examined the participants, determining baseline heart rate, medication use and SCID-I diagnoses. During the 3.5-week program, the participants completed the Trier Social Stress Test for Groups. Participants wore heart rate monitors and filled out Visual Analogue Scales during the TSST-G. RESULTS: Our participants presented a low cortisol variation, with mixed model analyses showing a maximal increase in free saliva cortisol of 26% (95% CI, 0.21-0.32. Simultaneously, the increase in heart rate and Visual Analogue Scales was substantial, indicating autonomic and psychological activation consistent with intense stress from the Trier Social Stress Test for Groups. CONCLUSIONS: The current findings are the first description of a blunted cortisol response in a heterogeneous group of patients on long-term sick leave. The results suggest lack of cortisol reactivity as a possible biological link involved in the pathway between stress, sustained activation and long-term sick leave.

Cuticle ultrastructure, cuticular lipid composition, and gene expression in hypoxia-stressed Arabidopsis stems and leaves.

Science.gov (United States)

Kim, Hyojin; Choi, Dongsu; Suh, Mi Chung

2017-06-01

An increased permeability of the cuticle is closely associated with downregulation of genes involved in cuticular lipid synthesis in hypoxia-stressed Arabidopsis and may allow plants to cope with oxygen deficiency. The hydrophobic cuticle layer consisting of cutin polyester and cuticular wax is the first barrier to protect the aerial parts of land plants from environmental stresses. In the present study, we investigated the role of cuticle membrane in Arabidopsis responses to oxygen deficiency. TEM analysis showed that the epidermal cells of hypoxia-treated Arabidopsis stems and leaves possessed a thinner electron-translucent cuticle proper and a more electron-dense cuticular layer. A reduction in epicuticular wax crystal deposition was observed in SEM images of hypoxia-treated Arabidopsis stem compared with normoxic control. Cuticular transpiration was more rapid in hypoxia-stressed leaves than in normoxic control. Total wax and cutin loads decreased by approximately 6-12 and 12-22%, respectively, and the levels of C29 alkanes, secondary alcohols, and ketones, C16:0 ω-hydroxy fatty acids, and C18:2 dicarboxylic acids were also prominently reduced in hypoxia-stressed Arabidopsis leaves and/or stems relative to normoxic control. Genome-wide transcriptome and quantitative RT-PCR analyses revealed that the expression of several genes involved in the biosynthesis and transport of cuticular waxes and cutin monomers were downregulated more than fourfold, but no significant alterations were detected in the transcript levels of fatty acid biosynthetic genes, BCCP2, PDH-E1α, and ENR1 in hypoxia-treated Arabidopsis stems and leaves compared with normoxic control. Taken together, an increased permeability of the cuticle is closely associated with downregulation of genes involved in cuticular lipid synthesis in hypoxia-stressed Arabidopsis. The present study elucidates one of the cuticle-related adaptive responses that may allow plants to cope with low oxygen levels.

Comparing Kaolin and Pinolene to Improve Sustainable Grapevine Production during Drought.

Science.gov (United States)

Brillante, Luca; Belfiore, Nicola; Gaiotti, Federica; Lovat, Lorenzo; Sansone, Luigi; Poni, Stefano; Tomasi, Diego

2016-01-01

Viticulture is widely practiced in dry regions, where the grapevine is greatly exposed to water stress. Optimizing plant water use efficiency (WUE) without affecting crop yield, grape and wine quality is crucial to limiting use of water for irrigation and to significantly improving viticulture sustainability. This study examines the use in vineyards of particle film technology (engineered kaolin) and compares it to a film-forming antitranspirant (pinolene), traditionally used to limit leaf water loss, and to an untreated control. The trial was carried out under field conditions over three growing seasons, during which moderate to very severe plant water stress (down to -1.9 MPa) was measured through stem water potential. Leaf stomatal conductance (gs) and photosynthesis rate (An) were measured during the seasons and used to compute intrinsic WUE (WUEi, defined as An/gs ratio). Leaf temperature was also recorded and compared between treatments. Bunch quantity, bunch and berry weight, sugar accumulation, anthocyanin and flavonoid contents were measured. Finally, microvinifications were performed and resultant wines subjected to sensory evaluation.Results showed that the use of kaolin increased grapevine intrinsic WUE (+18% on average as compared to unsprayed vines) without affecting berry and bunch weight and quantity, or sugar level. Anthocyanin content increased (+35%) in kaolin treatment, and the wine was judged more attractive (p-value wine was the least appreciated. This study demonstrates that particle film technology can improve vine WUEi and wine quality at the same time, while traditional antitranspirants were not as effective for these purposes. This positive effect can be used in interaction with other already-demonstrated uses of particle film technology, such as pest control and sunburn reduction, in order to achieve more sustainable vineyard management.

Differential expression of genes of Xylella fastidiosa in xylem fluid of citrus and grapevine.

Science.gov (United States)

Shi, Xiangyang; Bi, Jianlong; Morse, Joseph G; Toscano, Nick C; Cooksey, Donald A

2010-03-01

Xylella fastidiosa causes a serious Pierce's disease (PD) in grapevine. Xylella fastidiosa cells from a PD strain were grown in a pure xylem fluid of a susceptible grapevine cultivar vs. xylem fluid from citrus, which is not a host for this strain of X. fastidiosa. When grown in grapevine xylem fluid, cells of the PD strain formed clumps and biofilm formed to a greater extent than in citrus xylem fluid, although the PD strain did grow in xylem fluid of three citrus varieties. The differential expression of selected genes of a PD X. fastidiosa strain cultured in the two xylem fluids was analyzed using a DNA macroarray. Compared with citrus xylem fluid, grapevine xylem fluid stimulated the expression of X. fastidiosa genes involved in virulence regulation, such as gacA, algU, xrvA, and hsq, and also genes involved in the biogenesis of pili and twitching motility, such as fimT, pilI, pilU, and pilY1. Increased gene expression likely contributes to PD expression in grapevine, whereas citrus xylem fluid did not support or possibly suppressed the expression of these virulence genes.

Plant Growth Promotion Potential Is Equally Represented in Diverse Grapevine Root-Associated Bacterial Communities from Different Biopedoclimatic Environments

Directory of Open Access Journals (Sweden)

Ramona Marasco

2013-01-01

Full Text Available Plant-associated bacteria provide important services to host plants. Environmental factors such as cultivar type and pedoclimatic conditions contribute to shape their diversity. However, whether these environmental factors may influence the plant growth promoting (PGP potential of the root-associated bacteria is not widely understood. To address this issue, the diversity and PGP potential of the bacterial assemblage associated with the grapevine root system of different cultivars in three Mediterranean environments along a macrotransect identifying an aridity gradient were assessed by culture-dependent and independent approaches. According to 16S rRNA gene PCR-DGGE, the structure of endosphere and rhizosphere bacterial communities was highly diverse (P=0.03 and was associated with a cultivar/latitudinal/climatic effect. Despite being diverse, the bacterial communities associated with Egyptian grapevines shared a higher similarity with the Tunisian grapevines than those cultivated in North Italy. A similar distribution, according to the cultivar/latitude/aridity gradients, was observed for the cultivable bacteria. Many isolates (23% presented in vitro multiple stress resistance capabilities and PGP activities, the most frequent being auxin synthesis (82%, insoluble phosphate solubilisation (61%, and ammonia production (70%. The comparable numbers and types of potential PGP traits among the three different environmental settings indicate a strong functional homeostasis of beneficial bacteria associated with grape root.

Unraveling uranium induced oxidative stress related responses in Arabidopsis thaliana seedlings. Part II: responses in the leaves and general conclusions.

Science.gov (United States)

Vanhoudt, Nathalie; Cuypers, Ann; Horemans, Nele; Remans, Tony; Opdenakker, Kelly; Smeets, Karen; Bello, Daniel Martinez; Havaux, Michel; Wannijn, Jean; Van Hees, May; Vangronsveld, Jaco; Vandenhove, Hildegarde

2011-06-01

The cellular redox balance seems an important modulator under heavy metal stress. While for other heavy metals these processes are well studied, oxidative stress related responses are also known to be triggered under uranium stress but information remains limited. This study aimed to further unravel the mechanisms by which plants respond to uranium stress. Seventeen-day-old Arabidopsis thaliana seedlings, grown on a modified Hoagland solution under controlled conditions, were exposed to 0, 0.1, 1, 10 and 100 μM uranium for 1, 3 and 7 days. While in Part I of this study oxidative stress related responses in the roots were discussed, this second Part II discusses oxidative stress related responses in the leaves and general conclusions drawn from the results of the roots and the leaves will be presented. As several responses were already visible following 1 day exposure, when uranium concentrations in the leaves were negligible, a root-to-shoot signaling system was suggested in which plastids could be important sensing sites. While lipid peroxidation, based on the amount of thiobarbituric acid reactive compounds, was observed after exposure to 100 μM uranium, affecting membrane structure and function, a transient concentration dependent response pattern was visible for lipoxygenase initiated lipid peroxidation. This transient character of uranium stress responses in leaves was emphasized by results of lipoxygenase (LOX2) and antioxidative enzyme transcript levels, enzyme capacities and glutathione concentrations both in time as with concentration. The ascorbate redox balance seemed an important modulator of uranium stress responses in the leaves as in addition to the previous transient responses, the total ascorbate concentration and ascorbate/dehydroascorbate redox balance increased in a concentration and time dependent manner. This could represent either a slow transient response or a stable increase with regard to plant acclimation to uranium stress. Copyright �

The study of antioxidants in grapevine seeds

Directory of Open Access Journals (Sweden)

Lenka Tomášková

2017-01-01

Full Text Available Grapevine seeds contain a large amount of antioxidant components, and are therefore recommended in the prevention and treatment of many diseases. For this research, we studied the antioxidant properties of grapevine seeds from the Marlen variety, as evidence suggests that these types have higher resistance against fungal diseases. Through high-performance liquid chromatography with UV/VIS detection, a total of 10 antioxidant components were selected for further investigation, specifically: catechin, epicatechin, rutin, quercitrin, quercetin, caftaric acid, caffeic acid, p-coumaric acid, ferulic acid, and gallic acid. The antioxidant activity was determinated spectrophotometrically through the adoption of three fundamentally different methods (the DPPH assay, the ABTS method, and the FRAP method. Using the Folin-Ciocalteu method, it was possible to determine the content of all the polyphenolic compounds. The results of the assessment antioxidant activity and the content of polyphenolic compounds were recalculated to gallic acid equivalents (GAE. The values of the antioxidant activity as determinated by the DPPH test were 6643 (±154 mg of GAE; 1984 (±88 mg of GAE when using the FRAP method; and 812 (±31 mg of GAE when the ABTS method was utilised. The content of the total polyphenolic compounds came to 6982 (±221 mg of GAE. The most abundant antioxidant was catechin, with a content of 115 mg.L-1, whilst the least represented compound was ferulic acid (0.139 mg.L-1. Overall, this study showed a high antioxidant potential of grapevine seeds. 

Combination of RGB and multispectral imagery for discrimination of cabernet sauvignon grapevine elements.

Science.gov (United States)

Fernández, Roemi; Montes, Héctor; Salinas, Carlota; Sarria, Javier; Armada, Manuel

2013-06-19

This paper proposes a sequential masking algorithm based on the K-means method that combines RGB and multispectral imagery for discrimination of Cabernet Sauvignon grapevine elements in unstructured natural environments, without placing any screen behind the canopy and without any previous preparation of the vineyard. In this way, image pixels are classified into five clusters corresponding to leaves, stems, branches, fruit and background. A custom-made sensory rig that integrates a CCD camera and a servo-controlled filter wheel has been specially designed and manufactured for the acquisition of images during the experimental stage. The proposed algorithm is extremely simple, efficient, and provides a satisfactory rate of classification success. All these features turn out the proposed algorithm into an appropriate candidate to be employed in numerous tasks of the precision viticulture, such as yield estimation, water and nutrients needs estimation, spraying and harvesting.

Use of Endophytic and Rhizosphere Actinobacteria from Grapevine Plants To Reduce Nursery Fungal Graft Infections That Lead to Young Grapevine Decline.

Science.gov (United States)

Álvarez-Pérez, José Manuel; González-García, Sandra; Cobos, Rebeca; Olego, Miguel Ángel; Ibañez, Ana; Díez-Galán, Alba; Garzón-Jimeno, Enrique; Coque, Juan José R

2017-12-15

Endophytic and rhizosphere actinobacteria isolated from the root system of 1-year-old grafted Vitis vinifera plants were evaluated for their activities against fungi that cause grapevine trunk diseases. A total of 58 endophytic and 94 rhizosphere isolates were tested. Based on an in vitro bioassay, 15.5% of the endophytic isolates and 30.8% of the rhizosphere isolates exhibited antifungal activity against the fungal pathogen Diplodia seriata , whereas 13.8% of the endophytic isolates and 16.0% of the rhizosphere isolates showed antifungal activity against Dactylonectria macrodidyma (formerly Ilyonectria macrodidyma ). The strains which showed the greatest in vitro efficacy against both pathogens were further analyzed for their ability to inhibit the growth of Phaeomoniella chlamydospora and Phaeoacremonium minimum (formerly Phaeoacremonium aleophilum ). Based on their antifungal activity, three rhizosphere isolates and three endophytic isolates were applied on grafts in an open-root field nursery in a 3-year trial. The field trial led to the identification of one endophytic strain, Streptomyces sp. VV/E1, and two rhizosphere isolates, Streptomyces sp. VV/R1 and Streptomyces sp. VV/R4, which significantly reduced the infection rates produced by the fungal pathogens Dactylonectria sp., Ilyonectria sp., P. chlamydospora , and P. minimum , all of which cause young grapevine decline. The VV/R1 and VV/R4 isolates also significantly reduced the mortality level of grafted plants in the nursery. This study shows that certain actinobacteria could represent a promising new tool for controlling fungal trunk pathogens that infect grapevine plants through the root system in nurseries. IMPORTANCE Grapevine trunk diseases are a major threat to the wine and grape industry worldwide. They cause a significant reduction in yields as well as in grape quality, and they can even cause plant death. Trunk diseases are caused by fungal pathogens that enter through pruning wounds and/or the

Grapevine yield components and composition of Isabel grape produced according to the organic and conventional systems

Directory of Open Access Journals (Sweden)

Miele Alberto

2016-01-01

Full Text Available There is an increasing demand for organic grapes by the juice industry of Serra Gaúcha, Brazil. This region presents a humid and hot summer, ideal climatic conditions for the development of a number of diseases. To control such diseases and problems brought about by other organisms, growers apply pesticides on the grapevines which may leave residues in grapes. However, in general, grapes produced by organic system have lower yield, but there is a lack of research data on this subject. Thus, an experiment was carried out over three years in order to compare the yield components and the physicochemical composition of the must of Isabel grapes conducted in both production systems. When the grapes were ripe, variables related to yield components were evaluated, such as the number of clusters/vine, yield/vine and weight/cluster. Then the grapes were sampled and taken to the laboratory where they were crushed and the musts were centrifuged and analyzed. The 3-year data mean were submitted to correlation analysis and Principal Component Analysis. The results show that conventional grapevines produced 2.18 times more than organic. However, the grapes from the organic system had higher density, Brix, pH, Brix/titratable acidity ratio, P and Mg but lower K, and Ca varied little between both production systems.

Selection and evaluation of phosphate-solubilizing bacteria from grapevine rhizospheres for use as biofertilizers

International Nuclear Information System (INIS)

Liu, M.; Liu, X.; Cheng, B.S.; Ma, X.L.; Lyu, X.; Zhao, X.; Ju, Y.; Min, Z.; Fang, Y.

2016-01-01

Phosphate-solubilizing bacteria (PSB) have the ability to solubilize insoluble phosphorus (P) and release soluble P. Extensive research has been performed with respect to PSB isolation from the rhizospheres of various plants, but little is known about the prevalence of PSB in the grapevine rhizosphere. In this study, we aimed to isolate and identify PSB from the grapevine rhizosphere in five vineyards of Northwest China, to characterize their plant-growth-promoting (PGP) traits, evaluate the effect of stress on their phosphate-solubilizing activity (PSA), and test their ability to stimulate the growth of Vitis vinifera L. cv. Cabernet Sauvignon. From the vineyard soils, 66 PSB isolates were screened, and 10 strains with high PSA were identified by 16S rRNA sequencing. Sequence analysis revealed that these 10 strains belonged to 4 genera and 5 species: Bacillus aryabhattai, B. megaterium, Klebsiella variicola, Stenotrophomonas rhizophila, and Enterobacter aerogenes. The selected PSB strains JY17 (B. aryabhattai) and JY22 (B. aryabhattai) were positive for multiple PGP traits, including nitrogen fixation and production of indole acetic acid (IAA), siderophores, 1-aminocyclopropane-1-carboxylate (ACC) deaminase, chitinase, and protease. JY17 and JY22 showed strong PSA under stress conditions of high pH, high salt, and high temperature. Therefore, these two isolates can be used as biofertilizers in saline-alkaline soils. The inoculation with PSB significantly facilitated the growth of V. vinifera cv. Cabernet Sauvignon under greenhouse conditions. Use of these PSB as biofertilizers will increase the available P content in soils, minimize P-fertilizer application, reduce environmental pollution, and promote sustainable agriculture.

Selection and evaluation of phosphate-solubilizing bacteria from grapevine rhizospheres for use as biofertilizers

Energy Technology Data Exchange (ETDEWEB)

Liu, M.; Liu, X.; Cheng, B.S.; Ma, X.L.; Lyu, X.; Zhao, X.; Ju, Y.; Min, Z.; Fang, Y.

2016-07-01

Phosphate-solubilizing bacteria (PSB) have the ability to solubilize insoluble phosphorus (P) and release soluble P. Extensive research has been performed with respect to PSB isolation from the rhizospheres of various plants, but little is known about the prevalence of PSB in the grapevine rhizosphere. In this study, we aimed to isolate and identify PSB from the grapevine rhizosphere in five vineyards of Northwest China, to characterize their plant-growth-promoting (PGP) traits, evaluate the effect of stress on their phosphate-solubilizing activity (PSA), and test their ability to stimulate the growth of Vitis vinifera L. cv. Cabernet Sauvignon. From the vineyard soils, 66 PSB isolates were screened, and 10 strains with high PSA were identified by 16S rRNA sequencing. Sequence analysis revealed that these 10 strains belonged to 4 genera and 5 species: Bacillus aryabhattai, B. megaterium, Klebsiella variicola, Stenotrophomonas rhizophila, and Enterobacter aerogenes. The selected PSB strains JY17 (B. aryabhattai) and JY22 (B. aryabhattai) were positive for multiple PGP traits, including nitrogen fixation and production of indole acetic acid (IAA), siderophores, 1-aminocyclopropane-1-carboxylate (ACC) deaminase, chitinase, and protease. JY17 and JY22 showed strong PSA under stress conditions of high pH, high salt, and high temperature. Therefore, these two isolates can be used as biofertilizers in saline-alkaline soils. The inoculation with PSB significantly facilitated the growth of V. vinifera cv. Cabernet Sauvignon under greenhouse conditions. Use of these PSB as biofertilizers will increase the available P content in soils, minimize P-fertilizer application, reduce environmental pollution, and promote sustainable agriculture.

[Cross-sectional study on the determinants of work stress for nurses and intention of leaving the profession].

Science.gov (United States)

Romano, Marina; Festini, Filippo; Bronner, Leonardo

2015-01-01

Occupational stress is one of the main causes of sick leaves among healthcare professionals and it determines high costs to health systems. Monitoring occupational related stress can be an important tool for policy makers. The Italian nursing research gave little attention to nurses' occupational stress. The aims of this study is to estimate the prevalence of occupational stress and evaluate risks factors among Italian nurses in order to evaluate health promotion intervention. Cross-sectional study on a convenience sample of nurses from three Italian public hospitals was carried out. The Nursing Stress Scale was administrated together with socio-demographic data information(age, occupational age, family structure etc). The Nursing Stress Scale includes 34 items with a score from 0 to 3. Seven areas of job related stress are investigate in the scale: conflict with physicians, inadequate training, lack of support, conflict with other nurses, workload, uncertainty about treatments, death and suffering. Scores were calculated for each item and for each area. Associations between stress scores and socio-demographic data were analyzed. 231 nurses participated to the study. The two stress areas with the highest scores were "workload" (1.58) and "death and suffering" (1.39). Among the 13 items that exceed the overall mean stress score (i.e. 1.07), five belong to the "workload" area. "Watching a suffering patient" is the single item with the highest mean score. Demographic data associated to higher stress scores are, female gender (p=0.03) and working with night shifts (p=0.02). Intention to leave the nursing profession is associated to higher stress scores (p=0.002). Age, occupational age, time to commute to work, number of children, having disabled relatives at home, were not correlated to higher stress scores. Our study provides data regarding nurses' occupational stress that was not available before. This data may be useful for policy makers to plan preventive

Expression profiling on soybean leaves reveals integration of ER- and osmotic-stress pathways

Directory of Open Access Journals (Sweden)

Dewey Ralph E

2007-11-01

Full Text Available Abstract Background Despite the potential of the endoplasmic reticulum (ER stress response to accommodate adaptive pathways, its integration with other environmental-induced responses is poorly understood in plants. We have previously demonstrated that the ER-stress sensor binding protein (BiP from soybean exhibits an unusual response to drought. The members of the soybean BiP gene family are differentially regulated by osmotic stress and soybean BiP confers tolerance to drought. While these results may reflect crosstalk between the osmotic and ER-stress signaling pathways, the lack of mutants, transcriptional response profiles to stresses and genome sequence information of this relevant crop has limited our attempts to identify integrated networks between osmotic and ER stress-induced adaptive responses. As a fundamental step towards this goal, we performed global expression profiling on soybean leaves exposed to polyethylene glycol treatment (osmotic stress or to ER stress inducers. Results The up-regulated stress-specific changes unmasked the major branches of the ER-stress response, which include enhancing protein folding and degradation in the ER, as well as specific osmotically regulated changes linked to cellular responses induced by dehydration. However, a small proportion (5.5% of total up-regulated genes represented a shared response that seemed to integrate the two signaling pathways. These co-regulated genes were considered downstream targets based on similar induction kinetics and a synergistic response to the combination of osmotic- and ER-stress-inducing treatments. Genes in this integrated pathway with the strongest synergistic induction encoded proteins with diverse roles, such as plant-specific development and cell death (DCD domain-containing proteins, an ubiquitin-associated (UBA protein homolog and NAC domain-containing proteins. This integrated pathway diverged further from characterized specific branches of ER-stress as

ADVANCES IN PROPAGATION OF GRAPEVINE IN THE WORLD

Directory of Open Access Journals (Sweden)

DANIEL SANTOS GROHS

2017-12-01

Full Text Available ABSTRACT Grapevine production by classical grafting methods and in commercial scale emerged over 130 years. This system remained handmade until the mid-1950s, when the first international certification programs aimed at obtaining mother plants with high viral sanity emerged. The necessity to increase the scale of production on industrial model and plant material production based on minimum morphological standards appeared at the end of the 1960s. Along the 1970s, research unlocked knowledge on semi-automated grafting, process hygiene, use of plant growth regulators and understanding of physiological events of rootstock-scion compatibility, callus formation and rooting. So, until the mid-2000s, certification schemes and propagation processes advanced little in technical standard. However, grapevine growing areas were expanded and demands for plant material increased, and new diseases emerged from contaminated nurseries. These new diseases (new viral complexes, phytoplasmas, bacteria and grapevine trunk diseases were discovered by high-sensitivity diagnostic methods. Today, there is a new discussion on the nursery segment worldwide. The propagation techniques have been reviewed from the perspective of reducing the incidence of new diseases and minimum physiological damage of nursery plants during the production stages. Therefore, technological innovations regarding equipment, practices and production inputs have been incorporated in new certification schemes. However, despite these advantages, these schemes have become more complex and multidisciplinary than previous ones, bringing difficulties in adaptation of nurserymen.

Pollination: a key event controlling the expression of genes related to phytohormone biosynthesis during grapevine berry formation.

Science.gov (United States)

Kühn, Nathalie; Arce-Johnson, Patricio

2012-01-01

Berry formation is the process of ovary conversion into a functional fruit, and is characterized by abrupt changes in the content of several phytohormones, associated with pollination and fertilization. Much effort has been made in order to improve our understanding of berry development, particularly from veraison to post-harvest time. However, the period of berry formation has been poorly investigated, despite its importance. Phytohormones are involved in the control of fruit formation; hence it is important to understand the regulation of their content at this stage. Grapevine is an excellent fleshy-fruit plant model since its fruits have particularities that differentiate them from those of commonly studied organisms. For instance, berries are prepared to cope with stress by producing several antioxidants and they are non-climacteric fruits. Also its genome is fully sequenced, which allows to identify genes involved in developmental processes. In grapevine, no link has been established between pollination and phytohormone biosynthesis, until recently. Here we highlight relevant findings regarding pollination effect on gene expression related to phytohormone biosynthesis, and present unpublished results showing how quickly this effect is achieved.

Uptake and transport of radioactive cesium and strontium into grapevines after leaf contamination

Science.gov (United States)

Zehnder, H. J.; Kopp, P.; Eikenberg, J.; Feller, U.; Oertli, J. J.

1995-07-01

From 1989 to 1993 the foliar uptake of radioactive strontium (Sr-85) and cesium (Cs-134) by selected leaves of grapevine plants and the subsequent redistribution within the plants was examined under controlled conditions in a greenhouse. The radionuclides were applied as chlorides. These plants were grown in large pots containing a mixture of local soil and peat. Plant and soil samples were analyzed throughout the growing season and also during the following vegetation period. Only traces of the applied radiostrontium were taken up by the leaves. This element was essentially not redistributed within the plants. In contrast, radiocesium was easily taken up through the leaf surface, transported to other plant parts and to some extent released from the roots into the soil. Cesium reaching the soil may interact with clay particles causing a very reduced availability for plants. Therefore the soil may act as a long-term sink for radiocesium. On the other hand, grape berries represent transient sinks. The cesium levels in the berries decreased again in a late phase of maturation, but the mechanisms causing this loss are not yet identified. During the second vegetation period, only a very minor proportion of the radiocesium taken up previously by the plants was present in the above ground parts.

Combination of RGB and Multispectral Imagery for Discrimination of Cabernet Sauvignon Grapevine Elements

Directory of Open Access Journals (Sweden)

Carlota Salinas

2013-06-01

Full Text Available This paper proposes a sequential masking algorithm based on the K-means method that combines RGB and multispectral imagery for discrimination of Cabernet Sauvignon grapevine elements in unstructured natural environments, without placing any screen behind the canopy and without any previous preparation of the vineyard. In this way, image pixels are classified into five clusters corresponding to leaves, stems, branches, fruit and background. A custom-made sensory rig that integrates a CCD camera and a servo-controlled filter wheel has been specially designed and manufactured for the acquisition of images during the experimental stage. The proposed algorithm is extremely simple, efficient, and provides a satisfactory rate of classification success. All these features turn out the proposed algorithm into an appropriate candidate to be employed in numerous tasks of the precision viticulture, such as yield estimation, water and nutrients needs estimation, spraying and harvesting.

Production of polyclonal antisera using recombinant coat proteins of Grapevine leafroll-associated virus 2 and Grapevine virus B Produção de anti-soros policlonais a partir de proteínas capsidiais recombinantes de Grapevine leafroll-associated virus 2 e Grapevine virus B

Directory of Open Access Journals (Sweden)

Paula Radaelli

2008-10-01

Full Text Available The objective of this work was to produce and characterize specific antisera against Brazilian isolates of Grapevine leafroll-associated virus 2 (GLRaV-2 and Grapevine virus B (GVB, developed from expressed coat proteins (CPs in Escherichia coli, and to test their possible use for the detection of these two viruses in diseased grapevines. The coat protein (CP genes were RT-PCR-amplified, cloned and sequenced. The CP genes were subsequently subcloned, and the recombinant plasmids were used to transform E. coli cells and express the coat proteins. The recombinant coat proteins were purified, and their identities were confirmed by SDS-PAGE and Western blot and used for rabbit immunizations. Antisera raised against these proteins were able to recognize the corresponding recombinant proteins in Western blots and to detect GLRaV-2 and GVB in infected grapevine tissues, by indirect ELISA, discriminating healthy and infected grapevines with absorbances (A405 of 0.08/1.15 and 0.12/1.30, respectively. Expressing CP genes can yield high amount of viral protein with high antigenicity, and GLRaV-2 and GVB antisera obtained in this study can allow reliable virus disease diagnosis.O objetivo deste trabalho foi produzir e caracterizar anti-soros específicos contra isolados brasileiros do Vírus do enrolamento-da-folha da videira 2 (GLRaV-2 e do Vírus B da videira (GVB, desenvolvidos a partir das proteínas capsidiais expressas em Escherichia coli, e testar seu possível uso para a detecção destes dois vírus em videiras infectadas. Os genes da proteína capsidial (CP foram amplificados via RT-PCR, clonados e seqüenciados. Foram, subseqüentemente, subclonados, e os plasmídeos recombinantes foram empregados na transformação das células de E. coli e na expressão das proteínas capsidiais. As proteínas capsidiais recombinantes foram purificadas, e suas identidades foram confirmadas em SDS-PAGE e "Western blot" e utilizadas para imunizar coelhos. Os anti

Atmospheric circulation patterns and phenological anomalies of grapevine in Italy

Science.gov (United States)

Cola, Gabriele; Alilla, Roberta; Dal Monte, Giovanni; Epifani, Chiara; Mariani, Luigi; Parisi, Simone Gabriele

2014-05-01

Grapevine (Vitis vinifera L.) is a fundamental crop for Italian agriculture as testified by the first place of Italy in the world producers ranking. This justify the importance of quantitative analyses referred to this crucial crop and aimed to quantify meteorological resources and limitations to development and production. Phenological rhythms of grapevine are strongly affected by surface fields of air temperature which in their turn are affected by synoptic circulation. This evidence highlights the importance of an approach based on dynamic climatology in order to detect and explain phenological anomalies that can have relevant effects on quantity and quality of grapevine production. In this context, this research is aimed to study the existing relation among the 850 hPa circulation patterns over the Euro-Mediterranean area from NOAA Ncep dataset and grapevine phenological fields for Italy over the period 2006-2013, highlighting the main phenological anomalies and analyzing synoptic determinants. This work is based on phenological fields with a standard pixel of 2 km routinely produced from 2006 by the Iphen project (Italian Phenological network) on the base of phenological observations spatialized by means of a specific algorithm based on cumulated thermal resources expressed as Normal Heat Hours (NHH). Anomalies have been evaluated with reference to phenological normal fields defined for the Italian area on the base of phenological observations and Iphen model. Results show that relevant phenological anomalies observed over the reference period are primarily associated with long lasting blocking systems driving cold air masses (Arctic or Polar-Continental) or hot ones (Sub-Tropical) towards the Italian area. Specific cases are presented for some years like 2007 and 2011.

Infant sleep, parental sleep and parenting stress in families of mothers on maternity leave and in families of working mothers.

Science.gov (United States)

Sinai, Dana; Tikotzky, Liat

2012-04-01

The purpose of the present study was to investigate the links between infants' sleep and their parents' sleep and to assess the links between infant/parent sleep and parenting stress. Furthermore, we explored whether the links between sleep and parenting stress are moderated by maternal leave status. Participants were 50 families with an infant between the ages of 4-5 months. Half of the mothers were on maternity leave while the others returned to work. Parents completed daily sleep logs about infants' and their own sleep for 4 consecutive nights. Each parent also completed the Parenting Stress Index. Infant sleep was associated with sleep of both mothers and fathers, but the correlations with maternal sleep were stronger. Parental perceptions of their infant's sleep as problematic were associated with higher parenting stress. Poorer infant and maternal sleep patterns were associated with parenting stress only in families with mothers on maternity leave, probably because these mothers need to provide intensive caregiving "around the clock" without sufficient opportunities to rest. Copyright © 2012 Elsevier Inc. All rights reserved.

Gene expression profiling in susceptible interaction of grapevine with its fungal pathogen Eutypa lata: Extending MapMan ontology for grapevine

Directory of Open Access Journals (Sweden)

Usadel Björn

2009-08-01

Full Text Available Abstract Background Whole genome transcriptomics analysis is a very powerful approach because it gives an overview of the activity of genes in certain cells or tissue types. However, biological interpretation of such results can be rather tedious. MapMan is a software tool that displays large datasets (e.g. gene expression data onto diagrams of metabolic pathways or other processes and thus enables easier interpretation of results. The grapevine (Vitis vinifera genome sequence has recently become available bringing a new dimension into associated research. Two microarray platforms were designed based on the TIGR Gene Index database and used in several physiological studies. Results To enable easy and effective visualization of those and further experiments, annotation of Vitis vinifera Gene Index (VvGI version 5 to MapMan ontology was set up. Due to specificities of grape physiology, we have created new pictorial representations focusing on three selected pathways: carotenoid pathway, terpenoid pathway and phenylpropanoid pathway, the products of these pathways being important for wine aroma, flavour and colour, as well as plant defence against pathogens. This new tool was validated on Affymetrix microarrays data obtained during berry ripening and it allowed the discovery of new aspects in process regulation. We here also present results on transcriptional profiling of grape plantlets after exposal to the fungal pathogen Eutypa lata using Operon microarrays including visualization of results with MapMan. The data show that the genes induced in infected plants, encode pathogenesis related proteins and enzymes of the flavonoid metabolism, which are well known as being responsive to fungal infection. Conclusion The extension of MapMan ontology to grapevine together with the newly constructed pictorial representations for carotenoid, terpenoid and phenylpropanoid metabolism provide an alternative approach to the analysis of grapevine gene expression

GRAPEVINE FE-CHLOROSIS ON PODUNAVLJE VINEGROWING AREA

Directory of Open Access Journals (Sweden)

Mato Drenjančević

2012-06-01

Full Text Available The characteristic of Podunavlje vinegrowing area in the far east of the Republic of Croatia is carbonate soil with loess as a parent substrate. Chlorosis is common on this soil and it is often caused by excess concentrations of calcium and magnesium and deficiency of iron and zinc. It can also be resulted by inactivation, if it is transformed so that a plant can not use it. The lack of iron in grape vine is resulted in leaf vein, first in younger leaves where the venation remains green, and then marginal necrosis and defoliation are developed. The results of the study include the data based on the field researches of Podunavlje vinegrowing subregion and exact research of fertilization field trial. Field research of Podunavlje vinegrowing subregion, vineyards of Srijem, Erdut and Baranya were conducted in July 2007. The field research consisted of locating plantations, measuring plantations chlorosis, determining their general condition and measuring total concentration of chloroplast pigments by an indirect method (chlorophyll meter on the chlorotic and nonchlorotic plants of a grapevine. The intensity of a relative chlorosis was calculated from data measured by a chlorophyll meter. Field research was located on the production area of a company Agro-Ilok ltd. in Ilok, locality Radoš, and carried out during the period 2008 and 2009. It included cultivar Welsh Riesling, grapevine stock Kober 5BB, the most important white cultivar and grapevine stock in the vinegrowing region Continental Croatia. The experiment was set up according to a split plot method at 5x3 levels. The main factor A consisted of different chemical treatments in a basic fertilization: : A1 = 0 control without fertilization; A2 = 150 kg P2O5 + 300 K2O kg ha-1 (KCl; A3 = 150 kg P2O5 + 300 K2O kg ha-1 (K2SO4; A4 = 150 kg P2O5 + 300 K2O kg ha-1 (KCl + 25 kg ha-1 Fe - FeSO4x7H2O; A5 = 150 kg P2O5 + 300 K2O kg ha-1 (K2SO4 + 25 kg ha-1 Fe - FeSO4x7H2O. Factor B had got three levels

Genetic characterization of autochthonous grapevine cultivars from Eastern Turkey by simple sequence repeats (SSRs

Directory of Open Access Journals (Sweden)

Sadiye Peral Eyduran

2016-01-01

Full Text Available In this research, two well-recognized standard grape cultivars, Cabernet Sauvignon and Merlot, together with eight historical autochthonous grapevine cultivars from Eastern Anatolia in Turkey, were genetically characterized by using 12 pairs of simple sequence repeat (SSR primers in order to evaluate their genetic diversity and relatedness. All of the used SSR primers produced successful amplifications and revealed DNA polymorphisms, which were subsequently utilized to evaluate the genetic relatedness of the grapevine cultivars. Allele richness was implied by the identification of 69 alleles in 8 autochthonous cultivars with a mean value of 5.75 alleles per locus. The average expected heterozygosity and observed heterozygosity were found to be 0.749 and 0.739, respectively. Taking into account the generated alleles, the highest number was recorded in VVC2C3 and VVS2 loci (nine and eight alleles per locus, respectively, whereas the lowest number was recorded in VrZAG83 (three alleles per locus. Two main clusters were produced by using the unweighted pair-group method with arithmetic mean dendrogram constructed on the basis of the SSR data. Only Cabernet Sauvignon and Merlot cultivars were included in the first cluster. The second cluster involved the rest of the autochthonous cultivars. The results obtained during the study illustrated clearly that SSR markers have verified to be an effective tool for fingerprinting grapevine cultivars and carrying out grapevine biodiversity studies. The obtained data are also meaningful references for grapevine domestication.

Comparing Kaolin and Pinolene to Improve Sustainable Grapevine Production during Drought.

Directory of Open Access Journals (Sweden)

Luca Brillante

Full Text Available Viticulture is widely practiced in dry regions, where the grapevine is greatly exposed to water stress. Optimizing plant water use efficiency (WUE without affecting crop yield, grape and wine quality is crucial to limiting use of water for irrigation and to significantly improving viticulture sustainability. This study examines the use in vineyards of particle film technology (engineered kaolin and compares it to a film-forming antitranspirant (pinolene, traditionally used to limit leaf water loss, and to an untreated control. The trial was carried out under field conditions over three growing seasons, during which moderate to very severe plant water stress (down to -1.9 MPa was measured through stem water potential. Leaf stomatal conductance (gs and photosynthesis rate (An were measured during the seasons and used to compute intrinsic WUE (WUEi, defined as An/gs ratio. Leaf temperature was also recorded and compared between treatments. Bunch quantity, bunch and berry weight, sugar accumulation, anthocyanin and flavonoid contents were measured. Finally, microvinifications were performed and resultant wines subjected to sensory evaluation.Results showed that the use of kaolin increased grapevine intrinsic WUE (+18% on average as compared to unsprayed vines without affecting berry and bunch weight and quantity, or sugar level. Anthocyanin content increased (+35% in kaolin treatment, and the wine was judged more attractive (p-value <0.05 and slightly more appreciated (p-value < 0.1 than control. Pinolene did not increase WUEi, limiting An more than gs; grapes with this treatment contained lower sugar and anthocyanin content than control, and the obtained wine was the least appreciated. This study demonstrates that particle film technology can improve vine WUEi and wine quality at the same time, while traditional antitranspirants were not as effective for these purposes. This positive effect can be used in interaction with other already

The Phenylpropanoid Pathway Is Controlled at Different Branches by a Set of R2R3-MYB C2 Repressors in Grapevine1

Science.gov (United States)

Cavallini, Erika; Matus, José Tomás; Finezzo, Laura; Zenoni, Sara; Loyola, Rodrigo; Guzzo, Flavia; Schlechter, Rudolf; Ageorges, Agnès; Arce-Johnson, Patricio

2015-01-01

Because of the vast range of functions that phenylpropanoids possess, their synthesis requires precise spatiotemporal coordination throughout plant development and in response to the environment. The accumulation of these secondary metabolites is transcriptionally controlled by positive and negative regulators from the MYB and basic helix-loop-helix protein families. We characterized four grapevine (Vitis vinifera) R2R3-MYB proteins from the C2 repressor motif clade, all of which harbor the ethylene response factor-associated amphiphilic repression domain but differ in the presence of an additional TLLLFR repression motif found in the strong flavonoid repressor Arabidopsis (Arabidopsis thaliana) AtMYBL2. Constitutive expression of VvMYB4a and VvMYB4b in petunia (Petunia hybrida) repressed general phenylpropanoid biosynthetic genes and selectively reduced the amount of small-weight phenolic compounds. Conversely, transgenic petunia lines expressing VvMYBC2-L1 and VvMYBC2-L3 showed a severe reduction in petal anthocyanins and seed proanthocyanidins together with a higher pH of crude petal extracts. The distinct function of these regulators was further confirmed by transient expression in tobacco (Nicotiana benthamiana) leaves and grapevine plantlets. Finally, VvMYBC2-L3 was ectopically expressed in grapevine hairy roots, showing a reduction in proanthocyanidin content together with the down-regulation of structural and regulatory genes of the flavonoid pathway as revealed by a transcriptomic analysis. The physiological role of these repressors was inferred by combining the results of the functional analyses and their expression patterns in grapevine during development and in response to ultraviolet B radiation. Our results indicate that VvMYB4a and VvMYB4b may play a key role in negatively regulating the synthesis of small-weight phenolic compounds, whereas VvMYBC2-L1 and VvMYBC2-L3 may additionally fine tune flavonoid levels, balancing the inductive effects of

Formation of (E)-nerolidol in tea (Camellia sinensis) leaves exposed to multiple stresses during tea manufacturing.

Science.gov (United States)

Zhou, Ying; Zeng, Lanting; Liu, Xiaoyu; Gui, Jiadong; Mei, Xin; Fu, Xiumin; Dong, Fang; Tang, Jingchi; Zhang, Lingyun; Yang, Ziyin

2017-09-15

(E)-Nerolidol is a volatile sesquiterpene that contributes to the floral aroma of teas (Camellia sinensis). The unique manufacturing process for oolong tea involves multiple stresses, resulting in a high content of (E)-nerolidol, which is not known to form in tea leaves. This study aimed to determine the formation mechanism of (E)-nerolidol in tea exposed to multiple stresses during tea manufacture. C. sinensis (E)-nerolidol synthase (CsNES) recombinant protein, found in the cytosol, was found to transform farnesyl diphosphate into (E)-nerolidol. CsNES was highly expressed during the oolong tea turn over process, resulting in (E)-nerolidol accumulation. Continuous mechanical damage, simulating the turn over process, significantly enhanced CsNES expression level and (E)-nerolidol content. The combination of low temperature stress and mechanical damage had a synergistic effect on (E)-nerolidol formation. This is the first evidence of (E)-nerolidol formation mechanism in tea leaves and a characteristic example of plant volatile formation in response to dual stresses. Copyright © 2017 Elsevier Ltd. All rights reserved.

Investigation of drought stress in pepino (solanum muricatum ait. cv. miskl) leaves

International Nuclear Information System (INIS)

Duman, S.; Sivaci, A.

2015-01-01

In this study, the effects of drought stress on pepino seedlings (Solanum muricatum cv. Miski) under natural greenhouse conditions were examined. The control plants were watered at field capacity, and the stress group was not watered. Samples were collected on the 6th, 12th, 24th and 36th days from the leaves of S. muricatum seedlings that, were exposed to drought stress. The relative water content, the total phenolic compounds, and the malondialdehyde, total photosynthetic pigments (chlorophyll a, chlorophyll b and carotenoids), and proline contents in these samples were determined. Depending on drought stress, the relative water content, the chlorophyll a, chlorophyll b and carotenoid contents, and the total chlorophylls were found to be lower in the stress group compared with the control group. In contrast, the total phenolic compounds (24th and 36th days) and the proline (12th, 24th and 36th days) levels increased significantly compared with the control group. In addition, a significant increase in the malondialdehyde contents was obtained on the 36th day in the stress group compared with the control group. Such studies may be important for evaluation of metabolic changes in pepino under the drought stress. (author)

Effect of ploughing-down of grapevine chips on soil structure when using special agricultural machinery

Directory of Open Access Journals (Sweden)

Barbora Badalíková

2012-01-01

Full Text Available Within the period of 2008–2011, changes in soil structure were studied in two selected localities: one of them was situated in vineyards of the University Training Farm of Mendel University in Žabčice near Brno, the other was in vineyards situated in the cadastre of wine-growing municipality Velké Bílovice. Established were altogether three variants of experiments with application of crushed grapevine wood (chips: Variant 1 – control; Variant 2 – crushed grapevine wood ploughed down to the depth of 0.10 m; Variant 3 – crushed grapevine wood + grass spread on the soil surface as a mulch. Grapevine canes were crushed to chips using a special agricultural machinery while the soil in inter-rows was processed using conventional tilling machines. The obtained results showed that the best coefficient of structurality (expressing the degree of destruction of soil structure was recorded in Variants 2 in both localities. Considering values of this coefficient it could be concluded that just this variant showed a positive effect on soil structure. This variant reduced the compaction of soil caused by the movement of agricultural machines in vineyard inter-rows Crushed grapevine waste wood can therefore compensate losses of organic matter in soil. Better values of structurality coefficient were recorded in the locality Žabčice.

Grapevine dynamics after manual tending of juvenile stands on the Hoosier National Forest, Indiana

Science.gov (United States)

Robert C. Morrissey; Martin-Michel Gauthier; John A., Jr. Kershaw; Douglass F. Jacobs; Burnell C. Fischer; John R. Siefert

2008-01-01

Large woody vines, most notably grapevines, are a source of great concern for forest and wildlife managers in many parts of the Central Hardwood Forest Region of the United States. We examined grapevine dynamics in stands aged 21 - 35 years. The plots, located in regenerated clearcuts in the Hoosier National Forest (HNF), were evaluated for vine control, site, and tree...

The Mediator Effect Of Depression Level On The Effects Of Work Stress On The Intention Of Leaving Employment Among Education Employee

Directory of Open Access Journals (Sweden)

Ahmet Cezmi SAVAS

2017-12-01

Full Text Available The purpose of this study is to investigate the effects of depression level on the effects of work stress on the intention of leaving employment among education employee. The sample of the current research includes 67 principals, 79 assistant principals, and 163 teachers who work in various schools in the city center of Gaziantep during 2013-2014 education year. It was found that work stress and depression level were significant predictors of intention of leaving employment. Based on the results that the mediator effect of depression level when the level of work stress of education employee is predicting the intention of leaving of employment, it was found the level of depression is a mediator, and related solutions are presented.

Multi-gene analysis and morphology reveal novel Ilyonectria species associated with black foot disease of grapevines

NARCIS (Netherlands)

Cabral, A.; Rego, C.; Nascimento, T.; Oliveira, H.; Groenewald, J.Z.; Crous, P.W.

2012-01-01

Black foot is an important disease of grapevines, which has in recent years been recorded with increased incidence and severity throughout the world, affecting grapevines both in nurseries and young vineyards. In the past the disease has been associated with infections by Ilyonectria macrodidyma,

Aplicação foliar de nitrogênio em videira: avaliação do teor na folha e das reservas nitrogenadas e de carboidratos nas gemas dos ramos do ano Nitrogen foliar spraying in grapevine: content in leaves and reserve of nitrogen and carboihydrates in shoots buds

Directory of Open Access Journals (Sweden)

Gustavo Brunetto

2008-12-01

Full Text Available No Rio Grande do Sul (RS, as aplicações foliares de nitrogênio, quando necessárias, têm sido usadas para complementar a adubação via solo. Entretanto, carece-se de informações dos efeitos da freqüência e da quantidade de N aplicado sobre a sua dinâmica na folha e de reservas nitrogenadas e de carboidratos nas partes perenes da videira, que compõem o objetivo deste trabalho. O trabalho foi conduzido em um vinhedo da cultivar Chenin Blanc, safra 2004/05, na Embrapa Uva e Vinho, em Bento Gonçalves (RS, sobre um Neossolo Litólico. Os tratamentos consistiram de uma, duas e três aplicações foliares de 0 (água; 1,11; 2,23; 3,31 e 4,41g de N planta-1. Após cada aplicação de nitrogênio, foram coletadas folhas inteiras (limbo+pecíolo no terço médio dos ramos do ano, no interior e exterior dos diferentes lados da planta, secas, moídas e preparadas para a análise de N total. Na última época de coleta de folhas, foram coletados três ramos do ano em cada planta, retiradas seis gemas em cada ramo, as quais foram submetidas à análise de amido, carboidratos solúveis totais, carboidratos redutores, aminoácidos totais e proteínas totais. As aplicações foliares de N aumentaram o teor do nutriente na folha inteira, de forma destacada, nas épocas de coletas próximas às aplicações; entretanto, essas aplicações diminuíram os teores de amido e carboidratos solúveis totais nas gemas dos ramos do ano e não afetaram os teores de carboidratos redutores e os totais de aminoácidos e proteínas.Leaf nitrogen application is used in grapevines in Southern Brazil as complement to soil fertilization. On the other hand, there is no information about its affects on nitrogen content in the leaves and nitrogen and carbohydrates reserves in the perennial parts. The experiment was carried out in 2004/2005, with the objective to evaluate the effect of nitrogen foliar spraying on leaves and nitrogen and carbohydrates reserves in shoots buds

Development of a Grapevine Pruning Algorithm for Using in Pruning

Directory of Open Access Journals (Sweden)

S. M Hosseini

2017-10-01

Full Text Available Introduction Great areas of the orchards in the world are dedicated to cultivation of the grapevine. Normally grape vineyards are pruned twice a year. Among the operations of grape production, winter pruning of the bushes is the only operation that still has not been fully mechanized while it is known as the most laborious jobs in the farm. Some of the grape producing countries use various mechanical machines to prune the grapevines, but in most cases, these machines do not have a good performance. Therefore intelligent pruning machine seems to be necessary in this regard and this intelligent pruning machines can reduce the labor required to prune the vineyards. It this study in was attempted to develop an algorithm that uses image processing techniques to identify which parts of the grapevine should be cut. Stereo vision technique was used to obtain three dimensional images from the bare bushes whose leaves were fallen in autumn. Stereo vision systems are used to determine the depth from two images taken at the same time but from slightly different viewpoints using two cameras. Each pair of images of a common scene is related by a popular geometry, and corresponding points in the images pairs are constrained to lie on pairs of conjugate popular lines. Materials and Methods Photos were taken from gardens of the Research Center for Agriculture and Natural Resources of Fars province, Iran. At first, the distance between the plants and the cameras should be determined. The distance between the plants and cameras can be obtained by using the stereo vision techniques. Therefore, this method was used in this paper by two pictures taken from each plant with the left and right cameras. The algorithm was written in MATLAB. To facilitate the segmentation of the branches from the rows at the back, a blue plate with dimensions of 2×2 m2 were used at the background. After invoking the images, branches were segmented from the background to produce the binary

Grapevine responses to terroir: a global approach

Directory of Open Access Journals (Sweden)

Alain Deloire

2005-12-01

Full Text Available This paper deals with the technical and/or practical treatment of terroir as a study concept, together with related functional aspects. Functioning of the terroir relies on the relation between climate, soil and vine. In addition to this interaction, a comprehensive study concept for terroir requires the consideration of viticultural and enological sciences and techniques necessary to ensure the assurance of wine quality, together with spatial aspects of the grapevine response to environmental factors, as required for vineyard management. In order to comprehend the quality of the harvest, it is necessary to understand the relationship « whole plant - berry ». An easy field and laboratory method to study the relationship between the whole plant and berry and the consequences thereof for wine quality is proposed. Knowledge of grapevine water status and the biochemical evolution within the grape berry from berry set onwards are important issues for the understanding of the role that terroir plays with respect to the quality of the harvest and the wine style or « typicality ».

Vegetative, productive and qualitative performance of grapevine "Cabernet Sauvignon" according to the use of winter cover crops

Directory of Open Access Journals (Sweden)

Jean Carlos Bettoni

Full Text Available ABSTRACT To study the effect of winter cover crops on the vegetative, productive and qualitative behavior of "Cabernet Sauvignon" grapevines, an experiment was conducted in two wine harvests by sowing different species of winter cover crops and additional treatments with manual weeding and mechanical mowing in an experimental vineyard located at the Experimental Station of Epagri in Videira, state of Santa Catarina, Brazil. Plant attributes of the grapevine, such as number of rods and weight of pruned material and number of branches per plant. At the time of skin color change, petioles of recently matured leaves were collected for analysis of the levels of N, P, K, Ca, Mg, Fe, Mn, Zn and B. Moments before harvest, 100 grape berries were collected randomly to determine the total soluble solids, titratable acidity and pH. At harvest, the number of bunches per branch, the number and mass of clusters per plant and the average mass of clusters per plot were determined. Fresh and dry matter yields of the cover crop and weed plants were also determined when coverage reached full bloom. The winter cover crops did not alter the yield and quality of "Cabernet Sauvignon" grapes and showed no differences from each other for the management of spontaneous vegetation by hand weeding or mechanical mowing. Rye and ryegrass are effective alternatives for weed control alternatives. The species of white and red clover present difficulty in initial establishment, producing a small amount of biomass.

Using Image Texture and Spectral Reflectance Analysis to Detect Yellowness and Esca in Grapevines at Leaf-Level

Directory of Open Access Journals (Sweden)

Hania Al-Saddik

2018-04-01

Full Text Available Plant diseases are one of the main reasons behind major economic and production losses in the agricultural field. Current research activities enable large fields monitoring and plant disease detection using innovative and robust technologies. French grapevines have a reputation for producing premium quality wines, however, these major fruit crops are susceptible to many diseases, including Esca, Downy mildew, Powdery mildew, Yellowing, and many others. In this study, we focused on two main infections (Esca and Yellowing, and data were gathered from fields that were located in Aquitaine and Burgundy regions, France. Since plant diseases can be diagnosed from the properties of the leaf, we acquired both Red-Green-Blue (RGB digital image and hyperspectral reflectance data from infected and healthy leaves. Biophysical parameters that were produced by the PROSPECT model inversion together with texture parameters compiled from the literature were deduced. Then we investigated their relationship to damage caused by Yellowing and Esca. This study examined whether spectral and textural data can identify the two diseases through the use of Neural Networks. We obtained an overall accuracy of 99% for both of the diseases when textural and spectral data are combined. These results suggest that, first, biophysical parameters present a valid dimension reduction tool that could replace the use of complete hyperspectral data. Second, remote sensing using spectral reflectance and digital images can make an overall nondestructive, rapid, cost-effective, and reproducible technique to determine diseases in grapevines with a good level of accuracy.

Abscisic Acid-Induced H2O2 Accumulation Enhances Antioxidant Capacity in Pumpkin-Grafted Cucumber Leaves under Ca(NO3)2 Stress

Science.gov (United States)

Shu, Sheng; Gao, Pan; Li, Lin; Yuan, Yinghui; Sun, Jin; Guo, Shirong

2016-01-01

With the aim to clarifying the role of the ABA/H2O2 signaling cascade in the regulating the antioxidant capacity of grafted cucumber plants in response to Ca(NO3)2 stress, we investigated the relationship between ABA-mediated H2O2 production and the activities of antioxidant enzymes in the leaves of pumpkin-grafted cucumber seedlings. The results showed that both ABA and H2O2 were detected in pumpkin-grafted cucumber seedlings in response to Ca(NO3)2 treatment within 0.5 h in the leaves and peaked at 3 and 6 h after Ca(NO3)2 treatment, respectively, compared to the levels under control conditions. The activities of superoxide dismutase (SOD), ascorbate peroxidase (APX), and peroxidase (POD) in pumpkin-grafted cucumber leaves gradually increased over time and peaked at 12 h of Ca(NO3)2 stress. Furthermore, in the leaves of pumpkin-grafted cucumber seedlings, the H2O2 generation, the antioxidant enzyme activities and the expression of SOD, POD and cAPX were strongly blocked by an inhibitor of ABA under Ca(NO3)2 stress, but this effect was eliminated by the addition of exogenous ABA. Moreover, the activities and gene expressions of these antioxidant enzymes in pumpkin-grafted leaves were almost inhibited under Ca(NO3)2 stress by pretreatment with ROS scavengers. These results suggest that the pumpkin grafting-induced ABA accumulation mediated H2O2 generation, resulting in the induction of antioxidant defense systems in leaves exposed to Ca(NO3)2 stress in the ABA/H2O2 signaling pathway. PMID:27746808

Weed control and cover crop management affect mycorrhizal colonization of grapevine roots and arbuscular mycorrhizal fungal spore populations in a California vineyard.

Science.gov (United States)

Baumgartner, Kendra; Smith, Richard F; Bettiga, Larry

2005-03-01

Arbuscular mycorrhizal (AM) fungi naturally colonize grapevines in California vineyards. Weed control and cover cropping may affect AM fungi directly, through destruction of extraradical hyphae by soil disruption, or indirectly, through effects on populations of mycorrhizal weeds and cover crops. We examined the effects of weed control (cultivation, post-emergence herbicides, pre-emergence herbicides) and cover crops (Secale cereale cv. Merced rye, x Triticosecale cv.Trios 102) on AM fungi in a Central Coast vineyard. Seasonal changes in grapevine mycorrhizal colonization differed among weed control treatments, but did not correspond with seasonal changes in total weed frequency. Differences in grapevine colonization among weed control treatments may be due to differences in mycorrhizal status and/or AM fungal species composition among dominant weed species. Cover crops had no effect on grapevine mycorrhizal colonization, despite higher spring spore populations in cover cropped middles compared to bare middles. Cover crops were mycorrhizal and shared four AM fungal species (Glomus aggregatum, G. etunicatum, G. mosseae, G. scintillans) in common with grapevines. Lack of contact between grapevine roots and cover crop roots may have prevented grapevines from accessing higher spore populations in the middles.

Trocas gasosas em videira sob regime de estresse hídrico. II. fotorrespiração e comportamento varietal Gas exchanges in grapevines under water stress regime. II. photorespiration and varietal behavior

Directory of Open Access Journals (Sweden)

Murillo de Albuquerque Regina

1999-01-01

Full Text Available Analisou-se a fotorrespiração em folhas de videira (Vitis vinifera L. submetidas a um regime de estresse hídrico, com o objetivo de caracterizar o comportamento de diferentes cultivares. Foram utilizadas plantas de dois anos, enxertadas sobre o porta-enxerto Fercal, plantadas em vasos plásticos e cultivadas em ambiente controlado. A fotorrespiração foi calculada a partir de medidas das trocas gasosas foliares. Os valores absolutos da fotorrespiração variaram pouco entre cultivares e nível de irrigação; já a eficiência da carboxilação e o ponto de compensação ao CO2 foram bastante afetados pelo estresse hídrico, o que revela diferentes níveis de sensibilidade varietal. Foi verificada a ocorrência de inibição não-estomática da fotossíntese, afetando diferencialmente as cultivares analisadas. Destacou-se, ainda, a maior adaptação da Chardonnay às condições de estresse hídrico, em oposição à grande sensibilidade da Sémillon e da Ugni blanc.The photorespiration in grapevines (Vitis vinifera L. leaves subjected to a water stress regime was analysed with the purpose of characterizing the behavior of different cultivars. Two-year old plants were used, grafted on Fercal, planted in plastic pots and cultivated in controlled environment. The photorespiration was calculated from leaf gas exchange measurements taken by means of a portable infrared CO2 analyser (LCA3-ADC, working in an open circuit. The absolute photorespiration values varied little among cultivars and level of irrigation, whereas the carboxylation efficiency and the CO2 compensation point were highly affected by the water stress, thereby evidencing different varietal sensitivity levels. The occurrence of a nonstomatal inhibition of the photosynthesis was verified affecting in a specific way the cultivars analysed. The Chardonnay adapted itself better to the water stress conditions as opposed to the high sensitivity on the part of Sémillon and Ugni blanc.

Environmental plasticity of Pinot noir grapevine leaves: A trans-European study of morphological and biochemical changes along a 1,500-km latitudinal climatic gradient

Czech Academy of Sciences Publication Activity Database

Castagna, A.; Csepregi, K.; Neugart, S.; Zipoli, G.; Večeřová, Kristýna; Jakab, G.; Jug, T.; Llorens, L.; Martínez-Abaigar, J.; Martínez-Lüscher, J.; Núñez-Olivera, E.; Ranieri, A.; Schoedl-Hummel, K.; Schreiner, M.; Teszlák, P.; Tittmann, S.; Urban, Otmar; Verdaguer, D.; Jansen, M. A. K.; Hideg, É.

2017-01-01

Roč. 40, č. 11 (2017), s. 2790-2805 ISSN 0140-7791 R&D Projects: GA MŠk(CZ) LO1415; GA MŠk(CZ) LM2015061 Institutional support: RVO:86652079 Keywords : hydroxycinnamic acid- derivatives * oleracea var. sabellica * uv-b radiation * photosynthetically active radiation * different flavonol glycosides * alpha-tocopherol * arabidopsis-thaliana * phenolic-compounds * ultraviolet-radiation * natural-populations * alpha-tocopherol * carotenoids * climate * global radiation * grapevine * latitude * morphology * phenolic compounds * plasticity * ultraviolet radiation Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 6.173, year: 2016

The effect of strobilurins on leaf gas exchange, water use efficiency and ABA content in grapevine under field conditions.

Science.gov (United States)

Diaz-Espejo, Antonio; Cuevas, María Victoria; Ribas-Carbo, Miquel; Flexas, Jaume; Martorell, Sebastian; Fernández, José Enrique

2012-03-01

Strobilurins are one of the most important classes of agricultural fungicides. In addition to their anti-fungal effect, strobilurins have been reported to produce simultaneous effects in plant physiology. This study investigated whether the use of strobilurin fungicide improved water use efficiency in leaves of grapevines grown under field conditions in a Mediterranean climate in southern Spain. Fungicide was applied three times in the vineyard and measurements of leaf gas exchange, plant water status, abscisic acid concentration in sap ([ABA]), and carbon isotope composition in leaves were performed before and after applications. No clear effect on stomatal conductance, leaf water potential and intrinsic water use efficiency was found after three fungicide applications. ABA concentration was observed to increase after fungicide application on the first day, vanishing three days later. Despite this transient effect, evolution of [ABA] matched well with the evolution of leaf carbon isotope ratio, which can be used as a surrogate for plant water use efficiency. Morning stomatal conductance was negatively correlated to [ABA]. Yield was enhanced in strobilurin treated plants, whereas fruit quality remained unaltered. Published by Elsevier GmbH.

Stress amongst nurses working in a healthcare telephone-advice service: relationship with job satisfaction, intention to leave, sickness absence, and performance.

Science.gov (United States)

Farquharson, Barbara; Allan, Julia; Johnston, Derek; Johnston, Marie; Choudhary, Carolyn; Jones, Martyn

2012-07-01

This paper is a report of a study, which assessed levels of stress amongst nurses working in a healthcare telephone-advice service. We explored whether stress related to performance, sickness absence, and intention to leave. Nurses report high levels of stress, as do call-centre workers. The emergence of telephone health advice services means many nurses now work in call-centres, doing work that differs markedly from traditional nursing roles. Stress associated with these roles could have implications for nurses, patients, and service provision. This paper reports cross-sectional survey results. The design of the overall study included longitudinal elements. A comprehensive study of stress was conducted amongst nurses working for a telephone-advice service in Scotland (2008-2010). All nurse-advisors were approached by letter and invited to participate. A total of 152 participants (33%) completed a questionnaire including General Health Questionnaire-12, Work Family Conflict Questionnaire, Job Satisfaction Scale and a measure of intention to leave the telephone-advice service and rated the perceived stress of 2 working shifts. Nurses' employers provided data on sickness absence and performance. Overall levels of psychological distress were similar to those found amongst Scottish women generally. In multiple regression, work-family conflict was identified as a significant predictor of job satisfaction and intention to leave, and significantly related to sickness absence. There were significant correlations between General Health Questionnaire scores and perceived stress of shifts and some performance measures. Work-family conflict is a significant predictor of job satisfaction, intention to leave, and sickness absence amongst telephone helpline nurses. Minimizing the impact of nurses' work on their home lives might reduce turnover and sickness absence. © 2012 Blackwell Publishing Ltd.

Grapevine acclimation to water deficit: the adjustment of stomatal and hydraulic conductance differs from petiole embolism vulnerability.

Science.gov (United States)

Hochberg, Uri; Bonel, Andrea Giulia; David-Schwartz, Rakefet; Degu, Asfaw; Fait, Aaron; Cochard, Hervé; Peterlunger, Enrico; Herrera, Jose Carlos

2017-06-01

Drought-acclimated vines maintained higher gas exchange compared to irrigated controls under water deficit; this effect is associated with modified leaf turgor but not with improved petiole vulnerability to cavitation. A key feature for the prosperity of plants under changing environments is the plasticity of their hydraulic system. In the present research we studied the hydraulic regulation in grapevines (Vitis vinifera L.) that were first acclimated for 39 days to well-watered (WW), sustained water deficit (SD), or transient-cycles of dehydration-rehydration-water deficit (TD) conditions, and then subjected to varying degrees of drought. Vine development under SD led to the smallest leaves and petioles, but the TD vines had the smallest mean xylem vessel and calculated specific conductivity (k ts ). Unexpectedly, both the water deficit acclimation treatments resulted in vines more vulnerable to cavitation in comparison to WW, possibly as a result of developmental differences or cavitation fatigue. When exposed to drought, the SD vines maintained the highest stomatal (g s ) and leaf conductance (k leaf ) under low stem water potential (Ψ s ), despite their high xylem vulnerability and in agreement with their lower turgor loss point (Ψ TLP ). These findings suggest that the down-regulation of k leaf and g s is not associated with embolism, and the ability of drought-acclimated vines to maintain hydraulic conductance and gas exchange under stressed conditions is more likely associated with the leaf turgor and membrane permeability.

A 3-D functional-structural grapevine model that couples the dynamics of water transport with leaf gas exchange.

Science.gov (United States)

Zhu, Junqi; Dai, Zhanwu; Vivin, Philippe; Gambetta, Gregory A; Henke, Michael; Peccoux, Anthony; Ollat, Nathalie; Delrot, Serge

2017-12-23

Predicting both plant water status and leaf gas exchange under various environmental conditions is essential for anticipating the effects of climate change on plant growth and productivity. This study developed a functional-structural grapevine model which combines a mechanistic understanding of stomatal function and photosynthesis at the leaf level (i.e. extended Farqhuhar-von Caemmerer-Berry model) and the dynamics of water transport from soil to individual leaves (i.e. Tardieu-Davies model). The model included novel features that account for the effects of xylem embolism (fPLC) on leaf hydraulic conductance and residual stomatal conductance (g0), variable root and leaf hydraulic conductance, and the microclimate of individual organs. The model was calibrated with detailed datasets of leaf photosynthesis, leaf water potential, xylem sap abscisic acid (ABA) concentration and hourly whole-plant transpiration observed within a soil drying period, and validated with independent datasets of whole-plant transpiration under both well-watered and water-stressed conditions. The model well captured the effects of radiation, temperature, CO2 and vapour pressure deficit on leaf photosynthesis, transpiration, stomatal conductance and leaf water potential, and correctly reproduced the diurnal pattern and decline of water flux within the soil drying period. In silico analyses revealed that decreases in g0 with increasing fPLC were essential to avoid unrealistic drops in leaf water potential under severe water stress. Additionally, by varying the hydraulic conductance along the pathway (e.g. root and leaves) and changing the sensitivity of stomatal conductance to ABA and leaf water potential, the model can produce different water use behaviours (i.e. iso- and anisohydric). The robust performance of this model allows for modelling climate effects from individual plants to fields, and for modelling plants with complex, non-homogenous canopies. In addition, the model provides a

Water and Salt Stresses, Kinetin and Protein Synthesis in Tobacco Leaves 1

Science.gov (United States)

Ben-Zioni, Aliza; Itai, C.; Vaadia, Y.

1967-01-01

The capacity of tobacco (Nicotiana rustica) leaf discs to incorporate l-leucine 14C into proteins was measured. Leaf discs were obtained from plants which experienced soil water depletion, or which were exposed to a saline or osmotic stress in the root medium. The stresses were brief of relatively short duration and water potential did not decrease below 4 bars in the root media. Leaf discs were sampled 2 hours after stress removal, achieved by reirrigation, or replacement of saline and osmotic solutions with normal nutrient solution. Plants were always turgid when leaves were sampled. All stressed tissues showed reduced capacity to incorporate l-leucine 14C into protein. The reduction was about 50% and could not be attributed either to reduced uptake into the discs, or to possible isotopic dilution. Incorporation decreased progressively with leaf age in control discs as well as in stressed leaf discs. At all ages tested, incorporation in stressed discs was lower than that of the control. Full recovery of incorporation capacity in stressed discs was obtained when discs were sampled 72 hours after stress removal but not earlier. Kinetin pretreatment prior to incubation with labelled leucine partially restored incorporation in stressed discs. The differences in response to kinetin of stressed and control discs suggest a lower endogenous level of cytokinins in the stressed discs. The results were qualitatively similar regardless of the kind of stress given to the plants during pretreatment. This supports the hypothesis that the normal supply of root cytokinins is important in shoot metabolism. PMID:16656515

HEAVY METALS AND MICRONUTRIENTS IN THE SOIL AND GRAPEVINE UNDER DIFFERENT IRRIGATION STRATEGIES

Directory of Open Access Journals (Sweden)

Vanessa de Souza Oliveira

2015-02-01

Full Text Available Soils under natural conditions have heavy metals in variable concentrations and there may be an increase in these elements as a result of the agricultural practices adopted. Transport of heavy metals in soil mainly occurs in forms dissolved in the soil solution or associated with solid particles, water being their main means of transport. In this context, the aim of this study was to evaluate the heavy metal and micronutrient content in the soil and in the grapevine plant and fruit under different irrigation strategies. The experiment was carried out in Petrolina, PE, Brazil. The treatments consisted of three irrigation strategies: full irrigation (FI, regulated deficit irrigation (RDI, and deficit irrigation (DI. During the period of grape maturation, soil samples were collected at the depths of 0-10, 10-20, 20-40, 40-60, and 60-80 cm. In addition, leaves were collected at the time of ripening of the bunches, and berries were collected at harvest. Thus, the heavy metal and micronutrient contents were determined in the soil, leaves, and berries. The heavy metal and micronutrient contents in the soil showed a stochastic pattern in relation to the different irrigation strategies. The different irrigation strategies did not affect the heavy metal and micronutrient contents in the vine leaves, and they were below the contents considered toxic to the plant. In contrast, the greater availability of water in the FI treatment favored a greater Cu content in the grape, which may be a risk to vines, causing instability and turbidity. Thus, adoption of deficit irrigation is recommended so as to avoid compromising the stability of tropical wines of the Brazilian Northeast.

Computer Vision for High-Throughput Quantitative Phenotyping: A Case Study of Grapevine Downy Mildew Sporulation and Leaf Trichomes.

Science.gov (United States)

Divilov, Konstantin; Wiesner-Hanks, Tyr; Barba, Paola; Cadle-Davidson, Lance; Reisch, Bruce I

2017-12-01

Quantitative phenotyping of downy mildew sporulation is frequently used in plant breeding and genetic studies, as well as in studies focused on pathogen biology such as chemical efficacy trials. In these scenarios, phenotyping a large number of genotypes or treatments can be advantageous but is often limited by time and cost. We present a novel computational pipeline dedicated to estimating the percent area of downy mildew sporulation from images of inoculated grapevine leaf discs in a manner that is time and cost efficient. The pipeline was tested on images from leaf disc assay experiments involving two F 1 grapevine families, one that had glabrous leaves (Vitis rupestris B38 × 'Horizon' [RH]) and another that had leaf trichomes (Horizon × V. cinerea B9 [HC]). Correlations between computer vision and manual visual ratings reached 0.89 in the RH family and 0.43 in the HC family. Additionally, we were able to use the computer vision system prior to sporulation to measure the percent leaf trichome area. We estimate that an experienced rater scoring sporulation would spend at least 90% less time using the computer vision system compared with the manual visual method. This will allow more treatments to be phenotyped in order to better understand the genetic architecture of downy mildew resistance and of leaf trichome density. We anticipate that this computer vision system will find applications in other pathosystems or traits where responses can be imaged with sufficient contrast from the background.

VvGONST-A and VvGONST-B are Golgi-localised GDP-sugar transporters in grapevine (Vitis vinifera L.).

Science.gov (United States)

Utz, Daniella; Handford, Michael

2015-02-01

Plant nucleotide-sugar transporters (NSTs) are responsible for the import of nucleotide-sugar substrates into the Golgi lumen, for subsequent use in glycosylation reactions. NSTs are specific for either GDP- or UDP-sugars, and almost all transporters studied to date have been isolated from Arabidopsis thaliana L. In order to determine the conservation of the import mechanism in other higher plant species, here we report the identification and characterisation of VvGONST-A and VvGONST-B from grapevine (Vitis vinifera L. cv. Thompson Seedless), which are the orthologues of the GDP-sugar transporters GONST3 and GONST4 in Arabidopsis. Both grapevine NSTs possess the molecular features characteristic of GDP-sugar transporters, including a GDP-binding domain (GXL/VNK) towards the C-terminal. VvGONST-A and VvGONST-B expression is highest at berry setting and decreases throughout berry development and ripening. Moreover, we show using green fluorescent protein (GFP) tagged versions and brefeldin A treatments, that both are localised in the Golgi apparatus. Additionally, in vitro transport assays after expression of both NSTs in tobacco leaves indicate that VvGONST-A and VvGONST-B are capable of transporting GDP-mannose and GDP-glucose, respectively, but not a range of other UDP- and GDP-sugars. The possible functions of these NSTs in glucomannan synthesis and/or glycosylation of sphingolipids are discussed. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Unmanned Aerial Vehicle (UAV-based remote sensing to monitor grapevine leaf stripe disease within a vineyard affected by esca complex

Directory of Open Access Journals (Sweden)

Salvatore F. DI GENNARO

2016-07-01

Full Text Available Foliar symptoms of grapevine leaf stripe disease (GLSD, a disease within the esca complex are linked to drastic alteration of photosynthetic function and activation of defense responses in affected grapevines several days before the appearance of the first visible symptoms on leaves. The present study suggests a methodology to investigate the relationships between high-resolution multispectral images (0.05 m/pixel acquired using an Unmanned Aerial Vehicle (UAV, and GLSD foliar symptoms monitored by ground surveys. This approach showed high correlation between Normalized Differential Vegetation Index (NDVI acquired by the UAV and GLSD symptoms, and discrimination between symptomatic from asymptomatic plants. High-resolution multispectral images were acquired during June and July of 2012 and 2013, in an experimental vineyard heavily affected by GLSD, located in Tuscany (Italy, where vines had been surveyed and mapped since 2003. Each vine was located with a global positioning system, and classified for appearance of foliar symptoms and disease severity at weekly intervals from the beginning of each season. Remote sensing and ground observation data were analyzed to promptly identify the early stages of disease, even before visual detection. This work suggests an innovative methodology for quantitative and qualitative analysis of spatial distribution of symptomatic plants. The system may also be used for exploring the physiological bases of GLSD, and predicting the onset of this disease. 

Selenium alleviates chromium toxicity by preventing oxidative stress in cabbage (Brassica campestris L. ssp. Pekinensis) leaves.

Science.gov (United States)

Qing, Xuejiao; Zhao, Xiaohu; Hu, Chengxiao; Wang, Peng; Zhang, Ying; Zhang, Xuan; Wang, Pengcheng; Shi, Hanzhi; Jia, Fen; Qu, Chanjuan

2015-04-01

The beneficial role of selenium (Se) in alleviation of chromium (Cr)-induced oxidative stress is well established. However, little is known about the underlying mechanism. The impacts of exogenous Se (0.1mg/L) on Cr(1mg/L)-induced oxidative stress and antioxidant systems in leaves of cabbage (Brassica campestris L. ssp. Pekinensis) were investigated by using cellular and biochemical approaches. The results showed that supplementation of the medium with Se was effective in reducing Cr-induced increased levels of lipid peroxides and superoxide free radicals (O(-)2(·)), as well as increasing activities of superoxide dismutase (SOD) and peroxidase (POD). Meanwhile, 1mg/L Cr induced loss of plasma membrane integrity, growth inhibition, as well as ultrastructural changes of leaves were significantly reversed due to Se supplementation in the medium. In addition, Se application significantly altered the subcellular distribution of Cr which transported from mitochondria, nucleus and the cell-wall material to the soluble fraction and chloroplasts. However, Se application did no significant alteration of Cr effects on osmotic adjustment accumulating products. The study suggested that Se is able to protect leaves of cabbage against Cr toxicity by alleviation of Cr induced oxidative stress, and re-distribution of Cr in the subcellular of the leaf. Furthermore, free radicals, lipid peroxides, activity of SOD and POD, and subcellular distribution of Cr can be considered the efficient biomarkers to indicate the efficiency of Se to detoxification Cr. Copyright © 2015 Elsevier Inc. All rights reserved.

From 'Fire Esca' to 'Esca of Grapevine'

Directory of Open Access Journals (Sweden)

A. Graniti

2006-04-01

Full Text Available The use of tinder (‘esca’ or ‘amadou’ prepared from basidiocarps of some bracket fungi, e.g. Fomes fomentarius and Phellinus igniarius as an easy-to-burn matter goes back to the man’s conquest of fire. Archaeological finds, such as fragments of tinder, flint-stones and traces of pyrite carried by the ‘Ice man’ on his way across the Alps more than 5,000 years ago, bear evidence of the use of tinder in the Neolithic age. In 1926, on the assumption that P. igniarius was one of the pathogens of the so-called ‘apoplexy’ of grapevine, the name ‘esca’ was given to the disease. For long time, esca was thought to affect old vines only. In the last decades, however, various forms of the disease have been found to be widespread and to cause losses even to young vines. Aetiological studies have shown that esca of grapevine is a complex disease, incited by wilt-inducing ascomycetes (Togninia, Phaeoacremonium, Phaeomoniella and/or the wood-decaying basidiomycete Fomitiporia mediterranea. Since the latter is not a tinder fungus, the advisability of retaining the name ‘esca’ for the disease is discussed.

Ectopic expression of Arabidopsis broad-spectrum resistance gene RPW8.2 improves the resistance to powdery mildew in grapevine (Vitis vinifera).

Science.gov (United States)

Hu, Yang; Li, Yajuan; Hou, Fengjuan; Wan, Dongyan; Cheng, Yuan; Han, Yongtao; Gao, Yurong; Liu, Jie; Guo, Ye; Xiao, Shunyuan; Wang, Yuejin; Wen, Ying-Qiang

2018-02-01

Powdery mildew is the most economically important disease of cultivated grapevines worldwide. Here, we report that the Arabidopsis broad-spectrum disease resistance gene RPW8.2 could improve resistance to powdery mildew in Vitis vinifera cv. Thompson Seedless. The RPW8.2-YFP fusion gene was stably expressed in grapevines from either the constitutive 35S promoter or the native promoter (NP) of RPW8.2. The grapevine shoots and plantlets transgenic for 35S::RPW8.2-YFP showed reduced rooting and reduced growth at later development stages in the absence of any pathogens. Infection tests with an adapted grapevine powdery mildew isolate En NAFU1 showed that hyphal growth and sporulation were significantly restricted in transgenic grapevines expressing either of the two constructs. The resistance appeared to be attributable to the ectopic expression of RPW8.2, and associated with the enhanced encasement of the haustorial complex (EHC) and onsite accumulation of H 2 O 2 . In addition, the RPW8.2-YFP fusion protein showed focal accumulation around the fungal penetration sites. Transcriptome analysis revealed that ectopic expression of RPW8.2 in grapevines not only significantly enhanced salicylic acid-dependent defense signaling, but also altered expression of other phytohormone-associated genes. Taken together, our results indicate that RPW8.2 could be utilized as a transgene for improving resistance against powdery mildew in grapevines. Copyright © 2017 Elsevier B.V. All rights reserved.

Genotypic response of detached leaves versus intact plants for chlorophyll fluorescence parameters under high temperature stress in wheat

DEFF Research Database (Denmark)

Sharma, Dew Kumari; Fernández, Juan Olivares; Rosenqvist, Eva

2014-01-01

The genotypic response of wheat cultivars as affected by two methods of heat stress treatment (treatment of intact plants in growth chambers versus treatment of detached leaves in test tubes) in a temperature controlled water bath were compared to investigate how such different methods of heat...... to high temperatures. Further, the results suggest that genetic factors associated with cultivar differences are different for the two methods of heat treatment........ The responses of the same cultivars to heat stress were compared between the two methods of heat treatment. The results showed that in detached leaves, all of the fluorescence parameters remained almost unaffected in control (20°C at all durations tested), indicating that the detachment itself did not affect...

Spatio-temporal effects of soil and bedrock variability on grapevine water status in hillslope vineyards.

Science.gov (United States)

Brillante, Luca; Bois, Benjamin; Mathieu, Olivier; Leveque, Jean

2014-05-01

Hillslope vineyards show various and complex water dynamics between soil and plants, and in order to gain further insight into this phenomenon, 8 grapevine plots were monitored during three vintages, from 2010 to 2013, on Corton Hill, Burgundy, France. Plots were distributed along a topolithosequence from 330 to 270 metres a.s.l. Grapevine water status was monitored weekly by surveying water potential, and, at the end of the season, by the use of the δ13C analysis of grape juice. Soil profile of each plot was described and analysed (soil texture, gravel content, organic carbon, total nitrogen, pH, CEC). Soil volumetric humidity was measured weekly, using TDR probes. A pedotransfer function was developed to transform Electrical Resistivity Imaging (ERI) into soil volume wetness and therefore to spatialise and observe variation in the Fraction of Transpirable Soil Water (FTSW). During the three years of monitoring, grapevines experienced great variation in water status, which ranged from low to considerable water deficit (as expressed by pre-dawn leaf water potential and δ13C analysis of grape juice). With ERI imaging, it was possible to observe differences in water absorption pattern by roots, in different soils, and at different depth. In addition, significant differences were observed in grapevine water status in relation to variations in the physical characteristics of the terroir along the hillslope (i.e. the geo-pedological context, the elevation etc.). Grapevine water behaviour and plant-soil water relationships on the hillslope of Corton Hill have been extensively characterised in this study by ultimate technologies, allowing to present this terroir as a very interesting example for future generalisation and modelling of the hillslope vineyard water dynamics.

Isolation and pathogenicity of Xylella fastidiosa from grapevine and almond in Iran

Directory of Open Access Journals (Sweden)

Naser AMANIFAR

2014-09-01

Full Text Available Symptoms similar to those of Pierce’s disease (PD of grapevine and leaf scorch of almond were observed in vineyards and almond orchards in several provinces of Iran. Grafting of scions from symptomatic almond trees onto seedlings of a local almond (cv. Mamaee under greenhouse conditions resulted in the transmission of the leaf scorch agent. A number of symptomatic samples from orchard and greenhouse plants were positive for presence of Xylella fastidiosa when tested by DAS-ELISA and PCR with X. fastidiosa specific antibodies and primers. A Gram-negative bacterium similar to X. fastidiosa was isolated on ‘periwinkle wilt’ (PW medium. Selected isolates induced symptoms similar to those caused by X. fastidiosa when inoculated on Nicotiana tabacum, seedlings of almond and grapevine under greenhouse conditions. DAS-ELISA and PCR confirmed the identity of the isolated bacteria. On the basis of disease symptoms, graft transmission, isolation on specific X. fastidiosa culture medium, pathogenicity tests and positive reactions in DAS-ELISA and PCR, X. fastidiosa is associated with almond leaf scorch and Pierce’s disease in grapevine in Iran. This is the first report on the presence of X. fastidiosa in the Middle East and western Asia.

Suppressing Sorbitol Synthesis Substantially Alters the Global Expression Profile of Stress Response Genes in Apple (Malus domestica) Leaves.

Science.gov (United States)

Wu, Ting; Wang, Yi; Zheng, Yi; Fei, Zhangjun; Dandekar, Abhaya M; Xu, Kenong; Han, Zhenhai; Cheng, Lailiang

2015-09-01

Sorbitol is a major product of photosynthesis in apple (Malus domestica) that is involved in carbohydrate metabolism and stress tolerance. However, little is known about how the global transcript levels in apple leaves respond to decreased sorbitol synthesis. In this study we used RNA sequencing (RNA-seq) profiling to characterize the transcriptome of leaves from transgenic lines of the apple cultivar 'Greensleeves' exhibiting suppressed expression of aldose-6-phosphate reductase (A6PR) to gain insights into sorbitol function and the consequences of decreased sorbitol synthesis on gene expression. We observed that, although the leaves of the low sorbitol transgenic lines accumulate higher levels of various primary metabolites, only very limited changes were found in the levels of transcripts associated with primary metabolism. We suggest that this is indicative of post-transcriptional and/or post-translational regulation of primary metabolite accumulation and central carbon metabolism. However, we identified significantly enriched gene ontology terms belonging to the 'stress related process' category in the antisense lines (P-value sorbitol plays a role in the responses of apple trees to abiotic and biotic stresses. © The Author 2015. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

ROOTSTOCK-SCION INTERACTION: 1. EFFECT ON THE YIELD COMPONENTS OF CABERNET SAUVIGNON GRAPEVINE

Directory of Open Access Journals (Sweden)

ALBERTO MIELE

Full Text Available ABSTRACT The interaction between rootstock, scion and environment can induce different responses to the grapevine physiology. Thus, the aim of this study was to determine the rootstock effect on the yield components of Cabernet Sauvignon (CS grapevine grown in the Serra Gaúcha viticultural region. The experimental design was completely randomized blocks, with 15 treatments, three replicates and ten vines per plot. The results show that all variables evaluated were significantly affected by the year and the rootstock. The CS/Solferino was among other combinations influenced by the year and had higher significant yield/ vine. Indeed, it was higher than that CS/Rupestris du Lot, CS/101-14 Mgt., CS/3309 C, CS/5BB K, CS/161- 49 C, CS/1103 P. and CS/Isabel. The number of clusters/bud, per burst bud and per vine and the weight of clusters were affected by the rootstock as well. Pruning weight/vine, yield/pruning weight, leaf area/vine, leaf area index and leaf area/fresh fruit weight are variables related to the physiology of grapevine which were also affected by the rootstock. In general, rootstocks had adapted well to the environment where the experiment was carried out, giving vigor and high yield to Cabernet Sauvignon grapevine, which means that they may be used by grape growers in this region. However, the choice of the right rootstock depends on various aspects, such as those related to the soil characteristics, climate conditions, grape varieties, and even clones, and production purposes.

Proteome analysis of muscadine grape leaves

Directory of Open Access Journals (Sweden)

Sheikh M Basha

2009-04-01

Full Text Available Sheikh M Basha1, Ramesh Katam1, Hemanth Vasanthaiah1, Frank Matta21Center for Viticulture and Small Fruit Research, Florida A and M University, Tallahassee, FL, USA; 2Plant and Soil Science Department, Mississippi State University, Mississippi State, MS, USAAbstract: Muscadine grapes are native to the southeastern United States and are used for making wine and consumed as fresh fruit. Grape berries, as ‘sink organs,’ rely on the use of available carbohydrate resources produced by photosynthesis to support their development and composition. A high throughput two-dimensional gel electrophoresis (2-DE was conducted on muscadine (Vitis rotundifolia grape leaf proteins to document complexity in their composition and to determine protein identity and function for enhancing photosynthetic efficiency of muscadine grape. 2-DE resolved muscadine leaf proteins into >258 polypeptides with pIs between 3.5 and 8.0 and molecular weight between 12,000 to 15,0000 Daltons. The consistently expressed proteins were excised and subjected to sequencing. Homology search of protein sequences showed 84% identity with Viridi plantae database. Identity of some of these proteins included RuBisCO, glutamine synthetase, pathogenesis-related protein, glyoxisomal malate dehydrogenase, ribonucleoprotein, chloroplast precursor, oxygen evolving enhancer protein. Comparative analysis of 10 muscadine cultivars showed quantitative differences in expression of 39 polypeptides among these genotypes. The results suggested that the polypeptide composition of muscadine grape leaf is complex, and polypeptide number and amount vary widely among muscadine genotypes, and these variations may be responsible for differences in their physiology, berry and stress tolerance characteristics.Keywords: grapevine, leaves, muscadine, proteins, sequencing, 2-DE

Omics Approaches for Understanding Grapevine Berry Development: Regulatory Networks Associated with Endogenous Processes and Environmental Responses

Directory of Open Access Journals (Sweden)

Alejandra Serrano

2017-09-01

Full Text Available Grapevine fruit development is a dynamic process that can be divided into three stages: formation (I, lag (II, and ripening (III, in which physiological and biochemical changes occur, leading to cell differentiation and accumulation of different solutes. These stages can be positively or negatively affected by multiple environmental factors. During the last decade, efforts have been made to understand berry development from a global perspective. Special attention has been paid to transcriptional and metabolic networks associated with the control of grape berry development, and how external factors affect the ripening process. In this review, we focus on the integration of global approaches, including proteomics, metabolomics, and especially transcriptomics, to understand grape berry development. Several aspects will be considered, including seed development and the production of seedless fruits; veraison, at which anthocyanin accumulation begins in the berry skin of colored varieties; and hormonal regulation of berry development and signaling throughout ripening, focusing on the transcriptional regulation of hormone receptors, protein kinases, and genes related to secondary messenger sensing. Finally, berry responses to different environmental factors, including abiotic (temperature, water-related stress and UV-B radiation and biotic (fungi and viruses stresses, and how they can significantly modify both, development and composition of vine fruit, will be discussed. Until now, advances have been made due to the application of Omics tools at different molecular levels. However, the potential of these technologies should not be limited to the study of single-level questions; instead, data obtained by these platforms should be integrated to unravel the molecular aspects of grapevine development. Therefore, the current challenge is the generation of new tools that integrate large-scale data to assess new questions in this field, and to support

Evaluation of pollen dispersal and cross pollination using transgenic grapevine plants.

Science.gov (United States)

Harst, Margit; Cobanov, Beatrix-Axinja; Hausmann, Ludger; Eibach, Rudolf; Töpfer, Reinhard

2009-01-01

Public debate about the possible risk of genetically modified plants often concerns putative effects of pollen dispersal and out-crossing into conventional fields in the neighborhood of transgenic plants. Though Vitis vinifera (grapevine) is generally considered to be self-pollinating, it cannot be excluded that vertical gene transfer might occur. For monitoring pollen flow and out-crossing events, transgenic plants of Vitis vinifera cv. 'Dornfelder' harboring the gus-int gene were planted in the center of a field experiment in Southwest Germany in 1999. The rate of pollen dispersal was determined by pollen traps placed at radial distances of 5-150 m from the pollen-donor plants, at 1.00 and 1.80 m above ground. Transgenic pollen was evaluated by GUS staining, and could clearly be distinguished from pollen originating from non-transgenic grapevine plants. Transgenic pollen was observed up to 150 m from the pollen donors. The rate of out-crossing was determined by sampling seeds of selected grapevines at a distance of 10 m to the pollen source, and of a sector at 20 m distance, respectively, followed by GUS analysis of seedlings. The average cross-pollination rate during the experiment (2002-2004) was 2.7% at a distance of 20 m. The results of this first pilot study present a good base for further assessment under the conditions of normal viticulture practice.

Climate change (elevated CO{sub 2}, elevated temperature and moderate drought) triggers the antioxidant enzymes' response of grapevine cv. Tempranillo, avoiding oxidative damage

Energy Technology Data Exchange (ETDEWEB)

Salazar-Parra, C.; Aguirreolea, J.; Sanchez-Diaz, M.; Irigoyen, J.J.; Morales, F. (Departamento de Biologia Vegetal, Seccion Biologia Vegetal (Unidad Asociada al CSIC, EEAD, Zaragoza e ICVV, Logrono), Facultades de Ciencias y Farmacia, Universidad de Navarra, Pamplona (Spain))

2012-07-01

Photosynthetic carbon fixation (A{sub N}) and photosynthetic electron transport rate (ETR) are affected by different environmental stress factors, such as those associated with climate change. Under stress conditions, it can be generated an electron excess that cannot be consumed, which can react with O{sub 2}, producing reactive oxygen species. This work was aimed to evaluate the influence of climate change (elevated CO{sub 2}, elevated temperature and moderate drought) on the antioxidant status of grapevine (Vitis vinifera) cv. Tempranillo leaves, from veraison to ripeness. The lowest ratios between electrons generated (ETR) and consumed (A{sub N} + respiration + photorespiration) were observed in plants treated with elevated CO{sub 2} and elevated temperature. In partially irrigated plants under current ambient conditions, electrons not consumed seemed to be diverted to alternative ways. Oxidative damage to chlorophylls and carotenoids was not observed. However, these plants had increases in thiobarbituric acid reacting substances, an indication of lipid peroxidation. These increases matched well with an early rise of H{sub 2}O{sub 2} and antioxidant enzyme activities, superoxide dismutase (EC 1.15.1.1), ascorbate peroxidase (EC 1.11.1.11) and catalase (EC 1.11.1.6). Enzymatic activities were maintained high until ripeness. In conclusion, plants grown under current ambient conditions and moderate drought were less efficient to cope with oxidative damage than well-irrigated plants, and more interestingly, plants grown under moderate drought but treated with elevated CO{sub 2} and elevated temperature were not affected by oxidative damage, mainly because of higher rates of electrons consumed in photosynthetic carbon fixation. (Author)

Exogenous calcium alleviates low night temperature stress on the photosynthetic apparatus of tomato leaves.

Directory of Open Access Journals (Sweden)

Guoxian Zhang

Full Text Available The effect of exogenous CaCl2 on photosystem I and II (PSI and PSII activities, cyclic electron flow (CEF, and proton motive force of tomato leaves under low night temperature (LNT was investigated. LNT stress decreased the net photosynthetic rate (Pn, effective quantum yield of PSII [Y(II], and photochemical quenching (qP, whereas CaCl2 pretreatment improved Pn, Y(II, and qP under LNT stress. LNT stress significantly increased the non-regulatory quantum yield of energy dissipation [Y(NO], whereas CaCl2 alleviated this increase. Exogenous Ca2+ enhanced stimulation of CEF by LNT stress. Inhibition of oxidized PQ pools caused by LNT stress was alleviated by CaCl2 pretreatment. LNT stress reduced zeaxanthin formation and ATPase activity, but CaCl2 pretreatment reversed both of these effects. LNT stress caused excess formation of a proton gradient across the thylakoid membrane, whereas CaCl2 pretreatment decreased the said factor under LNT. Thus, our results showed that photoinhibition of LNT-stressed plants could be alleviated by CaCl2 pretreatment. Our findings further revealed that this alleviation was mediated in part by improvements in carbon fixation capacity, PQ pools, linear and cyclic electron transports, xanthophyll cycles, and ATPase activity.

Abscisic acid biosynthesis in leaves and roots of Xanthium strumarium

International Nuclear Information System (INIS)

Creelman, R.A.; Gage, D.A.; Stults, J.T.; Zeevaart, J.A.D.

1987-01-01

Research on the biosynthesis of abscisic acid (ABA) has focused primarily on two pathways: (a) the direct pathway from farnesyl pyrophosphate, and (b) the indirect pathway involving a carotenoid precursor. The authors have investigated which biosynthetic pathway is operating in turgid and stressed Xanthium leaves, and in stressed Xanthium roots using long-term incubations in 18 O 2 . It was found that in stressed leaves three atoms of 18 O from 18 O 2 are incorporated into the ABA molecule, and that the amount of 18 O incorporated increases with time. One 18 O atom is incorporated rapidly into the carboxyl group of ABA, whereas the other two atoms are very slowly incorporated into the ring oxygens. The fourth oxygen atom in the carboxyl group of ABA is derived from water. ABA from stressed roots of Xanthium incubated in 18 O 2 shows a labeling pattern similar to that of ABA in stressed leaves, but with incorporation of more 18 O into the tertiary hydroxyl group at C-1' after 6 and 12 hours than found in ABA from stressed leaves. It is proposed that the precursors to stress-induced ABA are xanthophylls, and that a xanthophyll lacking an oxygen function at C-6 plays a crucial role in ABA biosynthesis in Xanthium roots. In turgid Xanthium leaves, 18 O is incorporated into ABA to a much lesser extent that it is in stressed leaves, whereas exogenously applied 14 C-ABA is completely catabolized within 48 hours. This suggests that ABA in turgid leaves is either (a) made via a biosynthetic pathway which is different from the one in stressed leaves, or (b) has a half-life on the order of days as compared with a half-life of 15.5 hours in water-stressed Xanthium leaves. Phaseic acid showed a labeling pattern similar to that of ABA, but with an additional 18 O incorporated during 8'-hydroxylation of ABA to phaseic acid

Abscisic Acid Biosynthesis in Leaves and Roots of Xanthium strumarium.

Science.gov (United States)

Creelman, R A; Gage, D A; Stults, J T; Zeevaart, J A

1987-11-01

RESEARCH ON THE BIOSYNTHESIS OF ABSCISIC ACID (ABA) HAS FOCUSED PRIMARILY ON TWO PATHWAYS: (a) the direct pathway from farnesyl pyrophosphate, and (b) the indirect pathway involving a carotenoid precursor. We have investigated which biosynthetic pathway is operating in turgid and stressed Xanthium leaves, and in stressed Xanthium roots using long-term incubations in (18)O(2). It was found that in stressed leaves three atoms of (18)O from (18)O(2) are incorporated into the ABA molecule, and that the amount of (18)O incorporated increases with time. One (18)O atom is incorporated rapidly into the carboxyl group of ABA, whereas the other two atoms are very slowly incorporated into the ring oxygens. The fourth oxygen atom in the carboxyl group of ABA is derived from water. ABA from stressed roots of Xanthium incubated in (18)O(2) shows a labeling pattern similar to that of ABA in stressed leaves, but with incorporation of more (18)O into the tertiary hydroxyl group at C-1' after 6 and 12 hours than found in ABA from stressed leaves. It is proposed that the precursors to stress-induced ABA are xanthophylls, and that a xanthophyll lacking an oxygen function at C-6 (carotenoid numbering scheme) plays a crucial role in ABA biosynthesis in Xanthium roots. In turgid Xanthium leaves, (18)O is incorporated into ABA to a much lesser extent than it is in stressed leaves, whereas exogenously applied (14)C-ABA is completely catabolized within 48 hours. This suggests that ABA in turgid leaves is either (a) made via a biosynthetic pathway which is different from the one in stressed leaves, or (b) has a half-life on the order of days as compared with a half-life of 15.5 hours in water-stressed Xanthium leaves. Phaseic acid showed a labeling pattern similar to that of ABA, but with an additional (18)O incorporated during 8'-hydroxylation of ABA to phaseic acid.

Abscisic acid biosynthesis in leaves and roots of Xanthium strumarium

Energy Technology Data Exchange (ETDEWEB)

Creelman, R.A.; Gage, D.A.; Stults, J.T.; Zeevaart, J.A.D.

1987-11-01

Research on the biosynthesis of abscisic acid (ABA) has focused primarily on two pathways: (a) the direct pathway from farnesyl pyrophosphate, and (b) the indirect pathway involving a carotenoid precursor. The authors have investigated which biosynthetic pathway is operating in turgid and stressed Xanthium leaves, and in stressed Xanthium roots using long-term incubations in /sup 18/O/sub 2/. It was found that in stressed leaves three atoms of /sup 18/O from /sup 18/O/sub 2/ are incorporated into the ABA molecule, and that the amount of /sup 18/O incorporated increases with time. One /sup 18/O atom is incorporated rapidly into the carboxyl group of ABA, whereas the other two atoms are very slowly incorporated into the ring oxygens. The fourth oxygen atom in the carboxyl group of ABA is derived from water. ABA from stressed roots of Xanthium incubated in /sup 18/O/sub 2/ shows a labeling pattern similar to that of ABA in stressed leaves, but with incorporation of more /sup 18/O into the tertiary hydroxyl group at C-1' after 6 and 12 hours than found in ABA from stressed leaves. It is proposed that the precursors to stress-induced ABA are xanthophylls, and that a xanthophyll lacking an oxygen function at C-6 plays a crucial role in ABA biosynthesis in Xanthium roots. In turgid Xanthium leaves, /sup 18/O is incorporated into ABA to a much lesser extent that it is in stressed leaves, whereas exogenously applied /sup 14/C-ABA is completely catabolized within 48 hours. This suggests that ABA in turgid leaves is either (a) made via a biosynthetic pathway which is different from the one in stressed leaves, or (b) has a half-life on the order of days as compared with a half-life of 15.5 hours in water-stressed Xanthium leaves. Phaseic acid showed a labeling pattern similar to that of ABA, but with an additional /sup 18/O incorporated during 8'-hydroxylation of ABA to phaseic acid.

Oxidative stress responses induced by uranium exposure at low pH in leaves of Arabidopsis thaliana plants

International Nuclear Information System (INIS)

Saenen, Eline; Horemans, Nele; Vanhoudt, Nathalie; Vandenhove, Hildegarde; Biermans, Geert; Hees, May van; Wannijn, Jean; Vangronsveld, Jaco; Cuypers, Ann

2015-01-01

Anthropogenic activities have led to a widespread uranium (U) contamination in many countries. The toxic effects of U at the cellular level have mainly been investigated at a pH around 5.5, the optimal pH for hydroponically grown plants. However, since the speciation of U, and hence its toxicity, is strongly dependent on environmental factors such as the pH, it is important to investigate the effects of U at different environmentally relevant pH levels. Although U is poorly translocated from the roots to the shoots, resulting in a low U concentration in the leaves, it has been demonstrated that toxic effects in the leaves were already visible after 1 day exposure at pH 5.5, although only when exposed to relatively high U concentrations (100 μM). Therefore, the present study aimed to analyse the effects of different U concentrations (ranging from 0 to 100 μM) at pH 4.5 in leaves of Arabidopsis thaliana plants. Results indicate that U induces early senescence in A. thaliana leaves as was suggested by a decreased expression of CAT2 accompanied by an induction of CAT3 expression, a decreased CAT capacity and an increased lipid peroxidation. In addition, miRNA398b/c is involved in the regulation of the SOD response in the leaves. As such, an increased MIR398b/c expression was observed leading to a decreased transcript level of CSD1/2. Finally, the biosynthesis of ascorbate was induced after U exposure. This can point towards an important role for this metabolite in the scavenging of reactive oxygen species under U stress. - Highlights: • Uranium induces early senescence in A. thaliana after uranium exposure. • Ascorbate is involved in scavenging reactive oxygen species under uranium stress. • miRNA398b/c is involved in the regulation of the SOD response under uranium stress.

iTRAQ-based quantitative proteomic analysis reveals proteomic changes in leaves of cultivated tobacco (Nicotiana tabacum) in response to drought stress.

Science.gov (United States)

Xie, He; Yang, Da-Hai; Yao, Heng; Bai, Ge; Zhang, Yi-Han; Xiao, Bing-Guang

2016-01-15

Drought is one of the most severe forms of abiotic stresses that threaten the survival of plants, including crops. In turn, plants dramatically change their physiology to increase drought tolerance, including reconfiguration of proteomes. Here, we studied drought-induced proteomic changes in leaves of cultivated tobacco (Nicotiana tabacum), a solanaceous plant, using the isobaric tags for relative and absolute quantitation (iTRAQ)-based protein labeling technology. Of identified 5570 proteins totally, drought treatment increased and decreased abundance of 260 and 206 proteins, respectively, compared with control condition. Most of these differentially regulated proteins are involved in photosynthesis, metabolism, and stress and defense. Although abscisic acid (ABA) levels greatly increased in drought-treated tobacco leaves, abundance of detected ABA biosynthetic enzymes showed no obvious changes. In contrast, heat shock proteins (HSPs), thioredoxins, ascorbate-, glutathione-, and hydrogen peroxide (H2O2)-related proteins were up- or down-regulated in drought-treated tobacco leaves, suggesting that chaperones and redox signaling are important for tobacco tolerance to drought, and it is likely that redox-induced posttranslational modifications play an important role in modulating protein activity. This study not only provides a comprehensive dataset on overall protein changes in drought-treated tobacco leaves, but also shed light on the mechanism by which solanaceous plants adapt to drought stress. Copyright © 2015 Yunnan Academy of Tobacco Agricultural Sciences. Published by Elsevier Inc. All rights reserved.

Phytotoxins Produced by Fungi Associated with Grapevine Trunk Diseases

Science.gov (United States)

Andolfi, Anna; Mugnai, Laura; Luque, Jordi; Surico, Giuseppe; Cimmino, Alessio; Evidente, Antonio

2011-01-01

Up to 60 species of fungi in the Botryosphaeriaceae family, genera Cadophora, Cryptovalsa, Cylindrocarpon, Diatrype, Diatrypella, Eutypa, Eutypella, Fomitiporella, Fomitiporia, Inocutis, Phaeoacremonium and Phaeomoniella have been isolated from decline-affected grapevines all around the World. The main grapevine trunk diseases of mature vines are Eutypa dieback, the esca complex and cankers caused by the Botryospheriaceae, while in young vines the main diseases are Petri and black foot diseases. To understand the mechanism of these decline-associated diseases and the symptoms associated with them, the toxins produced by the pathogens involved in these diseases were isolated and characterised chemically and biologically. So far the toxins of only a small number of these decline fungi have been studied. This paper presents an overview of the toxins produced by the most serious of these vine wood pathogens: Eutypa lata, Phaeomoniella chlamydospora, Phaeoacremonium aleophilum and some taxa in the Botryosphaeriaceae family, and examines how these toxins produce decline symptoms. The chemical structure of these metabolites and in some cases their vivotoxin nature are also discussed. PMID:22295177

Phytotoxins Produced by Fungi Associated with Grapevine Trunk Diseases

Directory of Open Access Journals (Sweden)

Antonio Evidente

2011-12-01

Full Text Available Up to 60 species of fungi in the Botryosphaeriaceae family, genera Cadophora, Cryptovalsa, Cylindrocarpon, Diatrype, Diatrypella, Eutypa, Eutypella, Fomitiporella, Fomitiporia, Inocutis, Phaeoacremonium and Phaeomoniella have been isolated from decline-affected grapevines all around the World. The main grapevine trunk diseases of mature vines are Eutypa dieback, the esca complex and cankers caused by the Botryospheriaceae, while in young vines the main diseases are Petri and black foot diseases. To understand the mechanism of these decline-associated diseases and the symptoms associated with them, the toxins produced by the pathogens involved in these diseases were isolated and characterised chemically and biologically. So far the toxins of only a small number of these decline fungi have been studied. This paper presents an overview of the toxins produced by the most serious of these vine wood pathogens: Eutypa lata, Phaeomoniella chlamydospora, Phaeoacremonium aleophilum and some taxa in the Botryosphaeriaceae family, and examines how these toxins produce decline symptoms. The chemical structure of these metabolites and in some cases their vivotoxin nature are also discussed.

Physical mapping in highly heterozygous genomes: a physical contig map of the Pinot Noir grapevine cultivar

Directory of Open Access Journals (Sweden)

Jurman Irena

2010-03-01

Full Text Available Abstract Background Most of the grapevine (Vitis vinifera L. cultivars grown today are those selected centuries ago, even though grapevine is one of the most important fruit crops in the world. Grapevine has therefore not benefited from the advances in modern plant breeding nor more recently from those in molecular genetics and genomics: genes controlling important agronomic traits are practically unknown. A physical map is essential to positionally clone such genes and instrumental in a genome sequencing project. Results We report on the first whole genome physical map of grapevine built using high information content fingerprinting of 49,104 BAC clones from the cultivar Pinot Noir. Pinot Noir, as most grape varieties, is highly heterozygous at the sequence level. This resulted in the two allelic haplotypes sometimes assembling into separate contigs that had to be accommodated in the map framework or in local expansions of contig maps. We performed computer simulations to assess the effects of increasing levels of sequence heterozygosity on BAC fingerprint assembly and showed that the experimental assembly results are in full agreement with the theoretical expectations, given the heterozygosity levels reported for grape. The map is anchored to a dense linkage map consisting of 994 markers. 436 contigs are anchored to the genetic map, covering 342 of the 475 Mb that make up the grape haploid genome. Conclusions We have developed a resource that makes it possible to access the grapevine genome, opening the way to a new era both in grape genetics and breeding and in wine making. The effects of heterozygosity on the assembly have been analyzed and characterized by using several complementary approaches which could be easily transferred to the study of other genomes which present the same features.

Identification of a novel vitivirus from grapevines in New Zealand.

Science.gov (United States)

Blouin, Arnaud G; Keenan, Sandi; Napier, Kathryn R; Barrero, Roberto A; MacDiarmid, Robin M

2018-01-01

We report a sequence of a novel vitivirus from Vitis vinifera obtained using two high-throughput sequencing (HTS) strategies on RNA. The initial discovery from small-RNA sequencing was confirmed by HTS of the total RNA and Sanger sequencing. The new virus has a genome structure similar to the one reported for other vitiviruses, with five open reading frames (ORFs) coding for the conserved domains described for members of that genus. Phylogenetic analysis of the complete genome sequence confirmed its affiliation to the genus Vitivirus, with the closest described viruses being grapevine virus E (GVE) and Agave tequilana leaf virus (ATLV). However, the virus we report is distinct and shares only 51% amino acid sequence identity with GVE in the replicase polyprotein and 66.8% amino acid sequence identity with ATLV in the coat protein. This is well below the threshold determined by the ICTV for species demarcation, and we propose that this virus represents a new species. It is provisionally named "grapevine virus G".

Comparison of RNA Extraction Methods for the Identification of Grapevine fan leaf virus

Directory of Open Access Journals (Sweden)

Z. Gholampour

2016-06-01

Full Text Available Introduction: To now, more than 70 viral diseases have been reported from grapevine. Serological methods are regular diagnostic tools of grapevine viruses, however, their sensitivity has affected by seasonal fluctuations of the virus. Reverse transcription polymerase chain reaction provides significant improvement in detection of grapevine viruses. Extraction of high-quality RNA is essential for the successful application of many molecular techniques, such as RT-PCR. Extraction of high-quality RNA from the leaves of woody plants, such as grapevine, is particularly challenging because of high concentrations of polysaccharides, polyphenols, and other secondary metabolites. Some RNA extraction methods yield pellets that are poorly soluble, indicating the presence of unknown contaminants, whereas others are gelatinous, indicating the presence of polysaccharides. RNA can make complexes with polysaccharides and phenolic compounds render the RNA unusable for applications such as reverse transcription. Grapevine fanleaf virus is a member of the genus Nepovirus in the family Secoviridae. The GFLV genome consists of two positive-sense single stranded RNAs. The genome has a poly (A tail at the 3´ terminus and a covalently linked VPG protein at the 5´ terminus. Several extraction methods had been reported to be used for identification of GFLV in grapevine. Some of them require harmful chemical material; disadvantages of other are high costs. Immunocapture-RT-PCR requires preparation of specific antibody and direct binding RT-PCR (DB-RT-PCR has a high contamination risk. In this study, four RNA extraction protocols were compared with a commercial isolation kit to explore the most efficient RNA isolation method for grapevines. Material and Methods: 40 leaf samples were randomly collected during the growing season of 2011-2012. GFLV was detected in leaf samples by enzyme linked immunosorbent assay (ELISA Using specific antibodies raised against Iranian

Coping, Stress, and Job Satisfaction as Predictors of Advanced Placement Statistics Teachers' Intention to Leave the Field

Science.gov (United States)

McCarthy, Christopher J.; Lambert, Richard G.; Crowe, Elizabeth W.; McCarthy, Colleen J.

2010-01-01

This study examined the relationship of teachers' perceptions of coping resources and demands to job satisfaction factors. Participants were 158 Advanced Placement Statistics high school teachers who completed measures of personal resources for stress prevention, classroom demands and resources, job satisfaction, and intention to leave the field…

Dual mechanisms regulating glutamate decarboxylases and accumulation of gamma-aminobutyric acid in tea (Camellia sinensis) leaves exposed to multiple stresses.

Science.gov (United States)

Mei, Xin; Chen, Yiyong; Zhang, Lingyun; Fu, Xiumin; Wei, Qing; Grierson, Don; Zhou, Ying; Huang, Yahui; Dong, Fang; Yang, Ziyin

2016-03-29

γ-Aminobutyric acid (GABA) is one of the major inhibitory neurotransmitters in the central nervous system. It has multiple positive effects on mammalian physiology and is an important bioactive component of tea (Camellia sinensis). GABA generally occurs at a very low level in plants but GABA content increases substantially after exposure to a range of stresses, especially oxygen-deficiency. During processing of tea leaves, a combination of anoxic stress and mechanical damage are essential for the high accumulation of GABA. This is believed to be initiated by a change in glutamate decarboxylase activity, but the underlying mechanisms are unclear. In the present study we characterized factors regulating the expression and activity of three tea glutamate decarboxylase genes (CsGAD1, 2, and 3), and their encoded enzymes. The results suggests that, unlike the model plant Arabidopsis thaliana, there are dual mechanisms regulating the accumulation of GABA in tea leaves exposed to multiple stresses, including activation of CsGAD1 enzymatic activity by calmodulin upon the onset of the stress and accumulation of high levels of CsGAD2 mRNA induced by a combination of anoxic stress and mechanical damage.

Vegetative, productive and qualitative performance of grapevine "Cabernet Sauvignon" according to the use of winter cover crops

OpenAIRE

Bettoni, Jean Carlos; Feldberg, Nelson Pires; Nava, Gilberto; Veiga, Milton da; Wildner, Leandro do Prado

2016-01-01

ABSTRACT To study the effect of winter cover crops on the vegetative, productive and qualitative behavior of "Cabernet Sauvignon" grapevines, an experiment was conducted in two wine harvests by sowing different species of winter cover crops and additional treatments with manual weeding and mechanical mowing in an experimental vineyard located at the Experimental Station of Epagri in Videira, state of Santa Catarina, Brazil. Plant attributes of the grapevine, such as number of rods and weight ...

Abscisic Acid Biosynthesis in Leaves and Roots of Xanthium strumarium1

Science.gov (United States)

Creelman, Robert A.; Gage, Douglas A.; Stults, John T.; Zeevaart, Jan A. D.

1987-01-01

Research on the biosynthesis of abscisic acid (ABA) has focused primarily on two pathways: (a) the direct pathway from farnesyl pyrophosphate, and (b) the indirect pathway involving a carotenoid precursor. We have investigated which biosynthetic pathway is operating in turgid and stressed Xanthium leaves, and in stressed Xanthium roots using long-term incubations in 18O2. It was found that in stressed leaves three atoms of 18O from 18O2 are incorporated into the ABA molecule, and that the amount of 18O incorporated increases with time. One 18O atom is incorporated rapidly into the carboxyl group of ABA, whereas the other two atoms are very slowly incorporated into the ring oxygens. The fourth oxygen atom in the carboxyl group of ABA is derived from water. ABA from stressed roots of Xanthium incubated in 18O2 shows a labeling pattern similar to that of ABA in stressed leaves, but with incorporation of more 18O into the tertiary hydroxyl group at C-1′ after 6 and 12 hours than found in ABA from stressed leaves. It is proposed that the precursors to stress-induced ABA are xanthophylls, and that a xanthophyll lacking an oxygen function at C-6 (carotenoid numbering scheme) plays a crucial role in ABA biosynthesis in Xanthium roots. In turgid Xanthium leaves, 18O is incorporated into ABA to a much lesser extent than it is in stressed leaves, whereas exogenously applied 14C-ABA is completely catabolized within 48 hours. This suggests that ABA in turgid leaves is either (a) made via a biosynthetic pathway which is different from the one in stressed leaves, or (b) has a half-life on the order of days as compared with a half-life of 15.5 hours in water-stressed Xanthium leaves. Phaseic acid showed a labeling pattern similar to that of ABA, but with an additional 18O incorporated during 8′-hydroxylation of ABA to phaseic acid. PMID:16665768

VvWRKY13 enhances ABA biosynthesis in Vitis vinifera

Directory of Open Access Journals (Sweden)

JIe Hao

2017-06-01

Full Text Available Abscisic acid (ABA plays critical roles in plant growth and development as well as in plants’ responses to abiotic stresses. We previously isolated VvWRKY13, a novel transcription factor, from Vitis vinifera (grapevine, and here we present evidence that VvWRKY13 may regulate ABA biosynthesis in plants. When VvWRKY13 was ectopically expressed in Arabidopsis, the transgenic lines showed delayed seed germination, smaller stomatal aperture size, and several other phenotypic changes, indicating elevated ABA levels in these plants. Sequence analysis of several genes that are involved in grapevine ABA synthetic pathway identified WRKY-specific binding elements (W-box or W-like box in the promoter regions. Indeed, transient overexpression of VvWRKY13 in grapevine leaves significantly increased the transcript levels of ABA synthetic pathway genes. Taken together, we conclude that VvWRKY13 may promote ABA production by activating genes in the ABA synthetic pathway.

Poly(lactic-co-glycolic) acid nanoparticles uptake by Vitis vinifera and grapevine-pathogenic fungi

International Nuclear Information System (INIS)

Valletta, Alessio; Chronopoulou, Laura; Palocci, Cleofe; Baldan, Barbara; Donati, Livia; Pasqua, Gabriella

2014-01-01

Poly(lactic-co-glycolic) acid (PLGA)-based NPs are currently considered among the most promising drug carriers, nevertheless their use in plants has never been investigated. In this work, for the first time, we demonstrated the ability of PLGA NPs to cross the plant cell wall and membrane of Vitis vinifera cell cultures and grapevine-pathogenic fungi. By means of fluorescence microscopy, we established that PLGA NPs can enter in grapevine leaf tissues through stomata openings and that they can be absorbed by the roots and transported to the shoot through vascular tissues. TEM analysis on cultured cells showed that NPs ≤ 50 nm could enter cells, while bigger ones remained attached to the cell wall. Viability tests demonstrated that PLGA NPs were not cytotoxic for V. vinifera-cultured cells. The cellular uptake of PLGA NPs by some important grapevine-pathogenic fungi has also been observed, thus suggesting that PLGA NPs could be used to deliver antifungal compounds within fungal cells. Overall the results reported suggest that such NPs may play a key role in future developments of agrobiotechnologies, as it is currently happening in biomedicine

Poly(lactic-co-glycolic) acid nanoparticles uptake by Vitis vinifera and grapevine-pathogenic fungi

Energy Technology Data Exchange (ETDEWEB)

Valletta, Alessio [“Sapienza” University of Rome, Department of Environmental Biology (Italy); Chronopoulou, Laura; Palocci, Cleofe, E-mail: cleofe.palocci@uniroma1.it [“Sapienza” University of Rome, Department of Chemistry (Italy); Baldan, Barbara [University of Padua, Department of Biology (Italy); Donati, Livia; Pasqua, Gabriella [“Sapienza” University of Rome, Department of Environmental Biology (Italy)

2014-12-15

Poly(lactic-co-glycolic) acid (PLGA)-based NPs are currently considered among the most promising drug carriers, nevertheless their use in plants has never been investigated. In this work, for the first time, we demonstrated the ability of PLGA NPs to cross the plant cell wall and membrane of Vitis vinifera cell cultures and grapevine-pathogenic fungi. By means of fluorescence microscopy, we established that PLGA NPs can enter in grapevine leaf tissues through stomata openings and that they can be absorbed by the roots and transported to the shoot through vascular tissues. TEM analysis on cultured cells showed that NPs ≤ 50 nm could enter cells, while bigger ones remained attached to the cell wall. Viability tests demonstrated that PLGA NPs were not cytotoxic for V. vinifera-cultured cells. The cellular uptake of PLGA NPs by some important grapevine-pathogenic fungi has also been observed, thus suggesting that PLGA NPs could be used to deliver antifungal compounds within fungal cells. Overall the results reported suggest that such NPs may play a key role in future developments of agrobiotechnologies, as it is currently happening in biomedicine.

Movement of Water from Old to Young Leaves in Three Species of Succulents

Science.gov (United States)

RABAS, A. R.; MARTIN, C. E.

2003-01-01

A hypothetical adaptive response of succulent plants to drought‐stress is the redistribution of water from old to young leaves. We examined the effects of possible movement of water from old to young leaves in three succulent species, Carpobrotus edulis (weak CAM‐inducible), Kalanchoe tubiflora (CAM) and Sedum spectabile (possibly a CAM‐cycler or CAM‐inducible). Old leaves were removed from plants, and photosynthesis, transpiration, f. wt : d. wt ratios, diurnal acid fluctuations, stomatal conductance and internal CO2 concentrations of the remaining young leaves were measured during drought‐stress. Comparison was made with plants retaining old leaves. There was no evidence that water moved from old to young leaves during drought‐stress as previously hypothesized. Only in drought‐stressed plants of K. tubiflora, were photosynthetic and transpiration rates of young leaves greater on shoots with old leaves removed compared with attached. There was a trend in all species for greater fluctuations in acidity in young leaves on shoots that lacked older leaves. For two of the three species studied, the f. wt : d. wt ratios of young leaves were greater under drought‐stress, on shoots with old leaves removed than with them attached. Absence of old leaves may reduce competition for water with young leaves, which consequently have higher water content and greater photosynthetic rates. PMID:12907468

Protective effects of polysaccharides from Psidium guajava leaves against oxidative stresses.

Science.gov (United States)

Kim, Seo-Young; Kim, Eun-A; Kim, Young-Sun; Yu, Seok-Kyu; Choi, Changyong; Lee, Jung-Suk; Kim, Yong-Tae; Nah, Jae-Woon; Jeon, You-Jin

2016-10-01

The aim of this study was to analyze antioxidant properties of a polysaccharide isolated from Psidium guajava leaves (PS-PGL) in vitro including its radical scavenging activities and protective effects against damage to cells as well as in vivo in zebrafish. The water extract of P. guajava leaves (WE-PGL) and PS-PGL showed strong radical scavenging effects in terms of 2,2-diphenyl-1-picrylhydrazyl (DPPH), hydroxyl, and alkyl radical. Compared to WE-PGL, PS-PGL enhanced all scavenging activities and in particular strongly scavenged the hydroxyl radical (50% inhibitory concentration [IC50], 0.02mg/mL). In addition, PS-PGL exerted a protective effect against hydrogen peroxide-induced oxidative stress and against toxicity to Vero cells. Furthermore, in vivo experiments using zebrafish embryos indicated that treatment with hydrogen peroxide decreased the survival rate and heart-beating rate of zebrafish embryos, whereas these problems were reduced by PS-PGL treatment. Moreover, PS-PGL inhibited hydrogen peroxide-induced reactive oxygen species (ROS) production, lipid peroxidation, and cell death. Taken together, these results suggest that PS-PGL may be useful as a beneficial antioxidant material in the food and cosmetic industries. Copyright © 2016 Elsevier B.V. All rights reserved.

Development of degenerate and species-specific primers for the differential and simultaneous RT-PCR detection of grapevine-infecting nepoviruses of subgroups A, B and C.

Science.gov (United States)

Digiaro, Michele; Elbeaino, Toufic; Martelli, Giovanni Paolo

2007-04-01

Based on the nucleotide sequence homology of RNA-1 and RNA-2 of nepoviruses isolated from grapevines, three sets of degenerate primers, one for each of the three subgroups of the genus (A, B and C), were designed and proved effective for RT-PCR detection of subgroups in infected grapevines and herbaceous hosts. Primers designed specifically for detecting subgroup A species amplified a fragment of 255 bp from samples infected by Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Tobacco ringspot virus (TRSV) and Grapevine deformation virus (GDefV), but not from samples infected by other nepovirus species. Similarly, primers for detection of subgroup B nepoviruses amplified a 390 bp product from samples infected by Grapevine chrome mosaic virus (GCMV), Tomato black ring virus (TBRV), Grapevine Anatolian ringspot virus (GARSV) and Artichoke Italian latent virus (AILV). The third set of primers amplified a 640 bp fragment, only from samples infected by subgroup C nepoviruses, i.e Tomato ringspot virus (ToRSV) Grapevine Bulgarian latent virus (GBLV), and Grapevine Tunisian ringspot virus (GTRSV). These primers were able to detect simultaneously all viral species belonging to the same subgroup and to discriminate species of different subgroups. Multiplex-PCR detection of subgroup A and B nepoviruses was obtained using a specific primer (sense for subgroup A and antisense for subgroup B) for each of the species of the same subgroup in combination with the degenerate subgroup-specific primers. In this way it was possible to detect four different viral species in single samples containing mixtures of viruses of the same subgroup. In particular, for viruses of subgroup A (TRSV, GFLV, ArMV and GDefV) amplicons of 190, 259, 301 and 371 bp were obtained, whereas amplicons of 190, 278, 425 and 485 bp, respectively, were obtained from samples infected with viruses of subgroup B (GCMV, AILV, GARSV and TBRV).

Comparative proteomic analysis of soybean leaves and roots by iTRAQ provides insights into response mechanisms to short-term salt stress

Directory of Open Access Journals (Sweden)

Wei eJi

2016-04-01

Full Text Available Salinity severely threatens land use capability and crop yields worldwide. Understanding the mechanisms that protect soybean from salt stress will help in the development of salt-stress tolerant leguminous plants. Here we firstly analyzed the changes in malondialdehyde levels, the activities of superoxide dismutase and peroxidases, cholorophyll contents, and Na+/K+ ratios in leaves and roots from soybean seedlings treated with 200 mM NaCl for different time points, and suggested that 200 mM NaCl treated for 12 h was enough for exploring proteomic analysis to soybean seedlings. iTRAQ-based proteomic approach was used to investigate the proteomes of soybean leaves and roots under salt treatment. Data are available via ProteomeXchange with identifier PXD002851. In total, 278 and 440 proteins with significantly altered abundance were identified in leaves and roots of soybean, respectively, with only 50 mutual unique proteins in the both tissues. These identified differentially expressed proteins (DEPs were mainly involved in 13 biological processes. Moreover, protein-protein interaction analysis revealed that the proteins involved in metabolism, carbohydrate and energy metabolism, protein synthesis and redox homeostasis constructed four types of response networks to high salt stress. Besides, semi-quantitative RT-PCR analysis revealed that some of the proteins, such as 14-3-3, MMK2, PP1, TRX-h, were also regulated by salt stress at the level of transcription. These results indicated that effective regulatory protein expression related to signalling, membrane and transport, stress defense and metabolism played important roles in the short-term salt response of soybean seedlings.

ADVANCES IN PROPAGATION OF GRAPEVINE IN THE WORLD

OpenAIRE

GROHS, DANIEL SANTOS; ALMANÇA, MARCUS ANDRÉ KURTZ; FAJARDO, THOR VINICIUS MARTINS; HALLEEN, FRANCOIS; MIELE, ALBERTO

2017-01-01

ABSTRACT Grapevine production by classical grafting methods and in commercial scale emerged over 130 years. This system remained handmade until the mid-1950s, when the first international certification programs aimed at obtaining mother plants with high viral sanity emerged. The necessity to increase the scale of production on industrial model and plant material production based on minimum morphological standards appeared at the end of the 1960s. Along the 1970s, research unlocked knowledge ...

Shoot growth of Merlot and Cabernet Sauvignon grapevine varieties

Directory of Open Access Journals (Sweden)

Marcelo Borghezan

2012-02-01

Full Text Available The objective of this work was to evaluate shoot growth of the grapevine varieties Merlot and Cabernet Sauvignon, during 2006/2007, and Cabernet Sauvignon, during 2008/2009, in São Joaquim, SC, Brazil. The experiment was carried out in a commercial vineyard trained on a vertical trellis system. The shoots of the central part of the plants were selected, and the lengths from the base to the apex of 20 shoots per cultivar were evaluated. In 2006/2007, monitoring began at pruning, on 9/15/2006, and ended on 2/6/2007, totalizing 144 days of evaluation. During the 2008/2009 cycle, phenology and shoot growth for 'Cabernet Sauvignon' were assessed from grape development (1/13/2009 (pea-sized grapes until shoot vegetative growth had ceased. Budburst occurred in the second half of September, and shoot-growth cessation occurred during ripening. Higher growth rates (about 4 cm per day were observed in pre- and post-flowering, followed by reduction due to the competition for photosynthates for the formation of flowers and bunches. Temperature and photoperiod induce grapevine shoots to cease growth in the highland regions of Santa Catarina State, Brazil.

Genetic structure of the fungal grapevine pathogen Eutypa lata from four continents

Science.gov (United States)

The generalist ascomycete fungus Eutypa lata causes Eutypa dieback of grapevine (Vitis vinifera) worldwide. To decipher the cosmopolitan distribution of this fungus, the population genetic structure of 17 geographic samples was investigated from four continental regions (Australia, California, Europ...

Identification of differentially expressed genes in sunflower (Helianthus annuus) leaves and roots under drought stress by RNA sequencing.

Science.gov (United States)

Liang, Chunbo; Wang, Wenjun; Wang, Jing; Ma, Jun; Li, Cen; Zhou, Fei; Zhang, Shuquan; Yu, Ying; Zhang, Liguo; Li, Weizhong; Huang, Xutang

2017-10-25

Sunflower is recognized as one of the most important oil plants with strong tolerance to drought in the world. In order to study the response mechanisms of sunflower plants to drought stress, gene expression profiling using high throughput sequencing was performed for seedling leaves and roots (sunflower inbred line R5) after 24 h of drought stress (15% PEG 6000). The transcriptome assembled using sequences of 12 samples was used as a reference. 805 and 198 genes were identified that were differentially expressed in leaves and roots, respectively. Another 71 genes were differentially expressed in both organs, in which more genes were up-regulated than down-regulated. In agreement with results obtained for other crops or from previous sunflower studies, we also observed that nine genes may be associated with the response of sunflower to drought. The results of this study may provide new information regarding the sunflower drought response, as well as add to the number of known genes associated with drought tolerance.

Root-associated bacteria promote grapevine growth: from the laboratory to the field

KAUST Repository

Rolli, Eleonora; Marasco, Ramona; Saderi, Stefano; Corretto, Erika; Mapelli, Francesca; Cherif, Ameur; Borin, Sara; Valenti, Leonardo; Sorlini, Claudia; Daffonchio, Daniele

2016-01-01

of different geographical origins derived from different crop plants can colonize grapevine to gain a beneficial outcome for the plant leading to promote growth at the field scale. Methods: To link the ecological functions of bacteria to the promotion of plant

Association of RGA-SSCP markers with resistance to downy mildew and anthracnose in grapevines.

Science.gov (United States)

Tantasawat, P A; Poolsawat, O; Prajongjai, T; Chaowiset, W; Tharapreuksapong, A

2012-07-02

Downy mildew (Plasmopara viticola) and anthracnose (Sphaceloma ampelinum) are two major diseases that severely affect most grapevine (Vitis vinifera) cultivars grown commercially in Thailand. Progress of conventional breeding programs of grapevine for improved resistance to these diseases can be speeded up by selection of molecular markers associated with resistance traits. We evaluated the association between 13 resistance gene analog (RGA)-single-strand conformation polymorphism (SSCP) markers with resistance to downy mildew and anthracnose in 71 segregating progenies of seven cross combinations between susceptible cultivars and resistant lines. F(1) hybrids from each cross were assessed for resistance to downy mildew and anthracnose (isolates Nk4-1 and Rc2-1) under laboratory conditions. Association of resistance traits with RGA-SSCP markers was evaluated using simple linear regression analysis. Three RGA-SSCP markers were found to be significantly correlated with anthracnose resistance, whereas significant correlation with downy mildew resistance was observed for only one RGA-SSCP marker. These results demonstrate the usefulness of RGA-SSCP markers. Four candidate markers with significant associations to resistance to these two major diseases of grapevine were identified. However, these putative associations between markers and resistance need to be verified with larger segregating populations before they can be used for marker-assisted selection.

Proteome dynamics and physiological responses to short-term salt stress in Leymus chinensis leaves.

Directory of Open Access Journals (Sweden)

Jikai Li

Full Text Available Salt stress is becoming an increasing threat to global agriculture. In this study, physiological and proteomics analysis were performed using a salt-tolerant grass species, Leymus chinensis (L. chinensis. The aim of this study is to understand the potential mechanism of salt tolerance in L. chinensis that used for crop molecular breeding. A series of short-term (<48 h NaCl treatments (0 ~ 700 mM were conducted. Physiological data indicated that the root and leaves growth were inhibited, chlorophyll contents decreased, while hydraulic conductivity, proline, sugar and sucrose were accumulated under salt stress. For proteomic analysis, we obtained 274 differentially expressed proteins in response to NaCl treatments. GO analysis revealed that 44 out of 274 proteins are involved in the biosynthesis of amino acids and carbon metabolism. Our findings suggested that L. chinensis copes with salt stress by stimulating the activities of POD, SOD and CAT enzymes, speeding up the reactions of later steps of citrate cycle, and synthesis of proline and sugar. In agreement with our physiological data, proteomic analysis also showed that salt stress depress the expression of photosystem relevant proteins, Calvin cycle, and chloroplast biosynthesis.

Deep amplicon sequencing reveals mixed phytoplasma infection within single grapevine plants

DEFF Research Database (Denmark)

Nicolaisen, Mogens; Contaldo, Nicoletta; Makarova, Olga

2011-01-01

The diversity of phytoplasmas within single plants has not yet been fully investigated. In this project, deep amplicon sequencing was used to generate 50,926 phytoplasma sequences from 11 phytoplasma-infected grapevine samples from a PCR amplicon in the 5' end of the 16S region. After clustering ...

Comportamento vegetativo e produtivo de videiras 'Cabernet sauvignon' cultivadas sob cobertura plástica Vegetative growth and yield of 'Cabernet sauvignon' grapevine under overhead plastic covering

Directory of Open Access Journals (Sweden)

Clenilso Sehnen Mota

2008-03-01

Full Text Available O uso de cobertura plástica no cultivo de videira encontra-se em expansão no Rio Grande do Sul, por ser uma alternativa que visa a proteger as plantas da precipitação pluvial e do granizo. O objetivo deste estudo foi avaliar os impactos de uma cobertura plástica translúcida e impermeável sobre a fenologia, o crescimento (de ramos, folhas, cachos e bagas e a produtividade em videiras 'Cabernet Sauvignon' (Vitis vinifera L., com cinco anos de idade, conduzidas em sistema 'Y', sobre porta-enxerto Paulsen 1103. O experimento, conduzido no município de Caxias do Sul-RS, seguiu o delineamento em blocos ao acaso, tendo os tratamentos sem e com cobertura plástica, com quatro repetições de 15 plantas (unidade experimental. As alterações microclimáticas impostas pela cobertura plástica não foram expressivas para alterar a fenologia da videira. As plantas cultivadas sob cobertura plástica apresentaram maiores valores de comprimento e massa fresca de ramos e de área, e massa seca foliar em comparação às plantas descobertas. O peso e o diâmetro de bagas foram superiores nas videiras cobertas apenas no início do ciclo e não diferiram próximo da colheita. As demais variáveis analisadas não foram afetadas pela cobertura plástica. A cobertura plástica interferiu no crescimento vegetativo das plantas, mas não afetou a produção.There is an increasing adoption of overhead plastic covering for grapevines in the State of Rio Grande do Sul, Southern Brazil, to protect the plants from rain and hail storms. This study was carried out to evaluate the impacts of overhead plastic covering with a translucent and water-proof plastic film on phenological, growth (of branch, leaves, clusters, and berries, and yield attributes of five years old 'Cabernet Sauvignon' grapevines (Vitis vinifera L. on Paulsen 1103 rootstock raised as 'Y' management system. The experiment was carried out in Caxias do Sul, State of Rio Grande do Sul, and followed a

A DNA based method to detect the grapevine root-rotting fungus Roesleria subterranea in soil and root samples

Directory of Open Access Journals (Sweden)

S. Neuhauser

2009-05-01

Full Text Available Roesleria subterranea causes root rot in grapevine and fruit trees. The fungus has long been underestimated as a weak parasite, but during the last years it has been reported to cause severe damages in German vineyards. Direct, observation-based detection of the parasite is time consuming and destructive, as large parts of the rootstocks have to be uprooted and screened for the tiny, stipitate, hypogeous ascomata of R. subterranea. To facilitate rapid detection in vineyards, protocols to extract DNA from soil samples and grapevine roots, and R.-subterranea-specific PCR primers were designed. Twelve DNA-extraction protocols for soil samples were tested in small-scale experiments, and selected parameters were optimised. A protocol based on ball-mill homogenization, DNA extraction with SDS, skim milk, chloroform, and isopropanol, and subsequent purifi cation of the raw extracts with PVPP-spin-columns was most effective. This DNA extraction protocol was found to be suitable for a wide range of soil-types including clay, loam and humic-rich soils. For DNA extraction from grapevine roots a CTAB-based protocol was more reliable for various grapevine rootstock varieties. Roesleria-subterranea-specific primers for the ITS1-5.8S-ITS2 rDNA region were developed and tested for their specifi city to DNA extracts from eleven R. subterranea strains isolated from grapevine and fruit trees. No cross reactions were detected with DNA extracts from 44 different species of fungi isolated from vineyard soils. The sensitivity of the species-specifi c primers in combination with the DNA extraction method for soil was high: as little as 100 fg μl-1 R.-subterranea-DNA was suffi cient for a detection in soil samples and plant material. Given that specifi c primers are available, the presented method will also allow quick and large-scale testing for other root pathogens.

Effect of iron deficiency stress on leaves movements and electrical potentials in mimosa (Mimosa pudica L.

Directory of Open Access Journals (Sweden)

Edward Ślesak

2014-01-01

Full Text Available The aim of the studies was to trace the motorical and electrical activity of the mimosa (Mimosa pudica L. grown under conditions of iron deficiency. The speed of leaf folding was measured (motorical activity and the action potential induced with thermic and light stimuli and turgorin (electrical activity was recorded. It was found that the iron deficiency caused acidification of medium and the maximum of the process coincided with the period when the young leaves were turning green. Chlorotic mimosa leaves, not detached from the plant, showed an increased motorical activity. Motorical and electrical activity of the leaves were inhibited by an inhibitor of the plasmalemma redox systems - quinacrine, and stimulated by blue light. Leaf movement factor - turgorin - caused a hypersensitivity of chlorotic plants. It follows from the studies that the observed effects resulted from the adaptation of mimosa to the iron stress. The adaptation was a result of formation of new plasmalemma redox systems (turbo-reductase, responsible for maintaining high energy levels in the cells.

How Streptomyces anulatus Primes Grapevine Defenses to Cope with Gray Mold: A Study of the Early Responses of Cell Suspensions

Directory of Open Access Journals (Sweden)

Parul Vatsa-Portugal

2017-06-01

Full Text Available Gray mold, caused by Botrytis cinerea, is one of the most destructive diseases of grapevine and is controlled with an intense application of fungicides. As alternatives to chemicals, beneficial microbes may promote plant health by stimulating the plant’s immune system. An actinomycete, Streptomyces anulatus S37, has been screened from the rhizosphere microbiome of healthy Vitis vinifera on the basis of its ability to promote grapevine growth and to induce resistance against various phytopathogens, including B. cinerea. However, molecular mechanisms involved locally after direct perception of these bacteria by plant cells still remain unknown. This study focuses on local defense events induced in grapevine cells during interactions with S. anulatus S37 before and after pathogen challenge. We demonstrated that S. anulatus S37 induced early responses including oxidative burst, extracellular alkalinization, activation of protein kinases, induction of defense gene expression and phytoalexin accumulation, but not the programmed cell death. Interestingly, upon challenge with the B. cinerea, the S. anulatus S37 primed grapevine cells for enhanced defense reactions with a decline in cell death. In the presence of the EGTA, a calcium channel inhibitor, the induced oxidative burst, and the protein kinase activity were inhibited, but not the extracellular alkalinization, suggesting that Ca2+ may also contribute upstream to the induced defenses. Moreover, desensitization assays using extracellular pH showed that once increased by S. anulatus S37, cells became refractory to further stimulation by B. cinerea, suggesting that grapevine cells perceive distinctly beneficial and pathogenic microbes.

Mechanisms of copper stress alleviation in Citrus trees after metal uptake by leaves or roots.

Science.gov (United States)

Hippler, Franz Walter Rieger; Petená, Guilherme; Boaretto, Rodrigo Marcelli; Quaggio, José Antônio; Azevedo, Ricardo Antunes; Mattos-Jr, Dirceu

2018-05-01

Nutritional disorders caused by copper (Cu) have affected citrus orchards. Since Cu is foliar sprayed as a pesticide to control citrus diseases, this metal accumulates in the soil. Thereby, we evaluated the effects of Cu leaf absorption after spray of different metal sources, as well as roots absorption on growth, nutritional status, and oxidative stress of young sweet orange trees. Two experiments were carried out under greenhouse conditions. The first experiment was set up with varying Cu levels to the soil (nil Cu, 0.5, 2.0, 4.0 and 8.0 g of Cu per plant as CuSO 4 .5H 2 O), whereas the second experiment with Cu application via foliar sprays (0.5 and 2.0 g of Cu per plant) and comparing two metal sources (CuSO 4 .5H 2 O or Cu(OH) 2 ). Copper was mainly accumulated in roots with soil supply, but an increase of oxidative stress levels was observed in leaves. On the other hand, Cu concentrations were higher in leaves that received foliar sprays, mainly as Cu(OH) 2 . However, when sulfate was foliar sprayed, plants exhibited more symptoms of injuries in the canopy with decreased chlorophyll contents and increased hydrogen peroxide and lipid peroxidation levels. Copper toxicity was characterized by sap leakage from the trunk and twigs, which is the first report of this specific Cu excess symptom in woody trees. Despite plants with 8.0 g of Cu soil-applied exhibiting the sap leakage, growth of new plant parts was more vigorous with lower oxidative stress levels and injuries compared to those with 4.0 g of Cu soil-applied (without sap leakage). With the highest level of Cu applied via foliar as sulfate, Cu was eliminated by plant roots, increasing the rhizospheric soil metal levels. Despite citrus likely exhibiting different mechanisms to reduce the damages caused by metal toxicity, such as responsive enzymatic antioxidant system, metal accumulation in the roots, and metal exclusion by roots, excess Cu resulted in damages on plant growth and metabolism when the

Metabolic changes of Vitis vinifera berries and leaves exposed to Bordeaux mixture.

Science.gov (United States)

Martins, Viviana; Teixeira, António; Bassil, Elias; Blumwald, Eduardo; Gerós, Hernâni

2014-09-01

Since the development of Bordeaux mixture in the late 1800's, copper-based fungicides have been widely used against grapevine (Vitis vinifera L.) diseases, mainly in organic but also in conventional viticulture; however their intensive use has raised phytotoxicity concerns. In this study, the composition of grape berries and leaves upon Bordeaux mixture treatment was investigated during the fructification season by a metabolomic approach. Four applications of Bordeaux mixture till 3 weeks before harvest were performed following the regular management practices of organic viticulture. Results showed that the copper-based treatment affected the content in sugars, organic acids, lipids and flavan-3-ols of grapes and leaves at specific developmental stages. Nonetheless, the levels of sucrose, glucose and fructose, and of tartaric and malic acids were not significantly affected in mature grapes. In contrast, a sharp decrease in free natural amino acids was observed, together with a reduction in protein content and in mineral nitrogen forms. The treatment with Bordeaux mixture increased by 7-fold the copper levels in tissue extracts from surface-washed mature berries. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

Early identification in primary health care of people at risk for sick leave due to work-related stress - study protocol of a randomized controlled trial (RCT).

Science.gov (United States)

Holmgren, Kristina; Sandheimer, Christine; Mårdby, Ann-Charlotte; Larsson, Maria E H; Bültmann, Ute; Hange, Dominique; Hensing, Gunnel

2016-11-25

Early identification of persons at risk of sickness absence due to work-related stress is a crucial problem for society in general, and primary health care in particular. Tho date, no established method to do this exists. This project's aim is to evaluate whether systematic early identification of work-related stress can prevent sickness absence. This paper presents the study design, procedure and outcome measurements, as well as allocation and baseline characteristics of the study population. The study is a two-armed randomized controlled trial with follow-up at 3, 6 and 12 months. Non-sick-listed employed women and men, aged 18 to 64 years, who had mental and physical health complaints and sought care at primary health care centers (PHCC) were eligible to participate. At baseline work-related stress was measured by the Work Stress Questionnaire (WSQ), combined with feedback at consultation, at PHCC. The preventive intervention included early identification of work-related stress by the WSQ, GP training in the use of WSQ, GP feedback at consultation and finding suitable preventive measures. A process evaluation was used to explore how to facilitate future implementation and structural use of the WSQ at the PHCC. The primary outcome to compare the preventive sick leave intervention by the general practitioner (GP) versus treatment as usual is sick leave data obtained from the Swedish Social Insurance Agency register. Early screening for sick leave due to work-related stress makes it possible not only to identify those at risk for sick leave, but also to put focus on the patient's specific work-related stress problems, which can be helpful in finding suitable preventive measures. This study investigates if use of the WSQ by GPs at PHCCs, combined with feedback at consultation, prevents future sickness absence. ClinicalTrials.gov. Identifier: NCT02480855 . Registered 20 May 2015.

Manejo do dossel vegetativo da videira e seu efeito na composição do vinho Merlot Grapevine canopy management effects on Merlot wine composition

Directory of Open Access Journals (Sweden)

Alberto Miele

2009-05-01

Full Text Available O objetivo deste trabalho foi avaliar o efeito de modalidades de poda verde da videira (Vitis vinifera L. na composição do vinho Merlot. Um experimento foi conduzido de 1993/1994 a 1996/1997, em Bento Gonçalves, RS, com uma testemunha e 11 modalidades de poda verde em vinhedo conduzido em latada. A análise de componentes principais mostrou que o efeito da poda verde variou conforme o ano. Considerando a média dos quatro anos avaliados, os três principais componentes foram responsáveis por 72% da variação total. Adesbrota, desponta e desfolha realizada no início da floração, com eliminação de todas as folhas abaixo dos cachos foi a modalidade de poda que apresentou os valores mais elevados de intensidade de cor, absorbâncias a 280 e 520 nm, antocianinas, taninos, álcool, 3-metil-1-butanol/2-metil-1-propanol, álcool em peso/extrato seco reduzido e fósforo, e foi a mais indicada para a produção de vinho Merlot.The objective of this work was to evaluate the effect of grapevine (Vitis vinifera L. summer pruning on Merlot wine composition. An experiment was carried out from 1993/1994 to 1996/1997 in Bento Gonçalves, RS, Brazil, using a control and 11 summer pruning in grapevines trained in pergola system. Principal component analysis showed that the summer pruning effects varied by year. Considering the average of the four years, the first three principal components were responsible for 72% of the total variation. Sprouting, topping, and removal of all leaves below grapevine clusters at the beginning of bloom had high values of color intensity, absorbances at 280 and 520 nm, anthocyanins, tannins, alcohol, 3-methyl-1-butanol/2-methyl-1-propanol, alcohol in weight/reduced dry extract, and phosphorus and was the best alternative for the production of quality Merlot wine.

High-throughput sequencing of microbial community diversity in soil, grapes, leaves, grape juice and wine of grapevine from China.

Science.gov (United States)

Wei, Yu-Jie; Wu, Yun; Yan, Yin-Zhuo; Zou, Wan; Xue, Jie; Ma, Wen-Rui; Wang, Wei; Tian, Ge; Wang, Li-Ye

2018-01-01

In this study Illumina MiSeq was performed to investigate microbial diversity in soil, leaves, grape, grape juice and wine. A total of 1,043,102 fungal Internal Transcribed Spacer (ITS) reads and 2,422,188 high quality bacterial 16S rDNA sequences were used for taxonomic classification, revealed five fungal and eight bacterial phyla. At the genus level, the dominant fungi were Ascomycota, Sordariales, Tetracladium and Geomyces in soil, Aureobasidium and Pleosporaceae in grapes leaves, Aureobasidium in grape and grape juice. The dominant bacteria were Kaistobacter, Arthrobacter, Skermanella and Sphingomonas in soil, Pseudomonas, Acinetobacter and Kaistobacter in grape and grapes leaves, and Oenococcus in grape juice and wine. Principal coordinate analysis showed structural separation between the composition of fungi and bacteria in all samples. This is the first study to understand microbiome population in soil, grape, grapes leaves, grape juice and wine in Xinjiang through High-throughput Sequencing and identify microorganisms like Saccharomyces cerevisiae and Oenococcus spp. that may contribute to the quality and flavor of wine.

High-throughput sequencing of microbial community diversity in soil, grapes, leaves, grape juice and wine of grapevine from China

Science.gov (United States)

Yan, Yin-zhuo; Zou, Wan; Ma, Wen-rui; Wang, Wei; Tian, Ge; Wang, Li-ye

2018-01-01

In this study Illumina MiSeq was performed to investigate microbial diversity in soil, leaves, grape, grape juice and wine. A total of 1,043,102 fungal Internal Transcribed Spacer (ITS) reads and 2,422,188 high quality bacterial 16S rDNA sequences were used for taxonomic classification, revealed five fungal and eight bacterial phyla. At the genus level, the dominant fungi were Ascomycota, Sordariales, Tetracladium and Geomyces in soil, Aureobasidium and Pleosporaceae in grapes leaves, Aureobasidium in grape and grape juice. The dominant bacteria were Kaistobacter, Arthrobacter, Skermanella and Sphingomonas in soil, Pseudomonas, Acinetobacter and Kaistobacter in grape and grapes leaves, and Oenococcus in grape juice and wine. Principal coordinate analysis showed structural separation between the composition of fungi and bacteria in all samples. This is the first study to understand microbiome population in soil, grape, grapes leaves, grape juice and wine in Xinjiang through High-throughput Sequencing and identify microorganisms like Saccharomyces cerevisiae and Oenococcus spp. that may contribute to the quality and flavor of wine. PMID:29565999

Electronic nose as an innovative tool for the diagnosis of grapevine crown gall

Energy Technology Data Exchange (ETDEWEB)

Blasioli, S., E-mail: sonia.blasioli@unibo.it [Dipartimento di Scienze e Tecnologie Agroambientali, Universita di Bologna, V.le Fanin, 44, 40127 Bologna (Italy); Biondi, E., E-mail: erbiondi@tin.it [Dipartimento di Scienze e Tecnologie Agroambientali, Universita di Bologna, V.le Fanin, 44, 40127 Bologna (Italy); Braschi, I., E-mail: ilaria.braschi@unibo.it [Dipartimento di Scienze e Tecnologie Agroambientali, Universita di Bologna, V.le Fanin, 44, 40127 Bologna (Italy); Mazzucchi, U., E-mail: umberto.mazzucchi@unibo.it [Dipartimento di Scienze e Tecnologie Agroambientali, Universita di Bologna, V.le Fanin, 44, 40127 Bologna (Italy); Bazzi, C., E-mail: carlo.bazzi@unibo.it [Dipartimento di Scienze e Tecnologie Agroambientali, Universita di Bologna, V.le Fanin, 44, 40127 Bologna (Italy); Gessa, C.E., E-mail: carloemanuele.gessa@unibo.it [Dipartimento di Scienze e Tecnologie Agroambientali, Universita di Bologna, V.le Fanin, 44, 40127 Bologna (Italy)

2010-07-05

For the first time, a portable electronic nose was used to discriminate between healthy and galled grapevines, experimentally inoculated with two tumourigenic strains of Agrobacterium vitis. The volatile profile of target cutting samples was analysed by headspace solid phase microextraction coupled with gas chromatography-mass spectrometry. Spectra from tumoured samples revealed the presence of styrene which is compatible with decarboxylation of cinnamic acid involved in secondary metabolism of plants. Principal Component Analysis confirmed the difference in volatile profiles of infected vines and their healthy controls. Linear Discriminant Analysis allowed the correct discrimination between healthy and galled grapevines (83.3%, cross-validation). Although a larger number of samples should be analysed to create a more robust model, our results give novel interesting clues to go further with research on the diagnostic potential of this innovative system associated with multi-dimensional chemometric techniques.

The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13.

Science.gov (United States)

Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L

1989-04-01

The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.

Climate vs grapevine pests and diseases worldwide: the first results of a global survey

Directory of Open Access Journals (Sweden)

Benjamin Bois

2017-05-01

Methods and results: Based on the answer of respondent about the main reported diseases/pests in their region, a severity index was calculated. Each region was geolocalised and data were compared to the WorldClim gridded climate database to document the range of climate conditions (growing season temperature and rainfall associated to the main diseases/pests. The potential climatic-induced changes of grapevine disease and pest geography by 2050 are assessed using agro-climate projections from the ARPEGE CNRM model, using the RCP 4.5 scenario. The preliminary results allow to determine the distribution of diseases as function of agroclimatic indicators. Conclusion: While the distribution of diseases differs according to the region of the world, the current analysis suggests that mildews remain the major phytosanitary threat in most of the regions. Powdery mildew, trunk diseases and viruses were reported in extremely diverse climatic conditions, including intermediate and wet regions.  Significance and impact of the study: This paper present an original methodology to address the relationship between grapevine disease and pest occurrences and climate. Such documentation is scarce in the current literature. Further analysis is currently being performed, including additional survey answers, climate indices and supplementary data collected (spatial extension, frequency of treatments… to better depict the challenges of grapevine phytosanitary management in a changing climate.

Sesquiterpene volatile organic compounds (VOCs are markers of elicitation by sulfated laminarine in grapevine

Directory of Open Access Journals (Sweden)

Malik eChalal

2015-05-01

Full Text Available Inducing resistance in plants by application of elicitors of defense reactions is an attractive plant protection strategy, especially for grapevine (Vitis vinifera which is susceptible to severe fungal diseases. Though induced resistance (IR can be successful in controlled conditions, under outdoor conditions IR is in most cases not effective enough for practical disease control. Progress in the application of IR requires a better understanding of grapevine defense mechanisms and the ability to monitor defense markers in order to identify factors (physiological, environmental… that can impact IR in the vineyard.Volatile organic compounds (VOCs are well-known plant defenses compounds that have only received little or no attention in the case of grape-pathogen interactions to date. This prompted us to investigate whether an elicitor, the sulfated laminarin (PS3, actually induces the production of VOCs in grapevine. Online analysis (PTR-QMS of VOC emissions in dynamic cuvettes and passive sampling in gas tight bags with solid phase micro extraction (SPME-GC-MS under greenhouse conditions showed that PS3 elicited emission of VOCs. Some of them (as (E,E-α-farnesene might be good candidates as biomarkers of elicitor-IR whereas methyl salicylate appears to be rather a biomarker of downy mildew infection. A negative correlation between VOC emission and disease severity suggests a positive role of VOCs in grape defense against diseases.

Radicinin from Cochliobolus sp. inhibits Xylella fastidiosa, the causal agent of Pierce's Disease of grapevine.

Science.gov (United States)

Aldrich, Thomas J; Rolshausen, Philippe E; Roper, M Caroline; Reader, Jordan M; Steinhaus, Matthew J; Rapicavoli, Jeannette; Vosburg, David A; Maloney, Katherine N

2015-08-01

The fastidious phytopathogenic bacterium, Xylella fastidiosa, poses a substantial threat to many economically important crops, causing devastating diseases including Pierce's Disease of grapevine. Grapevines (Vitis vinifera L.) planted in an area under Pierce's Disease pressure often display differences in disease severity and symptom expression, with apparently healthy vines growing alongside the dying ones, despite the fact that all the vines are genetic clones of one another. Under the hypothesis that endophytic microbes might be responsible for this non-genetic resistance to X. fastidiosa, endophytic fungi were isolated from vineyard cvs. 'Chardonnay' and 'Cabernet Sauvignon' grown under high Pierce's Disease pressure. A Cochliobolus sp. isolated from a Cabernet Sauvignon grapevine inhibited the growth of X. fastidiosa in vitro. Bioassay-guided isolation of an organic extract of Cochliobolus sp. yielded the natural product radicinin as the major active compound. Radicinin also inhibited proteases isolated from the culture supernatant of X. fastidiosa. In order to assess structure-activity relationships, three semi-synthetic derivatives of radicinin were prepared and tested for activity against X. fastidiosa in vitro. Assay results of these derivatives are consistent with enzyme inactivation by conjugate addition to carbon-10 of radicinin, as proposed previously. Copyright © 2015 Elsevier Ltd. All rights reserved.

A Comparative Proteomic Analysis of Pinellia ternata Leaves Exposed to Heat Stress

Directory of Open Access Journals (Sweden)

Zuoyi Liu

2013-10-01

Full Text Available Pinellia ternata is an important traditional Chinese medicinal plant. The growth of P. ternata is sensitive to high temperatures. To gain a better understanding of heat stress responses in P. ternata, we performed a comparative proteomic analysis. P. ternata seedlings were subjected to a temperature of 38 °C and samples were collected 24 h after treatment. Increased relative ion leakage and lipid peroxidation suggested that oxidative stress was frequently generated in rice leaves exposed to high temperature. Two-dimensional electrophoresis (2-DE was used to analyze heat-responsive proteins. More than 600 protein spots were reproducibly detected on each gel; of these spots, 20 were up-regulated, and 7 were down-regulated. A total of 24 proteins and protein species were successfully identified by MALDI-TOF/TOF MS. These proteins and protein species were found to be primarily small heat shock proteins (58% as well as proteins involved in RNA processing (17%, photosynthesis (13%, chlorophyll biosynthetic processes (4%, protein degradation (4% and defense (4%. Using 2-DE Western blot analysis, we confirmed the identities of the cytosolic class II small heat shock protein (sHSPs-CII identified by MS. The expression levels of four different proteins [cytosolic class I small heat shock protein (sHSPs-CI, sHSPs-CII, mitochondrial small heat shock protein (sHSPs-MIT, glycine-rich RNA-binding protein (GRP] were analyzed at the transcriptional level by quantitative real-time PCR. The mRNA levels of three sHSPs correlated with the corresponding protein levels. However, GRP was down-regulated at the beginning of heat stress but then increased substantially to reach a peak after 24 h of heat stress. Our study provides valuable new insight into the responses of P. ternata to heat stress.

Characterization of the Xylella fastidiosa PD1311 gene mutant and its suppression of Pierce's disease on grapevines.

Science.gov (United States)

Hao, Lingyun; Johnson, Kameka; Cursino, Luciana; Mowery, Patricia; Burr, Thomas J

2017-06-01

Xylella fastidiosa causes Pierce's disease (PD) on grapevines, leading to significant economic losses in grape and wine production. To further our understanding of X. fastidiosa virulence on grapevines, we examined the PD1311 gene, which encodes a putative acyl-coenzyme A (acyl-CoA) synthetase, and is highly conserved across Xylella species. It was determined that PD1311 is required for virulence, as the deletion mutant, ΔPD1311, was unable to cause disease on grapevines. The ΔPD1311 strain was impaired in behaviours known to be associated with PD development, including motility, aggregation and biofilm formation. ΔPD1311 also expressed enhanced sensitivity to H 2 O 2 and polymyxin B, and showed reduced survival in grapevine sap, when compared with wild-type X. fastidiosa Temecula 1 (TM1). Following inoculation, ΔPD1311 could not be detected in grape shoots, which may be related to its altered growth and sensitivity phenotypes. Inoculation with ΔPD1311 2 weeks prior to TM1 prevented the development of PD in a significant fraction of vines and eliminated detectable levels of TM1. In contrast, vines inoculated simultaneously with TM1 and ΔPD1311 developed disease at the same level as TM1 alone. In these vines, TM1 populations were distributed similarly to populations in TM1-only inoculated plants. These findings suggest that, through an indirect mechanism, pretreatment of vines with ΔPD1311 suppresses pathogen population and disease. © 2016 BSPP AND JOHN WILEY & SONS LTD.

A Fundamental Step in IPM on Grapevine: Evaluating the Side Effects of Pesticides on Predatory Mites

Directory of Open Access Journals (Sweden)

Alberto Pozzebon

2015-10-01

Full Text Available Knowledge on side effects of pesticides on non-target beneficial arthropods is a key point in Integrated Pest Management (IPM. Here we present the results of four experiments conducted in vineyards where the effects of chlorpyrifos, thiamethoxam, indoxacarb, flufenoxuron, and tebufenozide were evaluated on the generalist predatory mites Typhlodromus pyri Scheuten and Amblyseius andersoni (Chant, key biocontrol agents of herbivorous mites on grapevines. Results show that indoxacarb and tebufenozide had a low impact on the predatory mites considered here, while a significant impact was observed for chlorpyrifos, flufenoxuron, and thiamethoxam. The information obtained here should be considered in the design of IPM strategies on grapevine.

Structural Changes Induced in Grapevine (Vitis vinifera L. DNA by Femtosecond IR Laser Pulses: A Surface-Enhanced Raman Spectroscopic Study

Directory of Open Access Journals (Sweden)

Nicoleta E. Dina

2016-05-01

Full Text Available In this work, surface-enhanced Raman spectra of ten genomic DNAs extracted from leaf tissues of different grapevine (Vitis vinifera L. varieties, respectively, are analyzed in the wavenumber range 300–1800 cm−1. Furthermore, structural changes induced in grapevine genomic nucleic acids upon femtosecond (170 fs infrared (IR laser pulse irradiation (λ = 1100 nm are discussed in detail for seven genomic DNAs, respectively. Surface-enhanced Raman spectroscopy (SERS signatures, vibrational band assignments and structural characterization of genomic DNAs are reported for each case. As a general observation, the wavenumber range between 1500 and 1660 cm−1 of the spectra seems to be modified upon laser treatment. This finding could reflect changes in the base-stacking interactions in DNA. Spectral shifts are mainly attributed to purines (dA, dG and deoxyribose. Pyrimidine residues seem to be less affected by IR femtosecond laser pulse irradiation. Furthermore, changes in the conformational properties of nucleic acid segments are observed after laser treatment. We have found that DNA isolated from Feteasca Neagra grapevine leaf tissues is the most structurally-responsive system to the femtosecond IR laser irradiation process. In addition, using unbiased computational resources by means of principal component analysis (PCA, eight different grapevine varieties were discriminated.

Arsenic and trace elements in soil, water, grapevine and onion in Jáchal, Argentina.

Science.gov (United States)

Funes Pinter, Iván; Salomon, M Victoria; Gil, Raúl; Mastrantonio, Leandro; Bottini, Rubén; Piccoli, Patricia

2018-02-15

Contamination by trace elements (TE) is an increasing concern worldwide. In some areas, crop production could be limited by the presence of metals and metalloids, so it is important to determine their concentrations and mobility. The region of Jáchal, province of San Juan, Argentina, has good growing conditions for onion and grapevine production, but their quality and yield are affected by high TE concentration in soils and water. Soils, water, grapevine and onion were sampled and TE content determined. In soils elevated As, B, Cr, Hg, and Tl concentrations were detected (506±46, 149±3, 2714±217, 16±7, and 12±3μgg -1 , respectively, for maximum values measured), and physicochemical properties of the soil promotes these elements mobility. Water samples had high As, B, Cr, and Fe concentrations (1438±400, 10,871±471, 11,516±2363, and 3071±257μgL -1 , respectively, for maximum values measured) while in onion bulbs and grapevine berries, As, Cr, Cu, and Fe (92±7 and 171±20, 1412±18 and 2965±32, 17±3 and 126±88, and 418±204 and 377±213μgg -1 , respectively, for maximum values measured) exceeded the limits for food consumption established by Argentinian law. Correlation analyses indicated that: i) there is a common source of TE in this area, ii) each elements concentration in plants is associated with different soil variables and different soils depths, and iii) the lack of correlation between soil and water indicates that concentration in water is not constant over the time and/or there exists a differential accumulation of elements in soils depending on their own properties. Data obtained demonstrate very high concentration of TE in soil, grapevines, and onion plants in Jáchal region, and different remediation techniques are necessary to stabilize and minimize the bioavailability of these elements. Copyright © 2017 Elsevier B.V. All rights reserved.

Fatty Acid Methyl Ester (FAME) analyses for characterization and detection of grapevine pathogens

Science.gov (United States)

Grapevines can become infected by a variety of devastating pathogens, including the bacterium Xylella fastidiosa and canker fungi. Multiple strains of Xylella fastidiosa exist, each causing different diseases on various hosts. Although sequence-based genotyping can assist in distinguishing these str...

A polyphasic approach for the characterization of endophytic Alternaria strains isolated from grapevines

DEFF Research Database (Denmark)

Polizzotto, Rachele; Andersen, Birgitte; Martini, Marta

2012-01-01

A polyphasic approach was set up and applied to characterize 20 fungal endophytes belonging to the genus Alternaria, recovered from grapevine in different Italian regions.Morphological, microscopical, molecular and chemical investigations were performed and the obtained results were combined in a...

Quantitative and qualitative characteristics of cell wall components and prenyl lipids in the leaves of Tilia x euchlora trees growing under salt stress.

Science.gov (United States)

Milewska-Hendel, Anna; Baczewska, Aneta H; Sala, Katarzyna; Dmuchowski, Wojciech; Brągoszewska, Paulina; Gozdowski, Dariusz; Jozwiak, Adam; Chojnacki, Tadeusz; Swiezewska, Ewa; Kurczynska, Ewa

2017-01-01

The study was focused on assessing the presence of arabinogalactan proteins (AGPs) and pectins within the cell walls as well as prenyl lipids, sodium and chlorine content in leaves of Tilia x euchlora trees. The leaves that were analyzed were collected from trees with and without signs of damage that were all growing in the same salt stress conditions. The reason for undertaking these investigations was the observations over many years that indicated that there are trees that present a healthy appearance and trees that have visible symptoms of decay in the same habitat. Leaf samples were collected from trees growing in the median strip between roadways that have been intensively salted during the winter season for many years. The sodium content was determined using atomic spectrophotometry, chloride using potentiometric titration and poly-isoprenoids using HPLC/UV. AGPs and pectins were determined using immunohistochemistry methods. The immunohistochemical analysis showed that rhamnogalacturonans I (RG-I) and homogalacturonans were differentially distributed in leaves from healthy trees in contrast to leaves from injured trees. In the case of AGPs, the most visible difference was the presence of the JIM16 epitope. Chemical analyses of sodium and chloride showed that in the leaves from injured trees, the level of these ions was higher than in the leaves from healthy trees. Based on chromatographic analysis, four poly-isoprenoid alcohols were identified in the leaves of T. x euchlora. The levels of these lipids were higher in the leaves from healthy trees. The results suggest that the differences that were detected in the apoplast and symplasm may be part of the defensive strategy of T. x euchlora trees to salt stress, which rely on changes in the chemical composition of the cell wall with respect to the pectic and AGP epitopes and an increased synthesis of prenyl lipids.

Responce of leaves of three plant species to aluminium stress

Directory of Open Access Journals (Sweden)

Agata Konarska

2012-12-01

Full Text Available Water culture experiments were undertaken for 14 days to examine the effect of increasing aluminum level (0, 10, 20 40 mg·dm-3 AlCl3·6 H2O on growth of sunflower, red pepper and radish leaves. The early stage of Al toxicity was characterized by curling or rolling of young leaves, marginal and veinal chlorosis, dark green leaves as soon as purpling of margins and veins of leaves. Reduction of leaf size and increased stomata density were observed with increasing Al concentration. Additionally, length of stomata cells decreased after Al-treatment.

Genome-wide identification of WRKY family genes and their response to cold stress in Vitis vinifera

Science.gov (United States)

WRKY transcription factors are one of the largest families of transcriptional regulators in plants. WRKY genes are not only found to play significant roles in biotic and abiotic stress response, but also regulate growth and development. Grapevine (Vitis vinifera) production is largely limited by str...

GLOBAL SOLAR RADIATION INTERCEPTION BY GRAPEVINES TRAINED TO A VERTICAL TRELLIS SYSTEM

Directory of Open Access Journals (Sweden)

CLAUDIA GUIMARÃES CAMARGO CAMPOS

2016-01-01

Full Text Available ABSTRACT In this paper we assess the utilization of radiant energy in the growing of grapevines (Cabernet Sauvignon trained to a vertical trellis system, and estimate the global solar radiation interception taking into account the physical characteristics of the training system at different phenological stages. The experiment was based on daily measurements of global solar radiation made by an automatic weather station placed at the vineyard of a winery located in the municipality of São Joaquim, in the southern Brazilian State of Santa Catarina (Villa Francioni winery, 28º 15’ 14” S, 49º 57’ 02” W, 1294m a.s.l.. Growth and phenological development of the shoots were evaluated. The global solar radiation is intercepted by the canopy (trained to a vertical trellis system in different orientations and the accumulated total is slightly greater on the east than on the west face of the canopy, especially after flowering. The daily variability of global solar radiation intercepted by the canopy is greater after flowering. The accumulated solar energy incident on the canopy increases until the onset of ripening. From the results, vineyards trained to a vertical trellis system in the north-south direction provide favorable sunlight exposure to leaves and fruits and are promising in quality and productivity.

Phylogeny of geminivirus coat protein sequences and digital PCR aid in identifying Spissistilus festinus (Say) as a vector of Grapevine red blotch-associated virus

Science.gov (United States)

Grapevine red blotch-associated virus (GRBaV) is a newly identified virus of grapevines, and a putative member of a new genus within the family Geminiviridae. This virus is associated with red blotch disease that was first reported in California in 2008. It affects the profitability of vineyards by ...

Evaluation of the protective effect of guava fruits and leaves on oxidative stress - doi: 10.4025/actascibiolsci.v36i1.19839

Directory of Open Access Journals (Sweden)

Juliana Mesquita Freire

2013-09-01

Full Text Available Oxidative stress is an imbalance between reactive oxygen species and antioxidant capacity of action. Thus, research, alternative to mitigate the damaging effects of oxidative stress, improving the body´s antioxidant capacity, prevented the disease and its complicatons. The leaves and fruits of guava are rich in the antioxidants. This work aimed to study the effect of flour and ethanolic/acetone extracts leaves and fruits of guava on lipid oxidation in rats with hypercholesterolemic. The flour and extracts decreased leves of triglycerides and non – HDL cholesterol and increased in the HDL. Cholesterol levels decreased only leaves and fruits. The activity of GPx decreased in samples serum in all treatments  and the SOD only the extracts were effective. There was no difference in levels the MDA in relation hypercholesterolemic control. For the samples of liver, there was no difference in activity SOD. In relation of activity GPx, only the flour was effective. There were differences in levels the MDA of the hypercholesterolemic animals treated with flour and extracts with the animals of the hypercholesterolemic control.

The humic acid-induced changes in the water status, chlorophyll fluorescence and antioxidant defense systems of wheat leaves with cadmium stress.

Science.gov (United States)

Ozfidan-Konakci, Ceyda; Yildiztugay, Evren; Bahtiyar, Mustafa; Kucukoduk, Mustafa

2018-07-15

The using of bio-stimulant in plants grown under stress conditions for enhancing nutrition efficiency and crop quality traits is an effective approach. One of the bio-stimulants, humus material, is defined as humic acid (HA). HA application as a promotion of plant growth to plants grown in the heavy metals-contaminated soils has promised hope in terms of effects on plants but the its limiting effect is the application dose. Therefore, the wheat seedlings were grown in hydroponic culture for 21 d and the various concentrations of humic acid (HA; 750 or 1500 mg L -1 ) were treated alone or in combination with cadmium (Cd) stress (100 or 200 μM) for 7 d. The results showed that after Cd stress treatment, water content (RWC), osmotic potential (Ψ Π ) and chlorophyll fluorescence parameters decreased and proline content (Pro) increased for 7 d. In spite of activated peroxidase (POX) and ascorbate peroxidase (APX), stress induced the toxic levels of hydrogen peroxide (H 2 O 2 ) accumulation. Cd stress triggered lipid peroxidation (TBARS content). HA application successfully eliminated the negative effects of stress on RWC, Ψ Π and photosynthetic parameters. In the presence of HA under stress, the increased activation of superoxide dismutase (SOD), catalase (CAT) and NADPH-oxidase (NOX) enzymes and ascorbate, glutathione and GSH/GSSG ratio observed. Only 750 mg L -1 HA under stress conditions induced the activities of monodehydroascorbate reductase (MDHAR) and dehydroascorbate reductase (DHAR), and dehydroascorbate (DHA) content. After the combined application of HA and Cd stress, the low contents of H 2 O 2 and TBARS maintained in wheat leaves. Hence, HA successfully eliminated the toxicity of Cd stress by modulating the water status, photosynthetic apparatus and antioxidant activity in wheat leaves. Copyright © 2018 Elsevier Inc. All rights reserved.

Characterization of Campylocarpon pseudofasciculare associated with black foot of grapevine in southern Brazil

Directory of Open Access Journals (Sweden)

Ricardo Feliciano dos SANTOS

2015-01-01

Full Text Available The incidence and severity of black foot has been recently increasing in nurseries and vineyards of southern Brazil. The goal of the present study was to characterize Campylocarpon isolates associated with black foot of grapevines (Vitis spp. using multi-gene DNA analysis (internal transcribed spacers [ITS rDNA], β-tubulin and histone H3 and morphological characteristics, and to test the pathogenicity of the isolates in grapevine (Vitis labrusca cv. Bordô. The three DNA regions analyzed indicated that all the isolates belonged to Campylocarpon pseudofasciculare. Their morphology was similar to descriptions published for the species. Isolates exhibited umber- to chestnut-coloured colonies and macroconidia (38.0 × 7.0 μm predominantly with three septa. All the isolates inoculated in V. labrusca cv. Bordô caused typical symptoms of black foot. This is the first report of Campylocarpon pseudofasciculare in southern Brazil.

Survey of potential sharpshooter and spittlebug vectors of Xylella fastidiosa to grapevines at the São Francisco River Valley, Brazil

Directory of Open Access Journals (Sweden)

Rudiney Ringenberg

2014-06-01

Full Text Available Survey of potential sharpshooter and spittlebug vectors of Xylella fastidiosa to grapevines at the São Francisco River Valley, Brazil. Pierce's disease of grapevines, caused by Xylella fastidiosa, is a serious problem in some regions of North America, not yet reported in Brazil. In this study, a survey of potential sharpshooter (Hemiptera, Cicadellidae, Cicadellinae and spittlebug (Hemiptera, Cercopidae vectors of X. fastidiosa was conducted in vineyards at the São Francisco River Valley, a major grape growing region in Brazil. Four vineyards of Vitis vinifera L. were sampled fortnightly from June/2005 to June/2007, using yellow sticky cards, each placed at two different heights (45 cm aboveground and 45 cm above the crop canopy in 10 sampling localities. A total of 4,095 specimens of sharpshooters were collected, nearly all from 3 Proconiini species, Homalodisca spottii Takiya, Cavichioli & McKamey, 2006 (96.8% of the specimens, Tapajosa fulvopunctata (Signoret, 1854 (3.1%, and Tretogonia cribrata Melichar, 1926 (1 specimen. Hortensia similis (Walker, 1851 (2 specimens was the only Cicadellini species. Only 1 cercopid specimen, belonging to Aeneolamia colon (Germar, 1821, was trapped. Even though they are not considered potential Xylella vectors, 2 Gyponini leafhoppers were collected: Curtara samera DeLong & Freytag, 1972 (11 specimens and Curtara inflata DeLong & Freytag, 1976 (1 specimen. Homalodisca spottii was observed feeding and mating on green branches of grapevines, in addition to egg masses. Because of its prevalence on the crop canopy, occurrence throughout the year (with peaks from February to August, and ability to colonize grapevines, H. spottii could be an important vector if a X. fastidiosa strain pathogenic to grapevines becomes introduced at the São Francisco River Valley.

The distribution and symptomatology of grapevine trunk disease pathogens are influenced by climate

NARCIS (Netherlands)

van Niekerk, J.M.; Bester, W.; Halleen, F.; Crous, P.W.; Fourie, P.H.

2011-01-01

Grapevine trunk diseases, caused by a range of phytopathogenic fungi, represent a serious impediment to wine and table grape production wherever these crops are cultivated. Previous studies have shown that the distribution of these pathogens is influenced by climate and that they are associated with

Design and validation of an STR hexaplex assay for DNA profiling of grapevine cultivars

Czech Academy of Sciences Publication Activity Database

Drábek, A.; Smolíková, M.; Kalendar, R.; Pinto, F. A. L.; Pavloušek, P.; Klepárník, Karel; Frébort, I.

2016-01-01

Roč. 37, 23-24 (2016), s. 3059-3067 ISSN 0173-0835 Institutional support: RVO:68081715 Keywords : grapevine DNA analysis * multiplex PCR * STRs * Vitis vinifera L Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 2.744, year: 2016

Comparative response of six grapevine rootstocks to inoculation with arbuscular mycorrhizal fungi based on root traits

Science.gov (United States)

Pogiatzis, Antreas; Bowen, Pat; Hart, Miranda; Holland, Taylor; Klironomos, John

2017-04-01

Arbuscular mycorrhizal (AM) symbiosis has been proven to be essential in grapevines, sustaining plant growth especially under abiotic and biotic stressors. The mycorrhizal growth response of young grapevines varies among rootstock cultivars and the underlying mechanisms involved in this variation are unknown. We predicted that this variation in mycorrhizal response may be explained by differences in root traits among rootstocks. We analyzed the entire root system of six greenhouse-grown rootstocks (Salt Creek, 3309 Couderc, Riparia Gloire, 101-14 Millardet et de Grasset, Swarzmann, Teleki 5C), with and without AM fungal inoculation (Rhizophagus irregularis) and characterized their morphological and architectural responses. Twenty weeks after the inoculation, aboveground growth was enhanced by AM colonization. The rootstock varieties were distinctly different in their response to AM fungi, with Salt Creek receiving the highest growth benefit, while Schwarzmann and 5C Teleki receiving the lowest. Plant responsiveness to AM fungi was negatively correlated with branching intensity (fine roots per root length). Furthermore, there was evidence that mycorrhizas can influence the expression of root traits, inducing a higher branching intensity and a lower root to shoot ratio. The results of this study will help to elucidate how interactions between grapevine rootstocks and AM fungi may benefit the establishment of new vineyards.

Changes in the free amino acid composition of Capsicum annuum (pepper) leaves in response to Myzus persicae (green peach aphid) infestation. A comparison with water stress.

Science.gov (United States)

Florencio-Ortiz, Victoria; Sellés-Marchart, Susana; Zubcoff-Vallejo, José; Jander, Georg; Casas, José L

2018-01-01

Amino acids play a central role in aphid-plant interactions. They are essential components of plant primary metabolism, function as precursors for the synthesis of defense-related specialized metabolites, and are major growth-limiting nutrients for aphids. To quantify changes in the free amino acid content of pepper (Capsicum annuum L.) leaves in response to green peach aphid (Myzus persicae Sulzer) feeding, plants were infested with a low (20 aphids/plant) or a high (200 aphids/plant) aphid density in time-course experiments ranging from 3 hours to 7 days. A parallel experiment was conducted with pepper plants that had been subjected to water stress. Factor Analysis of Mixed Data revealed a significant interaction of time x density in the free amino acid response of aphid-infested leaves. At low aphid density, M. persicae did not trigger a strong response in pepper leaves. Conversely, at high density, a large increase in total free amino acid content was observed and specific amino acids peaked at different times post-infestation. Comparing aphid-infested with water-stressed plants, most of the observed differences were quantitative. In particular, proline and hydroxyproline accumulated dramatically in response to water stress, but not in response to aphid infestation. Some additional differences and commonalities between the two stress treatments are discussed.

Biostimulation of grapevine : mode of action and possible agronomic uses

OpenAIRE

Krzyzaniak, Yuko; Trouvelot, Sophie; Heloir, Marie-Claire; Fourquez, P.; Magnin-Robert, Jean-Bernard; Randoux, B.; Siah, A.; Halama, Patrice; Moreau, Emmanuelle; Adrian, Marielle

2016-01-01

Although there is a growing interest for the use of biostimulants in agriculture, only few methods allowing a precise description of their effects on plants have been reported. In the IRIS+ FUI project, two major and highly different worldwide crops, wheat (annual, monocotyledon) and grapevine (perennial, broadleaf), were chosen to deepen our knowledge of such compounds and explore their potential additional interest. The first objective is to develop in greenhouse conditions, a panel of tool...

Grapevine rootstock effects on scion sap phenolic levels, resistance to Xylella fastidiosa infection, and progression of Pierce’s disease

Directory of Open Access Journals (Sweden)

Christopher Michael Wallis

2013-12-01

Full Text Available The xylem-limited bacterium Xylella fastidiosa (Xf causes Pierce’s disease (PD, an important disease of grapevine, Vitis vinifera L.. Grapevine rootstocks were developed to provide increased resistance to root disease, but rootstock effects on cane and vine diseases remain unclear. Grapevines that consisted of Cabernet Sauvignon or Chardonnay grafted to 13 different rootstocks were inoculated with Xf and evaluated for PD severity and Xf titer after six months. A subset of six rootstock/scion combinations had xylem sap phenolic levels assessed in non-infected and Xf-infected grapevines. Vigor also was analyzed by measuring root lengths and masses. Cabernet Sauvignon grafted to 101-14MG, 1103P, 420A, or Schwarzmann had reduced PD severity compared to Cabernet Sauvignon grafted to 110R, 5BB, or SO4. Chardonnay grafted to Salt Creek or Freedom had reduced PD severity compared to Chardonnay grafted to RS3 or Schwarzmann. Chardonnay grafted to RS3 had greater Xf titer than Chardonnay grafted to 101-14MG, Freedom, or Salt Creek. No other differences in Xf titer among rootstocks were observed. Of the six scion/rootstock combinations which had xylem sap phenolics analyzed, Chardonnay/ RS3 had the highest levels of most phenolics whereas Cabernet Sauvignon/101-14MG had the lowest phenolic levels. However, Chardonnay/101-14MG, which had mild PD symptoms, had greater sap levels of caftaric acid than other scion/rootstock combinations. Sap levels of caftaric acid, methyl salicylate, a procyanidin trimer, and quinic acid were greater in Xf-infected versus non-infected grapevines. Chardonnay on 101-14MG or Salt Creek had greater root mass than Chardonnay on RS3. Cabernet Sauvignon on 101-14MG had greater root mass than Cabernet Sauvignon on 110R. These results identified rootstocks with the capacity for reducing PD symptom progression. Rootstocks also were shown to affect Xf titer, xylem sap phenolic levels, and plant vigor.

[Effects of water stress and temperature on gas exchange and chlorophyll fluorescence of Sinocalycanthus chinensis leaves].

Science.gov (United States)

Ke, Shi-sheng; Jin, Ze-xin

2008-01-01

Sinocalycanthus chinensis is an endangered species in Sinocalycanthus, and only distributed in Zhejiang Province of China. This paper studied the photosynthetic responses of 2-year-old pot-cultured S. chinensis to different levels of water stress and temperature. The results indicated that under mild and moderate water stress, the net photosynthetic rate (Pn) of S. chinensis leaves was decreased to 92.3% and 74.3% of the control, respectively, which was mainly attributed to stomatal limitation; and under severe water stress, the Pn was decreased to 44.4% of the control, which might be mainly linked to non-stomatal limitation. The appropriate temperature for S. chinensis photosynthesis was from 20 degrees C to 28 degrees C. At 39 degrees C, the Pn, water use efficiency (WUE), and maximal photochemistry efficiency (Fv/Fm) were decreased significantly, while the dark respiration rate (Rd) and transpiration rate (Tr) were enhanced significantly. With increasing water stress and temperature, some photosynthetic parameters including light saturation point (LSP), apparent quantum yield (AQY) and maximal CO2 assimilation rate (Pmax) decreased to certain extents, while light compensation point (LCP) increased, suggesting that both severe water stress and higher temperature were the important environmental factors affecting the survival of S. chinensis.

Shoot growth of Merlot and Cabernet Sauvignon grapevine varieties

OpenAIRE

Marcelo Borghezan; Olavo Gavioli; Hamilton Justino Vieira; Aparecido Lima da Silva

2012-01-01

The objective of this work was to evaluate shoot growth of the grapevine varieties Merlot and Cabernet Sauvignon, during 2006/2007, and Cabernet Sauvignon, during 2008/2009, in São Joaquim, SC, Brazil. The experiment was carried out in a commercial vineyard trained on a vertical trellis system. The shoots of the central part of the plants were selected, and the lengths from the base to the apex of 20 shoots per cultivar were evaluated. In 2006/2007, monitoring began at pruning, on 9/15/2006, ...

New insights into thermal growing conditions of Portuguese grapevine varieties under changing climates

Science.gov (United States)

Santos, João A.; Costa, Ricardo; Fraga, Helder

2018-03-01

New decision support tools for Portuguese viticulture are urging under a climate change context. In the present study, heat and chilling accumulation conditions of a collection of 44 grapevine cultivars currently grown in Portugal are assessed at very high spatial resolution ( 1 km) and for 1981-2015. Two bioclimatic indices that incorporate non-linear plant-temperature relationships are selected for this purpose: growing degree hours—GDH (February-October) and chilling portions—CP (October-February). The current thermal growing conditions of each variety are examined and three clusters of grapevine cultivars are identified based on their GDH medians, thus assembling varieties with close heat accumulation requirements and providing more physiologically consistent information when compared to previous studies, as non-linear plant-temperature relationships are herein taken into account. These new clusters are also a complement to previous bioclimatic zoning. Ensemble mean projections under two anthropogenic-driven scenarios (RCP4.5 and RCP8.5, 2041-2070), from four EURO-CORDEX simulations, reveal a widespread increase of GDH and decrease of CP, but with spatial heterogeneities. The spatial variability of these indices throughout Portugal is projected to decrease (strongest increases of GDH in the coolest regions of the northeast) and to increase (strongest decreases of CP in the warmest regions of the south and west), respectively. The typical heat accumulation conditions of each cluster are projected to gradually shift north-eastwards and to higher-elevation areas, whereas insufficient chilling may represent a new challenge in warmer future climates. An unprecedented level of detail for a large collection of grapevine varieties in Portugal is provided, thus promoting a better planning of climate change adaptation measures.

Evaluation of biocontrol agents for grapevine pruning wound protection against trunk pathogen infection.

Directory of Open Access Journals (Sweden)

Charl KOTZE

2011-12-01

Full Text Available Trunk diseases of grapevine are caused by numerous pathogens, including Eutypa lata, Phaeomoniella chlamydospora, and species of Botryosphaeriaceae (incl. Botryosphaeria and aggregate genera, Phomopsis and Phaeoacremonium. Since infections occur mainly through pruning wounds, that have been shown by previous research to stay susceptible for up to 16 weeks after pruning, long-term pruning wound protection is required for prevention of infection. This study evaluated several biocontrol agents against a range of trunk disease pathogens in dual plate laboratory trials to determine macroscopic and microscopic interactions. The biocontrol agents had a substantial effect on all the pathogens, with a wide range of macroscopic and microscopic interactions observed. The best performing biocontrol agents were tested in two field trials. Fresh pruning wounds were treated with benomyl, Trichoderma products (Biotricho®, Vinevax® and ECO 77® and isolates (USPP-T1 and -T2, identified as T. atroviride and Bacillus subtilis. Seven days after treatment the pruning wounds were inoculated by spraying with spore suspensions of Neofusicoccum australe, N. parvum, Diplodia seriata, Lasiodiplodia theobromae, Eutypa lata, Phaeomoniella chlamydospora or Phomopsis viticola. Eight months after inoculation, the treatments were evaluated by isolation onto potato dextrose agar. The efficacy of the biocontrol agents was in most cases similar or superior to that observed for benomyl. Isolate USPP-T1, in particular, was very effective, reducing incidence of Ph. viticola, E. lata, Pa. chlamydospora, N. australe, N. parvum, D. seriata and L. theobromae by 69, 76, 77, 78, 80, 85 and 92%, respectively. This is the first report of biological protection of grapevine pruning wounds against this group of grapevine trunk disease pathogens.

Dissipation of glyphosate from grapevine soils in Sonora, Mexico

Directory of Open Access Journals (Sweden)

Norma J. Salazar López

2016-10-01

Full Text Available Grapevine is one of the important crops in Sonora, due to revenue generation from its export to foreign countries. Among the most widely used herbicides for this crop is glyphosate, which is considered moderately toxic and persistent. The present research evaluates the dissipation of glyphosate in grapevine planted soil at three depths (5, 30 and 60 cm. Sampling was carried out before glyphosate application, and 5, 10, 18, 27, and 65 days after. Glyphosate was extracted from soil samples using ammonium hydroxide. The derivate extracts were partitioned with dichloromethane and analyzed using gas chromatography with pulsed flame photometric detector (PFPD. The results showed that average glyphosate residues are significantly greater at 5 cm (0.09 mg kg-1 than the other depths (30 and 60 cm, having a difference of 0.078 mg kg-1 between them (P < 0.03. Glyphosate concentration time profiles were similar; it reached maximum soil concentration in a range of 10 to 18 days after application. The half-life of glyphosate in soil has an average of 39 days at all depths. Our data suggests that the release in soil of glyphosate applied to weeds delays its transference to soil by 14 days, and extends residue half life to 55 days after application. These results could be the basis for further research, including more environmental parameters that could affect the dissipation or degradation process in soil.

Impact of an arbuscular mycorrhizal fungus versus a mixed microbial inoculum on the transcriptome reprogramming of grapevine roots.

Science.gov (United States)

Balestrini, Raffaella; Salvioli, Alessandra; Dal Molin, Alessandra; Novero, Mara; Gabelli, Giovanni; Paparelli, Eleonora; Marroni, Fabio; Bonfante, Paola

2017-07-01

Grapevine, cultivated for both fruit and beverage production, represents one of the most economically important fruit crops worldwide. With the aim of better understanding how grape roots respond to beneficial microbes, a transcriptome sequencing experiment has been performed to evaluate the impact of a single arbuscular mycorrhizal (AM) fungal species (Funneliformis mosseae) versus a mixed inoculum containing a bacterial and fungal consortium, including different AM species, on Richter 110 rootstock. Results showed that the impact of a single AM fungus and of a complex microbial inoculum on the grapevine transcriptome differed. After 3 months, roots exclusively were colonized after the F. mosseae treatment and several AM marker genes were found to be upregulated. The mixed inoculum led only to traces of colonization by AM fungi, but elicited an important transcriptional regulation. Additionally, the expression of genes belonging to categories such as nutrient transport, transcription factors, and cell wall-related genes was significantly altered in both treatments, but the exact genes affected differed in the two conditions. These findings advance our understanding about the impact of soil beneficial microbes on the root system of a woody plant, also offering the basis for novel approaches in grapevine cultivation.

Cold stress decreases the capacity for respiratory NADH oxidation in potato leaves

DEFF Research Database (Denmark)

Svensson, Å.S.; Johansson, F.I.; Møller, I.M.

2002-01-01

is 10% of the original level. This decrease is accompanied by specific decreases of immunodetected NDA protein and internal rotenone-insensitive NADH oxidation in mitochondria isolated from cold-treated plants. The alternative oxidase is not cold-induced neither at the protein nor at the activity level......Cold stress effects on the expression of genes for respiratory chain enzymes were investigated in potato (Solarium tuberosum L., cv. Desiree) leaves. The nda1 and ndb1 genes, homologues to genes encoding the non-proton-pumping respiratory chain NADH dehydrogenases of Escherichia coli and yeast......, were compared to genes encoding catalytic subunits of the proton-pumping NADH dehydrogenase (complex I). Using a real-time PCR system, we demonstrate a specific and gradual decrease of the NDA1 transcript after exposing the plants to 5 C. After 6 days of cold treatment the NDA1 transcript abundance...

Oxidative stress response in Arabidopsis thaliana roots and leaves exposed to cadmium, uranium or a combination of both stressors

Energy Technology Data Exchange (ETDEWEB)

Horemans, N.; Saenen, E.; Vandenhove, H. [Belgian Nuclear Research Centre, SCK.CEN, Boeretang 200, 2400 Mol (Belgium); Hendrix, S.; Keunen, E.; Cuypers, A. [Hasselt University, Centre for Environmental Sciences, Agoralaan, Building D, 3590 Diepenbeek (Belgium)

2014-07-01

Nuclear energy production or NORM industry released low amounts of radioactive substances together with non-radioactive substances (e.g., heavy metals, organic chemicals) to the environment. As sessile organisms, plants are commonly exposed to a number of adverse conditions and therefore it is interesting to study the stress responses of plants induced by the single stressors as well as in a in a multi-pollution set-up. The aim of this study was to understand and predict fast induced oxidative stress responses in plants exposed to Cd and U or a combination of both stressors. Arabidopsis thaliana plants grown hydroponically for 18 days were exposed to a Cd (5 μM) or {sup 238}U (25 μM) or an equi-toxic mixture of Cd and {sup 238}U (2.5 μM + 12.5 μM) for 24 h. As expected both metals were taken up into the plants with Cd being more readily transported to the leaves than U. The root-to-shoot ratio was approximately 1,3 for Cd whereas it was above 3500 for U. For both U and Cd the root-to-shoot ratio was not affected under multiple exposure conditions used here. Notwithstanding the limited exposure time, leave and root fresh weight was already decreasing in U-treated plants. For Cd or Cd+U a decreasing but at this point not significant trend was visible. As U concentrations in the leaves were very low the decrease in leaf fresh weight is possibly due to signaling from the roots rather than a direct toxicity of U. The oxidative stress response was investigated by measuring the transcription of selected pro- and anti-oxidative genes, anti-oxidative enzyme capacities and concentration and redox status of major anti-oxidative metabolites. Cd strongly up-regulated lipoxygenase (LOX1) and NADPH-oxidases (RBOHD or C in roots and leaves, respectively) whereas this was not found in the U-treated plants. For the anti-oxidative response related enzymes both Cd and U induced a decrease in Cu/Zn superoxide dismutases (CSD1,2) and a concomitant increase in Fe-SOD (FSD1). However

Quality information from the grapevine.

Science.gov (United States)

Laszlo, Pierre

2010-07-01

A letter by Lucien Herr, a highly regarded leading French intellectual at the time of World War I, provides capsule portraits of chemists such as Gabriel Bertrand, Paul Lebeau, Charles Moureu, and Georges Urbain. It makes us better aware of who they were and of how their contemporaries saw their work, which had much to do with their personalities, whether congenial or abrasive. This article is concerned with the kind of information carried by the so-called grapevine. It can be invaluable to the historian, for the light it sheds on the character of a scientist. The document drawn upon, from World War I (1915), depicts graphically the personalities of some of the French chemists engaged in the rush to design and produce chemical weapons. It is a frank and even brutal appraisal of their strengths and weaknesses. This is the kind of evaluation that scientists routinely engage in, but devoid of the hyperbole, pro or con, which usually flavours it.

Nitrogen nutrition of the grape-vine (Vitis vinifera spp)

International Nuclear Information System (INIS)

Conradie, W.J.

1985-12-01

A thorough knowledge concerning the nitrogen relationship in the grape-vine is essential in order to appreciate how different patterns of uptake, assimilation, storage and utilisation of nitrogen might be advantageous in particular environmental situations. The 15 N-isotope technique has been used to determine the uptake and distribution of nitrogen absorbed during early spring, early summer and autumn. Apart from the total N fraction, protein N and soluble N were determined as well. The utilisation of labelled N applied in the field, was determined for vineyards on heavier and lighter soils

Transcriptional profiling of sugarcane leaves and roots under progressive osmotic stress reveals a regulated coordination of gene expression in a spatiotemporal manner.

Directory of Open Access Journals (Sweden)

Alejandro Pereira-Santana

Full Text Available Sugarcane is one of the most important crops worldwide and is a key plant for the global production of sucrose. Sugarcane cultivation is severely affected by drought stress and it is considered as the major limiting factor for their productivity. In recent years, this plant has been subjected to intensive research focused on improving its resilience against water scarcity; particularly the molecular mechanisms in response to drought stress have become an underlying issue for its improvement. To better understand water stress and the molecular mechanisms we performed a de novo transcriptomic assembly of sugarcane (var. Mex 69-290. A total of 16 libraries were sequenced in a 2x100 bp configuration on a HiSeq-Illumina platform. A total of 536 and 750 genes were differentially up-regulated along with the stress treatments for leave and root tissues respectively, while 1093 and 531 genes were differentially down-regulated in leaves and roots respectively. Gene Ontology functional analysis showed that genes related to response of water deprivation, heat, abscisic acid, and flavonoid biosynthesis were enriched during stress treatment in our study. The reliability of the observed expression patterns was confirmed by RT-qPCR. Additionally, several physiological parameters of sugarcane were significantly affected due to stress imposition. The results of this study may help identify useful target genes and provide tissue-specific data set of genes that are differentially expressed in response to osmotic stress, as well as a complete analysis of the main groups is significantly enriched under this condition. This study provides a useful benchmark for improving drought tolerance in sugarcane and other economically important grass species.

Identification of Agrobacterium vitis as a causal agent of grapevine crown gall in Serbia

Directory of Open Access Journals (Sweden)

Kuzmanović N.

2012-01-01

Full Text Available In 2010, a serious outbreak of crown gall disease was observed on grapevines (Vitis vinifera L. cv. Cabernet Sauvignon in several commercial vineyards located in the Vojvodina province, Serbia. Bacteria were isolated from the young tumor tissue on nonselective YMA medium and five representative strains were selected for further identification. Tumorigenic (Ti plasmid was detected in all strains by PCR using primers designed to amplify the virC pathogenicity gene, producing a 414-bp PCR product. The strains were identified as Agrobacterium vitis using differential physiological and biochemical tests, and a multiplex PCR assay targeting 23S rRNA gene sequences. In the pathogenicity assay, all strains induced characteristic symptoms on inoculated tomato and grapevine plants. They were less virulent on tomato plants in comparison to the reference strains of A. tumefaciens and A. vitis. [Ministarstva nauke Republike Srbije, br. III46008: Development of integrated management of harmful organisms in plant production in order to overcome resistance and to improve food quality and safety

Desfolha em videiras americanas e viníferas na fase de pré-maturação dos frutos Defoliation of american and vinifera grapevines in the pre ripening of fruits

Directory of Open Access Journals (Sweden)

Rafael Anzanello

2011-07-01

2006/2007 harvesting. The experiment was disposed in a randomized block design, with four replications and four plants per plot. The following treatments were tested: T1 (no defoliation, T2 (removal of leaves located in the opposite side of the grapes, T3 (removal of leaves located under the grapes and T4 (removal of leaves located under and in the opposite side of the grapes. The Vitis labrusca received an additional treatment (T5 consisting of leaves removed above the grapes. These treatments were applied during the change of berries color for Concord, Cabernet Sauvignon and Merlot grapes and in the beginning of berries softening for Niagara Branca grape. After the harvesting, the grapevine production, cluster weight, total soluble solids, total titratable acidity and pH were evaluated. It was observed that the defoliation until the grapes height did not influence the quantity and quality of grapes. However, when the defoliation was carried out above the clusters, there was a delay in the maturation of american grapes. This condition shows that is not necessary a selective desfolation until the clusters height on grapevines, when it is realized during the initial fruit ripening phase.

Cloning, expression, purification and crystallization of dihydrodipicolinate synthase from the grapevine Vitis vinifera

International Nuclear Information System (INIS)

Atkinson, Sarah C.; Dogovski, Con; Newman, Janet; Dobson, Renwick C. J.; Perugini, Matthew A.

2011-01-01

Dihydrodipicolinate synthase from the common grapevine V. vinifera has been cloned, expressed, purified and crystallized in the presence of the substrate pyruvate by in-drop hexahistidine-tag cleavage. A diffraction data set has been collected to a resolution of 2.2 Å. Dihydrodipicolinate synthase (DHDPS) catalyses the first committed step of the lysine-biosynthesis pathway in bacteria, plants and some fungi. This study describes the cloning, expression, purification and crystallization of DHDPS from the grapevine Vitis vinifera (Vv-DHDPS). Following in-drop cleavage of the hexahistidine tag, cocrystals of Vv-DHDPS with the substrate pyruvate were grown in 0.1 M Bis-Tris propane pH 8.2, 0.2 M sodium bromide, 20%(w/v) PEG 3350. X-ray diffraction data in space group P1 at a resolution of 2.2 Å are presented. Preliminary diffraction data analysis indicated the presence of eight molecules per asymmetric unit (V M = 2.55 Å 3 Da −1 , 52% solvent content). The pending crystal structure of Vv-DHDPS will provide insight into the molecular evolution in quaternary structure of DHDPS enzymes

Silencing Agrobacterium oncogenes in transgenic grapevine results in strain-specific crown gall resistance.

Science.gov (United States)

Galambos, A; Zok, A; Kuczmog, A; Oláh, R; Putnoky, P; Ream, W; Szegedi, E

2013-11-01

Grapevine rootstock transformed with an Agrobacterium oncogene-silencing transgene was resistant to certain Agrobacterium strains but sensitive to others. Thus, genetic diversity of Agrobacterium oncogenes may limit engineering crown gall resistance. Crown gall disease of grapevine induced by Agrobacterium vitis or Agrobacterium tumefaciens causes serious economic losses in viticulture. To establish crown gall-resistant lines, somatic proembryos of Vitis berlandieri × V. rupestris cv. 'Richter 110' rootstock were transformed with an oncogene-silencing transgene based on iaaM and ipt oncogene sequences from octopine-type, tumor-inducing (Ti) plasmid pTiA6. Twenty-one transgenic lines were selected, and their transgenic nature was confirmed by polymerase chain reaction (PCR). These lines were inoculated with two A. tumefaciens and three A. vitis strains. Eight lines showed resistance to octopine-type A. tumefaciens A348. Resistance correlated with the expression of the silencing genes. However, oncogene silencing was mostly sequence specific because these lines did not abolish tumorigenesis by A. vitis strains or nopaline-type A. tumefaciens C58.

Characterization of the largest relic Eurasian wild grapevine reservoir in Southern Iberian Peninsula

Energy Technology Data Exchange (ETDEWEB)

Arroyo-García, R.; Cantos, M.; Lara, M.; López, M.A.; Gallardo, A.; Ocete, C.A.; Pérez, A.; Bánáti, B.; García, J.L.; Ocete, R.

2016-11-01

Wild grapevine is becoming a threatened species in the Iberian Peninsula due to human impacts. The aim of this work was to carry out a holistic study for six years of the largest wild grapevine population found up to date in SW Iberian Peninsula. This population has 115 vines. Ampelographic and soil characteristics have been studied. Evaluation of its environment has also been studied by describing the main parasitic species and natural enemies of pests. The ability of this plant material for its micropropagation and storage in slow-growth conditions has been tested. Microvinification resulted in a wine with good acidity and medium color intensity, two interesting characteristics under a warm climatology. Finally, the identification of private alleles in this wild population, absent in other locations from the Northern and Southern Iberian territories, is a very valuable feature and confirms the importance of establishing conservation programs. The population here studied is genetically unique and potentially useful for commercial rootstocks and cultivars breeding that would improve viticulture and enology. (Author)

Preliminary study on biomarkers for the fungal resistance in Vitis vinifera leaves.

Science.gov (United States)

Batovska, Daniela Ilieva; Todorova, Iva Todorova; Nedelcheva, Daniela Valentinova; Parushev, Stoyan Parushev; Atanassov, Atanas Ivanov; Hvarleva, Tzvetanka Dimitrova; Djakova, Galina Jordanova; Bankova, Vassya Stefanova; Popov, Simeon Simeonov

2008-05-26

We examined the leaf chemical composition of six seedlings obtained by self-pollination of the Bulgarian wine-making variety Storgozia as well as the cultivar Bouquet, which is the susceptible parent of Storgozia. The chemical composition was investigated in the framework of a program for identification of metabolites associated with disease resistance in grape-vine. Acetone, dichloromethane and butanol extracts, as well as volatiles obtained from fresh material were analyzed by GC/MS. Based on the correlations of the GC/MS data and estimated resistance of the leaves towards the etiological agents of powdery mildew, downy mildew and botrytis as biomarkers for the fungal resistance, we proposed 16 individual metabolites--alpha- and gamma-tocopherol, squalene, alpha-amyrine, stigmasta-3,5-diene-7-one, hexahydrofarnesyl acetone, glycolic acid, 3-hydroxybutanoic acid, 3-hydroxycaproic acid, malic acid, tartaric acid, erythronic acid, arabinoic acid, monoethyl phosphate, undecyl laurate and isopropyl myristate. The obtained correlations were confirmed by cluster analysis.

Proteomic analysis of shoot tissue during photoperiod induced growth cessation in V. riparia Michx. grapevines

Directory of Open Access Journals (Sweden)

Victor Kim J

2010-08-01

Full Text Available Abstract Background Growth cessation, cold acclimation and dormancy induction in grapevines and other woody perennial plants native to temperate continental climates is frequently triggered by short photoperiods. The early induction of these processes by photoperiod promotes winter survival of grapevines in cold temperate zones. Examining the molecular processes, in particular the proteomic changes in the shoot, will provide greater insight into the signaling cascade that initiates growth cessation and dormancy induction. To begin understanding transduction of the photoperiod signal, Vitis riparia Michx. grapevines that had grown for 35 days in long photoperiod (long day, LD, 15 h were subjected to either a continued LD or a short photoperiod (short day, SD, 13 h treatment. Shoot tips (4-node shoot terminals were collected from each treatment at 7 and 28 days of LD and SD for proteomic analysis via two-dimensional (2D gel electrophoresis. Results Protein profiles were characterized in V. riparia shoot tips during active growth or SD induced growth cessation to examine physiological alterations in response to differential photoperiod treatments. A total of 1054 protein spots were present on the 2D gels. Among the 1054 proteins, 216 showed differential abundance between LD and SD (≥ two-fold ratio, p-value ≤ 0.05. After 7 days, 39 protein spots were more abundant in LD and 30 were more abundant in SD. After 28 days, 93 protein spots were more abundant in LD and 54 were more abundant in SD. MS/MS spectrometry was performed to determine the functions of the differentially abundant proteins. Conclusions The proteomics analysis uncovered a portion of the signal transduction involved in V. riparia grapevine growth cessation and dormancy induction. Different enzymes of the Calvin-Benson cycle and glutamate synthetase isoforms were more abundant either in LD or SD treatments. In LD tissues the significantly differentially more abundant proteins

Proteomic analysis of shoot tissue during photoperiod induced growth cessation in V. riparia Michx. grapevines

Science.gov (United States)

2010-01-01

Background Growth cessation, cold acclimation and dormancy induction in grapevines and other woody perennial plants native to temperate continental climates is frequently triggered by short photoperiods. The early induction of these processes by photoperiod promotes winter survival of grapevines in cold temperate zones. Examining the molecular processes, in particular the proteomic changes in the shoot, will provide greater insight into the signaling cascade that initiates growth cessation and dormancy induction. To begin understanding transduction of the photoperiod signal, Vitis riparia Michx. grapevines that had grown for 35 days in long photoperiod (long day, LD, 15 h) were subjected to either a continued LD or a short photoperiod (short day, SD, 13 h) treatment. Shoot tips (4-node shoot terminals) were collected from each treatment at 7 and 28 days of LD and SD for proteomic analysis via two-dimensional (2D) gel electrophoresis. Results Protein profiles were characterized in V. riparia shoot tips during active growth or SD induced growth cessation to examine physiological alterations in response to differential photoperiod treatments. A total of 1054 protein spots were present on the 2D gels. Among the 1054 proteins, 216 showed differential abundance between LD and SD (≥ two-fold ratio, p-value ≤ 0.05). After 7 days, 39 protein spots were more abundant in LD and 30 were more abundant in SD. After 28 days, 93 protein spots were more abundant in LD and 54 were more abundant in SD. MS/MS spectrometry was performed to determine the functions of the differentially abundant proteins. Conclusions The proteomics analysis uncovered a portion of the signal transduction involved in V. riparia grapevine growth cessation and dormancy induction. Different enzymes of the Calvin-Benson cycle and glutamate synthetase isoforms were more abundant either in LD or SD treatments. In LD tissues the significantly differentially more abundant proteins included flavonoid

Glutathione reductase in leaves of cowpea: cloning of two cDNAs, expression and enzymatic activity under progressive drought stress, desiccation and abscisic acid treatment.

Science.gov (United States)

Contour-Ansel, Dominique; Torres-Franklin, Maria Lucia; Cruz DE Carvalho, Maria Helena; D'Arcy-Lameta, Agnès; Zuily-Fodil, Yasmine

2006-12-01

Reactive oxygen species are frequently produced when plants are exposed to abiotic stresses. Among the detoxication systems, two enzymes, ascorbate peroxidase and glutathione reductase (GR) play key roles. GR has also a central role in keeping the reduced glutathione pool during stress thus allowing the adjustments on the cellular redox reactions. The aim of this work was to study the variations in cytosolic and dual-targeted GR gene expression in the leaves of cowpea plants submitted to progressive drought, rapid desiccation and application of exogenous abscisic acid (ABA). Two cowpea (Vigna unguiculata) cultivars, one drought-resistant ('EPACE-1'), the other drought-sensitive ('1183') were submitted to progressive drought stress by withholding irrigation. Cut-off leaves were air-dried or treated with exogenous ABA. Two GR cDNAs, one cytosolic, the other dual-targeted to chloroplasts and mitochondria were isolated by PCR and cloned in plasmid vectors. Reverse-transcription PCR was used to study the variations in GR gene expression. Two new cDNAs encoding a putative dual-targeted and a cytosolic GR were cloned and sequenced from leaves of V. unguiculata. Drought stress induced an up-regulation of the expression of the cytosolic GR gene directly related to the intensity of the stress in both cultivars. The expression of dual-targeted GR was up-regulated by the drought treatment in the susceptible cultivar only. Under a fast desiccation, the '1183' cultivar responded later than the 'EPACE-1', although in 'EPACE-1' it was the cytosolic isoform which responded and in '1183' the dual-targeted one. Exogenous ABA enhanced significantly the activity and expression levels of GR in both cultivars after treatment for 24 h. These results demonstrate a noticeable activation in both cultivars of the antioxidant metabolism under a progressive water stress, which involves both GR genes in the case of the susceptible cultivar. Under a fast desiccation, the susceptible cultivar

Relative Prevalence of Grapevine Leafroll-Associated Virus Species in Wine Grape-Growing Regions of California.

Directory of Open Access Journals (Sweden)

Abhineet M Sharma

Full Text Available Some diseases manifest as one characteristic set of symptoms to the host, but can be caused by multiple pathogens. Control treatments based on plant symptoms can make it difficult to effectively manage such diseases, as the biology of the underlying pathogens can vary. Grapevine leafroll disease affects grapes worldwide, and is associated with several viral species in the family Closteroviridae. Whereas some of the viruses associated with this disease are transmitted by insect vectors, others are only graft-transmissible. In three regions of California, we surveyed vineyards containing diseased vines and screened symptomatic plants for all known viral species associated with grapevine leafroll disease. Relative incidence of each virus species differed among the three regions regions, particularly in relation to species with known vectors compared with those only known to be graft-transmitted. In one region, the pathogen population was dominated by species not known to have an insect vector. In contrast, populations in the other surveyed regions were dominated by virus species that are vector-transmissible. Our survey did not detect viruses associated with grapevine leafroll disease at some sites with characteristic disease symptoms. This could be explained either by undescribed genetic diversity among these viruses that prevented detection with available molecular tools at the time the survey was performed, or a misidentification of visual symptoms that may have had other underlying causes. Based on the differences in relative prevalence of each virus species among regions and among vineyards within regions, we expect that region and site-specific management strategies are needed for effective disease control.

Magnetic resonance imaging of water ascent in embolized xylem vessels of grapevine stem segments

Science.gov (United States)

Mingtao Wang; Melvin T. Tyree; Roderick E. Wasylishen

2013-01-01

Temporal and spatial information about water refilling of embolized xylem vessels and the rate of water ascent in these vessels is critical for understanding embolism repair in intact living vascular plants. High-resolution 1H magnetic resonance imaging (MRI) experiments have been performed on embolized grapevine stem segments while they were...

Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

OpenAIRE

Le Gall, O; Candresse, T; Brault, V; Dunez, J

1989-01-01

The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that o...

Abstracts of oral and poster presentations given at the 8th International Workshop on Grapevine Trunk Diseases, Valencia, Spain, 18–21 June 2012

Directory of Open Access Journals (Sweden)

AA. VV.

2012-09-01

Full Text Available The 8th International Workshop on Grapevine Trunk Diseases was held in Valencia, Spain, on June 18–21 2012. The meeting was attended by 120 participants and 103 papers were presented either as oral or poster presentations in four sessions: Pathogen Detection and Characterization, Epidemiology, Host-Pathogen Interaction and Disease Management. A special session was dedicated on implications of trunk diseases for grapevine nurseries with five invited presentations, followed by several oral and poster presentations. A field trip to the Utiel-Requena wine-producing area was undertaken on June the 20th, including visits to vineyards and a winery. The workshop is the 8th organised by members of the International Council on Grapevine Trunk Diseases (www.icgtd.org, a subject matter committee of the International Society for Plant Pathology (www.isppweb.org.

VitisNet: "Omics" integration through grapevine molecular networks.

Directory of Open Access Journals (Sweden)

Jérôme Grimplet

Full Text Available BACKGROUND: Genomic data release for the grapevine has increased exponentially in the last five years. The Vitis vinifera genome has been sequenced and Vitis EST, transcriptomic, proteomic, and metabolomic tools and data sets continue to be developed. The next critical challenge is to provide biological meaning to this tremendous amount of data by annotating genes and integrating them within their biological context. We have developed and validated a system of Grapevine Molecular Networks (VitisNet. METHODOLOGY/PRINCIPAL FINDINGS: The sequences from the Vitis vinifera (cv. Pinot Noir PN40024 genome sequencing project and ESTs from the Vitis genus have been paired and the 39,424 resulting unique sequences have been manually annotated. Among these, 13,145 genes have been assigned to 219 networks. The pathway sets include 88 "Metabolic", 15 "Genetic Information Processing", 12 "Environmental Information Processing", 3 "Cellular Processes", 21 "Transport", and 80 "Transcription Factors". The quantitative data is loaded onto molecular networks, allowing the simultaneous visualization of changes in the transcriptome, proteome, and metabolome for a given experiment. CONCLUSIONS/SIGNIFICANCE: VitisNet uses manually annotated networks in SBML or XML format, enabling the integration of large datasets, streamlining biological functional processing, and improving the understanding of dynamic processes in systems biology experiments. VitisNet is grounded in the Vitis vinifera genome (currently at 8x coverage and can be readily updated with subsequent updates of the genome or biochemical discoveries. The molecular network files can be dynamically searched by pathway name or individual genes, proteins, or metabolites through the MetNet Pathway database and web-portal at http://metnet3.vrac.iastate.edu/. All VitisNet files including the manual annotation of the grape genome encompassing pathway names, individual genes, their genome identifier, and chromosome

European grapevine moth (Lobesia botrana Denis and Schiff. (Lepidoptera: Totricidae – occurence and management in Istrian vineyards

Directory of Open Access Journals (Sweden)

Renata Bažok

2016-02-01

Full Text Available The aim of this paper was to identify European grapevine moths (Lobesia botrana Denis and Schiff. flight dynamics, larvae occurrence and degree-day accumulations (DDA for each moth generation in two Istrian vineyards with different pest management practices. The moth has developed three generations. During the third generation there was a significant flight peak in the vineyard without pest management. Predictions about larvae number and possible damage must be based on both, visual monitoring of grapevine and weekly adults catch. Developmental time with lower thermal threshold of 7 °C was calculated. The flight of the first generation was between 217.9 and 406.6 °C, second generation between 786.3 and 1329.8 °C, third generation between 1452.8 and 2108.2 °C.

High taxonomic diversity of cultivation-recalcitrant endophytic bacteria in grapevine field shoots, their in vitro introduction, and unsuspected persistence.

Science.gov (United States)

Thomas, Pious; Sekhar, Aparna C; Shaik, Sadiq Pasha

2017-11-01

Molecular and microscopic analyses reveal enormous non-cultivable endophytic bacteria in grapevine field shoots with functional significance. Diverse bacteria enter tissue cultures through surface-sterilized tissues and survive surreptitiously with varying taxonomic realignments. The study was envisaged to assess the extent of endophytic bacterial association with field shoot tissues of grapevine and the likelihood of introduction of such internally colonizing bacteria in vitro adopting molecular techniques targeting the non-cultivable bacterial community. PowerFood ® -kit derived DNA from surface-sterilized field shoot tips of grapevine Flame Seedless was employed in a preliminary bacterial class-specific PCR screening proving positive for major prokaryotic taxa including Archaea. Taxonomic and functional diversity were analyzed through whole metagenome profiling (WMG) which revealed predominantly phylum Actinobacteria, Proteobacteria, and minor shares of Firmicutes, Bacteroidetes, and Deinococcus-Thermus with varying functional roles ascribable to the whole bacterial community. Field shoot tip tissues and callus derived from stem segments were further employed in 16S rRNA V3-V4 amplicon taxonomic profiling. This revealed elevated taxonomic diversity in field shoots over WMG, predominantly Proteobacteria succeeded by Actinobacteria, Firmicutes, Bacteroidetes, and 15 other phyla including several candidate phyla (135 families, 179 genera). Callus stocks also displayed broad bacterial diversity (16 phyla; 96 families; 141 genera) bearing resemblance to field tissues with Proteobacterial dominance but a reduction in its share, enrichment of Actinobacteria and Firmicutes, disappearance of some field-associated phyla and detection of a few additional taxonomic groups over field community. Similar results were documented during 16S V3-V4 amplicon taxonomic profiling on Thompson Seedless field shoot tip and callus tissues. Video microscopy on tissue homogenates

The Type II Secreted Lipase/Esterase LesA is a Key Virulence Factor Required for Xylella fastidiosa Pathogenesis in Grapevines.

Science.gov (United States)

Nascimento, Rafael; Gouran, Hossein; Chakraborty, Sandeep; Gillespie, Hyrum W; Almeida-Souza, Hebréia O; Tu, Aye; Rao, Basuthkar J; Feldstein, Paul A; Bruening, George; Goulart, Luiz R; Dandekar, Abhaya M

2016-01-12

Pierce's disease (PD) of grapevines is caused by Xylella fastidiosa (Xf), a xylem-limited gamma-proteobacterium that is responsible for several economically important crop diseases. The occlusion of xylem elements and interference with water transport by Xf and its associated biofilm have been posited as the main cause of PD symptom development; however, Xf virulence mechanisms have not been described. Analysis of the Xf secretome revealed a putative lipase/esterase (LesA) that was abundantly secreted in bacterial culture supernatant and was characterized as a protein ortholog of the cell wall-degrading enzyme LipA of Xanthomonas strains. LesA was secreted by Xf and associated with a biofilm filamentous network. Additional proteomic analysis revealed its abundant presence in outer membrane vesicles (OMVs). Accumulation of LesA in leaf regions associated positively with PD symptoms and inversely with bacterial titer. The lipase/esterase also elicited a hypersensitive response in grapevine. Xf lesA mutants were significantly deficient for virulence when mechanically inoculated into grapevines. We propose that Xf pathogenesis is caused by LesA secretion mediated by OMV cargos and that its release and accumulation in leaf margins leads to early stages of observed PD symptoms.

Predicting the occurrence of iron chlorosis in grapevine with tests based on soil iron forms

Directory of Open Access Journals (Sweden)

Isabel Díaz de la Torre

2010-06-01

Significance and impact of study: This study has shown the limited usefulness of tests based on the contents and reactivity of the soil carbonate to predict the occurrence of Fe chlorosis in grapevine; tests capable of estimating the contents of the labile soil Fe forms constitute the best alternative.

Presence and uses of wild grapevine (Vitis spp. in the central region of Veracruz in Mexico

Directory of Open Access Journals (Sweden)

Juan Guillermo Cruz-Castillo

2009-06-01

Significance and impact of study: The exploration of Vitis spp. in the area studied raises the possibility of finding new hybrids or multi-hybrids between species. Wild grapevines could be used to produce natural products that could be sold on the market.

Genetic diversity and geographical dispersal in grapevine clones revealed by microsatellite markers.

Science.gov (United States)

Moncada, Ximena; Pelsy, Frédérique; Merdinoglu, Didier; Hinrichsen, Patricio

2006-11-01

Intravarietal genetic diversification associated with geographical dispersal of a vegetatively propagated species was studied using grapevine Vitis vinifera L. 'Cabernet Sauvignon' as a model. Fifty-nine clonal samples obtained from 7 countries (France, Chile, Spain, Australia, Hungary, USA, and Italy) were analyzed using 84 microsatellite markers. Eighteen polymorphic microsatellite loci (21.4%) were detected, finding 22 different genotypes in the population analyzed with a genetic similarity of over 97%. The presence of chimeric clones was evidenced at locus VMC5g7 by means of a segregation analysis of descendants by self-pollination of a triallelic Chilean clone and by somatic embryogenesis analysis, showing a mutation in L2 cell layer. Only 2 clones (obtained from France and Australia) presented the ancestral genotype, and the most divergent genotype was exhibited by another French clone, which had accumulated 5 somatic mutations. The 2 largest populations considered (from France and Chile) showed a clear divergency in the polymorphisms detected. These antecedents enabled the tracing of geographical dispersal with a phylogenetic hypothesis supporting France as the center of origin of diversification of Cabernet Sauvignon. The results obtained could help to explain diversification processes in other grapevine cultivars. The possibility that this kind of genetic variability occurs in other vegetatively propagated species is discussed, focusing on possible fingerprinting applications.

Modelling climate change impacts on viticultural yield, phenology and stress conditions in Europe.

Science.gov (United States)

Fraga, Helder; García de Cortázar Atauri, Iñaki; Malheiro, Aureliano C; Santos, João A

2016-11-01

Viticulture is a key socio-economic sector in Europe. Owing to the strong sensitivity of grapevines to atmospheric factors, climate change may represent an important challenge for this sector. This study analyses viticultural suitability, yield, phenology, and water and nitrogen stress indices in Europe, for present climates (1980-2005) and future (2041-2070) climate change scenarios (RCP4.5 and 8.5). The STICS crop model is coupled with climate, soil and terrain databases, also taking into account CO 2 physiological effects, and simulations are validated against observational data sets. A clear agreement between simulated and observed phenology, leaf area index, yield and water and nitrogen stress indices, including the spatial differences throughout Europe, is shown. The projected changes highlight an extension of the climatic suitability for grapevines up to 55°N, which may represent the emergence of new winemaking regions. Despite strong regional heterogeneity, mean phenological timings (budburst, flowering, veraison and harvest) are projected to undergo significant advancements (e.g. budburst/harvest can be >1 month earlier), with implications also in the corresponding phenophase intervals. Enhanced dryness throughout Europe is also projected, with severe water stress over several regions in southern regions (e.g. southern Iberia and Italy), locally reducing yield and leaf area. Increased atmospheric CO 2 partially offsets dryness effects, promoting yield and leaf area index increases in central/northern Europe. Future biomass changes may lead to modifications in nitrogen demands, with higher stress in northern/central Europe and weaker stress in southern Europe. These findings are critical decision support systems for stakeholders from the European winemaking sector. © 2016 John Wiley & Sons Ltd.

Inheritance of downy mildew (Plasmopara viticola) and anthracnose (Sphaceloma ampelinum) resistance in grapevines.

Science.gov (United States)

Poolsawat, O; Mahanil, S; Laosuwan, P; Wongkaew, S; Tharapreuksapong, A; Reisch, B I; Tantasawat, P A

2013-12-13

Downy mildew (Plasmopara viticola) and anthracnose (Sphaceloma ampelinum) are two of the major diseases of most grapevine (Vitis vinifera L.) cultivars grown in Thailand. Therefore, breeding grapevines for improved downy mildew and anthracnose resistance is crucial. Factorial crosses were made between three downy mildew and/or anthracnose resistant lines ('NY88.0517.01', 'NY65.0550.04', and 'NY65.0551.05'; male parents) and two or three susceptible cultivars of V. vinifera ('Black Queen', 'Carolina Black Rose', and/or 'Italia'; female parents). F1 hybrid seedlings were evaluated for downy mildew and anthracnose resistance using a detached/excised leaf assay. For both diseases, the general combining ability (GCA) variance among male parents was significant, while the variance of GCA among females and the specific combining ability (SCA) variance were not significant, indicating the prevalence of additive over non-additive gene actions. The estimated narrow sense heritabilities of downy mildew and anthracnose resistance were 55.6 and 79.2%, respectively, suggesting that downy mildew/anthracnose resistance gene(s) were highly heritable. The 'Carolina Black Rose x NY65.0550.04' cross combination is recommended for future use.

Impact of soil texture and water availability on the hydraulic control of plant and grape-berry development

Science.gov (United States)

Sara Tramontini; Cornelis van Leeuwen; Jean-Christophe Domec; Agnès Destrac-Irvine; Cyril Basteau; Marco Vitali; Olaf Mosbach-Schulz; Claudio Lovisolo

2013-01-01

All components of the soil-plant-atmosphere (s-p-a) continuum are known to control berry quality in grapevine (Vitis vinifera L.) via ecophysiological interactions between water uptake by roots and water loss by leaves. The scope of the present work was to explore how the main hydraulic components of grapevine influence fruit quality through changes...

Tolerance to oxidative stress is required for maximal xylem colonization by the xylem-limited bacterial phytopathogen, Xylella fastidiosa.

Science.gov (United States)

Wang, Peng; Lee, Yunho; Igo, Michele M; Roper, M Caroline

2017-09-01

Bacterial plant pathogens often encounter reactive oxygen species (ROS) during host invasion. In foliar bacterial pathogens, multiple regulatory proteins are involved in the sensing of oxidative stress and the activation of the expression of antioxidant genes. However, it is unclear whether xylem-limited bacteria, such as Xylella fastidiosa, experience oxidative stress during the colonization of plants. Examination of the X. fastidiosa genome uncovered only one homologue of oxidative stress regulatory proteins, OxyR. Here, a knockout mutation in the X. fastidiosa oxyR gene was constructed; the resulting strain was significantly more sensitive to hydrogen peroxide (H 2 O 2 ) relative to the wild-type. In addition, during early stages of grapevine infection, the survival rate was 1000-fold lower for the oxyR mutant than for the wild-type. This supports the hypothesis that grapevine xylem represents an oxidative environment and that X. fastidiosa must overcome this challenge to achieve maximal xylem colonization. Finally, the oxyR mutant exhibited reduced surface attachment and cell-cell aggregation and was defective in biofilm maturation, suggesting that ROS could be a potential environmental cue stimulating biofilm development during the early stages of host colonization. © 2016 BSPP AND JOHN WILEY & SONS LTD.

RUN1 and REN1 Pyramiding in Grapevine (Vitis vinifera cv. Crimson Seedless) Displays an Improved Defense Response Leading to Enhanced Resistance to Powdery Mildew (Erysiphe necator)

Science.gov (United States)

Agurto, Mario; Schlechter, Rudolf O.; Armijo, Grace; Solano, Esteban; Serrano, Carolina; Contreras, Rodrigo A.; Zúñiga, Gustavo E.; Arce-Johnson, Patricio

2017-01-01

Fungal pathogens are the cause of the most common diseases in grapevine and among them powdery mildew represents a major focus for disease management. Different strategies for introgression of resistance in grapevine are currently undertaken in breeding programs. For example, introgression of several resistance genes (R) from different sources for making it more durable and also strengthening the plant defense response. Taking this into account, we cross-pollinated P09-105/34, a grapevine plant carrying both RUN1 and REN1 pyramided loci of resistance to Erysiphe necator inherited from a pseudo-backcrossing scheme with Muscadinia rotundifolia and Vitis vinifera ‘Dzhandzhal Kara,’ respectively, with the susceptible commercial table grape cv. ‘Crimson Seedless.’ We developed RUN1REN1 resistant genotypes through conventional breeding and identified them by marker assisted selection. The characterization of defense response showed a highly effective defense mechanism against powdery mildew in these plants. Our results reveal that RUN1REN1 grapevine plants display a robust defense response against E. necator, leading to unsuccessful fungal establishment with low penetration rate and poor hypha development. This resistance mechanism includes reactive oxygen species production, callose accumulation, programmed cell death induction and mainly VvSTS36 and VvPEN1 gene activation. RUN1REN1 plants have a great potential as new table grape cultivars with durable complete resistance to E. necator, and are valuable germplasm to be included in grape breeding programs to continue pyramiding with other sources of resistance to grapevine diseases. PMID:28553300

Identification of the female-produced sex pheromone of the leafminer Holocacista capensis infesting grapevine in South Africa

NARCIS (Netherlands)

Wang, H.-L.; Geertsema, H.; Nieukerken, van E.J.; Löfstedt, C.

2015-01-01

We report the first identification of a sex pheromone in a heliozelid moth, Holocacista capensis van Nieukerken & Geertsema. This leafminer recently infested grapevine in South Africa. Compared to solvent extraction of pheromone glands, solid phase microextraction (SPME) proved to be highly

The bouquet of grapevine (Vitis vinifera L. cv. Cabernet Sauvignon) flowers arises from the biosynthesis of sesquiterpene volatiles in pollen grains

Science.gov (United States)

Martin, Diane M.; Toub, Omid; Chiang, Angela; Lo, Bernard C.; Ohse, Sebastian; Lund, Steven T.; Bohlmann, Jörg

2009-01-01

Terpenoid volatiles are important information molecules that enable pollinators to locate flowers and may protect reproductive tissues against pathogens or herbivores. Inflorescences of grapevine (Vitis vinifera L.) are composed of tiny green flowers that produce an abundance of sesquiterpenoid volatiles. We demonstrate that male flower parts of grapevines are responsible for sesquiterpenoid floral scent formation. We describe temporal and spatial patterns of biosynthesis and release of floral volatiles throughout the blooming of V. vinifera L. cv. Cabernet Sauvignon. The biosynthesis of sesquiterpene volatiles, which are emitted with a light-dependent diurnal pattern early in the morning at prebloom and bloom, is localized to anthers and, more specifically, within the developing pollen grains. Valencene synthase (VvValCS) enzyme activity, which produces the major sesquiterpene volatiles of grapevine flowers, is present in anthers. VvValCS transcripts are most abundant in flowers at prebloom stages. Western blot analysis identified VvValCS protein in anthers, and in situ immunolabeling located VvValCS protein in pollen grains during bloom. Histochemical staining, as well as immunolabeling analysis by fluorescent microscopy and transmission electron microscopy, indicated that VvValCS localizes close to lipid bodies within the maturing microspore. PMID:19359488

Restructuring of endophytic bacterial communities in grapevine yellows-diseased and recovered Vitis vinifera L. plants.

Science.gov (United States)

Bulgari, Daniela; Casati, Paola; Crepaldi, Paola; Daffonchio, Daniele; Quaglino, Fabio; Brusetti, Lorenzo; Bianco, Piero Attilio

2011-07-01

Length heterogeneity-PCR assays, combined with statistical analyses, highlighted that the endophytic bacterial community associated with healthy grapevines was characterized by a greater diversity than that present in diseased and recovered plants. The findings suggest that phytoplasmas can restructure the bacterial community by selecting endophytic strains that could elicit a plant defense response.

Laser induced fluorescence of some plant leaves

International Nuclear Information System (INIS)

Helmi, M.S.; Mohamed, M.M.; Amer, R.; Elshazly, O.; Elraey, M.

1992-01-01

Laser induced fluorescence (LIF) is successfully used as a technique for remote detection of spectral characteristics of some plants. A pulsed nitrogen laser at 337.1 nm is used to excite cotton, corn and rice leaves. The fluorescence spectrum is detected in the range from 340 nm to 820 nm. It is found that, these plant leaves have common fluorescence maxima at 440 nm, 685 nm and 740 nm. plant leaves are also found to be identifiable by the ratio of the fluorescence intensity at 440 nm to that at 685 nm. The present technique can be further used as a means of assessing, remotely, plant stresses. 5 fig

Abscisic Acid Metabolism in Relation to Water Stress and Leaf Age in Xanthium strumarium.

Science.gov (United States)

Cornish, K; Zeevaart, J A

1984-12-01

Intact plants of Xanthium strumarium L. were subjected to a water stress-recovery cycle. As the stress took effect, leaf growth ceased and stomatal resistance increased. The mature leaves then wilted, followed by the half expanded ones. Water, solute, and pressure potentials fell steadily in all leaves during the rest of the stress period. After 3 days, the young leaves lost turgor and the plants were rewatered. All the leaves rapidly regained turgor and the younger ones recommenced elongation. Stomatal resistance declined, but several days elapsed before pre-stress values were attained.Abscisic acid (ABA) and phaseic acid (PA) levels rose in all the leaves after the mature ones wilted. ABA-glucose ester (ABA-GE) levels increased to a lesser extent, and the young leaves contained little of this conjugate. PA leveled off in the older leaves during the last 24 hours of stress, and ABA levels declined slightly. The young leaves accumulated ABA and PA throughout the stress period and during the 14-hour period immediately following rewatering. The ABA and PA contents, expressed per unit dry weight, were highest in the young leaves. Upon rewatering, large quantities of PA appeared in the mature leaves as ABA levels fell to the pre-stress level within 14 hours. In the half expanded and young leaves, it took several days to reach pre-stress ABA values. ABA-GE synthesis ceased in the mature leaves, once the stress was relieved, but continued in the half expanded and young leaves for 2 days.Mature leaves, when detached and stressed, accumulated an amount of ABA similar to that in leaves on the intact plant. In contrast, detached and stressed young leaves produced little ABA. Detached mature leaves, and to a lesser extent the half expanded ones, rapidly catabolized ABA to PA and ABA-GE, but the young leaves did not. Studies with radioactive (+/-)-ABA indicated that in young leaves the conversion of ABA to PA took place at a much lower rate than in mature ones. Leaves of all

The aqueous extract of Albizia adianthifolia leaves attenuates 6-hydroxydopamine-induced anxiety, depression and oxidative stress in rat amygdala.

Science.gov (United States)

Beppe, Galba Jean; Dongmo, Alain Bertrand; Foyet, Harquin Simplice; Dimo, Théophile; Mihasan, Marius; Hritcu, Lucian

2015-10-19

While the Albizia adianthifolia (Schumach.) W. Wright (Fabaceae) is a traditional herb largely used in the African traditional medicine as analgesic, purgative, antiinflammatory, antioxidant, antimicrobial, memory-enhancer, anxiolytic and antidepressant drug, there are no scientific data that clarify the anxiolytic and antidepressant-like effects in 6-hydroxydopamine (6-OHDA)-lesioned animal model of Parkinson's disease. This study was undertaken in order to identify the effects of aqueous extract of A. adianthifolia leaves on 6-hydroxydopamine-induced anxiety, depression and oxidative stress in the rat amygdala. The effect of the aqueous extract of A. adianthifolia leaves (150 and 300 mg/kg, orally, daily, for 21 days) on anxiety and depression was assessed using elevated plus-maze and forced swimming tests, as animal models of anxiety and depression. Also, the antioxidant activity in the rat amygdala was assessed using assessed using superoxide dismutase, glutathione peroxidase and catalase specific activities, the total content of the reduced glutathione, protein carbonyl and malondialdehyde levels. Statistical analyses were performed using by one-way analysis of variance (ANOVA). Significant differences were determined by Tukey's post hoc test. F values for which p amygdala. Our results suggest that the aqueous extract ameliorates 6-OHDA-induced anxiety and depression by attenuation of the oxidative stress in the rat amygdala. These pieces of evidence accentuate its use in traditional medicine.

SNP high-throughput screening in grapevine using the SNPlex™ genotyping system

Directory of Open Access Journals (Sweden)

Velasco Riccardo

2008-01-01

Full Text Available Abstract Background Until recently, only a small number of low- and mid-throughput methods have been used for single nucleotide polymorphism (SNP discovery and genotyping in grapevine (Vitis vinifera L.. However, following completion of the sequence of the highly heterozygous genome of Pinot Noir, it has been possible to identify millions of electronic SNPs (eSNPs thus providing a valuable source for high-throughput genotyping methods. Results Herein we report the first application of the SNPlex™ genotyping system in grapevine aiming at the anchoring of an eukaryotic genome. This approach combines robust SNP detection with automated assay readout and data analysis. 813 candidate eSNPs were developed from non-repetitive contigs of the assembled genome of Pinot Noir and tested in 90 progeny of Syrah × Pinot Noir cross. 563 new SNP-based markers were obtained and mapped. The efficiency rate of 69% was enhanced to 80% when multiple displacement amplification (MDA methods were used for preparation of genomic DNA for the SNPlex assay. Conclusion Unlike other SNP genotyping methods used to investigate thousands of SNPs in a few genotypes, or a few SNPs in around a thousand genotypes, the SNPlex genotyping system represents a good compromise to investigate several hundred SNPs in a hundred or more samples simultaneously. Therefore, the use of the SNPlex assay, coupled with whole genome amplification (WGA, is a good solution for future applications in well-equipped laboratories.

Effects of hot water treatments on dormant grapevine propagation materials used for grafted vine production

Directory of Open Access Journals (Sweden)

Soltekin Oguzhan

2017-01-01

Full Text Available Agrobacterium vitis is responsible for the crown gall disease of grapevine which breaks the grapevine trunk vascular system. Nutrient flow is prevented by crown gall and it leads to weak growth and death of the plants. It can be destructive disease often encountered in vineyards and it can be spread in cuttings for propagation. Thermotherapy treatment is an alternative method for eradicating A. vitis from grapevine cuttings but effects of thermotherapy treatments on dormant vine tissue, bud vitality, rooting and shooting of the propagation materials are not yet fully understood. In this research, it is aimed to determine the effects of thermotherapy treatment (Hot water treatment on callus formation (at the basal part and grafting point, grafted vine quality (shoot length, shoot width, root number, shooting and rooting development, fresh and dry weight of shoots and roots and final take in the grafted vine production. Experiment was conducted in the nursery of Manisa Viticultural Research Institute. Rootstocks (Kober 5BB, Couderc 1613 and 41B and scions (Sultan 7 and Manisa sultanı were hot-water treated at 50°C for 30 minutes which is the most common technique against Agrobacterium vitis. After thermotherapy treatment, all rootstocks were grafted with Sultan 7 and Manisa sultanıvarieties. They were kept for 22 days in callusing room for callus development and then they were planted in polyethlyene bags for rooting. At the end of the study, significant treatment x rootstock interaction were observed for the final take of Sultan 7 variety. Thermotherapy treated of 1613C/Sultan 7 combinations had more final take than the control (untreated group. For instance, hot water treated cuttings of 1613C/Sultan 7 combinations had 75% final take while the control group had the 70%. Also there were not observed any adverse effects of HWT on bud and tissue vitality.

Broader leaves result in better performance of indica rice under drought stress.

Science.gov (United States)

Farooq, M; Kobayashi, N; Ito, O; Wahid, A; Serraj, R

2010-09-01

Leaf growth is one of the first physiological processes affected by changes in plant water status under drought. A decrease in leaf expansion rate usually precedes any reduction in stomatal conductance or photosynthesis. Changes in leaf size and stomatal opening are potential adaptive mechanisms, which may help avoid drought by reducing transpiration rate, and can be used to improve rice genotypes in water-saving cultivation. The indica rice cultivar IR64 and four of its near-isogenic lines (NILs; BC(3)-derived lines) unique for leaf size traits, YTK 124 (long leaves), YTK 127 (broad leaves), YTK 205 (short leaves) and YTK 214 (narrow leaves), were compared in this study for changes in leaf growth and its water status. The plants were subjected to two soil water regimes, well-watered and progressive soil drying measured by the fraction of transpirable soil water (FTSW). Applied drought reduced leaf number, total leaf area, specific leaf area, plant biomass, tiller number, plant height, stomatal conductance, amount of water transpired, leaf relative water content, and leaf water potential more in IR64 and the NILs than in the respective controls; nonetheless, transpiration efficiency (TE) was slightly higher under drought than in the well-watered controls. NILs with broader leaves had higher biomass (and its individual components), less stomatal conductance, and higher TE under drought than NILs with narrow and shorter leaves. Under drought, leaf number was positively correlated with tiller number and plant height; nonetheless, root weight and total biomass, water transpired and TE, and plant height and TE were positively correlated with each other. However, a negative correlation was observed between stomatal conductance and the FTSW threshold at which normalized transpiration started to decline during soil drying. Overall, the IR64-derived lines with broader leaves performed better than NILs with narrow and short leaves under drought. Copyright 2010 Elsevier Gmb

Root Proteomic Analysis of Grapevine Rootstocks Inoculated with Rhizophagus irregularis and Fusarium oxysporum f. sp. herbemontis

Directory of Open Access Journals (Sweden)

Elisa Vilvert

Full Text Available ABSTRACT Grapevine decline and death caused by the pathogenic fungus Fusarium oxysporum f. sp. herbemontis is among the main phytosanitary problem for viticulture in southern Brazil. The eradication of infected plants is presently the most common procedure for disease control in vineyards. Inoculation with arbuscular mycorrhizal fungi is an option to reduce or neutralize the negative impacts of soil pathogenic microorganisms, but the mechanisms of plant response involved in this process are not yet completely elucidated. In order to better understand these mechanisms, an experiment was carried out to identify proteins related to plant defence induced by the mycorrhizal fungus after infection with the pathogenic fungus. We used the grapevine rootstocks SO4 and R110 (susceptible and resistant to the pathogenic fungus, respectively inoculated or not inoculated with the mycorrhizal fungus Rhizophagus irregularis, and inoculated or not inoculated with Fusarium oxysporum f. sp. herbemontis. Growth of the rootstocks’ shoot and root and presence of pathogenic symptoms were evaluated. The protein profiles of roots were characterized by two-dimensional electrophoresis and proteins were identified using mass spectrometry. The grapevine rootstocks inoculated with R. irregularis had higher biomass production and lower level of pathogenic symptoms. The R110 rootstock differentially accumulated 73 proteins, while SO4 accumulated 59 proteins. Nine plant-defence proteins were expressed by SO4 rootstock, and six were expressed by R110 rootstock plants. The results confirm the effect of mycorrhizal fungi in plant growth promotion and their potential for biological control against soil pathogenic fungus. Protein expression is dependent on rootstock characteristics and on the combination of plant material with the fungi.

Expression of ABA synthesis and metabolism genes under different irrigation strategies and atmospheric VPDs is associated with stomatal conductance in grapevine (Vitis vinifera L. cv Cabernet Sauvignon).

Science.gov (United States)

Speirs, Jim; Binney, Allan; Collins, Marisa; Edwards, Everard; Loveys, Brian

2013-04-01

The influence of different levels of irrigation and of variation in atmospheric vapour pressure deficit (VPD) on the synthesis, metabolism, and transport of abscisic acid (ABA) and the effects on stomatal conductance were examined in field-grown Cabernet Sauvignon grapevines. Xylem sap, leaf tissue, and root tissue were collected at regular intervals during two seasons in conjunction with measurements of leaf water potential (Ψleaf) and stomatal conductance (gs). The different irrigation levels significantly altered the Ψleaf and gs of the vines across both seasons. ABA abundance in the xylem sap was correlated with gs. The expression of genes associated with ABA synthesis, NCED1 and NCED2, was higher in the roots than in the leaves throughout and highest in the roots in mid January, a time when soil moisture declined and VPD was at its highest. Their expression in roots was also inversely related to the levels of irrigation and correlated with ABA abundance in the roots, xylem sap, and leaves. Three genes encoding ABA 8'-hydroxylases were isolated and their identities confirmed by expression in yeast cells. The expression of one of these, Hyd1, was elevated in leaves when VPD was below 2.0-2.5 kPa and minimal at higher VPD levels. The results provide evidence that ABA plays an important role in linking stomatal response to soil moisture status and that changes in ABA catabolism at or near its site of action allows optimization of gas exchange to current environmental conditions.

Work-focused cognitive behavioral intervention for psychological complaints in patients on sick leave due to work-related stress: Results from a randomized controlled trial.

Science.gov (United States)

Dalgaard, Vita Ligaya; Andersen, Lars Peter Sønderbo; Andersen, Johan Hviid; Willert, Morten Vejs; Carstensen, Ole; Glasscock, David John

2017-08-22

Work-related stress is a global problem with negative implications for individuals and society. The purpose of the current study was to evaluate a stress management intervention for patients on sick leave due to work-related stress complaints using a three-armed randomized controlled design. Participants were patients referred from three municipalities to the regional Department of Occupational Medicine. Inclusion criteria were: 1) sick leave due to work-related stress complaints, 2) a diagnosis of adjustment disorder or reactions to severe stress (ICD 10 code: F43,2 - F 43,9 not PTSD) or mild depressive episode (F 32.0). Through a double randomization procedure patients (n = 163) were randomized to either an intervention group (n = 58), a 'control group A' receiving a clinical examination (n = 56), or 'control group B' (n = 49) receiving no offers at the department. The intervention comprised six sessions of individual cognitive behavioral therapy and the offer of a small workplace intervention. Questionnaire data were analyzed with multivariate repeated measurements analysis. Primary outcomes assessed were perceived stress and general mental health. Secondary outcomes were sleep quality and cognitive failures. Follow-up was at four and 10 months after baseline. Complaints were significantly reduced in all groups over time. No group effects were observed between the intervention group and control group A that was clinically assessed. Significant group effects were found for perceived stress and memory when comparing the intervention group to group B, but most likely not due to an intervention effect. Psychological complaints improved substantially over time in all groups, but there was no significant treatment effect on any outcomes when the intervention group was compared to control group A that received a clinical assessment. ISRCTN ISRCTN91404229. Registered 03 August 2012 (retrospectively registered).

Genome-wide prediction methods in highly diverse and heterozygous species: proof-of-concept through simulation in grapevine.

Directory of Open Access Journals (Sweden)

Agota Fodor

Full Text Available Nowadays, genome-wide association studies (GWAS and genomic selection (GS methods which use genome-wide marker data for phenotype prediction are of much potential interest in plant breeding. However, to our knowledge, no studies have been performed yet on the predictive ability of these methods for structured traits when using training populations with high levels of genetic diversity. Such an example of a highly heterozygous, perennial species is grapevine. The present study compares the accuracy of models based on GWAS or GS alone, or in combination, for predicting simple or complex traits, linked or not with population structure. In order to explore the relevance of these methods in this context, we performed simulations using approx 90,000 SNPs on a population of 3,000 individuals structured into three groups and corresponding to published diversity grapevine data. To estimate the parameters of the prediction models, we defined four training populations of 1,000 individuals, corresponding to these three groups and a core collection. Finally, to estimate the accuracy of the models, we also simulated four breeding populations of 200 individuals. Although prediction accuracy was low when breeding populations were too distant from the training populations, high accuracy levels were obtained using the sole core-collection as training population. The highest prediction accuracy was obtained (up to 0.9 using the combined GWAS-GS model. We thus recommend using the combined prediction model and a core-collection as training population for grapevine breeding or for other important economic crops with the same characteristics.

Production of Polyclonal Antibody against Grapevine fanleaf virus Movement Protein Expressed in Escherichia coli

Directory of Open Access Journals (Sweden)

Davoud Koolivand

2016-10-01

Full Text Available The genomic region of Grapevine fanleaf virus (GFLV encoding the movement protein (MP was cloned into pET21a and transformed into Escherichia coli strain BL21 (DE3 to express the protein. Induction was made with a wide range of isopropyl-β-D-thiogalactopyranoside (IPTG concentrations (1, 1.5, and 2 mM each for duration of 4, 6, or 16 h. However, the highest expression level was achieved with 1 mM IPTG for 4 h. Identity of the expressed protein was confirmed by sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE followed by Western blotting. The expressed 41 kDa protein was purified under denaturing condition by affinity chromatography, reconfirmed by Western blotting and plate-trapped antigen enzyme-linked immunosorbent assay (PTA-ELISA before being used as a recombinant antigen to raise polyclonal antibodies in rabbits. Purified anti-GFLV MP immunoglobulines (IgGs and conjugated IgGs detected the expressed MP and GFLV virions in infected grapevines when used in PTA-ELISA, double antibody sandwich-ELISA, and Western blotting. This is the first report on the production of anti-GFLV MP polyclonal antibodies and application for the virus detection.

RNA2 of grapevine fanleaf virus: sequence analysis and coat protein cistron location.

Science.gov (United States)

Serghini, M A; Fuchs, M; Pinck, M; Reinbolt, J; Walter, B; Pinck, L

1990-07-01

The nucleotide sequence of the genomic RNA2 (3774 nucleotides) of grapevine fanleaf virus strain F13 was determined from overlapping cDNA clones and its genetic organization was deduced. Two rapid and efficient methods were used for cDNA cloning of the 5' region of RNA2. The complete sequence contained only one long open reading frame of 3555 nucleotides (1184 codons, 131K product). The analysis of the N-terminal sequence of purified coat protein (CP) and identification of its C-terminal residue have allowed the CP cistron to be precisely positioned within the polyprotein. The CP produced by proteolytic cleavage at the Arg/Gly site between residues 680 and 681 contains 504 amino acids (Mr 56019) and has hydrophobic properties. The Arg/Gly cleavage site deduced by N-terminal amino acid sequence analysis is the first for a nepovirus coat protein and for plant viruses expressing their genomic RNAs by polyprotein synthesis. Comparison of GFLV RNA2 with M RNA of cowpea mosaic comovirus and with RNA2 of two closely related nepoviruses, tomato black ring virus and Hungarian grapevine chrome mosaic virus, showed strong similarities among the 3' non-coding regions but less similarity among the 5' end non-coding sequences than reported among other nepovirus RNAs.

77 FR 55829 - Western Area Power Administration; Grapevine Canyon Wind Project Record of Decision (DOE/EIS-0427)

Science.gov (United States)

2012-09-11

... DEPARTMENT OF ENERGY Western Area Power Administration; Grapevine Canyon Wind Project Record of... one or more phases, dependent on one or more power sale contracts. The proposed wind park would... that limit construction vehicle speed limits. Foresight indicated that the wind park contractor will...

Microscope image based fully automated stomata detection and pore measurement method for grapevines

Directory of Open Access Journals (Sweden)

Hiranya Jayakody

2017-11-01

Full Text Available Abstract Background Stomatal behavior in grapevines has been identified as a good indicator of the water stress level and overall health of the plant. Microscope images are often used to analyze stomatal behavior in plants. However, most of the current approaches involve manual measurement of stomatal features. The main aim of this research is to develop a fully automated stomata detection and pore measurement method for grapevines, taking microscope images as the input. The proposed approach, which employs machine learning and image processing techniques, can outperform available manual and semi-automatic methods used to identify and estimate stomatal morphological features. Results First, a cascade object detection learning algorithm is developed to correctly identify multiple stomata in a large microscopic image. Once the regions of interest which contain stomata are identified and extracted, a combination of image processing techniques are applied to estimate the pore dimensions of the stomata. The stomata detection approach was compared with an existing fully automated template matching technique and a semi-automatic maximum stable extremal regions approach, with the proposed method clearly surpassing the performance of the existing techniques with a precision of 91.68% and an F1-score of 0.85. Next, the morphological features of the detected stomata were measured. Contrary to existing approaches, the proposed image segmentation and skeletonization method allows us to estimate the pore dimensions even in cases where the stomatal pore boundary is only partially visible in the microscope image. A test conducted using 1267 images of stomata showed that the segmentation and skeletonization approach was able to correctly identify the stoma opening 86.27% of the time. Further comparisons made with manually traced stoma openings indicated that the proposed method is able to estimate stomata morphological features with accuracies of 89.03% for area

Abscisic Acid Metabolism in Relation to Water Stress and Leaf Age in Xanthium strumarium1

Science.gov (United States)

Cornish, Katrina; Zeevaart, Jan A.D.

1984-01-01

Intact plants of Xanthium strumarium L. were subjected to a water stress-recovery cycle. As the stress took effect, leaf growth ceased and stomatal resistance increased. The mature leaves then wilted, followed by the half expanded ones. Water, solute, and pressure potentials fell steadily in all leaves during the rest of the stress period. After 3 days, the young leaves lost turgor and the plants were rewatered. All the leaves rapidly regained turgor and the younger ones recommenced elongation. Stomatal resistance declined, but several days elapsed before pre-stress values were attained. Abscisic acid (ABA) and phaseic acid (PA) levels rose in all the leaves after the mature ones wilted. ABA-glucose ester (ABA-GE) levels increased to a lesser extent, and the young leaves contained little of this conjugate. PA leveled off in the older leaves during the last 24 hours of stress, and ABA levels declined slightly. The young leaves accumulated ABA and PA throughout the stress period and during the 14-hour period immediately following rewatering. The ABA and PA contents, expressed per unit dry weight, were highest in the young leaves. Upon rewatering, large quantities of PA appeared in the mature leaves as ABA levels fell to the pre-stress level within 14 hours. In the half expanded and young leaves, it took several days to reach pre-stress ABA values. ABA-GE synthesis ceased in the mature leaves, once the stress was relieved, but continued in the half expanded and young leaves for 2 days. Mature leaves, when detached and stressed, accumulated an amount of ABA similar to that in leaves on the intact plant. In contrast, detached and stressed young leaves produced little ABA. Detached mature leaves, and to a lesser extent the half expanded ones, rapidly catabolized ABA to PA and ABA-GE, but the young leaves did not. Studies with radioactive (±)-ABA indicated that in young leaves the conversion of ABA to PA took place at a much lower rate than in mature ones. Leaves of all

Differential responses between mature and young leaves of sunflower plants to oxidative stress caused by water deficit Diferentes respostas entre folhas adultas e jovens de plantas de girassol ao estresse oxidativo causado pelo déficit hídrico

Directory of Open Access Journals (Sweden)

Inês Cechin

2010-06-01

Full Text Available The effects of water stress and rehydration on leaf gas exchange characteristics along with changes in lipid peroxidation and pirogalol peroxidase (PG-POD were studied in mature and in young leaves of sunflower (Helianthus annuus L., which were grown in a greenhouse. Water stress reduced photosynthesis (Pn, stomatal conductance (g s, and transpiration (E in both young and mature leaves. However, the amplitude of the reduction was dependent on leaf age. The intercellular CO2 concentration (Ci was increased in mature leaves but it was not altered in young leaves. Instantaneous water use efficiency (WUE in mature stressed leaves was reduced when compared to control leaves while in young stressed leaves it was maintained to the same level as the control. After 24h of rehydration, most of the parameters related to gas exchange recovered to the same level as the unstressed plants except gs and E in mature leaves. Water stress did not activated PG-POD independently of leaf age. However, after rehydration the enzyme activity was increased in mature leaves and remained to the same as the control in young leaves. Malondialdehyde (MDA content was increased by water stress in both mature and young leaves. The results suggest that young leaves are more susceptible to water stress in terms of gas exchange characteristics than mature leaves although both went through oxidative estresse.Os efeitos do estresse hídrico e da reidratação nas trocas gasosas juntamente com alterações na lipoperoxidação e atividade da pirogalol peroxidase (PG-POD foram estudados em folhas adultas e jovens de plantas de girassol (Helianthus annuus L. cultivadas em casa de vegetação. O estresse hídrico reduziu a fotossíntese (P N, a condutância estomática (g s e a transpiração (E nas folhas adultas e jovens. No entanto, a amplitude da redução foi dependente da idade da folha. A concentração intercelular de CO2 (Ci aumentou nas folhas adultas, mas não apresentou

Burgundy regional climate change and its potential impact on grapevines

Energy Technology Data Exchange (ETDEWEB)

Xu, Yiwen [University of Burgundy, Center for Climate Research, UMR 5210 CNRS, Dijon (France); G.C. Rieber Climate Institute at the Nansen Environment and Remote Sensing Center, Bergen (Norway); Castel, Thierry [University of Burgundy, Center for Climate Research, UMR 5210 CNRS, Dijon (France); AgroSup, Department of Agriculture and Environment, Dijon (France); Richard, Yves; Cuccia, Cedric [University of Burgundy, Center for Climate Research, UMR 5210 CNRS, Dijon (France); Bois, Benjamin [University of Burgundy, Center for Climate Research, UMR 5210 CNRS, Dijon (France); IUVV, University of Burgundy, Dijon (France)

2012-10-15

ARPEGE general circulation model simulations were dynamically downscaled by The Weather Research and Forecasting Model (WRF) for the study of climate change and its impact on grapevine growth in Burgundy region in France by the mid twenty-first century. Two time periods were selected: 1970-1979 and 2031-2040. The WRF model driven by ERA-INTERIM reanalysis data was validated against in situ surface temperature observations. The daily maximum and minimum surface temperature (T{sub max} and T{sub min}) were simulated by the WRF model at 8 x 8 km horizontal resolution. The averaged daily T{sub max} for each month during 1970-1979 have good agreement with observations, the averaged daily T{sub min} have a warm bias about 1-2 K. The daily T{sub max} and T{sub min} for each month (domain averaged) during 2031-2040 show a general increase. The largest increment ({proportional_to}3 K) was found in summer. The smallest increments (<1 K) were found in spring and fall. The spatial distribution of temperature increment shows a strong meridional gradient, high in south in summer, reversing in winter. The resulting potential warming rate in summer is equivalent to 4.7 K/century under the IPCC A2 emission scenario. The dynamically downscaled T{sub max} and T{sub min} were used to simulate the grape (Pinot noir grape variety) flowering and veraison dates. For 2031-2040, the projected dates are 8 and 12 days earlier than those during 1970-1979, respectively. The simulated hot days increase more than 50% in the two principal grapevine regions. They show strong impact on Pinot noir development. (orig.)

Evaluation of nitrogen status and total chlorophyll in longkong (Aglaia dookkoo Griff. leaves under water stress using a chlorophyll meter

Directory of Open Access Journals (Sweden)

Sdoodee, S.

2005-07-01

Full Text Available A chlorophyll meter (SPAD-502 was used to assess nitrogen status and total chlorophyll in longkong leaves, leaves from twelve of 10-year-old trees grown in the experimental plot at Prince of Songkla University, Songkhla province. The relationship between SPAD-502 meter reading and nitrogen status and total chlorophyll content analyzed in the laboratory was evaluated during 8 months (May-December 2003. It was found that the trend of the relationships in each month was similar. There was no significant differenceamong regression linears of all months. The data of 8 months showed that SPAD-reading and nitrogen content, and SPAD-reading and total chlorophyll content were related in a positive manner. They were Y = 0.19X+10.10, r = 0.76** (n = 240, and Y = 0.43X-7.89, r = 0.79** (n = 400, respectively. The SPAD-502 was then used to assess total nitrogen and total chlorophyll content during imposed water stress. Fifteen 4-yearold plants were grown in pots (each pot containing 50 kg soil volume. The experiment was arranged in acompletely randomized design with 3 treatments: (1 daily watering (2 once watering on day 7 (3 no watering with 5 replications during 14 days of the experimental period. Measurements showed a continuous decrease of SPAD-reading in the treatment of no watering. On day 14, a significant difference of SPAD- reading values between the treatment of daily watering and no watering was found. Then, the values of nitrogen content and total chlorophyll were assessed by using the linear regression equations. From the result, it is suggested that the measurement by chlorophyll meter is a rapid technique for the evaluation of total chlorophyll and nitrogen status in longkong leaves during water stress.

How do line managers experience and handle the return to work of employees on sick leave due to work-related stress? A one-year follow-up study.

Science.gov (United States)

Ladegaard, Yun; Skakon, Janne; Elrond, Andreas Friis; Netterstrøm, Bo

2017-08-28

To examine how line managers experience and manage the return to work process of employees on sick leave due to work-related stress and to identify supportive and inhibiting factors. Semi-structured interviews with 15 line managers who have had employees on sick leave due to work-related stress. The grounded theory approach was employed. Even though managers may accept the overall concept of work-related stress, they focus on personality and individual circumstances when an employee is sick-listed due to work-related stress. The lack of a common understanding of stress creates room for this focus. Line managers experience cross-pressure, discrepancies between strategic and human-relationship perspectives and a lack of organizational support in the return to work process. Organizations should aim to provide support for line managers. Research-based knowledge and guidelines on work-related stress and return to work process are essential, as is the involvement of coworkers. A commonly accepted definition of stress and a systematic risk assessment is also important. Cross-pressure on line managers should be minimized and room for adequate preventive actions should be provided as such an approach could support both the return to work process and the implementation of important interventions in the work environment. Implication for rehabilitation Organizations should aim to provide support for line managers handling the return to work process. Cross-pressure on line managers should be minimized and adequate preventive actions should be provided in relation to the return to work process. Research-based knowledge and guidelines on work-related stress and return to work are essential. A common and formal definition of stress should be emphasized in the workplace.

Cultivated grapevines represent a symptomless reservoir for the transmission of hop stunt viroid to hop crops: 15 years of evolutionary analysis.

Directory of Open Access Journals (Sweden)

Yoko Kawaguchi-Ito

Full Text Available Hop stunt was a mysterious disorder that first emerged in the 1940s in commercial hops in Japan. To investigate the origin of this disorder, we infected hops with natural Hop stunt viroid (HpSVd isolates derived from four host species (hop, grapevine, plum and citrus, which except for hop represent possible sources of the ancestral viroid. These plants were maintained for 15 years, then analyzed the HpSVd variants present. Here we show that the variant originally found in cultivated grapevines gave rise to various combinations of mutations at positions 25, 26, 54, 193, and 281. However, upon prolonged infection, these variants underwent convergent evolution resulting in a limited number of adapted mutants. Some of them showed nucleotide sequences identical to those currently responsible for hop stunt epidemics in commercial hops in Japan, China, and the United States. Therefore, these results indicate that we have successfully reproduced the original process by which a natural HpSVd variant naturally introduced into cultivated hops was able to mutate into the HpSVd variants that are currently present in commercial hops. Furthermore, and importantly, we have identified cultivated grapevines as a symptomless reservoir in which HSVd can evolve and be transmitted to hop crops to cause epidemics.

Modelling Growth and Partitioning of Annual Above-Ground Vegetative and Reproductive Biomass of Grapevine

Science.gov (United States)

Meggio, Franco; Vendrame, Nadia; Maniero, Giovanni; Pitacco, Andrea

2014-05-01

In the current climate change scenarios, both agriculture and forestry inherently may act as carbon sinks and consequently can play a key role in limiting global warming. An urgent need exists to understand which land uses and land resource types have the greatest potential to mitigate greenhouse gas (GHG) emissions contributing to global change. A common believe is that agricultural fields cannot be net carbon sinks due to many technical inputs and repeated disturbances of upper soil layers that all contribute to a substantial loss both of the old and newly-synthesized organic matter. Perennial tree crops (vineyards and orchards), however, can behave differently: they grow a permanent woody structure, stand undisturbed in the same field for decades, originate a woody pruning debris, and are often grass-covered. In this context, reliable methods for quantifying and modelling emissions and carbon sequestration are required. Carbon stock changes are calculated by multiplying the difference in oven dry weight of biomass increments and losses with the appropriate carbon fraction. These data are relatively scant, and more information is needed on vineyard management practices and how they impact vineyard C sequestration and GHG emissions in order to generate an accurate vineyard GHG footprint. During the last decades, research efforts have been made for estimating the vineyard carbon budget and its allocation pattern since it is crucial to better understand how grapevines control the distribution of acquired resources in response to variation in environmental growth conditions and agronomic practices. The objective of the present study was to model and compare the dynamics of current year's above-ground biomass among four grapevine varieties. Trials were carried out over three growing seasons in field conditions. The non-linear extra-sums-of-squares method demonstrated to be a feasible way of growth models comparison to statistically assess significant differences among

Contribution of soil electric resistivity measurements to the studies on soil/grapevine water relations

Directory of Open Access Journals (Sweden)

Etienne Goulet

2006-06-01

Full Text Available The classical techniques that allow to quantify the soil water status such as the gravimetric method or the use of neutrons probes do not give access to the volume of soil explored by the plant root system. On the contrary, electric tomography can be used to have a global vision on the water exchange area between soil and plant. The measurement of soil electric resistivity, as a non destructive, spatially integrative technique, has recently been introduced into viticulture. The use of performing equipment and adapted software allows for rapid data processing and gives the possibility to spatialize the variations of soil texture or humidity in two or three dimensions. Soil electric resistivity has been tested for the last three years at the Experimental Unit on Grapevine and Vine, INRA, Angers, France, to study the water supply to the vine in different “terroir” conditions. Resistivity measurements were carried out with the resistivity meter Syscal R1+ (Iris Instruments, France equipped with 21 electrodes. Those electrodes were lined up on the soil surface in a direction perpendiculary to 5 grapevine rows with an electrode spacing of 0.5 m. and a dipole-dipole arrangement. Resistivity measurements were performed on the same place at different times in order to study soil moisture variations. This experimental set up has permitted to visualise the soil stratification and individualize some positive electric anomalies corresponding to preferential drying ; this desiccation could be attributed to grapevine root activity. The soil bulk subject to the water up-take could be defined more precisely and in some types of soil, available water may even be quantified. Terroir effect on grapevine root activity has also been shown up on two different experimental parcels through electric tomography and first results indicate that it is possible to monitor the effects of soil management (inter-row grassing or different rootstocks on the water supply to the

REMINDER Saved Leave Scheme (SLS) : Transfer of leave to saved leave accounts

CERN Multimedia

HR Division

2002-01-01

Under the provisions of the voluntary saved leave scheme (SLS), a maximum total of 10 days'*) annual and compensatory leave (excluding saved leave accumulated in accordance with the provisions of Administrative Circular No. 22B) can be transferred to the saved leave account at the end of the leave year (30 September). We remind you that, since last year, unused leave of all those taking part in the saved leave scheme at the closure of the leave-year accounts is transferred automatically to the saved leave account on that date. Therefore, staff members have no administrative steps to take. In addition, the transfer, which eliminates the risk of omitting to request leave transfers and rules out calculation errors in transfer requests, will be clearly shown in the list of leave transactions that can be consulted in EDH from October 2002 onwards. Furthermore, this automatic leave transfer optimizes staff members' chances of benefiting from a saved leave bonus provided that they are still participants in the schem...

Carboxylated multi-walled carbon nanotubes aggravated biochemical and subcellular damages in leaves of broad bean (Vicia faba L.) seedlings under combined stress of lead and cadmium

International Nuclear Information System (INIS)

Wang, Chengrun; Liu, Haitao; Chen, Jinyun; Tian, Yuan; Shi, Jian; Li, Dongdong; Guo, Chen; Ma, Qingping

2014-01-01

Highlights: • MWCNTs-COOH disturb mineral elements and cause oxidative damages in the leaves. • Cd and Pb combination result in reduction of mineral elements and enrichment of Na, involving in toxicity mechanisms. • MWCNTs-COOH facilitate Cd and Pb uptake, and aggravate biochemical and subcellular damages. - Abstract: Increasing industrialization of multi-walled carbon nanotubes (MWCNTs) would inevitably lead to their release into the environment and combination with heavy metals. However, studies concerning the combined effects of MWCNTs and heavy metals on agricultural crops are limited. Herein, effects and mechanisms of carboxylated MWCNTs (MWCNTs-COOH) (2.5, 5 and 10 mg/L) and their combination with 20 μM Pb and 5 μM Cd (shortened as Pb + Cd) on Vicia faba L. seedlings were investigated. The results showed that the MWCNTs-COOH disturbed the imbalance of nutrient elements, and caused oxidative stress and damages in the leaves. Additionally, the combination of MWCNTs-COOH with Pb + Cd resulted in enrichment of Pb and Cd, and deterioration of oxidative damages compared with the treatments of MWCNTs-COOH or Pb + Cd alone in the leaves. As the results, the concentrations of MWCNTs-COOH not only caused oxidative stress, but also exacerbated the biochemical and subcellular damages due to the treatment of Pb + Cd in the leaves. It also suggests that persistent release of MWCNTs-COOH into the environment may cause phytotoxicity and aggravate ecological risks due to combination of heavy metals

Humidity-dependent wound sealing in succulent leaves of Delosperma cooperi - An adaptation to seasonal drought stress.

Science.gov (United States)

Speck, Olga; Schlechtendahl, Mark; Borm, Florian; Kampowski, Tim; Speck, Thomas

2018-01-01

During evolution, plants evolved various reactions to wounding. Fast wound sealing and subsequent healing represent a selective advantage of particular importance for plants growing in arid habitats. An effective self-sealing function by internal deformation has been found in the succulent leaves of Delosperma cooperi. After a transversal incision, the entire leaf bends until the wound is closed. Our results indicate that the underlying sealing principle is a combination of hydraulic shrinking and swelling as the main driving forces and growth-induced mechanical pre-stresses in the tissues. Hydraulic effects were measured in terms of the relative bending angle over 55 minutes under various humidity conditions. The higher the relative air humidity, the lower the bending angle. Negative bending angles were found when a droplet of liquid water was applied to the wound. The statistical analysis revealed highly significant differences of the single main effects such as "humidity conditions in the wound region" and "time after wounding" and their interaction effect. The centripetal arrangement of five tissue layers with various thicknesses and significantly different mechanical properties might play an additional role with regard to mechanically driven effects. Injury disturbs the mechanical equilibrium, with pre-stresses leading to internal deformation until a new equilibrium is reached. In the context of self-sealing by internal deformation, the highly flexible wide-band tracheids, which form a net of vascular bundles, are regarded as paedomorphic tracheids, which are specialised to prevent cell collapse under drought stress and allow for building growth-induced mechanical pre-stresses.

Everyday hassles and uplifts among women on long-term sick-leave due to stress-related disorders.

Science.gov (United States)

Johansson, Gun; Eklund, Mona; Erlandsson, Lena-Karin

2012-05-01

A balance between different experiences of occupations in everyday life is important for well-being. The study aim was to describe hassles and uplifts in everyday occupations among women on long-term sick-leave due to stress-related disorders. The sample consisted of 77 women and experiences were collected by the THU-5 instrument. The statements were analysed using quantitative content analysis. Data were categorized into three domains of hassles concerning oneself, doings, and social and physical context. The same domains occurred among the uplifts. Hassles were mostly generated by disturbing people around the women and by their limited body functions. The women were uplifted by supportive social relationships and by performing relaxing and calming occupations. The study illuminates the strong need for social support among women on sick-leave, as well as their low level of energy, which was an obvious obstacle for performing occupations. It is suggested that, in order to increase well-being in the target group, the occupational therapist should meet their need for occupations that match their current level of energy. The challenge for the client is to avoid remaining in a pattern of low-demand occupations without exceeding her/his capacity and returning to an unhealthy pattern of occupations.

Metabolic changes associated with ozone injury of bean leaves

Energy Technology Data Exchange (ETDEWEB)

Craker, L.E.; Starbuck, J.S.

1972-07-01

Metabolic processes in primary leaves of bean plants (Phaseolus vulgaris) were altered by ozone stress. Decreases in levels of ribonucleic acid (RNA) and protein, and increases in ribonuclease (RNase) and free amine groups were associated with visible oxidant injury to the leaves. It appears that some air pollution injury to plants may result from changes in metabolic processes. 23 references, 5 figures, 2 tables.

Effectiveness of a Minimal Intervention for Stress-related mental disorders with Sick leave (MISS; study protocol of a cluster randomised controlled trial in general practice [ISRCTN43779641

Directory of Open Access Journals (Sweden)

van Marwijk Harm WJ

2006-05-01

Full Text Available Abstract Background The main aims of this paper are to describe the setting and design of a Minimal Intervention in general practice for Stress-related mental disorders in patients on Sick leave (MISS, as well as to ascertain the study complies with the requirements for a cluster randomised controlled trial (RCT. The potential adverse consequences of sick leave due to Stress-related Mental Disorders (SMDs are extensive, but often not recognised. Since most people having SMDs with sick leave consult their general practitioner (GP at an early stage, a tailored intervention given by GPs is justified. We provide a detailed description of the MISS; that is more accurate assessment, education, advice and monitoring to treat SMDs in patients on sick leave. Our hypothesis is that the MISS will be more effective compared to the usual care, in reducing days of sick leave of these patients. Methods The design is a pragmatic RCT. Randomisation is at the level of GPs. They received the MISS-training versus no training, in order to compare the MISS vs. usual care at patient level. Enrolment of patients took place after screening in the source population, that comprised 20–60 year old primary care attendees. Inclusion criteria were: moderately elevated distress levels, having a paid job and sick leave for no longer than three months. There is a one year follow up. The primary outcome measure is lasting full return to work. Reduction of SMD- symptoms is one of the secondary outcome measures. Forty-six GPs and 433 patients agreed to participate. Discussion In our study design, attention is given to the practical application of the requirements for a pragmatic trial. The results of this cluster RCT will add to the evidence about treatment options in general practice for SMDs in patients on sick leave, and might contribute to a new and appropriate guideline. These results will be available at the end of 2006.

Survival of FUngi Associated with Grapevine Decline in Pruned Wood after Composting

Directory of Open Access Journals (Sweden)

P. Lecomte

2006-04-01

Full Text Available Recycling vine wood pruned in winter in the vineyard, after grinding and composting, might pose a risk of recontamination with fungi associated with grapevine decline. The survival of four ascomycete fungi (Botryosphaeria obtusa, Phaeomoniella chlamydospora, Phaeoacremonium aleophilum and Eutypa lata in composted material was investigated in a 3-year study conducted in the Bordeaux area. Naturally and artificially infested material was examined before and after composting using classical isolation procedures. Results clearly showed that a composting process can eradicate the four target fungi efficiently.

Responses of wild watermelon to drought stress: accumulation of an ArgE homologue and citrulline in leaves during water deficits.

Science.gov (United States)

Kawasaki, S; Miyake, C; Kohchi, T; Fujii, S; Uchida, M; Yokota, A

2000-07-01

Wild watermelon from the Botswana desert had an ability to survive under severe drought conditions by maintaining its water status (water content and water potential). In the analysis by two-dimensional electrophoresis of leaf proteins, seven spots were newly induced after watering stopped. One with the molecular mass of 40 kilodaltons of the spots was accumulated abundantly. The cDNA encoding for the protein was cloned based on its amino-terminal sequence and the amino acid sequence deduced from the determined nucleotide sequences of the cDNA exhibited homology to the enzymes belong to the ArgE/DapE/Acy1/Cpg2/YscS protein family (including acetylornithine deacetylase, carboxypeptidase and aminoacylase-1). This suggests that the protein is involved in the release of free amino acid by hydrolyzing a peptidic bond. As the drought stress progressed, citrulline became one of the major components in the total free amino acids. Eight days after withholding watering, although the lower leaves wilted significantly, the upper leaves still maintained their water status and the content of citrulline reached about 50% in the total free amino acids. The accumulation of citrulline during the drought stress in wild watermelon is an unique phenomenon in C3-plants. These results suggest that the drought tolerance of wild watermelon is related to (1) the maintenance of the water status and (2) a metabolic change to accumulate citrulline.

Restructuring of Endophytic Bacterial Communities in Grapevine Yellows-Diseased and Recovered Vitis vinifera L. Plants ▿

Science.gov (United States)

Bulgari, Daniela; Casati, Paola; Crepaldi, Paola; Daffonchio, Daniele; Quaglino, Fabio; Brusetti, Lorenzo; Bianco, Piero Attilio

2011-01-01

Length heterogeneity-PCR assays, combined with statistical analyses, highlighted that the endophytic bacterial community associated with healthy grapevines was characterized by a greater diversity than that present in diseased and recovered plants. The findings suggest that phytoplasmas can restructure the bacterial community by selecting endophytic strains that could elicit a plant defense response. PMID:21622794

Functional Annotation, Genome Organization and Phylogeny of the Grapevine (Vitis vinifera Terpene Synthase Gene Family Based on Genome Assembly, FLcDNA Cloning, and Enzyme Assays

Directory of Open Access Journals (Sweden)

Toub Omid

2010-10-01

Full Text Available Abstract Background Terpenoids are among the most important constituents of grape flavour and wine bouquet, and serve as useful metabolite markers in viticulture and enology. Based on the initial 8-fold sequencing of a nearly homozygous Pinot noir inbred line, 89 putative terpenoid synthase genes (VvTPS were predicted by in silico analysis of the grapevine (Vitis vinifera genome assembly 1. The finding of this very large VvTPS family, combined with the importance of terpenoid metabolism for the organoleptic properties of grapevine berries and finished wines, prompted a detailed examination of this gene family at the genomic level as well as an investigation into VvTPS biochemical functions. Results We present findings from the analysis of the up-dated 12-fold sequencing and assembly of the grapevine genome that place the number of predicted VvTPS genes at 69 putatively functional VvTPS, 20 partial VvTPS, and 63 VvTPS probable pseudogenes. Gene discovery and annotation included information about gene architecture and chromosomal location. A dense cluster of 45 VvTPS is localized on chromosome 18. Extensive FLcDNA cloning, gene synthesis, and protein expression enabled functional characterization of 39 VvTPS; this is the largest number of functionally characterized TPS for any species reported to date. Of these enzymes, 23 have unique functions and/or phylogenetic locations within the plant TPS gene family. Phylogenetic analyses of the TPS gene family showed that while most VvTPS form species-specific gene clusters, there are several examples of gene orthology with TPS of other plant species, representing perhaps more ancient VvTPS, which have maintained functions independent of speciation. Conclusions The highly expanded VvTPS gene family underpins the prominence of terpenoid metabolism in grapevine. We provide a detailed experimental functional annotation of 39 members of this important gene family in grapevine and comprehensive information

HONEY BEE CONTRIBUTION TO ‘BORDÔ’ GRAPEVINE FRUIT PRODUCTION IN SOUTHERN BRAZIL

OpenAIRE

MARTIGNAGO, MIRELI; MARTINS, RAFAEL; HARTER-MARQUES, BIRGIT

2017-01-01

ABSTRACT The production of fruits and seeds of many crops is increased when bees visit their flowers pollinating them. The aim of this study was to evaluate the effect of different pollination treatments on ‘Bordô’ grapevine (Vitis labrusca L.) fruit quantity and quality. Quantitative and qualitative fruit production parameters of plants visited by Apis mellifera L., manually self- and cross-pollinated plants and plants without pollination were analyzed and compared. Fruit production was hig...

Minor long-term effects 3-4 years after the ReDO™ intervention for women with stress-related disorders: A focus on sick leave rate, everyday occupations and well-being.

Science.gov (United States)

Eklund, Mona

2017-01-01

The Redesigning Daily Occupations (ReDO™) work rehabilitation method has been found effective, compared with care as usual (CAU), for women with stress-related disorders. To conduct a long-term follow-up of former ReDO™ and CAU participants with respect to sick leave, well-being and everyday occupations 3-4 years after completed work rehabilitation. Forty-two women in each group participated. An index day was decided to estimate sick-leave rate, retrieved from register data. Fifty-five women also participated in a telephone interview addressing well-being, everyday occupations and life events. Both groups had reduced their sick-leave rate further, but no difference between the groups was established. The ReDO™ women perceived a better balance in the work domain of everyday occupations, whereas the CAU group reported more over-occupation. No differences were found on well-being. The groups had experienced similar important life events, affecting the women's work and private lives. Previous stress and anxiety predicted sick leave at the long-term follow-up. Although the ReDO™ intervention had speeded up return to work in the immediate follow-up perspective, the CAU had caught up in the longer term. Still, the ReDO™ women exhibited better balance in the work domain.

An abundant 'Candidatus Phytoplasma solani' tuf b strain is associated with grapevine, stinging nettle and Hyalesthes obsoletus.

Science.gov (United States)

Aryan, A; Brader, G; Mörtel, J; Pastar, M; Riedle-Bauer, M

2014-10-01

Bois noir (BN) associated with ' Candidatus Phytoplasma solani' (Stolbur) is regularly found in Austrian vine growing regions. Investigations between 2003 and 2008 indicated sporadic presence of the confirmed disease vector Hyalesthes obsoletus and frequent infections of bindweed and grapevine. Infections of nettles were rare. In contrast present investigations revealed a mass occurrence of H. obsoletus almost exclusively on stinging nettle. The high population densities of H. obsoletus on Urtica dioica were accompanied by frequent occurrence of ' Ca. P. solani' in nettles and planthoppers. Sequence analysis of the molecular markers secY, stamp, tuf and vmp1 of stolbur revealed a single genotype named CPsM4_At1 in stinging nettles and more than 64 and 90 % abundance in grapevine and H. obsoletus , respectively. Interestingly, this genotype showed tuf b type restriction pattern previously attributed to bindweed associated ' Ca. P. solani' strains, but a different sequence assigned as tuf b2 compared to reference tuf b strains. All other marker genes of CPsM4_At1 clustered with tuf a and nettle derived genotypes verifying distinct nettle phytoplasma genotypes. Transmission experiments with H. obsoletus and Anaceratagallia ribauti resulted in successful transmission of five different strains including the major genotype to Catharanthus roseus and in transmission of the major genotype to U. dioica . Altogether, five nettle and nine bindweed associated genotypes were described. Bindweed types were verified in 34 % of grapevine samples, in few positive Reptalus panzeri , rarely in bindweeds and occasionally in Catharanthus roseus infected by H. obsoletus or A. ribauti . ' Candidatus Phytoplasma convolvuli' (bindweed yellows) was ascertained in nettle and bindweed samples.

Working around Childbirth: Comparative and Empirical Perspectives on Parental Leave Policy.

Science.gov (United States)

Garrett, Patricia; And Others

1990-01-01

Cites research that supports a U.S. parental leave policy that includes job protection and wage replacement during childbirth. Issues dealt with in the literature include current U.S. child welfare legislation, international parental leave legislation, job continuity, reduced stress on the child welfare system, and prejudice against young mothers.…

Plant-mediated interspecific horizontal transmission of an intracellular symbiont in insects.

Science.gov (United States)

Gonella, Elena; Pajoro, Massimo; Marzorati, Massimo; Crotti, Elena; Mandrioli, Mauro; Pontini, Marianna; Bulgari, Daniela; Negri, Ilaria; Sacchi, Luciano; Chouaia, Bessem; Daffonchio, Daniele; Alma, Alberto

2015-11-13

Intracellular reproductive manipulators, such as Candidatus Cardinium and Wolbachia are vertically transmitted to progeny but rarely show co-speciation with the host. In sap-feeding insects, plant tissues have been proposed as alternative horizontal routes of interspecific transmission, but experimental evidence is limited. Here we report results from experiments that show that Cardinium is horizontally transmitted between different phloem sap-feeding insect species through plants. Quantitative PCR and in situ hybridization experiments indicated that the leafhopper Scaphoideus titanus releases Cardinium from its salivary glands during feeding on both artificial media and grapevine leaves. Successional time-course feeding experiments with S. titanus initially fed sugar solutions or small areas of grapevine leaves followed by feeding by the phytoplasma vector Macrosteles quadripunctulatus or the grapevine feeder Empoasca vitis revealed that the symbionts were transmitted to both species. Explaining interspecific horizontal transmission through plants improves our understanding of how symbionts spread, their lifestyle and the symbiont-host intermixed evolutionary pattern.

Plant-mediated interspecific horizontal transmission of an intracellular symbiont in insects

KAUST Repository

Gonella, Elena

2015-11-13

Intracellular reproductive manipulators, such as Candidatus Cardinium and Wolbachia are vertically transmitted to progeny but rarely show co-speciation with the host. In sap-feeding insects, plant tissues have been proposed as alternative horizontal routes of interspecific transmission, but experimental evidence is limited. Here we report results from experiments that show that Cardinium is horizontally transmitted between different phloem sap-feeding insect species through plants. Quantitative PCR and in situ hybridization experiments indicated that the leafhopper Scaphoideus titanus releases Cardinium from its salivary glands during feeding on both artificial media and grapevine leaves. Successional time-course feeding experiments with S. titanus initially fed sugar solutions or small areas of grapevine leaves followed by feeding by the phytoplasma vector Macrosteles quadripunctulatus or the grapevine feeder Empoasca vitis revealed that the symbionts were transmitted to both species. Explaining interspecific horizontal transmission through plants improves our understanding of how symbionts spread, their lifestyle and the symbiont-host intermixed evolutionary pattern.

Induction of cyclic electron flow around photosystem I during heat stress in grape leaves.

Science.gov (United States)

Sun, Yongjiang; Geng, Qingwei; Du, Yuanpeng; Yang, Xinghong; Zhai, Heng

2017-03-01

Photosystem II (PSII) in plants is susceptible to high temperatures. The cyclic electron flow (CEF) around PSI is thought to protect both PSII and PSI from photodamage. However, the underlying physiological mechanisms of the photosynthetic electron transport process and the role of CEF in grape at high temperatures remain unclear. To investigate this issue, we examined the responses of PSII energy distribution, the P700 redox state and CEF to high temperatures in grape leaves. After exposing 'Cabernet Sauvignon' leaves to various temperatures (25, 30, 35, 40 and 45°C) in the light (600μmol photons m -2 s -1 ) for 4h, the maximum quantum yield of PSII (Fv/Fm) significantly decreased at high temperatures (40 and 45°C), while the maximum photo-oxidizable P700 (Pm) was not affected. As the temperature increased, higher initial rates of increase in post-illumination Chl fluorescence were detected, which were accompanied by an increase in high energy state quenching (qE). The chloroplast NAD(P)H dehydrogenase-dependent CEF (NDH-dependent CEF) activities were different among grape cultivators. 'Gold Finger' with greater susceptibility to photoinhibition, exhibited lower NDH-dependent CEF activities under acute heat stress than a more heat tolerant 'Cabernet Sauvignon'. These results suggest that overclosure of PSII reaction centers at high temperature resulted in the photoinhibition of PSII, while the stimulation of CEF in grape played an important role in the photoprotection of PSII and PSI at high temperatures through contributing to the generation of a proton gradient. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Prognostic Factors of Returning to Work after Sick Leave due to Work-Related Common Mental Disorders

DEFF Research Database (Denmark)

Netterstrøm, Bo; Eller, Nanna Hurwitz; Borritz, Marianne

2015-01-01

The aim of this paper was to assess the prognostic factors of return to work (RTW) after one and three years among people on sick leave due to occupational stress. Methods. The study population comprised 223 completers on sick leave, who participated in a stress treatment program. Self...... decision authority, low reward, low support from leaders and colleagues, bullying, high global symptom index, length of sick leave at baseline, and stressful negative life events during the year before baseline were associated with no RTW after one year. Low work ability and full-time sick leave......-reported psychosocial work environment, life events during the past year, severity of the condition, occupational position, employment sector, marital status, and medication were assessed at baseline. RTW was assessed with data from a national compensation database (DREAM). Results. Self-reported high demands, low...

Foliar application of processed calcite particles improves leaf photosynthesis of potted Vitis vinifera L. (var. ‘Cot’ grown under water deficit

Directory of Open Access Journals (Sweden)

Faouzi Attia

2014-12-01

Significance and impact of the study: In the context of climate change, grapevine will most likely experience long periods of drought during its seasonal cycle. Foliar application of processed mineral particles is widely used to reduce heat stress in perennial fruit crops. Here, the micronized calcite Megagreen® does improve photosynthesis of water stressed grapevines.

Physiological responses of Alternanthera philoxeroides (Mart.) Griseb leaves to cadmium stress

International Nuclear Information System (INIS)

Ding Bingzhong; Shi Guoxin; Xu Ye; Hu Jinzhao; Xu Qinsong

2007-01-01

Aquatic macrophytes were found to be the potential scavengers of heavy metals from aquatic environment. In this study, several physiological responses of Alternanthera philoxeroides (Mart.) Griseb leaves to elevated concentrations of cadmium (up to 10 mM) were investigated. It was found that A. philoxeroides was able to accumulate cadmium in its leaves. The pigment contents decreased with the increase of the Cd concentrations. The Cd could induce rise of the activity of peroxidase (POD) at lower concentration (<5 mM), however, when the concentration of Cd rose up to 10 mM, the POD activity declined. The changes of superoxide dismutase (SOD) and Catalase (CAT) activities were exactly opposite to that of POD. In the leaves of Cd-treated fronds, the amounts of three polypeptides with apparent molecular weights 80, 39 and 28 kDa, respectively, were became visible in SDS-PAGE. The nature of these polypeptides remains to be determined. - Cd modified a number of physiological processes and particularly chlorophyll degradation

Essential oil alloaromadendrene from mixed-type Cinnamomum osmophloeum leaves prolongs the lifespan in Caenorhabditis elegans.

Science.gov (United States)

Yu, Chan-Wei; Li, Wen-Hsuan; Hsu, Fu-Lan; Yen, Pei-Ling; Chang, Shang-Tzen; Liao, Vivian Hsiu-Chuan

2014-07-02

Cinnamomum osmophloeum Kaneh. is an indigenous tree species in Taiwan. The present study investigates phytochemical characteristics, antioxidant activities, and longevity of the essential oils from the leaves of the mixed-type C. osmophloeum tree. We demonstrate that the essential oils from leaves of mixed-type C. osmophloeum exerted in vivo antioxidant activities on Caenorhabditis elegans. In addition, minor (alloaromadendrene, 5.0%) but not major chemical components from the leaves of mixed-type C. osmophloeum have a key role against juglone-induced oxidative stress in C. elegans. Additionally, alloaromadendrene not only acts protective against oxidative stress but also prolongs the lifespan of C. elegans. Moreover, mechanistic studies show that DAF-16 is required for alloaromadendrene-mediated oxidative stress resistance and longevity in C. elegans. The results in the present study indicate that the leaves of mixed-type C. osmophloeum and essential oil alloaromadendrene have the potential for use as a source for antioxidants or treatments to delay aging.

Detection of a divergent variant of grapevine virus F by next-generation sequencing.

Science.gov (United States)

Molenaar, Nicholas; Burger, Johan T; Maree, Hans J

2015-08-01

The complete genome sequence of a South African isolate of grapevine virus F (GVF) is presented. It was first detected by metagenomic next-generation sequencing of field samples and validated through direct Sanger sequencing. The genome sequence of GVF isolate V5 consists of 7539 nucleotides and contains a poly(A) tail. It has a typical vitivirus genome arrangement that comprises five open reading frames (ORFs), which share only 88.96 % nucleotide sequence identity with the existing complete GVF genome sequence (JX105428).

Water extract of Vitis coignetiae Pulliat leaves attenuates oxidative stress and inflammation in progressive NASH rats.

Science.gov (United States)

Pak, Wing; Takayama, Fusako; Hasegawa, Azusa; Mankura, Mitsumasa; Egashira, Toru; Ueki, Keiji; Nakamoto, Kazuo; Kawasaki, Hiromu; Mori, Akitane

2012-01-01

This study aimed to investigate the therapeutic effects of the water extract of leaves of Vitis coignetiae Pulliat (VCPL) on nonalcoholic steatohepatitis (NASH) with advanced fibrosis, as our previous study exhibited its preventive effect on NASH. The NASH animal model [PCT/JP2007/52477] was prepared by loading recurrent and intermittent hypoxemia stress to a rat with fatty liver, which resembled the condition occurring in patients with obstructive sleep apnea (OSA) and fatty liver, who have a high incidence of NASH. Intermittent hypoxemia stress is regarded as a condition similar to warm ischemia followed by re-oxygenation, which induces oxidative stress (OS). The daily 100 or 300 mg/kg VCPL administrations were performed for 3 weeks perorally beginning at the time of detection of advanced liver fibrosis. The therapeutic efficacy of VCPL on NASH was demonstrated by the reduction of the leakage of hepato-biliary enzymes and the amelioration of liver fibrosis. The OS elevation in NASH rats was measured based on the derivation of reactive oxygen species from liver mitochondrial energy metabolism and on the decrease in plasma SOD-like activity. The aggravation of inflammatory responses was demonstrated by the neutrophil infiltration (elevated myeloperoxidase activity) and the progression of fibrosis in the livers of NASH rats. In addition, the NASH rats without VCPL treatment also exhibited activation of nuclear factor-κB, a key factor in the link between oxidative stress and inflammation. All of these changes were reduced dose-dependently by the VCPL administration. These findings indicate that VCPL may improve hepatic fibrosis or at least suppress the progression of NASH, by breaking the crosstalk between OS and inflammation.

Protective effect of the leaves of Vitex negundo against ethanol ...

African Journals Online (AJOL)

The present study investigated the effect of the various fractions of hydromethanolic extract of the leaves of Vitex negundo (Verbenaceae) against ethanol-induced cerebral oxidative stress in rats. Cerebral oxidative stress was induced by the administration of 20% ethanol (5 ml/100g bw) for a period of 28 days.

Management of Botryosphaeriaceae species infection in grapevine propagation materials

Directory of Open Access Journals (Sweden)

Regina BILLONES-BAAIJENS

2015-09-01

Full Text Available In New Zealand grapevine propagation nurseries, Botryosphaeriaceae species have been reported to infect the source blocks of the nursery propagators leading to infection of the propagation materials. This research investigated the efficacy of different control methods which could prevent infection or eradicate the pathogen from harvested canes prior to plant propagation. In the source blocks, attempts to reduce infection of shoots by protecting trimming wounds were partially successful (P=0.036, with 19.5% incidence in fungicide-treated shoots and 24.3% infection in the control shoots. Further sampling showed that overall 19.9% of these infections were in the bark and 9.6% in the wood. Hot water treatment (HWT of dormant rootstock 5C canes, previously infected with Neofusicoccum luteum and N. parvum, at 50°C for 30 min resulted in internal infection incidences of 55 and 100%, respectively. HWT at 53°C reduced infection incidence to 0 and 8.5%, respectively, but killed the buds. In naturally infected canes, HWT of 50°C for 30 min reduced infection incidence from 35% in controls, to 0–15% over all Botryosphaeriaceae species. Shorter periods of HWT, at 55°C for 10 min, designed to kill bark infections, were effective in Sauvignon blanc but killed the buds of Pinot noir. Sauvignon blanc canes superficially infected with N. luteum were soaked for 30 min in the fungicides carbendazim, tebuconazole, thiophanate methyl and flusilazole, with and without a polyether-modified trisiloxane adjuvant. Results showed that carbendazim with no adjuvant and tebuconazole with 0.5 mL L-1 adjuvant eliminated 100% of bark infections. A further experiment that soaked 2,000 canes (Sauvignon blanc and Pinot noir in a carbendazim solution prior to rooting found that all canes were free of Botryosphaeriaceae species infection, compared to 17% natural incidence. These results have indicated the potential efficacy of several methods for preventing or reducing infection

Dehydration induced loss of photosynthesis in Arabidopsis leaves during senescence is accompanied by the reversible enhancement in the activity of cell wall β-glucosidase.

Science.gov (United States)

Patro, Lichita; Mohapatra, Pranab Kishor; Biswal, Udaya Chand; Biswal, Basanti

2014-08-01

The physiology of loss of photosynthetic production of sugar and the consequent cellular sugar reprogramming during senescence of leaves experiencing environmental stress largely remains unclear. We have shown that leaf senescence in Arabidopsis thaliana causes a significant reduction in the rate of oxygen evolution and net photosynthetic rate (Pn). The decline in photosynthesis is further aggravated by dehydration. During dehydration, primary photochemical reaction of thylakoids and net photosynthesis decrease in parallel with the increase in water deficit. Senescence induced loss in photosynthesis is accompanied by a significant increase in the activity of cell wall hydrolyzing enzyme such as β-glucosidase associated with cell wall catabolism. The activity of this enzyme is further enhanced when the senescing leaves experience dehydration stress. It is possible that both senescence and stress separately or in combination result in the loss in photosynthesis which could be a signal for an enhancement in the activity of β-glucosidase that breaks down cell wall polysaccharides to sugar to sustain respiration for metabolic activities of plants experiencing stress. Thus dehydration response of cell wall hydrolases of senescing leaves is considered as plants' strategy to have cell wall polysaccharides as an alternative energy source for completion of energy requiring senescence process, stress survival and maintenance of recovery potential of energy deficit cells in the background of loss in photosynthesis. Withdrawal of stress (rehydration) distinctly exhibits recovery of photosynthesis and suppression of enzyme activity. Retention of the signaling for sugar reprogramming through breakdown of cell wall polysaccharides in the senescing leaves exposed to severe drought stress suggests that senescing leaves like mature ones possess potential for stress recovery. The precise mechanism of stress adaptation of senescing leaves is yet to be known. A significant

The effects of callus age, UV irradiation and incubation time on trans-resveratol production in grapevine callus culture

International Nuclear Information System (INIS)

Keskin, N.; Kunter, B.

2009-01-01

In this study, the effects of callus age, ultraviolet (UV) irradiation and incubation time were investigated for the induction of trans-resveratrol production in callus cultures of Kalecik karası (Clone 12) Vitis vinifera L. grape cultivar. Part of leaves (~1 cm 2 ) were taken from one year old grapevines grown in greenhouse and then were cultured in Gamborg B-5 media including 2% saccarose, 0.8% agar, 1.0 μM BAP (6-benzylaminopurine) and 0.1 μM 2, 4-D (2, 4-dichlorophenoxy-acetic acid). After the second subculture, 12 and 15 days old callus tissues were exposed to 254 nm UV light at 10 cm distance from the source for 10 and 15 min. Trans-resveratrol was measured at 0, 24, 48 and 72 hours of incubation by using High Pressure Liquid Chromatography (HPLC). Trans-resveratrol concentration of control callus ranged from 0.56 to 0.96 μg g fw -1 . The highest trans-resveratrol production was obtained from 12 and 15 days-old callus irradiated for 10 min. at the 48th hours of incubation (2.42 μg g fw -1 ). Considering the highest value of trans-resveratrol concentration in controls and experiments, it was determined that UV irraditation in Kalecik karası elicitated the trans-resveratrol production by 2.5 times. (author) [tr

Differences in Flower Transcriptome between Grapevine Clones Are Related to Their Cluster Compactness, Fruitfulness, and Berry Size

Directory of Open Access Journals (Sweden)

Jérôme Grimplet

2017-04-01

Full Text Available Grapevine cluster compactness has a clear impact on fruit quality and health status, as clusters with greater compactness are more susceptible to pests and diseases and ripen more asynchronously. Different parameters related to inflorescence and cluster architecture (length, width, branching, etc., fruitfulness (number of berries, number of seeds and berry size (length, width contribute to the final level of compactness. From a collection of 501 clones of cultivar Garnacha Tinta, two compact and two loose clones with stable differences for cluster compactness-related traits were selected and phenotyped. Key organs and developmental stages were selected for sampling and transcriptomic analyses. Comparison of global gene expression patterns in flowers at the end of bloom allowed identification of potential gene networks with a role in determining the final berry number, berry size and ultimately cluster compactness. A large portion of the differentially expressed genes were found in networks related to cell division (carbohydrates uptake, cell wall metabolism, cell cycle, nucleic acids metabolism, cell division, DNA repair. Their greater expression level in flowers of compact clones indicated that the number of berries and the berry size at ripening appear related to the rate of cell replication in flowers during the early growth stages after pollination. In addition, fluctuations in auxin and gibberellin signaling and transport related gene expression support that they play a central role in fruit set and impact berry number and size. Other hormones, such as ethylene and jasmonate may differentially regulate indirect effects, such as defense mechanisms activation or polyphenols production. This is the first transcriptomic based analysis focused on the discovery of the underlying gene networks involved in grapevine traits of grapevine cluster compactness, berry number and berry size.

Differences in Flower Transcriptome between Grapevine Clones Are Related to Their Cluster Compactness, Fruitfulness, and Berry Size.

Science.gov (United States)

Grimplet, Jérôme; Tello, Javier; Laguna, Natalia; Ibáñez, Javier

2017-01-01

Grapevine cluster compactness has a clear impact on fruit quality and health status, as clusters with greater compactness are more susceptible to pests and diseases and ripen more asynchronously. Different parameters related to inflorescence and cluster architecture (length, width, branching, etc.), fruitfulness (number of berries, number of seeds) and berry size (length, width) contribute to the final level of compactness. From a collection of 501 clones of cultivar Garnacha Tinta, two compact and two loose clones with stable differences for cluster compactness-related traits were selected and phenotyped. Key organs and developmental stages were selected for sampling and transcriptomic analyses. Comparison of global gene expression patterns in flowers at the end of bloom allowed identification of potential gene networks with a role in determining the final berry number, berry size and ultimately cluster compactness. A large portion of the differentially expressed genes were found in networks related to cell division (carbohydrates uptake, cell wall metabolism, cell cycle, nucleic acids metabolism, cell division, DNA repair). Their greater expression level in flowers of compact clones indicated that the number of berries and the berry size at ripening appear related to the rate of cell replication in flowers during the early growth stages after pollination. In addition, fluctuations in auxin and gibberellin signaling and transport related gene expression support that they play a central role in fruit set and impact berry number and size. Other hormones, such as ethylene and jasmonate may differentially regulate indirect effects, such as defense mechanisms activation or polyphenols production. This is the first transcriptomic based analysis focused on the discovery of the underlying gene networks involved in grapevine traits of grapevine cluster compactness, berry number and berry size.

Studying of Salinity Stress Effect on Germination, Proline, Sugar, Protein, Lipid and Chlorophyll Content in Purslane (Portulaca oleracea L. Leaves

Directory of Open Access Journals (Sweden)

Parvaneh Rahdari

2012-04-01

Full Text Available Approximately 30% of country regions are under influence of salt and one of the main important methods for increasing of hectare performance in salt soils, using of resistant plant against with salt such as medicinal annual plant of Purslane (Portulaca oleraceae L..Studying of the salt stress effect on germination and some physiological parameters in Purslane was carried out in completely random framework and with three replications and under controlled conditions. In this study, salinity was imposed by sodium chloride (NaCl and in five levels of framework included of Control (distilled water, 50, 100, 150 and 200 Mmol from NaCl. Studied physiological parameters included of proline, sugar, protein, lipid and chlorophyll in Purslane leaves.In relation with observed germination that increasing of salt level, germination rate was reduced that the least germination rate in 200 Mmol and the highest germination was observed in control which in statistical level 0.01 showed meaningful difference. Also, results showed an increasing of leaf proline and sugar that was synchronize with increasing of sodium chloride, this increasing in statistical level of P<0.01 was meaningful, while blank had the least rate and salt level 200 Mmol was observed. Synchronize with increasing of salinity level, lipid and protein concentration decreasing that was meaningful (P<0.01 which highest of leaf lipid and protein content in control level and least concentration was observed in 200 Mmol of salinity level. Also, salinity stress due to increasing of chlorophyll a and b levels in Purslane leaves which this increasing in leaf chlorophyll b concentrations in 0.01 statistical level was meaningful and the least level chlorophyll a and b in blank and the highest level of chlorophyll a and b by order in 150 and 200 Mmol of NaCl was observed. The results showed that plant for resistance against salinity increasing of proline, sugar and chlorophyll content in leaves are useful for

Paid Maternity Leave in the United States: Associations with Maternal and Infant Health.

Science.gov (United States)

Jou, Judy; Kozhimannil, Katy B; Abraham, Jean M; Blewett, Lynn A; McGovern, Patricia M

2018-02-01

Objectives The United States is one of only three countries worldwide with no national policy guaranteeing paid leave to employed women who give birth. While maternity leave has been linked to improved maternal and child outcomes in international contexts, up-to-date research evidence in the U.S. context is needed to inform current policy debates on paid family leave. Methods Using data from Listening to Mothers III, a national survey of women ages 18-45 who gave birth in 2011-2012, we conducted multivariate logistic regression to predict the likelihood of outcomes related to infant health, maternal physical and mental health, and maternal health behaviors by the use and duration of paid maternity leave. Results Use of paid and unpaid leave varied significantly by race/ethnicity and household income. Women who took paid maternity leave experienced a 47% decrease in the odds of re-hospitalizing their infants (95% CI 0.3, 1.0) and a 51% decrease in the odds of being re-hospitalized themselves (95% CI 0.3, 0.9) at 21 months postpartum, compared to women taking unpaid or no leave. They also had 1.8 times the odds of doing well with exercise (95% CI 1.1, 3.0) and stress management (95% CI 1.1, 2.8), compared to women taking only unpaid leave. Conclusions for Practice Paid maternity leave significantly predicts lower odds of maternal and infant re-hospitalization and higher odds of doing well with exercise and stress management. Policies aimed at expanding access to paid maternity and family leave may contribute toward reducing socio-demographic disparities in paid leave use and its associated health benefits.

vitisFlower®: Development and Testing of a Novel Android-Smartphone Application for Assessing the Number of Grapevine Flowers per Inflorescence Using Artificial Vision Techniques.

Science.gov (United States)

Aquino, Arturo; Millan, Borja; Gaston, Daniel; Diago, María-Paz; Tardaguila, Javier

2015-08-28

Grapevine flowering and fruit set greatly determine crop yield. This paper presents a new smartphone application for automatically counting, non-invasively and directly in the vineyard, the flower number in grapevine inflorescence photos by implementing artificial vision techniques. The application, called vitisFlower(®), firstly guides the user to appropriately take an inflorescence photo using the smartphone's camera. Then, by means of image analysis, the flowers in the image are detected and counted. vitisFlower(®) has been developed for Android devices and uses the OpenCV libraries to maximize computational efficiency. The application was tested on 140 inflorescence images of 11 grapevine varieties taken with two different devices. On average, more than 84% of flowers in the captures were found, with a precision exceeding 94%. Additionally, the application's efficiency on four different devices covering a wide range of the market's spectrum was also studied. The results of this benchmarking study showed significant differences among devices, although indicating that the application is efficiently usable even with low-range devices. vitisFlower is one of the first applications for viticulture that is currently freely available on Google Play.

vitisFlower®: Development and Testing of a Novel Android-Smartphone Application for Assessing the Number of Grapevine Flowers per Inflorescence Using Artificial Vision Techniques

Directory of Open Access Journals (Sweden)

Arturo Aquino

2015-08-01

Full Text Available Grapevine flowering and fruit set greatly determine crop yield. This paper presents a new smartphone application for automatically counting, non-invasively and directly in the vineyard, the flower number in grapevine inflorescence photos by implementing artificial vision techniques. The application, called vitisFlower®, firstly guides the user to appropriately take an inflorescence photo using the smartphone’s camera. Then, by means of image analysis, the flowers in the image are detected and counted. vitisFlower® has been developed for Android devices and uses the OpenCV libraries to maximize computational efficiency. The application was tested on 140 inflorescence images of 11 grapevine varieties taken with two different devices. On average, more than 84% of flowers in the captures were found, with a precision exceeding 94%. Additionally, the application’s efficiency on four different devices covering a wide range of the market’s spectrum was also studied. The results of this benchmarking study showed significant differences among devices, although indicating that the application is efficiently usable even with low-range devices. vitisFlower is one of the first applications for viticulture that is currently freely available on Google Play.

Salt stress aggravates boron toxicity symptoms in banana leaves by impairing guttation.

Science.gov (United States)

Shapira, O R; Israeli, Yair; Shani, Uri; Schwartz, Amnon

2013-02-01

Boron (B) is known to accumulate in the leaf margins of different plant species, arguably a passive consequence of enhanced transpiration at the ends of the vascular system. However, transpiration rate is not the only factor affecting ion distribution. We examine an alternative hypothesis, suggesting the participation of the leaf bundle sheath in controlling radial water and solute transport from the xylem to the mesophyll in analogy to the root endodermis. In banana, excess B that remains confined to the vascular system is effectively disposed of via dissolution in the guttation fluid; therefore, impairing guttation should aggravate B damage to the leaf margins. Banana plants were subjected to increasing B concentrations. Guttation rates were manipulated by imposing a moderate osmotic stress. Guttation fluid was collected and analysed continuously. The distribution of ions across the lamina was determined. Impairing guttation indeed led to increased B damage to the leaf margins. The kinetics of ion concentration in guttation samples revealed major differences between ion species, corresponding to their distribution in the lamina dry matter. We provide evidence that the distribution pattern of B and other ions across banana leaves depends on active filtration of the transpiration stream and on guttation. © 2012 Blackwell Publishing Ltd.

Genetic and functional diversity of soil microbial communities associated to grapevine plants and wine quality

Science.gov (United States)

Mocali, Stefano; Fabiani, Arturo; Kuramae, Eiko; de Hollander, Mattias; Kowalchuk, George A.; Vignozzi, Nadia; Valboa, Giuseppe; Costantini, Edoardo

2013-04-01

Despite the economic importance of vineyards in Italy, the wine sector is facing severe challenges from increased global competition and climate changes. The quality of the grape at harvest has a strong direct impact on wine final quality and the strong relationship between wine composition, aroma, taste, and soil properties has been outlined in the "Terroir concept". However, information on the impact of soil microbial communities on soil functions, grapevine plants, and wine quality is generally lacking. In the current study, soils from two close sites in Central Tuscany (BRO11 and BRO12) cultivated with the same grapevine cultivar Sangiovese, but with contrasting wine quality, were examined. Although the BRO12 site provided a better wine quality than the BRO11, the two soils showed similar physical, chemical, and hydrological properties. Also soil humidity, as determined by FDR (Frequency Domain Reflectometry) sensors, indicated a similar water availability in the first 75 cm during a three years trial (2000-2010). Interestingly, the mean three years value of the ratio between the two stable carbon isotopes 13C/12C, measured in the alcohol of the wines, was significantly higher in BRO12 than in BRO11 (-28,3‰ and -24,4‰, respectively), indicating the presence of a relatively higher water stress in the BRO11 soil. Functional GeoChip microarray analyses revealed higher presence of Actinobacteria in the BRO12 than in the BRO11 soil, where the alfa-Proteobacteria were more abundant. Furthermore, a consistent difference in genes involved in S cycling, with a significant overrepresentation of sulphur-oxidation genes in BRO11 and increased levels of sulphate reduction genes BRO12 was detected. These results are consistent with the high content of sulphates and the abundance of Firmicutes such as Sulfobacillus thermosulfidooxidans in the BRO11 soil. Therefore, the different microbiology of the two soils could be related to the different redox conditions of the two

Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

Science.gov (United States)

Le Gall, O; Candresse, T; Brault, V; Dunez, J

1989-10-11

The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein.

A Long-Term Follow-Up of the Efficacy of Nature-Based Therapy for Adults Suffering from Stress-Related Illnesses on Levels of Healthcare Consumption and Sick-Leave Absence: A Randomized Controlled Trial

Science.gov (United States)

Corazon, Sus Sola; Nyed, Patrik Karlsson; Sidenius, Ulrik

2018-01-01

Stress-related illnesses are a growing health problem in the Western world; which also has economic significance for society. As a consequence; there is a growing demand for effective treatments. The study investigates the long-term efficacy of the Nacadia® nature-based therapy (NNBT) by comparing it to the efficacy of a validated cognitive behavioral therapy, called STreSS. The study is designed as a randomized controlled trial in which 84 participants are randomly allocated between the treatments. Long-term efficacy is investigated through data extracts from the national database of Statistics Denmark on the sick leave and the health-care consumption. The results show that both the NNBT and the STreSS lead to a significant decrease in number of contacts with a general practitioner in the period from twelve months prior to treatment to twelve months after treatment; and, a significant decrease in long-term sick leave from the month prior to treatment to twelve months after treatment. The positive long-term effects provide validation for the NNBT as an efficient treatment of stress-related illnesses. PMID:29342952

A Long-Term Follow-Up of the Efficacy of Nature-Based Therapy for Adults Suffering from Stress-Related Illnesses on Levels of Healthcare Consumption and Sick-Leave Absence: A Randomized Controlled Trial

Directory of Open Access Journals (Sweden)

Sus Sola Corazon

2018-01-01

Full Text Available Stress-related illnesses are a growing health problem in the Western world; which also has economic significance for society. As a consequence; there is a growing demand for effective treatments. The study investigates the long-term efficacy of the Nacadia® nature-based therapy (NNBT by comparing it to the efficacy of a validated cognitive behavioral therapy, called STreSS. The study is designed as a randomized controlled trial in which 84 participants are randomly allocated between the treatments. Long-term efficacy is investigated through data extracts from the national database of Statistics Denmark on the sick leave and the health-care consumption. The results show that both the NNBT and the STreSS lead to a significant decrease in number of contacts with a general practitioner in the period from twelve months prior to treatment to twelve months after treatment; and, a significant decrease in long-term sick leave from the month prior to treatment to twelve months after treatment. The positive long-term effects provide validation for the NNBT as an efficient treatment of stress-related illnesses.

A Long-Term Follow-Up of the Efficacy of Nature-Based Therapy for Adults Suffering from Stress-Related Illnesses on Levels of Healthcare Consumption and Sick-Leave Absence: A Randomized Controlled Trial.

Science.gov (United States)

Corazon, Sus Sola; Nyed, Patrik Karlsson; Sidenius, Ulrik; Poulsen, Dorthe Varning; Stigsdotter, Ulrika Karlsson

2018-01-15

Stress-related illnesses are a growing health problem in the Western world; which also has economic significance for society. As a consequence; there is a growing demand for effective treatments. The study investigates the long-term efficacy of the Nacadia ® nature-based therapy (NNBT) by comparing it to the efficacy of a validated cognitive behavioral therapy, called STreSS. The study is designed as a randomized controlled trial in which 84 participants are randomly allocated between the treatments. Long-term efficacy is investigated through data extracts from the national database of Statistics Denmark on the sick leave and the health-care consumption. The results show that both the NNBT and the STreSS lead to a significant decrease in number of contacts with a general practitioner in the period from twelve months prior to treatment to twelve months after treatment; and, a significant decrease in long-term sick leave from the month prior to treatment to twelve months after treatment. The positive long-term effects provide validation for the NNBT as an efficient treatment of stress-related illnesses.

The sequencing of the complete genome of a Tomato black ring virus (TBRV) and of the RNA2 of three Grapevine chrome mosaic virus (GCMV) isolates from grapevine reveals the possible recombinant origin of GCMV.

Science.gov (United States)

Digiaro, M; Yahyaoui, E; Martelli, G P; Elbeaino, T

2015-02-01

The complete genome of a Tomato black ring virus isolate (TBRV-Mirs) (RNA1, 7,366 nt and RNA2, 4,640 nt) and the RNA2 sequences (4,437; 4,445; and 4,442 nts) of three Grapevine chrome mosaic virus isolates (GCMV-H6, -H15, and -H27) were determined. All RNAs contained a single open reading frame encoding polyproteins of 254 kDa (p1) and 149 kDa (p2) for TBRV-Mirs RNA1 and RNA2, respectively, and 146 kDa for GCMV RNA2. p1 of TBRV-Mirs showed the highest identity with TBRV-MJ (94 %), Beet ringspot virus (BRSV, 82 %), and Grapevine Anatolian ringspot virus (GARSV, 66 %), while p2 showed the highest identity with TBRV isolates MJ (89 %) and ED (85 %), followed by BRSV (65 %), GCMV (58 %), and GARSV (57 %). The amino acid identity of RNA2 sequences of four GCMV isolates (three from this study and one from GenBank) ranged from 91 to 98 %, the homing protein being the most variable. The RDP3 program predicted putative intra-species recombination events for GCMV-H6 and recognized GCMV as a putative inter-species recombinant between GARSV and TBRV. In both cases, the recombination events were at the movement protein level.

Retrospectively exploring the importance of items in the decision to leave the emergency medical services (EMS) profession and their relationships to life satisfaction after leaving EMS and likelihood of returning to EMS.

Science.gov (United States)

Blau, Gary; Chapman, Susan

2011-01-01

An exit survey was returned by a sample of 127 respondents in fully compensated positions who left the EMS profession, most within 12 months prior to filling out the exit survey. A very high percentage continued to work after leaving EMS. Respondents were asked to rate the importance of each of 17 items in affecting their decision to leave EMS. A higher than anticipated response to a "not applicable" response choice affected the usability of 8 of these items. Nine of the 17 items had at least 65 useable responses and were used for further analysis. Within these 9, stress/burnout and lack of job challenges had the highest importance in affecting the decision to leave EMS, while desire for better pay and benefits had the lowest importance. Desire for career change was positively related to life satisfaction after leaving EMS and negatively related to likelihood of returning to EMS. Stress/burnout was positively related to life satisfaction after leaving EMS. Study limitations and future research issues are briefly discussed.

Hormonal and Hydroxycinnamic Acids Profiles in Banana Leaves in Response to Various Periods of Water Stress

Directory of Open Access Journals (Sweden)

Jalel Mahouachi

2014-01-01

Full Text Available The pattern of change in the endogenous levels of several plant hormones and hydroxycinnamic acids in addition to growth and photosynthetic performance was investigated in banana plants (Musa acuminata cv. “Grand Nain” subjected to various cycles of drought. Water stress was imposed by withholding irrigation for six periods with subsequent rehydration. Data showed an increase in abscisic acid (ABA and indole-3-acetic acid (IAA levels, a transient increase in salicylic acid (SA concentration, and no changes in jasmonic acid (JA after each period of drought. Moreover, the levels of ferulic (FA and cinnamic acids (CA were increased, and plant growth and leaf gas exchange parameters were decreased by drought conditions. Overall, data suggest an involvement of hormones and hydroxycinnamic acids in plant avoidance of tissue dehydration. The increase in IAA concentration might alleviate the senescence of survival leaves and maintained cell elongation, and the accumulation of FA and CA could play a key role as a mechanism of photoprotection through leaf folding, contributing to the effect of ABA on inducing stomatal closure. Data also suggest that the role of SA similarly to JA might be limited to a transient and rapid increase at the onset of the first period of stress.

Hormonal and hydroxycinnamic acids profiles in banana leaves in response to various periods of water stress.

Science.gov (United States)

Mahouachi, Jalel; López-Climent, María F; Gómez-Cadenas, Aurelio

2014-01-01

The pattern of change in the endogenous levels of several plant hormones and hydroxycinnamic acids in addition to growth and photosynthetic performance was investigated in banana plants (Musa acuminata cv. "Grand Nain") subjected to various cycles of drought. Water stress was imposed by withholding irrigation for six periods with subsequent rehydration. Data showed an increase in abscisic acid (ABA) and indole-3-acetic acid (IAA) levels, a transient increase in salicylic acid (SA) concentration, and no changes in jasmonic acid (JA) after each period of drought. Moreover, the levels of ferulic (FA) and cinnamic acids (CA) were increased, and plant growth and leaf gas exchange parameters were decreased by drought conditions. Overall, data suggest an involvement of hormones and hydroxycinnamic acids in plant avoidance of tissue dehydration. The increase in IAA concentration might alleviate the senescence of survival leaves and maintained cell elongation, and the accumulation of FA and CA could play a key role as a mechanism of photoprotection through leaf folding, contributing to the effect of ABA on inducing stomatal closure. Data also suggest that the role of SA similarly to JA might be limited to a transient and rapid increase at the onset of the first period of stress.

Effectiveness of a minimal intervention for stress-related mental disorders with sick leave (MISS): study protocol of a cluster randomised controlled trial in general practice [ISRCTN43779641

NARCIS (Netherlands)

Bakker, I.M.; Terluin, B.; van Marwijk, H.W.J.; Cundy, C.M.; Smit, J.H.; van Mechelen, W.; Stalman, W.A.B.

2006-01-01

Background: The main aims of this paper are to describe the setting and design of a Minimal Intervention in general practice for Stress-related mental disorders in patients on Sick leave (MISS), as well as to ascertain the study complies with the requirements for a cluster randomised controlled

Estimation of the base temperature and growth phase duration in terms of thermal time for four grapevine cultivars

Science.gov (United States)

Zapata, D.; Salazar, M.; Chaves, B.; Keller, M.; Hoogenboom, G.

2015-12-01

Thermal time models have been used to predict the development of many different species, including grapevine ( Vitis vinifera L.). These models normally assume that there is a linear relationship between temperature and plant development. The goal of this study was to estimate the base temperature and duration in terms of thermal time for predicting veraison for four grapevine cultivars. Historical phenological data for four cultivars that were collected in the Pacific Northwest were used to develop the thermal time model. Base temperatures ( T b) of 0 and 10 °C and the best estimated T b using three different methods were evaluated for predicting veraison in grapevine. Thermal time requirements for each individual cultivar were evaluated through analysis of variance, and means were compared using the Fisher's test. The methods that were applied to estimate T b for the development of wine grapes included the least standard deviation in heat units, the regression coefficient, and the development rate method. The estimated T b varied among methods and cultivars. The development rate method provided the lowest T b values for all cultivars. For the three methods, Chardonnay had the lowest T b ranging from 8.7 to 10.7 °C, while the highest T b values were obtained for Riesling and Cabernet Sauvignon with 11.8 and 12.8 °C, respectively. Thermal time also differed among cultivars, when either the fixed or estimated T b was used. Predictions of the beginning of ripening with the estimated temperature resulted in the lowest variation in real days when compared with predictions using T b = 0 or 10 °C, regardless of the method that was used to estimate the T b.

ABA Represses the Expression of Cell Cycle Genes and May Modulate the Development of Endodormancy in Grapevine Buds

Directory of Open Access Journals (Sweden)

Ricardo Vergara

2017-05-01

Full Text Available Recently, the plant hormone abscisic acid (ABA has been implicated as a key player in the regulation of endodormancy (ED in grapevine buds (Vitis vinifera L. In this study, we show that in the vine, the expression of genes related to the biosynthesis of ABA (VvNCED1; VvNCED2 and the content of ABA are significantly higher in the latent bud than at the shoot apex, while the expression of an ABA catabolic gene (VvA8H3 showed no significant difference between either organ. A negative correlation between the content of ABA and transcript levels of cell cycle genes (CCG was found in both tissues. This result suggested that ABA may negatively regulate the expression of CCG in meristematic tissues of grapevines. To test this proposition, the effect of ABA on the expression of CCG was analyzed in two meristematic tissues of the vine: somatic embryos and shoot apexes. The results indicated that cell cycle progression is repressed by ABA in both organs, since it down-regulated the expression of genes encoding cyclin-dependent kinases (VvCDKB1, VvCDKB2 and genes encoding cyclins of type A (VvCYCA1, VvCYCA2, VvCYCA3, B (VvCYCB, and D (VvCYCD3.2a and up-regulated the expression of VvICK5, a gene encoding an inhibitor of CDKs. During ED, the content of ABA increased, and the expression of CCG decreased. Moreover, the dormancy-breaking compound hydrogen cyanamide (HC reduced the content of ABA and up-regulated the expression of CCG, this last effect was abolished when HC and ABA were co-applied. Taken together, these results suggest that ABA-mediated repression of CCG transcription may be part of the mechanism through which ABA modulates the development of ED in grapevine buds.

Women Superintendents Who Leave: Stress and Health Factors

Science.gov (United States)

Robinson, Kerry K.; Shakeshaft, Charol

2015-01-01

Previous research on stress in the workplace has demonstrated that it can have not only a current, but lasting effect on a worker's health. The superintendency is a stressful job due to all of the competing demands of running a school system, no matter the size. This exploratory study reexamined qualitative interview transcripts from Robinson's…

Saved Leave Scheme (SLS) : Simplified procedure for the transfer of leave to saved leave accounts

CERN Multimedia

HR Division

2001-01-01

As part of the process of streamlining procedures, the HR and AS Divisions have jointly developed a system whereby annual and compensatory leave will henceforth be automatically transferred1) to saved leave accounts. Under the provisions of the voluntary saved leave scheme (SLS), a maximum total of 10 days'2) annual and compensatory leave (excluding saved leave accumulated in accordance with the provisions of Administrative Circular No. 22 B) can be transferred to the saved leave account at the end of the leave year (30 September). Previously, every person taking part in the scheme has been individually issued with a form for the purposes of requesting the transfer of leave to the leave account and the transfer has then had to be done manually by HR Division. To streamline the procedure, unused leave of all those taking part in the saved leave scheme at the closure of of the leave-year accounts will henceforth be transferred automatically to the saved leave account on that date. This simplification is in the ...

Fathers’ Experience of Shared Parental Leave in Sweden

Directory of Open Access Journals (Sweden)

Anders Chronholm

2011-03-01

Full Text Available Since the introduction of the Swedish parental leave reform in 1974, fathers have had the same rights to use parental leave as mothers. Between 2000 and 2003, a research project at the Department of Sociology, University of Gothenburg, focused on fathers who had taken more than four months of paid parental leave. The approach of the study was mainly qualitative, based upon a combination of a survey and interviews. A majority of the fathers who answered the questionnaire had been the main caregivers for their children during their parental leave. During the interviews many of the men described their mothers as role models for their fatherhood. The men also described their own partner as both anxious to get back to her work after her own parental leave period and convinced of the importance of a nurturing father. An early decision to take part of the parental leave probably made it easier for the men to reach workplace agreements. Most of the men described themselves as both nurturing fathers and as sharing housework equally. They stressed the importance of being alone with their child during a long period, to be able to develop a deep relationship with their child.

Paid Family Leave, Fathers' Leave-Taking, and Leave-Sharing in Dual-Earner Households.

Science.gov (United States)

Bartel, Anne P; Rossin-Slater, Maya; Ruhm, Christopher J; Stearns, Jenna; Waldfogel, Jane

Using difference-in-difference and difference-in-difference-in-difference designs, we study California's Paid Family Leave (CA-PFL) program, the first source of government-provided paid parental leave available to fathers in the Unites States. Relative to the pre-treatment mean, fathers of infants in California are 46 percent more likely to be on leave when CA-PFL is available. In households where both parents work, we find suggestive evidence that CA-PFL increases both father-only leave-taking (i.e., father on leave while mother is at work) and joint leave-taking (i.e., both parents on leave at the same time). Effects are larger for fathers of first-born children than for fathers of later-born children.

Review of invasive grapevine aphid, Aphis illinoisensis Shimer, and native parasitoids in the Mediterranean (Hemiptera, Aphididae; Hymenoptera, Braconidae, Aphidiinae)

Czech Academy of Sciences Publication Activity Database

Havelka, Jan; Shukshuk, A. H.; Ghaliow, M. E.; Laamari, M.; Kavallieratos, N. G.; Tomanović, Ž.; Rakhshani, E.; Pons, X.; Starý, Petr

2011-01-01

Roč. 63, č. 1 (2011), s. 269-274 ISSN 0354-4664 Grant - others:Ministry of Science and Technological Development of the Republic of Serbia(CS) 43001 Institutional research plan: CEZ:AV0Z50070508 Keywords : invasions * Aphis illinoisensis * grapevine Subject RIV: EH - Ecology, Behaviour Impact factor: 0.360, year: 2011

Grapevine rootstocks differentially affect the rate of ripening and modulate auxin-related genes in Cabernet Sauvignon berries

Directory of Open Access Journals (Sweden)

Massimiliano eCorso

2016-02-01

Full Text Available In modern viticulture, grafting commercial grapevine varieties on interspecific rootstocks is a common practice required for conferring resistance to many biotic and abiotic stresses. Nevertheless, the use of rootstocks to gain these essential traits is also known to impact grape berry development and quality, although the underlying mechanisms are still poorly understood. In grape berries, the onset of ripening (véraison is regulated by a complex network of mobile signals including hormones such as auxins, ethylene, abscisic acid and brassinosteroids. Recently, a new rootstock, designated M4, was selected based on its enhanced tolerance to water stress and medium vigour. This study investigates the effect of M4 on Cabernet Sauvignon (CS berry development in comparison to the commercial 1103P rootstock. Physical and biochemical parameters showed that the ripening rate of CS berries is faster when grafted onto M4. A multifactorial analysis performed on mRNA-Seq data obtained from skin and pulp of berries grown in both graft combinations revealed that genes controlling auxin action (ARF and Aux/IAA represent one of main categories affected by the rootstock genotype. Considering that the level of auxin tightly regulates the transcription of these genes, we investigated the behaviour of the main gene families involved in auxin biosynthesis and conjugation. Molecular and biochemical analyses confirmed a link between the rate of berry development and the modulation of auxin metabolism. Moreover the data indicate that this phenomenon appears to be particularly pronounced in skin tissue in comparison to the flesh.

Grapevine Rootstocks Differentially Affect the Rate of Ripening and Modulate Auxin-Related Genes in Cabernet Sauvignon Berries.

Science.gov (United States)

Corso, Massimiliano; Vannozzi, Alessandro; Ziliotto, Fiorenza; Zouine, Mohamed; Maza, Elie; Nicolato, Tommaso; Vitulo, Nicola; Meggio, Franco; Valle, Giorgio; Bouzayen, Mondher; Müller, Maren; Munné-Bosch, Sergi; Lucchin, Margherita; Bonghi, Claudio

2016-01-01

In modern viticulture, grafting commercial grapevine varieties on interspecific rootstocks is a common practice required for conferring resistance to many biotic and abiotic stresses. Nevertheless, the use of rootstocks to gain these essential traits is also known to impact grape berry development and quality, although the underlying mechanisms are still poorly understood. In grape berries, the onset of ripening (véraison) is regulated by a complex network of mobile signals including hormones such as auxins, ethylene, abscisic acid, and brassinosteroids. Recently, a new rootstock, designated M4, was selected based on its enhanced tolerance to water stress and medium vigor. This study investigates the effect of M4 on Cabernet Sauvignon (CS) berry development in comparison to the commercial 1103P rootstock. Physical and biochemical parameters showed that the ripening rate of CS berries is faster when grafted onto M4. A multifactorial analysis performed on mRNA-Seq data obtained from skin and pulp of berries grown in both graft combinations revealed that genes controlling auxin action (ARF and Aux/IAA) represent one of main categories affected by the rootstock genotype. Considering that the level of auxin tightly regulates the transcription of these genes, we investigated the behavior of the main gene families involved in auxin biosynthesis and conjugation. Molecular and biochemical analyses confirmed a link between the rate of berry development and the modulation of auxin metabolism. Moreover, the data indicate that this phenomenon appears to be particularly pronounced in skin tissue in comparison to the flesh.

Cytoplasmic- and extracellular-proteome analysis of Diplodia seriata: a phytopathogenic fungus involved in grapevine decline

Directory of Open Access Journals (Sweden)

Cobos Rebeca

2010-09-01

Full Text Available Abstract Background The phytopathogenic fungus Diplodia seriata, whose genome remains unsequenced, produces severe infections in fruit trees (fruit blight and grapevines. In this crop is recognized as one of the most prominent pathogens involved in grapevine trunk disease (or grapevine decline. This pathology can result in the death of adult plants and therefore it produces severe economical losses all around the world. To date no genes or proteins have been characterized in D. seriata that are involved in the pathogenicity process. In an effort to help identify potential gene products associated with pathogenicity and to gain a better understanding of the biology of D. seriata, we initiated a proteome-level study of the fungal mycelia and secretome. Results Intracellular and secreted proteins from D. seriata collected from liquid cultures were separated using two-dimensional gel electrophoresis. About 550 cytoplasmic proteins were reproducibly present in 3 independent extractions, being 53 identified by peptide mass fingerprinting and tandem mass spectrometry. The secretome analysis showed 75 secreted proteins reproducibly present in 3 biological replicates, being 16 identified. Several of the proteins had been previously identified as virulence factors in other fungal strains, although their contribution to pathogenicity in D. seriata remained to be analyzed. When D. seriata was grown in a medium supplemented with carboxymethylcellulose, 3 proteins were up-regulated and 30 down-regulated. Within the up-regulated proteins, two were identified as alcohol dehydrogenase and mitochondrial peroxyrredoxin-1, suggesting that they could play a significant role in the pathogenicity process. As for the 30 down-regulated proteins, 9 were identified being several of them involved in carbohydrate metabolism. Conclusions This study is the first report on proteomics on D. seriata. The proteomic data obtained will be important to understand the pathogenicity

Paid Family Leave, Fathers' Leave-Taking, and Leave-Sharing in Dual-Earner Households

OpenAIRE

Bartel, Ann P.; Rossin-Slater, Maya; Ruhm, Christopher J.; Stearns, Jenna; Waldfogel, Jane

2015-01-01

This paper provides quasi-experimental evidence on the impact of paid leave legislation on fathers' leave-taking, as well as on the division of leave between mothers and fathers in dual-earner households. Using difference-in-difference and difference-in-difference-in-difference designs, we study California's Paid Family Leave (CA-PFL) program, which is the first source of government-provided paid parental leave available to fathers in the United States. Our results show that fathers in Califo...

Transcriptional analysis of late ripening stages of grapevine berry

Science.gov (United States)

2011-01-01

Background The composition of grapevine berry at harvest is a major determinant of wine quality. Optimal oenological maturity of berries is characterized by a high sugar/acidity ratio, high anthocyanin content in the skin, and low astringency. However, harvest time is still mostly determined empirically, based on crude biochemical composition and berry tasting. In this context, it is interesting to identify genes that are expressed/repressed specifically at the late stages of ripening and which may be used as indicators of maturity. Results Whole bunches and berries sorted by density were collected in vineyard on Chardonnay (white cultivar) grapevines for two consecutive years at three stages of ripening (7-days before harvest (TH-7), harvest (TH), and 10-days after harvest (TH+10)). Microvinification and sensory analysis indicate that the quality of the wines made from the whole bunches collected at TH-7, TH and TH+10 differed, TH providing the highest quality wines. In parallel, gene expression was studied with Qiagen/Operon microarrays using two types of samples, i.e. whole bunches and berries sorted by density. Only 12 genes were consistently up- or down-regulated in whole bunches and density sorted berries for the two years studied in Chardonnay. 52 genes were differentially expressed between the TH-7 and TH samples. In order to determine whether these genes followed a similar pattern of expression during the late stages of berry ripening in a red cultivar, nine genes were selected for RT-PCR analysis with Cabernet Sauvignon grown under two different temperature regimes affecting the precocity of ripening. The expression profiles and their relationship to ripening were confirmed in Cabernet Sauvignon for seven genes, encoding a carotenoid cleavage dioxygenase, a galactinol synthase, a late embryogenesis abundant protein, a dirigent-like protein, a histidine kinase receptor, a valencene synthase and a putative S-adenosyl-L-methionine:salicylic acid carboxyl

Transcriptional analysis of late ripening stages of grapevine berry

Directory of Open Access Journals (Sweden)

Guillaumie Sabine

2011-11-01

Full Text Available Abstract Background The composition of grapevine berry at harvest is a major determinant of wine quality. Optimal oenological maturity of berries is characterized by a high sugar/acidity ratio, high anthocyanin content in the skin, and low astringency. However, harvest time is still mostly determined empirically, based on crude biochemical composition and berry tasting. In this context, it is interesting to identify genes that are expressed/repressed specifically at the late stages of ripening and which may be used as indicators of maturity. Results Whole bunches and berries sorted by density were collected in vineyard on Chardonnay (white cultivar grapevines for two consecutive years at three stages of ripening (7-days before harvest (TH-7, harvest (TH, and 10-days after harvest (TH+10. Microvinification and sensory analysis indicate that the quality of the wines made from the whole bunches collected at TH-7, TH and TH+10 differed, TH providing the highest quality wines. In parallel, gene expression was studied with Qiagen/Operon microarrays using two types of samples, i.e. whole bunches and berries sorted by density. Only 12 genes were consistently up- or down-regulated in whole bunches and density sorted berries for the two years studied in Chardonnay. 52 genes were differentially expressed between the TH-7 and TH samples. In order to determine whether these genes followed a similar pattern of expression during the late stages of berry ripening in a red cultivar, nine genes were selected for RT-PCR analysis with Cabernet Sauvignon grown under two different temperature regimes affecting the precocity of ripening. The expression profiles and their relationship to ripening were confirmed in Cabernet Sauvignon for seven genes, encoding a carotenoid cleavage dioxygenase, a galactinol synthase, a late embryogenesis abundant protein, a dirigent-like protein, a histidine kinase receptor, a valencene synthase and a putative S

Peptidoglycan from Fermentation By-Product Triggers Defense Responses in Grapevine

Science.gov (United States)

Chen, Yang; Takeda, Taito; Aoki, Yoshinao; Fujita, Keiko; Suzuki, Shunji; Igarashi, Daisuke

2014-01-01

Plants are constantly under attack from a variety of microorganisms, and rely on a series of complex detection and response systems to protect themselves from infection. Here, we found that a by-product of glutamate fermentation triggered defense responses in grapevine, increasing the expression of defense response genes in cultured cells, foliar chitinase activity, and resistance to infection by downy mildew in leaf explants. To identify the molecule that triggered this innate immunity, we fractionated and purified candidates extracted from Corynebacterium glutamicum, a bacterium used in the production of amino acids by fermentation. Using hydrolysis by lysozyme, a silkworm larva plasma detection system, and gel filtration analysis, we identified peptidoglycan as inducing the defense responses. Peptidoglycans of Escherichia coli, Bacillus subtilis, and Staphylococcus aureus also generated similar defensive responses. PMID:25427192

Performance of a New Model for Predicting End of Flowering Date (bbch 69) of Grapevine (Vitis Vinifera L.)

Science.gov (United States)

Gentilucci, Matteo

2017-04-01

The end of flowering date (BBCH 69) is an important phenological stage for grapevine (Vitis Vinifera L.), in fact up to this date the growth is focused on the plant and gradually passes on the berries through fruit set. The aim of this study is to perform a model to predict the date of the end of flowering (BBCH69) for some grapevine varieties. This research carried out using three cultivars of grapevine (Maceratino, Montepulciano, Sangiovese) in three different locations (Macerata, Morrovalle and Potenza Picena), places of an equal number of wine farms for the time interval between 2006 and 2013. In order to have reliable temperatures for each location, the data of 6 weather stations near these farms have been interpolated using cokriging methods with elevation as independent variable. The procedure to predict the end of flowering date starts with an investigation of cardinal temperatures typical of each grapevine cultivar. In fact the analysis is characterized by four temperature thresholds (cardinals): minimum activity temperature (TCmin = below this temperature there is no growth for the plant), lower optimal temperature (TLopt = above this temperature there is maximum growth), upper optimal temperature (TUopt = below this temperature there is maximum growth) and maximum activity temperature (TC max = above this temperature there is no growth). Thus this model take into consideration maximum, mean and minimum daily temperatures of each location, relating them with the four above mentioned cultivar temperature thresholds. In this way it has been obtained some possible cases (32) corresponding to as many equations, depending on the position of temperatures compared with the thresholds, in order to calculate the amount of growing degree units (GDU) for each day. Several iterative tests (about 1000 for each cultivar) have been performed, changing the values of temperature thresholds and GDU in order to find the best possible combination which minimizes error

Climate Change and Crop Exposure to Adverse Weather: Changes to Frost Risk and Grapevine Flowering Conditions.

Science.gov (United States)

Mosedale, Jonathan R; Wilson, Robert J; Maclean, Ilya M D

2015-01-01

The cultivation of grapevines in the UK and many other cool climate regions is expected to benefit from the higher growing season temperatures predicted under future climate scenarios. Yet the effects of climate change on the risk of adverse weather conditions or events at key stages of crop development are not always captured by aggregated measures of seasonal or yearly climates, or by downscaling techniques that assume climate variability will remain unchanged under future scenarios. Using fine resolution projections of future climate scenarios for south-west England and grapevine phenology models we explore how risks to cool-climate vineyard harvests vary under future climate conditions. Results indicate that the risk of adverse conditions during flowering declines under all future climate scenarios. In contrast, the risk of late spring frosts increases under many future climate projections due to advancement in the timing of budbreak. Estimates of frost risk, however, were highly sensitive to the choice of phenology model, and future frost exposure declined when budbreak was calculated using models that included a winter chill requirement for dormancy break. The lack of robust phenological models is a major source of uncertainty concerning the impacts of future climate change on the development of cool-climate viticulture in historically marginal climatic regions.

Explaining Leaving Union Membership by the Degree of Labour Market Attachment

DEFF Research Database (Denmark)

Leschke, Janine; Vandaele, Kurt

2018-01-01

By particularly stressing the weaker labour market attachment of workers with non-standard contracts, this article contributes to the rather unexplored issue of mainly non-union-related reasons for leaving trade unions. Germany has been selected as a case study because German unions experienced....... Their analysis shows the impact of labour market attachment and firm-level characteristics on union leaving and points especially to important differences across gender....

Comparison of Sensitivity to Photoinhibition and UV-B Stress between Developing and Mature Leaves of Red Pepper (Capsicum annuum L.) Plants from Control and Gamma-Irradiated Seeds

International Nuclear Information System (INIS)

Kim, J.H.; Baek, M.H.; Chung, B.Y.; Kim, J.S.; Lee, Y.B.

2004-01-01

The stress-resistance of red pepper (Capsicum annuum L. cv. Yeomyung and Joheung) plants from the seeds irradiated with low doses of gamma-radiation (2, 4, 8, and 16 Gy) was examined under the conditions of photoinhibition and UV-B stress. To induce photoinhibition, the leaves acclimated overnight with a dim light were exposed to a photon flux density (PFD) of 200 μmol · m-² · s-¹ at 25℃ for 1 h. Then, they were further exposed to the same PFD with supplementary UV-B irradiance at 25℃ for 3 h (UV-B stress). The gamma-irradiation stimulated the early growth of the plants in both cultivars at 2, 4, and 8 Gy

VitiCanopy: A Free Computer App to Estimate Canopy Vigor and Porosity for Grapevine.

Science.gov (United States)

De Bei, Roberta; Fuentes, Sigfredo; Gilliham, Matthew; Tyerman, Steve; Edwards, Everard; Bianchini, Nicolò; Smith, Jason; Collins, Cassandra

2016-04-23

Leaf area index (LAI) and plant area index (PAI) are common and important biophysical parameters used to estimate agronomical variables such as canopy growth, light interception and water requirements of plants and trees. LAI can be either measured directly using destructive methods or indirectly using dedicated and expensive instrumentation, both of which require a high level of know-how to operate equipment, handle data and interpret results. Recently, a novel smartphone and tablet PC application, VitiCanopy, has been developed by a group of researchers from the University of Adelaide and the University of Melbourne, to estimate grapevine canopy size (LAI and PAI), canopy porosity, canopy cover and clumping index. VitiCanopy uses the front in-built camera and GPS capabilities of smartphones and tablet PCs to automatically implement image analysis algorithms on upward-looking digital images of canopies and calculates relevant canopy architecture parameters. Results from the use of VitiCanopy on grapevines correlated well with traditional methods to measure/estimate LAI and PAI. Like other indirect methods, VitiCanopy does not distinguish between leaf and non-leaf material but it was demonstrated that the non-leaf material could be extracted from the results, if needed, to increase accuracy. VitiCanopy is an accurate, user-friendly and free alternative to current techniques used by scientists and viticultural practitioners to assess the dynamics of LAI, PAI and canopy architecture in vineyards, and has the potential to be adapted for use on other plants.

VitiCanopy: A Free Computer App to Estimate Canopy Vigor and Porosity for Grapevine

Directory of Open Access Journals (Sweden)

Roberta De Bei

2016-04-01

Full Text Available Leaf area index (LAI and plant area index (PAI are common and important biophysical parameters used to estimate agronomical variables such as canopy growth, light interception and water requirements of plants and trees. LAI can be either measured directly using destructive methods or indirectly using dedicated and expensive instrumentation, both of which require a high level of know-how to operate equipment, handle data and interpret results. Recently, a novel smartphone and tablet PC application, VitiCanopy, has been developed by a group of researchers from the University of Adelaide and the University of Melbourne, to estimate grapevine canopy size (LAI and PAI, canopy porosity, canopy cover and clumping index. VitiCanopy uses the front in-built camera and GPS capabilities of smartphones and tablet PCs to automatically implement image analysis algorithms on upward-looking digital images of canopies and calculates relevant canopy architecture parameters. Results from the use of VitiCanopy on grapevines correlated well with traditional methods to measure/estimate LAI and PAI. Like other indirect methods, VitiCanopy does not distinguish between leaf and non-leaf material but it was demonstrated that the non-leaf material could be extracted from the results, if needed, to increase accuracy. VitiCanopy is an accurate, user-friendly and free alternative to current techniques used by scientists and viticultural practitioners to assess the dynamics of LAI, PAI and canopy architecture in vineyards, and has the potential to be adapted for use on other plants.

Comparative evaluation of oxidative enzyme activities during adventitious rooting in the cuttings of grapevine rootstocks.

Science.gov (United States)

Kose, Cafer; Erdal, Serkan; Kaya, Ozkan; Atici, Okkeş

2011-03-15

This study investigated changes in peroxidase (POX) and polyphenol oxidase (PPO) activities through adventitious rooting in hardwood cuttings of grapevine rootstocks. Three grapevine rootstocks with different propensity to produce adventitious roots were selected: recalcitrant (Ramsey), non-recalcitrant (Rupestris du Lot) and intermediate (99R) cultivars. The averages of root number at 65 days were 96 in Lot, 76 in 99R and 30 in Ramsey. Both enzyme activities characteristically increased before adventitious rooting, regardless of rooting ability of the rootstocks, and then decreased. POX activity increased in Ramsey cuttings at 22 days, in Lot and 99R cuttings at 14 days after planting, and then decreased gradually until 51 days. The highest POX activity was determined in Ramsey rootstock with the highest rooting ability and the lowest activity was determined in the rootstocks with the lowest rooting ability. PPO activity gradually increased in Ramsey rootstock cuttings from 10 days to 22 days, in Lot and 99R cuttings at 14 days, and then decreased until 51 days. A significant correlation was identified between high POX activity and adventitious rooting capability in rootstocks, but the same result was not determined with PPO activity. A recalcitrant rooting variety cannot increase POX activity sufficiently before rooting. Therefore applications that could increase POX activity in stem cuttings during rooting may facilitate increased rooting in such rootstocks. Copyright © 2011 Society of Chemical Industry.

Pathogenicity and molecular detection of Uruguayan isolates of Greeneria uvicola and Cadophora luteo-olivacea associated with grapevine trunk diseases

Directory of Open Access Journals (Sweden)

Fernando NAVARRETE

2011-12-01

Full Text Available Normal 0 21 MicrosoftInternetExplorer4 Species from different fungal genera have been indicated as responsible for the development of trunk diseases of grapevines. Greeneria uvicola is responsible for the bitter rot of Vitis vinifera grape bunchesnear harvest, and can also attack other Vitis species. In Uruguay, G. uvicola was isolated from dead arm affected grapevines and as an endophyte from healthy canes. Cadophora luteo-olivacea is a phialophora-likeascomycete with a wide distribution that was isolated from asymptomatic wood tissues in Vitis and Petridisease-affected nursery plants in Uruguay. Pathogenicity of isolates of both species was evaluated on Vitis vinifera cv. Tannat and Cabernet Sauvignon, and rootstocks SO4 and 3309C. Specific primers were developed for the ITS rDNA region for both species. Number of plants showing discoloration, length of discoloration, number of re-isolations and amplifications confirmed the pathogenicity of G. uvicola isolates. Pathogenicityof the isolate of C. luteo-olivacea obtained from symptomatic tissues is discussed. Specific primers can be usedto detect the presence of these fungi in asymptomatic tissues.

Determination of the activity signature of key carbohydrate metabolism enzymes in phenolic-rich grapevine tissues

DEFF Research Database (Denmark)

Covington, Elizabeth Dunn; Roitsch, Thomas Georg; Dermastia, Marina

2016-01-01

Physiological studies in plants often require enzyme extraction from tissues containing high concentrations of phenols and polyphenols. Unless removed or neutralized, such compounds may hinder extraction, inactivate enzymes, and interfere with enzyme detection. The following protocol for activity...... assays for enzymes of primary carbohydrate metabolism, while based on our recently published one for quantitative measurement of activities using coupled spectrophotometric assays in a 96-well format, is tailored to the complexities of phenolic- and anthocyanin-rich extracts from grapevine leaf...

The grapevine root-specific aquaporin VvPIP2;4N controls root hydraulic conductance and leaf gas exchange under well-watered conditions but not under water stress.

Science.gov (United States)

Perrone, Irene; Gambino, Giorgio; Chitarra, Walter; Vitali, Marco; Pagliarani, Chiara; Riccomagno, Nadia; Balestrini, Raffaella; Kaldenhoff, Ralf; Uehlein, Norbert; Gribaudo, Ivana; Schubert, Andrea; Lovisolo, Claudio

2012-10-01

We functionally characterized the grape (Vitis vinifera) VvPIP2;4N (for Plasma membrane Intrinsic Protein) aquaporin gene. Expression of VvPIP2;4N in Xenopus laevis oocytes increased their swelling rate 54-fold. Northern blot and quantitative reverse transcription-polymerase chain reaction analyses showed that VvPIP2;4N is the most expressed PIP2 gene in root. In situ hybridization confirmed root localization in the cortical parenchyma and close to the endodermis. We then constitutively overexpressed VvPIP2;4N in grape 'Brachetto', and in the resulting transgenic plants we analyzed (1) the expression of endogenous and transgenic VvPIP2;4N and of four other aquaporins, (2) whole-plant, root, and leaf ecophysiological parameters, and (3) leaf abscisic acid content. Expression of transgenic VvPIP2;4N inhibited neither the expression of the endogenous gene nor that of other PIP aquaporins in both root and leaf. Under well-watered conditions, transgenic plants showed higher stomatal conductance, gas exchange, and shoot growth. The expression level of VvPIP2;4N (endogenous + transgene) was inversely correlated to root hydraulic resistance. The leaf component of total plant hydraulic resistance was low and unaffected by overexpression of VvPIP2;4N. Upon water stress, the overexpression of VvPIP2;4N induced a surge in leaf abscisic acid content and a decrease in stomatal conductance and leaf gas exchange. Our results show that aquaporin-mediated modifications of root hydraulics play a substantial role in the regulation of water flow in well-watered grapevine plants, while they have a minor role upon drought, probably because other signals, such as abscisic acid, take over the control of water flow.

Taking Leave?

CERN Multimedia

2000-01-01

Planning a holiday? Then if you're a member of the personnel, you'll need to use the Laboratory's new leave system that will be put in place on 1 October. Leave allocations don't change - you are entitled to just as much holiday as before - but instead of being credited annually, your leave will be credited on a monthly basis, and this information will be communicated on your salary slip. The reason for the change is that with the various new leave schemes such as Recruitment by Saved Leave (RSL) and the Progressive Retirement Programme (PRP), a streamlined procedure was required for dealing with all kinds of leave. In the new system, each member of the personnel will have leave accounts to which leave will be credited monthly from the payroll and debited each time an absence is registered in the CERN Electronic Document Handling system (EDH). Leave balances will appear on monthly pay slips, and full details of leave transactions and balances will be available through EDH at all times. As the leave will be c...

Guided Imagery and Music (GIM) with adults on sick leave suffering from work-related stress – a mixed methods experimental study

DEFF Research Database (Denmark)

Beck, Bolette Daniels

2012-01-01

%). The treatment condition included six sessions of GIM plus standard care versus standard care alone. Significant effects of GIM compared to standard care were found after nine weeks in the psychological variables Mood, Sleep Quality, Anxiety, Well-being and Physical Symptoms with effect sizes ranging from 0...... was carried out. Significant effects in Perceived Stress, Mood, Depression and Anxiety were found with effect sizes from 0.80 to 1.11. Job return did not significantly improve in the early intervention group compared to late intervention, but the odds of being on sick leave at 6 months' follow- up were 4...... as a supportive space for self-regulative body processes, emotional expression, reconnection to self-esteem and competency, processes of existential life issues and contact with creativity. A result generated from the convergence of qualitative and quantitative results is that GIM decreased bodily stress symptoms...

Timing matters: length of leave and working mothers' daily reentry regrets.

Science.gov (United States)

Wiese, Bettina S; Ritter, Johannes O

2012-11-01

Dealing with developmental tasks in work and family domains is an important challenge for young and middle-aged adults. We investigated a transition that has evolved into a normative task for women, namely, the retransition back to paid work following maternity leave. In a diary study with 149 mothers who had just returned to work, we examined the daily experienced regrets concerning this return. In addition to personal resources (i.e., emotional stability, feeling prepared for the transition) and financial requirements needed to return to work, daily experienced family stress predicted decisional regrets. Moreover, our results suggest that leave length is related to psychological resilience in the face of day-to-day stress experiences: Late returners reported fewer regrets in general and were unaffected by daily family stress. Return-to-work regrets, in turn, were predictive of withdrawal intentions. This underlines the relevancy of the timing of the transition back to work in terms of successful development during this life phase.

Preventing intimate partner violence through paid parental leave policies.

Science.gov (United States)

D'Inverno, Ashley Schappell; Reidy, Dennis E; Kearns, Megan C

2018-05-30

Paid parental leave policies have the potential to strengthen economic supports, reduce family discord, and provide opportunities to empower women (Basile et al., 2016; Niolon et al., 2017). In this article, we present a theory of change and evidence to suggest how paid parental leave may impact intimate partner violence (IPV). In doing so, we present three mechanisms of change (i.e., reduction in financial stress, increase in egalitarian parenting practices, and promotion of child/parent bonding) through which paid parental leave could reduce rates of IPV. We also describe limitations of the current state of knowledge in this area, as well as opportunities for future research. Ultimately, our goal is to facilitate the identification and implementation of approaches that have the potential to reduce violence at the population level. Paid parental leave embodies the potential of policies to change societal-level factors and serve as an important prevention strategy for IPV. Copyright © 2018. Published by Elsevier Inc.

Solar radiation affects grapevine susceptibility to Plasmopara Viticola Radiação solar e susceptibilidade da videira à Plasmopara Viticola

Directory of Open Access Journals (Sweden)

Anna Dalla Marta

2008-12-01

Full Text Available Solar radiation plays an important role in the development of some fungal diseases due to its direct action on the microorganisms and also its indirect effect on the production of specific plant compounds. This experiment examined the effect of two light environments (100% and 35% of full strength on the polyphenolic content of grapevine leaves and quantified their relation to resistance to downy mildew (Plasmopara viticola. Leaf epidermal polyphenolic contents were non-destructively measured during the growing season 2006 using the Dualex chlorophyll fluorescence-based portable leaf-clip. The experimental design consisted of six parcels of 30 vines and measurements were performed on the 12 central vines. The leaves were inoculated with a sporangia suspension containing 50,000 sporangia of P. viticola per mL and the disease severity was assessed after the appearance of symptoms. Leaves maintained at 100% sun had high polyphenolic content and significantly lower disease severity compared to leaves under shading nets. These results indicate an inverse relationship between produced polyphenolics and downy mildew severity.A radiação solar exerce papel importante no desenvolvimento de algumas doenças fúngicas, devido à sua ação direta sobre os microorganismos e também devido ao seu efeito indireto sobre a produção de compostos específicos nas plantas. Este experimento examinou o efeito de dois ambientes de luz (100% e 35% da intensidade máxima sobre o conteúdo de polifenóis nas folhas da videira e quantificou sua relação com a resistência ao míldio (Plasmopara viticola. As concentrações de polifenóis na epiderme das folhas foram quantificadas de forma não destrutiva, durante a estação de crescimento de 2006, usando o equipamento portátil Dualex, baseado na fluorescência da clorofila. O delineamento experimental consistiu de seis parcelas de 30 videiras e as medidas foram feitas nas 12 plantas centrais. As folhas foram

Oxidative stress-triggered interactions between the succinyl- and acetyl-proteomes of rice leaves.

Science.gov (United States)

Zhou, Heng; Finkemeier, Iris; Guan, Wenxue; Tossounian, Maria-Armineh; Wei, Bo; Young, David; Huang, Jingjing; Messens, Joris; Yang, Xibin; Zhu, Jun; Wilson, Michael H; Shen, Wenbiao; Xie, Yanjie; Foyer, Christine H

2018-05-01

Protein lysine acylations, such as succinylation and acetylation, are important post-translational modification (PTM) mechanisms, with key roles in cellular regulation. Antibody-based affinity enrichment, high-resolution liquid chromatography mass spectrometry analysis, and integrated bioinformatics analysis were used to characterize the lysine succinylome (K suc ) and acetylome (K ace ) of rice leaves. In total, 2,593 succinylated and 1,024 acetylated proteins were identified, of which 723 were simultaneously acetylated and succinylated. Proteins involved in photosynthetic carbon metabolism such as the large and small subunits of RuBisCO, ribosomal functions, and other key processes were subject to both PTMs. Preliminary insights into oxidant-induced changes to the rice acetylome and succinylome were gained from treatments with hydrogen peroxide. Exposure to oxidative stress did not regulate global changes in the rice acetylome or succinylome but rather led to modifications on a specific subset of the identified sites. De-succinylation of recombinant catalase (CATA) and glutathione S-transferase (OsGSTU6) altered the activities of these enzymes showing that this PTM may have a regulatory function. These findings not only greatly extend the list of acetylated and/or succinylated proteins but they also demonstrate the close cooperation between these PTMs in leaf proteins with key metabolic functions. © 2017 John Wiley & Sons Ltd.

Influence of climate cycles on grapevine domestication and ancient migrations in Eurasia.

Science.gov (United States)

Mariani, Luigi; Cola, Gabriele; Maghradze, David; Failla, Osvaldo; Zavatti, Franco

2018-09-01

The objective of this work is to investigate the Holocenic climate cycles that may have influenced the domestication of grapevine in the Subcaucasian area and its subsequent spread in Eurasia. The analysis covered the longitudinal belt ranging from the Iberian Peninsula to Japan, seen as the preferential pathway for the Holocenic spread of grapevine and many other crops in Eurasia. Spectral analysis was considered as the criterion of investigation and the Holocenic cycles were analyzed considering different geochemical and biological proxies, of which seven are directly referred to vine. In this context the relation of the abovementioned proxies with spectral peaks of possible causal factors like Solar activity (SA), North Atlantic oceanic factors (Atlantic Multidecadal Oscillation - AMO and North Atlantic Oscillation - NAO), and subtropical oceanic factors (El Nino Southern Oscillation - ENSO) was also analyzed. In order to acquire a sufficiently wide number of proxies sensitive to the causal factors, we referred to a latitudinal belt wider than the one colonized by vine, also acquiring proxy from the Scandinavian area, notoriously susceptible to North Atlantic forcings. The analysis of the proxy spectral peaks, considering 20 classes with a 50-years step in the 0-1000 years range, showed that the 50% of the classes have a higher frequency of peaks at East than West, the 20% a higher frequency at West than East and the 10% an equal frequency, showing the efficiency of the propagation of Western signals towards the center of Eurasia. The search of the causal factors spectral peaks in the proxy series showed that AMO, NAO and SA acted with a certain regularity on the entire belt investigated both latitudinally and longitudinally, while spectral peaks linked to ENSO underwent a considerable attenuation moving northward. Finally, the specific analysis on viticultural proxies showed common peaks with causal factors. Copyright © 2018 Elsevier B.V. All rights reserved.

Characterization and Identification of the Basidiomycetous Fungus Associated with 'hoya de malvón' Grapevine Disease in Argentina

Directory of Open Access Journals (Sweden)

S. Lupo

2006-04-01

Full Text Available Inocutis jamaicensis (Murrill Gottlieb, J.E. Wright & Moncalvo was identified as the basidiomycetous species associated with ‘hoja de malvón’ grapevine disease in Argentina. Macro and micro-morphological characteristics of fruit bodies corresponded to those described for the white-rotting fungus associated with native plant species and Eucalyptus globulus Labill. planted in Uruguay. Monokariotic isolates were obtained from basidiospores produced by fruit bodies of I. jamaicensis collected from Vitis vinifera L. and E. globulus. Dikaryons and fruit bodies produced by pairing monokaryotic mycelium suggest that all these isolates belong to the same species. The analysis of RFLP of the dikaryon produced by pairing monokaryons derived from V. vinifera and E. globulus revealed fragments that corresponded to each monokaryon, confirming that isolates from Vitis mated with those from Eucalyptus. In order to compare grapevine and Uruguayan isolates, RFLPs from ITS region generated by restriction digestion with Alu I, Hae III, Hha I, Msp I and Taq I were performed. Differences found in some restriction pattern could reflect a certain degree of variability between dikariotic isolates, probably related with a particular lifestyle, host specificity or geographic origin.

Influence on wine biogenic amine composition of modifications to soil N availability and grapevine N by cover crops.

Science.gov (United States)

Pérez-Álvarez, Eva P; Garde-Cerdán, Teresa; Cabrita, Maria João; García-Escudero, Enrique; Peregrina, Fernando

2017-11-01

Vineyard soil management can modify the nitrogen soil availability and, therefore, grape amino acid content. These compounds are precursors of biogenic amines, which have negative effects on wine quality and human health. The objective was to study whether the effect of conventional tillage and two cover crops (barley and clover) on grapevine nitrogen status could be related to wine biogenic amines. Over 4 years, soil NO 3 - -N, nitrogen content in leaf and wine biogenic amine concentration were determined. Barley reduced soil NO 3 - -N availability and clover increased it. In 2011, at bloom, nitrogen content decreased with barley treatment in both blade and petiole. In 2012, nitrogen content in both leaf tissues at bloom was greater with clover than with tillage and barley treatments. Also, total biogenic amines decreased in barley with respect to tillage and clover treatments. There were correlations between some individual and total biogenic amine concentrations with respect to nitrogen content in leaf tissues. Wine biogenic amine concentration can be affected by the grapevine nitrogen status, provoked by changes in the soil NO 3 - -N availability with both cover crop treatments. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

5 CFR 630.1204 - Intermittent leave or reduced leave schedule.

Science.gov (United States)

2010-01-01

... insurance, health benefits, retirement coverage, and leave accrual). (e) The agency shall determine the... REGULATIONS ABSENCE AND LEAVE Family and Medical Leave § 630.1204 Intermittent leave or reduced leave schedule... reduced leave schedule unless the employee and the agency agree to do so. (b) Leave under § 630.1203(a) (3...

Efficacy of a copper-based bactericide in controlling bacterial blight of grapevines caused by Xylophilus ampelinus

OpenAIRE

Komatsu, Tsutomu; Kondo, Norio

2015-01-01

We investigated the efficacy of a microbial copper agent to protect against bacterial blight of grapevine caused by Xylophilus ampelinus from 2012 to 2014 in Hokkaido, Japan. A solution of the basic copper wettable powder sulfate was sprayed at 10-day intervals in two processing plots, using two application protocols: seven rounds of application immediately after leaf development and three or four applications at the initial onset of the disease. Due to the low disease incidence for the durat...

A stilbene synthase allele from a Chinese wild grapevine confers resistance to powdery mildew by recruiting salicylic acid signalling for efficient defence.

Science.gov (United States)

Jiao, Yuntong; Xu, Weirong; Duan, Dong; Wang, Yuejin; Nick, Peter

2016-10-01

Stilbenes are central phytoalexins in Vitis, and induction of the key enzyme stilbene synthase (STS) is pivotal for disease resistance. Here, we address the potential for breeding resistance using an STS allele isolated from Chinese wild grapevine Vitis pseudoreticulata (VpSTS) by comparison with its homologue from Vitis vinifera cv. 'Carigane' (VvSTS). Although the coding regions of both alleles are very similar (>99% identity on the amino acid level), the promoter regions are significantly different. By expression in Arabidopsis as a heterologous system, we show that the allele from the wild Chinese grapevine can confer accumulation of stilbenes and resistance against the powdery mildew Golovinomyces cichoracearum, whereas the allele from the vinifera cultivar cannot. To dissect the upstream signalling driving the activation of this promoter, we used a dual-luciferase reporter system in a grapevine cell culture. We show elevated responsiveness of the promoter from the wild grape to salicylic acid (SA) and to the pathogen-associated molecular pattern (PAMP) flg22, equal induction of both alleles by jasmonic acid (JA), and a lack of response to the cell death-inducing elicitor Harpin. This elevated SA response of the VpSTS promoter depends on calcium influx, oxidative burst by RboH, mitogen-activated protein kinase (MAPK) signalling, and JA synthesis. We integrate the data in the context of a model where the resistance of V. pseudoreticulata is linked to a more efficient recruitment of SA signalling for phytoalexin synthesis. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Effectiveness of inorganic and organic mulching for soil salinity and sodicity control in a grapevine orchard drip-irrigated with moderately saline waters

Directory of Open Access Journals (Sweden)

Ramón Aragüés

2014-05-01

Full Text Available Soil mulching is a sensible strategy to reduce evaporation, accelerate crop development, reduce erosion and assist in weed control, but its efficiency for soil salinity control is not as well documented. The benefits of inorganic (plastic and organic (grapevine pruning residues mulching for soil salinity and sodicity control were quantified in a grapevine orchard (cultivars ‘Autumn’ Royal and ‘Crimson’ drip-irrigated with moderately saline waters. Soil samples were taken at the beginning and end of the 2008 and 2009 irrigation seasons in six vines of each cultivar and mulching treatment. Soil saturation extract electrical conductivity (ECe, chloride (Cle and sodium adsorption ratio (SARe values increased in all treatments of both grapevines along the irrigation seasons, but the increases were much lower in the mulched than in the bare soils due to reduced evaporation losses and concomitant decreases in salt evapo-concentration. The absolute salinity and sodicity daily increases in ‘Autumn’ and ‘Crimson’ 2008 and in ‘Crimson’ 2009 were on the average 44% lower in the plastic and 76% lower in the organic mulched soils than in the bare soil. The greater efficiency of the organic than the plastic mulch in ‘Crimson’ 2009 was attributed to the leaching of salts by a precipitation of 104 mm that infiltrated the organic mulch but was intercepted by the plastic mulch. Although further work is needed to substantiate these results, the conclusion is that the plastic mulch and, particularly, the organic mulch were more efficient than the bare soil for soil salinity and sodicity control.

Direct observation of local xylem embolisms induced by soil drying in intact Zea mays leaves.

Science.gov (United States)

Ryu, Jeongeun; Hwang, Bae Geun; Kim, Yangmin X; Lee, Sang Joon

2016-04-01

The vulnerability of vascular plants to xylem embolism is closely related to their stable long-distance water transport, growth, and survival. Direct measurements of xylem embolism are required to understand what causes embolism and what strategies plants employ against it. In this study, synchrotron X-ray microscopy was used to non-destructively investigate both the anatomical structures of xylem vessels and embolism occurrence in the leaves of intact Zea mays (maize) plants. Xylem embolism was induced by water stress at various soil drying periods and soil water contents. X-ray images of dehydrated maize leaves showed that the ratio of gas-filled vessels to all xylem vessels increased with decreased soil water content and reached approximately 30% under severe water stress. Embolism occurred in some but not all vessels. Embolism in maize leaves was not strongly correlated with xylem diameter but was more likely to occur in the peripheral veins. The rate of embolism formation in metaxylem vessels was higher than in protoxylem vessels. This work has demonstrated that xylem embolism remains low in maize leaves under water stress and that there xylem has characteristic spatial traits of vulnerability to embolism. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

A preliminary survey on the presence of Xylella fastidiosa in olive, citrus and grapevine groves in Morocco

Directory of Open Access Journals (Sweden)

Ahmed AARABE

2018-03-01

Full Text Available The bacterium Xylella fastidiosa is gram negative, xylem-inhabiting, devastating pathogen which causes various diseases on more than 300 plant hosts. Given the recent confirmed findings of X. fastidiosa in the European Union, this bacterium is becoming a serious threat to the Moroccan agricultural sector. A survey was conducted during May-September 2015 on the presence of X. fastidiosa in several commercial groves, covering olive, citrus and grapevine growing areas. In a few trees, severe symptoms which could be associated to the bacterium were observed. A total of 900 samples of different crops from different regions were randomly collected: 220 olive trees (cv. Picholine Marocaine from two regions, 410 citrus trees belonging to 7 different cultivars collected in 4 regions and 270 grapevine plants belonging to 6 different cultivars from 3 regions; all these samples were tested for the presence of X. fastidiosa by using an ELISA commercial kit. The obtained results did not show any positive sample. These preliminary results are taken as an encouraging indication, considering that X. fastidiosa was not found in Morocco, at least in the surveyed crops. However, frequent extensive surveys in different regions are needed to prevent its entrance into the country.

Bacteria in a woody fungal disease: characterization of bacterial communities in wood tissues of esca-foliar symptomatic and asymptomatic grapevines

Directory of Open Access Journals (Sweden)

Emilie eBruez

2015-10-01

Full Text Available Esca is a grapevine trunk disease (GTD associated with different pathogenic fungi inhabiting the woody tissues. Bacteria can also be found in such tissues and they may interact with these fungal colonizers. Although such types of microbial interaction have been observed for wood diseases in many trees, this has never been studied for grapevine. In this study, the bacterial microflora of different vine status (esca-symptomatic and asymptomatic, different anatomical part (trunk and cordon and different type of tissues (necrotic or not have been studied. Based on Single Strand Conformation Polymorphism (SSCP analyses, data showed that (i specific complexes of bacterial microflora colonize the wood of both necrotic and non-necrotic tissues of esca-foliar symptomatic and asymptomatic vines, and also that (ii depending on the anatomical part of the plant, cordon or trunk, differences could be observed between the bacterial communities. Such differences were also revealed through the Community-Level Physiological Profiling (CLPP with Biolog Ecoplates™. Two hundred seventeen bacterial strains were also isolated from plants samples and then assigned to bacterial species based on the 16S rRNA genes. Although Bacillus spp. and Pantoea agglomerans were the two most commonly isolated species from all kinds of tissues, various other taxa were also isolated. Inoculation of vine cuttings with 14 different bacterial species, and one GTD fungus, Neofusicoccum parvum, showed no impact of these bacteria on the size of the wood necroses caused by N. parvum. This study showed, therefore, that bacterial communities differ according to the anatomical part (trunk or cordon and/or the type of tissue (necrotic or non necrotic of wood of grapevine plants showing external symptoms of esca disease. However, research into bacteria having a role in GTD development needs further studies.

Treatment of grapevines with prohexadione calcium as a growth regulator. The influence on production, winemaking and sensory characteristics of wines

Directory of Open Access Journals (Sweden)

Luis Vaquero-Fernández

2009-09-01

Significance and impact of study: ProCa as a growth regulator may be an option for a quality vitiviniculture. No previous studies have been published on applications of ProCa in grapevines in either Europe or in cv. Tempranillo. Additionally, studies with other varieties have not demonstrated sensory improvements in wines obtained from treated vines.

Urea-induced oxidative damage in Elodea densa leaves.

Science.gov (United States)

Maleva, Maria; Borisova, Galina; Chukina, Nadezda; Prasad, M N V

2015-09-01

Urea being a fertilizer is expected to be less toxic to plants. However, it was found that urea at 100 mg L(-1) caused the oxidative stress in Elodea leaves due to the formation of reactive oxygen species (ROS) and lipid peroxidation that are known to stimulate antioxidant pathway. Urea at a concentration of 500 and 1000 mg L(-1) decreased low-molecular-weight antioxidants. In this case, the antioxidant status of plants was supported by the activity of antioxidant enzymes such as superoxide dismutase and guaiacol peroxidase. A significant increase in the soluble proteins and -SH groups was observed with high concentrations of urea (30-60 % of control). Thus, the increased activity of antioxidant enzymes, low-molecular-weight antioxidants, and induced soluble protein thiols are implicated in plant resistance to oxidative stress imposed by urea. We found that guaiacol peroxidase plays an important role in the removal of the peroxide in Elodea leaves exposed to 1000 mg L(-1)of urea.

Reduced nighttime transpiration is a relevant breeding target for high water-use efficiency in grapevine.

Science.gov (United States)

Coupel-Ledru, Aude; Lebon, Eric; Christophe, Angélique; Gallo, Agustina; Gago, Pilar; Pantin, Florent; Doligez, Agnès; Simonneau, Thierry

2016-08-09

Increasing water scarcity challenges crop sustainability in many regions. As a consequence, the enhancement of transpiration efficiency (TE)-that is, the biomass produced per unit of water transpired-has become crucial in breeding programs. This could be achieved by reducing plant transpiration through a better closure of the stomatal pores at the leaf surface. However, this strategy generally also lowers growth, as stomatal opening is necessary for the capture of atmospheric CO2 that feeds daytime photosynthesis. Here, we considered the reduction in transpiration rate at night (En) as a possible strategy to limit water use without altering growth. For this purpose, we carried out a genetic analysis for En and TE in grapevine, a major crop in drought-prone areas. Using recently developed phenotyping facilities, potted plants of a cross between Syrah and Grenache cultivars were screened for 2 y under well-watered and moderate soil water deficit scenarios. High genetic variability was found for En under both scenarios and was primarily associated with residual diffusion through the stomata. Five quantitative trait loci (QTLs) were detected that underlay genetic variability in En Interestingly, four of them colocalized with QTLs for TE. Moreover, genotypes with favorable alleles on these common QTLs exhibited reduced En without altered growth. These results demonstrate the interest of breeding grapevine for lower water loss at night and pave the way to breeding other crops with this underexploited trait for higher TE.

Differences in Flower Transcriptome between Grapevine Clones Are Related to Their Cluster Compactness, Fruitfulness, and Berry Size

OpenAIRE

Grimplet, Jérôme; Tello, Javier; Laguna Ullán, Natalia; Ibáñez Marcos, Javier

2017-01-01

Grapevine cluster compactness has a clear impact on fruit quality and health status, as clusters with greater compactness are more susceptible to pests and diseases and ripen more asynchronously. Different parameters related to inflorescence and cluster architecture (length, width, branching, etc.), fruitfulness (number of berries, number of seeds) and berry size (length, width) contribute to the final level of compactness. From a collection of 501 clones of cultivar Garnacha Tinta, two compa...

Stress Prevention@Work : A study protocol for the evaluation of a multifaceted integral stress prevention strategy to prevent employee stress in a healthcare organization: a cluster controlled trial

NARCIS (Netherlands)

Hoek, R.J.A.; Havermans, B.M.; Houtman, I.L.D.; Brouwers, E.P.M.; Heerkens, Y.F.; Zijlstra-vlasveld, M.C.; Anema, J.R.; van der Beek, A.J.; Boot, C.R.L.

2018-01-01

Adequate implementation of work-related stress management interventions can reduce or prevent work-related stress and sick leave in organizations. We developed a multifaceted integral stress-prevention strategy for organizations from several sectors that includes a digital platform and collaborative

Stress Prevention@Work: a study protocol for the evaluation of a multifaceted integral stress prevention strategy to prevent employee stress in a healthcare organization: a cluster controlled trial

NARCIS (Netherlands)

Hoek, R.J.A.; Havermans, B.M.; Houtman, I.L.D.; Brouwers, E.P.M.; Heerkens, Y.F.; Zijlstra-Vlasveld, M.C.; Anema, J.R.; Beek, A.J. van der; Boot, C.R.L.

2017-01-01

Background. Adequate implementation of work-related stress management interventions can reduce or prevent work-related stress and sick leave in organizations. We developed a multifaceted integral stress-prevention strategy for organizations from several sectors that includes a digital platform and

Effects of ethanol extract of Bersama engleriana leaves on oxidative ...

African Journals Online (AJOL)

Pesticides are used to improve agricultural yields; meanwhile they have detrimental effects on human and animal reproduction. This study aimed at evaluating the protective effects of ethanol extract of Bersama engleriana leaves against cypermethrin-induced oxidative stress and reproductive toxicity. Fifty male guinea.

Metabolic responses of alfalfa (Medicago Sativa L.) leaves to low ...

African Journals Online (AJOL)

user

2011-02-14

Feb 14, 2011 ... and relative water content (RWC) in leaves under low and high temperature ... age of its supply as pasture, thus affecting development ..... te leak ag e (%. ) ) A. B. Figure 3. Effects of LT and HT stresses on MDA content and ...

Efeito do porta-enxerto no teor de nutrientes em tecidos da videira "cabernet sauvignon" Effect of rootstock on nutrient content of 'cabernet sauvignon' grapevine tissues

Directory of Open Access Journals (Sweden)

Alberto Miele

2009-12-01

Full Text Available A nutrição mineral da videira constitui-se em importante fator para a qualidade dos vinhos. Devido a isso, avaliou-se o efeito de porta-enxertos no teor de nutrientes em diferentes tecidos da videira 'Cabernet Sauvignon' (Vitis vinifera L. na Serra Gaúcha. o experimento foi conduzido durante o ciclo vegetativo de 2004/2005, com os porta-enxertos Rupestris du lot, 101-14, 3309, 420A, Kober 5BB, 161-49, So4 e Paulsen 1103, enxertados em 1993 com a cv. 'Cabernet Sauvignon'. o delineamento experimental foi em blocos ao acaso, com oito tratamentos e três repetições, sendo quatro plantas/parcela. Coletaram-se folhas - separando-se os pecíolos dos limbos -, cachos - separando-se as bagas das ráquis - e ramos, os quais foram posteriormente secados em estufa e pesados. Analisaram-se os nutrientes n, P, K, Ca e Mg. os resultados mostram que houve efeito significativo do porta-enxerto nos teores de N, P, K, Ca e Mg no limbo, pecíolo, ráquis e baga da videira 'Cabernet Sauvignon' e que este efeito variou em função do nutriente e do tecido considerado. Entretanto, não houve efeito significativo do porta-enxerto no teor desses nutrientes no ramo da videira. Além disso, a ordem de grandeza do teor dos nutrientes variou em função do tecido avaliado. Assim, os teores de n e de Ca foram maiores no limbo; os de P e K, na ráquis; e o de Mg, no pecíolo.Grapevine mineral nutrition is an important factor influencing wine quality. For this, the effect of rootstocks on the nutrient content in different tissues of 'Cabernet Sauvignon' grapevines (Vitis vinifera L. grown in the Serra Gaúcha region was evaluated. The experiment was carried out during the 2004/2005 vegetative cycle with the rootstocks Rupestris du Lot, 101-14, 3309, 420A, Kober 5BB, 161-49, SO4, and Paulsen 1103. The experimental design was in randomized blocks, with eight treatments, three replicates, four plants/plot. leaves - petioles were separated from the limbs -, clusters - berries

Global warming enhances sulphide stress in a key seagrass species (NW Mediterranean).

Science.gov (United States)

García, Rosa; Holmer, Marianne; Duarte, Carlos M; Marbà, Núria

2013-12-01

The build-up of sulphide concentrations in sediments, resulting from high inputs of organic matter and the mineralization through sulphate reduction, can be lethal to the benthos. Sulphate reduction is temperature dependent, thus global warming may contribute to even higher sulphide concentrations and benthos mortality. The seagrass Posidonia oceanica is very sensitive to sulphide stress. Hence, if concentrations build up with global warming, this key Mediterranean species could be seriously endangered. An 8-year monitoring of daily seawater temperature, the sulphur isotopic signatures of water (δ(34)S(water)), sediment (δ(34)SCRS ) and P. oceanica leaf tissue (δ(34)S(leaves)), along with total sulphur in leaves (TS(leaves)) and annual net population growth along the coast of the Balearic archipelago (Western Mediterranean) allowed us to determine if warming triggers P. oceanica sulphide stress and constrains seagrass survival. From the isotopic S signatures, we estimated sulphide intrusion into the leaves (F(sulphide)) and sulphur incorporation into the leaves from sedimentary sulphides (SS(leaves)). We observed lower δ(34)S(leaves), higher F(sulphide) and SS(leaves) coinciding with a 6-year period when two heat waves were recorded. Warming triggered sulphide stress as evidenced by the negative temperature dependence of δ(34)S(leaves) and the positive one of F(sulphide), TS(leaves) and SS(leaves). Lower P. oceanica net population growth rates were directly related to higher contents of TS(leaves). At equivalent annual maximum sea surface water temperature (SST(max)), deep meadows were less affected by sulphide intrusion than shallow ones. Thus, water depth acts as a protecting mechanism against sulphide intrusion. However, water depth would be insufficient to buffer seagrass sulphide stress triggered by Mediterranean seawater summer temperatures projected for the end of the 21st century even under scenarios of moderate greenhouse gas emissions, A1B

REMINDER Saved Leave Scheme (SLS) : Simplified procedure for the transfer of leave to saved leave accounts

CERN Multimedia

HR Division

2001-01-01

As part of the process of streamlining procedures, the HR and AS Divisions have jointly developed a system whereby annual and compensatory leave will henceforth be automatically transferred1) to saved leave accounts. Under the provisions of the voluntary saved leave scheme (SLS), a maximum total of 10 days'2)Previously, every person taking part in the scheme has been individually issued with a form for the purposes of requesting the transfer of leave to the leave account and the transfer has then had to be done manually by HR Division. To streamline the procedure, unused leave of all those taking part in the saved leave scheme at the closure of the leave-year accounts will henceforth be transferred automatically to the saved leave account on that date. This simplification is in the interest of all parties concerned. This automatic transfer procedure has a number of advantages for participants in the SLS scheme. First, staff members will no longer have to take any administrative steps. Secondly, the new proced...

Parental leave: the impact of recent legislation on parents' leave taking.