WorldWideScience

Sample records for stressed grapevine leaves

  1. Salicylic acid alleviates decreases in photosynthesis under heat stress and accelerates recovery in grapevine leaves

    Directory of Open Access Journals (Sweden)

    Cheng Jian-Shan

    2010-02-01

    Full Text Available Abstract Background Although the effect of salicylic acid (SA on photosynthesis of plants including grapevines has been investigated, very little is yet known about the effects of SA on carbon assimilation and several components of PSII electron transport (donor side, reaction center and acceptor side. In this study, the impact of SA pretreatment on photosynthesis was evaluated in the leaves of young grapevines before heat stress (25°C, during heat stress (43°C for 5 h, and through the following recovery period (25°C. Photosynthetic measures included gas exchange parameters, PSII electron transport, energy dissipation, and Rubisco activation state. The levels of heat shock proteins (HSPs in the chloroplast were also investigated. Results SA did not significantly (P Pn of leaves before heat stress. But, SA did alleviate declines in Pn and Rubisco activition state, and did not alter negative changes in PSII parameters (donor side, acceptor side and reaction center QA under heat stress. Following heat treatment, the recovery of Pn in SA-treated leaves was accelerated compared with the control (H2O-treated leaves, and, donor and acceptor parameters of PSII in SA-treated leaves recovered to normal levels more rapidly than in the controls. Rubisco, however, was not significantly (P Conclusion SA pretreatment alleviated the heat stress induced decrease in Pn mainly through maintaining higher Rubisco activition state, and it accelerated the recovery of Pn mainly through effects on PSII function. These effects of SA may be related in part to enhanced levels of HSP21.

  2. Impact of Ozone Gradient on Grapevine Leaves

    Science.gov (United States)

    Alebic-Juretic, Ana; Bokan-Vucelic, Itana; Mifka, Boris; Zatezalo, Marija; Zubak, Velimir

    2017-04-01

    Due to complex orography and air mass circulation, the Rijeka Bay area is characterized by O3 gradient, with concentrations risen with the altitude (1). Therefore AOT40 values were often exceeded and should result in harmful effects on vegetation. Based on previous controlled experiments (2), we examined the possible effect of atmospheric ozone on grape leaves under natural O3 gradient. Grapevine leaves (2-5) were collected from May to September 2016 at two sampling points in the proximity of two AQM stations: Site 1 in the city centre (20m asl) and Site 2 (186m asl) in the suburban settlement. Subsequent to weighing and determination of surface area, the leaves (0,5 g) were extracted in 95% ethanol and analysed on chlorophyl a (Chla), chlorophyl b (Chlb) and carotene (Car) content by UV-VIS spectrometry on 3 wavelengths (664, 649, 470 nm) (3) In summer 2016 O3 gradient was not that pronounced as usual (1), but stil the concentrations differed by approx. 20%, exceeding national AOT40 value at both sites (22.360 and 28.061 μg m-3 h, respectively, at Sites 1 and 2). The concentrations of other pollutants were bellow limit values (LV). The Cha and Chb in a sample leaves collected at the end of May at Site 2 are equal to that with filtered O3 in control experiment (2), i.e. without damage caused by ozone, while the Car content is lower approx. 50% and is kept at the same level. The con-centrations of pigments obtained in July prooved the possible damage by O3, while in subsequent months could speed up natural ageing. This is the first evidence of O3 damage on plants in the Rijeka Bay area, in spite of weaker O3 gradient and lacking visible signs of damage. Preliminary results indicate the need for more frequent sampling, particularly in the period included in AOT40 (May-July). References: 1. Alebić-Juretić A (2012) Int J Remote Sensing, 33(2): 335-345 2. Britvec M, Reichenauer T, Soja G., Ljubešić N, Pećina M (2001) Biologia (Bratislava),56/4: 417-424 3. Sumanata

  3. Levels of polonium-210 in the grapevine leaves in Alasehir district in Turkey

    International Nuclear Information System (INIS)

    Gurboga, G.; Aytas Oelmez, S.

    2001-01-01

    The objective of present work is the estimation of Po-210 (polonium) content in the edible grapevine leaves (Vitis viniferae, L.cv Sultana syn.) collected from Gediz plain in Western Turkey. Alasehir District in Gediz plain is one of the most important wine culture region of Turkey. Grapevine leaves are important food material for Dolma in Turkish cuisine. Dolma is a name applied to such vegetables as grapevine leaves, cabbage leaves and green peppers stuffed ground meat or spiked rice. Levels of Po-210 in the grapevine leaves had not been analyzed before in Turkey. In this study, after wet ashing of grapevine leaves, Po-210 was spontaneously plated onto a copper disc from dilute hydrochloric acid medium and deposited activity was measured. The results for Po-210 in the grapevine leaves are compared with the other foodstuff values in the literature

  4. Iron deficiency stimulates anthocyanin accumulation in grapevine apical leaves.

    Science.gov (United States)

    Caramanico, Leila; Rustioni, Laura; De Lorenzis, Gabriella

    2017-10-01

    Iron chlorosis is a diffuse disorder affecting Mediterranean vineyards. Beside the commonly described symptom of chlorophyll decrease, an apex reddening was recently observed. Secondary metabolites, such as anthocyanins, are often synthetized to cope with stresses in plants. The present work aimed to evaluate grapevine responses to iron deficiency, in terms of anthocyanin metabolism (reflectance spectrum, total anthocyanin content, HPLC profile and gene expression) in apical leaves of Cabernet sauvignon and Sangiovese grown in hydroponic conditions. Iron supply interruption produced after one month an increasing of anthocyanin content associated to a more stable profile in both cultivars. In Cabernet sauvignon, the higher red pigment accumulation was associated to a lower intensity of chlorotic symptoms, while in Sangiovese, despite the activation of the metabolism, the lower anthocyanin accumulation was associated to a stronger decrease in chlorophyll concentration. Gene expression data showed a significant increase of anthocyanin biosynthesis. The effects on the expression of structural and transcription factor genes of phenylpropanoid pathway were cultivar dependent. F3H, F3'H, F3'5'H and LDOX genes, in Cabernet sauvignon, and AOMT1 and AOMT genes, in Sangiovese, were positively affected by the treatment in response to iron deficiency. All data support the hypothesis of an anthocyanin biosynthesis stimulation rather than a decreased degradation of them due to iron chlorosis. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  5. Oxidative stress homeostasis in grapevine (Vitis vinifera L.

    Directory of Open Access Journals (Sweden)

    Luisa C Carvalho

    2015-03-01

    Full Text Available Plants can maintain growth and reproductive success by sensing changes in the environment and reacting through mechanisms at molecular, cellular, physiological and developmental levels. Each stress condition prompts a unique response although some overlap between the reactions to abiotic stress (drought, heat, cold, salt or high light and to biotic stress (pathogens does occur. A common feature in the response to all stresses is the onset of oxidative stress, through the production of reactive oxygen species (ROS. As hydrogen peroxide and superoxide are involved in stress signaling, a tight control in ROS homeostasis requires a delicate balance of systems involved in their generation and degradation. If the plant lacks the capacity to generate scavenging potential, this can ultimately lead to death. In grapevine, antioxidant homeostasis can be considered at whole plant levels and during the development cycle. The most striking example lies in berries and their derivatives, such as wine, with nutraceutical properties associated with their antioxidant capacity. Antioxidant homeostasis is tightly regulated in leaves, assuring a positive balance between photosynthesis and respiration, explaining the tolerance of many grapevine varieties to extreme environments.In this review we will focus on antioxidant metabolites, antioxidant enzymes, transcriptional regulation and cross-talk with hormones prompted by abiotic stress conditions. We will also discuss three situations that require specific homeostasis balance: biotic stress, the oxidative burst in berries at veraison and in vitro systems. The genetic plasticity of the antioxidant homeostasis response put in evidence by the different levels of tolerance to stress presented by grapevine varieties will be addressed. The gathered information is relevant to foster varietal adaptation to impending climate changes, to assist breeders in choosing the more adapted varieties and to suitable viticulture

  6. Current perspectives in proteomic analysis of abiotic stress in Grapevines

    Directory of Open Access Journals (Sweden)

    Iniga Seraphina George

    2014-12-01

    Full Text Available Grapes are an important crop plant which forms the basis of a globally important industry. Grape and wine production is particularly vulnerable to environmental and climatic fluctuations, which makes it essential for us to develop a greater understanding of the molecular level responses of grape plants to various abiotic stresses. The completion of the initial grape genome sequence in 2007 has led to a significant increase in research on grapes using proteomics approaches. In this article, we discuss some of the current research on abiotic stress in grapevines, in the context of abiotic stress research in other plant species. We also highlight some of the current limitations in grapevine proteomics and identify areas with promising scope for potential future research.

  7. Influence of water stress on Botryosphaeriaceae disease expression in grapevines

    Directory of Open Access Journals (Sweden)

    Jan VAN NIEKERK

    2011-12-01

    Full Text Available Several species in Botryosphaeriaceae have been associated with grapevine trunk diseases. To evaluate the effect of water stress on infection of grapevines by Botryosphaeriaceae spp., 1-year-old Shiraz/101-14 Mgt nursery grapevine plants were planted in plastic potting bags and placed outdoors under shade netting. Five weeks after planting, vines were pruned and the pruning wounds inoculated with spore suspensions of Neofusicoccum australe, Neofusicoccum parvum, Lasiodiplodia theobromae or Diplodia seriata. Control treatments consisted of applications of sterile water or a Trichoderma harzianum spore suspension. Stem inoculations were done by inserting a colonised or uncolonised agar plug into a wound made in each stem. Four different irrigation regimes were introduced 12 weeks after planting to simulate varying degrees of water stress. Measurements of stomatal conductance, photosynthetic rate and leaf spectrometry were made to monitor physiological stress. Eight months after inoculation, vines were uprooted and the root, shoot and plant mass of each vine determined. Lesions observed in the inoculated pruning wounds and stems were also measured. Vines subjected to the lowest irrigation regime were significantly smaller than optimally irrigated vines. Water stressed vines also had significantly lower photosynthetic rates and levels of stomatal conductance compared with vines receiving optimal irrigation, indicating that these plants experienced significantly higher levels of physiological stress. The mean lesion length was significantly longer in the pruning wounds and stems of plants subjected to the lowest irrigation regime, with lesion length declining linearly with increasing irrigation volume. These results clearly indicate that when a grapevine is exposed to water stress, colonisation and disease expression by Botryosphaeriaceae spp. are much more severe.

  8. Phakopsora euvitis Causes Unusual Damage to Leaves and Modifies Carbohydrate Metabolism in Grapevine

    Directory of Open Access Journals (Sweden)

    Antonio F. Nogueira Júnior

    2017-09-01

    Full Text Available Asian grapevine rust (Phakopsora euvitis is a serious disease, which causes severe leaf necrosis and early plant defoliation. These symptoms are unusual for a strict biotrophic pathogen. This work was performed to quantify the effects of P. euvitis on photosynthesis, carbohydrates, and biomass accumulation of grapevine. The reduction in photosynthetic efficiency of the green leaf tissue surrounding the lesions was quantified using the virtual lesion concept (β parameter. Gas exchange and responses of CO2 assimilation to increasing intercellular CO2 concentration were analyzed. Histopathological analyses and quantification of starch were also performed on diseased leaves. Biomass and carbohydrate accumulation were quantified in different organs of diseased and healthy plants. Rust reduced the photosynthetic rate, and β was estimated at 5.78, indicating a large virtual lesion. Mesophyll conductance, maximum rubisco carboxylation rate, and regeneration of ribulose-1,5-bisphosphate dependent on electron transport rate were reduced, causing diffusive and biochemical limitations to photosynthesis. Hypertrophy, chloroplast degeneration of mesophyll cells, and starch accumulation in cells close to lesions were observed. Root carbohydrate concentration was reduced, even at low rust severity. Asian grapevine rust dramatically reduced photosynthesis and altered the dynamics of production and accumulation of carbohydrates, unlike strict biotrophic pathogens. The reduction in carbohydrate reserves in roots would support polyetic damage on grapevine, caused by a polycyclic disease.

  9. Effects of Drought Stress and Rewatering on some Morphological and Physiological Properties of Three Grapevine Cultivars

    Directory of Open Access Journals (Sweden)

    Mehdi Aran

    2017-12-01

    Full Text Available Introduction: Most plants have developed morphological and physiological mechanisms which allow them to cope with drought stress. Almost all the studies conducted on grapevines (Vitisvinifera L. responses to drought conditions have focused on physiological responses such as stomatal reactions, photosynthesis and osmotic adjustment, and biochemical responses like carbohydrates and proline. According to these studies, physiological and biochemical responses of grapevines to water stress are quite variable. This variability could be related to cultivar, time of the year, previous water stress level, intensity of stress, and environmental conditions. Osmotic adjustment in terms of compatible solutes accumulation has been considered as an important physiological adaptation for plant to resist drought, which facilitates the extraction of water from dry soils and maintenance of cell turgor, gas exchange and growth in very dry environments. Acting as compatible solutes as well as antioxidants, a significant rise in proline amount was observed in grapevine leaves under water stress conditions, suggesting that this amino acid has a protective role against the formation of excessive reactive oxygen species (ROS. Plants, in order to overcome oxidative stress, have developed enzymatic and non-enzymatic antioxidant defense mechanisms against scavenge ROS. Materials and Methods: This research was conducted to assess the effect of different levels of irrigation on some characteristics of three cultivars of grapevine (Yaghooti, Bidanesefid and Askari, as a factorial based on a randomized complete block design in two years with four replications. The experiment started in June 21, 2014 and 2015. Water treatments were applied in four levels including: control plant (100% FC, moderate stress (60% FC, severe stress (30% FC and rewatering treatment after severe stress treatment. Increase height, leaf number, stem diameter, leaf fresh and dry weight, stem dry weight

  10. Photosynthetic responses to heat treatments at different temperatures and following recovery in grapevine (Vitis amurensis L.) leaves.

    Science.gov (United States)

    Luo, Hai-Bo; Ma, Ling; Xi, Hui-Feng; Duan, Wei; Li, Shao-Hua; Loescher, Wayne; Wang, Jun-Fang; Wang, Li-Jun

    2011-01-01

    The electron transport chain, Rubisco and stomatal conductance are important in photosynthesis. Little is known about their combined responses to heat treatment at different temperatures and following recovery in grapevines (Vitis spp.) which are often grown in climates with high temperatures. The electron transport function of photosystem II, the activation state of Rubisco and the influence of stomatal behavior were investigated in grapevine leaves during heat treatments and following recovery. High temperature treatments included 35, 40 and 45°C, with 25°C as the control and recovery temperature. Heat treatment at 35°C did not significantly (P>0.05) inhibit net photosynthetic rate (P(n)). However, with treatments at 40 and 45°C, P(n) was decreased, accompanied by an increase in substomatal CO(2) concentration (C(i)), decreases in stomatal conductance (g(s)) and the activation state of Rubisco, and inhibition of the donor side and the reaction center of PSII. The acceptor side of PSII was inhibited at 45°C but not at 40°C. When grape leaves recovered following heat treatment, P(n), g(s) and the activation state of Rubisco also increased, and the donor side and the reaction center of PSII recovered. The increase in P(n) during the recovery period following the second 45°C stress was slower than that following the 40°C stress, and these increases corresponded to the donor side of PSII and the activation state of Rubisco. Heat treatment at 35°C did not significantly (P>0.05) influence photosynthesis. The decrease of P(n) in grape leaves exposed to more severe heat stress (40 or 45°C) was mainly attributed to three factors: the activation state of Rubisco, the donor side and the reaction center of PSII. However, the increase of P(n) in grape leaves following heat stress was also associated with a stomatal response. The acceptor side of PSII in grape leaves was responsive but less sensitive to heat stress.

  11. Nitrogen fertilization of Cabernet Sauvignon grapevines: yield, total nitrogen content in the leaves and must composition

    Directory of Open Access Journals (Sweden)

    Felipe Lorensini

    2015-08-01

    Full Text Available Grapevines grown on sandy soils are subjected to the application of supplemental nitrogen (N; however, there is little information available regarding the impact of these applications on yield, plant nutritional state and must composition. The aim of this study was to evaluate the yield, nutritional state and must composition of grapevines subjected to N fertilization. Cabernet Sauvignon grapevines were subjected to annual applications of 0, 10, 15, 20, 40, 80 and 120 kg N ha-1 in 2008, 2009 and 2010. During the 2008/09, 2009/10 and 2010/11 harvest seasons, leaves were collected during full flowering and when the berries changed color, and the total N content was analyzed. The grape yield and the enological characteristics of the must were evaluated. The response to applied N was low, and the highest Cabernet Sauvignon grape yield was obtained in response to an application of 20 kg N ha-1 year-1. The application of N increased the nutrient content in the leaf collected at full flowering, but it had little effect on the total nutrient content in the must, and it did not affect the enological characteristics of the must, such as soluble solids, pH, total acidity, malic acid and tartaric acid.

  12. Endophytic bacterial community of grapevine leaves influenced by sampling date and phytoplasma infection process.

    Science.gov (United States)

    Bulgari, Daniela; Casati, Paola; Quaglino, Fabio; Bianco, Piero A

    2014-07-21

    Endophytic bacteria benefit host plant directly or indirectly, e.g. by biocontrol of the pathogens. Up to now, their interactions with the host and with other microorganisms are poorly understood. Consequently, a crucial step for improving the knowledge of those relationships is to determine if pathogens or plant growing season influence endophytic bacterial diversity and dynamic. Four healthy, four phytoplasma diseased and four recovered (symptomatic plants that spontaneously regain a healthy condition) grapevine plants were sampled monthly from June to October 2010 in a vineyard in north-western Italy. Metagenomic DNA was extracted from sterilized leaves and the endophytic bacterial community dynamic and diversity were analyzed by taxon specific real-time PCR, Length-Heterogeneity PCR and genus-specific PCR. These analyses revealed that both sampling date and phytoplasma infection influenced the endophytic bacterial composition. Interestingly, in June, when the plants are symptomless and the pathogen is undetectable (i) the endophytic bacterial community associated with diseased grapevines was different from those in the other sampling dates, when the phytoplasmas are detectable inside samples; (ii) the microbial community associated with recovered plants differs from that living inside healthy and diseased plants. Interestingly, LH-PCR database identified bacteria previously reported as biocontrol agents in the examined grapevines. Of these, Burkholderia, Methylobacterium and Pantoea dynamic was influenced by the phytoplasma infection process and seasonality. Results indicated that endophytic bacterial community composition in grapevine is correlated to both phytoplasma infection and sampling date. For the first time, data underlined that, in diseased plants, the pathogen infection process can decrease the impact of seasonality on community dynamic. Moreover, based on experimental evidences, it was reasonable to hypothesize that after recovery the restructured

  13. Genes expressed in grapevine leaves reveal latent wood infection by the fungal pathogen Neofusicoccum parvum.

    Directory of Open Access Journals (Sweden)

    Stefan Czemmel

    Full Text Available Some pathogenic species of the Botryosphaeriaceae have a latent phase, colonizing woody tissues while perennial hosts show no apparent symptoms until conditions for disease development become favorable. Detection of these pathogens is often limited to the later pathogenic phase. The latent phase is poorly characterized, despite the need for non-destructive detection tools and effective quarantine strategies, which would benefit from identification of host-based markers in leaves. Neofusicoccum parvum infects the wood of grapevines and other horticultural crops, killing the fruit-bearing shoots. We used light microscopy and high-resolution computed tomography (HRCT to examine the spatio-temporal relationship between pathogen colonization and anatomical changes in stem sections. To identify differentially-expressed grape genes, leaves from inoculated and non-inoculated plants were examined using RNA-Seq. The latent phase occurred between 0 and 1.5 months post-inoculation (MPI, during which time the pathogen did not spread significantly beyond the inoculation site nor were there differences in lesion lengths between inoculated and non-inoculated plants. The pathogenic phase occurred between 1.5 and 2 MPI, when recovery beyond the inoculation site increased and lesion lengths of inoculated plants tripled. By 2 MPI, inoculated plants also had decreased starch content in xylem fibers and rays, and increased levels of gel-occluded xylem vessels, the latter of which HRCT revealed at a higher frequency than microscopy. RNA-Seq and screening of 21 grape expression datasets identified 20 candidate genes that were transcriptionally-activated by infection during the latent phase, and confirmed that the four best candidates (galactinol synthase, abscisic acid-induced wheat plasma membrane polypeptide-19 ortholog, embryonic cell protein 63, BURP domain-containing protein were not affected by a range of common foliar and wood pathogens or abiotic stresses

  14. Evaluation of antioxidant activity of grapevine leaves extracts (Vitis labrusca in liver of Wistar rats

    Directory of Open Access Journals (Sweden)

    THAYS K. SCHAFFER

    2016-03-01

    Full Text Available The aim of this study was to evaluate the hepatoprotection of organic and conventional grapevine leaves extract (Vitis labrusca. The total polyphenol content and the isolate polyphenols by HPLC were evaluate. The animals received intraperitoneal injections of saline or extracts (conventional or organic - 30 mg/kg for 14 days. On day 15, the rats received carbon tetrachloride (CCl4 or mineral oil (i.p.. After 4h, the animals were euthanized. The analysis of the liver enzymes activity (AST, ALT, GGT was performed using serum, obtained by blood and the levels of lipid peroxidation (TBARS, protein oxidation (carbonyl, and the activity of antioxidant enzymes superoxide dismutase and catalase were analyzed in the liver. The results showed that the organic extract is richer in polyphenol and resveratrol than the conventional one. Both extracts prevent lipid peroxidation and protein oxidation generated by CCl4. Moreover, the extracts demonstrated ability to modulate the activity of SOD and CAT, as well as to establish a balance in the ratio of SOD/CAT. We also found that the CCl4 increased the levels of AST and GGT, and that both extracts prevent this. These results indicate that grapevine leaves extracts, both, organic and conventional, can prevent liver disorders.

  15. Water stress exacerbates the severity of Botryosphaeria dieback in grapevines infected by Neofusicoccum parvum

    Science.gov (United States)

    Botryosphaeria dieback (causal fungus Neofusicoccum parvum) is a detrimental grapevine trunk disease, causing internal wood degradation, killing shoots, and reducing yields. We examined the interactive effects of drought and N. parvum infection, common vineyard stresses, on wood-lesion development. ...

  16. Neofusicoccum parvum Colonization of the Grapevine Woody Stem Triggers Asynchronous Host Responses at the Site of Infection and in the Leaves

    Directory of Open Access Journals (Sweden)

    Mélanie Massonnet

    2017-06-01

    Full Text Available Grapevine trunk diseases cause important economic losses in vineyards worldwide. Neofusicoccum parvum, one of the most aggressive causal agents of the trunk disease Botryosphaeria dieback, colonizes cells and tissues of the grapevine wood, leading to the formation of an internal canker. Symptoms then extend to distal shoots, with wilting of leaves and bud mortality. Our aim was to characterize the transcriptional dynamics of grapevine genes in the woody stem and in the leaves during Neofusicoccum parvum colonization. Genome-wide transcriptional profiling at seven distinct time points (0, 3, and 24 hours; 2, 6, 8, and 12 weeks showed that both stems and leaves undergo extensive transcriptomic reprogramming in response to infection of the stem. While most intense transcriptional responses were detected in the stems at 24 hours, strong responses were not detected in the leaves until the next sampling point at 2 weeks post-inoculation. Network co-expression analysis identified modules of co-expressed genes common to both organs and showed most of these genes were asynchronously modulated. The temporal shift between stem vs. leaf responses affected transcriptional modulation of genes involved in both signal perception and transduction, as well as downstream biological processes, including oxidative stress, cell wall rearrangement and cell death. Promoter analysis of the genes asynchronously modulated in stem and leaves during N. parvum colonization suggests that the temporal shift of transcriptional reprogramming between the two organs might be due to asynchronous co-regulation by common transcriptional regulators. Topology analysis of stem and leaf co-expression networks pointed to specific transcription factor-encoding genes, including WRKY and MYB, which may be associated with the observed transcriptional responses in the two organs.

  17. Free amino acids of leaves and berries of Cabernet Sauvignon grapevines

    Directory of Open Access Journals (Sweden)

    Alberto Miele

    2000-03-01

    Full Text Available The composition of free amino acids was studied from leaves, pericarps, skins, musts and seeds of Vitis vinifera L. cv. Cabernet Sauvignon. Vineyards were in the Bordeaux region and the grapevines were conducted in espalier and lyre systems. Grapes were collected at maturity and lyophilized after sampling. Extraction of free amino acids was done with a hydroalcoholic solution and their analysis was performed with an autoanalyzer. A standard of 34 amino acids was utilized for the qualitative analysis. The results showed that, for both espalier and lyre training systems, respectively, the free amino acids were predominant in the pericarps (12.85 and 11.21 mg/g dw - 16.88 and 15.12 mg/g dw in skins and 3.29 and 2.88 g/l in musts -, followed by the seeds (2.37 and 2.32 mg/g dw and leaves (1.87 and 1.98 mg/g dw. The most abundant free amino acids in leaves were glutamic acid (23.8 and 28.8 p. cent, aspartic acid (8.8 and 11.1 p. cent, and glutamine (10.1 and 9.4 p. cent. Proline (41.8 and 41.5 p. cent and arginine (22.8 and 22.4 p. cent predominated in the pericarps. In seeds, the main amino acids were proline (14.5 and 15.8 p. cent, arginine (11.0 and 11.8 p. cent, histidine (11.2 and 8.7 p. cent, and glutamic acid (11.3 and 8.2 p. cent. Grapevine training system showed some differences in the total amount and in the percentages of each free amino acid, but the pattern of these compounds for each tissue was similar for both training systems.

  18. Kaolin modulates ABA and IAA dynamics and physiology of grapevine under Mediterranean summer stress.

    Science.gov (United States)

    Dinis, L-T; Bernardo, S; Luzio, A; Pinto, G; Meijón, M; Pintó-Marijuan, M; Cotado, A; Correia, C; Moutinho-Pereira, J

    2018-01-01

    The foliar exogenous application of kaolin, a radiation-reflecting inert mineral, has proven to be an effective short-term climate change mitigation strategy for Mediterranean vineyards. In this work, we address the hypothesis that kaolin could improve both the hormonal dynamics and physiological responses of grapevines growing in Douro Region, northern Portugal. For this purpose, the leaf water potential, gas exchange and chlorophyll a fluorescence parameters were monitored, as well as the abscisic acid (ABA) and indole-3-acetic acid (IAA) quantification and immunolocalization were assessed. The study revealed a slight decrease in ABA and an increase in IAA in the kaolin treatment, which in turn were associated with the improvement of physiological performance. A month after spraying, kaolin improves the water potential respectively, 30% and 17% in the predawn and midday periods. Besides, plants treated with kaolin showed higher values of stomatal conductance, net CO 2 assimilation rate and intrinsic water use efficiency. Kaolin also ameliorates the effective PSII efficiency (67%), as well as the maximum quantum efficiency of photosystem II and the photosynthetic electron transport rate (>73%). These results were consistent with the higher photochemical quenching and the lower non-photochemical quenching observed in treated leaves and with the better performance obtained by the JIP test parameters. Physiological and hormonal analysis confirmed that kaolin effectively enhance grapevine summer stress tolerance. Copyright © 2017 Elsevier GmbH. All rights reserved.

  19. Modulation of flavonoid biosynthetic pathway genes and anthocyanins due to virus infection in grapevine (Vitis vinifera L. leaves

    Directory of Open Access Journals (Sweden)

    Gutha Linga R

    2010-08-01

    Full Text Available Abstract Background Symptoms of grapevine leafroll disease (GLRD in red-fruited wine grape (Vitis vinifera L. cultivars consist of green veins and red and reddish-purple discoloration of inter-veinal areas of leaves. The reddish-purple color of symptomatic leaves may be due to the accumulation of anthocyanins and could reflect an up-regulation of genes involved in their biosynthesis. Results We examined six putative constitutively expressed genes, Ubiquitin, Actin, GAPDH, EF1-a, SAND and NAD5, for their potential as references for normalization of gene expression in reverse transcription-quantitative real-time polymerase chain reaction (RT-qPCR. Using the geNorm program, a combination of two genes (Actin and NAD5 was identified as the stable set of reference genes for normalization of gene expression data obtained from grapevine leaves. By using gene-specific RT-qPCR in combination with a reliable normalization factor, we compared relative expression of the flavonoid biosynthetic pathway genes between leaves infected with Grapevine leafroll-associated virus 3 (GLRaV-3 and exhibiting GLRD symptoms and virus-free green leaves obtained from a red-fruited wine grape cultivar (cv. Merlot. The expression levels of these different genes ranged from two- to fifty-fold increase in virus-infected leaves. Among them, CHS3, F3'5'H, F3H1, LDOX, LAR1 and MybA1 showed greater than 10-fold increase suggesting that they were expressed at significantly higher levels in virus-infected symptomatic leaves. HPLC profiling of anthocyanins extracted from leaves indicated the presence of cyanidin-3-glucoside and malvidin-3-glucoside only in virus-infected symptomatic leaves. The results also showed 24% higher levels of flavonols in virus-infected symptomatic leaves than in virus-free green leaves, with quercetin followed by myricetin being the predominant compounds. Proanthocyanidins, estimated as total tannins by protein precipitation method, were 36% higher in virus

  20. The grapevine kinome: annotation, classification and expression patterns in developmental processes and stress responses.

    Science.gov (United States)

    Zhu, Kaikai; Wang, Xiaolong; Liu, Jinyi; Tang, Jun; Cheng, Qunkang; Chen, Jin-Gui; Cheng, Zong-Ming Max

    2018-01-01

    Protein kinases (PKs) have evolved as the largest family of molecular switches that regulate protein activities associated with almost all essential cellular functions. Only a fraction of plant PKs, however, have been functionally characterized even in model plant species. In the present study, the entire grapevine kinome was identified and annotated using the most recent version of the grapevine genome. A total of 1168 PK-encoding genes were identified and classified into 20 groups and 121 families, with the RLK-Pelle group being the largest, with 872 members. The 1168 kinase genes were unevenly distributed over all 19 chromosomes, and both tandem and segmental duplications contributed to the expansion of the grapevine kinome, especially of the RLK-Pelle group. Ka/Ks values indicated that most of the tandem and segmental duplication events were under purifying selection. The grapevine kinome families exhibited different expression patterns during plant development and in response to various stress treatments, with many being coexpressed. The comprehensive annotation of grapevine kinase genes, their patterns of expression and coexpression, and the related information facilitate a more complete understanding of the roles of various grapevine kinases in growth and development, responses to abiotic stress, and evolutionary history.

  1. Physiological behaviors and recovery responses of four Galician grapevine (Vitis vinifera L. ) cultivars under water stress

    OpenAIRE

    Islam, M.; Berrios, J.

    2012-01-01

    Gas exchange parameters and chlorophyll fluorescence of four pot grown Galician grapevines (Vitis vinifera L. cv. Albariño, Brancellao, Godello and Treixadura) were examined under different levels of water stress in greenhouse. After extreme stress, gas exchange recovery responses were evaluated. Average ΨPD for control and stressed plants were -0.4MPa and -1.45MPa respectively. All varieties showed gradual declining of all gas exchange parameters (gs, E and A) with increasing of stress perio...

  2. Characterization of epiphytic bacterial communities from grapes, leaves, bark and soil of grapevine plants grown, and their relations.

    Directory of Open Access Journals (Sweden)

    Guilherme Martins

    Full Text Available Despite its importance in plant health and crop quality, the diversity of epiphytic bacteria on grape berries and other plant parts, like leaves and bark, remains poorly described, as does the role of telluric bacteria in plant colonization. In this study, we compare the bacterial community size and structure in vineyard soils, as well as on grapevine bark, leaves and berries. Analyses of culturable bacteria revealed differences in the size and structure of the populations in each ecosystem. The highest bacteria population counts and the greatest diversity of genera were found in soil samples, followed by bark, grapes and leaves. The identification of isolates revealed that some genera - Pseudomonas, Curtobacterium, and Bacillus - were present in all ecosystems, but in different amounts, while others were ecosystem-specific. About 50% of the genera were common to soil and bark, but absent from leaves and grapes. The opposite was also observed: grape and leaf samples presented 50% of genera in common that were absent from trunk and soil. The bacterial community structure analyzed by T-RFLP indicated similarities between the profiles of leaves and grapes, on the one hand, and bark and soil, on the other, reflecting the number of shared T-RFs. The results suggest an interaction between telluric bacterial communities and the epiphytic bacteria present on the different grapevine parts.

  3. Identification and utilization of a new Erysiphe necator isolate NAFU1 to quickly evaluate powdery mildew resistance in wild Chinese grapevine species using detached leaves.

    Science.gov (United States)

    Gao, Yu-Rong; Han, Yong-Tao; Zhao, Feng-Li; Li, Ya-Juan; Cheng, Yuan; Ding, Qin; Wang, Yue-Jin; Wen, Ying-Qiang

    2016-01-01

    The most economically important disease of cultivated grapevines worldwide is powdery mildew caused by the biotrophic fungal pathogen Erysiphe necator. To integrate effective genetic resistance into cultivated grapevines, numerous disease resistance screens of diverse Vitis germplasm, including wild species, have been conducted to identify powdery mildew resistance, but the results have been inconsistent. Here, a new powdery mildew isolate that is infectious on grapevines, designated Erysiphe necator NAFU1 (En. NAFU1), was identified and characterized by phylogeny inferred from the internal transcribed spacer (ITS) of pathogen ribosomal DNA sequences. Three classical methods were compared for the maintenance of En. NAFU1, and the most convenient method was maintenance on detached leaves and propagation by contact with infected leaves. Furthermore, controlled inoculations of En. NAFU1 were performed using detached leaves from 57 wild Chinese grapevine accessions to quickly evaluate powdery mildew resistance based on trypan blue staining of leaf sections. The results were compared with previous natural epidemics in the field. Among the screened accessions inoculated with En. NAFU1, 22.8% were resistant, 33.3% were moderately resistant, and 43.9% were susceptible. None of the accessions assessed herein were immune from infection. These results support previous findings documenting the presence of race-specific resistance to E. necator in wild Chinese grapevine. The resistance of wild Chinese grapevine to En. NAFU1 could be due to programmed cell death. The present results suggest that En. NAFU1 isolate could be used for future large-scale screens of resistance to powdery mildew in diverse Vitis germplasms and investigations of the interaction between grapevines and pathogens. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  4. Influence of constitutive phenolic compounds on the response of grapevine (Vitis vinifera L.) leaves to infection by Plasmopara viticola.

    Science.gov (United States)

    Latouche, Gwendal; Bellow, Sébastien; Poutaraud, Anne; Meyer, Sylvie; Cerovic, Zoran G

    2013-01-01

    Flavonols and hydroxycinnamic acids are known to contribute to plant resistance against pathogens, but there are few reports on the implication of flavonols in the resistance of grapevine against Plasmopara viticola, and none on the involvement of hydroxycinnamic acids. In order to analyze the effect of flavonols on P. viticola infection, variable amounts of flavonols were induced by different light conditions in otherwise phenologically identical leaves. Differences in content of leaf hydroxycinnamic acids were induced at the same time. A non-invasive monitoring of flavonols and hydroxycinnamic acids was performed with Dualex leaf-clip optical sensors. Whatever the light condition, there were no significant changes in flavonol or in hydroxycinnamic acid contents for control and inoculated leaves during the development of P. viticola until 6 days after inoculation. The violet-blue autofluorescence of stilbenes, the main phytoalexins of grapevine that accumulate in inoculated leaves, was used as an indicator of infection by P. viticola. The implication of leaf constitutive flavonols and hydroxycinnamic acids in the defence of Vitis vinifera against P. viticola could be investigated in vivo thanks to this indicator. The increase in stilbene violet-blue autofluorescence started earlier for leaves with low flavonol content than for leaves with higher content, suggesting that constitutive flavonols are able to slow down the infection by P. viticola. On the contrary, constitutive hydroxycinnamic acids did not seem to play a role in defence against P. viticola. The non-destructive nature of the methods used alleviates the major problem of destructive experiments: the large variability in leaf phenolic contents.

  5. Effects of Bois noir on carbon assimilation, transpiration, stomatal conductance of leaves and yield of grapevine (Vitis vinifera) cv. Chardonnay.

    Science.gov (United States)

    Endeshaw, Solomon T; Murolo, Sergio; Romanazz, Gianfranco; Neri, Davide

    2012-06-01

    Bois noir (BN) is one of the main phytoplasma diseases of grapevine (Vitis vinifera). It is widespread, and can cause severe losses in European vineyards. The infective agent colonizes phloem elements and induces visible symptoms of leaf yellowing or reddening after a relatively long incubation period. As the most sensitive cultivars to BN, Chardonnay plants were grouped as healthy or symptomatic in spring, based on the records from the previous year. Leaf gas exchange and chlorophyll a fluorescence were measured weekly from July to September in healthy plants, and in symptomatic and asymptomatic leaves from symptomatic plants. The midday relative water content (mRWC) was measured once per month. The detection of phytoplasma DNA by nested-polymerase chain reaction revealed BN infection in symptomatic leaf samples at the end of September. A significant decrease in pigment content and maximum quantum efficiency of photosystem II (Fv/Fm) of these symptomatic leaves was detected from July to September, although in the asymptomatic leaves of the symptomatic plants the net photosynthesis (Pn) decrease was not significant. In the leaves from the healthy plants, Pn and transpiration were relatively stable. Of note, in July, an initially healthy plant showed a strong Pn reduction that was followed by visible leaf yellowing symptoms only in August. The phytoplasma infection also stimulated significant reductions in mRWC of the symptomatic leaves, with a final large decrease in yield.

  6. Physiological behaviors and recovery responses of four galician grapevine (Vitis vinifera L. cultivars under water stress

    Directory of Open Access Journals (Sweden)

    Islam M. T.

    2012-11-01

    Full Text Available Gas exchange parameters and chlorophyll fluorescence of four pot grown Galician grapevines (Vitis vinifera L. cv. Albariño, Brancellao, Godello and Treixadura were examined under different levels of water stress in greenhouse. After extreme stress, gas exchange recovery responses were evaluated. Average ΨPD for control and stressed plants were -0.4MPa and -1.45MPa respectively. All varieties showed gradual declining of all gas exchange parameters (gs, E and A with increasing of stress periods. Under stressed conditions, Albariño and Godello showed higher CO2 assimilation rate. At the end of stress period leaf defoliation was found in Albariño and Brancellao. Gas exchange recovery was higher for both Godello and Treixadura. A better response of auxiliary bud recovery was present in Albariño than in Brancellao. Close correlations between water stress and gas exchange parameters were found and it varies on genotype. Albariño, Godello and Treixadura followed same diurnal patterns of gas exchange rate for control and stressed plant respectively. Diurnal pattern of CO2 assimilation rate of all tested varieties followed gs and E. Only Brancellao showed treatment effect on mid-day Fv/Fm. Among four varieties photoinhibition was only found in Brancellao. At stressed condition physiological responses of grapevines were genotype depended.

  7. A water stress index based on water balance modelling for discrimination of grapevine quality and yield

    Directory of Open Access Journals (Sweden)

    Rémi Gaudin

    2014-01-01

    Significance and impact of the study: This water stress index is a valuable tool for explaining the variations in grape yield and quality among various locations and years because it reflects the vineyard water stress history in relation to rainfall regime and soil conditions. Improvement would come from the simulation of FTSW during winter, notably for soils of high Total Transpirable Soil Water. One potential application is the quantification of water stress change brought by irrigation in Mediterranean vineyards, and its relation to grapevine production.

  8. Ecophysiological modeling of grapevine water stress in Burgundy terroirs by a machine-learning approach

    Directory of Open Access Journals (Sweden)

    Luca eBrillante

    2016-06-01

    Full Text Available In a climate change scenario, successful modeling of the relationships between plant-soil-meteorology is crucial for a sustainable agricultural production, especially for perennial crops. Grapevines (Vitis vinifera L. cv Chardonnay located in eight experimental plots (Burgundy, France along a hillslope were monitored weekly for three years for leaf water potentials, both at predawn (Ψpd and at midday (Ψstem. The water stress experienced by grapevine was modeled as a function of meteorological data (minimum and maximum temperature, rainfall and soil characteristics (soil texture, gravel content, slope by a gradient boosting machine. Model performance was assessed by comparison with carbon isotope discrimination (δ13C of grape sugars at harvest and by the use of a test-set. The developed models reached outstanding prediction performance (RMSE < 0.08 MPa for Ψstem and < 0.06 MPa for Ψpd, comparable to measurement accuracy. Model predictions at a daily time step improved correlation with δ13C data, respect to the observed trend at a weekly time scale. The role of each predictor in these models was described in order to understand how temperature, rainfall, soil texture, gravel content and slope affect the grapevine water status in the studied context. This work proposes a straight-forward strategy to simulate plant water stress in field condition, at a local scale; to investigate ecological relationships in the vineyard and adapt cultural practices to future conditions.

  9. Ecophysiological Modeling of Grapevine Water Stress in Burgundy Terroirs by a Machine-Learning Approach.

    Science.gov (United States)

    Brillante, Luca; Mathieu, Olivier; Lévêque, Jean; Bois, Benjamin

    2016-01-01

    In a climate change scenario, successful modeling of the relationships between plant-soil-meteorology is crucial for a sustainable agricultural production, especially for perennial crops. Grapevines (Vitis vinifera L. cv Chardonnay) located in eight experimental plots (Burgundy, France) along a hillslope were monitored weekly for 3 years for leaf water potentials, both at predawn (Ψpd) and at midday (Ψstem). The water stress experienced by grapevine was modeled as a function of meteorological data (minimum and maximum temperature, rainfall) and soil characteristics (soil texture, gravel content, slope) by a gradient boosting machine. Model performance was assessed by comparison with carbon isotope discrimination (δ(13)C) of grape sugars at harvest and by the use of a test-set. The developed models reached outstanding prediction performance (RMSE < 0.08 MPa for Ψstem and < 0.06 MPa for Ψpd), comparable to measurement accuracy. Model predictions at a daily time step improved correlation with δ(13)C data, respect to the observed trend at a weekly time scale. The role of each predictor in these models was described in order to understand how temperature, rainfall, soil texture, gravel content and slope affect the grapevine water status in the studied context. This work proposes a straight-forward strategy to simulate plant water stress in field condition, at a local scale; to investigate ecological relationships in the vineyard and adapt cultural practices to future conditions.

  10. Abiotic stresses affect Trichoderma harzianum T39-induced resistance to downy mildew in grapevine.

    Science.gov (United States)

    Roatti, Benedetta; Perazzolli, Michele; Gessler, Cesare; Pertot, Ilaria

    2013-12-01

    Enhancement of plant defense through the application of resistance inducers seems a promising alternative to chemical fungicides for controlling crop diseases but the efficacy can be affected by abiotic factors in the field. Plants respond to abiotic stresses with hormonal signals that may interfere with the mechanisms of induced systemic resistance (ISR) to pathogens. In this study, we exposed grapevines to heat, drought, or both to investigate the effects of abiotic stresses on grapevine resistance induced by Trichoderma harzianum T39 (T39) to downy mildew. Whereas the efficacy of T39-induced resistance was not affected by exposure to heat or drought, it was significantly reduced by combined abiotic stresses. Decrease of leaf water potential and upregulation of heat-stress markers confirmed that plants reacted to abiotic stresses. Basal expression of defense-related genes and their upregulation during T39-induced resistance were attenuated by abiotic stresses, in agreement with the reduced efficacy of T39. The evidence reported here suggests that exposure of crops to abiotic stress should be carefully considered to optimize the use of resistance inducers, especially in view of future global climate changes. Expression analysis of ISR marker genes could be helpful to identify when plants are responding to abiotic stresses, in order to optimize treatments with resistance inducers in field.

  11. The Impact of Phaeomoniella chlamydospora Infection on the Grapevine's Physiological Response to Water Stress - Part 2 : Cabernet Sauvignon and Chardonnay

    Directory of Open Access Journals (Sweden)

    J. Edwards

    2007-04-01

    Full Text Available Phaeomoniella chlamydospora is a vascular pathogen that colonises the xylem tissues of the grapevine. It is associated with the diseases, esca and Petri disease, often considered to be ‘stress-related’ diseases. In glasshouse experiments using Cabernet Sauvignon and Chardonnay, stomatal conductance was higher in infected plants, implying that infection interferes with stomatal control. In Cabernet Sauvignon, leaf water potentials were lower in infected plants subjected to water stress, indicating that infection made it more difficult for the vine to get water to the leaf. This was less apparent in Chardonnay. Clearly, infection alters the grapevine response to water stress and some cultivars are affected more than others.

  12. Grapevine fruit extract protects against radiation-induced oxidative stress and apoptosis in human lymphocyte

    International Nuclear Information System (INIS)

    Singha, Indrani; Das, Subir Kumar

    2015-01-01

    Ionizing radiation (IR) causes oxidative stress through overwhelming generation of reactive oxygen species (ROS) in the living cells leading the oxidative damage further to biomolecules. Grapevine (Vitis vinifera L.) posses several bioactive phytochemicals and is the richest source of antioxidants. In this study, we investigated V. vinifera for its phytochemical content, enzymes profile and, ROS-and oxidant-scavenging activities. We have also studied the fruit extract of four different grapevine viz., Thompson seedless, Flame seedless, Kishmish chorni and Red globe for their radioprotective actions in human lymphocytes. The activities of ascorbic acid oxidase and catalase significantly (P < 0.01) differed among extracts within the same cultivar, while that of peroxidase and polyphenol oxidase did not differ significantly. The superoxide radical-scavenging activity was higher in the seed as compared to the skin or pulp of the same cultivar. Pretreatment with grape extracts attenuated the oxidative stress induced by 4 Gy γ-radiation in human lymphocytes in vitro. Further, γ-radiation-induced increase in caspase 3/7 activity was significantly attenuated by grape extracts. These results suggest that grape extract serve as a potential source of natural antioxidants against the IR-induced oxidative stress and also inhibit apoptosis. Furthermore, the protective action of grape depends on the source of extract (seed, skin or pulp) and type of the cultivars. (author)

  13. A multimodal image sensor system for identifying water stress in grapevines

    Science.gov (United States)

    Zhao, Yong; Zhang, Qin; Li, Minzan; Shao, Yongni; Zhou, Jianfeng; Sun, Hong

    2012-11-01

    Water stress is one of the most common limitations of fruit growth. Water is the most limiting resource for crop growth. In grapevines, as well as in other fruit crops, fruit quality benefits from a certain level of water deficit which facilitates to balance vegetative and reproductive growth and the flow of carbohydrates to reproductive structures. A multi-modal sensor system was designed to measure the reflectance signature of grape plant surfaces and identify different water stress levels in this paper. The multi-modal sensor system was equipped with one 3CCD camera (three channels in R, G, and IR). The multi-modal sensor can capture and analyze grape canopy from its reflectance features, and identify the different water stress levels. This research aims at solving the aforementioned problems. The core technology of this multi-modal sensor system could further be used as a decision support system that combines multi-modal sensory data to improve plant stress detection and identify the causes of stress. The images were taken by multi-modal sensor which could output images in spectral bands of near-infrared, green and red channel. Based on the analysis of the acquired images, color features based on color space and reflectance features based on image process method were calculated. The results showed that these parameters had the potential as water stress indicators. More experiments and analysis are needed to validate the conclusion.

  14. Day and night heat stress trigger different transcriptomic responses in green and ripening grapevine (vitis vinifera) fruit.

    Science.gov (United States)

    Rienth, Markus; Torregrosa, Laurent; Luchaire, Nathalie; Chatbanyong, Ratthaphon; Lecourieux, David; Kelly, Mary T; Romieu, Charles

    2014-04-28

    Global climate change will noticeably affect plant vegetative and reproductive development. The recent increase in temperatures has already impacted yields and composition of berries in many grapevine-growing regions. Physiological processes underlying temperature response and tolerance of the grapevine fruit have not been extensively investigated. To date, all studies investigating the molecular regulation of fleshly fruit response to abiotic stress were only conducted during the day, overlooking possible critical night-specific variations. The present study explores the night and day transcriptomic response of grapevine fruit to heat stress at several developmental stages. Short heat stresses (2 h) were applied at day and night to vines bearing clusters sequentially ordered according to the developmental stages along their vertical axes. The recently proposed microvine model (DRCF-Dwarf Rapid Cycling and Continuous Flowering) was grown in climatic chambers in order to circumvent common constraints and biases inevitable in field experiments with perennial macrovines. Post-véraison berry heterogeneity within clusters was avoided by constituting homogenous batches following organic acids and sugars measurements of individual berries. A whole genome transcriptomic approach was subsequently conducted using NimbleGen 090818 Vitis 12X (30 K) microarrays. Present work reveals significant differences in heat stress responsive pathways according to day or night treatment, in particular regarding genes associated with acidity and phenylpropanoid metabolism. Precise distinction of ripening stages led to stage-specific detection of malic acid and anthocyanin-related transcripts modulated by heat stress. Important changes in cell wall modification related processes as well as indications for heat-induced delay of ripening and sugar accumulation were observed at véraison, an effect that was reversed at later stages. This first day - night study on heat stress adaption of the

  15. Response of grapevine leaves to plasmopara viticola infection by means of measurement of reflectance and fluorescence signals

    Czech Academy of Sciences Publication Activity Database

    Šebela, David; Olejníčková, Julie; Župčanová, A.; Sotolář, R.

    2012-01-01

    Roč. 27, č. 8 (2012), s. 229-237 ISSN 1211-8516 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0073 Institutional support: RVO:67179843 Keywords : Plasmopara viticola * downy mildew * grapevine * leaf tissue * susceptible varieties * chlorophyll fluorescence imaging * reflectance Subject RIV: GM - Food Processing

  16. Genome-wide analysis of the grapevine stilbene synthase multigenic family: genomic organization and expression profiles upon biotic and abiotic stresses

    Directory of Open Access Journals (Sweden)

    Vannozzi Alessandro

    2012-08-01

    Full Text Available Abstract Background Plant stilbenes are a small group of phenylpropanoids, which have been detected in at least 72 unrelated plant species and accumulate in response to biotic and abiotic stresses such as infection, wounding, UV-C exposure and treatment with chemicals. Stilbenes are formed via the phenylalanine/polymalonate-route, the last step of which is catalyzed by the enzyme stilbene synthase (STS, a type III polyketide synthase (PKS. Stilbene synthases are closely related to chalcone synthases (CHS, the key enzymes of the flavonoid pathway, as illustrated by the fact that both enzymes share the same substrates. To date, STSs have been cloned from peanut, pine, sorghum and grapevine, the only stilbene-producing fruiting-plant for which the entire genome has been sequenced. Apart from sorghum, STS genes appear to exist as a family of closely related genes in these other plant species. Results In this study a complete characterization of the STS multigenic family in grapevine has been performed, commencing with the identification, annotation and phylogenetic analysis of all members and integration of this information with a comprehensive set of gene expression analyses including healthy tissues at differential developmental stages and in leaves exposed to both biotic (downy mildew infection and abiotic (wounding and UV-C exposure stresses. At least thirty-three full length sequences encoding VvSTS genes were identified, which, based on predicted amino acid sequences, cluster in 3 principal groups designated A, B and C. The majority of VvSTS genes cluster in groups B and C and are located on chr16 whereas the few gene family members in group A are found on chr10. Microarray and mRNA-seq expression analyses revealed different patterns of transcript accumulation between the different groups of VvSTS family members and between VvSTSs and VvCHSs. Indeed, under certain conditions the transcriptional response of VvSTS and VvCHS genes appears to be

  17. ABA and GA3 regulate the synthesis of primary and secondary metabolites related to alleviation from biotic and abiotic stresses in grapevine.

    Science.gov (United States)

    Murcia, Germán; Fontana, Ariel; Pontin, Mariela; Baraldi, Rita; Bertazza, Gianpaolo; Piccoli, Patricia N

    2017-03-01

    Plants are able to synthesize a large number of organic compounds. Among them, primary metabolites are known to participate in plant growth and development, whereas secondary metabolites are mostly involved in defense and other facultative processes. In grapevine, one of the major fruit crops in the world, secondary metabolites, mainly polyphenols, are of great interest for the wine industry. Even though there is an extensive literature on the content and profile of those compounds in berries, scarce or no information is available regarding polyphenols in other organs. In addition, little is known about the effect of plant growth regulators (PGRs), ABA and GA 3 (extensively used in table grapes) on the synthesis of primary and secondary metabolites in wine grapes. In table grapes, cultural practices include the use of GA 3 sprays shortly before veraison, to increase berry and bunch size, and sugar content in fruits. Meanwhile, ABA applications to the berries on pre-veraison improve the skin coloring and sugar accumulation, anticipating the onset of veraison. Accordingly, the aim of this study was to assess and characterize primary and secondary metabolites in leaves, berries and roots of grapevine plants cv. Malbec at veraison, and changes in compositions after ABA and GA 3 aerial sprayings. Metabolic profiling was conducted using GC-MS, GC-FID and HPLC-MWD. A large set of metabolites was identified: sugars, alditols, organic acids, amino acids, polyphenols (flavonoids and non-flavonoids) and terpenes (mono-, sesqui-, di- and triterpenes). The obtained results showed that ABA applications elicited synthesis of mono- and sesquiterpenes in all assessed tissues, as well as L-proline, acidic amino acids and anthocyanins in leaves. Additionally, applications with GA 3 elicited synthesis of L-proline in berries, and mono- and sesquiterpenes in all the tissues. However, treatment with GA 3 seemed to block polyphenol synthesis, mainly in berries. In conclusion, ABA and GA

  18. Reinforcement of the radiative and thermic stresses of the grapevine. Repercussions on yeast surface microflora

    International Nuclear Information System (INIS)

    Salmon, J.M.; Mailhac, N.; Sauvage, F.X.; Biron, M.J.; Robin, J.P.

    1997-01-01

    All along the ripening period, the radiative and thermic stresses of the grapevine may be reinforced by the use of a reflective soil cover (aluminized film). Such a treatment leads to repercussions on the berries, on the must composition and finally on the wine quality. During such a preliminary experiment, we demonstrated that the temperature increase and/or the reinforcement of the reflected ultraviolet radiations (measured at 254 nm) at the level of grape berries severely impaired the development of yeast cells at their surfaces. By means of an artificial inoculation of grapes at the beginning of the ripening period with a mixture of four different yeast genera (Saccharomyces cerevisiae, Hanseniaspora uvarum, Pichia fermentans and Schizosaccharomyces pombe), we demonstrated that the repartition of yeast genera amongst this population was affected by the treatment of stocks with the aluminized film: during the experiment presented in this paper, the Saccharomyces genus was favoured. One may consider by extension similar effects resulting from the reflective properties of some natural soils. Such effects may considerably influence the distribution of wild yeast flora during the spontaneous fermentation of musts. If such an hypothesis is confirmed at a local or regional level, it will represent a first significant piece of the definition of one of the aspects of the ''terroir'' effect on the characteristics of wines [fr

  19. The sulfated laminarin triggers a stress transcriptome before priming the SA- and ROS-dependent defenses during grapevine's induced resistance against Plasmopara viticola.

    Directory of Open Access Journals (Sweden)

    Adrien Gauthier

    Full Text Available Grapevine (Vitis vinifera is susceptible to many pathogens which cause significant losses to viticulture worldwide. Chemical control is available, but agro-ecological concerns have raised interest in alternative methods, especially in triggering plant immunity by elicitor treatments. The β-glucan laminarin (Lam and its sulfated derivative (PS3 have been previously demonstrated to induce resistance in grapevine against downy mildew (Plasmopara viticola. However, if Lam elicits classical grapevine defenses such as oxidative burst, pathogenesis-related (PR-proteins and phytoalexin production, PS3 triggered grapevine resistance via a poorly understood priming phenomenon. The aim of this study was to identify the molecular mechanisms of the PS3-induced resistance. For this purpose we studied i the signaling events and transcriptome reprogramming triggered by PS3 treatment on uninfected grapevine, ii grapevine immune responses primed by PS3 during P. viticola infection. Our results showed that i PS3 was unable to elicit reactive oxygen species (ROS production, cytosolic Ca(2+ concentration variations, mitogen-activated protein kinase (MAPK activation but triggered a long lasting plasma membrane depolarization in grapevine cells, ii PS3 and Lam shared a common stress-responsive transcriptome profile that partly overlapped the salicylate- (SA and jasmonate-(JA-dependent ones. After P. viticola inoculation, PS3 specifically primed the SA- and ROS-dependent defense pathways leading to grapevine induced resistance against this biotroph. Interestingly pharmacological approaches suggested that the plasma membrane depolarization and the downstream ROS production are key events of the PS3-induced resistance.

  20. A Comparison of Petiole Hydraulics and Aquaporin Expression in an Anisohydric and Isohydric Cultivar of Grapevine in Response to Water-Stress Induced Cavitation.

    Science.gov (United States)

    Shelden, Megan C; Vandeleur, Rebecca; Kaiser, Brent N; Tyerman, Stephen D

    2017-01-01

    We report physiological, anatomical and molecular differences in two economically important grapevine ( Vitis vinifera L.) cultivars cv. Grenache (near-isohydric) and Chardonnay (anisohydric) in their response to water-stress induced cavitation. The aim of the study was to compare organ vulnerability (petiole and stem) to cavitation by measuring ultrasonic acoustic emissions (UAE) and percent loss of conductance of potted grapevines subject to the onset of water-stress. Leaf (ψ L ) and stem water potential (ψ S ), stomatal conductance ( g s ), transpiration ( E ), petiole hydraulics ( K Pet ), and xylem diameter were also measured. Chardonnay displayed hydraulic segmentation based on UAE, with cavitation occurring at a less negative ψ L in the petiole than in the stem. Vulnerability segmentation was not observed in Grenache, with both petioles and stems equally vulnerable to cavitation. Leaf water potential that induced 50% of maximum UAE was significantly different between petioles and stems in Chardonnay (ψ 50Petiole = -1.14 and ψ 50Stem = -2.24 MPa) but not in Grenache (ψ 50Petiole = -0.73 and ψ 50Stem = -0.78 MPa). Grenache stems appeared more susceptible to water-stress induced cavitation than Chardonnay stems. Grenache displayed (on average) a higher K Pet likely due to the presence of larger xylem vessels. A close relationship between petiole hydraulic properties and vine water status was observed in Chardonnay but not in Grenache. Transcriptional analysis of aquaporins in the petioles and leaves ( VvPIP1;1, VvPIP2;1, VvPIP2;2 VvPIP2;3, VvTIP1;1 , and VvTIP2;1 ) showed differential regulation diurnally and in response to water-stress. VvPIP2;1 showed strong diurnal regulation in the petioles and leaves of both cultivars with expression highest predawn. Expression of VvPIP2;1 and VvPIP2;2 responded to ψ L and ψ S in both cultivars indicating the expression of these two genes are closely linked to vine water status. Expression of several aquaporin

  1. Phenolic compounds and properties of antioxidants in grapevine roots (Vitis vinifera L. under low-temperature stress followed by recovery

    Directory of Open Access Journals (Sweden)

    Stanisław Weidner

    2011-01-01

    Full Text Available The research has been performed on roots of Vitis vinifera, cv. Himrod, obtained from seedlings grown under chill stress conditions (+10oC in the day and +7oC at night, under optimum conditions (+25oC in the day and +18oC at night and from seedling which underwent a recover period after the chill stress treatment. The purpose of the study has been to determine quantitative and qualitative changes in phenolic compounds as well as to demonstrate changes in antiradical properties of extracts from grapevine roots, which appeared as a result of chill stress and during recovery under the optimum conditions following the stress. Phenolic compounds from grapevine roots were extracted using 80% acetone. The total content of phenolics was determined by colorimetry. The content of tannins was tested by precipitation with bovine serum albumin. The reducing power as well as DPPH• free radical and ABTS+• cation radical scavenging activity of the extracts were also tested. In order to identify phenolic compounds present in the extracts the RP-HPLC technique was employed. The tested material was found to contain tannins and three identified phenolic acids: ferulic, caffeic and p-coumaric ones. The latter occurred in the highest concentrations (from 4.46 to 6.28 µg/g fresh matter. Ferulic acid appeared in smaller amounts (from 1.68 to 2.65 µg/g fresh matter, followed by caffeic acid (from 0.87 to 1.55 µg/g fresh matter. Significantly less total phenolic compounds occurred in roots of seedlings subjected to chill stress. However, the total content of these compounds increased significantly in roots of plants which underwent recovery after chill stress. Concentration of tannins was determined by two methods. The content of condensed tannins was depressed in roots as a result of low temperature stress, whereas the content of condensed and hydrolysing tannins (determined via the BSA method rose under chill stress conditions. A significant increase in tannins

  2. Effect of osmotic stress and post-stress recovery on the content of phenolics and properties of antioxidants in germinating seeds of grapevine Vitis californica

    Directory of Open Access Journals (Sweden)

    Stanisław Weidner

    2011-05-01

    Full Text Available The tested material consisted of grapevine Vitis californica stratified seeds germinated under optimum conditions (+25°C in water, under osmotic stress (-0.2 MPa in PEG solution and submitted to recovery after stress (+25°C in water. The germinating seeds were determined to contain tannins, catechins and the following phenolic acids: gallic, caffeic, p-coumaric and ferulic. The acids occurred in free, ester- and glycoside-bound forms. The dominant form of phenolic acids was the ester-bound fraction. Gallic acid was the most abundant phenolic acid in germinating seeds, while ferulic acid appeared in the smallest amounts. Our analysis of tannins demonstrated that osmotic stress depressed their concentration. Presence of catechin group compounds such as catechin and epicatechin was also determined. In each sample epicatechin was dominant. The total concentration of catechin increased under stress conditions and declined during post-stress recovery. Catechins are a constituent of tannins and their increase under osmotic stress is most probably caused by the breakdown of some tannins in seeds germinating under stress conditions. Samples submitted to osmotic stress were also found to contain less of total phenolic compounds, whereas in samples which underwent post-stress recovery the total level of phenolic compounds increased. Compared to extracts from seeds germinating under optimum conditions, osmotic stress depressed the capacity of extract to scavenge DPPH● (2,2-diphenyl-1-picrylhydrazyl and ABTS●+ – 2,2-Azino-bis (3-etylbenzothiazoline-6-sulfonic acid free radicals, but the antioxidant activity rose in seeds submitted to recovery after stress. Positive correlation was therefore demonstrated between the total content of phenolic acids in germinating grapevine seeds and the reducing power of extracts obtained from these seeds and their free radical scavenging activity. The results suggest that osmotic stress inhibits the activity of

  3. Hydraulics and gas exchange recover more rapidly from severe drought stress in small pot-grown grapevines than in field-grown plants.

    Science.gov (United States)

    Romero, Pascual; Botía, Pablo; Keller, Markus

    2017-09-01

    Modifications of plant hydraulics and shoot resistances (R shoot ) induced by water withholding followed by rewatering, and their relationships with plant water status, leaf gas exchange and water use efficiency at the leaf level, were investigated in pot-grown and field-grown, own-rooted Syrah grapevines in an arid climate. Water stress induced anisohydric behavior, gradually reducing stomatal conductance (g s ) and leaf photosynthesis (A) in response to decreasing midday stem water potential (Ψ s ). Water stress also rapidly increased intrinsic water-use efficiency (A/g s ); this effect persisted for many days after rewatering. Whole-plant (K plant ), canopy (K canopy ), shoot (K shoot ) and leaf (K leaf ) hydraulic conductances decreased during water stress, in tune with the gradual decrease in Ψ s , leaf gas exchange and whole plant water use. Water-stressed vines also had a lower Ψ gradient between stem and leaf (ΔΨ l ), which was correlated with lower leaf transpiration rate (E). E and ΔΨ l increased with increasing vapour pressure deficit (VPD) in non-stressed control vines but not in stressed vines. Perfusion of xylem-mobile dye showed that water flow to petioles and leaves was substantially reduced or even stopped under moderate and severe drought stress. Leaf blade hydraulic resistance accounted for most of the total shoot resistance. However, hydraulic conductance of the whole root system (K root ) was not significantly reduced until water stress became very severe in pot-grown vines. Significant correlations between K plant , K canopy and Ψ s , K canopy and leaf gas exchange, K leaf and Ψ s , and K leaf and A support a link between water supply, leaf water status and gas exchange. Upon re-watering, Ψ s recovered faster than gas exchange and leaf-shoot hydraulics. A gradual recovery of hydraulic functionality of plant organs was also observed, the leaves being the last to recover after rewatering. In pot-grown vines, K canopy recovered rather

  4. Temperature dependent RNA metabolism in Xylella fastidiosa during cold stress and grapevine infection

    Science.gov (United States)

    Re-occurrence of Pierce’s disease of grapes, caused by Xylella fastidiosa, is known to be influenced by environmental factors, particularly cold temperatures during overwintering. Grapevines in colder regions are often cured of X. fastidiosa infection over the winter season, depending on cultivar, t...

  5. Investigation of Catalase, Proxidase and Total Protein Level in Some Cold Treated Grapevine Cultivars Cold Stress Response

    Directory of Open Access Journals (Sweden)

    M. Karimi Alavijeh

    2016-02-01

    Full Text Available Chilling is an important environmental stress that influences the yield and quality of many agricultural crops. Different plants use different systems to endure this stress and minimize its effects. One of these systems is enzymatic reaction. To find out more about responses of different grapevine species and cultivars to the low temperature conditions, their enzymatic changes were evaluated in a factorial experiment based on randomized complete design with 3 replication during different periods after chilling stress. Leaf samples of plants under cold stress had been taken and maintained in -80 °C until enzyme extraction. Low temperature around 4 °C is sufficient to induce genes that produce chilling acclimatization proteins. In the present study, leaf samples were collected from the plants that were kept at 4 °C during different time intervals, and then total proteins as well as two main antioxidant enzymes (catalase and guaiacolperoxidase activities were measured. Results showed that as temperature decreased, enzymatic activities were increased in six Iranian grapevine cultivars (‘Atabaki’, ‘Khalili-Danedar’, ‘Shahroodi’, ‘Rajabi-Siah’, ‘Askari’ and ‘Bidane-Sefid’ as well as ‘Riparia’, an American species. The highest enzymatic activities of catalase and ceroxidase were recorded in ‘Khalili-Danedar’ and ‘Riparia’. However,the lowest activities were recorded in ‘Rajabi-Siah’, ‘Bidane-Sefid’ and ‘Shahroodi’. For all studied cultivars, peroxidase showed its highest activity at 12 h after chilling stress, then remained constant, while, the highest activity of catalase were recorded at 8 h. In addition, cold stress increased the total protein content for all studied cultivars, in which ‘Khalili-Danedar’ had the highest protein content amongstudied cultivars. Also, the highest proteins content were recorded at 12 h after exposing plants to cold.

  6. Grapevine (Vitis vinifera L.).

    Science.gov (United States)

    Torregrosa, Laurent; Vialet, Sandrine; Adivèze, Angélique; Iocco-Corena, Pat; Thomas, Mark R

    2015-01-01

    Grapevine (Vitis) is considered to be one of the major fruit crops in the world based on hectares cultivated and economic value. Grapes are used not only for wine but also for fresh fruit, dried fruit, and juice production. Wine is by far the major product of grapes, and the focus of this chapter is on wine grape cultivars. Grapevine cultivars of Vitis vinifera L. have a reputation for producing premium quality wines. These premium quality wines are produced from a small number of cultivars that enjoy a high level of consumer acceptance and are firmly entrenched in the market place because of varietal name branding and the association of certain wine styles and regions with specific cultivars. In light of this situation, grapevine improvement by a transgenic approach is attractive when compared to a classical breeding approach. The transfer of individual traits as single genes with a minimum disruption to the original genome would leave the traditional characteristics of the cultivar intact. However, a reliable transformation system is required for a successful transgenic approach to grapevine improvement. There are three criteria for achieving an efficient Agrobacterium-mediated transformation system: (1) the production of highly regenerative transformable tissue, (2) optimal cocultivation conditions for both grapevine tissue and Agrobacterium, and (3) an efficient selection regime for transgenic plant regeneration. In this chapter, we describe a grapevine transformation system that meets these criteria. We also describe a protocol for the production of transformed roots suitable for functional gene studies and for the production of semi-transgenic grafted plants.

  7. The grapevine VvWRKY2 gene enhances salt and osmotic stress tolerance in transgenic Nicotiana tabacum.

    Science.gov (United States)

    Mzid, Rim; Zorrig, Walid; Ben Ayed, Rayda; Ben Hamed, Karim; Ayadi, Mariem; Damak, Yosra; Lauvergeat, Virginie; Hanana, Mohsen

    2018-06-01

    Our study aims to assess the implication of WRKY transcription factor in the molecular mechanisms of grapevine adaptation to salt and water stresses. In this respect, a full-length VvWRKY2 cDNA, isolated from a Vitis vinifera grape berry cDNA library, was constitutively over-expressed in Nicotiana tabacum seedlings. Our results showed that transgenic tobacco plants exhibited higher seed germination rates and better growth, under both salt and osmotic stress treatments, when compared to wild type plants. Furthermore, our analyses demonstrated that, under stress conditions, transgenic plants accumulated more osmolytes, such as soluble sugars and free proline, while no changes were observed regarding electrolyte leakage, H 2 O 2 , and malondialdehyde contents. The improvement of osmotic adjustment may be an important mechanism underlying the role of VvWRKY 2 in promoting tolerance and adaptation to abiotic stresses. Principal component analysis of our results highlighted a clear partition of plant response to stress. On the other hand, we observed a significant adaptation behaviour response for transgenic lines under stress. Taken together, all our findings suggest that over-expression of VvWRKY2 gene has a compelling role in abiotic stress tolerance and, therefore, would provide a useful strategy to promote abiotic stress tolerance in grape via molecular-assisted breeding and/or new biotechnology tools.

  8. High-throughput sequencing of microbial community diversity in soil, grapes, leaves, grape juice and wine of grapevine from China.

    Science.gov (United States)

    Wei, Yu-Jie; Wu, Yun; Yan, Yin-Zhuo; Zou, Wan; Xue, Jie; Ma, Wen-Rui; Wang, Wei; Tian, Ge; Wang, Li-Ye

    2018-01-01

    In this study Illumina MiSeq was performed to investigate microbial diversity in soil, leaves, grape, grape juice and wine. A total of 1,043,102 fungal Internal Transcribed Spacer (ITS) reads and 2,422,188 high quality bacterial 16S rDNA sequences were used for taxonomic classification, revealed five fungal and eight bacterial phyla. At the genus level, the dominant fungi were Ascomycota, Sordariales, Tetracladium and Geomyces in soil, Aureobasidium and Pleosporaceae in grapes leaves, Aureobasidium in grape and grape juice. The dominant bacteria were Kaistobacter, Arthrobacter, Skermanella and Sphingomonas in soil, Pseudomonas, Acinetobacter and Kaistobacter in grape and grapes leaves, and Oenococcus in grape juice and wine. Principal coordinate analysis showed structural separation between the composition of fungi and bacteria in all samples. This is the first study to understand microbiome population in soil, grape, grapes leaves, grape juice and wine in Xinjiang through High-throughput Sequencing and identify microorganisms like Saccharomyces cerevisiae and Oenococcus spp. that may contribute to the quality and flavor of wine.

  9. High-throughput sequencing of microbial community diversity in soil, grapes, leaves, grape juice and wine of grapevine from China

    Science.gov (United States)

    Yan, Yin-zhuo; Zou, Wan; Ma, Wen-rui; Wang, Wei; Tian, Ge; Wang, Li-ye

    2018-01-01

    In this study Illumina MiSeq was performed to investigate microbial diversity in soil, leaves, grape, grape juice and wine. A total of 1,043,102 fungal Internal Transcribed Spacer (ITS) reads and 2,422,188 high quality bacterial 16S rDNA sequences were used for taxonomic classification, revealed five fungal and eight bacterial phyla. At the genus level, the dominant fungi were Ascomycota, Sordariales, Tetracladium and Geomyces in soil, Aureobasidium and Pleosporaceae in grapes leaves, Aureobasidium in grape and grape juice. The dominant bacteria were Kaistobacter, Arthrobacter, Skermanella and Sphingomonas in soil, Pseudomonas, Acinetobacter and Kaistobacter in grape and grapes leaves, and Oenococcus in grape juice and wine. Principal coordinate analysis showed structural separation between the composition of fungi and bacteria in all samples. This is the first study to understand microbiome population in soil, grape, grapes leaves, grape juice and wine in Xinjiang through High-throughput Sequencing and identify microorganisms like Saccharomyces cerevisiae and Oenococcus spp. that may contribute to the quality and flavor of wine. PMID:29565999

  10. Endophytic bacterial diversity in grapevine (Vitis vinifera L.) leaves described by 16S rRNA gene sequence analysis and length heterogeneity-PCR.

    Science.gov (United States)

    Bulgari, Daniela; Casati, Paola; Brusetti, Lorenzo; Quaglino, Fabio; Brasca, Milena; Daffonchio, Daniele; Bianco, Piero Attilio

    2009-08-01

    Diversity of bacterial endophytes associated with grapevine leaf tissues was analyzed by cultivation and cultivation-independent methods. In order to identify bacterial endophytes directly from metagenome, a protocol for bacteria enrichment and DNA extraction was optimized. Sequence analysis of 16S rRNA gene libraries underscored five diverse Operational Taxonomic Units (OTUs), showing best sequence matches with gamma-Proteobacteria, family Enterobacteriaceae, with a dominance of the genus Pantoea. Bacteria isolation through cultivation revealed the presence of six OTUs, showing best sequence matches with Actinobacteria, genus Curtobacterium, and with Firmicutes genera Bacillus and Enterococcus. Length Heterogeneity-PCR (LH-PCR) electrophoretic peaks from single bacterial clones were used to setup a database representing the bacterial endophytes identified in association with grapevine tissues. Analysis of healthy and phytoplasma-infected grapevine plants showed that LH-PCR could be a useful complementary tool for examining the diversity of bacterial endophytes especially for diversity survey on a large number of samples.

  11. Antioxidant Activity of Grapevine Leaf Extracts against Oxidative Stress Induced by Carbon Tetrachloride in Cerebral Cortex, Hippocampus and Cerebellum of Rats

    Directory of Open Access Journals (Sweden)

    Mariane Wohlenberg

    2014-04-01

    Full Text Available In recent years, it has become increasingly important to study the beneficial properties of derivatives of grapes and grapevine. The objective of this study was to determine the antioxidant activity of Vitis labrusca leaf extracts, comparing conventional and organic grapevines, in different brain areas of rats. We used male Wistar rats treated with grapevine leaf extracts for a period of 14 days, and on the 15th day, we administered in half of the rats, mineral oil and the other half, carbon tetrachloride (CCl4. The animals were euthanized by decapitation and the cerebral cortex, hippocampus and cerebellum were removed to assess oxidative stress parameters and the activity of antioxidant enzymes. Lipid peroxidation levels (TBARS were unchanged. However, CCl4 induced oxidative damage to proteins in all tissues studied, and this injury was prevented by both extracts. Superoxide dismutase (SOD activity was increased by CCl4 in the cerebral cortex and decreased in other tissues. However, CCl4 increased catalase (CAT activity in the cerebellum and decreased it in the cerebral cortex. The SOD/CAT ratio was restored in the cerebellum by both extracts and only in the cerebral cortex by the organic extract.

  12. Inspection of the grapevine BURP superfamily highlights an expansion of RD22 genes with distinctive expression features in berry development and ABA-mediated stress responses.

    Directory of Open Access Journals (Sweden)

    José Tomás Matus

    Full Text Available The RESPONSIVE TO DEHYDRATION 22 (RD22 gene is a molecular link between abscisic acid (ABA signalling and abiotic stress responses. Its expression has been used as a reliable ABA early response marker. In Arabidopsis, the single copy RD22 gene possesses a BURP domain also located at the C-terminus of USP embryonic proteins and the beta subunit of polygalacturonases. In grapevine, a RD22 gene has been identified but putative paralogs are also found in the grape genome, possibly forming a large RD22 family in this species. In this work, we searched for annotations containing BURP domains in the Vitis vinifera genome. Nineteen proteins were defined by a comparative analysis between the two genome predictions and RNA-Seq data. These sequences were compared to other plant BURPs identified in previous genome surveys allowing us to reconceive group classifications based on phylogenetic relationships and protein motif occurrence. We observed a lineage-specific evolution of the RD22 family, with the biggest expansion in grapevine and poplar. In contrast, rice, sorghum and maize presented highly expanded monocot-specific groups. The Vitis RD22 group may have expanded from segmental duplications as most of its members are confined to a region in chromosome 4. The inspection of transcriptomic data revealed variable expression of BURP genes in vegetative and reproductive organs. Many genes were induced in specific tissues or by abiotic and biotic stresses. Three RD22 genes were further studied showing that they responded oppositely to ABA and to stress conditions. Our results show that the inclusion of RNA-Seq data is essential while describing gene families and improving gene annotations. Robust phylogenetic analyses including all BURP members from other sequenced species helped us redefine previous relationships that were erroneously established. This work provides additional evidence for RD22 genes serving as marker genes for different organs or stresses

  13. Inspection of the grapevine BURP superfamily highlights an expansion of RD22 genes with distinctive expression features in berry development and ABA-mediated stress responses.

    Science.gov (United States)

    Matus, José Tomás; Aquea, Felipe; Espinoza, Carmen; Vega, Andrea; Cavallini, Erika; Dal Santo, Silvia; Cañón, Paola; Rodríguez-Hoces de la Guardia, Amparo; Serrano, Jennifer; Tornielli, Giovanni Battista; Arce-Johnson, Patricio

    2014-01-01

    The RESPONSIVE TO DEHYDRATION 22 (RD22) gene is a molecular link between abscisic acid (ABA) signalling and abiotic stress responses. Its expression has been used as a reliable ABA early response marker. In Arabidopsis, the single copy RD22 gene possesses a BURP domain also located at the C-terminus of USP embryonic proteins and the beta subunit of polygalacturonases. In grapevine, a RD22 gene has been identified but putative paralogs are also found in the grape genome, possibly forming a large RD22 family in this species. In this work, we searched for annotations containing BURP domains in the Vitis vinifera genome. Nineteen proteins were defined by a comparative analysis between the two genome predictions and RNA-Seq data. These sequences were compared to other plant BURPs identified in previous genome surveys allowing us to reconceive group classifications based on phylogenetic relationships and protein motif occurrence. We observed a lineage-specific evolution of the RD22 family, with the biggest expansion in grapevine and poplar. In contrast, rice, sorghum and maize presented highly expanded monocot-specific groups. The Vitis RD22 group may have expanded from segmental duplications as most of its members are confined to a region in chromosome 4. The inspection of transcriptomic data revealed variable expression of BURP genes in vegetative and reproductive organs. Many genes were induced in specific tissues or by abiotic and biotic stresses. Three RD22 genes were further studied showing that they responded oppositely to ABA and to stress conditions. Our results show that the inclusion of RNA-Seq data is essential while describing gene families and improving gene annotations. Robust phylogenetic analyses including all BURP members from other sequenced species helped us redefine previous relationships that were erroneously established. This work provides additional evidence for RD22 genes serving as marker genes for different organs or stresses in grapevine.

  14. Melatonin-producing endophytic bacteria from grapevine roots promote the abiotic stress-induced production of endogenous melatonin in their hosts

    Directory of Open Access Journals (Sweden)

    Jian Jiao

    2016-09-01

    Full Text Available Endophytes form symbiotic relationships with plants and constitute an important source of phytohormones and bioactive secondary metabolites for their hosts. To date, most studies of endophytes have focused on the influence of these microorganisms on plant growth and physiology and their role in plant defenses against biotic and abiotic stressors; however, to the best of our knowledge, the ability of endophytes to produce melatonin has not been reported. In the present study, we isolated and identified root-dwelling bacteria from three grapevine varieties and found that, when cultured under laboratory conditions, some of the bacteria strains secreted melatonin and tryptophan-ethyl ester. The endophytic bacterium Bacillus amyloliquefaciens SB-9 exhibited the highest level of in vitro melatonin secretion and also produced three intermediates of the melatonin biosynthesis pathway: 5-hydroxytryptophan, serotonin, and N-acetylserotonin. After B. amyloliquefaciens SB-9 colonization, the plantlets exhibited increased plant growth. Additionally, we found that, in grapevine plantlets exposed to salt or drought stress, colonization by B. amyloliquefaciens SB-9 increased the upregulation of melatonin synthesis, as well as that of its intermediates, but reduced the upregulation of grapevine tryptophan decaboxylase genes (VvTDCs and a serotonin N-acetyltransferase gene (VvSNAT transcription, when compared to the un-inoculated control. Colonization by B. amyloliquefaciens SB-9 was also able to counteract the adverse effects of salt- and drought-induced stress by reducing the production of malondialdehyde and reactive oxygen species (H2O2 and O2− in roots. Therefore, our findings demonstrate the occurrence of melatonin biosynthesis in endophytic bacteria and provide evidence for a novel form of communication between beneficial endophytes and host plants via melatonin.

  15. Moderate water stress from regulated deficit irrigation decreases transpiration similarly to net carbon exchange in grapevine canopies

    Science.gov (United States)

    To determine the effects of timing and extent of regulated deficit irrigation (RDI) on grapevine (Vitis vinifera) canopies, whole-canopy transpiration (TrV) and canopy conductance to water vapor (gc) were calculated from whole-vine gas exchange near key stages of fruit development. The vines were ma...

  16. Water and salinity stress in grapevines: early and late changes in transcript and metabolite profiles.

    Science.gov (United States)

    Cramer, Grant R; Ergül, Ali; Grimplet, Jerome; Tillett, Richard L; Tattersall, Elizabeth A R; Bohlman, Marlene C; Vincent, Delphine; Sonderegger, Justin; Evans, Jason; Osborne, Craig; Quilici, David; Schlauch, Karen A; Schooley, David A; Cushman, John C

    2007-04-01

    Grapes are grown in semiarid environments, where drought and salinity are common problems. Microarray transcript profiling, quantitative reverse transcription-PCR, and metabolite profiling were used to define genes and metabolic pathways in Vitis vinifera cv. Cabernet Sauvignon with shared and divergent responses to a gradually applied and long-term (16 days) water-deficit stress and equivalent salinity stress. In this first-of-a-kind study, distinct differences between water deficit and salinity were revealed. Water deficit caused more rapid and greater inhibition of shoot growth than did salinity at equivalent stem water potentials. One of the earliest responses to water deficit was an increase in the transcript abundance of RuBisCo activase (day 4), but this increase occurred much later in salt-stressed plants (day 12). As water deficit progressed, a greater number of affected transcripts were involved in metabolism, transport, and the biogenesis of cellular components than did salinity. Salinity affected a higher percentage of transcripts involved in transcription, protein synthesis, and protein fate than did water deficit. Metabolite profiling revealed that there were higher concentrations of glucose, malate, and proline in water-deficit-treated plants as compared to salinized plants. The metabolite differences were linked to differences in transcript abundance of many genes involved in energy metabolism and nitrogen assimilation, particularly photosynthesis, gluconeogenesis, and photorespiration. Water-deficit-treated plants appear to have a higher demand than salinized plants to adjust osmotically, detoxify free radicals (reactive oxygen species), and cope with photoinhibition.

  17. Environmental plasticity of Pinot noir grapevine leaves: A trans-European study of morphological and biochemical changes along a 1,500-km latitudinal climatic gradient

    Czech Academy of Sciences Publication Activity Database

    Castagna, A.; Csepregi, K.; Neugart, S.; Zipoli, G.; Večeřová, Kristýna; Jakab, G.; Jug, T.; Llorens, L.; Martínez-Abaigar, J.; Martínez-Lüscher, J.; Núñez-Olivera, E.; Ranieri, A.; Schoedl-Hummel, K.; Schreiner, M.; Teszlák, P.; Tittmann, S.; Urban, Otmar; Verdaguer, D.; Jansen, M. A. K.; Hideg, É.

    2017-01-01

    Roč. 40, č. 11 (2017), s. 2790-2805 ISSN 0140-7791 R&D Projects: GA MŠk(CZ) LO1415; GA MŠk(CZ) LM2015061 Institutional support: RVO:86652079 Keywords : hydroxycinnamic acid- derivatives * oleracea var. sabellica * uv-b radiation * photosynthetically active radiation * different flavonol glycosides * alpha-tocopherol * arabidopsis-thaliana * phenolic-compounds * ultraviolet-radiation * natural-populations * alpha-tocopherol * carotenoids * climate * global radiation * grapevine * latitude * morphology * phenolic compounds * plasticity * ultraviolet radiation Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 6.173, year: 2016

  18. Abscisic acid biosynthesis in water-stressed leaves

    International Nuclear Information System (INIS)

    Li, Yi.

    1989-01-01

    Although abscisic acid (ABA) was discovered 30 years ago, very little is known about its biosynthetic pathway in higher plants. Two hypotheses have been proposed: (i) a direct pathway involving only C-15 intermediates like farnesyl pyrophosphate, (ii) an indirect pathway involving C-40 intermediates like the xanthophylls. When 14 CO 2 was fed into greened bean plants, the 14 C specific activity of ABA was always lower than those in xanthophylls, such as violaxanthin and lutein, regardless of 12 CO 2 chase periods. The ABA accumulation in green leaves was not affected by fluridone when plants were stressed once, but the 14 C incorporation into ABA was inhibited to the same extent as those of xanthophylls. The incorporation of 18 O into the ABA ring when violaxanthin was labeled by 18 O in vivo via the violaxanthin cycle indicates that at least a portion of ABA was derived from 18 O-labeled violaxanthin during water stress

  19. Abscisic acid biosynthesis in water-stressed leaves

    Energy Technology Data Exchange (ETDEWEB)

    Li, Yi.

    1989-01-01

    Although abscisic acid (ABA) was discovered 30 years ago, very little is known about its biosynthetic pathway in higher plants. Two hypotheses have been proposed: (i) a direct pathway involving only C-15 intermediates like farnesyl pyrophosphate, (ii) an indirect pathway involving C-40 intermediates like the xanthophylls. When {sup 14}CO{sub 2} was fed into greened bean plants, the {sup 14}C specific activity of ABA was always lower than those in xanthophylls, such as violaxanthin and lutein, regardless of {sup 12}CO{sub 2} chase periods. The ABA accumulation in green leaves was not affected by fluridone when plants were stressed once, but the {sup 14}C incorporation into ABA was inhibited to the same extent as those of xanthophylls. The incorporation of {sup 18}O into the ABA ring when violaxanthin was labeled by {sup 18}O in vivo via the violaxanthin cycle indicates that at least a portion of ABA was derived from {sup 18}O-labeled violaxanthin during water stress.

  20. Wild grapevine management

    Science.gov (United States)

    H. Clay Smith

    1989-01-01

    Wild grapevines are a problem for forest managers in many areas of the central hardwood forests. The vines grow on a wide range of soil and site conditions but usually are more concentrated on good sites (northern red oak site index 70 and above), on the faster growing more valuable timber. Presently there is more interest and concern in controlling grapevine for the...

  1. Follow-up of fluorine pollution effect on grapevine

    Directory of Open Access Journals (Sweden)

    Ferjani Ben Abdallah

    2004-12-01

    By another way, our results seem to show that full mature grapevine leaves may constitute an efficient tool to assess fluorine pollution impact. Berries contamination seems to be affected directly by the factory smoke, there is no endogenous supply. Likewise, by its characteristic necrosis in the leaf boundaries, grapevine may be considered as a bioindicator variety of fluorine pollution which can be used in mapping polluted areas.

  2. Violaxanthin is an abscisic acid precursor in water-stressed dark-grown bean leaves

    International Nuclear Information System (INIS)

    Li, Yi; Walton, D.C.

    1990-01-01

    The leaves a dark-grown bean (Phaseolus vulgaris L.) seedlings accumulate considerably lower quantities of xanthophylls and carotenes than do leaves of light-grown seedlings, but they synthesize at least comparable amounts of abscisic acid (ABA) and its metabolites when water stressed. We observed a 1:1 relationship on a molar basis between the reduction in levels of ciolaxanthin, 9'-cis-neoxanthin, and 9-cis-violaxanthin and the accumulation of ABA, phaseic acid, and dihydrophaseic acid, when leaves from dark-grown plants were stressed for 7 hours. Early in the stress period, reductions in xanthophylls were greater than the accumulation of ABA and its metabolites, suggesting the accumulation of an intermediate which was subsequently converted to ABA. Leaves which were detached, but no stressed, did not accumulate ABA nor were their xanthophyll levels reduced. Leaves from plants that had been sprayed with cycloheximido did not accumulate ABA when stressed, nor were their xanthophyll levels reduced significantly. Incubation of dark-grown stressed leaves in an 18 O 2 -containing atmosphere resulted in the synthesis of ABA with levels of 18 O in the carboxyl group that were virtually identical to those observed in light-grown leaves. The results of these experiments indicate that violaxanthin is an ABA precursor in stressed dark-grown leaves, and they are used to suggest several possible pathways from violaxanthin to ABA

  3. Violaxanthin is an abscisic acid precursor in water-stressed dark-grown bean leaves

    Energy Technology Data Exchange (ETDEWEB)

    Li, Yi; Walton, D.C. (State Univ. of New York, Syracuse (USA))

    1990-03-01

    The leaves a dark-grown bean (Phaseolus vulgaris L.) seedlings accumulate considerably lower quantities of xanthophylls and carotenes than do leaves of light-grown seedlings, but they synthesize at least comparable amounts of abscisic acid (ABA) and its metabolites when water stressed. We observed a 1:1 relationship on a molar basis between the reduction in levels of ciolaxanthin, 9{prime}-cis-neoxanthin, and 9-cis-violaxanthin and the accumulation of ABA, phaseic acid, and dihydrophaseic acid, when leaves from dark-grown plants were stressed for 7 hours. Early in the stress period, reductions in xanthophylls were greater than the accumulation of ABA and its metabolites, suggesting the accumulation of an intermediate which was subsequently converted to ABA. Leaves which were detached, but no stressed, did not accumulate ABA nor were their xanthophyll levels reduced. Leaves from plants that had been sprayed with cycloheximido did not accumulate ABA when stressed, nor were their xanthophyll levels reduced significantly. Incubation of dark-grown stressed leaves in an {sup 18}O{sub 2}-containing atmosphere resulted in the synthesis of ABA with levels of {sup 18}O in the carboxyl group that were virtually identical to those observed in light-grown leaves. The results of these experiments indicate that violaxanthin is an ABA precursor in stressed dark-grown leaves, and they are used to suggest several possible pathways from violaxanthin to ABA.

  4. Responce of leaves of three plant species to aluminium stress

    Directory of Open Access Journals (Sweden)

    Agata Konarska

    2012-12-01

    Full Text Available Water culture experiments were undertaken for 14 days to examine the effect of increasing aluminum level (0, 10, 20 40 mg·dm-3 AlCl3·6 H2O on growth of sunflower, red pepper and radish leaves. The early stage of Al toxicity was characterized by curling or rolling of young leaves, marginal and veinal chlorosis, dark green leaves as soon as purpling of margins and veins of leaves. Reduction of leaf size and increased stomata density were observed with increasing Al concentration. Additionally, length of stomata cells decreased after Al-treatment.

  5. The grapevine VvCAX3 is a cation/H+ exchanger involved in vacuolar Ca2+ homeostasis.

    Science.gov (United States)

    Martins, Viviana; Carneiro, Filipa; Conde, Carlos; Sottomayor, Mariana; Gerós, Hernâni

    2017-12-01

    The grapevine VvCAX3 mediates calcium transport in the vacuole and is mostly expressed in green grape berries and upregulated by Ca 2+ , Na + and methyl jasmonate. Calcium is an essential plant nutrient with important regulatory and structural roles in the berries of grapevine (Vitis vinifera L.). On the other hand, the proton-cation exchanger CAX proteins have been shown to impact Ca 2+ homeostasis with important consequences for fruit integrity and resistance to biotic/abiotic stress. Here, the CAX gene found in transcriptomic databases as having one of the highest expressions in grapevine tissues, VvCAX3, was cloned and functionally characterized. Heterologous expression in yeast showed that a truncated version of VvCAX3 lacking its NNR autoinhibitory domain (sCAX3) restored the ability of the yeast strain to grow in 100-200 mM Ca 2+ , demonstrating a role in Ca 2+ transport. The truncated VvCAX3 was further shown to be involved in the transport of Na + , Li + , Mn 2+ and Cu 2+ in yeast cells. Subcellular localization studies using fluorescently tagged proteins confirmed VvCAX3 as a tonoplast transporter. VvCAX3 is expressed in grapevine stems, leaves, roots, and berries, especially at pea size, decreasing gradually throughout development, in parallel with the pattern of calcium accumulation in the fruit. The transcript abundance of VvCAX3 was shown to be regulated by methyl jasmonate (MeJA), Ca 2+ , and Na + in grape cell suspensions, and the VvCAX3 promotor contains several predicted cis-acting elements related to developmental and stress response processes. As a whole, the results obtained add new insights on the mechanisms involved in calcium homeostasis and intracellular compartmentation in grapevine, and indicate that VvCAX3 may be an interesting target towards the development of strategies for enhancement of grape berry properties.

  6. Trocas gasosas em videira sob regime de estresse hídrico. II. fotorrespiração e comportamento varietal Gas exchanges in grapevines under water stress regime. II. photorespiration and varietal behavior

    Directory of Open Access Journals (Sweden)

    Murillo de Albuquerque Regina

    1999-01-01

    Full Text Available Analisou-se a fotorrespiração em folhas de videira (Vitis vinifera L. submetidas a um regime de estresse hídrico, com o objetivo de caracterizar o comportamento de diferentes cultivares. Foram utilizadas plantas de dois anos, enxertadas sobre o porta-enxerto Fercal, plantadas em vasos plásticos e cultivadas em ambiente controlado. A fotorrespiração foi calculada a partir de medidas das trocas gasosas foliares. Os valores absolutos da fotorrespiração variaram pouco entre cultivares e nível de irrigação; já a eficiência da carboxilação e o ponto de compensação ao CO2 foram bastante afetados pelo estresse hídrico, o que revela diferentes níveis de sensibilidade varietal. Foi verificada a ocorrência de inibição não-estomática da fotossíntese, afetando diferencialmente as cultivares analisadas. Destacou-se, ainda, a maior adaptação da Chardonnay às condições de estresse hídrico, em oposição à grande sensibilidade da Sémillon e da Ugni blanc.The photorespiration in grapevines (Vitis vinifera L. leaves subjected to a water stress regime was analysed with the purpose of characterizing the behavior of different cultivars. Two-year old plants were used, grafted on Fercal, planted in plastic pots and cultivated in controlled environment. The photorespiration was calculated from leaf gas exchange measurements taken by means of a portable infrared CO2 analyser (LCA3-ADC, working in an open circuit. The absolute photorespiration values varied little among cultivars and level of irrigation, whereas the carboxylation efficiency and the CO2 compensation point were highly affected by the water stress, thereby evidencing different varietal sensitivity levels. The occurrence of a nonstomatal inhibition of the photosynthesis was verified affecting in a specific way the cultivars analysed. The Chardonnay adapted itself better to the water stress conditions as opposed to the high sensitivity on the part of Sémillon and Ugni blanc.

  7. Stress-related mental disorders with sick leave: a minimal intervention in general practice

    NARCIS (Netherlands)

    Bakker, I.M.

    2007-01-01

    1. Introduction As stated in chapter 1, this study is carried out because patients and their care-givers have much to gain by the development and implementation of effective care for patients on sick leave having stress-related mental disorders (SMDs). Most people having SMDs with sick leave consult

  8. Induction of defence mechanisms in grapevine leaves by emodin- and anthraquinone-rich plant extracts and their conferred resistance to downy mildew.

    Science.gov (United States)

    Godard, Sophie; Slacanin, Ivan; Viret, Olivier; Gindro, Katia

    2009-09-01

    The ability of two plant extracts, Rheum palmatum root extract (RPRE) and Frangula alnus bark extract (FABE), to protect Vitis vinifera leaves from Plasmopara viticola infection was evaluated. These natural products are toxic to the pathogen and induce defence reactions in a susceptible cultivar of V. vinifera (V. vinifera cv. Chasselas), including stilbenic phytoalexin accumulation, enhanced peroxidase (EC 1.11.1.7) activity, and a hypersensitive reaction. Inhibition of the first stage of biotrophic hyphal development of P. Viticola by the two plant extracts was observed. HPLC-DAD-MS analysis showed that these two natural extracts contain many phenolic compounds belonging to the anthraquinone family, such as rhein, frangulin A, emodin, aloe-emodin, chrysophanol, and physcion. Emodin alone is able to impair P. viticola development and to stimulate viniferins and the accumulation of pterostilbene.

  9. Stomatal Responses to Light and Drought Stress in Variegated Leaves of Hedera helix1

    Science.gov (United States)

    Aphalo, Pedro J.; Sánchez, Rodolfo A.

    1986-01-01

    Direct and indirect mechanisms underlying the light response of stomata were studied in variegated leaves of the juvenile phase of Hedera helix L. Dose response curves of leaf conductance were measured with blue and red light in leaves kept in normal or in an inverted position. In the green portions of the leaves, the sensitivity to blue light was nearly 100 times higher than that to red light. No response to red light was observed in the white portions of the leaves up to 90 micromoles per square meter per second. Red light indirectly affected leaf conductance while blue light had a direct effect. Leaf conductance was found to be more sensitive to drought stress and showed a more persistent aftereffect in the white portions of the leaves. A differential effect of drought stress on the responses to blue and red light was also observed. PMID:16664900

  10. Environmental plasticity of Pinot noir grapevine leaves: A trans-European study of morphological and biochemical changes along a 1,500-km latitudinal climatic gradient.

    Science.gov (United States)

    Castagna, Antonella; Csepregi, Kristóf; Neugart, Susanne; Zipoli, Gaetano; Večeřová, Kristýna; Jakab, Gábor; Jug, Tjaša; Llorens, Laura; Martínez-Abaigar, Javier; Martínez-Lüscher, Johann; Núñez-Olivera, Encarnación; Ranieri, Annamaria; Schoedl-Hummel, Katharina; Schreiner, Monika; Teszlák, Péter; Tittmann, Susanne; Urban, Otmar; Verdaguer, Dolors; Jansen, Marcel A K; Hideg, Éva

    2017-11-01

    A 2-year study explored metabolic and phenotypic plasticity of sun-acclimated Vitis vinifera cv. Pinot noir leaves collected from 12 locations across a 36.69-49.98°N latitudinal gradient. Leaf morphological and biochemical parameters were analysed in the context of meteorological parameters and the latitudinal gradient. We found that leaf fresh weight and area were negatively correlated with both global and ultraviolet (UV) radiation, cumulated global radiation being a stronger correlator. Cumulative UV radiation (sumUVR) was the strongest correlator with most leaf metabolites and pigments. Leaf UV-absorbing pigments, total antioxidant capacities, and phenolic compounds increased with increasing sumUVR, whereas total carotenoids and xanthophylls decreased. Despite of this reallocation of metabolic resources from carotenoids to phenolics, an increase in xanthophyll-cycle pigments (the sum of the amounts of three xanthophylls: violaxanthin, antheraxanthin, and zeaxanthin) with increasing sumUVR indicates active, dynamic protection for the photosynthetic apparatus. In addition, increased amounts of flavonoids (quercetin glycosides) and constitutive β-carotene and α-tocopherol pools provide antioxidant protection against reactive oxygen species. However, rather than a continuum of plant acclimation responses, principal component analysis indicates clusters of metabolic states across the explored 1,500-km-long latitudinal gradient. This study emphasizes the physiological component of plant responses to latitudinal gradients and reveals the physiological plasticity that may act to complement genetic adaptations. © 2017 John Wiley & Sons Ltd.

  11. Cadmium stress alters the redox reaction and hormone balance in oilseed rape (Brassica napus L.) leaves.

    Science.gov (United States)

    Yan, Hui; Filardo, Fiona; Hu, Xiaotao; Zhao, Xiaomin; Fu, DongHui

    2016-02-01

    In order to understand the physiological response of oilseed rape (Brassica napus L.) leaves to cadmium (Cd) stress and exploit the physiological mechanisms involved in Cd tolerance, macro-mineral and chlorophyll concentrations, reactive oxygen species (ROS) accumulation, activities of enzymatic antioxidants, nonenzymatic compounds metabolism, endogenous hormonal changes, and balance in leaves of oilseed rape exposed to 0, 100, or 200 μM CdSO4 were investigated. The results showed that under Cd exposure, Cd concentrations in the leaves continually increased while macro-minerals and chlorophyll concentrations decreased significantly. Meanwhile, with increased Cd stress, superoxide anion (O2(• -)) production rate and hydrogen peroxide (H2O2) concentrations in the leaves increased significantly, which caused malondialdehyde (MDA) accumulation and oxidative stress. For scavenging excess accumulated ROS and alleviating oxidative injury in the leaves, the activity of enzymatic antioxidants, such as superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT), was increased significantly at certain stress levels. However, with increased Cd stress, the antioxidant enzyme activities all showed a trend towards reduction. The nonenzymatic antioxidative compounds, such as proline and total soluble sugars, accumulated continuously with increased Cd stress to play a long-term role in scavenging ROS. In addition, ABA levels also increased continuously with Cd stress while ZR decreased and the ABA/ZR ratio increased, which might also be providing a protective role against Cd toxicity.

  12. Women Superintendents Who Leave: Stress and Health Factors

    Science.gov (United States)

    Robinson, Kerry K.; Shakeshaft, Charol

    2015-01-01

    Previous research on stress in the workplace has demonstrated that it can have not only a current, but lasting effect on a worker's health. The superintendency is a stressful job due to all of the competing demands of running a school system, no matter the size. This exploratory study reexamined qualitative interview transcripts from Robinson's…

  13. Carotenoid profiling of leaves of selected eggplant accessions subjected to drought stress

    Science.gov (United States)

    This study focused on the quantification of carotenoids of the leaves of African eggplants commonly consumed as leafy and fruit vegetables. The results gave comparative profiles of carotenoids at different growth and developmental stages and under drought stress. Stress was achieved by limiting irri...

  14. Downy mildew resistance induced by Trichoderma harzianum T39 in susceptible grapevines partially mimics transcriptional changes of resistant genotypes

    Science.gov (United States)

    2012-01-01

    Background Downy mildew, caused by Plasmopara viticola, is one of the most severe diseases of grapevine and is commonly controlled by fungicide treatments. The beneficial microorganism Trichoderma harzianum T39 (T39) can induce resistance to downy mildew, although the molecular events associated with this process have not yet been elucidated in grapevine. A next generation RNA sequencing (RNA-Seq) approach was used to study global transcriptional changes associated with resistance induced by T39 in Vitis vinifera Pinot Noir leaves. The long-term aim was to develop strategies to optimize the use of this agent for downy mildew control. Results More than 14.8 million paired-end reads were obtained for each biological replicate of T39-treated and control leaf samples collected before and 24 h after P. viticola inoculation. RNA-Seq analysis resulted in the identification of 7,024 differentially expressed genes, highlighting the complex transcriptional reprogramming of grapevine leaves during resistance induction and in response to pathogen inoculation. Our data show that T39 has a dual effect: it directly modulates genes related to the microbial recognition machinery, and it enhances the expression of defence-related processes after pathogen inoculation. Whereas several genes were commonly affected by P. viticola in control and T39-treated plants, opposing modulation of genes related to responses to stress and protein metabolism was found. T39-induced resistance partially inhibited some disease-related processes and specifically activated defence responses after P. viticola inoculation, causing a significant reduction of downy mildew symptoms. Conclusions The global transcriptional analysis revealed that defence processes known to be implicated in the reaction of resistant genotypes to downy mildew were partially activated by T39-induced resistance in susceptible grapevines. Genes identified in this work are an important source of markers for selecting novel

  15. Respecting the Grapevine.

    Science.gov (United States)

    Carroll, David J.

    2001-01-01

    Administrators can create word-of-mouth communication that dispels negative attitudes and build good school reputations by discovering what parents and students are saying, targeting employee satisfaction and retention, providing excellent customer service, actively seeking and handling complaints, nurturing champions, and integrating "grapevine"…

  16. Proline accumulation in water-stressed barley leaves in relation to translocation and the nitrogen budget

    International Nuclear Information System (INIS)

    Tully, R.E.; Hanson, A.D.; Nelsen, C.E.

    1979-01-01

    Mobilization of N from leaves of barley (Hordeum vulgare L.) during water stress, and the role of proline as a mobilized species, were examined in plants at the three-leaf stage. The plants responded to water stress by withdrawing about 25% of the total reduced N from the leaf blades via phloem translocation. Most of this N loss was during the first 2 days while translocation of 14 C-photosynthate out of the stressed blade still remained active. Free proline accumulation in the blade was initially slow, and became more rapid during the 2nd day of stress. Although a major free amino acid, proline accounted for only about 5% of the total N(soluble + insoluble) retained in severely stressed blades. When the translocation pathway in water-stressed leaves was interrupted just below the blade by a heat girdle, a cold jacket, or by blade excision, N loss from the blade was prevented and proline began to accumulate rapidly on 1st day of stress. Little free proline accumulated in the blades until after the ability to translocate was lost. Proline was, however, probably not a major species of N translocated during stress, because proline N accumulation in heat-girdled stressed leaves was five times slower than the rate of total N export from intact blades

  17. Tocopherol deficiency reduces sucrose export from salt-stressed potato leaves independently of oxidative stress and symplastic obstruction by callose

    Science.gov (United States)

    Asensi-Fabado, María Amparo; Ammon, Alexandra; Sonnewald, Uwe; Munné-Bosch, Sergi; Voll, Lars M.

    2015-01-01

    Tocopherol cyclase, encoded by the gene SUCROSE EXPORT DEFECTIVE1, catalyses the second step in the synthesis of the antioxidant tocopherol. Depletion of SXD1 activity in maize and potato leaves leads to tocopherol deficiency and a ‘sugar export block’ phenotype that comprises massive starch accumulation and obstruction of plasmodesmata in paraveinal tissue by callose. We grew two transgenic StSXD1:RNAi potato lines with severe tocopherol deficiency under moderate light conditions and subjected them to salt stress. After three weeks of salt exposure, we observed a strongly reduced sugar exudation rate and a lack of starch mobilization in leaves of salt-stressed transgenic plants, but not in wild-type plants. However, callose accumulation in the vasculature declined upon salt stress in all genotypes, indicating that callose plugging of plasmodesmata was not the sole cause of the sugar export block phenotype in tocopherol-deficient leaves. Based on comprehensive gene expression analyses, we propose that enhanced responsiveness of SnRK1 target genes in mesophyll cells and altered redox regulation of phloem loading by SUT1 contribute to the attenuation of sucrose export from salt-stressed SXD:RNAi source leaves. Furthermore, we could not find any indication that elevated oxidative stress may have served as a trigger for the salt-induced carbohydrate phenotype of SXD1:RNAi transgenic plants. In leaves of the SXD1:RNAi plants, sodium accumulation was diminished, while proline accumulation and pools of soluble antioxidants were increased. As supported by phytohormone contents, these differences seem to increase longevity and prevent senescence of SXD:RNAi leaves under salt stress. PMID:25428995

  18. Xanthophylls and abscisic acid biosynthesis in water-stressed bean leaves

    International Nuclear Information System (INIS)

    Li, Y.; Walton, D.C.

    1987-01-01

    Experiments were designed to obtain evidence about the possible role of xanthophylls as abscisic acid (ABA) precursors in water-stressed leaves of Phaseolus vularis L. Leaves were exposed to 14 CO 2 and the specific activities of several major leaf xanthophylls and stress-induced ABA were determined after a chase in 12 CO 2 for varying periods of time. The ABA specific radioactivities were about 30 to 70% of that of lutein and violaxanthin regardless of the chase period. The specific activity of neoxanthin, however, was only about 15% of that of ABA. The effects of fluridone on xanthophyll and ABA levels and the extent of labeling of both from 14 CO 2 were determined. Fluridone did not inhibit the accumulation of ABA when leaves were stressed once, although subsequent stresses in the presence of fluridone did lead to a reduced ABA accumulation. The incorporation of 14 C from 14 CO 2 into ABA and the xanthophylls was inhibited by fluridone and to about the same extent. The incorporation of 18 O into ABA from violaxanthin which had been labeled in situ by means of the violaxanthin cycle was measured. The results indicated that a portion of the ABA accumulated during stress was formed from violaxanthin which had been labeled with 18 O. The results of these experiments are consistent with a preformed xanthophyll(s) as the major ABA precursor in water-stressed bean leaves

  19. Xanthophylls and abscisic acid biosynthesis in water-stressed bean leaves

    Energy Technology Data Exchange (ETDEWEB)

    Li, Y.; Walton, D.C.

    1987-12-01

    Experiments were designed to obtain evidence about the possible role of xanthophylls as abscisic acid (ABA) precursors in water-stressed leaves of Phaseolus vularis L. Leaves were exposed to /sup 14/CO/sub 2/ and the specific activities of several major leaf xanthophylls and stress-induced ABA were determined after a chase in /sup 12/CO/sub 2/ for varying periods of time. The ABA specific radioactivities were about 30 to 70% of that of lutein and violaxanthin regardless of the chase period. The specific activity of neoxanthin, however, was only about 15% of that of ABA. The effects of fluridone on xanthophyll and ABA levels and the extent of labeling of both from /sup 14/CO/sub 2/ were determined. Fluridone did not inhibit the accumulation of ABA when leaves were stressed once, although subsequent stresses in the presence of fluridone did lead to a reduced ABA accumulation. The incorporation of /sup 14/C from /sup 14/CO/sub 2/ into ABA and the xanthophylls was inhibited by fluridone and to about the same extent. The incorporation of /sup 18/O into ABA from violaxanthin which had been labeled in situ by means of the violaxanthin cycle was measured. The results indicated that a portion of the ABA accumulated during stress was formed from violaxanthin which had been labeled with /sup 18/O. The results of these experiments are consistent with a preformed xanthophyll(s) as the major ABA precursor in water-stressed bean leaves.

  20. Betacyanin accumulation and guaiacol peroxidase activity in Beta vulgaris L. leaves following copper stress

    Directory of Open Access Journals (Sweden)

    Janet M. León Morales

    2012-07-01

    Full Text Available The effect of copper stress on betacyanin accumulation and guaiacol peroxidase (GPOD activity in leaves of different age was evaluated in red beet (Beta vulgaris L. var. Crosby Egyptian plants. In hydroponic culture, plants were treated with 0.3 μM (control, 50 μM, 100 μM, and 250 μM of CuSO4 for 6 days. Copper was taken up and accumulated in old roots but was not translocated to leaves. However in young leaves, the increase of lipid peroxidation and reduction of growth were evident from day 3 of copper exposure; whereas in old leaves, the lipid peroxidation and growth were the same from either copper-treated or control plants. In response to copper exposure, the betacyanin accumulation was evident in young leaves by day 3, and continued to increase until day 6. Betacyanin only were accumulated in old leaves until day 6, but the contents were from 4 to 5 times lower than those observed in young leaves at the same copper concentrations. GPOD activity increased 3.3- and 1.4-fold in young and old leaves from day 3 of copper treatment respectively, but only in the young leaves was sustained at the same level until day 6. Old roots shown betacyanin in the control plants, but the betacyanin level and growth were reduced with the copper exposure. In contrast, young roots emerged by copper effect also accumulated copper and showed the highest betacyanin content of all plant parts assayed. These results indicate that betacyanin accumulation and GPOD activity are defense responses to copper stress in actively growing organs.

  1. Transcriptomic analysis of grape (Vitis vinifera L.) leaves during and after recovery from heat stress.

    Science.gov (United States)

    Liu, Guo-Tian; Wang, Jun-Fang; Cramer, Grant; Dai, Zhan-Wu; Duan, Wei; Xu, Hong-Guo; Wu, Ben-Hong; Fan, Pei-Ge; Wang, Li-Jun; Li, Shao-Hua

    2012-09-28

    Grapes are a major fruit crop around the world. Heat stress can significantly reduce grape yield and quality. Changes at the molecular level in response to heat stress and subsequent recovery are poorly understood. To elucidate the effect of heat stress and subsequent recovery on expression of genes by grape leaves representing the classic heat stress response and thermotolerance mechanisms, transcript abundance of grape (Vitis vinifera L.) leaves was quantified using the Affymetrix Grape Genome oligonucleotide microarray (15,700 transcripts), followed by quantitative Real-Time PCR validation for some transcript profiles. We found that about 8% of the total probe sets were responsive to heat stress and/or to subsequent recovery in grape leaves. The heat stress and recovery responses were characterized by different transcriptional changes. The number of heat stress-regulated genes was almost twice the number of recovery-regulated genes. The responsive genes identified in this study belong to a large number of important traits and biological pathways, including cell rescue (i.e., antioxidant enzymes), protein fate (i.e., HSPs), primary and secondary metabolism, transcription factors, signal transduction, and development. We have identified some common genes and heat shock factors (HSFs) that were modulated differentially by heat stress and recovery. Most HSP genes were upregulated by heat stress but were downregulated by the recovery. On the other hand, some specific HSP genes or HSFs were uniquely responsive to heat stress or recovery. The effect of heat stress and recovery on grape appears to be associated with multiple processes and mechanisms including stress-related genes, transcription factors, and metabolism. Heat stress and recovery elicited common up- or downregulated genes as well as unique sets of responsive genes. Moreover, some genes were regulated in opposite directions by heat stress and recovery. The results indicated HSPs, especially small HSPs

  2. Transcriptomic analysis of grape (Vitis vinifera L. leaves during and after recovery from heat stress

    Directory of Open Access Journals (Sweden)

    Liu Guo-Tian

    2012-09-01

    Full Text Available Abstract Background Grapes are a major fruit crop around the world. Heat stress can significantly reduce grape yield and quality. Changes at the molecular level in response to heat stress and subsequent recovery are poorly understood. To elucidate the effect of heat stress and subsequent recovery on expression of genes by grape leaves representing the classic heat stress response and thermotolerance mechanisms, transcript abundance of grape (Vitis vinifera L. leaves was quantified using the Affymetrix Grape Genome oligonucleotide microarray (15,700 transcripts, followed by quantitative Real-Time PCR validation for some transcript profiles. Results We found that about 8% of the total probe sets were responsive to heat stress and/or to subsequent recovery in grape leaves. The heat stress and recovery responses were characterized by different transcriptional changes. The number of heat stress-regulated genes was almost twice the number of recovery-regulated genes. The responsive genes identified in this study belong to a large number of important traits and biological pathways, including cell rescue (i.e., antioxidant enzymes, protein fate (i.e., HSPs, primary and secondary metabolism, transcription factors, signal transduction, and development. We have identified some common genes and heat shock factors (HSFs that were modulated differentially by heat stress and recovery. Most HSP genes were upregulated by heat stress but were downregulated by the recovery. On the other hand, some specific HSP genes or HSFs were uniquely responsive to heat stress or recovery. Conclusion The effect of heat stress and recovery on grape appears to be associated with multiple processes and mechanisms including stress-related genes, transcription factors, and metabolism. Heat stress and recovery elicited common up- or downregulated genes as well as unique sets of responsive genes. Moreover, some genes were regulated in opposite directions by heat stress and recovery

  3. Forest management guidelines for controlling wild grapevines

    Science.gov (United States)

    H. Clay Smith

    1984-01-01

    Grapevines (Vitis spp.) are becoming a major problem to forest managers in the Appalachians, especially when clearcutting is done on highly productive hardwood sites. Where present, grapevines can reduce tree quality and growth, and eventually kill the tree. Silvical characteristics of grapevines are discussed as background for grapevine control....

  4. Comparison of ion balance and nitrogen metabolism in old and young leaves of alkali-stressed rice plants.

    Science.gov (United States)

    Wang, Huan; Wu, Zhihai; Han, Jiayu; Zheng, Wei; Yang, Chunwu

    2012-01-01

    Alkali stress is an important agricultural contaminant and has complex effects on plant metabolism. The aim of this study was to investigate whether the alkali stress has different effects on the growth, ion balance, and nitrogen metabolism in old and young leaves of rice plants, and to compare functions of both organs in alkali tolerance. The results showed that alkali stress only produced a small effect on the growth of young leaves, whereas strongly damaged old leaves. Rice protected young leaves from ion harm via the large accumulation of Na(+) and Cl(-) in old leaves. The up-regulation of OsHKT1;1, OsAKT1, OsHAK1, OsHAK7, OsHAK10 and OsHAK16 may contribute to the larger accumulation of Na(+) in old leaves under alkali stress. Alkali stress mightily reduced the NO(3)(-) contents in both organs. As old leaf cells have larger vacuole, under alkali stress these scarce NO(3)(-) was principally stored in old leaves. Accordingly, the expression of OsNRT1;1 and OsNRT1;2 in old leaves was up-regulated by alkali stress, revealing that the two genes might contribute to the accumulation of NO(3)(-) in old leaves. NO(3)(-) deficiency in young leaves under alkali stress might induce the reduction in OsNR1 expression and the subsequent lacking of NH(4)(+), which might be main reason for the larger down-regulation of OsFd-GOGAT and OsGS2 in young leaves. Our results strongly indicated that, during adaptation of rice to alkali stress, young and old leaves have distinct mechanisms of ion balance and nitrogen metabolism regulation. We propose that the comparative studies of young and old tissues may be important for abiotic stress tolerance research.

  5. Identification of Eutypa lata, a Grapevine Parasite

    Directory of Open Access Journals (Sweden)

    Goran Delibašić

    2006-01-01

    Full Text Available The phytopathogenic fungus Eutypa lata (Pers.: Fr. Tul. and C. Tul., the causing agent of eutypa dieback, has been increasingly often identified in recent times as a cause of grapevine disease. It was first discovered and identified in Australian vineyards (Carter,1973, where it represented one of the most dangerous fungus pathogens of this plant. A few years later it was discovered in European vineyards as well. This polyfagous fungus,known originally as E. armeniaca (Honsf. & Carter, was first discovered on apricot, on which it caused the “gummosis disease”.In Serbia, Eutypa lata has not been determined officially. However, bearing in mind the form of its spreading (anemochory, as well as the fact that our country is a major producer of grape and fruit, we need to pay special attention to this dangerous pathogen since thereare indications that it is already present in our vineyards.During the period between 2003 and 2005, an inspection of a great number of vineyards in the areas of Vršac, Fruška Gora and Kruševac, was conducted. Many of them had grapevines with typical eutypa dieback symptoms. The aim of the inspection was to find grapevines with this disease, to mark them and take samples for laboratory analysis. Marking suspicious grapevines enabled us to monitor the volume of symptoms, as well as other changes on grapevines. Different colours were used for markings, according to the principle “same colour – same year” The procedure revealed that the average periodbetween early and mild disease symptoms and extreme changes, including withering of entire vines, was 2 to 3 years.The signs of eutypa dieback on diseased grapevines are manifested: on leaves in the form of chlorosis, twisting, necrosis of the edges, drying out and falling off; on shoots,where the shortening of internodia is noticable, as well as colour change and “zig-zag” distribution of internodes; on blossoms and clusters, where absence of flowering, partial

  6. 14C-incorporation into sugars and organic acids of water-stressed maize leaves

    International Nuclear Information System (INIS)

    Becker, T.; Fock, H.

    1986-01-01

    The incorporation of 14 C into sugars and some organic acids of maize leaves has been studied in relation to the leaf water potential by feeding 14 CO 2 (370 ppm) for 1,2 and 4 min during steady state photosynthesis at 25 0 C (PAR = 800 μmol m -2 s -1 ). The relative specific radioactivity (RSA) of the sugars was low (0.2% after 4 min) at -0.62 MPa (control) and decreased by about 50% when psi dropped to -0.95 MPa. The authors conclude that the low rate of photosynthetic sugar synthesis in maize leaves decreased during water stress. The RSA of malate was extremely low at -0.62 MPa (0.02%). This result may be the consequence of the large pool size of malate in maize leaves. The authors presume that there are two malate pools present in maize leaves, a small metabolic pool and a larger storage pool. The RSA of malate decreased during the stress period. This is consistent with the decline in net CO 2 uptake during water stress. The pool sizes of citrate and isocitrate increased when psi dropped to -0.95 MPa. As practically no radioactivity was detected in these organic acids, they conclude that these compounds are synthesized from unlabelled precursors during water stress

  7. Protective, curative and eradicative activities of fungicides against grapevine rust

    Directory of Open Access Journals (Sweden)

    Francislene Angelotti

    2014-01-01

    Full Text Available The protective, eradicative and curative activities of the fungicides azoxystrobin, tebuconazole, pyraclostrobin+metiram, and ciproconazole against grapevine rust, were determined in greenhouse. To evaluate the protective activity, leaves of potted ´Niagara´ (Vitis labrusca vines were artificially inoculated with an urediniospore suspension of Phakopsora euvitis four, eight or forteen days after fungicidal spray; and to evaluate the curative and eradicative activities, leaves were sprayed with fungicides two, four or eight days after inoculation. Disease severity was assessed 14 days after each inoculation. All tested fungicides present excellent preventive activity against grapevine rust; however, tebuconazole and ciproconazole provide better curative activity than azoxystrobin and pyraclostrobin+metiram. It was observed also that all tested fungicides significantly reduced the germination of urediniospore produced on sprayed leaves.

  8. Expression profiling on soybean leaves reveals integration of ER- and osmotic-stress pathways

    Directory of Open Access Journals (Sweden)

    Dewey Ralph E

    2007-11-01

    Full Text Available Abstract Background Despite the potential of the endoplasmic reticulum (ER stress response to accommodate adaptive pathways, its integration with other environmental-induced responses is poorly understood in plants. We have previously demonstrated that the ER-stress sensor binding protein (BiP from soybean exhibits an unusual response to drought. The members of the soybean BiP gene family are differentially regulated by osmotic stress and soybean BiP confers tolerance to drought. While these results may reflect crosstalk between the osmotic and ER-stress signaling pathways, the lack of mutants, transcriptional response profiles to stresses and genome sequence information of this relevant crop has limited our attempts to identify integrated networks between osmotic and ER stress-induced adaptive responses. As a fundamental step towards this goal, we performed global expression profiling on soybean leaves exposed to polyethylene glycol treatment (osmotic stress or to ER stress inducers. Results The up-regulated stress-specific changes unmasked the major branches of the ER-stress response, which include enhancing protein folding and degradation in the ER, as well as specific osmotically regulated changes linked to cellular responses induced by dehydration. However, a small proportion (5.5% of total up-regulated genes represented a shared response that seemed to integrate the two signaling pathways. These co-regulated genes were considered downstream targets based on similar induction kinetics and a synergistic response to the combination of osmotic- and ER-stress-inducing treatments. Genes in this integrated pathway with the strongest synergistic induction encoded proteins with diverse roles, such as plant-specific development and cell death (DCD domain-containing proteins, an ubiquitin-associated (UBA protein homolog and NAC domain-containing proteins. This integrated pathway diverged further from characterized specific branches of ER-stress as

  9. [Investigation of the hyperspectral image characteristics of wheat leaves under different stress].

    Science.gov (United States)

    Zhang, Dong-Yan; Zhang, Jing-Cheng; Zhu, Da-Zhou; Wang, Ji-Hua; Luo, Ju-Hua; Zhao, Jin-Ling; Huang, Wen-Jiang

    2011-04-01

    The diagnosis of growing status and vigor of crops under various stresses is an important step in precision agriculture. Hyperspectral imaging technology has the advantage of providing both spectral and spatial information simultaneously, and has become a research hot spot. In the present study, auto-development of the pushbroom imaging spectrometer (PIS) was utilized to collect hyperspectral images of wheat leaves which suffer from shortage of nutrient, pest and disease stress. The hyperspectral cube was processed by the method of pixel average step by step to highlight the spectral characteristics, which facilitate the analysis based on the differences of leaves reflectance. The results showed that the hyperspectra of leaves from different layers can display nutrient differences, and recognize intuitively different stress extent by imaging figures. With the 2 nanometer spectral resolution and millimeter level spatial resolution of PIS, the number of disease spot can be qualitatively calculated when crop is infected with diseases, and, the area of plant disease could also be quantitatively analyzed; when crop suffered from pest and insect, the spectral information of leaves with single aphid and aphids can be detected by PIS, which provides a new means to quantitatively detect the aphid destroying of wheat leaf. The present study demonstrated that hyperspecral imaging has a great potential in quantitative and qualitative analysis of crop growth.

  10. Cuticle ultrastructure, cuticular lipid composition, and gene expression in hypoxia-stressed Arabidopsis stems and leaves.

    Science.gov (United States)

    Kim, Hyojin; Choi, Dongsu; Suh, Mi Chung

    2017-06-01

    An increased permeability of the cuticle is closely associated with downregulation of genes involved in cuticular lipid synthesis in hypoxia-stressed Arabidopsis and may allow plants to cope with oxygen deficiency. The hydrophobic cuticle layer consisting of cutin polyester and cuticular wax is the first barrier to protect the aerial parts of land plants from environmental stresses. In the present study, we investigated the role of cuticle membrane in Arabidopsis responses to oxygen deficiency. TEM analysis showed that the epidermal cells of hypoxia-treated Arabidopsis stems and leaves possessed a thinner electron-translucent cuticle proper and a more electron-dense cuticular layer. A reduction in epicuticular wax crystal deposition was observed in SEM images of hypoxia-treated Arabidopsis stem compared with normoxic control. Cuticular transpiration was more rapid in hypoxia-stressed leaves than in normoxic control. Total wax and cutin loads decreased by approximately 6-12 and 12-22%, respectively, and the levels of C29 alkanes, secondary alcohols, and ketones, C16:0 ω-hydroxy fatty acids, and C18:2 dicarboxylic acids were also prominently reduced in hypoxia-stressed Arabidopsis leaves and/or stems relative to normoxic control. Genome-wide transcriptome and quantitative RT-PCR analyses revealed that the expression of several genes involved in the biosynthesis and transport of cuticular waxes and cutin monomers were downregulated more than fourfold, but no significant alterations were detected in the transcript levels of fatty acid biosynthetic genes, BCCP2, PDH-E1α, and ENR1 in hypoxia-treated Arabidopsis stems and leaves compared with normoxic control. Taken together, an increased permeability of the cuticle is closely associated with downregulation of genes involved in cuticular lipid synthesis in hypoxia-stressed Arabidopsis. The present study elucidates one of the cuticle-related adaptive responses that may allow plants to cope with low oxygen levels.

  11. The role of stress in absenteeism: cortisol responsiveness among patients on long-term sick leave.

    Directory of Open Access Journals (Sweden)

    Henrik B Jacobsen

    Full Text Available OBJECTIVE: This study aimed to (1 See whether increased or decreased variation relate to subjective reports of common somatic and psychological symptoms for a population on long-term sick leave; and (2 See if this pattern in variation is correlated with autonomic activation and psychological appraisal. METHODS: Our participants (n = 87 were referred to a 3.5-week return-to-work rehabilitation program, and had been on paid sick leave >8 weeks due to musculoskeletal pain, fatigue and/or common mental disorders. An extensive survey was completed, addressing socio-demographics, somatic and psychological complaints. In addition, a physician and a psychologist examined the participants, determining baseline heart rate, medication use and SCID-I diagnoses. During the 3.5-week program, the participants completed the Trier Social Stress Test for Groups. Participants wore heart rate monitors and filled out Visual Analogue Scales during the TSST-G. RESULTS: Our participants presented a low cortisol variation, with mixed model analyses showing a maximal increase in free saliva cortisol of 26% (95% CI, 0.21-0.32. Simultaneously, the increase in heart rate and Visual Analogue Scales was substantial, indicating autonomic and psychological activation consistent with intense stress from the Trier Social Stress Test for Groups. CONCLUSIONS: The current findings are the first description of a blunted cortisol response in a heterogeneous group of patients on long-term sick leave. The results suggest lack of cortisol reactivity as a possible biological link involved in the pathway between stress, sustained activation and long-term sick leave.

  12. Selenium alleviates chromium toxicity by preventing oxidative stress in cabbage (Brassica campestris L. ssp. Pekinensis) leaves.

    Science.gov (United States)

    Qing, Xuejiao; Zhao, Xiaohu; Hu, Chengxiao; Wang, Peng; Zhang, Ying; Zhang, Xuan; Wang, Pengcheng; Shi, Hanzhi; Jia, Fen; Qu, Chanjuan

    2015-04-01

    The beneficial role of selenium (Se) in alleviation of chromium (Cr)-induced oxidative stress is well established. However, little is known about the underlying mechanism. The impacts of exogenous Se (0.1mg/L) on Cr(1mg/L)-induced oxidative stress and antioxidant systems in leaves of cabbage (Brassica campestris L. ssp. Pekinensis) were investigated by using cellular and biochemical approaches. The results showed that supplementation of the medium with Se was effective in reducing Cr-induced increased levels of lipid peroxides and superoxide free radicals (O(-)2(·)), as well as increasing activities of superoxide dismutase (SOD) and peroxidase (POD). Meanwhile, 1mg/L Cr induced loss of plasma membrane integrity, growth inhibition, as well as ultrastructural changes of leaves were significantly reversed due to Se supplementation in the medium. In addition, Se application significantly altered the subcellular distribution of Cr which transported from mitochondria, nucleus and the cell-wall material to the soluble fraction and chloroplasts. However, Se application did no significant alteration of Cr effects on osmotic adjustment accumulating products. The study suggested that Se is able to protect leaves of cabbage against Cr toxicity by alleviation of Cr induced oxidative stress, and re-distribution of Cr in the subcellular of the leaf. Furthermore, free radicals, lipid peroxides, activity of SOD and POD, and subcellular distribution of Cr can be considered the efficient biomarkers to indicate the efficiency of Se to detoxification Cr. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. Elimination of Grapevine leafroll associated virus-3, Grapevine rupestris stem pitting associated virus and Grapevine virus A from a Tunisian Cultivar by Somatic Embryogenesis and Characterization of the Somaclones Using Ampelographic Descriptors.

    Science.gov (United States)

    Bouamama-Gzara, Badra; Selmi, Ilhem; Chebil, Samir; Melki, Imene; Mliki, Ahmed; Ghorbel, Abdelwahed; Carra, Angela; Carimi, Francesco; Mahfoudhi, Naima

    2017-12-01

    Prospecting of local grapevine ( Vitis vinifera L.) germplasm revealed that Tunisia possesses a rich patrimony which presents diversified organoleptic characteristics. However, viral diseases seriously affect all local grapevine cultivars which risk a complete extinction. Sanitation programs need to be established to preserve and exploit, as a gene pool, the Tunisian vineyards areas. The presence of the Grapevine leafroll associated virus-3 (GLRaV-3), Grapevine stem pitting associated virus (GRSPaV) and Grapevine virus A (GVA), were confirmed in a Tunisian grapevine cultivar using serological and molecular analyses. The association between GRSPaV and GVA viruses induces more rugose wood symptoms and damages. For this reason the cleansing of the infected cultivar is highly advisable. Direct and recurrent somatic embryos of cv. 'Hencha' were successfully induced from filament, when cultured on Chée and Pool (1987). based-medium, enriched with 2 mg 1 -1 of 2,4-dichlorophenoxyacetic acid and 2.5 mg 1 -1 of Thidiazuron, after 36 weeks of culture. After six months of acclimatization, RT-PCR carried on 50 somaplants confirmed the absence of GVA, GRSPa-V as well as GLRaV-3 viruses in all somaplants. Ampelographic analysis, based on eight OIV descriptors, was carried out on two years acclimated somaplants, compared to the mother plant. Results demonstrated that the shape and contours of 46 somaclones leaves are identical to mother plant leaves and four phenotypically off-type plants were observed. The healthy state of 100% 'Hencha' somaclones and the high percentage of phenotypically true-to-type plants demonstrate that somatic embryogenesis is a promising technique to adopt for grapevine viruses elimination.

  14. Elimination of Grapevine leafroll associated virus-3, Grapevine rupestris stem pitting associated virus and Grapevine virus A from a Tunisian Cultivar by Somatic Embryogenesis and Characterization of the Somaclones Using Ampelographic Descriptors

    Directory of Open Access Journals (Sweden)

    Badra Bouamama-Gzara

    2017-12-01

    Full Text Available Prospecting of local grapevine (Vitis vinifera L. germplasm revealed that Tunisia possesses a rich patrimony which presents diversified organoleptic characteristics. However, viral diseases seriously affect all local grapevine cultivars which risk a complete extinction. Sanitation programs need to be established to preserve and exploit, as a gene pool, the Tunisian vineyards areas. The presence of the Grapevine leafroll associated virus-3 (GLRaV-3, Grapevine stem pitting associated virus (GRSPaV and Grapevine virus A (GVA, were confirmed in a Tunisian grapevine cultivar using serological and molecular analyses. The association between GRSPaV and GVA viruses induces more rugose wood symptoms and damages. For this reason the cleansing of the infected cultivar is highly advisable. Direct and recurrent somatic embryos of cv. ‘Hencha’ were successfully induced from filament, when cultured on Chée and Pool (1987. based-medium, enriched with 2 mg 1−1 of 2,4-dichlorophenoxyacetic acid and 2.5 mg 1−1 of Thidiazuron, after 36 weeks of culture. After six months of acclimatization, RT-PCR carried on 50 somaplants confirmed the absence of GVA, GRSPa-V as well as GLRaV-3 viruses in all somaplants. Ampelographic analysis, based on eight OIV descriptors, was carried out on two years acclimated somaplants, compared to the mother plant. Results demonstrated that the shape and contours of 46 somaclones leaves are identical to mother plant leaves and four phenotypically off-type plants were observed. The healthy state of 100% ‘Hencha’ somaclones and the high percentage of phenotypically true-to-type plants demonstrate that somatic embryogenesis is a promising technique to adopt for grapevine viruses elimination.

  15. Water and Salt Stresses, Kinetin and Protein Synthesis in Tobacco Leaves 1

    Science.gov (United States)

    Ben-Zioni, Aliza; Itai, C.; Vaadia, Y.

    1967-01-01

    The capacity of tobacco (Nicotiana rustica) leaf discs to incorporate l-leucine 14C into proteins was measured. Leaf discs were obtained from plants which experienced soil water depletion, or which were exposed to a saline or osmotic stress in the root medium. The stresses were brief of relatively short duration and water potential did not decrease below 4 bars in the root media. Leaf discs were sampled 2 hours after stress removal, achieved by reirrigation, or replacement of saline and osmotic solutions with normal nutrient solution. Plants were always turgid when leaves were sampled. All stressed tissues showed reduced capacity to incorporate l-leucine 14C into protein. The reduction was about 50% and could not be attributed either to reduced uptake into the discs, or to possible isotopic dilution. Incorporation decreased progressively with leaf age in control discs as well as in stressed leaf discs. At all ages tested, incorporation in stressed discs was lower than that of the control. Full recovery of incorporation capacity in stressed discs was obtained when discs were sampled 72 hours after stress removal but not earlier. Kinetin pretreatment prior to incubation with labelled leucine partially restored incorporation in stressed discs. The differences in response to kinetin of stressed and control discs suggest a lower endogenous level of cytokinins in the stressed discs. The results were qualitatively similar regardless of the kind of stress given to the plants during pretreatment. This supports the hypothesis that the normal supply of root cytokinins is important in shoot metabolism. PMID:16656515

  16. Exogenous calcium alleviates low night temperature stress on the photosynthetic apparatus of tomato leaves.

    Directory of Open Access Journals (Sweden)

    Guoxian Zhang

    Full Text Available The effect of exogenous CaCl2 on photosystem I and II (PSI and PSII activities, cyclic electron flow (CEF, and proton motive force of tomato leaves under low night temperature (LNT was investigated. LNT stress decreased the net photosynthetic rate (Pn, effective quantum yield of PSII [Y(II], and photochemical quenching (qP, whereas CaCl2 pretreatment improved Pn, Y(II, and qP under LNT stress. LNT stress significantly increased the non-regulatory quantum yield of energy dissipation [Y(NO], whereas CaCl2 alleviated this increase. Exogenous Ca2+ enhanced stimulation of CEF by LNT stress. Inhibition of oxidized PQ pools caused by LNT stress was alleviated by CaCl2 pretreatment. LNT stress reduced zeaxanthin formation and ATPase activity, but CaCl2 pretreatment reversed both of these effects. LNT stress caused excess formation of a proton gradient across the thylakoid membrane, whereas CaCl2 pretreatment decreased the said factor under LNT. Thus, our results showed that photoinhibition of LNT-stressed plants could be alleviated by CaCl2 pretreatment. Our findings further revealed that this alleviation was mediated in part by improvements in carbon fixation capacity, PQ pools, linear and cyclic electron transports, xanthophyll cycles, and ATPase activity.

  17. Carbon Accumulation during Photosynthesis in Leaves of Nitrogen- and Phosphorus-Stressed Cotton.

    Science.gov (United States)

    Radin, J W; Eidenbock, M P

    1986-11-01

    Leaves of cotton (Gossypium hirsutum L.) accumulate considerable dry mass per unit area during photosynthesis. The percentage of C in that accumulated dry mass was estimated as the regression coefficient (slope) of a linear regression relating C per unit area to total dry mass per unit area. Plants were grown on full nutrients or on N- or P-deficient nutrient solutions. In the fully nourished controls, the mass that accumulated over a 9-hour interval beginning at dawn contained 38.6% C. N and P stress increased the C concentration of accumulated mass to 49.7% and 45.1%, respectively. Nutrient stress also increased the starch concentration of accumulated mass, but starch alone could not account for the differences in C concentration. P stress decreased the estimated rate of C export from source leaves, calculated as the difference between C assimilation and C accumulation. The effect of P stress on apparent export was very sensitive to the C concentration used in the calculation, and would not have been revealed with an assumption of unchanged C concentration in the accumulated mass.

  18. Investigation of drought stress in pepino (solanum muricatum ait. cv. miskl) leaves

    International Nuclear Information System (INIS)

    Duman, S.; Sivaci, A.

    2015-01-01

    In this study, the effects of drought stress on pepino seedlings (Solanum muricatum cv. Miski) under natural greenhouse conditions were examined. The control plants were watered at field capacity, and the stress group was not watered. Samples were collected on the 6th, 12th, 24th and 36th days from the leaves of S. muricatum seedlings that, were exposed to drought stress. The relative water content, the total phenolic compounds, and the malondialdehyde, total photosynthetic pigments (chlorophyll a, chlorophyll b and carotenoids), and proline contents in these samples were determined. Depending on drought stress, the relative water content, the chlorophyll a, chlorophyll b and carotenoid contents, and the total chlorophylls were found to be lower in the stress group compared with the control group. In contrast, the total phenolic compounds (24th and 36th days) and the proline (12th, 24th and 36th days) levels increased significantly compared with the control group. In addition, a significant increase in the malondialdehyde contents was obtained on the 36th day in the stress group compared with the control group. Such studies may be important for evaluation of metabolic changes in pepino under the drought stress. (author)

  19. From job stress to intention to leave among hospital nurses: A structural equation modelling approach.

    Science.gov (United States)

    Lo, Wen-Yen; Chien, Li-Yin; Hwang, Fang-Ming; Huang, Nicole; Chiou, Shu-Ti

    2018-03-01

    The aim of this study was to examine the structural relationships linking job stress to leaving intentions through job satisfaction, depressed mood and stress adaptation among hospital nurses. High turnover among nurses is a global concern. Structural relationships linking job stress to leaving intentions have not been thoroughly examined. Two nationwide cross-sectional surveys of full-time hospital staff in 2011 and 2014. The study participants were 26,945 and 19,386 full-time clinical nurses in 2011 and 2014 respectively. Structural equation modelling was used to examine the interrelationships among the study variables based on the hypothesized model. We used cross-validation procedures to ensure the stability and validity of the model in the two samples. There were five main paths from job stress to intention to leave the hospital. In addition to the direct path, job stress directly affected job satisfaction and depressed mood, which in turn affected intention to leave the hospital. Stress adaptation mitigated the effects of job stress on job satisfaction and depressed mood, which led to intention to leave the hospital. Intention to leave the hospital preceded intention to leave the profession. Those variables explained about 55% of the variance in intention to leave the profession in both years. The model fit was good for both samples, suggesting validity of the model. Strategies to decrease turnover intentions among nurses could focus on creating a less stressful work environment, increasing job satisfaction and stress adaptation and decreasing depressed mood. Hospitals should cooperate in this issue to decrease nurse turnover. © 2017 John Wiley & Sons Ltd.

  20. Teor de açúcares solúveis e insolúveis em folhe de videiras, cv. syrah, em diferentes posições no ramo e épocas do ano Soluble and insoluble sugars content in cv. syrah grapevine leaves in different positions of the branch and seasons

    Directory of Open Access Journals (Sweden)

    Bárbara França Dantas

    2007-04-01

    Full Text Available Com o crescimento da área cultivada de videira para produção de vinho, tem aumentado a demanda por pesquisas para a região semi-árida do Brasil que resultem no desenvolvimento da viticultura no Vale do São Francisco. Todos os produtos da videira, como uva, vinho, passas, vinagre, têm origem nos açúcares que são produzidos nas folhas durante a fotossíntese e transportados, tanto para os frutos, na época de produção, como para troncos, raízes, folhas não expandidas na fase vegetativa. O objetivo deste trabalho é avaliar a influência da posição no ramo e da variação sazonal no teor de açúcares solúveis e insolúveis nas folhas em videiras para vinho (Vitis vinifera L., cv. Syrah, no Vale do São Francisco. Para tanto, o trabalho foi realizado em um vinhedo comercial e no Laboratório de Sementes/ Fisiologia Vegetal da Embrapa Semi-Árido. A partir dos resultados observados, conclui-se que os açúcares são produzidos em maior quantidade, a partir da quinta folha expandida e acumulam-se em folhas próximas aos cachos. O acúmulo de açúcares nas folhas aumenta após o início da maturação; no entanto, é fortemente influenciado pela temperatura, insolação e radiação.Due to the growth of grapevines cultivated areas for wine production, the requirement for viticulture researches have increased for the Brazilian semi-arid region, that could result in a great development of the viticulture at São Francisco River Valley. All commercialized products of the grapevine, as grape, wine, raisin, vinegar, have their origin in the sugars which are produced in leaves during photosynthesis and transported, in production time, to fruits, trunks, roots and leaves which do not expand in vegetative phase. The objective of this work was to evaluate the influence of the branch position and the seasonal variations in the content of soluble and insoluble sugars in 'Syrah' grapevine for wine production, cultivated at São Francisco River

  1. Global gene expression in cotton (Gossypium hirsutum L. leaves to waterlogging stress.

    Directory of Open Access Journals (Sweden)

    Yanjun Zhang

    Full Text Available Cotton is sensitive to waterlogging stress, which usually results in stunted growth and yield loss. To date, the molecular mechanisms underlying the responses to waterlogging in cotton remain elusive. Cotton was grown in a rain-shelter and subjected to 0 (control-, 10-, 15- and 20-d waterlogging at flowering stage. The fourth-leaves on the main-stem from the top were sampled and immediately frozen in liquid nitrogen for physiological measurement. Global gene transcription in the leaves of 15-d waterlogged plants was analyzed by RNA-Seq. Seven hundred and ninety four genes were up-regulated and 1018 genes were down-regulated in waterlogged cotton leaves compared with non-waterlogged control. The differentially expressed genes were mainly related to photosynthesis, nitrogen metabolism, starch and sucrose metabolism, glycolysis and plant hormone signal transduction. KEGG (Kyoto Encyclopedia of Genes and Genomes analysis indicated that most genes related to flavonoid biosynthesis, oxidative phosphorylation, amino acid metabolism and biosynthesis as well as circadian rhythm pathways were differently expressed. Waterlogging increased the expression of anaerobic fermentation related genes, such as alcohol dehydrogenase (ADH, but decreased the leaf chlorophyll concentration and photosynthesis by down-regulating the expression of photosynthesis related genes. Many genes related to plant hormones and transcription factors were differently expressed under waterlogging stress. Most of the ethylene related genes and ethylene-responsive factor-type transcription factors were up-regulated under water-logging stress, suggesting that ethylene may play key roles in the survival of cotton under waterlogging stress.

  2. General properties of grapevine viruses occurring in Hungary

    OpenAIRE

    Eszter Cseh; András Takács; László Kocsis; Richard Gáborjányi

    2012-01-01

    The past fifty years important advances have been made in the field of grapevine virus research, including characterization of pathogens and control measurements. Still the occurrence of Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Tomato black ring virus (TBRV), Grapevine chrome mosaic virus (GCMV), Alfalfa mosaic virus (AMV), Grapevine Bulgarian latent virus (GBLV), Grapevine fleck virus (GFkV), Grapevine leafroll- associated viruses (GLRaV1-4), Grapevine virus A (GVA), Grape...

  3. Aplicação foliar de nitrogênio em videira: avaliação do teor na folha e das reservas nitrogenadas e de carboidratos nas gemas dos ramos do ano Nitrogen foliar spraying in grapevine: content in leaves and reserve of nitrogen and carboihydrates in shoots buds

    Directory of Open Access Journals (Sweden)

    Gustavo Brunetto

    2008-12-01

    Full Text Available No Rio Grande do Sul (RS, as aplicações foliares de nitrogênio, quando necessárias, têm sido usadas para complementar a adubação via solo. Entretanto, carece-se de informações dos efeitos da freqüência e da quantidade de N aplicado sobre a sua dinâmica na folha e de reservas nitrogenadas e de carboidratos nas partes perenes da videira, que compõem o objetivo deste trabalho. O trabalho foi conduzido em um vinhedo da cultivar Chenin Blanc, safra 2004/05, na Embrapa Uva e Vinho, em Bento Gonçalves (RS, sobre um Neossolo Litólico. Os tratamentos consistiram de uma, duas e três aplicações foliares de 0 (água; 1,11; 2,23; 3,31 e 4,41g de N planta-1. Após cada aplicação de nitrogênio, foram coletadas folhas inteiras (limbo+pecíolo no terço médio dos ramos do ano, no interior e exterior dos diferentes lados da planta, secas, moídas e preparadas para a análise de N total. Na última época de coleta de folhas, foram coletados três ramos do ano em cada planta, retiradas seis gemas em cada ramo, as quais foram submetidas à análise de amido, carboidratos solúveis totais, carboidratos redutores, aminoácidos totais e proteínas totais. As aplicações foliares de N aumentaram o teor do nutriente na folha inteira, de forma destacada, nas épocas de coletas próximas às aplicações; entretanto, essas aplicações diminuíram os teores de amido e carboidratos solúveis totais nas gemas dos ramos do ano e não afetaram os teores de carboidratos redutores e os totais de aminoácidos e proteínas.Leaf nitrogen application is used in grapevines in Southern Brazil as complement to soil fertilization. On the other hand, there is no information about its affects on nitrogen content in the leaves and nitrogen and carbohydrates reserves in the perennial parts. The experiment was carried out in 2004/2005, with the objective to evaluate the effect of nitrogen foliar spraying on leaves and nitrogen and carbohydrates reserves in shoots buds

  4. Effect of heavy metal stress on the catalase activity and expression of isozymes in the leaves of rice seedling

    International Nuclear Information System (INIS)

    Ge Cailin; Yang Xiaoyong; Zhu Hongxia; Wang Zegang; Luo Shishi; Ma Fei; Sun Jinhe

    2002-01-01

    The effect of heavy metal stress on the catalase (CAT) activity and expression of isozymes in the leaves of rice (Wuyujing, Yangdao 6, Shanyou 818) seedling was measured and analyzed. The results showed as follows. (1) When the concentration of Cu, Cd and Hg was in the range of 0.05-2.0 mM, the CAT activity decreased continuously with the concentration of Cu and Cd increasing. However, with the concentration of Hg increasing the CAT activity rapidly decreased first, and then increased slightly, and again decreased obviously, indicating that the Cu, Cd and Hg of 0.05-2.0 mM inhibited the CAT activity in the leaves of rice seedling. (2) The results by using polyacrylamide concentration gradient gel electrophoresis technique to analyze the CAT isozymes indicated that, on the normal condition, there were 1 to 2 CAT isozymes being expressed in the rice leaves (2 CAT isozymes being expressed in Wuyujing leaves, 1 CAT isozymes in Yangdao 6 and Shanyou 818 leaves). 0.1 mM Cd stress induced Wuyujing leaves to express 1 new CAT isozymes, 0.1 mM Cd and Hg stress also induced Yangdao 6 leaves to express 1 new CAT isozymes, but the expression of CAT isozymes, which were expressed in normal condition, were inhibited by Cu, Cd and Hg stress

  5. Nitrogen metabolism in a grapevine in vitro system

    Directory of Open Access Journals (Sweden)

    Nuria Llorens

    2002-09-01

    Full Text Available Ammonium, nitrate, nitrite, protein and individual and total amino acid contents were determined in grapevine (cv Sauvignon cultured in vitro. The enzyme activities of nitrate and nitrite reductases, glutamine synthetase, glutamate synthetase and dehydrogenase were also determined. The nitrogen taken up by the plants was 70% of the total nitrogen in the medium after 75 days of in vitro culture. Most of the nitrogen taken up was recovered in the leaves, yet only ammonia and amino acid concentrations were significantly higher in leaves. In roots, glutamine was the most abundant amino acid. In leaves, the most abundant amino acids were aspartate, glutamate, glutamine, alanine, arginine and g-aminobutirate. All enzyme activities were higher in roots than in leaves. These results suggest that both roots and leaves incorporate inorganic nitrogen into organic forms.

  6. Estimation of water content in the leaves of fruit trees using infra-red images

    International Nuclear Information System (INIS)

    Muramatsu, N.; Hiraoka, K.

    2006-01-01

    A method was developed to evaluate water contents of fruit trees using infra-red photography. The irrigation of potted satsuma mandarin trees and grapevines was suppressed to induce water stress. During the drought treatment the leaf edges of basal parts of the shoots of grapevines became necrotic and the area of necrosis extended as the duration of stress increased. Necrosis was clearly distinguished from the viable areas on infra-red images. In satsuma mandarin, an abscission layer formed at the basal part of the petiole, then the leaves fell. Thus, detailed analysis was indispensable for detecting of the leaf water content. After obtaining infra-red images of satsuma mandarin leaves with or without water stress, a background treatment (subtraction of the background image) was performed on the images, then the average brightness of the leaf was determined using image analyzing software (Image Pro-plus). Coefficient correlation between the water status index using the infra-red camera and water content determined from dry weight and fresh weight of leaves was significant (r = 0.917 for adaxial surface data and r = 0.880 for abaxial surface data). These data indicate that infra-red photography is useful for detecting the degree of plant water stress

  7. [Effects of water stress and temperature on gas exchange and chlorophyll fluorescence of Sinocalycanthus chinensis leaves].

    Science.gov (United States)

    Ke, Shi-sheng; Jin, Ze-xin

    2008-01-01

    Sinocalycanthus chinensis is an endangered species in Sinocalycanthus, and only distributed in Zhejiang Province of China. This paper studied the photosynthetic responses of 2-year-old pot-cultured S. chinensis to different levels of water stress and temperature. The results indicated that under mild and moderate water stress, the net photosynthetic rate (Pn) of S. chinensis leaves was decreased to 92.3% and 74.3% of the control, respectively, which was mainly attributed to stomatal limitation; and under severe water stress, the Pn was decreased to 44.4% of the control, which might be mainly linked to non-stomatal limitation. The appropriate temperature for S. chinensis photosynthesis was from 20 degrees C to 28 degrees C. At 39 degrees C, the Pn, water use efficiency (WUE), and maximal photochemistry efficiency (Fv/Fm) were decreased significantly, while the dark respiration rate (Rd) and transpiration rate (Tr) were enhanced significantly. With increasing water stress and temperature, some photosynthetic parameters including light saturation point (LSP), apparent quantum yield (AQY) and maximal CO2 assimilation rate (Pmax) decreased to certain extents, while light compensation point (LCP) increased, suggesting that both severe water stress and higher temperature were the important environmental factors affecting the survival of S. chinensis.

  8. Pyrosequencing detects human and animal pathogenic taxa in the grapevine endosphere.

    Science.gov (United States)

    Yousaf, Sohail; Bulgari, Daniela; Bergna, Alessandro; Pancher, Michael; Quaglino, Fabio; Casati, Paola; Campisano, Andrea

    2014-01-01

    Generally, plants are not considered as hosts for human and animal pathogens (HAP). The recent produce-associated outbreaks of food-borne diseases have drawn attention toward significant deficiencies in our understanding of the ecology of HAP, and their potential for interkingdom transfer. To examine the association of microorganisms classified as HAP with plants, we surveyed the presence and distribution of HAP bacterial taxa (henceforth HAPT, for brevity's sake) in the endosphere of grapevine (Vitis vinifera L.) both in the plant stems and leaves. An enrichment protocol was used on leaves to detect taxa with very low abundance in undisturbed tissues. We used pyrosequencing and phylogenetic analyses of the 16S rDNA gene. We identified several HAPT, and focused on four genera (Propionibacterium, Staphylococcus, Clostridium, and Burkholderia). The majority of the bacterial sequences in the genus Propionibacterium, from grapevine leaf and stem, were identified as P. acnes. Clostridia were detected in leaves and stems, but their number was much higher in leaves after enrichment. HAPT were indentified both in leaves and wood of grapevines. This depicts the ability of these taxa to be internalized within plant tissues and maintain their population levels in a variety of environments. Our analysis highlighted the presence of HAPT in the grapevine endosphere and unexpected occurrence of these bacterial taxa in this atypical environment.

  9. Effect of iron deficiency stress on leaves movements and electrical potentials in mimosa (Mimosa pudica L.

    Directory of Open Access Journals (Sweden)

    Edward Ślesak

    2014-01-01

    Full Text Available The aim of the studies was to trace the motorical and electrical activity of the mimosa (Mimosa pudica L. grown under conditions of iron deficiency. The speed of leaf folding was measured (motorical activity and the action potential induced with thermic and light stimuli and turgorin (electrical activity was recorded. It was found that the iron deficiency caused acidification of medium and the maximum of the process coincided with the period when the young leaves were turning green. Chlorotic mimosa leaves, not detached from the plant, showed an increased motorical activity. Motorical and electrical activity of the leaves were inhibited by an inhibitor of the plasmalemma redox systems - quinacrine, and stimulated by blue light. Leaf movement factor - turgorin - caused a hypersensitivity of chlorotic plants. It follows from the studies that the observed effects resulted from the adaptation of mimosa to the iron stress. The adaptation was a result of formation of new plasmalemma redox systems (turbo-reductase, responsible for maintaining high energy levels in the cells.

  10. Biotechnology of temperate fruit trees and grapevines.

    Science.gov (United States)

    Laimer, Margit; Mendonça, Duarte; Maghuly, Fatemeh; Marzban, Gorji; Leopold, Stephan; Khan, Mahmood; Balla, Ildiko; Katinger, Hermann

    2005-01-01

    Challenges concerning fruit trees and grapevines as long lived woody perennial crops require adapted biotechnological approaches, if solutions are to be found within a reasonable time frame. These challenges are represented by the need for correct identification of genetic resources, with the foreseen use either in conservation or in breeding programmes. Molecular markers provide most accurate information and will be the major solution for questions about plant breeders rights. Providing healthy planting material and rapid detection of newly introduced pathogens by reliable methods involving serological and molecular biological tools will be a future challenge of increases importance, given the fact that plant material travels freely in the entire European Union. But also new breeding goals and transgenic solutions are part of the biotechnological benefits, e.g. resistance against biotic and abiotic stress factors, modified growth habits, modified nutritional properties and altered processing and storage qualities. The successful characterization of transgenic grapevines and stone fruit trees carrying genes of viral origin in different vectors constructed under ecological consideration, will be presented. Beyond technical feasibility, efficiency of resistance, environmental safety and Intellectual Property Rights, also public acceptance needs consideration and has been addressed in a specific project. The molecular determination of internal quality parameters of food can also be addressed by the use of biotechnological tools. Patient independent detection tools for apple allergens have been developed and should allow to compare fruits from different production systems, sites, and genotypes for their content of health threatening compounds.

  11. Unraveling uranium induced oxidative stress related responses in Arabidopsis thaliana seedlings. Part II: responses in the leaves and general conclusions

    Energy Technology Data Exchange (ETDEWEB)

    Vanhoudt, Nathalie, E-mail: nvanhoud@sckcen.be [Belgian Nuclear Research Center (SCK-CEN), Biosphere Impact Studies, Boeretang 200, 2400 Mol (Belgium); Hasselt University, Environmental Biology, Centre for Environmental Sciences, Agoralaan Building D, 3590 Diepenbeek (Belgium); Cuypers, Ann [Hasselt University, Environmental Biology, Centre for Environmental Sciences, Agoralaan Building D, 3590 Diepenbeek (Belgium); Horemans, Nele [Belgian Nuclear Research Center (SCK-CEN), Biosphere Impact Studies, Boeretang 200, 2400 Mol (Belgium); Remans, Tony; Opdenakker, Kelly; Smeets, Karen [Hasselt University, Environmental Biology, Centre for Environmental Sciences, Agoralaan Building D, 3590 Diepenbeek (Belgium); Bello, Daniel Martinez [Hasselt University, Interuniversity Institute for Biostatistics and Statistical Bioinformatics, Agoralaan Building D, 3590 Diepenbeek (Belgium); Havaux, Michel [Commissariat a l' Energie Atomique (CEA)/Cadarache, Direction des Sciences du Vivant, Departement d' Ecophysiologie Vegetale et de Microbiologie, Laboratoire d' Ecophysiologie de la Photosynthese, 13108 Saint-Paul-lez-Durance (France); Wannijn, Jean; Van Hees, May [Belgian Nuclear Research Center (SCK-CEN), Biosphere Impact Studies, Boeretang 200, 2400 Mol (Belgium); Vangronsveld, Jaco [Hasselt University, Environmental Biology, Centre for Environmental Sciences, Agoralaan Building D, 3590 Diepenbeek (Belgium); Vandenhove, Hildegarde [Belgian Nuclear Research Center (SCK-CEN), Biosphere Impact Studies, Boeretang 200, 2400 Mol (Belgium)

    2011-06-15

    The cellular redox balance seems an important modulator under heavy metal stress. While for other heavy metals these processes are well studied, oxidative stress related responses are also known to be triggered under uranium stress but information remains limited. This study aimed to further unravel the mechanisms by which plants respond to uranium stress. Seventeen-day-old Arabidopsis thaliana seedlings, grown on a modified Hoagland solution under controlled conditions, were exposed to 0, 0.1, 1, 10 and 100 {mu}M uranium for 1, 3 and 7 days. While in Part I of this study oxidative stress related responses in the roots were discussed, this second Part II discusses oxidative stress related responses in the leaves and general conclusions drawn from the results of the roots and the leaves will be presented. As several responses were already visible following 1 day exposure, when uranium concentrations in the leaves were negligible, a root-to-shoot signaling system was suggested in which plastids could be important sensing sites. While lipid peroxidation, based on the amount of thiobarbituric acid reactive compounds, was observed after exposure to 100 {mu}M uranium, affecting membrane structure and function, a transient concentration dependent response pattern was visible for lipoxygenase initiated lipid peroxidation. This transient character of uranium stress responses in leaves was emphasized by results of lipoxygenase (LOX2) and antioxidative enzyme transcript levels, enzyme capacities and glutathione concentrations both in time as with concentration. The ascorbate redox balance seemed an important modulator of uranium stress responses in the leaves as in addition to the previous transient responses, the total ascorbate concentration and ascorbate/dehydroascorbate redox balance increased in a concentration and time dependent manner. This could represent either a slow transient response or a stable increase with regard to plant acclimation to uranium stress

  12. Proteome dynamics and physiological responses to short-term salt stress in Leymus chinensis leaves.

    Directory of Open Access Journals (Sweden)

    Jikai Li

    Full Text Available Salt stress is becoming an increasing threat to global agriculture. In this study, physiological and proteomics analysis were performed using a salt-tolerant grass species, Leymus chinensis (L. chinensis. The aim of this study is to understand the potential mechanism of salt tolerance in L. chinensis that used for crop molecular breeding. A series of short-term (<48 h NaCl treatments (0 ~ 700 mM were conducted. Physiological data indicated that the root and leaves growth were inhibited, chlorophyll contents decreased, while hydraulic conductivity, proline, sugar and sucrose were accumulated under salt stress. For proteomic analysis, we obtained 274 differentially expressed proteins in response to NaCl treatments. GO analysis revealed that 44 out of 274 proteins are involved in the biosynthesis of amino acids and carbon metabolism. Our findings suggested that L. chinensis copes with salt stress by stimulating the activities of POD, SOD and CAT enzymes, speeding up the reactions of later steps of citrate cycle, and synthesis of proline and sugar. In agreement with our physiological data, proteomic analysis also showed that salt stress depress the expression of photosystem relevant proteins, Calvin cycle, and chloroplast biosynthesis.

  13. Grapevine fatty acid hydroperoxide lyase generates actin-disrupting volatiles and promotes defence-related cell death

    Science.gov (United States)

    Wang, Hao; Claudel, Patricia; Riemann, Michael; Hause, Bettina; Hugueney, Philippe; Nick, Peter

    2018-01-01

    Abstract Fatty acid hydroperoxides can generate short-chained volatile aldehydes that may participate in plant defence. A grapevine hydroperoxide lyase (VvHPL1) clustering to the CYP74B class was functionally characterized with respect to a role in defence. In grapevine leaves, transcripts of this gene accumulated rapidly to high abundance in response to wounding. Cellular functions of VvHPL1 were investigated upon heterologous expression in tobacco BY-2 cells. A C-terminal green fluorescent protein (GFP) fusion of VvHPL1 was located in plastids. The overexpression lines were found to respond to salinity stress or the bacterial elicitor harpin by increasing cell death. This signal-dependent mortality response was mitigated either by addition of exogenous jasmonic acid or by treatment with diphenyleneiodonium (DPI), an inhibitor of NADPH oxidases. By feeding different substrates to recombinantly expressed enzyme, VvHPL1 could also be functionally classified as true 13-HPL. The cognate products generated by this 13-HPL were cis-3-hexenal and trans-2-hexenal. Using a GFP-tagged actin marker line, one of these isomeric products, cis-3-hexenal, was found specifically to elicit a rapid disintegration of actin filaments. This response was not only observed in the heterologous system (tobacco BY-2), but also in a grapevine cell strain expressing this marker, as well as in leaf discs from an actin marker grape used as a homologous system. These results are discussed in the context of a role for VvHPL1 in a lipoxygenase-dependent signalling pathway triggering cell death-related defence that bifurcates from jasmonate-dependent basal immunity. PMID:29659985

  14. General properties of grapevine viruses occurring in Hungary

    Directory of Open Access Journals (Sweden)

    Eszter Cseh

    2012-03-01

    Full Text Available The past fifty years important advances have been made in the field of grapevine virus research, including characterization of pathogens and control measurements. Still the occurrence of Grapevine fanleaf virus (GFLV, Arabis mosaic virus (ArMV, Tomato black ring virus (TBRV, Grapevine chrome mosaic virus (GCMV, Alfalfa mosaic virus (AMV, Grapevine Bulgarian latent virus (GBLV, Grapevine fleck virus (GFkV, Grapevine leafroll- associated viruses (GLRaV1-4, Grapevine virus A (GVA, Grapevine virus B (GVB and Grapevine rupestris stem pitting- associated virus (GRSPaV have been reported in Hungary and characterized by conventional methods as woody indexing, herbaceous indexing and serological methods. Among grapevine viruses the Grapevine line pattern virus (GLPV seems to be uncial; because it was reported only in Hungary. Causal agents of several grapevine diseases, like enation, vein necrosis and vein mosaic remained undiscovered. These virus-like diseases occurred only sporadically, without economic importance.

  15. Grapevine fruiting cuttings: validation of an experimental system to study grapevine physiology. I. Main vegetative characteristics

    Directory of Open Access Journals (Sweden)

    Nathalie Ollat

    1998-03-01

    Full Text Available A method for producing fruiting cuttings of grapevine cv. Cabernet Sauvignon is described. The main developmental features of these cuttings are presented. The clusters reach maturity after 5 months and the period of cluster development is not shortened. Before flowering, a careful control of stem and leaf growth improves the partitioning of stored carbon towards the roots and the cluster. Vegetative growth occurs mainly between fruit set and veraison. During ripening, the leaf to fruit ratio is between 20 and 30 cm2 of leaf area per gram of fruit. In the cuttings as well as in grapevines from the vineyard, free polyamine content in the leafblade does not change during development. Conjugate polyamine content does not evolve in the same way. It peaks at veraison for vineyard leaves but decreases continuously for cuttings. A proper nutrient solution provides a minerai composition in accordance with viticultural requirements. The cuttings also behave like vineyard plants in response to different levels of potassium in the nutrient solution.

  16. Unraveling uranium induced oxidative stress related responses in Arabidopsis thaliana seedlings. Part II: responses in the leaves and general conclusions.

    Science.gov (United States)

    Vanhoudt, Nathalie; Cuypers, Ann; Horemans, Nele; Remans, Tony; Opdenakker, Kelly; Smeets, Karen; Bello, Daniel Martinez; Havaux, Michel; Wannijn, Jean; Van Hees, May; Vangronsveld, Jaco; Vandenhove, Hildegarde

    2011-06-01

    The cellular redox balance seems an important modulator under heavy metal stress. While for other heavy metals these processes are well studied, oxidative stress related responses are also known to be triggered under uranium stress but information remains limited. This study aimed to further unravel the mechanisms by which plants respond to uranium stress. Seventeen-day-old Arabidopsis thaliana seedlings, grown on a modified Hoagland solution under controlled conditions, were exposed to 0, 0.1, 1, 10 and 100 μM uranium for 1, 3 and 7 days. While in Part I of this study oxidative stress related responses in the roots were discussed, this second Part II discusses oxidative stress related responses in the leaves and general conclusions drawn from the results of the roots and the leaves will be presented. As several responses were already visible following 1 day exposure, when uranium concentrations in the leaves were negligible, a root-to-shoot signaling system was suggested in which plastids could be important sensing sites. While lipid peroxidation, based on the amount of thiobarbituric acid reactive compounds, was observed after exposure to 100 μM uranium, affecting membrane structure and function, a transient concentration dependent response pattern was visible for lipoxygenase initiated lipid peroxidation. This transient character of uranium stress responses in leaves was emphasized by results of lipoxygenase (LOX2) and antioxidative enzyme transcript levels, enzyme capacities and glutathione concentrations both in time as with concentration. The ascorbate redox balance seemed an important modulator of uranium stress responses in the leaves as in addition to the previous transient responses, the total ascorbate concentration and ascorbate/dehydroascorbate redox balance increased in a concentration and time dependent manner. This could represent either a slow transient response or a stable increase with regard to plant acclimation to uranium stress. Copyright

  17. Mechanisms of copper stress alleviation in Citrus trees after metal uptake by leaves or roots.

    Science.gov (United States)

    Hippler, Franz Walter Rieger; Petená, Guilherme; Boaretto, Rodrigo Marcelli; Quaggio, José Antônio; Azevedo, Ricardo Antunes; Mattos-Jr, Dirceu

    2018-05-01

    Nutritional disorders caused by copper (Cu) have affected citrus orchards. Since Cu is foliar sprayed as a pesticide to control citrus diseases, this metal accumulates in the soil. Thereby, we evaluated the effects of Cu leaf absorption after spray of different metal sources, as well as roots absorption on growth, nutritional status, and oxidative stress of young sweet orange trees. Two experiments were carried out under greenhouse conditions. The first experiment was set up with varying Cu levels to the soil (nil Cu, 0.5, 2.0, 4.0 and 8.0 g of Cu per plant as CuSO 4 .5H 2 O), whereas the second experiment with Cu application via foliar sprays (0.5 and 2.0 g of Cu per plant) and comparing two metal sources (CuSO 4 .5H 2 O or Cu(OH) 2 ). Copper was mainly accumulated in roots with soil supply, but an increase of oxidative stress levels was observed in leaves. On the other hand, Cu concentrations were higher in leaves that received foliar sprays, mainly as Cu(OH) 2 . However, when sulfate was foliar sprayed, plants exhibited more symptoms of injuries in the canopy with decreased chlorophyll contents and increased hydrogen peroxide and lipid peroxidation levels. Copper toxicity was characterized by sap leakage from the trunk and twigs, which is the first report of this specific Cu excess symptom in woody trees. Despite plants with 8.0 g of Cu soil-applied exhibiting the sap leakage, growth of new plant parts was more vigorous with lower oxidative stress levels and injuries compared to those with 4.0 g of Cu soil-applied (without sap leakage). With the highest level of Cu applied via foliar as sulfate, Cu was eliminated by plant roots, increasing the rhizospheric soil metal levels. Despite citrus likely exhibiting different mechanisms to reduce the damages caused by metal toxicity, such as responsive enzymatic antioxidant system, metal accumulation in the roots, and metal exclusion by roots, excess Cu resulted in damages on plant growth and metabolism when the

  18. A Comparative Proteomic Analysis of Pinellia ternata Leaves Exposed to Heat Stress

    Directory of Open Access Journals (Sweden)

    Zuoyi Liu

    2013-10-01

    Full Text Available Pinellia ternata is an important traditional Chinese medicinal plant. The growth of P. ternata is sensitive to high temperatures. To gain a better understanding of heat stress responses in P. ternata, we performed a comparative proteomic analysis. P. ternata seedlings were subjected to a temperature of 38 °C and samples were collected 24 h after treatment. Increased relative ion leakage and lipid peroxidation suggested that oxidative stress was frequently generated in rice leaves exposed to high temperature. Two-dimensional electrophoresis (2-DE was used to analyze heat-responsive proteins. More than 600 protein spots were reproducibly detected on each gel; of these spots, 20 were up-regulated, and 7 were down-regulated. A total of 24 proteins and protein species were successfully identified by MALDI-TOF/TOF MS. These proteins and protein species were found to be primarily small heat shock proteins (58% as well as proteins involved in RNA processing (17%, photosynthesis (13%, chlorophyll biosynthetic processes (4%, protein degradation (4% and defense (4%. Using 2-DE Western blot analysis, we confirmed the identities of the cytosolic class II small heat shock protein (sHSPs-CII identified by MS. The expression levels of four different proteins [cytosolic class I small heat shock protein (sHSPs-CI, sHSPs-CII, mitochondrial small heat shock protein (sHSPs-MIT, glycine-rich RNA-binding protein (GRP] were analyzed at the transcriptional level by quantitative real-time PCR. The mRNA levels of three sHSPs correlated with the corresponding protein levels. However, GRP was down-regulated at the beginning of heat stress but then increased substantially to reach a peak after 24 h of heat stress. Our study provides valuable new insight into the responses of P. ternata to heat stress.

  19. Protective effects of polysaccharides from Psidium guajava leaves against oxidative stresses.

    Science.gov (United States)

    Kim, Seo-Young; Kim, Eun-A; Kim, Young-Sun; Yu, Seok-Kyu; Choi, Changyong; Lee, Jung-Suk; Kim, Yong-Tae; Nah, Jae-Woon; Jeon, You-Jin

    2016-10-01

    The aim of this study was to analyze antioxidant properties of a polysaccharide isolated from Psidium guajava leaves (PS-PGL) in vitro including its radical scavenging activities and protective effects against damage to cells as well as in vivo in zebrafish. The water extract of P. guajava leaves (WE-PGL) and PS-PGL showed strong radical scavenging effects in terms of 2,2-diphenyl-1-picrylhydrazyl (DPPH), hydroxyl, and alkyl radical. Compared to WE-PGL, PS-PGL enhanced all scavenging activities and in particular strongly scavenged the hydroxyl radical (50% inhibitory concentration [IC50], 0.02mg/mL). In addition, PS-PGL exerted a protective effect against hydrogen peroxide-induced oxidative stress and against toxicity to Vero cells. Furthermore, in vivo experiments using zebrafish embryos indicated that treatment with hydrogen peroxide decreased the survival rate and heart-beating rate of zebrafish embryos, whereas these problems were reduced by PS-PGL treatment. Moreover, PS-PGL inhibited hydrogen peroxide-induced reactive oxygen species (ROS) production, lipid peroxidation, and cell death. Taken together, these results suggest that PS-PGL may be useful as a beneficial antioxidant material in the food and cosmetic industries. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Cold stress decreases the capacity for respiratory NADH oxidation in potato leaves

    DEFF Research Database (Denmark)

    Svensson, Å.S.; Johansson, F.I.; Møller, I.M.

    2002-01-01

    is 10% of the original level. This decrease is accompanied by specific decreases of immunodetected NDA protein and internal rotenone-insensitive NADH oxidation in mitochondria isolated from cold-treated plants. The alternative oxidase is not cold-induced neither at the protein nor at the activity level......Cold stress effects on the expression of genes for respiratory chain enzymes were investigated in potato (Solarium tuberosum L., cv. Desiree) leaves. The nda1 and ndb1 genes, homologues to genes encoding the non-proton-pumping respiratory chain NADH dehydrogenases of Escherichia coli and yeast......, were compared to genes encoding catalytic subunits of the proton-pumping NADH dehydrogenase (complex I). Using a real-time PCR system, we demonstrate a specific and gradual decrease of the NDA1 transcript after exposing the plants to 5 C. After 6 days of cold treatment the NDA1 transcript abundance...

  1. Water extract of Vitis coignetiae Pulliat leaves attenuates oxidative stress and inflammation in progressive NASH rats.

    Science.gov (United States)

    Pak, Wing; Takayama, Fusako; Hasegawa, Azusa; Mankura, Mitsumasa; Egashira, Toru; Ueki, Keiji; Nakamoto, Kazuo; Kawasaki, Hiromu; Mori, Akitane

    2012-01-01

    This study aimed to investigate the therapeutic effects of the water extract of leaves of Vitis coignetiae Pulliat (VCPL) on nonalcoholic steatohepatitis (NASH) with advanced fibrosis, as our previous study exhibited its preventive effect on NASH. The NASH animal model [PCT/JP2007/52477] was prepared by loading recurrent and intermittent hypoxemia stress to a rat with fatty liver, which resembled the condition occurring in patients with obstructive sleep apnea (OSA) and fatty liver, who have a high incidence of NASH. Intermittent hypoxemia stress is regarded as a condition similar to warm ischemia followed by re-oxygenation, which induces oxidative stress (OS). The daily 100 or 300 mg/kg VCPL administrations were performed for 3 weeks perorally beginning at the time of detection of advanced liver fibrosis. The therapeutic efficacy of VCPL on NASH was demonstrated by the reduction of the leakage of hepato-biliary enzymes and the amelioration of liver fibrosis. The OS elevation in NASH rats was measured based on the derivation of reactive oxygen species from liver mitochondrial energy metabolism and on the decrease in plasma SOD-like activity. The aggravation of inflammatory responses was demonstrated by the neutrophil infiltration (elevated myeloperoxidase activity) and the progression of fibrosis in the livers of NASH rats. In addition, the NASH rats without VCPL treatment also exhibited activation of nuclear factor-κB, a key factor in the link between oxidative stress and inflammation. All of these changes were reduced dose-dependently by the VCPL administration. These findings indicate that VCPL may improve hepatic fibrosis or at least suppress the progression of NASH, by breaking the crosstalk between OS and inflammation.

  2. Hormonal and Hydroxycinnamic Acids Profiles in Banana Leaves in Response to Various Periods of Water Stress

    Directory of Open Access Journals (Sweden)

    Jalel Mahouachi

    2014-01-01

    Full Text Available The pattern of change in the endogenous levels of several plant hormones and hydroxycinnamic acids in addition to growth and photosynthetic performance was investigated in banana plants (Musa acuminata cv. “Grand Nain” subjected to various cycles of drought. Water stress was imposed by withholding irrigation for six periods with subsequent rehydration. Data showed an increase in abscisic acid (ABA and indole-3-acetic acid (IAA levels, a transient increase in salicylic acid (SA concentration, and no changes in jasmonic acid (JA after each period of drought. Moreover, the levels of ferulic (FA and cinnamic acids (CA were increased, and plant growth and leaf gas exchange parameters were decreased by drought conditions. Overall, data suggest an involvement of hormones and hydroxycinnamic acids in plant avoidance of tissue dehydration. The increase in IAA concentration might alleviate the senescence of survival leaves and maintained cell elongation, and the accumulation of FA and CA could play a key role as a mechanism of photoprotection through leaf folding, contributing to the effect of ABA on inducing stomatal closure. Data also suggest that the role of SA similarly to JA might be limited to a transient and rapid increase at the onset of the first period of stress.

  3. Hormonal and hydroxycinnamic acids profiles in banana leaves in response to various periods of water stress.

    Science.gov (United States)

    Mahouachi, Jalel; López-Climent, María F; Gómez-Cadenas, Aurelio

    2014-01-01

    The pattern of change in the endogenous levels of several plant hormones and hydroxycinnamic acids in addition to growth and photosynthetic performance was investigated in banana plants (Musa acuminata cv. "Grand Nain") subjected to various cycles of drought. Water stress was imposed by withholding irrigation for six periods with subsequent rehydration. Data showed an increase in abscisic acid (ABA) and indole-3-acetic acid (IAA) levels, a transient increase in salicylic acid (SA) concentration, and no changes in jasmonic acid (JA) after each period of drought. Moreover, the levels of ferulic (FA) and cinnamic acids (CA) were increased, and plant growth and leaf gas exchange parameters were decreased by drought conditions. Overall, data suggest an involvement of hormones and hydroxycinnamic acids in plant avoidance of tissue dehydration. The increase in IAA concentration might alleviate the senescence of survival leaves and maintained cell elongation, and the accumulation of FA and CA could play a key role as a mechanism of photoprotection through leaf folding, contributing to the effect of ABA on inducing stomatal closure. Data also suggest that the role of SA similarly to JA might be limited to a transient and rapid increase at the onset of the first period of stress.

  4. Induction of cyclic electron flow around photosystem I during heat stress in grape leaves.

    Science.gov (United States)

    Sun, Yongjiang; Geng, Qingwei; Du, Yuanpeng; Yang, Xinghong; Zhai, Heng

    2017-03-01

    Photosystem II (PSII) in plants is susceptible to high temperatures. The cyclic electron flow (CEF) around PSI is thought to protect both PSII and PSI from photodamage. However, the underlying physiological mechanisms of the photosynthetic electron transport process and the role of CEF in grape at high temperatures remain unclear. To investigate this issue, we examined the responses of PSII energy distribution, the P700 redox state and CEF to high temperatures in grape leaves. After exposing 'Cabernet Sauvignon' leaves to various temperatures (25, 30, 35, 40 and 45°C) in the light (600μmol photons m -2 s -1 ) for 4h, the maximum quantum yield of PSII (Fv/Fm) significantly decreased at high temperatures (40 and 45°C), while the maximum photo-oxidizable P700 (Pm) was not affected. As the temperature increased, higher initial rates of increase in post-illumination Chl fluorescence were detected, which were accompanied by an increase in high energy state quenching (qE). The chloroplast NAD(P)H dehydrogenase-dependent CEF (NDH-dependent CEF) activities were different among grape cultivators. 'Gold Finger' with greater susceptibility to photoinhibition, exhibited lower NDH-dependent CEF activities under acute heat stress than a more heat tolerant 'Cabernet Sauvignon'. These results suggest that overclosure of PSII reaction centers at high temperature resulted in the photoinhibition of PSII, while the stimulation of CEF in grape played an important role in the photoprotection of PSII and PSI at high temperatures through contributing to the generation of a proton gradient. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  5. Coping, Stress, and Job Satisfaction as Predictors of Advanced Placement Statistics Teachers' Intention to Leave the Field

    Science.gov (United States)

    McCarthy, Christopher J.; Lambert, Richard G.; Crowe, Elizabeth W.; McCarthy, Colleen J.

    2010-01-01

    This study examined the relationship of teachers' perceptions of coping resources and demands to job satisfaction factors. Participants were 158 Advanced Placement Statistics high school teachers who completed measures of personal resources for stress prevention, classroom demands and resources, job satisfaction, and intention to leave the field…

  6. The grapevine root-specific aquaporin VvPIP2;4N controls root hydraulic conductance and leaf gas exchange under well-watered conditions but not under water stress.

    Science.gov (United States)

    Perrone, Irene; Gambino, Giorgio; Chitarra, Walter; Vitali, Marco; Pagliarani, Chiara; Riccomagno, Nadia; Balestrini, Raffaella; Kaldenhoff, Ralf; Uehlein, Norbert; Gribaudo, Ivana; Schubert, Andrea; Lovisolo, Claudio

    2012-10-01

    We functionally characterized the grape (Vitis vinifera) VvPIP2;4N (for Plasma membrane Intrinsic Protein) aquaporin gene. Expression of VvPIP2;4N in Xenopus laevis oocytes increased their swelling rate 54-fold. Northern blot and quantitative reverse transcription-polymerase chain reaction analyses showed that VvPIP2;4N is the most expressed PIP2 gene in root. In situ hybridization confirmed root localization in the cortical parenchyma and close to the endodermis. We then constitutively overexpressed VvPIP2;4N in grape 'Brachetto', and in the resulting transgenic plants we analyzed (1) the expression of endogenous and transgenic VvPIP2;4N and of four other aquaporins, (2) whole-plant, root, and leaf ecophysiological parameters, and (3) leaf abscisic acid content. Expression of transgenic VvPIP2;4N inhibited neither the expression of the endogenous gene nor that of other PIP aquaporins in both root and leaf. Under well-watered conditions, transgenic plants showed higher stomatal conductance, gas exchange, and shoot growth. The expression level of VvPIP2;4N (endogenous + transgene) was inversely correlated to root hydraulic resistance. The leaf component of total plant hydraulic resistance was low and unaffected by overexpression of VvPIP2;4N. Upon water stress, the overexpression of VvPIP2;4N induced a surge in leaf abscisic acid content and a decrease in stomatal conductance and leaf gas exchange. Our results show that aquaporin-mediated modifications of root hydraulics play a substantial role in the regulation of water flow in well-watered grapevine plants, while they have a minor role upon drought, probably because other signals, such as abscisic acid, take over the control of water flow.

  7. PLEADING FOR THE GRAPEVINE CULTURE

    Directory of Open Access Journals (Sweden)

    Ionela Cătălina Guţă

    2012-04-01

    Full Text Available The grapevine is cultivated with good results on hilly terrain, on sand and sandy soils, thus ensuring high recovery of these categories of agricultural land considered unsuitable for other crops. Vineyards, so related to people existence everywhere, became something more than just places of economic interest. What makes the viticulture to be so important is that it refers to the food value, therapeutic, recreational of grapes, must and wine, wine derived products and residues from wine, the great extent of the area occupied by vineyards, to good natural conditions (pedo-climatic existing in our country and also to the aesthetic value of the land planted with vines worldwide. The fitting of the gardens of the house, both in the countryside and in urban areas, includes in most cases the presence of grapevine plants cut in different art forms, their care being an exciting job. In general, by the presence of vines are valued the spaces next to existing buildings (house, yard, various outbuildings, along fences and roads. Grapevines location, cutting types chosen, besides beautifying the yard, must make a harmonious aspect of the whole surrounding. Chosen forms of management (arches, halfarches can protect the strong sunlight places. By the kiosks or other artistic realized forms are created spaces for rest, shade.

  8. Infant sleep, parental sleep and parenting stress in families of mothers on maternity leave and in families of working mothers.

    Science.gov (United States)

    Sinai, Dana; Tikotzky, Liat

    2012-04-01

    The purpose of the present study was to investigate the links between infants' sleep and their parents' sleep and to assess the links between infant/parent sleep and parenting stress. Furthermore, we explored whether the links between sleep and parenting stress are moderated by maternal leave status. Participants were 50 families with an infant between the ages of 4-5 months. Half of the mothers were on maternity leave while the others returned to work. Parents completed daily sleep logs about infants' and their own sleep for 4 consecutive nights. Each parent also completed the Parenting Stress Index. Infant sleep was associated with sleep of both mothers and fathers, but the correlations with maternal sleep were stronger. Parental perceptions of their infant's sleep as problematic were associated with higher parenting stress. Poorer infant and maternal sleep patterns were associated with parenting stress only in families with mothers on maternity leave, probably because these mothers need to provide intensive caregiving "around the clock" without sufficient opportunities to rest. Copyright © 2012 Elsevier Inc. All rights reserved.

  9. [Cross-sectional study on the determinants of work stress for nurses and intention of leaving the profession].

    Science.gov (United States)

    Romano, Marina; Festini, Filippo; Bronner, Leonardo

    2015-01-01

    Occupational stress is one of the main causes of sick leaves among healthcare professionals and it determines high costs to health systems. Monitoring occupational related stress can be an important tool for policy makers. The Italian nursing research gave little attention to nurses' occupational stress. The aims of this study is to estimate the prevalence of occupational stress and evaluate risks factors among Italian nurses in order to evaluate health promotion intervention. Cross-sectional study on a convenience sample of nurses from three Italian public hospitals was carried out. The Nursing Stress Scale was administrated together with socio-demographic data information(age, occupational age, family structure etc). The Nursing Stress Scale includes 34 items with a score from 0 to 3. Seven areas of job related stress are investigate in the scale: conflict with physicians, inadequate training, lack of support, conflict with other nurses, workload, uncertainty about treatments, death and suffering. Scores were calculated for each item and for each area. Associations between stress scores and socio-demographic data were analyzed. 231 nurses participated to the study. The two stress areas with the highest scores were "workload" (1.58) and "death and suffering" (1.39). Among the 13 items that exceed the overall mean stress score (i.e. 1.07), five belong to the "workload" area. "Watching a suffering patient" is the single item with the highest mean score. Demographic data associated to higher stress scores are, female gender (p=0.03) and working with night shifts (p=0.02). Intention to leave the nursing profession is associated to higher stress scores (p=0.002). Age, occupational age, time to commute to work, number of children, having disabled relatives at home, were not correlated to higher stress scores. Our study provides data regarding nurses' occupational stress that was not available before. This data may be useful for policy makers to plan preventive

  10. Oxidative stress-triggered interactions between the succinyl- and acetyl-proteomes of rice leaves.

    Science.gov (United States)

    Zhou, Heng; Finkemeier, Iris; Guan, Wenxue; Tossounian, Maria-Armineh; Wei, Bo; Young, David; Huang, Jingjing; Messens, Joris; Yang, Xibin; Zhu, Jun; Wilson, Michael H; Shen, Wenbiao; Xie, Yanjie; Foyer, Christine H

    2018-05-01

    Protein lysine acylations, such as succinylation and acetylation, are important post-translational modification (PTM) mechanisms, with key roles in cellular regulation. Antibody-based affinity enrichment, high-resolution liquid chromatography mass spectrometry analysis, and integrated bioinformatics analysis were used to characterize the lysine succinylome (K suc ) and acetylome (K ace ) of rice leaves. In total, 2,593 succinylated and 1,024 acetylated proteins were identified, of which 723 were simultaneously acetylated and succinylated. Proteins involved in photosynthetic carbon metabolism such as the large and small subunits of RuBisCO, ribosomal functions, and other key processes were subject to both PTMs. Preliminary insights into oxidant-induced changes to the rice acetylome and succinylome were gained from treatments with hydrogen peroxide. Exposure to oxidative stress did not regulate global changes in the rice acetylome or succinylome but rather led to modifications on a specific subset of the identified sites. De-succinylation of recombinant catalase (CATA) and glutathione S-transferase (OsGSTU6) altered the activities of these enzymes showing that this PTM may have a regulatory function. These findings not only greatly extend the list of acetylated and/or succinylated proteins but they also demonstrate the close cooperation between these PTMs in leaf proteins with key metabolic functions. © 2017 John Wiley & Sons Ltd.

  11. Salt stress aggravates boron toxicity symptoms in banana leaves by impairing guttation.

    Science.gov (United States)

    Shapira, O R; Israeli, Yair; Shani, Uri; Schwartz, Amnon

    2013-02-01

    Boron (B) is known to accumulate in the leaf margins of different plant species, arguably a passive consequence of enhanced transpiration at the ends of the vascular system. However, transpiration rate is not the only factor affecting ion distribution. We examine an alternative hypothesis, suggesting the participation of the leaf bundle sheath in controlling radial water and solute transport from the xylem to the mesophyll in analogy to the root endodermis. In banana, excess B that remains confined to the vascular system is effectively disposed of via dissolution in the guttation fluid; therefore, impairing guttation should aggravate B damage to the leaf margins. Banana plants were subjected to increasing B concentrations. Guttation rates were manipulated by imposing a moderate osmotic stress. Guttation fluid was collected and analysed continuously. The distribution of ions across the lamina was determined. Impairing guttation indeed led to increased B damage to the leaf margins. The kinetics of ion concentration in guttation samples revealed major differences between ion species, corresponding to their distribution in the lamina dry matter. We provide evidence that the distribution pattern of B and other ions across banana leaves depends on active filtration of the transpiration stream and on guttation. © 2012 Blackwell Publishing Ltd.

  12. Genotypic response of detached leaves versus intact plants for chlorophyll fluorescence parameters under high temperature stress in wheat

    DEFF Research Database (Denmark)

    Sharma, Dew Kumari; Fernández, Juan Olivares; Rosenqvist, Eva

    2014-01-01

    The genotypic response of wheat cultivars as affected by two methods of heat stress treatment (treatment of intact plants in growth chambers versus treatment of detached leaves in test tubes) in a temperature controlled water bath were compared to investigate how such different methods of heat...... to high temperatures. Further, the results suggest that genetic factors associated with cultivar differences are different for the two methods of heat treatment........ The responses of the same cultivars to heat stress were compared between the two methods of heat treatment. The results showed that in detached leaves, all of the fluorescence parameters remained almost unaffected in control (20°C at all durations tested), indicating that the detachment itself did not affect...

  13. VULNERABILITY TO CAVITATION IN GRAPEVINES HAS BEEN OVERESTIMATED BY THE CENTRIFUGE TECHNIQUE

    Science.gov (United States)

    Grapevines are considered among the most vulnerable woody plant species to water stress-induced cavitation with embolism forming at slight tensions. However, we found that native embolism in stems of field grown Vitis vinifera cv. Chardonnay never exceeded 30% despite xylem water potentials ('x) rea...

  14. Suppressing Sorbitol Synthesis Substantially Alters the Global Expression Profile of Stress Response Genes in Apple (Malus domestica) Leaves.

    Science.gov (United States)

    Wu, Ting; Wang, Yi; Zheng, Yi; Fei, Zhangjun; Dandekar, Abhaya M; Xu, Kenong; Han, Zhenhai; Cheng, Lailiang

    2015-09-01

    Sorbitol is a major product of photosynthesis in apple (Malus domestica) that is involved in carbohydrate metabolism and stress tolerance. However, little is known about how the global transcript levels in apple leaves respond to decreased sorbitol synthesis. In this study we used RNA sequencing (RNA-seq) profiling to characterize the transcriptome of leaves from transgenic lines of the apple cultivar 'Greensleeves' exhibiting suppressed expression of aldose-6-phosphate reductase (A6PR) to gain insights into sorbitol function and the consequences of decreased sorbitol synthesis on gene expression. We observed that, although the leaves of the low sorbitol transgenic lines accumulate higher levels of various primary metabolites, only very limited changes were found in the levels of transcripts associated with primary metabolism. We suggest that this is indicative of post-transcriptional and/or post-translational regulation of primary metabolite accumulation and central carbon metabolism. However, we identified significantly enriched gene ontology terms belonging to the 'stress related process' category in the antisense lines (P-value sorbitol plays a role in the responses of apple trees to abiotic and biotic stresses. © The Author 2015. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  15. Broader leaves result in better performance of indica rice under drought stress.

    Science.gov (United States)

    Farooq, M; Kobayashi, N; Ito, O; Wahid, A; Serraj, R

    2010-09-01

    Leaf growth is one of the first physiological processes affected by changes in plant water status under drought. A decrease in leaf expansion rate usually precedes any reduction in stomatal conductance or photosynthesis. Changes in leaf size and stomatal opening are potential adaptive mechanisms, which may help avoid drought by reducing transpiration rate, and can be used to improve rice genotypes in water-saving cultivation. The indica rice cultivar IR64 and four of its near-isogenic lines (NILs; BC(3)-derived lines) unique for leaf size traits, YTK 124 (long leaves), YTK 127 (broad leaves), YTK 205 (short leaves) and YTK 214 (narrow leaves), were compared in this study for changes in leaf growth and its water status. The plants were subjected to two soil water regimes, well-watered and progressive soil drying measured by the fraction of transpirable soil water (FTSW). Applied drought reduced leaf number, total leaf area, specific leaf area, plant biomass, tiller number, plant height, stomatal conductance, amount of water transpired, leaf relative water content, and leaf water potential more in IR64 and the NILs than in the respective controls; nonetheless, transpiration efficiency (TE) was slightly higher under drought than in the well-watered controls. NILs with broader leaves had higher biomass (and its individual components), less stomatal conductance, and higher TE under drought than NILs with narrow and shorter leaves. Under drought, leaf number was positively correlated with tiller number and plant height; nonetheless, root weight and total biomass, water transpired and TE, and plant height and TE were positively correlated with each other. However, a negative correlation was observed between stomatal conductance and the FTSW threshold at which normalized transpiration started to decline during soil drying. Overall, the IR64-derived lines with broader leaves performed better than NILs with narrow and short leaves under drought. Copyright 2010 Elsevier Gmb

  16. Localization and subcellular association of Grapevine Pinot Gris Virus in grapevine leaf tissues.

    Science.gov (United States)

    Tarquini, Giulia; Ermacora, Paolo; Bianchi, Gian Luca; De Amicis, Francesca; Pagliari, Laura; Martini, Marta; Loschi, Alberto; Saldarelli, Pasquale; Loi, Nazia; Musetti, Rita

    2018-05-01

    Despite the increasing impact of Grapevine Pinot gris disease (GPG-disease) worldwide, etiology about this disorder is still uncertain. The presence of the putative causal agent, the Grapevine Pinot Gris Virus (GPGV), has been reported in symptomatic grapevines (presenting stunting, chlorotic mottling, and leaf deformation) as well as in symptom-free plants. Moreover, information on virus localization in grapevine tissues and virus-plant interactions at the cytological level is missing at all. Ultrastructural and cytochemical investigations were undertaken to detect virus particles and the associated cytopathic effects in field-grown grapevine showing different symptom severity. Asymptomatic greenhouse-grown grapevines, which tested negative for GPGV by real time RT-PCR, were sampled as controls. Multiplex real-time RT-PCR and ELISA tests excluded the presence of viruses included in the Italian certification program both in field-grown and greenhouse-grown grapevines. Conversely, evidence was found for ubiquitous presence of Grapevine Rupestris Stem Pitting-associated Virus (GRSPaV), Hop Stunt Viroid (HSVd), and Grapevine Yellow Speckle Viroid 1 (GYSVd-1) in both plant groups. Moreover, in every field-grown grapevine, GPGV was detected by real-time RT-PCR. Ultrastructural observations and immunogold labelling assays showed filamentous flexuous viruses in the bundle sheath cells, often located inside membrane-bound organelles. No cytological differences were observed among field-grown grapevine samples showing different symptom severity. GPGV localization and associated ultrastructural modifications are reported and discussed, in the perspective of assisting management and control of the disease.

  17. Transcriptome analyses of the Dof-like gene family in grapevine reveal its involvement in berry, flower and seed development.

    Science.gov (United States)

    da Silva, Danielle Costenaro; da Silveira Falavigna, Vítor; Fasoli, Marianna; Buffon, Vanessa; Porto, Diogo Denardi; Pappas, Georgios Joannis; Pezzotti, Mario; Pasquali, Giancarlo; Revers, Luís Fernando

    2016-01-01

    The Dof (DNA-binding with one finger) protein family spans a group of plant transcription factors involved in the regulation of several functions, such as plant responses to stress, hormones and light, phytochrome signaling and seed germination. Here we describe the Dof-like gene family in grapevine (Vitis vinifera L.), which consists of 25 genes coding for Dof. An extensive in silico characterization of the VviDofL gene family was performed. Additionally, the expression of the entire gene family was assessed in 54 grapevine tissues and organs using an integrated approach with microarray (cv Corvina) and real-time PCR (cv Pinot Noir) analyses. The phylogenetic analysis comparing grapevine sequences with those of Arabidopsis, tomato, poplar and already described Dof genes in other species allowed us to identify several duplicated genes. The diversification of grapevine DofL genes during evolution likely resulted in a broader range of biological roles. Furthermore, distinct expression patterns were identified between samples analyzed, corroborating such hypothesis. Our expression results indicate that several VviDofL genes perform their functional roles mainly during flower, berry and seed development, highlighting their importance for grapevine growth and production. The identification of similar expression profiles between both approaches strongly suggests that these genes have important regulatory roles that are evolutionally conserved between grapevine cvs Corvina and Pinot Noir.

  18. Formation of (E)-nerolidol in tea (Camellia sinensis) leaves exposed to multiple stresses during tea manufacturing.

    Science.gov (United States)

    Zhou, Ying; Zeng, Lanting; Liu, Xiaoyu; Gui, Jiadong; Mei, Xin; Fu, Xiumin; Dong, Fang; Tang, Jingchi; Zhang, Lingyun; Yang, Ziyin

    2017-09-15

    (E)-Nerolidol is a volatile sesquiterpene that contributes to the floral aroma of teas (Camellia sinensis). The unique manufacturing process for oolong tea involves multiple stresses, resulting in a high content of (E)-nerolidol, which is not known to form in tea leaves. This study aimed to determine the formation mechanism of (E)-nerolidol in tea exposed to multiple stresses during tea manufacture. C. sinensis (E)-nerolidol synthase (CsNES) recombinant protein, found in the cytosol, was found to transform farnesyl diphosphate into (E)-nerolidol. CsNES was highly expressed during the oolong tea turn over process, resulting in (E)-nerolidol accumulation. Continuous mechanical damage, simulating the turn over process, significantly enhanced CsNES expression level and (E)-nerolidol content. The combination of low temperature stress and mechanical damage had a synergistic effect on (E)-nerolidol formation. This is the first evidence of (E)-nerolidol formation mechanism in tea leaves and a characteristic example of plant volatile formation in response to dual stresses. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Quantificação da área e do teor de clorofilas em folhas de plantas jovens de videira 'Cabernet Sauvignon' mediante métodos não destrutivos Non-destructive quantification of area and chlorophyll content in the leaves of young 'Cabernet Sauvignon' grapevines

    Directory of Open Access Journals (Sweden)

    Cassandro Vidal Talamini do Amarante

    2009-09-01

    Full Text Available Este trabalho foi conduzido visando a desenvolver métodos não destrutivos para estimar a área foliar e o conteúdo de clorofilas em folhas de plantas jovens de videira 'Cabernet Sauvignon'. Para a estimativa da área foliar, foram tomadas medidas de comprimento da nervura principal e das duas maiores nervuras secundárias em folhas representando uma grande amplitude de áreas foliares, seguindo-se da leitura em um integrador de área foliar. Para a quantificação de clorofilas, folhas com tonalidades variando de verde-amareladas (folha clorótica a verde-escuras foram avaliadas individualmente com um medidor de clorofila (Minolta SPAD-502 e um colorímetro (Minolta CR-400, no espaço de cores L, C e hº, nas faces abaxial (inferior e adaxial (superior, seguido de quantificações destrutivas de clorofilas a, b e totais. A quantificação do comprimento da nervura principal proporcionou boa estimativa da área foliar, sendo que a soma do comprimento das duas nervuras secundárias, bem como do somatório destes comprimentos com o comprimento da nervura principal, resultou em aumento muito pequeno na capacidade de estimativa da área foliar. Os valores das leituras do medidor de clorofila e da relação hº/(LxC do colorímetro, avaliados em ambas as faces das folhas, aumentaram com o incremento nos teores de clorofilas. Os modelos ajustados entre os teores de clorofilas e as leituras do medidor de clorofila e da relação hº/(LxC do colorímetro apresentaram valores de R² similares. Todavia, a medição da relação hº/(LxC do colorímetro, feita na face adaxial da folha, mostrou melhor estimativa do teor de clorofila, expresso em unidade de área (µg.cm-2 de folha.This work was carried out to develop non destructive methods to estimate the area and chlorophylls content in the leaves of young grapevines 'Cabernet Sauvignon'. For leaf area estimation, the lengths of main and two secondary leaf veins were measured, in leaves ranging from

  20. Interaction of Ulocladium atrum, a Potential Biological Control Agent, with Botrytis cinerea and Grapevine Plantlets

    Directory of Open Access Journals (Sweden)

    Sébastien Ronseaux

    2013-09-01

    Full Text Available The effectiveness of biological control agent, Ulocladium atrum (isolates U13 and U16 in protecting Vitis vinifera L. cv. Chardonnay against gray mold disease caused by Botrytis cinerea, and simulation of the foliar defense responses was investigated. A degraded mycelium structure during cultural assay on potato dextrose agar revealed that U. atrum isolates U13 and U16 were both antagonistic to B. cinerea, mainly when isolates were inoculated two days before Botrytis. Under in vitro conditions, foliar application of U. atrum protected grapevine leaves against gray mold disease. An increase in chitinase activity was induced by the presence of U. atrum isolates indicating that the biological control agents triggered plant defense mechanisms. Moreover, U13 has the potential to colonize the grapevine plantlets and to improve their growth. The ability of U. atrum isolates to exhibit an antagonistic effect against B. cinerea in addition to their aptitude to induce plant resistance and to promote grapevine growth may explain a part of their biological activity. Hence, this study suggests that U. atrum provides a suitable biocontrol agent against gray mold in grapevines.

  1. Arthropods vector grapevine trunk disease pathogens.

    Science.gov (United States)

    Moyo, P; Allsopp, E; Roets, F; Mostert, L; Halleen, F

    2014-10-01

    Arthropod-mediated dispersal of pathogens is known in many cropping systems but has never been demonstrated for grapevine trunk disease pathogens. Arthropods from vineyards were screened for the presence of pathogens associated with Petri disease and esca using cultural and molecular techniques. The ability of the most abundant pathogen-carrying species to inoculate healthy grapevine vascular tissues was also determined. Millipedes and ants were allowed to associate with a DsRed- Express-transformed Phaeomoniella chlamydospora, after which they were exposed to freshly pruned healthy grapevines under controlled conditions and wounds were monitored for subsequent infection. In addition, the possibility of millipede excreta, commonly found on pruning wounds in the field, to act as inoculum source was determined. A diverse arthropod fauna was associated with declining grapevines and many of these carried trunk disease pathogens. However, spiders, the ant Crematogaster peringueyi, and the millipede Ommattoiulus moreleti were the most abundant pathogen carriers. The ant and millipede species fed on pruning wound sap and effectively transmitted trunk disease pathogens. Millipede excreta contained viable spores of Phaeomoniella chlamydospora and may serve as an inoculum source. Numerous arthropods, including beneficial predators, are potential vectors of grapevine trunk disease pathogens. Our results highlight the need for an integrated approach, including targeted management of ants and millipedes at the time of pruning, to limit the spread of grapevine trunk diseases.

  2. THE ORIGIN OF GRAPEVINE CULTIVATION IN ITALY: THE ARCHAEOBOTANICAL EVIDENCE

    Directory of Open Access Journals (Sweden)

    S. Marvelli

    2013-04-01

    Full Text Available Grapevine remains show that this plant has been important for humans since ancient times. This paper presents a synthesis of archaeobotanical studies on grapevine remains (pollen, wood, charcoal, seed/fruit and other botanical remains from Epigravettian to Bronze Age sites. Carpological remains are the most important ones, because they often allow to distinguish cultivated and wild grapevines. Grapevine findings are rare in Mesolithic sites, they increase during Neolithic period and become frequent in Bronze Age. Archaeobotanical data show that during Neolithic and in the Early Bronze Age a good level of knowledge concerning grapevine utilization was already acquired; during Middle and Late Bronze Age the grapevine diffusion increases. Based on archaeobotanical data, the wild grapevine evolution by indigenous people was probably accompanied by an input of allochtonous vines from Mycenaean world, and then from Hellenic world. Therefore, the critical period of grapevine domestication can be placed between Bronze Age and Early Iron Age.

  3. Quality information from the grapevine.

    Science.gov (United States)

    Laszlo, Pierre

    2010-07-01

    A letter by Lucien Herr, a highly regarded leading French intellectual at the time of World War I, provides capsule portraits of chemists such as Gabriel Bertrand, Paul Lebeau, Charles Moureu, and Georges Urbain. It makes us better aware of who they were and of how their contemporaries saw their work, which had much to do with their personalities, whether congenial or abrasive. This article is concerned with the kind of information carried by the so-called grapevine. It can be invaluable to the historian, for the light it sheds on the character of a scientist. The document drawn upon, from World War I (1915), depicts graphically the personalities of some of the French chemists engaged in the rush to design and produce chemical weapons. It is a frank and even brutal appraisal of their strengths and weaknesses. This is the kind of evaluation that scientists routinely engage in, but devoid of the hyperbole, pro or con, which usually flavours it.

  4. Oxidative stress responses induced by uranium exposure at low pH in leaves of Arabidopsis thaliana plants

    International Nuclear Information System (INIS)

    Saenen, Eline; Horemans, Nele; Vanhoudt, Nathalie; Vandenhove, Hildegarde; Biermans, Geert; Hees, May van; Wannijn, Jean; Vangronsveld, Jaco; Cuypers, Ann

    2015-01-01

    Anthropogenic activities have led to a widespread uranium (U) contamination in many countries. The toxic effects of U at the cellular level have mainly been investigated at a pH around 5.5, the optimal pH for hydroponically grown plants. However, since the speciation of U, and hence its toxicity, is strongly dependent on environmental factors such as the pH, it is important to investigate the effects of U at different environmentally relevant pH levels. Although U is poorly translocated from the roots to the shoots, resulting in a low U concentration in the leaves, it has been demonstrated that toxic effects in the leaves were already visible after 1 day exposure at pH 5.5, although only when exposed to relatively high U concentrations (100 μM). Therefore, the present study aimed to analyse the effects of different U concentrations (ranging from 0 to 100 μM) at pH 4.5 in leaves of Arabidopsis thaliana plants. Results indicate that U induces early senescence in A. thaliana leaves as was suggested by a decreased expression of CAT2 accompanied by an induction of CAT3 expression, a decreased CAT capacity and an increased lipid peroxidation. In addition, miRNA398b/c is involved in the regulation of the SOD response in the leaves. As such, an increased MIR398b/c expression was observed leading to a decreased transcript level of CSD1/2. Finally, the biosynthesis of ascorbate was induced after U exposure. This can point towards an important role for this metabolite in the scavenging of reactive oxygen species under U stress. - Highlights: • Uranium induces early senescence in A. thaliana after uranium exposure. • Ascorbate is involved in scavenging reactive oxygen species under uranium stress. • miRNA398b/c is involved in the regulation of the SOD response under uranium stress.

  5. Method validation for determination of metals in Vitis labrusca L. grapevine leaf extracts by inductively coupled plasma mass spectrometry (ICP-MS

    Directory of Open Access Journals (Sweden)

    LIANE V.V. BOKOWSKI

    Full Text Available ABSTRACT Vitis labrusca L. is the main species used for wine and juice production in Brazil. The grapevine leaves can be used both as functional foods and as cheapest sources for the extraction of phenolic compounds. Besides the antioxidant activity, grapevine leaves exhibited significant anti-inflammatory activity. Therefore, the aim of this study was to develop and validate an analytical methodology to determine the metals selenium (96Se, chromium (53Cr, nickel (62Ni, cadmium (111Cd and lead (206Pb in 30 samples of grapevine leaf extracts (Vitis labrusca, Bordo cultivar using inductively coupled plasma mass spectrometry (ICP-MS. To obtain the grapevine leaf extracts the samples were milled, weighed and digested in microwave oven with nitric acid. The method showed linearity, precision, accuracy and limits of quantification and detection acceptable for INMETRO protocol validation of analytical methods. Therefore, the method using ICP-MS was developed and validated to determine metals concentrations in grapevine leaves of Vitis labrusca L. and the proposed method could be applied in routine analytical laboratory.

  6. The status of Botryosphaeriaceae species infecting grapevines

    Directory of Open Access Journals (Sweden)

    Jose Ramón URBEZ-TORRES

    2011-12-01

    Full Text Available Normal 0 MicrosoftInternetExplorer4 Normal 0 MicrosoftInternetExplorer4 Species in the Botryosphaeriaceae have a cosmopolitan distribution, and occur on a wide range of annual and perennial hosts including grapevines. To date, morphological and taxonomic studies, as well as analyses of nucleotide sequences of multiple genes, have allowed the identification of at least 21 different species in the Botryosphaeriaceae occurring in grapevines worldwide. Grapevine disease symptoms caused by members of this family include leaf spots, fruit rots, shoot dieback, bud necrosis, vascular discoloration of the wood, and perennial cankers, and their current status as pathogens is reviewed. Additionally, the disease name Botryosphaeria dieback is proposed here to describe the different grapevine trunk disease symptoms caused by species of Botryosphaeriaceae. Much has been written during the last decade about the association between species in the Botryosphaeriaceae and grapevine trunk diseases, which has contributed to a better understanding of the role that these fungal taxa play in grapevine diseases. Although virulence has been shown to vary between species and isolates of the same species in different countries, these fungi have become well-recognized as important grapevine pathogens worldwide. Latest and novel findings from studies conducted in different countries, on disease etiology and species distribution, epidemiology and biology are discussed. Much progress has been achieved in the development and implementation of novel diagnostic and detection techniques.Vineyard sanitation techniques, as well as chemical, biological, and cultural control strategies available at the present time to reduce the infection caused by botryosphaeriaceous fungi, are presented in this review. 

  7. Cyclic lipopeptides from Bacillus subtilis activate distinct patterns of defence responses in grapevine.

    Science.gov (United States)

    Farace, Giovanni; Fernandez, Olivier; Jacquens, Lucile; Coutte, François; Krier, François; Jacques, Philippe; Clément, Christophe; Barka, Essaid Ait; Jacquard, Cédric; Dorey, Stéphan

    2015-02-01

    Non-self-recognition of microorganisms partly relies on the perception of microbe-associated molecular patterns (MAMPs) and leads to the activation of an innate immune response. Bacillus subtilis produces three main families of cyclic lipopeptides (LPs), namely surfactins, iturins and fengycins. Although LPs are involved in induced systemic resistance (ISR) activation, little is known about defence responses induced by these molecules and their involvement in local resistance to fungi. Here, we showed that purified surfactin, mycosubtilin (iturin family) and plipastatin (fengycin family) are perceived by grapevine plant cells. Although surfactin and mycosubtilin stimulated grapevine innate immune responses, they differentially activated early signalling pathways and defence gene expression. By contrast, plipastatin perception by grapevine cells only resulted in early signalling activation. Gene expression analysis suggested that mycosubtilin activated salicylic acid (SA) and jasmonic acid (JA) signalling pathways, whereas surfactin mainly induced an SA-regulated response. Although mycosubtilin and plipastatin displayed direct antifungal activity, only surfactin and mycosubtilin treatments resulted in a local long-lasting enhanced tolerance to the necrotrophic fungus Botrytis cinerea in grapevine leaves. Moreover, challenge with specific strains overproducing surfactin and mycosubtilin led to a slightly enhanced stimulation of the defence response compared with the LP-non-producing strain of B. subtilis. Altogether, our results provide the first comprehensive view of the involvement of LPs from B. subtilis in grapevine plant defence and local resistance against the necrotrophic pathogen Bo. cinerea. Moreover, this work is the first to highlight the ability of mycosubtilin to trigger an immune response in plants. © 2014 BSPP AND JOHN WILEY & SONS LTD.

  8. Combining proteomics and metabolite analyses to unravel cadmium stress-response in poplar leaves.

    Science.gov (United States)

    Kieffer, Pol; Planchon, Sébastien; Oufir, Mouhssin; Ziebel, Johanna; Dommes, Jacques; Hoffmann, Lucien; Hausman, Jean-François; Renaut, Jenny

    2009-01-01

    A proteomic analysis of poplar leaves exposed to cadmium, combined with biochemical analysis of pigments and carbohydrates revealed changes in primary carbon metabolism. Proteomic results suggested that photosynthesis was slightly affected. Together with a growth inhibition, photoassimilates were less needed for developmental processes and could be stored in the form of hexoses or complex sugars, acting also as osmoprotectants. Simultaneously, mitochondrial respiration was upregulated, providing energy needs of cadmium-exposed plants.

  9. Physiological responses of Alternanthera philoxeroides (Mart.) Griseb leaves to cadmium stress

    International Nuclear Information System (INIS)

    Ding Bingzhong; Shi Guoxin; Xu Ye; Hu Jinzhao; Xu Qinsong

    2007-01-01

    Aquatic macrophytes were found to be the potential scavengers of heavy metals from aquatic environment. In this study, several physiological responses of Alternanthera philoxeroides (Mart.) Griseb leaves to elevated concentrations of cadmium (up to 10 mM) were investigated. It was found that A. philoxeroides was able to accumulate cadmium in its leaves. The pigment contents decreased with the increase of the Cd concentrations. The Cd could induce rise of the activity of peroxidase (POD) at lower concentration (<5 mM), however, when the concentration of Cd rose up to 10 mM, the POD activity declined. The changes of superoxide dismutase (SOD) and Catalase (CAT) activities were exactly opposite to that of POD. In the leaves of Cd-treated fronds, the amounts of three polypeptides with apparent molecular weights 80, 39 and 28 kDa, respectively, were became visible in SDS-PAGE. The nature of these polypeptides remains to be determined. - Cd modified a number of physiological processes and particularly chlorophyll degradation

  10. Drought adaptation strategies of four grapevine cultivars (Vitis vinifera L.: modification of the properties of the leaf area

    Directory of Open Access Journals (Sweden)

    María Gómez-del-Campo

    2003-09-01

    Full Text Available This essay studies the morphological and anatomical properties of the leaves of Garnacha tinta, Tempranillo, Chardonnay and Airén grapevines in order to discover the drought adaptation strategies present in Vitis vinifera L. The grapevines were grown under two water availability conditions: water limitation and non-water limitation. There was a significantly lower development of leaf area under conditions of water limitation compared to non-water limitation due to a reduction in the size of main and lateral shoot leaves, and a smaller number of leaves on lateral shoots. The development of the leaf area under water limitation conditions occurred on earlier dates than under non-water limitation conditions. Significantly lower stomatal density was observed under water limitation conditions rather than non-water limitation conditions exclusively in the Airén cultivar.

  11. Oxidative stress response in Arabidopsis thaliana roots and leaves exposed to cadmium, uranium or a combination of both stressors

    Energy Technology Data Exchange (ETDEWEB)

    Horemans, N.; Saenen, E.; Vandenhove, H. [Belgian Nuclear Research Centre, SCK.CEN, Boeretang 200, 2400 Mol (Belgium); Hendrix, S.; Keunen, E.; Cuypers, A. [Hasselt University, Centre for Environmental Sciences, Agoralaan, Building D, 3590 Diepenbeek (Belgium)

    2014-07-01

    Nuclear energy production or NORM industry released low amounts of radioactive substances together with non-radioactive substances (e.g., heavy metals, organic chemicals) to the environment. As sessile organisms, plants are commonly exposed to a number of adverse conditions and therefore it is interesting to study the stress responses of plants induced by the single stressors as well as in a in a multi-pollution set-up. The aim of this study was to understand and predict fast induced oxidative stress responses in plants exposed to Cd and U or a combination of both stressors. Arabidopsis thaliana plants grown hydroponically for 18 days were exposed to a Cd (5 μM) or {sup 238}U (25 μM) or an equi-toxic mixture of Cd and {sup 238}U (2.5 μM + 12.5 μM) for 24 h. As expected both metals were taken up into the plants with Cd being more readily transported to the leaves than U. The root-to-shoot ratio was approximately 1,3 for Cd whereas it was above 3500 for U. For both U and Cd the root-to-shoot ratio was not affected under multiple exposure conditions used here. Notwithstanding the limited exposure time, leave and root fresh weight was already decreasing in U-treated plants. For Cd or Cd+U a decreasing but at this point not significant trend was visible. As U concentrations in the leaves were very low the decrease in leaf fresh weight is possibly due to signaling from the roots rather than a direct toxicity of U. The oxidative stress response was investigated by measuring the transcription of selected pro- and anti-oxidative genes, anti-oxidative enzyme capacities and concentration and redox status of major anti-oxidative metabolites. Cd strongly up-regulated lipoxygenase (LOX1) and NADPH-oxidases (RBOHD or C in roots and leaves, respectively) whereas this was not found in the U-treated plants. For the anti-oxidative response related enzymes both Cd and U induced a decrease in Cu/Zn superoxide dismutases (CSD1,2) and a concomitant increase in Fe-SOD (FSD1). However

  12. The aqueous extract of Albizia adianthifolia leaves attenuates 6-hydroxydopamine-induced anxiety, depression and oxidative stress in rat amygdala.

    Science.gov (United States)

    Beppe, Galba Jean; Dongmo, Alain Bertrand; Foyet, Harquin Simplice; Dimo, Théophile; Mihasan, Marius; Hritcu, Lucian

    2015-10-19

    While the Albizia adianthifolia (Schumach.) W. Wright (Fabaceae) is a traditional herb largely used in the African traditional medicine as analgesic, purgative, antiinflammatory, antioxidant, antimicrobial, memory-enhancer, anxiolytic and antidepressant drug, there are no scientific data that clarify the anxiolytic and antidepressant-like effects in 6-hydroxydopamine (6-OHDA)-lesioned animal model of Parkinson's disease. This study was undertaken in order to identify the effects of aqueous extract of A. adianthifolia leaves on 6-hydroxydopamine-induced anxiety, depression and oxidative stress in the rat amygdala. The effect of the aqueous extract of A. adianthifolia leaves (150 and 300 mg/kg, orally, daily, for 21 days) on anxiety and depression was assessed using elevated plus-maze and forced swimming tests, as animal models of anxiety and depression. Also, the antioxidant activity in the rat amygdala was assessed using assessed using superoxide dismutase, glutathione peroxidase and catalase specific activities, the total content of the reduced glutathione, protein carbonyl and malondialdehyde levels. Statistical analyses were performed using by one-way analysis of variance (ANOVA). Significant differences were determined by Tukey's post hoc test. F values for which p amygdala. Our results suggest that the aqueous extract ameliorates 6-OHDA-induced anxiety and depression by attenuation of the oxidative stress in the rat amygdala. These pieces of evidence accentuate its use in traditional medicine.

  13. Identification of differentially expressed genes in sunflower (Helianthus annuus) leaves and roots under drought stress by RNA sequencing.

    Science.gov (United States)

    Liang, Chunbo; Wang, Wenjun; Wang, Jing; Ma, Jun; Li, Cen; Zhou, Fei; Zhang, Shuquan; Yu, Ying; Zhang, Liguo; Li, Weizhong; Huang, Xutang

    2017-10-25

    Sunflower is recognized as one of the most important oil plants with strong tolerance to drought in the world. In order to study the response mechanisms of sunflower plants to drought stress, gene expression profiling using high throughput sequencing was performed for seedling leaves and roots (sunflower inbred line R5) after 24 h of drought stress (15% PEG 6000). The transcriptome assembled using sequences of 12 samples was used as a reference. 805 and 198 genes were identified that were differentially expressed in leaves and roots, respectively. Another 71 genes were differentially expressed in both organs, in which more genes were up-regulated than down-regulated. In agreement with results obtained for other crops or from previous sunflower studies, we also observed that nine genes may be associated with the response of sunflower to drought. The results of this study may provide new information regarding the sunflower drought response, as well as add to the number of known genes associated with drought tolerance.

  14. Nature-Based Stress Management Course for Individuals at Risk of Adverse Health Effects from Work-Related Stress—Effects on Stress Related Symptoms, Workability and Sick Leave

    Directory of Open Access Journals (Sweden)

    Eva Sahlin

    2014-06-01

    Full Text Available Sick leave due to stress-related disorders is increasing in Sweden after a period of decrease. To avoid that individuals living under heavy stress develop more severe stress-related disorders, different stress management interventions are offered. Self-assessed health, burnout-scores and well-being are commonly used as outcome measures. Few studies have used sick-leave to compare effects of stress interventions. A new approach is to use nature and garden in a multimodal stress management context. This study aimed to explore effects on burnout, work ability, stress-related health symptoms, and sick leave for 33 women participating in a 12-weeks nature based stress management course and to investigate how the nature/garden activities were experienced. A mixed method approach was used. Measures were taken at course start and three follow-ups. Results showed decreased burnout-scores and long-term sick leaves, and increased work ability; furthermore less stress-related symptoms were reported. Tools and strategies to better handle stress were achieved and were widely at use at all follow-ups. The garden and nature content played an important role for stress relief and for tools and strategies to develop. The results from this study points to beneficial effects of using garden activities and natural environments in a stress management intervention.

  15. Nature-Based Stress Management Course for Individuals at Risk of Adverse Health Effects from Work-Related Stress—Effects on Stress Related Symptoms, Workability and Sick Leave

    Science.gov (United States)

    Sahlin, Eva; Ahlborg, Gunnar; Vega Matuszczyk, Josefa; Grahn, Patrik

    2014-01-01

    Sick leave due to stress-related disorders is increasing in Sweden after a period of decrease. To avoid that individuals living under heavy stress develop more severe stress-related disorders, different stress management interventions are offered. Self-assessed health, burnout-scores and well-being are commonly used as outcome measures. Few studies have used sick-leave to compare effects of stress interventions. A new approach is to use nature and garden in a multimodal stress management context. This study aimed to explore effects on burnout, work ability, stress-related health symptoms, and sick leave for 33 women participating in a 12-weeks nature based stress management course and to investigate how the nature/garden activities were experienced. A mixed method approach was used. Measures were taken at course start and three follow-ups. Results showed decreased burnout-scores and long-term sick leaves, and increased work ability; furthermore less stress-related symptoms were reported. Tools and strategies to better handle stress were achieved and were widely at use at all follow-ups. The garden and nature content played an important role for stress relief and for tools and strategies to develop. The results from this study points to beneficial effects of using garden activities and natural environments in a stress management intervention. PMID:25003175

  16. Evaluation of nitrogen status and total chlorophyll in longkong (Aglaia dookkoo Griff. leaves under water stress using a chlorophyll meter

    Directory of Open Access Journals (Sweden)

    Sdoodee, S.

    2005-07-01

    Full Text Available A chlorophyll meter (SPAD-502 was used to assess nitrogen status and total chlorophyll in longkong leaves, leaves from twelve of 10-year-old trees grown in the experimental plot at Prince of Songkla University, Songkhla province. The relationship between SPAD-502 meter reading and nitrogen status and total chlorophyll content analyzed in the laboratory was evaluated during 8 months (May-December 2003. It was found that the trend of the relationships in each month was similar. There was no significant differenceamong regression linears of all months. The data of 8 months showed that SPAD-reading and nitrogen content, and SPAD-reading and total chlorophyll content were related in a positive manner. They were Y = 0.19X+10.10, r = 0.76** (n = 240, and Y = 0.43X-7.89, r = 0.79** (n = 400, respectively. The SPAD-502 was then used to assess total nitrogen and total chlorophyll content during imposed water stress. Fifteen 4-yearold plants were grown in pots (each pot containing 50 kg soil volume. The experiment was arranged in acompletely randomized design with 3 treatments: (1 daily watering (2 once watering on day 7 (3 no watering with 5 replications during 14 days of the experimental period. Measurements showed a continuous decrease of SPAD-reading in the treatment of no watering. On day 14, a significant difference of SPAD- reading values between the treatment of daily watering and no watering was found. Then, the values of nitrogen content and total chlorophyll were assessed by using the linear regression equations. From the result, it is suggested that the measurement by chlorophyll meter is a rapid technique for the evaluation of total chlorophyll and nitrogen status in longkong leaves during water stress.

  17. Selection of grapevine leaf varieties for culinary process based on phytochemical composition and antioxidant properties.

    Science.gov (United States)

    Lima, Adriano; Bento, Albino; Baraldi, Ilton; Malheiro, Ricardo

    2016-12-01

    Grapevine leaves are an abundant sub-product of vineyards which is devalued in many regions. The objective of this work is to study the antioxidant activity and phytochemical composition of ten grapevine leaf varieties (four red varieties: Tinta Amarela, Tinta Roriz, Touriga Franca, and Touriga Nacional; and six white varieties: Côdega do Larinho, Fernão Pires, Gouveio, Malvasia Fina, Rabigato, and Viosinho) to select varieties to be used as food ingredients. White grapevine leaves revealed higher antioxidant potential. Malvasia Fina reported better antioxidant properties contrasting with Touriga Franca. Phenolic content varied between 112 and 150mgGAEg(-1) of extract (gallic acid equivalents), hydroxycinnamic acid derivatives and flavonols varied between 76 and 108mgCAEg(-1) of extract (caffeic acid equivalents) and 39 and 54mgQEg(-1) of extract (quercetin equivalents). Malvasia Fina is a good candidate for culinary treatment due to its antioxidant properties and composition in bioactive compounds. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Determination of oxidative stress in wheat leaves as influenced by boron toxicity and NaCl stress.

    Science.gov (United States)

    Masood, Sajid; Saleh, Livia; Witzel, Katja; Plieth, Christoph; Mühling, Karl H

    2012-07-01

    Boron (B) toxicity symptoms are visible in the form of necrotic spots and may worsen the oxidative stress caused by salinity. Hence, the interactive effects of combined salinity and B toxicity stress on antioxidative activities (TAC, LUPO, SOSA, CAT, and GR) were investigated by novel luminescence assays and standard photometric procedures. Wheat plants grown under hydroponic conditions were treated with 2.5 μM H₃BO₃ (control), 75 mM NaCl, 200 μM H₃BO₃, or 75 mM NaCl + 200 μM H₃BO₃, and analysed 6 weeks after germination. Shoot fresh weight (FW), shoot dry weight (DW), and relative water content (RWC) were significantly reduced, whereas the antioxidative activity of all enzymes was increased under salinity compared with the control. High B application led to necrotic leaf spots but did not influence growth parameters. Following NaCl + B treatment, shoot DW, RWC, SOSA, GR, and CAT activities remained the same compared with NaCl alone, whereas the TAC and LUPO activities were increased under the combined stress compared with NaCl alone. However, shoot FW was significantly reduced under NaCl + B compared with NaCl alone, as an additive effect of combined stress. Thus, we found an adjustment of antioxidative enzyme activity to the interactive effects of NaCl and high B. The stress factor "salt" mainly produced more oxidative stress than that of the factor "high B". Furthermore, addition of higher B in the presence of NaCl increases TAC and LUPO demonstrating that increased LUPO activity is an important physiological response in wheat plants against multiple stresses. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  19. Biochemical method for fast affinity diagnosis in grape-vine transplantation

    International Nuclear Information System (INIS)

    Lilov, D.

    1977-01-01

    Long term experiments have proved the affinity of cv. Mavroud in transplantations on various root stocks. Best affinity was observed in the combination cv. Mavroud X Riparia tomanteau, followed, in a descending order, by the combinations Mavroud X Mavroud (autotransplantation), Mavroud X Berlandieri X Riparia Kobber SBB and Mavroud X Riparia 33 EM. In view to establish indices for predicting the transplantation affinity a great number of physiological-biochemical and morphological-anatomical studies were carried out. The results obtained showed that a most clearly expressed positive, statistically significant correlation exists between the amount of 15 N transported from the root stock to the scions, shoots and leaves. As a result, a biochemical method for fast affinity diagnosis in grape-vine transplantation has been developed. The reliability of the method has been checked up also with other cultivars. Up to the present no such method was known in grape-vine science and practice. (author)

  20. Dietary l-tryptophan leaves a lasting impression on the brain and the stress response

    DEFF Research Database (Denmark)

    Höglund, Erik; Øverli, Øyvind; Åberg Andersson, Madelene

    2017-01-01

    Comparative models suggest that effects of dietary tryptophan (Trp) on brain serotonin (5-hydroxytryptamine; 5-HT) neurochemistry and stress responsiveness are present throughout the vertebrate lineage. Moreover, hypothalamic 5-HT seems to play a central role in control of the neuroendocrine stre...

  1. Everyday hassles and uplifts among women on long-term sick-leave due to stress-related disorders.

    Science.gov (United States)

    Johansson, Gun; Eklund, Mona; Erlandsson, Lena-Karin

    2012-05-01

    A balance between different experiences of occupations in everyday life is important for well-being. The study aim was to describe hassles and uplifts in everyday occupations among women on long-term sick-leave due to stress-related disorders. The sample consisted of 77 women and experiences were collected by the THU-5 instrument. The statements were analysed using quantitative content analysis. Data were categorized into three domains of hassles concerning oneself, doings, and social and physical context. The same domains occurred among the uplifts. Hassles were mostly generated by disturbing people around the women and by their limited body functions. The women were uplifted by supportive social relationships and by performing relaxing and calming occupations. The study illuminates the strong need for social support among women on sick-leave, as well as their low level of energy, which was an obvious obstacle for performing occupations. It is suggested that, in order to increase well-being in the target group, the occupational therapist should meet their need for occupations that match their current level of energy. The challenge for the client is to avoid remaining in a pattern of low-demand occupations without exceeding her/his capacity and returning to an unhealthy pattern of occupations.

  2. The Mediator Effect Of Depression Level On The Effects Of Work Stress On The Intention Of Leaving Employment Among Education Employee

    Directory of Open Access Journals (Sweden)

    Ahmet Cezmi SAVAS

    2017-12-01

    Full Text Available The purpose of this study is to investigate the effects of depression level on the effects of work stress on the intention of leaving employment among education employee. The sample of the current research includes 67 principals, 79 assistant principals, and 163 teachers who work in various schools in the city center of Gaziantep during 2013-2014 education year. It was found that work stress and depression level were significant predictors of intention of leaving employment. Based on the results that the mediator effect of depression level when the level of work stress of education employee is predicting the intention of leaving of employment, it was found the level of depression is a mediator, and related solutions are presented.

  3. Comparing Kaolin and Pinolene to Improve Sustainable Grapevine Production during Drought

    OpenAIRE

    Brillante, Luca; Belfiore, Nicola; Gaiotti, Federica; Lovat, Lorenzo; Sansone, Luigi; Poni, Stefano; Tomasi, Diego

    2016-01-01

    Viticulture is widely practiced in dry regions, where the grapevine is greatly exposed to water stress. Optimizing plant water use efficiency (WUE) without affecting crop yield, grape and wine quality is crucial to limiting use of water for irrigation and to significantly improving viticulture sustainability. This study examines the use in vineyards of particle film technology (engineered kaolin) and compares it to a film-forming antitranspirant (pinolene), traditionally used to limit leaf wa...

  4. Exogenous strigolactone interacts with abscisic acid-mediated accumulation of anthocyanins in grapevine berries

    Czech Academy of Sciences Publication Activity Database

    Ferrero, M.; Pagliarani, C.; Novák, Ondřej; Ferrandino, A.; Cardinale, F.; Visentin, I.; Schubert, A.

    2018-01-01

    Roč. 69, č. 9 (2018), s. 2391-2401 ISSN 0022-0957 Institutional support: RVO:61389030 Keywords : vitis-vinifera l. * cabernet-sauvignon * seed-germination * drought stress * nonclimacteric fruit * lotus-japonicus * gene-expression * plant hormones * analog gr24 * biosynthesis * ABA conjugation * ABA hydroxylases * ABA transporters * abscisic acid * anthocyanin * grapevine * gr24 * ripening * strigolactones Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 5.830, year: 2016

  5. Osmotic Adjustment in Leaves of VA Mycorrhizal and Nonmycorrhizal Rose Plants in Response to Drought Stress.

    Science.gov (United States)

    Augé, R M; Schekel, K A; Wample, R L

    1986-11-01

    Osmotic adjustment in Rosa hybrida L. cv Samantha was characterized by the pressure-volume approach in drought-acclimated and unacclimated plants brought to the same level of drought strain, as assayed by stomatal closure. Plants were colonized by either of the vesicular-arbuscular mycorrhizal fungi Glomus deserticola Trappe, Bloss and Menge or G. intraradices Schenck and Smith, or were nonmycorrhizal. Both the acclimation and the mycorrhizal treatments decreased the osmotic potential (Psi(pi)) of leaves at full turgor and at the turgor loss point, with a corresponding increase in pressure potential at full turgor. Mycorrhizae enabled plants to maintain leaf turgor and conductance at greater tissue water deficits, and lower leaf and soil water potentials, when compared with nonmycorrhizal plants. As indicated by the Psi(pi) at the turgor loss point, the active Psi(pi) depression which attended mycorrhizal colonization alone was 0.4 to 0.6 megapascals, and mycorrhizal colonization and acclimation in concert 0.6 to 0.9 megapascals, relative to unacclimated controls without mycorrhizae. Colonization levels and sporulation were higher in plants subjected to acclimation. In unacclimated hosts, leaf water potential, water saturation deficit, and soil water potential at a particular level of drought strain were affected most by G. intraradices. G. deserticola had the greater effect after drought preconditioning.

  6. Humidity-dependent wound sealing in succulent leaves of Delosperma cooperi - An adaptation to seasonal drought stress.

    Science.gov (United States)

    Speck, Olga; Schlechtendahl, Mark; Borm, Florian; Kampowski, Tim; Speck, Thomas

    2018-01-01

    During evolution, plants evolved various reactions to wounding. Fast wound sealing and subsequent healing represent a selective advantage of particular importance for plants growing in arid habitats. An effective self-sealing function by internal deformation has been found in the succulent leaves of Delosperma cooperi. After a transversal incision, the entire leaf bends until the wound is closed. Our results indicate that the underlying sealing principle is a combination of hydraulic shrinking and swelling as the main driving forces and growth-induced mechanical pre-stresses in the tissues. Hydraulic effects were measured in terms of the relative bending angle over 55 minutes under various humidity conditions. The higher the relative air humidity, the lower the bending angle. Negative bending angles were found when a droplet of liquid water was applied to the wound. The statistical analysis revealed highly significant differences of the single main effects such as "humidity conditions in the wound region" and "time after wounding" and their interaction effect. The centripetal arrangement of five tissue layers with various thicknesses and significantly different mechanical properties might play an additional role with regard to mechanically driven effects. Injury disturbs the mechanical equilibrium, with pre-stresses leading to internal deformation until a new equilibrium is reached. In the context of self-sealing by internal deformation, the highly flexible wide-band tracheids, which form a net of vascular bundles, are regarded as paedomorphic tracheids, which are specialised to prevent cell collapse under drought stress and allow for building growth-induced mechanical pre-stresses.

  7. Studying of Salinity Stress Effect on Germination, Proline, Sugar, Protein, Lipid and Chlorophyll Content in Purslane (Portulaca oleracea L. Leaves

    Directory of Open Access Journals (Sweden)

    Parvaneh Rahdari

    2012-04-01

    Full Text Available Approximately 30% of country regions are under influence of salt and one of the main important methods for increasing of hectare performance in salt soils, using of resistant plant against with salt such as medicinal annual plant of Purslane (Portulaca oleraceae L..Studying of the salt stress effect on germination and some physiological parameters in Purslane was carried out in completely random framework and with three replications and under controlled conditions. In this study, salinity was imposed by sodium chloride (NaCl and in five levels of framework included of Control (distilled water, 50, 100, 150 and 200 Mmol from NaCl. Studied physiological parameters included of proline, sugar, protein, lipid and chlorophyll in Purslane leaves.In relation with observed germination that increasing of salt level, germination rate was reduced that the least germination rate in 200 Mmol and the highest germination was observed in control which in statistical level 0.01 showed meaningful difference. Also, results showed an increasing of leaf proline and sugar that was synchronize with increasing of sodium chloride, this increasing in statistical level of P<0.01 was meaningful, while blank had the least rate and salt level 200 Mmol was observed. Synchronize with increasing of salinity level, lipid and protein concentration decreasing that was meaningful (P<0.01 which highest of leaf lipid and protein content in control level and least concentration was observed in 200 Mmol of salinity level. Also, salinity stress due to increasing of chlorophyll a and b levels in Purslane leaves which this increasing in leaf chlorophyll b concentrations in 0.01 statistical level was meaningful and the least level chlorophyll a and b in blank and the highest level of chlorophyll a and b by order in 150 and 200 Mmol of NaCl was observed. The results showed that plant for resistance against salinity increasing of proline, sugar and chlorophyll content in leaves are useful for

  8. Lycium chinense leaves extract ameliorates diabetic nephropathy by suppressing hyperglycemia mediated renal oxidative stress and inflammation.

    Science.gov (United States)

    Olatunji, Opeyemi Joshua; Chen, Hongxia; Zhou, Yifeng

    2018-06-01

    Diabetic nephropathy is one of the most serious and most frequently encountered diabetic complication, accounting for the highest cause of end-stage renal disease. This present study was aimed at exploring the protective/attenuative effect of Lycium chinense leaf extract (MELC) on streptozotocin induced diabetic nephropathy in experimental Sprague Dawley rats. The oral administration of diabetic rats with MELC markedly ameliorated renal dysfunction as observed in the significant reduction in the serum levels of creatinine, blood urea nitrogen (BUN), albumin and TGF-β1 as compared to the untreated diabetic control rats. In addition, the elevated levels of renal oxidative stress markers and pro-inflammatory parameters (GSH, SOD, CAT, MDA, TNF-α, IL-6 and IL-1β) were significantly reduced in MELC treated diabetic rats. The results obtained in this study suggests that L. chinense leaf might have the potential as possible pharmacological agent against diabetic nephropathy by suppressing renal oxidative stress and inflammation. Copyright © 2018. Published by Elsevier Masson SAS.

  9. Grapevine leafroll-associated virus 3

    Directory of Open Access Journals (Sweden)

    Hans J. Maree

    2013-04-01

    Full Text Available Grapevine leafroll disease (GLD is one of the most important grapevine viral diseases affecting grapevines worldwide. The impact on vine health, crop yield and quality is difficult to assess due to a high number of variables, but significant economic losses are consistently reported over the lifespan of a vineyard if intervention strategies are not implemented. Several viruses from the family Closteroviridae are associated with GLD. However, Grapevine leafroll-associated virus 3 (GLRaV-3, the type species for the genus Ampelovirus, is regarded as the most important causative agent. Here we provide a general overview on various aspects of GLRaV-3, with an emphasis on the latest advances in the characterization of the genome. The full genome of several isolates have recently been sequenced and annotated, revealing the existence of several genetic variants. The classification of these variants, based on their genome sequence, will be discussed and a guideline is presented to facilitate future comparative studies. The characterization of sgRNAs produced during the infection cycle of GLRaV-3 has given some insight into the replication strategy and the putative functionality of the ORFs. The latest nucleotide sequence based molecular diagnostic techniques were shown to be more sensitive than conventional serological assays and although ELISA is not as sensitive it remains valuable for high-throughput screening and complementary to molecular diagnostics. The application of next-generation sequencing is proving to be a valuable tool to study the complexity of viral infection as well as plant-pathogen interaction. Next-generation sequencing data can provide information regarding disease complexes, variants of viral species, and abundance of particular viruses. This information can be used to develop more accurate diagnostic assays. Reliable virus screening in support of robust grapevine certification programs remains the cornerstone of GLD management.

  10. Abscisic Acid-Induced H2O2 Accumulation Enhances Antioxidant Capacity in Pumpkin-Grafted Cucumber Leaves under Ca(NO3)2 Stress

    Science.gov (United States)

    Shu, Sheng; Gao, Pan; Li, Lin; Yuan, Yinghui; Sun, Jin; Guo, Shirong

    2016-01-01

    With the aim to clarifying the role of the ABA/H2O2 signaling cascade in the regulating the antioxidant capacity of grafted cucumber plants in response to Ca(NO3)2 stress, we investigated the relationship between ABA-mediated H2O2 production and the activities of antioxidant enzymes in the leaves of pumpkin-grafted cucumber seedlings. The results showed that both ABA and H2O2 were detected in pumpkin-grafted cucumber seedlings in response to Ca(NO3)2 treatment within 0.5 h in the leaves and peaked at 3 and 6 h after Ca(NO3)2 treatment, respectively, compared to the levels under control conditions. The activities of superoxide dismutase (SOD), ascorbate peroxidase (APX), and peroxidase (POD) in pumpkin-grafted cucumber leaves gradually increased over time and peaked at 12 h of Ca(NO3)2 stress. Furthermore, in the leaves of pumpkin-grafted cucumber seedlings, the H2O2 generation, the antioxidant enzyme activities and the expression of SOD, POD and cAPX were strongly blocked by an inhibitor of ABA under Ca(NO3)2 stress, but this effect was eliminated by the addition of exogenous ABA. Moreover, the activities and gene expressions of these antioxidant enzymes in pumpkin-grafted leaves were almost inhibited under Ca(NO3)2 stress by pretreatment with ROS scavengers. These results suggest that the pumpkin grafting-induced ABA accumulation mediated H2O2 generation, resulting in the induction of antioxidant defense systems in leaves exposed to Ca(NO3)2 stress in the ABA/H2O2 signaling pathway. PMID:27746808

  11. Protective Effect of γ-Irradiated Dried Powder of Artichoke Leaves against CCl4 Oxidative Stress Induced in Rat Liver

    International Nuclear Information System (INIS)

    Hamza, R.G.; El shahat, A.N.; Mekawey, H.M.S.

    2012-01-01

    Liver injuries are one of the most degenerative worldwide diseases and can lead to different complications. Artichoke (Cynara scolymus L.) is full of natural antioxidants and has hepato protective effect against liver toxicity. Gamma irradiation has been widely used as a first choice sterilization method of raw medicinal plants to be used in the phytotherapic industry worldwide .This study was designed to investigate the effect of dietary supplementation with γ- irradiated artichoke against carbon tetrachloride (CCl 4 )-induced oxidative stress and hepatotoxicity. The results of high performance liquid chromatography (HPLC) analysis of artichoke leaves indicated that the value of some of the main phenolic constituents was elevated under the effect of γ-irradiation (10 KGy). CCl 4 administration resulted in significant increase in the activity of serum alkaline phosphatase, gamma glutamyl transferase and transaminase in addition to an increase in the level of total bilirubine, malondialdehyde (MDA), glucose and the concentration of some lipid contents. Furthermore, CCl 4 administration reduced glutathione content, superoxides dismutase (SOD) and catalase (CAT) activity as well as a remarkable decrease in the level of insulin and high density lipoprotein-cholesterol was observed. In CCl 4 -treated rats dietary supplemented with either raw or γ-irradiated artichoke, a significant amelioration was observed on the adverse effects of the above mentioned parameters induced by CCl 4 administration. The present findings concluded that artichoke may be useful, as dietary supplement and possess phenolic compounds, for the prevention of oxidative stress-induced hepatotoxicity

  12. Water stress assessment of cork oak leaves and maritime pine needles based on LIF spectra

    Science.gov (United States)

    Lavrov, A.; Utkin, A. B.; Marques da Silva, J.; Vilar, Rui; Santos, N. M.; Alves, B.

    2012-02-01

    The aim of the present work was to develop a method for the remote assessment of the impact of fire and drought stress on Mediterranean forest species such as the cork oak ( Quercus suber) and maritime pine ( Pinus pinaster). The proposed method is based on laser induced fluorescence (LIF): chlorophyll fluorescence is remotely excited by frequency-doubled YAG:Nd laser radiation pulses and collected and analyzed using a telescope and a gated high sensitivity spectrometer. The plant health criterion used is based on the I 685/ I 740 ratio value, calculated from the fluorescence spectra. The method was benchmarked by comparing the results achieved with those obtained by conventional, continuous excitation fluorometric method and water loss gravimetric measurements. The results obtained with both methods show a strong correlation between them and with the weight-loss measurements, showing that the proposed method is suitable for fire and drought impact assessment on these two species.

  13. Grapevine acclimation to water deficit: the adjustment of stomatal and hydraulic conductance differs from petiole embolism vulnerability.

    Science.gov (United States)

    Hochberg, Uri; Bonel, Andrea Giulia; David-Schwartz, Rakefet; Degu, Asfaw; Fait, Aaron; Cochard, Hervé; Peterlunger, Enrico; Herrera, Jose Carlos

    2017-06-01

    Drought-acclimated vines maintained higher gas exchange compared to irrigated controls under water deficit; this effect is associated with modified leaf turgor but not with improved petiole vulnerability to cavitation. A key feature for the prosperity of plants under changing environments is the plasticity of their hydraulic system. In the present research we studied the hydraulic regulation in grapevines (Vitis vinifera L.) that were first acclimated for 39 days to well-watered (WW), sustained water deficit (SD), or transient-cycles of dehydration-rehydration-water deficit (TD) conditions, and then subjected to varying degrees of drought. Vine development under SD led to the smallest leaves and petioles, but the TD vines had the smallest mean xylem vessel and calculated specific conductivity (k ts ). Unexpectedly, both the water deficit acclimation treatments resulted in vines more vulnerable to cavitation in comparison to WW, possibly as a result of developmental differences or cavitation fatigue. When exposed to drought, the SD vines maintained the highest stomatal (g s ) and leaf conductance (k leaf ) under low stem water potential (Ψ s ), despite their high xylem vulnerability and in agreement with their lower turgor loss point (Ψ TLP ). These findings suggest that the down-regulation of k leaf and g s is not associated with embolism, and the ability of drought-acclimated vines to maintain hydraulic conductance and gas exchange under stressed conditions is more likely associated with the leaf turgor and membrane permeability.

  14. ER stress-induced protein, VIGG, disturbs plant cation homeostasis, which is correlated with growth retardation and robustness to ER stress

    International Nuclear Information System (INIS)

    Katoh, Hironori; Fujita, Keiko; Takuhara, Yuki; Ogawa, Atsushi; Suzuki, Shunji

    2011-01-01

    Highlights: → VIGG is an ER stress-induced protein in plant. → We examine the characteristics of VIGG-overexpressing Arabidopsis plants. → VIGG-overexpressing plants reveal growth retardation and robustness to ER stress. → VIGG disturbs cation homeostasis in plant. -- Abstract: VIGG is a putative endoplasmic reticulum (ER) resident protein induced by virus infection and ER stress, and is correlated with fruit quality in grapevine. The present study was undertaken to determine the biological function of VIGG in grapevine. Experiments using fluorescent protein-VIGG fusion protein demonstrated that VIGG is localized in ER and the ER targeting sequence is in the N-terminus. The overexpression of VIGG in Arabidopsis plant led to growth retardation. The rosette leaves of VIGG-overexpressing plants were smaller than those of the control plants and rolled at 42 days after seeding. VIGG-overexpressing plants revealed robustness to ER stress as well as the low expression of ER stress marker proteins, such as the luminal binding proteins. These characteristics of VIGG-overexpressing plants were supported by a microarray experiment that demonstrated the disruption of genes related to ER stress response and flowering, as well as cation mobility, in the plants. Finally, cation homeostasis in the plants was disturbed by the overexpression of VIGG. Taken together, these results suggest that VIGG may disturb cation homeostasis in plant, which is correlated with the robustness to ER stress and growth retardation.

  15. ER stress-induced protein, VIGG, disturbs plant cation homeostasis, which is correlated with growth retardation and robustness to ER stress

    Energy Technology Data Exchange (ETDEWEB)

    Katoh, Hironori; Fujita, Keiko; Takuhara, Yuki [Laboratory of Fruit Genetic Engineering, The Institute of Enology and Viticulture, University of Yamanashi, Kofu, Yamanashi 400-0005 (Japan); Ogawa, Atsushi [Department of Biological Production, Akita Prefectural University, Shimosinjyou-nakano 241-438, Akita 010-0195 (Japan); Suzuki, Shunji, E-mail: suzukis@yamanashi.ac.jp [Laboratory of Fruit Genetic Engineering, The Institute of Enology and Viticulture, University of Yamanashi, Kofu, Yamanashi 400-0005 (Japan)

    2011-02-18

    Highlights: {yields} VIGG is an ER stress-induced protein in plant. {yields} We examine the characteristics of VIGG-overexpressing Arabidopsis plants. {yields} VIGG-overexpressing plants reveal growth retardation and robustness to ER stress. {yields} VIGG disturbs cation homeostasis in plant. -- Abstract: VIGG is a putative endoplasmic reticulum (ER) resident protein induced by virus infection and ER stress, and is correlated with fruit quality in grapevine. The present study was undertaken to determine the biological function of VIGG in grapevine. Experiments using fluorescent protein-VIGG fusion protein demonstrated that VIGG is localized in ER and the ER targeting sequence is in the N-terminus. The overexpression of VIGG in Arabidopsis plant led to growth retardation. The rosette leaves of VIGG-overexpressing plants were smaller than those of the control plants and rolled at 42 days after seeding. VIGG-overexpressing plants revealed robustness to ER stress as well as the low expression of ER stress marker proteins, such as the luminal binding proteins. These characteristics of VIGG-overexpressing plants were supported by a microarray experiment that demonstrated the disruption of genes related to ER stress response and flowering, as well as cation mobility, in the plants. Finally, cation homeostasis in the plants was disturbed by the overexpression of VIGG. Taken together, these results suggest that VIGG may disturb cation homeostasis in plant, which is correlated with the robustness to ER stress and growth retardation.

  16. Oxidative Stress Induction by Lead in Leaves of Radish (Raphanus sativus Seedlings

    Directory of Open Access Journals (Sweden)

    Nadjet BITEUR

    2011-11-01

    Full Text Available Oxidative stress was induced by lead acetate (Pb in Raphanus sativus seedlings grown in a hydroponic system using sand as substrate. Thirty day old acclimated seeds were treated for 7 days with five Pb levels (0 as control, 100, 200, 500 and 1000 mg l-1. Parameters such as growth, oxidative damage markers (lipid peroxidation, protein oxidation and hydrogen peroxide contents and enzymatic activities of catalase (CAT and peroxidase (POD were investigated. Lead concentration in plant tissues increased with increasing of Pb levels. Shoot fresh weight, chlorophyll and carotenoid concentration were significantly decreased at 100 mg l-1 Pb. Lipid peroxidation, protein oxidation and H2O2 levels were increased at 500 and 1000 mg l-1 Pb compared to control treatment, in shoots. Peroxidase activity showed a straight correlation with H2O2 concentration, whereas CAT activity decreased only in shoots. These changes in enzymatic and non-enzymatic antioxidants showed that the Pb exposition had a significant disturbance on Raphanus sativus plantlets and affect the biochemical and physiological processes.

  17. Response of oxidative stress defense systems in rice (Oryza sativa) leaves with supplemental UV-B radiation

    International Nuclear Information System (INIS)

    Dai, Q.; Yan, B.; Huang, S.; Liu, X.; Peng, S.; Miranda, M.L.L.; Chavez, A.Q.; Vergara, B.S.; Olszyk, D.M.

    1997-01-01

    The impact of elevated ultraviolet-B radiation (UV-B, 280–320 nm) on membrane systems and lipid peroxidation, and possible involvement of active oxygen radicals was investigated in leaves of two UV-B susceptible rice cultivars (Oryza sativa L. cvs IR74 and Dular). Rice seedlings were grown in a greenhouse for 10 days and then treated with biologically effective UV-B (UV-B BE ) radiation for 28 days. Oxidative stress effects were evaluated by measuring superoxide anion (O 2 ) generation rate, hydrogen peroxide (H 2 O 2 ) content, malondialdehyde (MDA) concentration and relative electrolyte conductivity (EC) for IR74 and Dular at 0 (control), 6 or 13 kJ m −2 day −1 UV-B BE . Significant increases in these parameters were found in rice plants grown at 13 vs 0 kJ m −2 day −1 UV-B BE after 28 days; indicating that disruption of membrane systems may be an eventual reason for UV-B-induced injury in rice plants. There was a positive correlation between O 2 − generation and increases in EC or MDA in leaves. Activities of enzymatic and nonenzymatic free radical scavengers were measured for IR74 after 7, 14, 21 and 28 days of exposure to 13 or 0 UV-B BE to evaluate dynamics of these responses over time. Activities of catalase and superoxide dismutase (but not ascorbate peroxidase) and concentrations of ascorbic acid and glutathione were enhanced by 13 vs 0 UV-B BE after 14 days of UV-B exposure. Further exposure to 28 days of UV-B was associated with a decline in enzyme activities and ascorbic acid, but not glutathione. It is suggested that UV-B-induced injury may be associated with disturbance of active oxygen metabolism through the destruction and alteration of both enzymatic and nonenzymatic defense systems in rice. (author)

  18. The effect of reclaimed wastewater on the quality and growth of grapevines.

    Science.gov (United States)

    Mendoza-Espinosa, L G; Cabello-Pasini, A; Macias-Carranza, V; Daessle-Heuser, W; Orozco-Borbón, M V; Quintanilla-Montoya, A L

    2008-01-01

    The effect of the use of treated wastewater on the growth of cabernet sauvignon and merlot grapes from the Guadalupe Valley, Mexico was evaluated. Secondary advanced effluent was used to irrigate the grapevines at a rate of 66 L/vine/week. Wastewater quality results confirmed that all parameters complied with Mexican legislation for crop irrigation as well as reuse in activities in which the public would be in direct or indirect contact with the reclaimed water. Results showed that the number of leaves per shoot and the overall biomass increased in plants irrigated with wastewater and grape production per plant was 20% higher. The concentration of carbohydrates, organic acids and pH were similar in grapes from vines irrigated with wastewater to those irrigated with groundwater. Throughout the experiment, no fecal coliform bacteria were detected in the cultivated grapes. The wastewater caused an increase in the biomass of the grapevines and there was no presence of microbial indicators in the final product so a higher wine production could be achieved without an increase in health risk related problems. If 200 L/s of reclaimed wastewater would be returned to be used for grapevine irrigation in Valle de Guadalupe (the same amount that is currently being sent as drinking water to Ensenada), assuming an irrigation application of 6,000-7.500 m3/ha/year, approximately 837-1046 hectares (ha) of grapevines could be irrigated. Part of ongoing research includes an economical analysis of the best options for Ensenada and the Valle de Guadalupe in order to establish the optimum volume of water to be returned, the cost of its transportation, as well as the cost of irrigation. (c) IWA Publishing 2008.

  19. Quantitative and qualitative characteristics of cell wall components and prenyl lipids in the leaves of Tilia x euchlora trees growing under salt stress.

    Science.gov (United States)

    Milewska-Hendel, Anna; Baczewska, Aneta H; Sala, Katarzyna; Dmuchowski, Wojciech; Brągoszewska, Paulina; Gozdowski, Dariusz; Jozwiak, Adam; Chojnacki, Tadeusz; Swiezewska, Ewa; Kurczynska, Ewa

    2017-01-01

    The study was focused on assessing the presence of arabinogalactan proteins (AGPs) and pectins within the cell walls as well as prenyl lipids, sodium and chlorine content in leaves of Tilia x euchlora trees. The leaves that were analyzed were collected from trees with and without signs of damage that were all growing in the same salt stress conditions. The reason for undertaking these investigations was the observations over many years that indicated that there are trees that present a healthy appearance and trees that have visible symptoms of decay in the same habitat. Leaf samples were collected from trees growing in the median strip between roadways that have been intensively salted during the winter season for many years. The sodium content was determined using atomic spectrophotometry, chloride using potentiometric titration and poly-isoprenoids using HPLC/UV. AGPs and pectins were determined using immunohistochemistry methods. The immunohistochemical analysis showed that rhamnogalacturonans I (RG-I) and homogalacturonans were differentially distributed in leaves from healthy trees in contrast to leaves from injured trees. In the case of AGPs, the most visible difference was the presence of the JIM16 epitope. Chemical analyses of sodium and chloride showed that in the leaves from injured trees, the level of these ions was higher than in the leaves from healthy trees. Based on chromatographic analysis, four poly-isoprenoid alcohols were identified in the leaves of T. x euchlora. The levels of these lipids were higher in the leaves from healthy trees. The results suggest that the differences that were detected in the apoplast and symplasm may be part of the defensive strategy of T. x euchlora trees to salt stress, which rely on changes in the chemical composition of the cell wall with respect to the pectic and AGP epitopes and an increased synthesis of prenyl lipids.

  20. Effectiveness of a minimal intervention for stress-related mental disorders with sick leave (MISS): study protocol of a cluster randomised controlled trial in general practice [ISRCTN43779641

    NARCIS (Netherlands)

    Bakker, I.M.; Terluin, B.; van Marwijk, H.W.J.; Cundy, C.M.; Smit, J.H.; van Mechelen, W.; Stalman, W.A.B.

    2006-01-01

    Background: The main aims of this paper are to describe the setting and design of a Minimal Intervention in general practice for Stress-related mental disorders in patients on Sick leave (MISS), as well as to ascertain the study complies with the requirements for a cluster randomised controlled

  1. Early identification in primary health care of people at risk for sick leave due to work-related stress - study protocol of a randomized controlled trial (RCT).

    Science.gov (United States)

    Holmgren, Kristina; Sandheimer, Christine; Mårdby, Ann-Charlotte; Larsson, Maria E H; Bültmann, Ute; Hange, Dominique; Hensing, Gunnel

    2016-11-25

    Early identification of persons at risk of sickness absence due to work-related stress is a crucial problem for society in general, and primary health care in particular. Tho date, no established method to do this exists. This project's aim is to evaluate whether systematic early identification of work-related stress can prevent sickness absence. This paper presents the study design, procedure and outcome measurements, as well as allocation and baseline characteristics of the study population. The study is a two-armed randomized controlled trial with follow-up at 3, 6 and 12 months. Non-sick-listed employed women and men, aged 18 to 64 years, who had mental and physical health complaints and sought care at primary health care centers (PHCC) were eligible to participate. At baseline work-related stress was measured by the Work Stress Questionnaire (WSQ), combined with feedback at consultation, at PHCC. The preventive intervention included early identification of work-related stress by the WSQ, GP training in the use of WSQ, GP feedback at consultation and finding suitable preventive measures. A process evaluation was used to explore how to facilitate future implementation and structural use of the WSQ at the PHCC. The primary outcome to compare the preventive sick leave intervention by the general practitioner (GP) versus treatment as usual is sick leave data obtained from the Swedish Social Insurance Agency register. Early screening for sick leave due to work-related stress makes it possible not only to identify those at risk for sick leave, but also to put focus on the patient's specific work-related stress problems, which can be helpful in finding suitable preventive measures. This study investigates if use of the WSQ by GPs at PHCCs, combined with feedback at consultation, prevents future sickness absence. ClinicalTrials.gov. Identifier: NCT02480855 . Registered 20 May 2015.

  2. Stress amongst nurses working in a healthcare telephone-advice service: relationship with job satisfaction, intention to leave, sickness absence, and performance.

    Science.gov (United States)

    Farquharson, Barbara; Allan, Julia; Johnston, Derek; Johnston, Marie; Choudhary, Carolyn; Jones, Martyn

    2012-07-01

    This paper is a report of a study, which assessed levels of stress amongst nurses working in a healthcare telephone-advice service. We explored whether stress related to performance, sickness absence, and intention to leave. Nurses report high levels of stress, as do call-centre workers. The emergence of telephone health advice services means many nurses now work in call-centres, doing work that differs markedly from traditional nursing roles. Stress associated with these roles could have implications for nurses, patients, and service provision. This paper reports cross-sectional survey results. The design of the overall study included longitudinal elements. A comprehensive study of stress was conducted amongst nurses working for a telephone-advice service in Scotland (2008-2010). All nurse-advisors were approached by letter and invited to participate. A total of 152 participants (33%) completed a questionnaire including General Health Questionnaire-12, Work Family Conflict Questionnaire, Job Satisfaction Scale and a measure of intention to leave the telephone-advice service and rated the perceived stress of 2 working shifts. Nurses' employers provided data on sickness absence and performance. Overall levels of psychological distress were similar to those found amongst Scottish women generally. In multiple regression, work-family conflict was identified as a significant predictor of job satisfaction and intention to leave, and significantly related to sickness absence. There were significant correlations between General Health Questionnaire scores and perceived stress of shifts and some performance measures. Work-family conflict is a significant predictor of job satisfaction, intention to leave, and sickness absence amongst telephone helpline nurses. Minimizing the impact of nurses' work on their home lives might reduce turnover and sickness absence. © 2012 Blackwell Publishing Ltd.

  3. Grape yield, and must compounds of 'Cabernet Sauvignon' grapevine in sandy soil with potassium contents increasing

    Directory of Open Access Journals (Sweden)

    Marlise Nara Ciotta

    2016-08-01

    Full Text Available ABSTRACT: Content of exchangeable potassium (K in t soil may influence on its content in grapevines leaves, grape yield, as well as, in must composition. The study aimed to assess the interference of exchangeable K content in the soil on its leaf content, production and must composition of 'Cabernet Sauvignon' cultivar. In September 2011, in Santana do Livramento (RS five vineyards with increasing levels of exchangeable K in the soil were selected. In the 2012/13 and 2013/14 harvests, the grape yield, yield components, total K content in the leaves in full bloom and berries veraison were evaluated. Values of total soluble sugar (TSS, pH, total titratable acidity (TTA, total polyphenols and anthocyanins were evaluated in the must. Exchangeable K content increase in soil with sandy surface texture increased its content in leaves collected during full flowering and in berries and must pH; however, it did not affect production of the 'Cabernet Sauvignon'.

  4. Reduction of oxidative stress by an ethanolic extract of leaves of Piper betle (Paan) Linn. decreased methotrexate-induced toxicity.

    Science.gov (United States)

    De, Soumita; Sen, Tuhinadri; Chatterjee, Mitali

    2015-11-01

    Methotrexate (MTX), a folate antagonist, is currently used as first line therapy for autoimmune diseases like rheumatoid arthritis and psoriasis, but its use is limited by the associated hepatotoxicity. As leaves of Piper betle, belonging to family Piperaceae, have antioxidant and anti-inflammatory properties, the present study was undertaken to investigate the potential of Piper betle leaf extract (PB) in attenuating MTX-induced hepatotoxicity. Rats pre-treated with PB (50 or 100 mg kg(-1) b.w., p.o.) were administered with a single dose of MTX (20 mg kg(-1), b.w., i.p.) and its hepatoprotective efficacy was compared with folic acid (1 mg kg(-1) b.w., i.p.), conventionally used to minimize MTX-induced toxicity. MTX-induced hepatotoxicity was confirmed by increased activities of marker enzymes, alanine transaminase, aspartate transaminase, and alkaline phosphatase which were remitted by pre-treatment with PB and corroborated with histopathology. Additionally, MTX-induced hepatic oxidative stress which included increased generation of reactive oxygen species, enhanced lipid peroxidation, depleted levels of glutathione and decreased activities of antioxidant enzymes was effectively mitigated by PB, indicative that its promising antioxidant-mediated hepatoprotective activity was worthy of future pharmacological consideration.

  5. Identification, stress tolerance, and antioxidant activity of lactic acid bacteria isolated from tropically grown fruits and leaves.

    Science.gov (United States)

    Fessard, Amandine; Bourdon, Emmanuel; Payet, Bertrand; Remize, Fabienne

    2016-07-01

    From 6 samples of tropically grown fruits and leaves, 10 lactic acid bacteria belonging Leuconostoc, Weissella, and Lactobacillus species were isolated and identified by 16S rRNA gene sequencing and (GTG)5 fingerprinting. Acidification kinetics determined from BHI broth cultures showed genus-related patterns. In particular, Weissella cibaria appeared to act as a potent acidifier. Tolerance of isolates to acid, oxidative, or salt stress was highly variable and strain dependent. Isolate S14 (Leuconostoc pseudomesenteroides) growth was not affected by the presence of 0.05% H2O2, while Lactobacillus spp. isolates (S17 and S29) were the most tolerant to pH 4.5. The growth of 4 isolates, S5 (Leuconostoc mesenteroides), S14 and S10 (Leuconostoc pseudomesenteroides), and S27 (W. cibaria), was not affected by 5% NaCl. Nutritional beneficial properties were examined through measurement of antioxidant activities of short-term fermented pineapple juice, such as LDL oxidation and polyphenol content, and through exopolysaccharide formation from sucrose. Two isolates, S14 and S27, increased the antioxidant capacity of pineapple juice. The robust capacity of W. cibaria and of Leuconostoc pseudomesenteroides for vegetable lactic fermentation aimed to ameliorate food nutritional and functional quality was highlighted.

  6. Effectiveness of a Minimal Intervention for Stress-related mental disorders with Sick leave (MISS; study protocol of a cluster randomised controlled trial in general practice [ISRCTN43779641

    Directory of Open Access Journals (Sweden)

    van Marwijk Harm WJ

    2006-05-01

    Full Text Available Abstract Background The main aims of this paper are to describe the setting and design of a Minimal Intervention in general practice for Stress-related mental disorders in patients on Sick leave (MISS, as well as to ascertain the study complies with the requirements for a cluster randomised controlled trial (RCT. The potential adverse consequences of sick leave due to Stress-related Mental Disorders (SMDs are extensive, but often not recognised. Since most people having SMDs with sick leave consult their general practitioner (GP at an early stage, a tailored intervention given by GPs is justified. We provide a detailed description of the MISS; that is more accurate assessment, education, advice and monitoring to treat SMDs in patients on sick leave. Our hypothesis is that the MISS will be more effective compared to the usual care, in reducing days of sick leave of these patients. Methods The design is a pragmatic RCT. Randomisation is at the level of GPs. They received the MISS-training versus no training, in order to compare the MISS vs. usual care at patient level. Enrolment of patients took place after screening in the source population, that comprised 20–60 year old primary care attendees. Inclusion criteria were: moderately elevated distress levels, having a paid job and sick leave for no longer than three months. There is a one year follow up. The primary outcome measure is lasting full return to work. Reduction of SMD- symptoms is one of the secondary outcome measures. Forty-six GPs and 433 patients agreed to participate. Discussion In our study design, attention is given to the practical application of the requirements for a pragmatic trial. The results of this cluster RCT will add to the evidence about treatment options in general practice for SMDs in patients on sick leave, and might contribute to a new and appropriate guideline. These results will be available at the end of 2006.

  7. VTCdb: a gene co-expression database for the crop species Vitis vinifera (grapevine).

    Science.gov (United States)

    Wong, Darren C J; Sweetman, Crystal; Drew, Damian P; Ford, Christopher M

    2013-12-16

    ) whereby the recovered sub-networks reconfirm established plant gene functions and also identify novel associations. Together, we present valuable insights into grapevine transcriptional regulation by developing network models applicable to researchers in their prioritisation of gene candidates, for on-going study of biological processes related to grapevine development, metabolism and stress responses.

  8. A molecular approach to study the arbuscular mycorrhizal fungi community in a typical Piedmont grapevine cultivar

    Science.gov (United States)

    Magurno, F.; Bughi Peruglia, G.; Lumini, E.; Bianciotto, V.; Balestrini, R.

    2009-04-01

    Viticulture and wine production represent one of the most relevant agro-food sectors for the Piedmont Region (Italy) in terms of value, with more than 400 millions € a year (12 % of total agricultural production of the Region and the 10 % of the national grape and wine production). The soil where grapevines (Vitis spp.) grow is one of the first parameters influencing the complex grapevine-wine chain. Arbuscular mycorrhizal fungi (AMFs), a main component of soil microbiota in most agrosystems, are considered crucial biomarkers of soil quality because of their biofertilisers role. As mutualistic symbionts, they colonize the roots of the majority of plants. Benefits in symbiosis are well showed as an improvement in shoot/root growth, mineral transport, water-stress tolerance and resistance to certain diseases. Grapevines roots are often heavily colonized by AMFs under field conditions and in some cases AMFs appear to be necessary for their normal growth and survival. Even so, little information are until now available about composition of AMFs communities living in the vineyards soil and in associations with grapevine roots, mainly related to morphological characterization. Vineyard of Nebbiolo, one of the most important Piedmont cultivar, was selected in order to study the AMFs community using a molecular approach. Soil samples and roots from an experimental vineyard located in Lessona (Biella, Piedmont, Italy) were analyzed using AM fungal-specific primers to partially amplify the small subunit (SSU) of the ribosomal DNA genes. Much more than 650 clones were sequenced. Phylogenetic analyses identified 32 OTUs from soil, clustered into Glomus groups Aa, Ab, Ad and B, Diversisporaceae and Gigasporaceae families. Thirteen OTUs from roots were determined, clustered into Glomus groups Ab, Ad and B, and Gigasporaceae family. In particular, Glomus group Ad was the best represented in both compartments, suggesting a correlation between intra and extra radical communities

  9. iTRAQ-based quantitative proteomic analysis reveals proteomic changes in leaves of cultivated tobacco (Nicotiana tabacum) in response to drought stress.

    Science.gov (United States)

    Xie, He; Yang, Da-Hai; Yao, Heng; Bai, Ge; Zhang, Yi-Han; Xiao, Bing-Guang

    2016-01-15

    Drought is one of the most severe forms of abiotic stresses that threaten the survival of plants, including crops. In turn, plants dramatically change their physiology to increase drought tolerance, including reconfiguration of proteomes. Here, we studied drought-induced proteomic changes in leaves of cultivated tobacco (Nicotiana tabacum), a solanaceous plant, using the isobaric tags for relative and absolute quantitation (iTRAQ)-based protein labeling technology. Of identified 5570 proteins totally, drought treatment increased and decreased abundance of 260 and 206 proteins, respectively, compared with control condition. Most of these differentially regulated proteins are involved in photosynthesis, metabolism, and stress and defense. Although abscisic acid (ABA) levels greatly increased in drought-treated tobacco leaves, abundance of detected ABA biosynthetic enzymes showed no obvious changes. In contrast, heat shock proteins (HSPs), thioredoxins, ascorbate-, glutathione-, and hydrogen peroxide (H2O2)-related proteins were up- or down-regulated in drought-treated tobacco leaves, suggesting that chaperones and redox signaling are important for tobacco tolerance to drought, and it is likely that redox-induced posttranslational modifications play an important role in modulating protein activity. This study not only provides a comprehensive dataset on overall protein changes in drought-treated tobacco leaves, but also shed light on the mechanism by which solanaceous plants adapt to drought stress. Copyright © 2015 Yunnan Academy of Tobacco Agricultural Sciences. Published by Elsevier Inc. All rights reserved.

  10. The study of antioxidants in grapevine seeds

    Directory of Open Access Journals (Sweden)

    Lenka Tomášková

    2017-01-01

    Full Text Available Grapevine seeds contain a large amount of antioxidant components, and are therefore recommended in the prevention and treatment of many diseases. For this research, we studied the antioxidant properties of grapevine seeds from the Marlen variety, as evidence suggests that these types have higher resistance against fungal diseases. Through high-performance liquid chromatography with UV/VIS detection, a total of 10 antioxidant components were selected for further investigation, specifically: catechin, epicatechin, rutin, quercitrin, quercetin, caftaric acid, caffeic acid, p-coumaric acid, ferulic acid, and gallic acid. The antioxidant activity was determinated spectrophotometrically through the adoption of three fundamentally different methods (the DPPH assay, the ABTS method, and the FRAP method. Using the Folin-Ciocalteu method, it was possible to determine the content of all the polyphenolic compounds. The results of the assessment antioxidant activity and the content of polyphenolic compounds were recalculated to gallic acid equivalents (GAE. The values of the antioxidant activity as determinated by the DPPH test were 6643 (±154 mg of GAE; 1984 (±88 mg of GAE when using the FRAP method; and 812 (±31 mg of GAE when the ABTS method was utilised. The content of the total polyphenolic compounds came to 6982 (±221 mg of GAE. The most abundant antioxidant was catechin, with a content of 115 mg.L-1, whilst the least represented compound was ferulic acid (0.139 mg.L-1. Overall, this study showed a high antioxidant potential of grapevine seeds. 

  11. A complex protein derivative acts as biogenic elicitor of grapevine resistance against powdery mildew under field conditions

    Directory of Open Access Journals (Sweden)

    Andrea eNesler

    2015-09-01

    Full Text Available Powdery mildew caused by Erysiphe necator is one of the most important grapevine diseases in several viticulture areas, and high fungicide input is required to control it. However, numerous synthetic chemical pesticides are under scrutiny due to concerns about their impact on human health and the environment. Biopesticides, such as biogenic elicitors, are a promising alternative to chemical fungicides. Although several studies have reported on effective elicitors against grapevine diseases, their efficacy under field conditions has not been investigated extensively or has occurred at rather limited levels. Our goal was to examine the efficacy of a protein-based composition, namely nutrient broth (NB, against powdery mildew under field conditions and to characterize its mechanism of action. Weekly treatments with NB was highly effective in controlling powdery mildew on grapevine across seasons with different disease pressures. The level of disease control achieved with NB was comparable to standard fungicide treatments both on leaves and bunches across three different years. NB has no direct toxic effect on the germination of E. necator conidia, and it activates plant resistance with both systemic and translaminar effect in experiments with artificial inoculation under controlled conditions. NB induced the expression of defense-related genes in grapevine, demonstrating stimulation of plant defense mechanisms, prior to and in the early stages of pathogen infection. NB is a natural derivative from meat and yeast, substances that tend not to raise concerns about toxicological and ecotoxicological properties. NB represents a valid control tool for integrated plant protection programs against powdery mildew, to reduce the use of synthetic pesticides on grapevine.

  12. A complex protein derivative acts as biogenic elicitor of grapevine resistance against powdery mildew under field conditions.

    Science.gov (United States)

    Nesler, Andrea; Perazzolli, Michele; Puopolo, Gerardo; Giovannini, Oscar; Elad, Yigal; Pertot, Ilaria

    2015-01-01

    Powdery mildew caused by Erysiphe necator is one of the most important grapevine diseases in several viticulture areas, and high fungicide input is required to control it. However, numerous synthetic chemical pesticides are under scrutiny due to concerns about their impact on human health and the environment. Biopesticides, such as biogenic elicitors, are a promising alternative to chemical fungicides. Although several studies have reported on effective elicitors against grapevine diseases, their efficacy under field conditions has not been investigated extensively or has occurred at rather limited levels. Our goal was to examine the efficacy of a protein-based composition, namely nutrient broth (NB), against powdery mildew under field conditions and to characterize its mechanism of action. Weekly treatments with NB was highly effective in controlling powdery mildew on grapevine across seasons with different disease pressures. The level of disease control achieved with NB was comparable to standard fungicide treatments both on leaves and bunches across three different years. NB has no direct toxic effect on the germination of E. necator conidia, and it activates plant resistance with both systemic and translaminar effect in experiments with artificial inoculation under controlled conditions. NB induced the expression of defense-related genes in grapevine, demonstrating stimulation of plant defense mechanisms, prior to and in the early stages of pathogen infection. NB is a natural derivative from meat and yeast, substances that tend not to raise concerns about toxicological and ecotoxicological properties. NB represents a valid control tool for integrated plant protection programs against powdery mildew, to reduce the use of synthetic pesticides on grapevine.

  13. Jasmonic acid-isoleucine formation in grapevine (Vitis vinifera L.) by two enzymes with distinct transcription profiles.

    Science.gov (United States)

    Böttcher, Christine; Burbidge, Crista A; di Rienzo, Valentina; Boss, Paul K; Davies, Christopher

    2015-07-01

    The plant hormone jasmonic acid (JA) is essential for stress responses and the formation of reproductive organs, but its role in fruit development and ripening is unclear. Conjugation of JA to isoleucine is a crucial step in the JA signaling pathway since only JA-Ile is recognized by the jasmonate receptor. The conjugation reaction is catalyzed by JA-amido synthetases, belonging to the family of Gretchen Hagen3 (GH3) proteins. Here, in vitro studies of two grapevine (Vitis vinifera L. cv Shiraz) GH3 enzymes, VvGH3-7 and VvGH3-9, demonstrated JA-conjugating activities with an overlapping range of amino acid substrates, including isoleucine. Expression studies of the corresponding genes in grape berries combined with JA and JA-Ile measurements suggested a primary role for JA signaling in fruit set and cell division and did not support an involvement of JA in the ripening process. In response to methyl JA (MeJA) treatment, and in wounded and unwounded (distal) leaves, VvGH3-9 transcripts accumulated, indicating a participation in the JA response. In contrast, VvGH3-7 was unresponsive to MeJA and local wounding, demonstrating a differential transcriptional regulation of VvGH3-7 and VvGH3-9. The transient induction of VvGH3-7 in unwounded, distal leaves was suggestive of the involvement of an unknown mobile wound signal. © 2014 Institute of Botany, Chinese Academy of Sciences.

  14. Modeling deployment of Pierce’s disease resistant grapevines

    Science.gov (United States)

    Deployment of Pierce’s disease resistant grapevines is a key solution to mitigating economic losses caused by Xylella fastidiosa. While Pierce’s disease resistant grapevines under development display mild symptoms and have lower bacterial populations than susceptible varieties, all appear to remain ...

  15. Identification and Prevalence of Grapevine fanleaf virus in Khorasan-Razavi Vineyards

    Directory of Open Access Journals (Sweden)

    Z. Gholampour

    2016-02-01

    phosphate buffer. Total plant RNA were extracted from fresh leaves using silicon dioxide (Boom et al. 1990. The cDNA strand was synthesized using Moloney murine leukemia virus (MMuLV reverse transcriptase. The partial length of coat protein gene of GFLV isolates was further amplified using DetF (CGGCAGACTGGCAAGCTGT and DetR (GGTCCAGTTTAATTGCCATCCA specific primer pair by RT-PCR in leaf samples that were positive in DAS-ELISA. PCR products were run on 1% agarose gel containing 0.5 µg/ml DNA Green Viewer, and visualized under UV irradiation. The PCR products were purified using the Qiaquick PCR purification kit (Qiagen, then were sequenced bidirectionally using DetF/DetRspecific primer pair. Consensus sequences were verified using the BLAST program in NCBI database. Multiple sequence alignments of the nucleotide sequences of the coat protein gene Phylogenetic analysis were carried out by the Neighbour-joining method implemented in MEGA v.5 Results and Discussion: 187 out of 280 samples were found to be infected with GFLV in indirect ELISA. Based on ELISA results, GFLV infection rate in Khorasan-Razavi ranging from 32% to 63%. Kashmar had the most infected vineyards with the prevalence of the virus in 90% of the samples. GFLV induced yellow mosaic and vein banding in infected leaves. Shorten internode, the zigzag growth of stem and double nude were observed in infected grapevines, however, most of the GFLV infected vines were symptomless. Mechanical inoculation with sap extracts from the GFLV positive leaf samples, induced chlorotic local lesions followed by vein clearing in systemic leaves of Chenopodium quinoa two weeks post inoculation. RT-PCR using specific primers amplify 1000 bp fragment corresponding to the GFLV coat protein gene. No fragment was observed in healthy control. Pairwise comparisons of the coat protein gene of four Iranian isolates showed 89%–97% nucleotide sequence identity and 90%–92% identity at the amino acid level with those of previously

  16. Responses of grapevine rootstocks to drought through altered root system architecture and root transcriptomic regulations.

    Science.gov (United States)

    Yıldırım, Kubilay; Yağcı, Adem; Sucu, Seda; Tunç, Sümeyye

    2018-06-01

    Roots are the major interface between the plant and various stress factors in the soil environment. Alteration of root system architecture (RSA) (root length, spread, number and length of lateral roots) in response to environmental changes is known to be an important strategy for plant adaptation and productivity. In light of ongoing climate changes and global warming predictions, the breeding of drought-tolerant grapevine cultivars is becoming a crucial factor for developing a sustainable viticulture. Root-trait modeling of grapevine rootstock for drought stress scenarios, together with high-throughput phenotyping and genotyping techniques, may provide a valuable background for breeding studies in viticulture. Here, tree grafted grapevine rootstocks (110R, 5BB and 41B) having differential RSA regulations and drought tolerance were investigated to define their drought dependent root characteristics. Root area, root length, ramification and number of root tips reduced less in 110R grafted grapevines compared to 5BB and 41B grafted ones during drought treatment. Root relative water content as well as total carbohydrate and nitrogen content were found to be much higher in the roots of 110R than it was in the roots of other rootstocks under drought. Microarray-based root transcriptome profiling was also conducted on the roots of these rootstocks to identify their gene regulation network behind drought-dependent RSA alterations. Transcriptome analysis revealed totally 2795, 1196 and 1612 differentially expressed transcripts at the severe drought for the roots of 110R, 5BB and 41B, respectively. According to this transcriptomic data, effective root elongation and enlargement performance of 110R were suggested to depend on three transcriptomic regulations. First one is the drought-dependent induction in sugar and protein transporters genes (SWEET and NRT1/PTR) in the roots of 110R to facilitate carbohydrate and nitrogen accumulation. In the roots of the same rootstock

  17. Changes in the free amino acid composition of Capsicum annuum (pepper) leaves in response to Myzus persicae (green peach aphid) infestation. A comparison with water stress.

    Science.gov (United States)

    Florencio-Ortiz, Victoria; Sellés-Marchart, Susana; Zubcoff-Vallejo, José; Jander, Georg; Casas, José L

    2018-01-01

    Amino acids play a central role in aphid-plant interactions. They are essential components of plant primary metabolism, function as precursors for the synthesis of defense-related specialized metabolites, and are major growth-limiting nutrients for aphids. To quantify changes in the free amino acid content of pepper (Capsicum annuum L.) leaves in response to green peach aphid (Myzus persicae Sulzer) feeding, plants were infested with a low (20 aphids/plant) or a high (200 aphids/plant) aphid density in time-course experiments ranging from 3 hours to 7 days. A parallel experiment was conducted with pepper plants that had been subjected to water stress. Factor Analysis of Mixed Data revealed a significant interaction of time x density in the free amino acid response of aphid-infested leaves. At low aphid density, M. persicae did not trigger a strong response in pepper leaves. Conversely, at high density, a large increase in total free amino acid content was observed and specific amino acids peaked at different times post-infestation. Comparing aphid-infested with water-stressed plants, most of the observed differences were quantitative. In particular, proline and hydroxyproline accumulated dramatically in response to water stress, but not in response to aphid infestation. Some additional differences and commonalities between the two stress treatments are discussed.

  18. Non-destructive assessment of grapevine water status in the field using a portable NIR spectrophotometer.

    Science.gov (United States)

    Tardaguila, Javier; Fernández-Novales, Juan; Gutiérrez, Salvador; Diago, Maria Paz

    2017-08-01

    Until now, the majority of methods employed to assess grapevine water status have been destructive, time-intensive, costly and provide information of a limited number of samples, thus the ability of revealing within-field water status variability is reduced. The goal of this work was to evaluate the capability of non-invasive, portable near infrared (NIR) spectroscopy acquired in the field, to assess the grapevine water status in diverse varieties, grown under different environmental conditions, in a fast and reliable way. The research was conducted 2 weeks before harvest in 2012, in two commercial vineyards, planted with eight different varieties. Spectral measurements were acquired in the field on the adaxial and abaxial sides of 160 individual leaves (20 leaves per variety) using a commercially available handheld spectrophotometer (1600-2400 nm). Principal component analysis (PCA) and modified partial least squares (MPLS) were used to interpret the spectra and to develop reliable prediction models for stem water potential (Ψ s ) (cross-validation correlation coefficient (r cv ) ranged from 0.77 to 0.93, and standard error of cross validation (SECV) ranged from 0.10 to 0.23), and leaf relative water content (RWC) (r cv ranged from 0.66 to 0.81, and SECV between 1.93 and 3.20). The performance differences between models built from abaxial and adaxial-acquired spectra is also discussed. The capability of non-invasive NIR spectroscopy to reliably assess the grapevine water status under field conditions was proved. This technique can be a suitable and promising tool to appraise within-field variability of plant water status, helpful to define optimised irrigation strategies in the wine industry. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  19. Cover crops and pruning in Bobal and Tempranillo vineyards have little influence on grapevine nutrition

    Directory of Open Access Journals (Sweden)

    Pedro Pérez-Bermúdez

    2016-06-01

    Full Text Available ABSTRACT Cover crops may improve vineyard soil properties, grapevine nutrient status and berry composition, however, factors such as cover crop type, annual rainfall, climate and irrigation may change their effects on vineyards. From 2008 to 2011, the effects of a non-permanent cover crop and two pruning techniques on soil as well as vine nutrients and grapevine performance of two vineyards (cv. Tempranillo and cv. Bobal were evaluated. For that purpose, two legumes were sown in inter-rows of hand-pruned vines in February and were tilled at flowering. Soil tillage, or cover cropping, was combined with either light pruning or severe pruning to study foliar nutrient variations. Soil N, P, K and total organic carbon (TOC were determined in samples taken from the Ap1 horizon in January prior to vine pruning. Foliar N, P, K contents were measured in leaves sampled upon grape veraison. The differences between vineyards with cover cropping and bare soils suggest that legumes positively affected soil N (1.55 vs. 1.68 g kg−1 and 1.49 vs. 1.76 g kg−1 in Bobal and Tempranillo vineyards, respectively and soil organic matter (SOM (12.5 vs. 15.5 g kg−1 and 12.9 vs. 17.2 g kg−1 in Bobal and Tempranillo vineyards, respectively. The use of cover crops did not affect grapevine yields nor quality of Bobal and Tempranillo berry . Cover crops, or light pruning, did not alter the foliar N, P, K contents of both cultivars since their concentrations were similar to those found in the leaves from vineyards with soil tillage or severe pruning.

  20. Lasiojasmonates A-C, three jasmonic acid esters produced by Lasiodiplodia sp., a grapevine pathogen.

    Science.gov (United States)

    Andolfi, Anna; Maddau, Lucia; Cimmino, Alessio; Linaldeddu, Benedetto T; Basso, Sara; Deidda, Antonio; Serra, Salvatorica; Evidente, Antonio

    2014-07-01

    In this study, a strain (BL 101) of a species of Lasiodiplodia, not yet formally described, which was isolated from declining grapevine plants showing wedge-shaped cankers, was investigated for its ability to produce in vitro bioactive secondary metabolites. From culture filtrates of this strain three jasmonic acid esters, named lasiojasmonates A-C and 16-O-acetylbotryosphaerilactones A and C were isolated together with (1R,2R)-jasmonic acid, its methyl ester, botryosphaerilactone A, (3S,4R,5R)-4-hydroxymethyl-3,5-dimethyldihydro-2-furanone and (3R,4S)-botryodiplodin. The structures of lasiojasmonates A-C were established by spectroscopic methods as (1R*,2R*,3'S*,4'R*,5'R*)-4-hydroxymethyl-3,5-dimethyldihydro-2-furanone, (1R*,2R*,3'S*,4'R*,5'R*,10'R*,12'R*,13'R*,14'S*) and (1R*,2R*,3'S*,4'R*,5'R*,10'S*,12'R*,13'R*,14'S*)-4-(4-hydroxymethyl-3,5-dimethyltetrahydro-furan-2-yloxymethyl)-3,5-dimethyldihydro-2-furanones jasmonates (1, 4 and 5). The structures of 16-O-acetylbotryosphaerilactones A and C were determined by comparison of their spectral data with those of the corresponding acetyl derivatives obtained by acetylation of botryosphaerilactone A. The metabolites isolated, except 4 and 5, were tested at 1mg/mL on leaves of grapevine cv. Cannonau and cork oak using the leaf puncture assay. They were also tested on detached grapevine leaves at 0.5mg/mL and tomato cuttings at 0.1mg/mL. In all phytotoxic assays only jasmonic acid was found to be active. All metabolites were inactive in the zootoxic assay at 50 μg/mL. Copyright © 2014. Published by Elsevier Ltd.

  1. The humic acid-induced changes in the water status, chlorophyll fluorescence and antioxidant defense systems of wheat leaves with cadmium stress.

    Science.gov (United States)

    Ozfidan-Konakci, Ceyda; Yildiztugay, Evren; Bahtiyar, Mustafa; Kucukoduk, Mustafa

    2018-07-15

    The using of bio-stimulant in plants grown under stress conditions for enhancing nutrition efficiency and crop quality traits is an effective approach. One of the bio-stimulants, humus material, is defined as humic acid (HA). HA application as a promotion of plant growth to plants grown in the heavy metals-contaminated soils has promised hope in terms of effects on plants but the its limiting effect is the application dose. Therefore, the wheat seedlings were grown in hydroponic culture for 21 d and the various concentrations of humic acid (HA; 750 or 1500 mg L -1 ) were treated alone or in combination with cadmium (Cd) stress (100 or 200 μM) for 7 d. The results showed that after Cd stress treatment, water content (RWC), osmotic potential (Ψ Π ) and chlorophyll fluorescence parameters decreased and proline content (Pro) increased for 7 d. In spite of activated peroxidase (POX) and ascorbate peroxidase (APX), stress induced the toxic levels of hydrogen peroxide (H 2 O 2 ) accumulation. Cd stress triggered lipid peroxidation (TBARS content). HA application successfully eliminated the negative effects of stress on RWC, Ψ Π and photosynthetic parameters. In the presence of HA under stress, the increased activation of superoxide dismutase (SOD), catalase (CAT) and NADPH-oxidase (NOX) enzymes and ascorbate, glutathione and GSH/GSSG ratio observed. Only 750 mg L -1 HA under stress conditions induced the activities of monodehydroascorbate reductase (MDHAR) and dehydroascorbate reductase (DHAR), and dehydroascorbate (DHA) content. After the combined application of HA and Cd stress, the low contents of H 2 O 2 and TBARS maintained in wheat leaves. Hence, HA successfully eliminated the toxicity of Cd stress by modulating the water status, photosynthetic apparatus and antioxidant activity in wheat leaves. Copyright © 2018 Elsevier Inc. All rights reserved.

  2. Gating in grapevine: Relationship between application of the fungicide fludioxonil and circadian rhythm on photosynthesis

    Energy Technology Data Exchange (ETDEWEB)

    Petit, Anne-Noelle [Laboratoire de Stress, Defenses et Reproduction des Plantes, URVVC-SE EA 2069, Universite de Reims Champagne-Ardenne, UFR Sciences Exactes et Naturelles, Batiment 18, Moulin de la Housse, BP 1039, F-51687 REIMS Cedex 2 (France)], E-mail: petit081@etudiant.univ-reims.fr; Fontaine, Florence [Laboratoire de Stress, Defenses et Reproduction des Plantes, URVVC-SE EA 2069, Universite de Reims Champagne-Ardenne, UFR Sciences Exactes et Naturelles, Batiment 18, Moulin de la Housse, BP 1039, F-51687 REIMS Cedex 2 (France)], E-mail: florence.fontaine@univ-reims.fr; Clement, Christophe [Laboratoire de Stress, Defenses et Reproduction des Plantes, URVVC-SE EA 2069, Universite de Reims Champagne-Ardenne, UFR Sciences Exactes et Naturelles, Batiment 18, Moulin de la Housse, BP 1039, F-51687 REIMS Cedex 2 (France)], E-mail: christophe.clement@univ-reims.fr; Vaillant-Gaveau, Nathalie [Laboratoire de Stress, Defenses et Reproduction des Plantes, URVVC-SE EA 2069, Universite de Reims Champagne-Ardenne, UFR Sciences Exactes et Naturelles, Batiment 18, Moulin de la Housse, BP 1039, F-51687 REIMS Cedex 2 (France)], E-mail: nathalie.vaillant-gaveau@univ-reims.fr

    2009-01-15

    The aim of this study was to determine the impact of the fludioxonil (fdx) fungicide on the diurnal fluctuation in grapevine photosynthesis. Therefore, fdx treatment was performed at the end of flowering, at 8 am, 12 am or 7 pm. The study was performed in experimental field and several photosynthesis parameters were followed one day after treatment. Morning fdx treatment induced (i) a significant and simultaneous drop of both photosynthesis (Pn) and stomatal conductance between 8 am and 4 pm and (ii) an increase of intercellular CO{sub 2} concentration when compared to control plants. On the contrary, evening fdx treatment did not affect Pn whereas midday treatment caused Pn increase after 4 pm. These data suggest that (i) morning fdx treatment results in a non-stomatal limitation of Pn, (ii) midday treatment is more suitable to treat grapevine with fdx and (iii) a phenomenon of gating was noticed. - The period of fdx spraying was an important parameter in stress response: the midday fdx treatment is more suitable to treat grapevine with fdx.

  3. Gating in grapevine: Relationship between application of the fungicide fludioxonil and circadian rhythm on photosynthesis

    International Nuclear Information System (INIS)

    Petit, Anne-Noelle; Fontaine, Florence; Clement, Christophe; Vaillant-Gaveau, Nathalie

    2009-01-01

    The aim of this study was to determine the impact of the fludioxonil (fdx) fungicide on the diurnal fluctuation in grapevine photosynthesis. Therefore, fdx treatment was performed at the end of flowering, at 8 am, 12 am or 7 pm. The study was performed in experimental field and several photosynthesis parameters were followed one day after treatment. Morning fdx treatment induced (i) a significant and simultaneous drop of both photosynthesis (Pn) and stomatal conductance between 8 am and 4 pm and (ii) an increase of intercellular CO 2 concentration when compared to control plants. On the contrary, evening fdx treatment did not affect Pn whereas midday treatment caused Pn increase after 4 pm. These data suggest that (i) morning fdx treatment results in a non-stomatal limitation of Pn, (ii) midday treatment is more suitable to treat grapevine with fdx and (iii) a phenomenon of gating was noticed. - The period of fdx spraying was an important parameter in stress response: the midday fdx treatment is more suitable to treat grapevine with fdx

  4. Analysis of high-identity segmental duplications in the grapevine genome

    Directory of Open Access Journals (Sweden)

    Carelli Francesco N

    2011-08-01

    Full Text Available Abstract Background Segmental duplications (SDs are blocks of genomic sequence of 1-200 kb that map to different loci in a genome and share a sequence identity > 90%. SDs show at the sequence level the same characteristics as other regions of the human genome: they contain both high-copy repeats and gene sequences. SDs play an important role in genome plasticity by creating new genes and modeling genome structure. Although data is plentiful for mammals, not much was known about the representation of SDs in plant genomes. In this regard, we performed a genome-wide analysis of high-identity SDs on the sequenced grapevine (Vitis vinifera genome (PN40024. Results We demonstrate that recent SDs (> 94% identity and >= 10 kb in size are a relevant component of the grapevine genome (85 Mb, 17% of the genome sequence. We detected mitochondrial and plastid DNA and genes (10% of gene annotation in segmentally duplicated regions of the nuclear genome. In particular, the nine highest copy number genes have a copy in either or both organelle genomes. Further we showed that several duplicated genes take part in the biosynthesis of compounds involved in plant response to environmental stress. Conclusions These data show the great influence of SDs and organelle DNA transfers in modeling the Vitis vinifera nuclear DNA structure as well as the impact of SDs in contributing to the adaptive capacity of grapevine and the nutritional content of grape products through genome variation. This study represents a step forward in the full characterization of duplicated genes important for grapevine cultural needs and human health.

  5. Complete nucleotide sequence of the RNA-2 of grapevine deformation and Grapevine Anatolian ringspot viruses.

    Science.gov (United States)

    Ghanem-Sabanadzovic, Nina Abou; Sabanadzovic, Sead; Digiaro, Michele; Martelli, Giovanni P

    2005-05-01

    The nucleotide sequence of RNA-2 of Grapevine Anatolian ringspot virus (GARSV) and Grapevine deformation virus (GDefV), two recently described nepoviruses, has been determined. These RNAs are 3753 nt (GDefV) and 4607 nt (GARSV) in size and contain a single open reading frame encoding a polyprotein of 122 kDa (GDefV) and 150 kDa (GARSV). Full-length nucleotide sequence comparison disclosed 71-73% homology between GDefV RNA-2 and that of Grapevine fanleaf virus (GFLV) and Arabis mosaic virus (ArMV), and 62-64% homology between GARSV RNA-2 and that of Grapevine chrome mosaic virus (GCMV) and Tomato black ring virus (TBRV). As previously observed in other nepoviruses, the 5' non-coding regions of both RNAs are capable of forming stem-loop structures. Phylogenetic analysis of the three proteins encoded by RNA-2 (i.e. protein 2A, movement protein and coat protein) confirmed that GDefV and GARSV are distinct viruses which can be assigned as definitive species in subgroup A and subgroup B of the genus Nepovirus, respectively.

  6. Proteomic analysis of grapevine resistance induced by Trichoderma harzianum T39 reveals specific defence pathways activated against downy mildew

    Science.gov (United States)

    Perazzolli, Michele

    2012-01-01

    Downy mildew is caused by the oomycete Plasmopara viticola and is one of the most serious diseases of grapevine. The beneficial microorganism Trichoderma harzianum T39 (T39) has previously been shown to induce plant-mediated resistance and to reduce the severity of downy mildew in susceptible grapevines. In order to better understand the cellular processes associated with T39-induced resistance, the proteomic and histochemical changes activated by T39 in grapevine were investigated before and 1 day after P. viticola inoculation. A comprehensive proteomic analysis of T39-induced resistance in grapevine was performed using an eight-plex iTRAQ protocol, resulting in the identification and quantification of a total of 800 proteins. Most of the proteins directly affected by T39 were found to be involved in signal transduction, indicating activation of a complete microbial recognition machinery. Moreover, T39-induced resistance was associated with rapid accumulation of reactive oxygen species and callose at infection sites, as well as changes in abundance of proteins involved in response to stress and redox balance, indicating an active defence response to downy mildew. On the other hand, proteins affected by P. viticola in control plants mainly decreased in abundance, possibly reflecting the establishment of a compatible interaction. Finally, the high-throughput iTRAQ protocol allowed de novo peptide sequencing, which will be used to improve annotation of the Vitis vinifera cv. Pinot Noir proteome. PMID:23105132

  7. Carboxylated multi-walled carbon nanotubes aggravated biochemical and subcellular damages in leaves of broad bean (Vicia faba L.) seedlings under combined stress of lead and cadmium

    International Nuclear Information System (INIS)

    Wang, Chengrun; Liu, Haitao; Chen, Jinyun; Tian, Yuan; Shi, Jian; Li, Dongdong; Guo, Chen; Ma, Qingping

    2014-01-01

    Highlights: • MWCNTs-COOH disturb mineral elements and cause oxidative damages in the leaves. • Cd and Pb combination result in reduction of mineral elements and enrichment of Na, involving in toxicity mechanisms. • MWCNTs-COOH facilitate Cd and Pb uptake, and aggravate biochemical and subcellular damages. - Abstract: Increasing industrialization of multi-walled carbon nanotubes (MWCNTs) would inevitably lead to their release into the environment and combination with heavy metals. However, studies concerning the combined effects of MWCNTs and heavy metals on agricultural crops are limited. Herein, effects and mechanisms of carboxylated MWCNTs (MWCNTs-COOH) (2.5, 5 and 10 mg/L) and their combination with 20 μM Pb and 5 μM Cd (shortened as Pb + Cd) on Vicia faba L. seedlings were investigated. The results showed that the MWCNTs-COOH disturbed the imbalance of nutrient elements, and caused oxidative stress and damages in the leaves. Additionally, the combination of MWCNTs-COOH with Pb + Cd resulted in enrichment of Pb and Cd, and deterioration of oxidative damages compared with the treatments of MWCNTs-COOH or Pb + Cd alone in the leaves. As the results, the concentrations of MWCNTs-COOH not only caused oxidative stress, but also exacerbated the biochemical and subcellular damages due to the treatment of Pb + Cd in the leaves. It also suggests that persistent release of MWCNTs-COOH into the environment may cause phytotoxicity and aggravate ecological risks due to combination of heavy metals

  8. Grapevine tissues and phenology differentially affect soluble carbohydrates determination by capillary electrophoresis.

    Science.gov (United States)

    Moreno, Daniela; Berli, Federico; Bottini, Rubén; Piccoli, Patricia N; Silva, María F

    2017-09-01

    Soluble carbohydrates distribution depends on plant physiology and, among other important factors, determines fruit yield and quality. In plant biology, the analysis of sugars is useful for many purposes, including metabolic studies. Capillary electrophoresis (CE) proved to be a powerful green separation technique with minimal sample preparation, even in complex plant tissues, that can provide high-resolution efficiency. Matrix effect refers to alterations in the analytical response caused by components of a sample other than the analyte of interest. Thus, the assessment and reduction of the matrix factor is fundamental for metabolic studies in different matrices. The present study evaluated the source and levels of matrix effects in the determination of most abundant sugars in grapevine tissues (mature and young leaves, berries and roots) at two phenological growth stages. Sucrose was the sugar that showed the least matrix effects, while fructose was the most affected analyte. Based on plant tissues, young leaves presented the smaller matrix effects, irrespectively of the phenology. These changes may be attributed to considerable differences at chemical composition of grapevine tissues with plant development. Therefore, matrix effect should be an important concern for plant metabolomics. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  9. Dual mechanisms regulating glutamate decarboxylases and accumulation of gamma-aminobutyric acid in tea (Camellia sinensis) leaves exposed to multiple stresses.

    Science.gov (United States)

    Mei, Xin; Chen, Yiyong; Zhang, Lingyun; Fu, Xiumin; Wei, Qing; Grierson, Don; Zhou, Ying; Huang, Yahui; Dong, Fang; Yang, Ziyin

    2016-03-29

    γ-Aminobutyric acid (GABA) is one of the major inhibitory neurotransmitters in the central nervous system. It has multiple positive effects on mammalian physiology and is an important bioactive component of tea (Camellia sinensis). GABA generally occurs at a very low level in plants but GABA content increases substantially after exposure to a range of stresses, especially oxygen-deficiency. During processing of tea leaves, a combination of anoxic stress and mechanical damage are essential for the high accumulation of GABA. This is believed to be initiated by a change in glutamate decarboxylase activity, but the underlying mechanisms are unclear. In the present study we characterized factors regulating the expression and activity of three tea glutamate decarboxylase genes (CsGAD1, 2, and 3), and their encoded enzymes. The results suggests that, unlike the model plant Arabidopsis thaliana, there are dual mechanisms regulating the accumulation of GABA in tea leaves exposed to multiple stresses, including activation of CsGAD1 enzymatic activity by calmodulin upon the onset of the stress and accumulation of high levels of CsGAD2 mRNA induced by a combination of anoxic stress and mechanical damage.

  10. Bioavailability of potentially toxic elements in soil-grapevine (leaf, skin, pulp and seed) system and environmental and health risk assessment.

    Science.gov (United States)

    Milićević, Tijana; Urošević, Mira Aničić; Relić, Dubravka; Vuković, Gordana; Škrivanj, Sandra; Popović, Aleksandar

    2018-06-01

    Monitoring of potentially toxic elements in agricultural soil represents the first measure of caution regarding food safety, while research into element bioavailability should be a step forward in understanding the element transportation chain. This study was conducted in the grapevine growing area ("Oplenac Wine Route") for investigating element bioavailability in the soil-grapevine system accompanied by an assessment of the ecological implications and human health risk. Single extraction procedures (CH 3 COOH, Na 2 EDTA, CaCl 2 , NH 4 NO 3 and deionised H 2 O) and digestion were performed to estimate the bioavailability of 22 elements (Al, As, B, Ba, Be, Ca, Cd, Co, Cr, Cu, Fe, K, Li, Mg, Mn, Na, Ni, Pb, Sb, Sr, V and Zn) from the topsoil (0-30 cm) and subsoil (30-60 cm) to the grapevine parts (leaf, skin, pulp and seed) and wine. The extractants were effective comparing to the pseudo-total concentrations in following order Na 2 EDTA ˃ CH 3 COOH ˃ NH 4 NO 3  ˃ CaCl 2 , H 2 O 2 h and 16 h. The most suitable extractants for assessing the bioavailability of the elements from the soil to the grapevine parts were CaCl 2 , NH 4 NO 3 and Na 2 EDTA, but deionised H 2 O could be suitable, as well. The results showed that Ba was the most bioavailable element in the soil-grapevine system. Contamination factor implied a moderate contamination (1  1), the influence of atmospheric deposition on the aerial grapevine parts (leaves and grape skin) was observed. Nevertheless, low adverse health risk effects (HI wine consumers. Copyright © 2018 Elsevier B.V. All rights reserved.

  11. Comparative proteomic analysis of soybean leaves and roots by iTRAQ provides insights into response mechanisms to short-term salt stress

    Directory of Open Access Journals (Sweden)

    Wei eJi

    2016-04-01

    Full Text Available Salinity severely threatens land use capability and crop yields worldwide. Understanding the mechanisms that protect soybean from salt stress will help in the development of salt-stress tolerant leguminous plants. Here we firstly analyzed the changes in malondialdehyde levels, the activities of superoxide dismutase and peroxidases, cholorophyll contents, and Na+/K+ ratios in leaves and roots from soybean seedlings treated with 200 mM NaCl for different time points, and suggested that 200 mM NaCl treated for 12 h was enough for exploring proteomic analysis to soybean seedlings. iTRAQ-based proteomic approach was used to investigate the proteomes of soybean leaves and roots under salt treatment. Data are available via ProteomeXchange with identifier PXD002851. In total, 278 and 440 proteins with significantly altered abundance were identified in leaves and roots of soybean, respectively, with only 50 mutual unique proteins in the both tissues. These identified differentially expressed proteins (DEPs were mainly involved in 13 biological processes. Moreover, protein-protein interaction analysis revealed that the proteins involved in metabolism, carbohydrate and energy metabolism, protein synthesis and redox homeostasis constructed four types of response networks to high salt stress. Besides, semi-quantitative RT-PCR analysis revealed that some of the proteins, such as 14-3-3, MMK2, PP1, TRX-h, were also regulated by salt stress at the level of transcription. These results indicated that effective regulatory protein expression related to signalling, membrane and transport, stress defense and metabolism played important roles in the short-term salt response of soybean seedlings.

  12. Development of a Grapevine Pruning Algorithm for Using in Pruning

    Directory of Open Access Journals (Sweden)

    S. M Hosseini

    2017-10-01

    Full Text Available Introduction Great areas of the orchards in the world are dedicated to cultivation of the grapevine. Normally grape vineyards are pruned twice a year. Among the operations of grape production, winter pruning of the bushes is the only operation that still has not been fully mechanized while it is known as the most laborious jobs in the farm. Some of the grape producing countries use various mechanical machines to prune the grapevines, but in most cases, these machines do not have a good performance. Therefore intelligent pruning machine seems to be necessary in this regard and this intelligent pruning machines can reduce the labor required to prune the vineyards. It this study in was attempted to develop an algorithm that uses image processing techniques to identify which parts of the grapevine should be cut. Stereo vision technique was used to obtain three dimensional images from the bare bushes whose leaves were fallen in autumn. Stereo vision systems are used to determine the depth from two images taken at the same time but from slightly different viewpoints using two cameras. Each pair of images of a common scene is related by a popular geometry, and corresponding points in the images pairs are constrained to lie on pairs of conjugate popular lines. Materials and Methods Photos were taken from gardens of the Research Center for Agriculture and Natural Resources of Fars province, Iran. At first, the distance between the plants and the cameras should be determined. The distance between the plants and cameras can be obtained by using the stereo vision techniques. Therefore, this method was used in this paper by two pictures taken from each plant with the left and right cameras. The algorithm was written in MATLAB. To facilitate the segmentation of the branches from the rows at the back, a blue plate with dimensions of 2×2 m2 were used at the background. After invoking the images, branches were segmented from the background to produce the binary

  13. Transcriptional profiling of sugarcane leaves and roots under progressive osmotic stress reveals a regulated coordination of gene expression in a spatiotemporal manner.

    Directory of Open Access Journals (Sweden)

    Alejandro Pereira-Santana

    Full Text Available Sugarcane is one of the most important crops worldwide and is a key plant for the global production of sucrose. Sugarcane cultivation is severely affected by drought stress and it is considered as the major limiting factor for their productivity. In recent years, this plant has been subjected to intensive research focused on improving its resilience against water scarcity; particularly the molecular mechanisms in response to drought stress have become an underlying issue for its improvement. To better understand water stress and the molecular mechanisms we performed a de novo transcriptomic assembly of sugarcane (var. Mex 69-290. A total of 16 libraries were sequenced in a 2x100 bp configuration on a HiSeq-Illumina platform. A total of 536 and 750 genes were differentially up-regulated along with the stress treatments for leave and root tissues respectively, while 1093 and 531 genes were differentially down-regulated in leaves and roots respectively. Gene Ontology functional analysis showed that genes related to response of water deprivation, heat, abscisic acid, and flavonoid biosynthesis were enriched during stress treatment in our study. The reliability of the observed expression patterns was confirmed by RT-qPCR. Additionally, several physiological parameters of sugarcane were significantly affected due to stress imposition. The results of this study may help identify useful target genes and provide tissue-specific data set of genes that are differentially expressed in response to osmotic stress, as well as a complete analysis of the main groups is significantly enriched under this condition. This study provides a useful benchmark for improving drought tolerance in sugarcane and other economically important grass species.

  14. Work-focused cognitive behavioral intervention for psychological complaints in patients on sick leave due to work-related stress: Results from a randomized controlled trial.

    Science.gov (United States)

    Dalgaard, Vita Ligaya; Andersen, Lars Peter Sønderbo; Andersen, Johan Hviid; Willert, Morten Vejs; Carstensen, Ole; Glasscock, David John

    2017-08-22

    Work-related stress is a global problem with negative implications for individuals and society. The purpose of the current study was to evaluate a stress management intervention for patients on sick leave due to work-related stress complaints using a three-armed randomized controlled design. Participants were patients referred from three municipalities to the regional Department of Occupational Medicine. Inclusion criteria were: 1) sick leave due to work-related stress complaints, 2) a diagnosis of adjustment disorder or reactions to severe stress (ICD 10 code: F43,2 - F 43,9 not PTSD) or mild depressive episode (F 32.0). Through a double randomization procedure patients (n = 163) were randomized to either an intervention group (n = 58), a 'control group A' receiving a clinical examination (n = 56), or 'control group B' (n = 49) receiving no offers at the department. The intervention comprised six sessions of individual cognitive behavioral therapy and the offer of a small workplace intervention. Questionnaire data were analyzed with multivariate repeated measurements analysis. Primary outcomes assessed were perceived stress and general mental health. Secondary outcomes were sleep quality and cognitive failures. Follow-up was at four and 10 months after baseline. Complaints were significantly reduced in all groups over time. No group effects were observed between the intervention group and control group A that was clinically assessed. Significant group effects were found for perceived stress and memory when comparing the intervention group to group B, but most likely not due to an intervention effect. Psychological complaints improved substantially over time in all groups, but there was no significant treatment effect on any outcomes when the intervention group was compared to control group A that received a clinical assessment. ISRCTN ISRCTN91404229. Registered 03 August 2012 (retrospectively registered).

  15. Proteome analysis of muscadine grape leaves

    Directory of Open Access Journals (Sweden)

    Sheikh M Basha

    2009-04-01

    Full Text Available Sheikh M Basha1, Ramesh Katam1, Hemanth Vasanthaiah1, Frank Matta21Center for Viticulture and Small Fruit Research, Florida A and M University, Tallahassee, FL, USA; 2Plant and Soil Science Department, Mississippi State University, Mississippi State, MS, USAAbstract: Muscadine grapes are native to the southeastern United States and are used for making wine and consumed as fresh fruit. Grape berries, as ‘sink organs,’ rely on the use of available carbohydrate resources produced by photosynthesis to support their development and composition. A high throughput two-dimensional gel electrophoresis (2-DE was conducted on muscadine (Vitis rotundifolia grape leaf proteins to document complexity in their composition and to determine protein identity and function for enhancing photosynthetic efficiency of muscadine grape. 2-DE resolved muscadine leaf proteins into >258 polypeptides with pIs between 3.5 and 8.0 and molecular weight between 12,000 to 15,0000 Daltons. The consistently expressed proteins were excised and subjected to sequencing. Homology search of protein sequences showed 84% identity with Viridi plantae database. Identity of some of these proteins included RuBisCO, glutamine synthetase, pathogenesis-related protein, glyoxisomal malate dehydrogenase, ribonucleoprotein, chloroplast precursor, oxygen evolving enhancer protein. Comparative analysis of 10 muscadine cultivars showed quantitative differences in expression of 39 polypeptides among these genotypes. The results suggested that the polypeptide composition of muscadine grape leaf is complex, and polypeptide number and amount vary widely among muscadine genotypes, and these variations may be responsible for differences in their physiology, berry and stress tolerance characteristics.Keywords: grapevine, leaves, muscadine, proteins, sequencing, 2-DE

  16. From 'Fire Esca' to 'Esca of Grapevine'

    Directory of Open Access Journals (Sweden)

    A. Graniti

    2006-04-01

    Full Text Available The use of tinder (‘esca’ or ‘amadou’ prepared from basidiocarps of some bracket fungi, e.g. Fomes fomentarius and Phellinus igniarius as an easy-to-burn matter goes back to the man’s conquest of fire. Archaeological finds, such as fragments of tinder, flint-stones and traces of pyrite carried by the ‘Ice man’ on his way across the Alps more than 5,000 years ago, bear evidence of the use of tinder in the Neolithic age. In 1926, on the assumption that P. igniarius was one of the pathogens of the so-called ‘apoplexy’ of grapevine, the name ‘esca’ was given to the disease. For long time, esca was thought to affect old vines only. In the last decades, however, various forms of the disease have been found to be widespread and to cause losses even to young vines. Aetiological studies have shown that esca of grapevine is a complex disease, incited by wilt-inducing ascomycetes (Togninia, Phaeoacremonium, Phaeomoniella and/or the wood-decaying basidiomycete Fomitiporia mediterranea. Since the latter is not a tinder fungus, the advisability of retaining the name ‘esca’ for the disease is discussed.

  17. Grapevine responses to terroir: a global approach

    Directory of Open Access Journals (Sweden)

    Alain Deloire

    2005-12-01

    Full Text Available This paper deals with the technical and/or practical treatment of terroir as a study concept, together with related functional aspects. Functioning of the terroir relies on the relation between climate, soil and vine. In addition to this interaction, a comprehensive study concept for terroir requires the consideration of viticultural and enological sciences and techniques necessary to ensure the assurance of wine quality, together with spatial aspects of the grapevine response to environmental factors, as required for vineyard management. In order to comprehend the quality of the harvest, it is necessary to understand the relationship « whole plant - berry ». An easy field and laboratory method to study the relationship between the whole plant and berry and the consequences thereof for wine quality is proposed. Knowledge of grapevine water status and the biochemical evolution within the grape berry from berry set onwards are important issues for the understanding of the role that terroir plays with respect to the quality of the harvest and the wine style or « typicality ».

  18. Evaluation of the protective effect of guava fruits and leaves on oxidative stress - doi: 10.4025/actascibiolsci.v36i1.19839

    Directory of Open Access Journals (Sweden)

    Juliana Mesquita Freire

    2013-09-01

    Full Text Available Oxidative stress is an imbalance between reactive oxygen species and antioxidant capacity of action. Thus, research, alternative to mitigate the damaging effects of oxidative stress, improving the body´s antioxidant capacity, prevented the disease and its complicatons. The leaves and fruits of guava are rich in the antioxidants. This work aimed to study the effect of flour and ethanolic/acetone extracts leaves and fruits of guava on lipid oxidation in rats with hypercholesterolemic. The flour and extracts decreased leves of triglycerides and non – HDL cholesterol and increased in the HDL. Cholesterol levels decreased only leaves and fruits. The activity of GPx decreased in samples serum in all treatments  and the SOD only the extracts were effective. There was no difference in levels the MDA in relation hypercholesterolemic control. For the samples of liver, there was no difference in activity SOD. In relation of activity GPx, only the flour was effective. There were differences in levels the MDA of the hypercholesterolemic animals treated with flour and extracts with the animals of the hypercholesterolemic control.

  19. Resistance to Plasmopara viticola in a grapevine segregating population is associated with stilbenoid accumulation and with specific host transcriptional responses

    Directory of Open Access Journals (Sweden)

    Delledonne Massimo

    2011-08-01

    Full Text Available Abstract Background Downy mildew, caused by the oomycete Plasmopara viticola, is a serious disease in Vitis vinifera, the most commonly cultivated grapevine species. Several wild Vitis species have instead been found to be resistant to this pathogen and have been used as a source to introgress resistance into a V. vinifera background. Stilbenoids represent the major phytoalexins in grapevine, and their toxicity is closely related to the specific compound. The aim of this study was to assess the resistance response to P. viticola of the Merzling × Teroldego cross by profiling the stilbenoid content of the leaves of an entire population and the transcriptome of resistant and susceptible individuals following infection. Results A three-year analysis of the population's response to artificial inoculation showed that individuals were distributed in nine classes ranging from total resistance to total susceptibility. In addition, quantitative metabolite profiling of stilbenoids in the population, carried out using HPLC-DAD-MS, identified three distinct groups differing according to the concentrations present and the complexity of their profiles. The high producers were characterized by the presence of trans-resveratrol, trans-piceid, trans-pterostilbene and up to thirteen different viniferins, nine of them new in grapevine. Accumulation of these compounds is consistent with a resistant phenotype and suggests that they may contribute to the resistance response. A preliminary transcriptional study using cDNA-AFLP selected a set of genes modulated by the oomycete in a resistant genotype. The expression of this set of genes in resistant and susceptible genotypes of the progeny population was then assessed by comparative microarray analysis. A group of 57 genes was found to be exclusively modulated in the resistant genotype suggesting that they are involved in the grapevine-P. viticola incompatible interaction. Functional annotation of these transcripts

  20. 24-Epibrassinolide Restores the Synthesis of Proteins and Amino Acids in Brassica juncea L. Leaves Under Imidacloprid Stress

    Directory of Open Access Journals (Sweden)

    Sharma Anket

    2017-12-01

    Full Text Available Pesticides are applied to protect crops from a variety of insect pests but their application cause toxicity to plants that results, among others, in reduction of protein as well as amino acid contents. The present study is aimed at observing the effect of seed pre-soaking with 24-epibrassinolide (EBL on the protein and amino acid content in the leaves of Brassica juncea L. grown in soil that is amended with pesticide im-idacloprid (IMI. Soil amendment with IMI resulted in a decrease in the contents in leaves of total proteins and 21 amino acids studied. Seed soaking with 100 nM of EBL resulted in the recovery of total protein as well as amino acid contents in leaves, when compared with plants grown in only IMI amended soils.

  1. Detection and Molecular Characterization of Grapevine Virus A in Jordan

    Directory of Open Access Journals (Sweden)

    G. Anfoka

    2004-12-01

    Full Text Available In a study on grapevines in Jordan conducted between 2002 and 2003, grapevine virus A (GVA was detected in all areas where grapevines were planted. DAS-ELISA analysis of samples from symptomatic trees found that 16.1% of samples were infected with GVA. Using a GVA- specific primer pair (H587/C995, a portion of the coat protein gene of the virus was amplified by IC-RT-PCR and RT-PCR, using leaf extracts and RNA extracted from infected grapevines respectively. After cloning and sequencing the coat protein gene of the Jordanian isolate of GVA (GVA-Jo, the sequence of the amplified product was compared with sequences of other GVA isolates from different countries.

  2. GRAPEVINE FE-CHLOROSIS ON PODUNAVLJE VINEGROWING AREA

    Directory of Open Access Journals (Sweden)

    Mato Drenjančević

    2012-06-01

    Full Text Available The characteristic of Podunavlje vinegrowing area in the far east of the Republic of Croatia is carbonate soil with loess as a parent substrate. Chlorosis is common on this soil and it is often caused by excess concentrations of calcium and magnesium and deficiency of iron and zinc. It can also be resulted by inactivation, if it is transformed so that a plant can not use it. The lack of iron in grape vine is resulted in leaf vein, first in younger leaves where the venation remains green, and then marginal necrosis and defoliation are developed. The results of the study include the data based on the field researches of Podunavlje vinegrowing subregion and exact research of fertilization field trial. Field research of Podunavlje vinegrowing subregion, vineyards of Srijem, Erdut and Baranya were conducted in July 2007. The field research consisted of locating plantations, measuring plantations chlorosis, determining their general condition and measuring total concentration of chloroplast pigments by an indirect method (chlorophyll meter on the chlorotic and nonchlorotic plants of a grapevine. The intensity of a relative chlorosis was calculated from data measured by a chlorophyll meter. Field research was located on the production area of a company Agro-Ilok ltd. in Ilok, locality Radoš, and carried out during the period 2008 and 2009. It included cultivar Welsh Riesling, grapevine stock Kober 5BB, the most important white cultivar and grapevine stock in the vinegrowing region Continental Croatia. The experiment was set up according to a split plot method at 5x3 levels. The main factor A consisted of different chemical treatments in a basic fertilization: : A1 = 0 control without fertilization; A2 = 150 kg P2O5 + 300 K2O kg ha-1 (KCl; A3 = 150 kg P2O5 + 300 K2O kg ha-1 (K2SO4; A4 = 150 kg P2O5 + 300 K2O kg ha-1 (KCl + 25 kg ha-1 Fe - FeSO4x7H2O; A5 = 150 kg P2O5 + 300 K2O kg ha-1 (K2SO4 + 25 kg ha-1 Fe - FeSO4x7H2O. Factor B had got three levels

  3. Glutathione reductase in leaves of cowpea: cloning of two cDNAs, expression and enzymatic activity under progressive drought stress, desiccation and abscisic acid treatment.

    Science.gov (United States)

    Contour-Ansel, Dominique; Torres-Franklin, Maria Lucia; Cruz DE Carvalho, Maria Helena; D'Arcy-Lameta, Agnès; Zuily-Fodil, Yasmine

    2006-12-01

    Reactive oxygen species are frequently produced when plants are exposed to abiotic stresses. Among the detoxication systems, two enzymes, ascorbate peroxidase and glutathione reductase (GR) play key roles. GR has also a central role in keeping the reduced glutathione pool during stress thus allowing the adjustments on the cellular redox reactions. The aim of this work was to study the variations in cytosolic and dual-targeted GR gene expression in the leaves of cowpea plants submitted to progressive drought, rapid desiccation and application of exogenous abscisic acid (ABA). Two cowpea (Vigna unguiculata) cultivars, one drought-resistant ('EPACE-1'), the other drought-sensitive ('1183') were submitted to progressive drought stress by withholding irrigation. Cut-off leaves were air-dried or treated with exogenous ABA. Two GR cDNAs, one cytosolic, the other dual-targeted to chloroplasts and mitochondria were isolated by PCR and cloned in plasmid vectors. Reverse-transcription PCR was used to study the variations in GR gene expression. Two new cDNAs encoding a putative dual-targeted and a cytosolic GR were cloned and sequenced from leaves of V. unguiculata. Drought stress induced an up-regulation of the expression of the cytosolic GR gene directly related to the intensity of the stress in both cultivars. The expression of dual-targeted GR was up-regulated by the drought treatment in the susceptible cultivar only. Under a fast desiccation, the '1183' cultivar responded later than the 'EPACE-1', although in 'EPACE-1' it was the cytosolic isoform which responded and in '1183' the dual-targeted one. Exogenous ABA enhanced significantly the activity and expression levels of GR in both cultivars after treatment for 24 h. These results demonstrate a noticeable activation in both cultivars of the antioxidant metabolism under a progressive water stress, which involves both GR genes in the case of the susceptible cultivar. Under a fast desiccation, the susceptible cultivar

  4. Grapevine yield components and composition of Isabel grape produced according to the organic and conventional systems

    Directory of Open Access Journals (Sweden)

    Miele Alberto

    2016-01-01

    Full Text Available There is an increasing demand for organic grapes by the juice industry of Serra Gaúcha, Brazil. This region presents a humid and hot summer, ideal climatic conditions for the development of a number of diseases. To control such diseases and problems brought about by other organisms, growers apply pesticides on the grapevines which may leave residues in grapes. However, in general, grapes produced by organic system have lower yield, but there is a lack of research data on this subject. Thus, an experiment was carried out over three years in order to compare the yield components and the physicochemical composition of the must of Isabel grapes conducted in both production systems. When the grapes were ripe, variables related to yield components were evaluated, such as the number of clusters/vine, yield/vine and weight/cluster. Then the grapes were sampled and taken to the laboratory where they were crushed and the musts were centrifuged and analyzed. The 3-year data mean were submitted to correlation analysis and Principal Component Analysis. The results show that conventional grapevines produced 2.18 times more than organic. However, the grapes from the organic system had higher density, Brix, pH, Brix/titratable acidity ratio, P and Mg but lower K, and Ca varied little between both production systems.

  5. A 3-D functional-structural grapevine model that couples the dynamics of water transport with leaf gas exchange.

    Science.gov (United States)

    Zhu, Junqi; Dai, Zhanwu; Vivin, Philippe; Gambetta, Gregory A; Henke, Michael; Peccoux, Anthony; Ollat, Nathalie; Delrot, Serge

    2017-12-23

    Predicting both plant water status and leaf gas exchange under various environmental conditions is essential for anticipating the effects of climate change on plant growth and productivity. This study developed a functional-structural grapevine model which combines a mechanistic understanding of stomatal function and photosynthesis at the leaf level (i.e. extended Farqhuhar-von Caemmerer-Berry model) and the dynamics of water transport from soil to individual leaves (i.e. Tardieu-Davies model). The model included novel features that account for the effects of xylem embolism (fPLC) on leaf hydraulic conductance and residual stomatal conductance (g0), variable root and leaf hydraulic conductance, and the microclimate of individual organs. The model was calibrated with detailed datasets of leaf photosynthesis, leaf water potential, xylem sap abscisic acid (ABA) concentration and hourly whole-plant transpiration observed within a soil drying period, and validated with independent datasets of whole-plant transpiration under both well-watered and water-stressed conditions. The model well captured the effects of radiation, temperature, CO2 and vapour pressure deficit on leaf photosynthesis, transpiration, stomatal conductance and leaf water potential, and correctly reproduced the diurnal pattern and decline of water flux within the soil drying period. In silico analyses revealed that decreases in g0 with increasing fPLC were essential to avoid unrealistic drops in leaf water potential under severe water stress. Additionally, by varying the hydraulic conductance along the pathway (e.g. root and leaves) and changing the sensitivity of stomatal conductance to ABA and leaf water potential, the model can produce different water use behaviours (i.e. iso- and anisohydric). The robust performance of this model allows for modelling climate effects from individual plants to fields, and for modelling plants with complex, non-homogenous canopies. In addition, the model provides a

  6. Bottle gourd rootstock-grafting promotes photosynthesis by regulating the stomata and non-stomata performances in leaves of watermelon seedlings under NaCl stress.

    Science.gov (United States)

    Yang, Yanjuan; Yu, Li; Wang, Liping; Guo, Shirong

    2015-08-15

    Previously, we found that the amelioration of photosynthetic capacity by bottle gourd (Lagenaria siceraria Standl.) rootstock in watermelon seedlings (Citrullus lanatus [Thunb.] Mansf.) with salt treatment might be closely related to the enzymes in Calvin cycle such as ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) (Yang et al., 2012). We confirmed this and showed more details in this study that improved photosynthesis of watermelon plants by bottle gourd rootstock was associated with the decreased stomata resistance and the increased photochemical activity and photosynthetic metabolism with or without 100mM NaCl stress for 3 days. The analysis of gas exchange parameters showed that self-grafted plants suffered serious non-stomatal limitation to photosynthesis under salt stress while rootstock-grafted plants were mainly affected by stomata limitation in stress conditions. Further, results showed that NaCl stress markedly reduced the chlorophyll content, damaged the structure of photosynthetic apparatus, and inhibited photochemical activity and CO2 assimilation in self-grafted plants. In contrast, rootstock-grafting increased the chlorophyll content, especially chlorophyll b, and minimized the harmful effects on photosystem II (PSII) reaction center and the thylakoids structure induced by NaCl stress. Furthermore, rootstock-grafting enhanced the content and activity of Rubisco and thus elevated carbon fixation in the leaves of watermelon scions under salt stress. The gene expressions of enzymes related to ribulose-1,5-bisphosphate (RuBP) regeneration were also up-regulated by rootstock and this probably guaranteed the sufficient supply of RuBP for the operation of Calvin cycle in watermelon scions under salt stress. Thus, bottle gourd rootstock promoted photosynthesis by the activation of stomatal and non-stomatal abilities, especially the regulation of a variety of photosynthetic enzymes, including Rubisco in grafted watermelon plants under NaCl stress

  7. Chronic Administration of Oil Palm (Elaeis guineensis Leaves Extract Attenuates Hyperglycaemic-Induced Oxidative Stress and Improves Renal Histopathology and Function in Experimental Diabetes

    Directory of Open Access Journals (Sweden)

    Varatharajan Rajavel

    2012-01-01

    Full Text Available Oil palm (Elaeis guineensis leaves extract (OPLE has antioxidant properties and because oxidative stress contributes to the pathogenesis of diabetic nephropathy (DN, we tested the hypothesis that OPLE prevents diabetes renal oxidative stress, attenuating injury. Sprague-Dawley rats received OPLE (200 and 500 mg kg−1 for 4 and 12 weeks after diabetes induction (streptozotocin 60 mg kg−1. Blood glucose level, body and kidney weights, urine flow rate (UFR, glomerular filtration rate (GFR, and proteinuria were assessed. Oxidative stress variables such as 8-hydroxy-2′-deoxyguanosine (8-OHdG, glutathione (GSH, and lipid peroxides (LPO were quantified. Renal morphology was analysed, and plasma transforming growth factor-beta1 (TGF-β1 was measured. Diabetic rats demonstrated increase in blood glucose and decreased body and increased kidney weights. Renal dysfunction (proteinuria, elevations in UFR and GFR was observed in association with increases in LPO, 8-OHdG, and TGF-β1 and a decrease in GSH. Histological evaluation of diabetic kidney demonstrated glomerulosclerosis and tubulointerstitial fibrosis. OPLE attenuated renal dysfunction, improved oxidative stress markers, and reduced renal pathology in diabetic animals. These results suggest OPLE improves renal dysfunction and pathology in diabetes by reducing oxidative stress; furthermore, the protective effect of OPLE against renal damage in diabetes depends on the dose of OPLE as well as progression of DN.

  8. Guided Imagery and Music (GIM) with adults on sick leave suffering from work-related stress – a mixed methods experimental study

    DEFF Research Database (Denmark)

    Beck, Bolette Daniels

    2012-01-01

    %). The treatment condition included six sessions of GIM plus standard care versus standard care alone. Significant effects of GIM compared to standard care were found after nine weeks in the psychological variables Mood, Sleep Quality, Anxiety, Well-being and Physical Symptoms with effect sizes ranging from 0...... was carried out. Significant effects in Perceived Stress, Mood, Depression and Anxiety were found with effect sizes from 0.80 to 1.11. Job return did not significantly improve in the early intervention group compared to late intervention, but the odds of being on sick leave at 6 months' follow- up were 4...... as a supportive space for self-regulative body processes, emotional expression, reconnection to self-esteem and competency, processes of existential life issues and contact with creativity. A result generated from the convergence of qualitative and quantitative results is that GIM decreased bodily stress symptoms...

  9. Polyamine regulates tolerance to water stress in leaves of white clover associated with antioxidant defense and dehydrin genes via involvement in calcium messenger system and hydrogen peroxide signaling

    Directory of Open Access Journals (Sweden)

    Zhou eLi

    2015-10-01

    Full Text Available Endogenous polyamine (PA may play a critical role in tolerance to water stress in plants acting as a signaling molecule activator. Water stress caused increases in endogenous PA content in leaves, including putrescine (Put, spermidine (Spd, and spermine (Spm. Exogenous application of Spd could induce the instantaneous H2O2 burst and accumulation of cytosolic free Ca2+, and activate NADPH oxidase and CDPK gene expression in cells. To a great extent, PA biosynthetic inhibitor reduced the water stress-induced H2O2 accumulation, free cytosolic Ca2+ release, antioxidant enzyme activities and genes expression leading to aggravate water stress-induced oxidative damage, while these suppressing effects were alleviated by the addition of exogenous Spd, indicating PA was involved in water stress-induced H2O2 and cytosolic free Ca2+ production as well as stress tolerance. Dehydrin genes (Y2SK, Y2K, and SK2 were showed to be highly responsive to exogenous Spd. PA-induced antioxidant defense and dehydrin genes expression could be blocked by the scavenger of H2O2 and the inhibitors of H2O2 generation or Ca2+ channels blockers, a calmodulin antagonist, as well as the inhibitor of CDPK. These findings suggested that PA regulated tolerance to water stress in white clover associated with antioxidant defenses and dehydrins via involvement in the calcium messenger system and H2O2 signaling pathways. PA-induced H2O2 production required Ca2+ release, while PA-induced Ca2+ release was also essential for H2O2 production, suggesting an interaction between PA-induced H2O2 and Ca2+ signaling.

  10. Taking Leave?

    CERN Multimedia

    2000-01-01

    Planning a holiday? Then if you're a member of the personnel, you'll need to use the Laboratory's new leave system that will be put in place on 1 October. Leave allocations don't change - you are entitled to just as much holiday as before - but instead of being credited annually, your leave will be credited on a monthly basis, and this information will be communicated on your salary slip. The reason for the change is that with the various new leave schemes such as Recruitment by Saved Leave (RSL) and the Progressive Retirement Programme (PRP), a streamlined procedure was required for dealing with all kinds of leave. In the new system, each member of the personnel will have leave accounts to which leave will be credited monthly from the payroll and debited each time an absence is registered in the CERN Electronic Document Handling system (EDH). Leave balances will appear on monthly pay slips, and full details of leave transactions and balances will be available through EDH at all times. As the leave will be c...

  11. Responses of wild watermelon to drought stress: accumulation of an ArgE homologue and citrulline in leaves during water deficits.

    Science.gov (United States)

    Kawasaki, S; Miyake, C; Kohchi, T; Fujii, S; Uchida, M; Yokota, A

    2000-07-01

    Wild watermelon from the Botswana desert had an ability to survive under severe drought conditions by maintaining its water status (water content and water potential). In the analysis by two-dimensional electrophoresis of leaf proteins, seven spots were newly induced after watering stopped. One with the molecular mass of 40 kilodaltons of the spots was accumulated abundantly. The cDNA encoding for the protein was cloned based on its amino-terminal sequence and the amino acid sequence deduced from the determined nucleotide sequences of the cDNA exhibited homology to the enzymes belong to the ArgE/DapE/Acy1/Cpg2/YscS protein family (including acetylornithine deacetylase, carboxypeptidase and aminoacylase-1). This suggests that the protein is involved in the release of free amino acid by hydrolyzing a peptidic bond. As the drought stress progressed, citrulline became one of the major components in the total free amino acids. Eight days after withholding watering, although the lower leaves wilted significantly, the upper leaves still maintained their water status and the content of citrulline reached about 50% in the total free amino acids. The accumulation of citrulline during the drought stress in wild watermelon is an unique phenomenon in C3-plants. These results suggest that the drought tolerance of wild watermelon is related to (1) the maintenance of the water status and (2) a metabolic change to accumulate citrulline.

  12. The roles of H2S and H2O2 in regulating AsA-GSH cycle in the leaves of wheat seedlings under drought stress.

    Science.gov (United States)

    Shan, Changjuan; Zhang, Shengli; Ou, Xingqi

    2018-01-25

    This paper investigated the roles of hydrogen sulfide (H 2 S) and hydrogen peroxide (H 2 O 2 ) and the possible relationship between them in regulating the AsA-GSH cycle in wheat leaves under drought stress (DS). Results showed that DS markedly increased the production of H 2 S and H 2 O 2 , the transcript levels and activities of ascorbate peroxidase (APX), glutathione reductase (GR), monodehydroascorbate reductase (MDHAR), and dehydroascorbate reductase (DHAR); malondialdehyde (MDA) content; and electrolyte leakage (EL). Meanwhile, DS markedly reduced plant height and biomass. Above increases induced by drought stress except MDA content and EL were all suppressed by pretreatments with H 2 S synthesis inhibitor aminooxyaceticacid (AOA) and H 2 O 2 synthesis inhibitor diphenylene iodonium (DPI). Besides, pretreatments with AOA and DPI further significantly increased MDA content and EL and significantly reduced plant height and biomass under DS. DPI reduced the production of H 2 O 2 and H 2 S induced by DS. AOA also reduced the production of H 2 S and H 2 O 2 induced by DS. Pretreatments with NaHS + AOA and H 2 O 2 + DPI reversed above effects of AOA and DPI. Our results suggested that H 2 S and H 2 O 2 all participated in the up-regulation of AsA-GSH cycle in wheat leaves by DS and possibly affected each other.

  13. Endophytic infection alleviates Pb{sup 2+} stress effects on photosystem II functioning of Oryza sativa leaves

    Energy Technology Data Exchange (ETDEWEB)

    Li, Xuemei, E-mail: lxmls132@163.com [College of Chemistry and Life Science, Shenyang Normal University, Shenyang 110034 (China); Zhang, Lihong, E-mail: lihongzhang132@163.com [Environmental Science Department of Liaoning University,Shenyang 110036 (China)

    2015-09-15

    Highlights: • Chl fluorescence parameters of endophyte-infected rice under Pb{sup 2+} stress were tested. • The efficiency and stability of PSII are markedly affected by Pb{sup 2+} stress. • Endophyte infection improved photosynthetic system activity under Pb{sup 2+} stress. • JIP-test is a suitable tool for monitoring of Pb{sup 2+} stress. • Endophyte infection may increase tolerance to Pb{sup 2+} in rice. - Abstract: The aims of this study were to examine the effect of Pb{sup 2+} stress on the primary reaction of photosynthesis and to assess the potential benefits of endophytic infection on the Pb{sup 2+} tolerance of rice seedlings. Rice inoculated with an endophytic fungus (E+) and non-inoculated (E−) were subjected to 0, 50, 100, 150 and 200 μM Pb{sup 2+}. The responses to Pb{sup 2+} stress were characterized by the analysis of Chl a fluorescence. A comparison of E− with E+ rice seedlings, as evaluated by their performance index (PI{sub ABS} and PI{sub tot}), revealed the inhibitory effects of Pb{sup 2+} on photosystem II (PSII) connectivity, the oxygen evolving complex (OEC), and on the J step of the induction curves, which is associated with an inhibition of electron transport from the quinone acceptor Q{sub A} to Q{sub B}. Furthermore, the changes of the donor and the acceptor parameters of PSII were greater in E− than in E+ under Pb{sup 2+} stress. These observations suggest that the efficiency and stability of PSII are markedly affected by Pb{sup 2+} stress, and the photosynthetic energy conservation in E+ was more effective than in E−. We showed that endophytic infection plays an important role in enhancing the photosynthetic mechanism of rice seedlings exposed to Pb{sup 2+} stress.

  14. Transcriptional expression of Stilbene synthase genes are regulated developmentally and differentially in response to powdery mildew in Norton and Cabernet Sauvignon grapevine.

    Science.gov (United States)

    Dai, Ru; Ge, Hui; Howard, Susanne; Qiu, Wenping

    2012-12-01

    Stilbenic compounds are natural phytoalexins that have antimicrobial activities in plant defense against pathogens. Stilbene synthase (STS) is the key enzyme that catalyzes the biosynthesis of stilbenic compounds. Grapevine genome contains a family of preliminarily annotated 35 STS genes, the regulation of each STS gene needs to be studied to define their roles. In this study, we selected eight STS genes, STS8, STS27/31, STS16/22, STS13/17/23, and applied quantitative polymerase chain reaction (qPCR) to characterize their transcriptional expression profiles in leaf tissues upon infection by the powdery mildew fungus (PM), Erysiphe necator (Schw.) Burr. Their transcripts were also compared in young and old leaves as well as in the berry skin at five developmental stages in Vitis vinifera 'Cabernet Sauvignon' and Vitis aestivalis 'Norton'. The results showed that transcripts of selected STS genes increased significantly in Cabernet Sauvignon leaves at 24 and 48 h post inoculation with PM spores and remained unchanged in Norton leaves in response to the PM infection. Transcripts of STS8, STS27/31 and STS13/17/23 were more abundant in the old leaves of Norton than in Cabernet Sauvignon. STS genes showed lower expression levels in young leaves than in old leaves. Transcript levels of the eight STS genes increased drastically in the berry skin of Cabernet Sauvignon and Norton post véraison. In addition, the content of trans-resveratrol in the berry skin rapidly increased post véraison and reached the highest level at harvest. These assays demonstrated that individual STS genes are regulated differentially in response to PM infection and during development in the two grape varieties. The present study yields basic knowledge for further investigation of the regulation and function of each STS gene in grapevine and provides experimental evidences for the functional annotation of the STS gene family in the grapevine genome. Copyright © 2012 Elsevier Ireland Ltd. All

  15. Enhanced salt-induced antioxidative responses involve a contribution of polyamine biosynthesis in grapevine plants.

    Science.gov (United States)

    Ikbal, Fatima Ezzohra; Hernández, José Antonio; Barba-Espín, Gregorio; Koussa, Tayeb; Aziz, Aziz; Faize, Mohamed; Diaz-Vivancos, Pedro

    2014-06-15

    The possible involvement of polyamines in the salt stress adaptation was investigated in grapevine (Vitis vinifera L.) plantlets focusing on photosynthesis and oxidative metabolism. Salt stress resulted in the deterioration of plant growth and photosynthesis, and treatment of plantlets with methylglyoxal-bis(guanylhydrazone) (MGBG), a S-adenosylmethionine decarboxylase (SAMDC) inhibitor, enhanced the salt stress effect. A decrease in PSII quantum yield (Fv/Fm), effective PSII quantum yield (Y(II)) and coefficient of photochemical quenching (qP) as well as increases in non-photochemical quenching (NPQ) and its coefficient (qN) was observed by these treatments. Salt and/or MGBG treatments also triggered an increase in lipid peroxidation and reactive oxygen species (ROS) accumulation as well as an increase of superoxide dismutase (SOD) and peroxidase (POX) activities, but not ascorbate peroxidase (APX) activity. Salt stress also resulted in an accumulation of oxidized ascorbate (DHA) and a decrease in reduced glutathione. MGBG alone or in combination with salt stress increased monodehydroascorbate reductase (MDHAR), SOD and POX activities and surprisingly no accumulation of DHA was noticed following treatment with MGBG. These salt-induced responses correlated with the maintaining of high level of free and conjugated spermidine and spermine, whereas a reduction of agmatine and putrescine levels was observed, which seemed to be amplified by the MGBG treatment. These results suggest that maintaining polyamine biosynthesis through the enhanced SAMDC activity in grapevine leaf tissues under salt stress conditions could contribute to the enhanced ROS scavenging activity and a protection of photosynthetic apparatus from oxidative damages. Copyright © 2014 Elsevier GmbH. All rights reserved.

  16. Combination of RGB and Multispectral Imagery for Discrimination of Cabernet Sauvignon Grapevine Elements

    Directory of Open Access Journals (Sweden)

    Carlota Salinas

    2013-06-01

    Full Text Available This paper proposes a sequential masking algorithm based on the K-means method that combines RGB and multispectral imagery for discrimination of Cabernet Sauvignon grapevine elements in unstructured natural environments, without placing any screen behind the canopy and without any previous preparation of the vineyard. In this way, image pixels are classified into five clusters corresponding to leaves, stems, branches, fruit and background. A custom-made sensory rig that integrates a CCD camera and a servo-controlled filter wheel has been specially designed and manufactured for the acquisition of images during the experimental stage. The proposed algorithm is extremely simple, efficient, and provides a satisfactory rate of classification success. All these features turn out the proposed algorithm into an appropriate candidate to be employed in numerous tasks of the precision viticulture, such as yield estimation, water and nutrients needs estimation, spraying and harvesting.

  17. Combination of RGB and multispectral imagery for discrimination of cabernet sauvignon grapevine elements.

    Science.gov (United States)

    Fernández, Roemi; Montes, Héctor; Salinas, Carlota; Sarria, Javier; Armada, Manuel

    2013-06-19

    This paper proposes a sequential masking algorithm based on the K-means method that combines RGB and multispectral imagery for discrimination of Cabernet Sauvignon grapevine elements in unstructured natural environments, without placing any screen behind the canopy and without any previous preparation of the vineyard. In this way, image pixels are classified into five clusters corresponding to leaves, stems, branches, fruit and background. A custom-made sensory rig that integrates a CCD camera and a servo-controlled filter wheel has been specially designed and manufactured for the acquisition of images during the experimental stage. The proposed algorithm is extremely simple, efficient, and provides a satisfactory rate of classification success. All these features turn out the proposed algorithm into an appropriate candidate to be employed in numerous tasks of the precision viticulture, such as yield estimation, water and nutrients needs estimation, spraying and harvesting.

  18. Developmental control of hypoxia during bud burst in grapevine.

    Science.gov (United States)

    Meitha, Karlia; Agudelo-Romero, Patricia; Signorelli, Santiago; Gibbs, Daniel J; Considine, John A; Foyer, Christine H; Considine, Michael J

    2018-05-01

    Dormant or quiescent buds of woody perennials are often dense and in the case of grapevine (Vitis vinifera L.) have a low tissue oxygen status. The precise timing of the decision to resume growth is difficult to predict, but once committed, the increase in tissue oxygen status is rapid and developmentally regulated. Here, we show that more than a third of the grapevine homologues of widely conserved hypoxia-responsive genes and nearly a fifth of all grapevine genes possessing a plant hypoxia-responsive promoter element were differentially regulated during bud burst, in apparent harmony with resumption of meristem identity and cell-cycle gene regulation. We then investigated the molecular and biochemical properties of the grapevine ERF-VII homologues, which in other species are oxygen labile and function in transcriptional regulation of hypoxia-responsive genes. Each of the 3 VvERF-VIIs were substrates for oxygen-dependent proteolysis in vitro, as a function of the N-terminal cysteine. Collectively, these data support an important developmental function of oxygen-dependent signalling in determining the timing and effective coordination bud burst in grapevine. In addition, novel regulators, including GASA-, TCP-, MYB3R-, PLT-, and WUS-like transcription factors, were identified as hallmarks of the orderly and functional resumption of growth following quiescence in buds. © 2018 John Wiley & Sons Ltd.

  19. Genomics technologies to study structural variations in the grapevine genome

    Directory of Open Access Journals (Sweden)

    Cardone Maria Francesca

    2016-01-01

    Full Text Available Grapevine is one of the most important crop plants in the world. Recently there was great expansion of genomics resources about grapevine genome, thus providing increasing efforts for molecular breeding. Current cultivars display a great level of inter-specific differentiation that needs to be investigated to reach a comprehensive understanding of the genetic basis of phenotypic differences, and to find responsible genes selected by cross breeding programs. While there have been significant advances in resolving the pattern and nature of single nucleotide polymorphisms (SNPs on plant genomes, few data are available on copy number variation (CNV. Furthermore association between structural variations and phenotypes has been described in only a few cases. We combined high throughput biotechnologies and bioinformatics tools, to reveal the first inter-varietal atlas of structural variation (SV for the grapevine genome. We sequenced and compared four table grape cultivars with the Pinot noir inbred line PN40024 genome as the reference. We detected roughly 8% of the grapevine genome affected by genomic variations. Taken into account phenotypic differences existing among the studied varieties we performed comparison of SVs among them and the reference and next we performed an in-depth analysis of gene content of polymorphic regions. This allowed us to identify genes showing differences in copy number as putative functional candidates for important traits in grapevine cultivation.

  20. Genetic characterization of some Romanian red wine grapevine varieties

    Science.gov (United States)

    Ghetea, Ligia Gabriela; Motoc, Rozalia Magda; Niculescu, Ana-Maria; Litescu, Simona Carmen; Duma, Virgil-Florin; Popescu, Carmen Florentina

    2008-04-01

    In our study we have considered three of the most valuable Romanian red wine grapevine cultivars: Feteasca neagra, Feteasca alba and Novac. We have chosen to study grapevine because grapes and wine are an important part of a healthy diet, and because red grapes have the highest content of proanthocyanidins, that act as antioxidants (free radical scavengers) in the human body. Proanthocyanidins possess anti-mutagenic, anti-tumor, anti-viral activities and they present many other confirmed or potential benefits. Genotyping method was applied in order to asses the genetic profile at 14 microsatellite loci, for two cultivars: Feteasca neagra and Feteasca alba. In order to achieve this, the HPLC-DAD method was used. The content of anthocyans in grape skin from two cultivars - Feteasca neagra and Novac - was measured. Microsatellite markers have been certified as powerful tools for assessing genetic identities and genetic relationships between grapevine gene pools. Genetic characterization of grapevine cultivars can certify their authenticity and purity, two features that have a direct effect on the quality and value of the finished product, the wine. In our country, this is the first attempt in order to establish a genetic profile for valuable Romanian origin grapevine varieties. In some of the 14 microsatellitic loci, Feteasca neagra and Feteasca alba cultivars presented allele size variants different from the values cited in the literature, proving that these cultivars belong to a geographical distinct gene pool. The content of anthocyans in Feteasca neagra grape skin was significantly higher than in Novac.

  1. Support Vector Machine and Artificial Neural Network Models for the Classification of Grapevine Varieties Using a Portable NIR Spectrophotometer.

    Science.gov (United States)

    Gutiérrez, Salvador; Tardaguila, Javier; Fernández-Novales, Juan; Diago, María P

    2015-01-01

    The identification of different grapevine varieties, currently attended using visual ampelometry, DNA analysis and very recently, by hyperspectral analysis under laboratory conditions, is an issue of great importance in the wine industry. This work presents support vector machine and artificial neural network's modelling for grapevine varietal classification from in-field leaf spectroscopy. Modelling was attempted at two scales: site-specific and a global scale. Spectral measurements were obtained on the near-infrared (NIR) spectral range between 1600 to 2400 nm under field conditions in a non-destructive way using a portable spectrophotometer. For the site specific approach, spectra were collected from the adaxial side of 400 individual leaves of 20 grapevine (Vitis vinifera L.) varieties one week after veraison. For the global model, two additional sets of spectra were collected one week before harvest from two different vineyards in another vintage, each one consisting on 48 measurement from individual leaves of six varieties. Several combinations of spectra scatter correction and smoothing filtering were studied. For the training of the models, support vector machines and artificial neural networks were employed using the pre-processed spectra as input and the varieties as the classes of the models. The results from the pre-processing study showed that there was no influence whether using scatter correction or not. Also, a second-degree derivative with a window size of 5 Savitzky-Golay filtering yielded the highest outcomes. For the site-specific model, with 20 classes, the best results from the classifiers thrown an overall score of 87.25% of correctly classified samples. These results were compared under the same conditions with a model trained using partial least squares discriminant analysis, which showed a worse performance in every case. For the global model, a 6-class dataset involving samples from three different vineyards, two years and leaves

  2. Support Vector Machine and Artificial Neural Network Models for the Classification of Grapevine Varieties Using a Portable NIR Spectrophotometer.

    Directory of Open Access Journals (Sweden)

    Salvador Gutiérrez

    Full Text Available The identification of different grapevine varieties, currently attended using visual ampelometry, DNA analysis and very recently, by hyperspectral analysis under laboratory conditions, is an issue of great importance in the wine industry. This work presents support vector machine and artificial neural network's modelling for grapevine varietal classification from in-field leaf spectroscopy. Modelling was attempted at two scales: site-specific and a global scale. Spectral measurements were obtained on the near-infrared (NIR spectral range between 1600 to 2400 nm under field conditions in a non-destructive way using a portable spectrophotometer. For the site specific approach, spectra were collected from the adaxial side of 400 individual leaves of 20 grapevine (Vitis vinifera L. varieties one week after veraison. For the global model, two additional sets of spectra were collected one week before harvest from two different vineyards in another vintage, each one consisting on 48 measurement from individual leaves of six varieties. Several combinations of spectra scatter correction and smoothing filtering were studied. For the training of the models, support vector machines and artificial neural networks were employed using the pre-processed spectra as input and the varieties as the classes of the models. The results from the pre-processing study showed that there was no influence whether using scatter correction or not. Also, a second-degree derivative with a window size of 5 Savitzky-Golay filtering yielded the highest outcomes. For the site-specific model, with 20 classes, the best results from the classifiers thrown an overall score of 87.25% of correctly classified samples. These results were compared under the same conditions with a model trained using partial least squares discriminant analysis, which showed a worse performance in every case. For the global model, a 6-class dataset involving samples from three different vineyards, two years

  3. Distribution of Rotundone and Possible Translocation of Related Compounds Amongst Grapevine Tissues in Vitis vinifera L. cv. Shiraz

    Science.gov (United States)

    Zhang, Pangzhen; Fuentes, Sigfredo; Wang, Yueying; Deng, Rui; Krstic, Mark; Herderich, Markus; Barlow, Edward W. R.; Howell, Kate

    2016-01-01

    Rotundone is an attractive wine aroma compound, especially important for cool climate Shiraz. Its presence in wine is mainly from the grape skin, but can also be found in non-grape tissues, such as leaves and stems. Whether rotundone is produced independently within different grapevine tissues or transported amongst non-grape tissues and grape berries remains unclear. The current study investigated the distribution of this compound in different vine tissues during development and studied the most likely mode of rotundone translocation—via phloem—using stable isotope feeding. In addition, local production of rotundone induced by herbivore feeding was assessed. Results showed that rotundone was firstly detected in the petioles and peduncles/rachises within the development of Vitis vinifera L. cv. Shiraz. Different grapevine tissues had a similar pattern of rotundone production at different grape developmental stages. In the individual vine shoots, non-grape tissues contained higher concentrations and amounts of rotundone compared to berries, which showed that non-grape tissues were the larger pool of rotundone within the plant. This study confirmed the local production of rotundone in individual tissues and ruled out the possibility of phloem translocation of rotundone between different tissues. In addition, other terpenes, including one monoterpenoid (geraniol) and six sesquiterpenes (clovene, α-ylangene, β-copaene, α-muurolene, δ-cadinene, and cis/trans-calamenene) were, for the first time, detected in the ethylenediaminetetraacetic acid-facilitated petiole phloem exudates, with their originality unconfirmed. Unlike other herbivore-induced terpenes, herbivorous activity had limited influences on the concentration of rotundone in grapevine leaves. PMID:27446104

  4. Plant Growth Promotion Potential Is Equally Represented in Diverse Grapevine Root-Associated Bacterial Communities from Different Biopedoclimatic Environments

    Directory of Open Access Journals (Sweden)

    Ramona Marasco

    2013-01-01

    Full Text Available Plant-associated bacteria provide important services to host plants. Environmental factors such as cultivar type and pedoclimatic conditions contribute to shape their diversity. However, whether these environmental factors may influence the plant growth promoting (PGP potential of the root-associated bacteria is not widely understood. To address this issue, the diversity and PGP potential of the bacterial assemblage associated with the grapevine root system of different cultivars in three Mediterranean environments along a macrotransect identifying an aridity gradient were assessed by culture-dependent and independent approaches. According to 16S rRNA gene PCR-DGGE, the structure of endosphere and rhizosphere bacterial communities was highly diverse (P=0.03 and was associated with a cultivar/latitudinal/climatic effect. Despite being diverse, the bacterial communities associated with Egyptian grapevines shared a higher similarity with the Tunisian grapevines than those cultivated in North Italy. A similar distribution, according to the cultivar/latitude/aridity gradients, was observed for the cultivable bacteria. Many isolates (23% presented in vitro multiple stress resistance capabilities and PGP activities, the most frequent being auxin synthesis (82%, insoluble phosphate solubilisation (61%, and ammonia production (70%. The comparable numbers and types of potential PGP traits among the three different environmental settings indicate a strong functional homeostasis of beneficial bacteria associated with grape root.

  5. Use of Variogram Parameters in Analysis of Hyperspectral Imaging Data Acquired from Dual-Stressed Crop Leaves

    Directory of Open Access Journals (Sweden)

    Christian Nansen

    2012-01-01

    Full Text Available A detailed introduction to variogram analysis of reflectance data is provided, and variogram parameters (nugget, sill, and range values were examined as possible indicators of abiotic (irrigation regime and biotic (spider mite infestation stressors. Reflectance data was acquired from 2 maize hybrids (Zea mays L. at multiple time points in 2 data sets (229 hyperspectral images, and data from 160 individual spectral bands in the spectrum from 405 to 907 nm were analyzed. Based on 480 analyses of variance (160 spectral bands × 3 variogram parameters, it was seen that most of the combinations of spectral bands and variogram parameters were unsuitable as stress indicators mainly because of significant difference between the 2 data sets. However, several combinations of spectral bands and variogram parameters (especially nugget values could be considered unique indicators of either abiotic or biotic stress. Furthermore, nugget values at 683 and 775 nm responded significantly to abiotic stress, and nugget values at 731 nm and range values at 715 nm responded significantly to biotic stress. Based on qualitative characterization of actual hyperspectral images, it was seen that even subtle changes in spatial patterns of reflectance values can elicit several-fold changes in variogram parameters despite non-significant changes in average and median reflectance values and in width of 95% confidence limits. Such scattered stress expression is in accordance with documented within-leaf variation in both mineral content and chlorophyll concentration and therefore supports the need for reflectance-based stress detection at a high spatial resolution (many hyperspectral reflectance profiles acquired from a single leaf and may be used to explain or characterize within-leaf foraging patterns of herbivorous arthropods.

  6. The response of leaves to heat stress in tomato plants with source-sink modulated by growth regulators

    Directory of Open Access Journals (Sweden)

    Zofia Starck

    2014-01-01

    Full Text Available The response to heat stress was investigated in heat-sensitive, Roma V. F. and heat-tolerant, Robin, cultivars whose fruit growth was stimulated by NOA + GA3 , or NOA + GA3 + zeatin. The treated plants were compared with untreated control plant. In each of these series half of the plants were subjected to one or three cycles of heat stress. A single cycle of 38°/25°C day and night did not significantly affect either the respiration rate or chlorophyll content. In PGR-untreated intact cv. Roma, heat stress inhibited starch formation during the day and strongly depressed night export from the blades. High temperature depressed the night transport less in plants having a higher sink demand of fruits in plant treated with PGR. In this case the amount of substances available for export was much higher and both sugars and starch were more intensively remobilized at night. In intact Robin plants, PGR and heat stress much less affected sugar and starch content. High temperature diminished noctural starch remobilization only in the NOA + GA3 series. Leaf disc growth was evaluated as a measure of response to heat stress after elimination of the direct effect of fruit demands. One cycle of high temperature did not negatively affect the growth of leaf discs; it even caused thermal low growth activation in both cultivars. Three cycles of heat stress depressed leaf disc growth after short-term stimulation, especially in Roma plants. Immediately after 3-day heat stress, there was no response of discs to GA3 or zeatin added to the solution on which the discs were floated. Leaf disc growth of Robin control and NOA + GA3 series was very similar in plants from optimal temperature conditions. High temperature inhibited only disc growth of the NOA + GA3 series owing to depression of starch break-down, diminishing the pool of sugars. In contrast, leaf discs of Roma cv. excided from NOA + GA3 treated plants from the optimal temperature series, grew more intensively

  7. The Urban Environment Can Modify Drought Stress of Small-Leaved Lime (Tilia cordata Mill. and Black Locust (Robinia pseudoacacia L.

    Directory of Open Access Journals (Sweden)

    Astrid Moser

    2016-03-01

    Full Text Available The urban environment characterized by various stresses poses challenges to trees. In particular, water deficits and high temperatures can cause immense drought stress to urban trees, resulting in reduced growth and die-off. Drought-tolerant species are expected to be resilient to these conditions and are therefore advantageous over other, more susceptible species. However, the drought tolerance of urban trees in relation to the specific growth conditions in urban areas remains poorly researched. This study aimed to analyze the annual growth and drought tolerance of two common urban tree species, namely small-leaved lime (Tilia cordata Mill. (T. cordata and black locust (Robinia pseudoacacia L. (R. pseudoacacia, in two cities in southern Germany in relation to their urban growing conditions. Marked growth reductions during drought periods and subsequent fast recovery were found for R. pseudoacacia, whereas T. cordata exhibited continued reduced growth after a drought event, although these results were highly specific to the analyzed city. We further show that individual tree characteristics and environmental conditions significantly influence the growth of urban trees. Canopy openness and other aspects of the surrounding environment (water supply and open surface area of the tree pit, tree size, and tree species significantly affect urban tree growth and can modify the ability of trees to tolerate the drought stress in urban areas. Sustainable tree planting of well adapted tree species to their urban environment ensures healthy trees providing ecosystem services for a high quality of life in cities.

  8. Simultaneous measurement of proline and related compounds in oak leaves by high-performance ligand-exchange chromatography and electrospray ionization mass spectrometry for environmental stress studies.

    Science.gov (United States)

    Oufir, Mouhssin; Schulz, Nadine; Sha Vallikhan, Patan Shaik; Wilhelm, Eva; Burg, Kornel; Hausman, Jean-Francois; Hoffmann, Lucien; Guignard, Cedric

    2009-02-13

    A mass spectrometer was coupled to high-performance ligand-exchange liquid chromatography (HPLEC) for simultaneous analysis of stress associated solutes such as proline, hydroxyproline, methylproline, glycine betaine and trigonelline extracted from leaves of drought stressed oaks and an internal standard namely N-acetylproline. Methanol/chloroform/water extracts were analyzed using an Aminex HPX-87C column and specifically quantified by the positive ion mode of an electrospray ionisation-mass spectrometry (ESI-MS) in single ion monitoring (SIM) mode. The recovery of N-acetyl proline added to oak leaf extracts ranged from 85.2 to 122.1% for an intra-day study. Standard calibration curves showed good linearity in the measured range from 0.3125 to 10micromolL(-1) with the lowest correlation coefficient of 0.99961 for trigonelline. The advantages of this alternative procedure, compared to previously published methods using fluorescence or amperometric detections, are the simultaneous and direct detection of osmoprotectants in a single chromatographic run, a minimal sample preparation, a good specificity and reduced limits of quantification, ranging from 0.1 to 0.6micromolL(-1). Fifty-six days of water deficit exposure resulted in increased foliar free proline levels (2.4-fold, P<0.001, 155micromolg(-1) FW) and glycine betaine contents (2.5-fold, P<0.05, 175micromolg(-1) FW) of drought stressed oak compared to control.

  9. Characterization of an Antioxidant-Enriched Beverage from Grape Musts and Extracts of Winery and Grapevine By-Products

    Directory of Open Access Journals (Sweden)

    Tabita Aguilar

    2018-01-01

    Full Text Available The recovery of antioxidants from complex winery and grapevine by-products into Vitis vinifera must offers new opportunities for wine grapes by the development of a new, enriched fruit juice. However, this demands the search for new valorization methods to get hold of additional antioxidant compounds. The objective of this study was to find a novel functionality for grape pomace, grapevine leaves, and canes by its reuse as a functional matrix for the extraction of antioxidants into grape must. After thermomaceration, 22 polyphenols were identified by high performance liquid chromatography and mass spectrometry. Grape pomace was a good source of anthocyanins (malvidin-3-glucoside, while flavonols (quercetin-3-hexoside and phenolic acids (caftaric acid were the main phenolic compounds in leaf extracts. Catechin dimer was the only polyphenol compound present in all of the matrices. Enriched grape juice comprised by 40:20:40 (v/v/v of pomace, leaf, and cane extracts, yielded an oxygen radical absorbance capacity of pirogallol red and fluorescein ratio of 0.70, indicating that the reactivity of antioxidants present in enriched grape juice was at least as efficient as other polyphenol-rich beverages. Thus, pomace, leaves and canes supply additional polyphenols to grape must that results into a beverage with promissory antioxidant activity and potential health benefits.

  10. Climate change (elevated CO{sub 2}, elevated temperature and moderate drought) triggers the antioxidant enzymes' response of grapevine cv. Tempranillo, avoiding oxidative damage

    Energy Technology Data Exchange (ETDEWEB)

    Salazar-Parra, C.; Aguirreolea, J.; Sanchez-Diaz, M.; Irigoyen, J.J.; Morales, F. (Departamento de Biologia Vegetal, Seccion Biologia Vegetal (Unidad Asociada al CSIC, EEAD, Zaragoza e ICVV, Logrono), Facultades de Ciencias y Farmacia, Universidad de Navarra, Pamplona (Spain))

    2012-07-01

    Photosynthetic carbon fixation (A{sub N}) and photosynthetic electron transport rate (ETR) are affected by different environmental stress factors, such as those associated with climate change. Under stress conditions, it can be generated an electron excess that cannot be consumed, which can react with O{sub 2}, producing reactive oxygen species. This work was aimed to evaluate the influence of climate change (elevated CO{sub 2}, elevated temperature and moderate drought) on the antioxidant status of grapevine (Vitis vinifera) cv. Tempranillo leaves, from veraison to ripeness. The lowest ratios between electrons generated (ETR) and consumed (A{sub N} + respiration + photorespiration) were observed in plants treated with elevated CO{sub 2} and elevated temperature. In partially irrigated plants under current ambient conditions, electrons not consumed seemed to be diverted to alternative ways. Oxidative damage to chlorophylls and carotenoids was not observed. However, these plants had increases in thiobarbituric acid reacting substances, an indication of lipid peroxidation. These increases matched well with an early rise of H{sub 2}O{sub 2} and antioxidant enzyme activities, superoxide dismutase (EC 1.15.1.1), ascorbate peroxidase (EC 1.11.1.11) and catalase (EC 1.11.1.6). Enzymatic activities were maintained high until ripeness. In conclusion, plants grown under current ambient conditions and moderate drought were less efficient to cope with oxidative damage than well-irrigated plants, and more interestingly, plants grown under moderate drought but treated with elevated CO{sub 2} and elevated temperature were not affected by oxidative damage, mainly because of higher rates of electrons consumed in photosynthetic carbon fixation. (Author)

  11. Understanding long-term sick leave in female white-collar workers with burnout and stress-related diagnoses: a qualitative study

    Directory of Open Access Journals (Sweden)

    Sandmark Hélène

    2010-04-01

    Full Text Available Abstract Background Sick leave rates in Sweden have been significant since the end of the 1990s. In this paper we focus on individual female white-collar workers and explore various factors and setting-based sources of ill health in working life and in private life, in order to understand impaired work ability, leading ultimately to long-term sick leave. Methods A qualitative methodology was chosen, and thematic, open-ended interviews were carried out with 16 women. The interviewees were strategically selected from a cohort of 300 women in full-time white-collar jobs in high-level positions, living in three urban areas in Sweden, and on long-term sick leave ≥90 days. A qualitative content analysis was carried out. Results The informants in the study were generally well educated, but a few had surprisingly little formal education considering their salary level and position on the labour market. The women were in professional positions more commonly held by men, either as specialists with some degree of managerial role or as executives with managerial responsibilities. Both external and internal stressors were identified. The analysis indicated that being in these gender-typed jobs could have induced sex discrimination and role conflicts. The women expressed strong agreement regarding success in working life, but emphasised the lack of competence matching in their present jobs. They also lacked the sense of having a rewarding job, saw leadership as weak, and disliked their present workplace and colleagues. Impaired health may have hindered them from changing jobs; conversely, their locked-in positions could have resulted in deterioration in their health status. The women displayed personal overcommitment, both at work and in private life, and had difficulties in setting limits. Conclusions Factors in working life, as well as in private life, played an important role in the informants' deteriorated health and long-term sick leave. Job and

  12. Understanding long-term sick leave in female white-collar workers with burnout and stress-related diagnoses: a qualitative study.

    Science.gov (United States)

    Sandmark, Hélène; Renstig, Monica

    2010-04-26

    Sick leave rates in Sweden have been significant since the end of the 1990s. In this paper we focus on individual female white-collar workers and explore various factors and setting-based sources of ill health in working life and in private life, in order to understand impaired work ability, leading ultimately to long-term sick leave. A qualitative methodology was chosen, and thematic, open-ended interviews were carried out with 16 women. The interviewees were strategically selected from a cohort of 300 women in full-time white-collar jobs in high-level positions, living in three urban areas in Sweden, and on long-term sick leave > or =90 days. A qualitative content analysis was carried out. The informants in the study were generally well educated, but a few had surprisingly little formal education considering their salary level and position on the labour market. The women were in professional positions more commonly held by men, either as specialists with some degree of managerial role or as executives with managerial responsibilities. Both external and internal stressors were identified. The analysis indicated that being in these gender-typed jobs could have induced sex discrimination and role conflicts. The women expressed strong agreement regarding success in working life, but emphasised the lack of competence matching in their present jobs. They also lacked the sense of having a rewarding job, saw leadership as weak, and disliked their present workplace and colleagues. Impaired health may have hindered them from changing jobs; conversely, their locked-in positions could have resulted in deterioration in their health status. The women displayed personal overcommitment, both at work and in private life, and had difficulties in setting limits. Factors in working life, as well as in private life, played an important role in the informants' deteriorated health and long-term sick leave. Job and workplace mismatching, problems in connection with company profitability

  13. Long-term exposure to slightly elevated air temperature alleviates the negative impacts of short term waterlogging stress by altering nitrogen metabolism in cotton leaves.

    Science.gov (United States)

    Wang, Haimiao; Chen, Yinglong; Xu, Bingjie; Hu, Wei; Snider, John L; Meng, Yali; Chen, Binglin; Wang, Youhua; Zhao, Wenqing; Wang, Shanshan; Zhou, Zhiguo

    2018-02-01

    Short-term waterlogging and chronic elevated temperature occur frequently in the Yangtze River Valley, yet the effects of these co-occurring environments on nitrogen metabolism of the subtending leaf (a major source leaf for boll development) have received little attention. In this study, plants were exposed to two temperature regimes (31.6/26.5 °C and 34.1/29.0 °C) and waterlogging events (0 d, 3 d, 6 d) during flowering and boll development. The results showed that the effects of waterlogging stress and elevated temperature in isolation on nitrogen metabolism were quite different. Waterlogging stress not only limited NR (EC 1.6.6.1) and GS (EC 6.3.1.2) activities through the down-regulation of GhNR and GhGS expression for amino acid synthesis, but also promoted protein degradation by enhanced protease activity and peptidase activity, leading to lower organ and total biomass (reduced by 12.01%-27.63%), whereas elevated temperature inhibited protein degradation by limited protease activity and peptidase activity, promoting plant biomass accumulation. Furthermore, 2-3 °C chronic elevated temperature alleviated the negative impacts of a brief (3 d) waterlogging stress on cotton leaves, with the expression of GhNiR up-regulated, the activities of NR, GS and GOGAT (EC 1.4.7.1) increased and the activities of protease and peptidase decreased, leading to higher protein concentration and enhanced leaf biomass for EW 3 relative to AW 3 . The results of the study suggested that exposure to slightly elevated air temperature improves the cotton plants' ability to recover from short-term (3 d) waterlogging stress by sustaining processes associated with nitrogen assimilation. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  14. Urtica dioica leaves modulates hippocampal smoothened-glioma associated oncogene-1 pathway and cognitive dysfunction in chronically stressed mice.

    Science.gov (United States)

    Patel, Sita Sharan; Mahindroo, Neeraj; Udayabanu, Malairaman

    2016-10-01

    The present study was aimed to evaluate the effect of Urtica dioica (UD) extract against chronic unpredictable stress (CUS)-induced associative memory dysfunction and attempted to explore the possible mechanism. Male Swiss albino mice (25-30g) were divided into six groups, viz. group-I received 0.3% carboxymethyl cellulose and served as control (CTRL), group II was exposed to CUS (21days) and received vehicle (CUS), group III was subjected to CUS and received Hypericum perforatum extract (350mg/kg, p.o.) (CUS+HYP), group IV received Hypericum perforatum extract (350mg/kg, p.o.) (CTRL+HYP); group V was subjected to CUS and received UD extract (50mg/kg, p.o.) (CUS+UD), group VI received UD extract (50mg/kg, p.o.) (CTRL+UD). CUS significantly induced body weight loss (p<0.05) and associative memory impairment in step down task (p<0.05) as compared to control mice. CUS significantly downregulated Smo (p<0.05), Gli1 (p<0.01), cyclin D1 (p<0.05), BDNF (p<0.01), TrKB (p<0.01) and MAPK1 (p<0.01) mRNA expression in hippocampus as compared to control mice. CUS significantly increased the levels of TBARS (p<0.01) and nitric oxide (p<0.001), and decreased catalase (p<0.001) and total thiol (p<0.01) in plasma resulting in oxidative stress and inflammation. Chronic UD administration significantly reverted CUS mediated body weight loss (p<0.05) and cognitive impairment (p<0.05). UD administration significantly decreased the levels of TBARS (p<0.01) and nitric oxide (p<0.05), and increased the levels of catalase (p<0.01) and total thiol (p<0.05) in plasma. Chronic UD administration significantly upregulated hippocampal Smo (p<0.05), Gli1 (p<0.001), cyclin D1 (p<0.05), BDNF (p<0.05), TrKB (p<0.05) and MAPK1 (p<0.05) in stressed mice. Further, UD extract did not reverse cyclopamine induced downregulation of Gli1 and Ptch1 mRNA in hippocampal slices. UD modulated Smo-Gli1 pathway in the hippocampus as well as exerted anti-inflammatory and antioxidant effects. UD extract might prove

  15. Cyclic electron flow may provide some protection against PSII photoinhibition in rice (Oryza sativa L.) leaves under heat stress.

    Science.gov (United States)

    Essemine, Jemaa; Xiao, Yi; Qu, Mingnan; Mi, Hualing; Zhu, Xin-Guang

    2017-04-01

    Previously we have shown that a quick down-regulation in PSI activity compares to that of PSII following short-term heat stress for two rice groups including C4023 and Q4149, studied herein. These accessions were identified to have different natural capacities in driving cyclic electron flow (CEF) around PSI; i.e., low CEF (lcef) and high CEF (hcef) for C4023 and Q4149, respectively. The aim of this study was to investigate whether these two lines have different mechanisms of protecting photosystem II from photodamage under heat stress. We observed a stepwise alteration in the shape of Chl a fluorescence induction (OJIP) with increasing temperature treatment. The effect of 44°C treatment on the damping in Chl a fluorescence was more pronounced in C4023 than in Q4149. Likewise, we noted a disruption in the I-step, a decline in the F v due to a strong damping in the F m , and a slight increase in the F 0 . Normalized data demonstrated that the I-step seems more susceptible to 44°C in C4023 than in Q4149. We also measured the redox states of plastocyanin (PC) and P 700 by monitoring the transmission changes at 820nm (I 820 ), and observed a disturbance in the oxidation/reduction kinetics of PC and P 700 . The decline in the amplitude of their oxidation was shown to be about 29% and 13% for C4023 and Q4149, respectively. The electropotential component (Δφ) of ms-DLE appeared more sensitive to temperature stress than the chemical component (ΔpH), and the impact of heat was more evident and drastic in C4023 than in Q4149. Under heat stress, we noticed a concomitant decline in the primary photochemistry of PSII as well as in both the membrane energization process and the lumen protonation for both accessions, and it is evident that heat affects these parameters more in C4023 than in Q4149. All these data suggest that higher CET can confer higher photoprotection to PSII in rice lines, which can be a desirable trait during rice breeding, especially in the context of a

  16. Potassium improves photosynthetic tolerance to and recovery from episodic drought stress in functional leaves of cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Zahoor, Rizwan; Zhao, Wenqing; Dong, Haoran; Snider, John L; Abid, Muhammad; Iqbal, Babar; Zhou, Zhiguo

    2017-10-01

    To investigate whether potassium (K) application enhances the potential of cotton (Gossypium hirsutum L.) plants to maintain physiological functions during drought and recovery, low K-sensitive (Siza 3) and -tolerant (Simian 3) cotton cultivars were exposed to three K rates (0, 150, and 300 K 2 O kg ha -1 ) and either well-watered conditions or severe drought stress followed by a recovery period. Under drought stress, cotton plants showed a substantial decline in leaf water potential, stomatal conductance, photosynthetic rate, and the maximum and actual quantum yield of PSII, resulting in greater non-photochemical quenching and lipid peroxidation as compared to well-watered plants. However, plants under K application not only showed less of a decline in these traits but also displayed greater potential to recover after rewatering as compared to the plants without K application. Plants receiving K application showed lower lipid peroxidation, higher antioxidant enzyme activities, and increased proline accumulation as compared to plants without K application. Significant relationships between rates of photosynthetic recovery and K application were observed. The cultivar Siza 3 exhibited a more positive response to K application than Simian 3. The results suggest that K application enhances the cotton plant's potential to maintain functionality under drought and facilitates recovery after rewatering. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  17. Nature contact and organizational support during office working hours: Benefits relating to stress reduction, subjective health complaints, and sick leave.

    Science.gov (United States)

    Bjørnstad, Siv; Patil, Grete G; Raanaas, Ruth K

    2015-01-01

    Improving social support, and providing nature contact at work are potential health promoting workplace interventions. The objective was to investigate whether nature contact at work is associated with employee's health and participation, and to study whether the possible associations between nature contact and health can be explained by perceived organizational support. Data were collected through a web-based, cross-sectional survey of employees in seven public and private office workplaces in Norway (n = 707, 40% response rate). Multiple linear and logistic regression analysis were performed on 565 participants fulfilling inclusion criteria. A greater amount of indoor nature contact at work was significantly associated with less job stress (B = -0.18, CI = -0.318 to -0.042), fewer subjective health complaints (B = -0.278, CI = -0.445 to -0.112) and less sickness absence (B = -0.061, CI = -0.009 to -0.002). Perceived organizational support mediated the associations between indoor nature contact and job stress and sickness absence, and partly mediated the association with subjective health complaints. Outdoor nature contact showed no reliable association with the outcomes in this study. Extending nature contact in the physical work environment in offices, can add to the variety of possible health-promoting workplace interventions, primarily since it influences the social climate on the workplace.

  18. Physiological and agronomical responses of Syrah grapevine under protected cultivation

    Directory of Open Access Journals (Sweden)

    Claudia Rita de Souza

    2015-01-01

    Full Text Available The performance of Syrah grapevine under protected cultivation with different plastic films was evaluated during 2012 and 2013 seasons in South of Minas Gerais State. Agronomical and physiological measurements were done on eight years old grapevines, grafted onto ‘1103 Paulsen’ rootstock cultivated under uncovered conditions, covered with transparent and with diffuse plastic films. Both plastic covers induced the highest shoot growth rate and specific leaf area. The diffuse plastic induced greater differences on leaf area, pruning weight and leaf chlorophyll content as compared to uncovered vines. Grapevines under diffuse plastic also had the lowest rates of photosynthesis, stomatal conductance and transpiration. Leaf starch, glucose and fructose contents were not affected by treatment, but leaf sucrose was reduced by transparent plastic. The leaf and stem water potential were higher under diffuse plastic. In 2013, grapevines under diffuse plastic showed the highest yields mainly due to decreased rot incidence and increased cluster weight. Furthermore, berries under diffuse plastic showed the highest anthocyanins concentration. The use of diffuse plastic induces more agronomical benefits to produce Syrah grape under protected cultivation.

  19. Control of grapevine wood fungi in commercial nurseries

    Directory of Open Access Journals (Sweden)

    C. Rego

    2009-05-01

    Full Text Available Previous surveys conducted in commercial nurseries found that different wood fungi, namely Cylindrocarpon spp., Botryosphaeriaceae, Phomopsis viticola and Phaeomoniella chlamydospora infect grapevine cuttings. Two field trials were carried out to evaluate the effectiveness of cyprodinil + fludioxonil, pyraclostrobin + metiram, fludioxonil and cyprodinil to prevent or reduce natural infections caused by such fungi. Rootstock and scion cuttings were soaked in fungicidal suspensions for 50 min prior to grafting. After callusing, the grafted cuttings were planted in two commercial field nurseries with and without a previous history of grapevine cultivation. After nine months in the nursery, the plants were uprooted and analysed for the incidence and severity of the wood fungi. Plants uprooted from the field without a previous history of grapevine cultivation were generally less strongly infected by wood fungi. Under this condition, only the mixture cyprodinil + fludioxonil simultaneously reduced the incidence of Cylindrocarpon and Botryosphaeriaceae fungi, as well as the severity of Cylindrocarpon infections. Treatments did not produce significant differences in the incidence and severity of P. viticola, and Pa. chlamydospora. For plants grown in the field with a grapevine history, all fungicides except cyprodinil significantly reduced the incidence and severity of Cylindrocarpon fungi. Also, the incidence and severity of Botryosphaeriaceae pathogens were significantly decreased both by cyprodinil + fludioxonil and by cyprodinil. No significant differences were noticed for P. viticola incidence and severity, and Pa. chlamydospora was not detected again. These results suggest that the practice of soaking grapevine cuttings in selected fungicides prior to grafting significantly reduces Cylindrocarpon spp. and Botryosphaeriaceae infections, thus improving the quality of planting material.

  20. In vivo correlation of olive leaves extract on some oxidative stress markers in streptozotocin-induced diabetes mellitus in rats

    Directory of Open Access Journals (Sweden)

    A. M.R. Afify

    2018-03-01

    Full Text Available Diabetes mellitus type two (T2DM is one of the most extensive diseases in the world. Herbal therapy remains a possible adjunct therapy to sustain better glycemic control and reduce complications arising from diabetes. In order to evaluate the curative impacts of olive leaf extract (OLE on streptozotocin (STZ-induced diabetic rats, twenty-four Wistar male adult rats were divided into four equal groups; control, diabetic control (45 mg/kg STZ, normal rats treated with OLE (17.8 mg/kg b.wt., and diabetic rats treated with OLE (45 mg/kg STZ + 17.8 mg/kg b.wt.. The OLE extract was investigated for in vitro antioxidant activity using the DPPH• assay. The phenolic, tannin, and flavonoid contents were determined. The activity of GPX, SOD, and GSH in RBC lysate, CAT in plasma and MDA in serum were measured. The OLE prevented the decrease in GSH and kept MDA around the normal range in the treated diabetic rats. The current study suggests that OLE might be used safely to ameliorate T2DM and its accompanying oxidative stress.

  1. Over-expression of VvWRKY1 in grapevines induces expression of jasmonic acid pathway-related genes and confers higher tolerance to the downy mildew.

    Directory of Open Access Journals (Sweden)

    Chloé Marchive

    Full Text Available Most WRKY transcription factors activate expression of defence genes in a salicylic acid- and/or jasmonic acid-dependent signalling pathway. We previously identified a WRKY gene, VvWRKY1, which is able to enhance tolerance to fungal pathogens when it is overexpressed in tobacco. The present work analyzes the effects of VvWRKY1 overexpression in grapevine. Microarray analysis showed that genes encoding defence-related proteins were up-regulated in the leaves of transgenic 35S::VvWRKY1 grapevines. Quantitative RT-PCR analysis confirmed that three genes putatively involved in jasmonic acid signalling pathway were overexpressed in the transgenic grapes. The ability of VvWRKY1 to trans-activate the promoters of these genes was demonstrated by transient expression in grape protoplasts. The resistance to the causal agent of downy mildew, Plasmopara viticola, was enhanced in the transgenic plants. These results show that VvWRKY1 can increase resistance of grapevine against the downy mildew through transcriptional reprogramming leading to activation of the jasmonic acid signalling pathway.

  2. Effect of two doses of urea foliar application on leaves and grape nitrogen composition during two vintages.

    Science.gov (United States)

    Pérez-Álvarez, Eva P; Garde-Cerdán, Teresa; García-Escudero, Enrique; Martínez-Vidaurre, José María

    2017-06-01

    Nitrogen affects grapevine growth and also yeast metabolism, which have a direct influence on fermentation kinetics and the formation of different volatile compounds. Throughout the grapevine cycle, soil nitrogen availability and grape nitrogen composition can vary because of different factors. Nitrogen foliar applications can contribute toward enhancing grapevine nitrogen status and minimize the problem of leaching that traditional nitrogen-soil applications can provoke. The present study aimed to evaluate the influence of urea foliar applications on grapevine nitrogen status and grape amino acid content. Accordingly, two different doses of urea were applied over the leaves of a 'Tempranillo' vineyard. The highest urea doses affected nitrogen content on blade leaf tissues after veraison. Must amino acid profiles were modified by urea application and some of the compounds increased their concentrations. The effect of year on the increase of must total amino acid concentrations was more important than the effect of the doses applied. Urea foliar applications can be an interesting tool for decreasing grapevine nitrogen deficiencies. This method of nitrogen implementation in the vineyard could avoid sluggish fermentation problems during winemaking, enhance must nitrogen composition, and contribute to improving wine quality. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  3. Oxidative Stress Parameters and Erythrocyte Membrane Adenosine Triphosphatase Activities in Streptozotocin-induced Diabetic Rats Administered Aqueous Preparation of Kalanchoe Pinnata Leaves.

    Science.gov (United States)

    Menon, Nikhil; Sparks, Jean; Omoruyi, Felix O

    2016-01-01

    Diabetes mellitus is a chronic metabolic disease that according to the World Health Organization affects more than 382 million people. The rise in diabetes mellitus coupled with the lack of an effective treatment has led many to investigate medicinal plants to identify a viable alternative. To evaluate red blood cell (RBC) membrane adenosine triphosphatase (ATPase) activities and antioxidant levels in streptozotocin-induced diabetic rats administered aqueous preparation of Kalanchoe pinnata leaves. Diabetes mellitus was induced in rats by a single administration of streptozotocin (60 mg/kg). Diabetic rats were then treated with aqueous K. pinnata preparation (three mature leaves ~ 9.96 g/70 kg body weight or about 0.14 g/kg body weight/day) for 30 days. Serum glucose, RBC membrane ATPase activities, and antioxidant levels were determined. We noted weight loss and reduced food consumption in the treated diabetic group. Serum glucose levels were reduced in the treated diabetic group compared to the other groups. Superoxide dismutase activity and glutathione levels were not significantly elevated in the treated group compared to the diabetic group. However, serum catalase activity was significantly (P < 0.05) increased in the treated diabetic group compared to the other groups. Serum thiobarbituric acid reactive substances were not significantly altered among the groups. There was a significant (P < 0.05) increase in Mg(2+) ATPase activity and a nonsignificant increase in Na(+)/K(+) ATPase activity in the RBC membrane of the treated diabetic group compared to the diabetic group. The consumption of aqueous preparation of K. pinnata may accrue benefits in the management of diabetes by lowering oxidative stress often associated with the disease and improving the availability of cellular magnesium through an increase in the magnesium ATPase pump in the RBC membrane for increased cellular metabolism of glucose through the glycolytic pathway. We noted weight loss and

  4. Comparing Kaolin and Pinolene to Improve Sustainable Grapevine Production during Drought.

    Science.gov (United States)

    Brillante, Luca; Belfiore, Nicola; Gaiotti, Federica; Lovat, Lorenzo; Sansone, Luigi; Poni, Stefano; Tomasi, Diego

    2016-01-01

    Viticulture is widely practiced in dry regions, where the grapevine is greatly exposed to water stress. Optimizing plant water use efficiency (WUE) without affecting crop yield, grape and wine quality is crucial to limiting use of water for irrigation and to significantly improving viticulture sustainability. This study examines the use in vineyards of particle film technology (engineered kaolin) and compares it to a film-forming antitranspirant (pinolene), traditionally used to limit leaf water loss, and to an untreated control. The trial was carried out under field conditions over three growing seasons, during which moderate to very severe plant water stress (down to -1.9 MPa) was measured through stem water potential. Leaf stomatal conductance (gs) and photosynthesis rate (An) were measured during the seasons and used to compute intrinsic WUE (WUEi, defined as An/gs ratio). Leaf temperature was also recorded and compared between treatments. Bunch quantity, bunch and berry weight, sugar accumulation, anthocyanin and flavonoid contents were measured. Finally, microvinifications were performed and resultant wines subjected to sensory evaluation.Results showed that the use of kaolin increased grapevine intrinsic WUE (+18% on average as compared to unsprayed vines) without affecting berry and bunch weight and quantity, or sugar level. Anthocyanin content increased (+35%) in kaolin treatment, and the wine was judged more attractive (p-value wine was the least appreciated. This study demonstrates that particle film technology can improve vine WUEi and wine quality at the same time, while traditional antitranspirants were not as effective for these purposes. This positive effect can be used in interaction with other already-demonstrated uses of particle film technology, such as pest control and sunburn reduction, in order to achieve more sustainable vineyard management.

  5. Selection and evaluation of phosphate-solubilizing bacteria from grapevine rhizospheres for use as biofertilizers

    Energy Technology Data Exchange (ETDEWEB)

    Liu, M.; Liu, X.; Cheng, B.S.; Ma, X.L.; Lyu, X.; Zhao, X.; Ju, Y.; Min, Z.; Fang, Y.

    2016-07-01

    Phosphate-solubilizing bacteria (PSB) have the ability to solubilize insoluble phosphorus (P) and release soluble P. Extensive research has been performed with respect to PSB isolation from the rhizospheres of various plants, but little is known about the prevalence of PSB in the grapevine rhizosphere. In this study, we aimed to isolate and identify PSB from the grapevine rhizosphere in five vineyards of Northwest China, to characterize their plant-growth-promoting (PGP) traits, evaluate the effect of stress on their phosphate-solubilizing activity (PSA), and test their ability to stimulate the growth of Vitis vinifera L. cv. Cabernet Sauvignon. From the vineyard soils, 66 PSB isolates were screened, and 10 strains with high PSA were identified by 16S rRNA sequencing. Sequence analysis revealed that these 10 strains belonged to 4 genera and 5 species: Bacillus aryabhattai, B. megaterium, Klebsiella variicola, Stenotrophomonas rhizophila, and Enterobacter aerogenes. The selected PSB strains JY17 (B. aryabhattai) and JY22 (B. aryabhattai) were positive for multiple PGP traits, including nitrogen fixation and production of indole acetic acid (IAA), siderophores, 1-aminocyclopropane-1-carboxylate (ACC) deaminase, chitinase, and protease. JY17 and JY22 showed strong PSA under stress conditions of high pH, high salt, and high temperature. Therefore, these two isolates can be used as biofertilizers in saline-alkaline soils. The inoculation with PSB significantly facilitated the growth of V. vinifera cv. Cabernet Sauvignon under greenhouse conditions. Use of these PSB as biofertilizers will increase the available P content in soils, minimize P-fertilizer application, reduce environmental pollution, and promote sustainable agriculture.

  6. Selection and evaluation of phosphate-solubilizing bacteria from grapevine rhizospheres for use as biofertilizers

    International Nuclear Information System (INIS)

    Liu, M.; Liu, X.; Cheng, B.S.; Ma, X.L.; Lyu, X.; Zhao, X.; Ju, Y.; Min, Z.; Fang, Y.

    2016-01-01

    Phosphate-solubilizing bacteria (PSB) have the ability to solubilize insoluble phosphorus (P) and release soluble P. Extensive research has been performed with respect to PSB isolation from the rhizospheres of various plants, but little is known about the prevalence of PSB in the grapevine rhizosphere. In this study, we aimed to isolate and identify PSB from the grapevine rhizosphere in five vineyards of Northwest China, to characterize their plant-growth-promoting (PGP) traits, evaluate the effect of stress on their phosphate-solubilizing activity (PSA), and test their ability to stimulate the growth of Vitis vinifera L. cv. Cabernet Sauvignon. From the vineyard soils, 66 PSB isolates were screened, and 10 strains with high PSA were identified by 16S rRNA sequencing. Sequence analysis revealed that these 10 strains belonged to 4 genera and 5 species: Bacillus aryabhattai, B. megaterium, Klebsiella variicola, Stenotrophomonas rhizophila, and Enterobacter aerogenes. The selected PSB strains JY17 (B. aryabhattai) and JY22 (B. aryabhattai) were positive for multiple PGP traits, including nitrogen fixation and production of indole acetic acid (IAA), siderophores, 1-aminocyclopropane-1-carboxylate (ACC) deaminase, chitinase, and protease. JY17 and JY22 showed strong PSA under stress conditions of high pH, high salt, and high temperature. Therefore, these two isolates can be used as biofertilizers in saline-alkaline soils. The inoculation with PSB significantly facilitated the growth of V. vinifera cv. Cabernet Sauvignon under greenhouse conditions. Use of these PSB as biofertilizers will increase the available P content in soils, minimize P-fertilizer application, reduce environmental pollution, and promote sustainable agriculture.

  7. Comparing Kaolin and Pinolene to Improve Sustainable Grapevine Production during Drought.

    Directory of Open Access Journals (Sweden)

    Luca Brillante

    Full Text Available Viticulture is widely practiced in dry regions, where the grapevine is greatly exposed to water stress. Optimizing plant water use efficiency (WUE without affecting crop yield, grape and wine quality is crucial to limiting use of water for irrigation and to significantly improving viticulture sustainability. This study examines the use in vineyards of particle film technology (engineered kaolin and compares it to a film-forming antitranspirant (pinolene, traditionally used to limit leaf water loss, and to an untreated control. The trial was carried out under field conditions over three growing seasons, during which moderate to very severe plant water stress (down to -1.9 MPa was measured through stem water potential. Leaf stomatal conductance (gs and photosynthesis rate (An were measured during the seasons and used to compute intrinsic WUE (WUEi, defined as An/gs ratio. Leaf temperature was also recorded and compared between treatments. Bunch quantity, bunch and berry weight, sugar accumulation, anthocyanin and flavonoid contents were measured. Finally, microvinifications were performed and resultant wines subjected to sensory evaluation.Results showed that the use of kaolin increased grapevine intrinsic WUE (+18% on average as compared to unsprayed vines without affecting berry and bunch weight and quantity, or sugar level. Anthocyanin content increased (+35% in kaolin treatment, and the wine was judged more attractive (p-value <0.05 and slightly more appreciated (p-value < 0.1 than control. Pinolene did not increase WUEi, limiting An more than gs; grapes with this treatment contained lower sugar and anthocyanin content than control, and the obtained wine was the least appreciated. This study demonstrates that particle film technology can improve vine WUEi and wine quality at the same time, while traditional antitranspirants were not as effective for these purposes. This positive effect can be used in interaction with other already

  8. Omics Approaches for Understanding Grapevine Berry Development: Regulatory Networks Associated with Endogenous Processes and Environmental Responses

    Directory of Open Access Journals (Sweden)

    Alejandra Serrano

    2017-09-01

    Full Text Available Grapevine fruit development is a dynamic process that can be divided into three stages: formation (I, lag (II, and ripening (III, in which physiological and biochemical changes occur, leading to cell differentiation and accumulation of different solutes. These stages can be positively or negatively affected by multiple environmental factors. During the last decade, efforts have been made to understand berry development from a global perspective. Special attention has been paid to transcriptional and metabolic networks associated with the control of grape berry development, and how external factors affect the ripening process. In this review, we focus on the integration of global approaches, including proteomics, metabolomics, and especially transcriptomics, to understand grape berry development. Several aspects will be considered, including seed development and the production of seedless fruits; veraison, at which anthocyanin accumulation begins in the berry skin of colored varieties; and hormonal regulation of berry development and signaling throughout ripening, focusing on the transcriptional regulation of hormone receptors, protein kinases, and genes related to secondary messenger sensing. Finally, berry responses to different environmental factors, including abiotic (temperature, water-related stress and UV-B radiation and biotic (fungi and viruses stresses, and how they can significantly modify both, development and composition of vine fruit, will be discussed. Until now, advances have been made due to the application of Omics tools at different molecular levels. However, the potential of these technologies should not be limited to the study of single-level questions; instead, data obtained by these platforms should be integrated to unravel the molecular aspects of grapevine development. Therefore, the current challenge is the generation of new tools that integrate large-scale data to assess new questions in this field, and to support

  9. Dioscoreophyllum cumminsii (Stapf) Diels leaves halt high-fructose induced metabolic syndrome: Hyperglycemia, insulin resistance, inflammation and oxidative stress.

    Science.gov (United States)

    Ajiboye, T O; Aliyu, H; Tanimu, M A; Muhammad, R M; Ibitoye, O B

    2016-11-04

    extract. Data generated in this study further laid credence to the hypoglycemic activity of aqueous leaf extract of D. cumminsii as evident from the reversal of hyperglycemia, insulin resistance, dyslipidemia, inflammation and oxidative stress in high-fructose diet-induced metabolic syndrome rats. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  10. Uptake and transport of radioactive cesium and strontium into grapevines after leaf contamination

    Science.gov (United States)

    Zehnder, H. J.; Kopp, P.; Eikenberg, J.; Feller, U.; Oertli, J. J.

    1995-07-01

    From 1989 to 1993 the foliar uptake of radioactive strontium (Sr-85) and cesium (Cs-134) by selected leaves of grapevine plants and the subsequent redistribution within the plants was examined under controlled conditions in a greenhouse. The radionuclides were applied as chlorides. These plants were grown in large pots containing a mixture of local soil and peat. Plant and soil samples were analyzed throughout the growing season and also during the following vegetation period. Only traces of the applied radiostrontium were taken up by the leaves. This element was essentially not redistributed within the plants. In contrast, radiocesium was easily taken up through the leaf surface, transported to other plant parts and to some extent released from the roots into the soil. Cesium reaching the soil may interact with clay particles causing a very reduced availability for plants. Therefore the soil may act as a long-term sink for radiocesium. On the other hand, grape berries represent transient sinks. The cesium levels in the berries decreased again in a late phase of maturation, but the mechanisms causing this loss are not yet identified. During the second vegetation period, only a very minor proportion of the radiocesium taken up previously by the plants was present in the above ground parts.

  11. Comparison of RNA Extraction Methods for the Identification of Grapevine fan leaf virus

    Directory of Open Access Journals (Sweden)

    Z. Gholampour

    2016-06-01

    Full Text Available Introduction: To now, more than 70 viral diseases have been reported from grapevine. Serological methods are regular diagnostic tools of grapevine viruses, however, their sensitivity has affected by seasonal fluctuations of the virus. Reverse transcription polymerase chain reaction provides significant improvement in detection of grapevine viruses. Extraction of high-quality RNA is essential for the successful application of many molecular techniques, such as RT-PCR. Extraction of high-quality RNA from the leaves of woody plants, such as grapevine, is particularly challenging because of high concentrations of polysaccharides, polyphenols, and other secondary metabolites. Some RNA extraction methods yield pellets that are poorly soluble, indicating the presence of unknown contaminants, whereas others are gelatinous, indicating the presence of polysaccharides. RNA can make complexes with polysaccharides and phenolic compounds render the RNA unusable for applications such as reverse transcription. Grapevine fanleaf virus is a member of the genus Nepovirus in the family Secoviridae. The GFLV genome consists of two positive-sense single stranded RNAs. The genome has a poly (A tail at the 3´ terminus and a covalently linked VPG protein at the 5´ terminus. Several extraction methods had been reported to be used for identification of GFLV in grapevine. Some of them require harmful chemical material; disadvantages of other are high costs. Immunocapture-RT-PCR requires preparation of specific antibody and direct binding RT-PCR (DB-RT-PCR has a high contamination risk. In this study, four RNA extraction protocols were compared with a commercial isolation kit to explore the most efficient RNA isolation method for grapevines. Material and Methods: 40 leaf samples were randomly collected during the growing season of 2011-2012. GFLV was detected in leaf samples by enzyme linked immunosorbent assay (ELISA Using specific antibodies raised against Iranian

  12. The Phenylpropanoid Pathway Is Controlled at Different Branches by a Set of R2R3-MYB C2 Repressors in Grapevine1

    Science.gov (United States)

    Cavallini, Erika; Matus, José Tomás; Finezzo, Laura; Zenoni, Sara; Loyola, Rodrigo; Guzzo, Flavia; Schlechter, Rudolf; Ageorges, Agnès; Arce-Johnson, Patricio

    2015-01-01

    Because of the vast range of functions that phenylpropanoids possess, their synthesis requires precise spatiotemporal coordination throughout plant development and in response to the environment. The accumulation of these secondary metabolites is transcriptionally controlled by positive and negative regulators from the MYB and basic helix-loop-helix protein families. We characterized four grapevine (Vitis vinifera) R2R3-MYB proteins from the C2 repressor motif clade, all of which harbor the ethylene response factor-associated amphiphilic repression domain but differ in the presence of an additional TLLLFR repression motif found in the strong flavonoid repressor Arabidopsis (Arabidopsis thaliana) AtMYBL2. Constitutive expression of VvMYB4a and VvMYB4b in petunia (Petunia hybrida) repressed general phenylpropanoid biosynthetic genes and selectively reduced the amount of small-weight phenolic compounds. Conversely, transgenic petunia lines expressing VvMYBC2-L1 and VvMYBC2-L3 showed a severe reduction in petal anthocyanins and seed proanthocyanidins together with a higher pH of crude petal extracts. The distinct function of these regulators was further confirmed by transient expression in tobacco (Nicotiana benthamiana) leaves and grapevine plantlets. Finally, VvMYBC2-L3 was ectopically expressed in grapevine hairy roots, showing a reduction in proanthocyanidin content together with the down-regulation of structural and regulatory genes of the flavonoid pathway as revealed by a transcriptomic analysis. The physiological role of these repressors was inferred by combining the results of the functional analyses and their expression patterns in grapevine during development and in response to ultraviolet B radiation. Our results indicate that VvMYB4a and VvMYB4b may play a key role in negatively regulating the synthesis of small-weight phenolic compounds, whereas VvMYBC2-L1 and VvMYBC2-L3 may additionally fine tune flavonoid levels, balancing the inductive effects of

  13. Computer Vision for High-Throughput Quantitative Phenotyping: A Case Study of Grapevine Downy Mildew Sporulation and Leaf Trichomes.

    Science.gov (United States)

    Divilov, Konstantin; Wiesner-Hanks, Tyr; Barba, Paola; Cadle-Davidson, Lance; Reisch, Bruce I

    2017-12-01

    Quantitative phenotyping of downy mildew sporulation is frequently used in plant breeding and genetic studies, as well as in studies focused on pathogen biology such as chemical efficacy trials. In these scenarios, phenotyping a large number of genotypes or treatments can be advantageous but is often limited by time and cost. We present a novel computational pipeline dedicated to estimating the percent area of downy mildew sporulation from images of inoculated grapevine leaf discs in a manner that is time and cost efficient. The pipeline was tested on images from leaf disc assay experiments involving two F 1 grapevine families, one that had glabrous leaves (Vitis rupestris B38 × 'Horizon' [RH]) and another that had leaf trichomes (Horizon × V. cinerea B9 [HC]). Correlations between computer vision and manual visual ratings reached 0.89 in the RH family and 0.43 in the HC family. Additionally, we were able to use the computer vision system prior to sporulation to measure the percent leaf trichome area. We estimate that an experienced rater scoring sporulation would spend at least 90% less time using the computer vision system compared with the manual visual method. This will allow more treatments to be phenotyped in order to better understand the genetic architecture of downy mildew resistance and of leaf trichome density. We anticipate that this computer vision system will find applications in other pathosystems or traits where responses can be imaged with sufficient contrast from the background.

  14. Effects of moderate and high rates of biochar and compost on grapevine growth in a greenhouse experiment

    Directory of Open Access Journals (Sweden)

    Arianna Bozzolo

    2017-03-01

    Full Text Available Biochar is used as soil amendment and enhancer of plant growth, but the mechanisms involved in grapevine are not understood. In this study, the short-term effects of amendments were evaluated in a trial combining three substrates (biochar, compost, peat-based media with three doses (30, 70, 100% along a time sequence on 1-year-old bare root cuttings of grapevine. Amendments were analyzed for elemental composition. Soil pH, electrical conductivity (EC, chlorophyll (CHL, flavonoids (FL, anthocyans (ANT and nitrogen balance index (NBI were measured.Biochar differed from other amendments for stable C structures, where nutrients and lignin residues were high in compost. Biochar increased soil pH, whereas biochar plus compost mixture augmented EC. The amended plants had detrimental effects on root, true and lateral leaves. Nevertheless, at the lowest rate biochar increased the primary shoot and total scion to root biomass ratio. Among biochemicals, ANT and NBI were mostly affected by biochar, while compost gave only slight increments. Thus, although biochar rate was not adequate for the shedding in open field our results suggest that biochar might be useful in nursery when used at low dosages.

  15. Vegetative, productive and qualitative performance of grapevine "Cabernet Sauvignon" according to the use of winter cover crops

    Directory of Open Access Journals (Sweden)

    Jean Carlos Bettoni

    Full Text Available ABSTRACT To study the effect of winter cover crops on the vegetative, productive and qualitative behavior of "Cabernet Sauvignon" grapevines, an experiment was conducted in two wine harvests by sowing different species of winter cover crops and additional treatments with manual weeding and mechanical mowing in an experimental vineyard located at the Experimental Station of Epagri in Videira, state of Santa Catarina, Brazil. Plant attributes of the grapevine, such as number of rods and weight of pruned material and number of branches per plant. At the time of skin color change, petioles of recently matured leaves were collected for analysis of the levels of N, P, K, Ca, Mg, Fe, Mn, Zn and B. Moments before harvest, 100 grape berries were collected randomly to determine the total soluble solids, titratable acidity and pH. At harvest, the number of bunches per branch, the number and mass of clusters per plant and the average mass of clusters per plot were determined. Fresh and dry matter yields of the cover crop and weed plants were also determined when coverage reached full bloom. The winter cover crops did not alter the yield and quality of "Cabernet Sauvignon" grapes and showed no differences from each other for the management of spontaneous vegetation by hand weeding or mechanical mowing. Rye and ryegrass are effective alternatives for weed control alternatives. The species of white and red clover present difficulty in initial establishment, producing a small amount of biomass.

  16. Using Image Texture and Spectral Reflectance Analysis to Detect Yellowness and Esca in Grapevines at Leaf-Level

    Directory of Open Access Journals (Sweden)

    Hania Al-Saddik

    2018-04-01

    Full Text Available Plant diseases are one of the main reasons behind major economic and production losses in the agricultural field. Current research activities enable large fields monitoring and plant disease detection using innovative and robust technologies. French grapevines have a reputation for producing premium quality wines, however, these major fruit crops are susceptible to many diseases, including Esca, Downy mildew, Powdery mildew, Yellowing, and many others. In this study, we focused on two main infections (Esca and Yellowing, and data were gathered from fields that were located in Aquitaine and Burgundy regions, France. Since plant diseases can be diagnosed from the properties of the leaf, we acquired both Red-Green-Blue (RGB digital image and hyperspectral reflectance data from infected and healthy leaves. Biophysical parameters that were produced by the PROSPECT model inversion together with texture parameters compiled from the literature were deduced. Then we investigated their relationship to damage caused by Yellowing and Esca. This study examined whether spectral and textural data can identify the two diseases through the use of Neural Networks. We obtained an overall accuracy of 99% for both of the diseases when textural and spectral data are combined. These results suggest that, first, biophysical parameters present a valid dimension reduction tool that could replace the use of complete hyperspectral data. Second, remote sensing using spectral reflectance and digital images can make an overall nondestructive, rapid, cost-effective, and reproducible technique to determine diseases in grapevines with a good level of accuracy.

  17. A transient expression assay for the in planta efficacy screening of an antimicrobial peptide against grapevine bacterial pathogens.

    Science.gov (United States)

    Visser, M; Stephan, D; Jaynes, J M; Burger, J T

    2012-06-01

    Natural and synthetic antimicrobial peptides (AMPs) are of increasing interest as potential resistance conferring elements in plants against pathogen infection. The efficacy of AMPs against pathogens is prescreened by in vitro assays, and promising AMP candidates are introduced as transgenes into plants. As in vitro and in planta environments differ, a prescreening procedure of the AMP efficacy in the plant environment is desired. Here, we report the efficacy of the purified synthetic peptide D4E1 against the grapevine-infecting bacterial pathogens Agrobacterium vitis and Xylophilus ampelinus in vitro and describe for the first time an in planta prescreening procedure based on transiently expressed D4E1. The antimicrobial effect of D4E1 against Ag. vitis and X. ampelinus was shown by a reduction in colony-forming units in vitro in a traditional plate-based assay and by a reduction in bacterial titres in planta as measured by quantitative real-time PCR (qPCR) in grapevine leaves transiently expressing D4E1. A statistically significant reduction in titre was shown for X. ampelinus, but for Ag. vitis, a significant reduction in titre was only observed in a subset of plants. The titres of both grapevine-infecting bacterial pathogens were reduced in an in vitro assay and for X. ampelinus in an in planta assay by D4E1 application. This widens the applicability of D4E1 as a potential resistance-enhancing element to additional pathogens and in a novel plant species. D4E1 is a promising candidate to confer enhanced resistance against the two tested grapevine bacterial pathogens, and the applied transient expression system proved to be a valuable tool for prescreening of D4E1 efficacy in an in planta environment. The described prescreening procedure can be used for other AMPs and might be adapted to other plant species and pathogens before the expensive and tedious development of stably transgenic lines is started. © 2012 The Authors. Letters in Applied Microbiology © 2012

  18. Effects of heat stress on some reproductive parameters of male cavie (Cavia porcellus) and mitigation strategies using guava (Psidium guajava) leaves essential oil.

    Science.gov (United States)

    Ngoula, Ferdinand; Guemdjo Tekam, Maryvonne; Kenfack, Augustave; Tadondjou Tchingo, Cyrille D'Alex; Nouboudem, Sandrine; Ngoumtsop, Herman; Tsafack, Borice; Teguia, Alexis; Kamtchouing, Pierre; Galeotti, Marco; Tchoumboue, Joseph

    2017-02-01

    Climate changes, particularly the increase of temperature are among the main causes behind the decline of fertility in humans as well as animals. In this study, the effects of heat stress on some reproductive parameters of male cavies and mitigation strategies using guava leaves essential oil (GLEO) were studied. For this purpose, 40 male cavies aged 2.5-3 months and weighing between 348 and 446g were divided into 4 groups of 10 animals each and subjected to the following temperatures: Ambient temperature (20-25°C) for the control group, 35°C for group 1, 45°C for group 2 and 45°C+100µl GLEO/kg body weight, administered by gavage to animals for group 3. Exposure time of heat was 7h per day for 60 days. Results reveal that the relative weights of testes, epididymis, vas deferens and seminal vesicles were hardly affected by the temperature levels considered (P>0.05). The mass and individual sperm motility was significantly lower (Pleaves essential oil. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Grapevine species from varied native habitats exhibit differences in embolism formation/repair associated with leaf gas exchange and root pressure.

    Science.gov (United States)

    Knipfer, Thorsten; Eustis, Ashley; Brodersen, Craig; Walker, Andrew M; McElrone, Andrew J

    2015-08-01

    Drought induces xylem embolism formation, but grapevines can refill non-functional vessels to restore transport capacity. It is unknown whether vulnerability to embolism formation and ability to repair differ among grapevine species. We analysed in vivo embolism formation and repair using x-ray computed microtomography in three wild grapevine species from varied native habitats (Vitis riparia, V. arizonica, V. champinii) and related responses to measurements of leaf gas exchange and root pressure. Vulnerability to embolism formation was greatest in V. riparia, intermediate in V. arizonica and lowest in V. champinii. After re-watering, embolism repair was rapid and pronounced in V. riparia and V. arizonica, but limited or negligible in V. champinii even after numerous days. Similarly, root pressure measured after re-watering was positively correlated with drought stress severity for V. riparia and V. arizonica (species exhibiting embolism repair) but not for V. champinii. Drought-induced reductions in transpiration were greatest for V. riparia and least in V. champinii. Recovery of transpiration after re-watering was delayed for all species, but was greatest for V. champinii and most rapid in V. arizonica. These species exhibit varied responses to drought stress that involve maintenance/recovery of xylem transport capacity coordinated with root pressure and gas exchange responses. © 2014 John Wiley & Sons Ltd.

  20. Biostimulation of grapevine : mode of action and possible agronomic uses

    OpenAIRE

    Krzyzaniak, Yuko; Trouvelot, Sophie; Heloir, Marie-Claire; Fourquez, P.; Magnin-Robert, Jean-Bernard; Randoux, B.; Siah, A.; Halama, Patrice; Moreau, Emmanuelle; Adrian, Marielle

    2016-01-01

    Although there is a growing interest for the use of biostimulants in agriculture, only few methods allowing a precise description of their effects on plants have been reported. In the IRIS+ FUI project, two major and highly different worldwide crops, wheat (annual, monocotyledon) and grapevine (perennial, broadleaf), were chosen to deepen our knowledge of such compounds and explore their potential additional interest. The first objective is to develop in greenhouse conditions, a panel of tool...

  1. Atmospheric circulation patterns and phenological anomalies of grapevine in Italy

    Science.gov (United States)

    Cola, Gabriele; Alilla, Roberta; Dal Monte, Giovanni; Epifani, Chiara; Mariani, Luigi; Parisi, Simone Gabriele

    2014-05-01

    Grapevine (Vitis vinifera L.) is a fundamental crop for Italian agriculture as testified by the first place of Italy in the world producers ranking. This justify the importance of quantitative analyses referred to this crucial crop and aimed to quantify meteorological resources and limitations to development and production. Phenological rhythms of grapevine are strongly affected by surface fields of air temperature which in their turn are affected by synoptic circulation. This evidence highlights the importance of an approach based on dynamic climatology in order to detect and explain phenological anomalies that can have relevant effects on quantity and quality of grapevine production. In this context, this research is aimed to study the existing relation among the 850 hPa circulation patterns over the Euro-Mediterranean area from NOAA Ncep dataset and grapevine phenological fields for Italy over the period 2006-2013, highlighting the main phenological anomalies and analyzing synoptic determinants. This work is based on phenological fields with a standard pixel of 2 km routinely produced from 2006 by the Iphen project (Italian Phenological network) on the base of phenological observations spatialized by means of a specific algorithm based on cumulated thermal resources expressed as Normal Heat Hours (NHH). Anomalies have been evaluated with reference to phenological normal fields defined for the Italian area on the base of phenological observations and Iphen model. Results show that relevant phenological anomalies observed over the reference period are primarily associated with long lasting blocking systems driving cold air masses (Arctic or Polar-Continental) or hot ones (Sub-Tropical) towards the Italian area. Specific cases are presented for some years like 2007 and 2011.

  2. ADVANCES IN PROPAGATION OF GRAPEVINE IN THE WORLD

    OpenAIRE

    GROHS, DANIEL SANTOS; ALMANÇA, MARCUS ANDRÉ KURTZ; FAJARDO, THOR VINICIUS MARTINS; HALLEEN, FRANCOIS; MIELE, ALBERTO

    2017-01-01

    ABSTRACT Grapevine production by classical grafting methods and in commercial scale emerged over 130 years. This system remained handmade until the mid-1950s, when the first international certification programs aimed at obtaining mother plants with high viral sanity emerged. The necessity to increase the scale of production on industrial model and plant material production based on minimum morphological standards appeared at the end of the 1960s. Along the 1970s, research unlocked knowledge ...

  3. ADVANCES IN PROPAGATION OF GRAPEVINE IN THE WORLD

    Directory of Open Access Journals (Sweden)

    DANIEL SANTOS GROHS

    2017-12-01

    Full Text Available ABSTRACT Grapevine production by classical grafting methods and in commercial scale emerged over 130 years. This system remained handmade until the mid-1950s, when the first international certification programs aimed at obtaining mother plants with high viral sanity emerged. The necessity to increase the scale of production on industrial model and plant material production based on minimum morphological standards appeared at the end of the 1960s. Along the 1970s, research unlocked knowledge on semi-automated grafting, process hygiene, use of plant growth regulators and understanding of physiological events of rootstock-scion compatibility, callus formation and rooting. So, until the mid-2000s, certification schemes and propagation processes advanced little in technical standard. However, grapevine growing areas were expanded and demands for plant material increased, and new diseases emerged from contaminated nurseries. These new diseases (new viral complexes, phytoplasmas, bacteria and grapevine trunk diseases were discovered by high-sensitivity diagnostic methods. Today, there is a new discussion on the nursery segment worldwide. The propagation techniques have been reviewed from the perspective of reducing the incidence of new diseases and minimum physiological damage of nursery plants during the production stages. Therefore, technological innovations regarding equipment, practices and production inputs have been incorporated in new certification schemes. However, despite these advantages, these schemes have become more complex and multidisciplinary than previous ones, bringing difficulties in adaptation of nurserymen.

  4. HEAVY METALS AND MICRONUTRIENTS IN THE SOIL AND GRAPEVINE UNDER DIFFERENT IRRIGATION STRATEGIES

    Directory of Open Access Journals (Sweden)

    Vanessa de Souza Oliveira

    2015-02-01

    Full Text Available Soils under natural conditions have heavy metals in variable concentrations and there may be an increase in these elements as a result of the agricultural practices adopted. Transport of heavy metals in soil mainly occurs in forms dissolved in the soil solution or associated with solid particles, water being their main means of transport. In this context, the aim of this study was to evaluate the heavy metal and micronutrient content in the soil and in the grapevine plant and fruit under different irrigation strategies. The experiment was carried out in Petrolina, PE, Brazil. The treatments consisted of three irrigation strategies: full irrigation (FI, regulated deficit irrigation (RDI, and deficit irrigation (DI. During the period of grape maturation, soil samples were collected at the depths of 0-10, 10-20, 20-40, 40-60, and 60-80 cm. In addition, leaves were collected at the time of ripening of the bunches, and berries were collected at harvest. Thus, the heavy metal and micronutrient contents were determined in the soil, leaves, and berries. The heavy metal and micronutrient contents in the soil showed a stochastic pattern in relation to the different irrigation strategies. The different irrigation strategies did not affect the heavy metal and micronutrient contents in the vine leaves, and they were below the contents considered toxic to the plant. In contrast, the greater availability of water in the FI treatment favored a greater Cu content in the grape, which may be a risk to vines, causing instability and turbidity. Thus, adoption of deficit irrigation is recommended so as to avoid compromising the stability of tropical wines of the Brazilian Northeast.

  5. Grapevine dynamics after manual tending of juvenile stands on the Hoosier National Forest, Indiana

    Science.gov (United States)

    Robert C. Morrissey; Martin-Michel Gauthier; John A., Jr. Kershaw; Douglass F. Jacobs; Burnell C. Fischer; John R. Siefert

    2008-01-01

    Large woody vines, most notably grapevines, are a source of great concern for forest and wildlife managers in many parts of the Central Hardwood Forest Region of the United States. We examined grapevine dynamics in stands aged 21 - 35 years. The plots, located in regenerated clearcuts in the Hoosier National Forest (HNF), were evaluated for vine control, site, and tree...

  6. Evidence for gastroprotective, anti-inflammatory and antioxidant potential of methanolic extract of Cordia dichotoma leaves on indomethacin and stress induced gastric lesions in Wistar rats.

    Science.gov (United States)

    Hatware, Ketan Vinayakrao; Sharma, Sanjay; Patil, Kiran; Shete, Meghanath; Karri, Sravani; Gupta, Gaurav

    2018-07-01

    The Cordia dichotoma (CD) is having anticancer and other pharmacological effects as it contains mainly flavonoids. The present study was aimed to demonstrate the gastroprotective effect of methanolic extract of CD leaves (MECD) obtained using Soxhlet extractor. In this study the qualitative phytochemical analysis of MECD revealed the presence of bioflavonoids and determination of quercetin was confirmed by HPLC analysis. The MECD was administered orally at doses 50 mg/kg, 100 mg/kg and 200 mg/kg against indomethacin induced gastric ulceration and stress-induced gastric ulceration in Wistar rats. Omeprazole at 10 mg/kg orally was used as the reference standard. The various parameters like gastric volume, gastric pH, total acidity, ulcer index, percent protection were estimated for assessment of anti-secretory and gastroprotective effects of MECD. At the same time antioxidant parameters like superoxide dismutase (SOD), catalase (CAT) and malondialdehyde (MDA) in addition to that inflammatory parameters such as tumor necrosis factor-α (TNF-α), interleukin-6 and interleukin-10 were also estimated according to their respective method of estimation using analyzing kit. The MECD have reduced gastric volume, total acidity and gastric mucosal damage in both the experimental models significantly and dose dependently as compared with control group. Similarly the antioxidant enzymes like SOD and CAT were increased while MDA levels were decreased significantly, at the same time TNF-α and IL-6 levels were decreased and anti-inflammatory IL-10 levels were increased significantly in MECD treated groups. Thus the pretreatment with MECD has shown significant gastroprotective potential probably due to its antioxidant and anti-inflammatory properties. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  7. Minor long-term effects 3-4 years after the ReDO™ intervention for women with stress-related disorders: A focus on sick leave rate, everyday occupations and well-being.

    Science.gov (United States)

    Eklund, Mona

    2017-01-01

    The Redesigning Daily Occupations (ReDO™) work rehabilitation method has been found effective, compared with care as usual (CAU), for women with stress-related disorders. To conduct a long-term follow-up of former ReDO™ and CAU participants with respect to sick leave, well-being and everyday occupations 3-4 years after completed work rehabilitation. Forty-two women in each group participated. An index day was decided to estimate sick-leave rate, retrieved from register data. Fifty-five women also participated in a telephone interview addressing well-being, everyday occupations and life events. Both groups had reduced their sick-leave rate further, but no difference between the groups was established. The ReDO™ women perceived a better balance in the work domain of everyday occupations, whereas the CAU group reported more over-occupation. No differences were found on well-being. The groups had experienced similar important life events, affecting the women's work and private lives. Previous stress and anxiety predicted sick leave at the long-term follow-up. Although the ReDO™ intervention had speeded up return to work in the immediate follow-up perspective, the CAU had caught up in the longer term. Still, the ReDO™ women exhibited better balance in the work domain.

  8. How do line managers experience and handle the return to work of employees on sick leave due to work-related stress? A one-year follow-up study.

    Science.gov (United States)

    Ladegaard, Yun; Skakon, Janne; Elrond, Andreas Friis; Netterstrøm, Bo

    2017-08-28

    To examine how line managers experience and manage the return to work process of employees on sick leave due to work-related stress and to identify supportive and inhibiting factors. Semi-structured interviews with 15 line managers who have had employees on sick leave due to work-related stress. The grounded theory approach was employed. Even though managers may accept the overall concept of work-related stress, they focus on personality and individual circumstances when an employee is sick-listed due to work-related stress. The lack of a common understanding of stress creates room for this focus. Line managers experience cross-pressure, discrepancies between strategic and human-relationship perspectives and a lack of organizational support in the return to work process. Organizations should aim to provide support for line managers. Research-based knowledge and guidelines on work-related stress and return to work process are essential, as is the involvement of coworkers. A commonly accepted definition of stress and a systematic risk assessment is also important. Cross-pressure on line managers should be minimized and room for adequate preventive actions should be provided as such an approach could support both the return to work process and the implementation of important interventions in the work environment. Implication for rehabilitation Organizations should aim to provide support for line managers handling the return to work process. Cross-pressure on line managers should be minimized and adequate preventive actions should be provided in relation to the return to work process. Research-based knowledge and guidelines on work-related stress and return to work are essential. A common and formal definition of stress should be emphasized in the workplace.

  9. Effectiveness of some microorganisms in the limitation of grapevine cuttings infection by Phomopsis viticola Sacc.

    Directory of Open Access Journals (Sweden)

    Ewa Król

    2013-12-01

    Full Text Available The possibilities of using antagonistic fungi and bacteria in the limitation of grapevine stems infection by Phomopsis viticola Sacc. were studied. Trichodema koningii Oud., T.viride Persoon ex S.F.,T.harzianum Rifai, Gliocladium catenulatum Gilman and Abbott, G.fimbriatum Gilman and Abbott, Bacillus sp., Pseudomonas fluorescens and five unidentified isolates of bacteria i.e.: 22a, 35, 40, 45, 66 were estimated. It was appeared what Trichoderma spp. were the most effective in protection of grapevine stems against the infection by P.viticola. After these antagonistic fungi were used on protected grapevine canes not numerous necrosis were observed and few cultures of pathogen were reisolated from them. Moreover, Trichoderma spp. survived on the grapevine stems during the period of experiment. The abilities of other microorganisms tested to protect grapevine cuttings against P.viticola infection and to exist on the stems were less than Trichoderma spp.

  10. GLOBAL SOLAR RADIATION INTERCEPTION BY GRAPEVINES TRAINED TO A VERTICAL TRELLIS SYSTEM

    Directory of Open Access Journals (Sweden)

    CLAUDIA GUIMARÃES CAMARGO CAMPOS

    2016-01-01

    Full Text Available ABSTRACT In this paper we assess the utilization of radiant energy in the growing of grapevines (Cabernet Sauvignon trained to a vertical trellis system, and estimate the global solar radiation interception taking into account the physical characteristics of the training system at different phenological stages. The experiment was based on daily measurements of global solar radiation made by an automatic weather station placed at the vineyard of a winery located in the municipality of São Joaquim, in the southern Brazilian State of Santa Catarina (Villa Francioni winery, 28º 15’ 14” S, 49º 57’ 02” W, 1294m a.s.l.. Growth and phenological development of the shoots were evaluated. The global solar radiation is intercepted by the canopy (trained to a vertical trellis system in different orientations and the accumulated total is slightly greater on the east than on the west face of the canopy, especially after flowering. The daily variability of global solar radiation intercepted by the canopy is greater after flowering. The accumulated solar energy incident on the canopy increases until the onset of ripening. From the results, vineyards trained to a vertical trellis system in the north-south direction provide favorable sunlight exposure to leaves and fruits and are promising in quality and productivity.

  11. Effect of methyl jasmonate application to grapevine leaves on grape amino acid content.

    Science.gov (United States)

    Garde-Cerdán, Teresa; Portu, Javier; López, Rosa; Santamaría, Pilar

    2016-07-15

    Over the last few years, considerable attention has been paid to the application of elicitors to vineyard. However, research about the effect of elicitors on grape amino acid content is scarce. Therefore, the aim of this study was to evaluate the influence of foliar application of methyl jasmonate on must amino acid content. Results revealed that total amino acid content was not modified by the application of methyl jasmonate. However, the individual content of certain amino acids was increased as consequence of methyl jasmonate foliar application, i.e., histidine, serine, tryptophan, phenylalanine, tyrosine, asparagine, methionine, and lysine. Among them, phenylalanine content was considerably increased; this amino acid is precursor of phenolic and aromatic compounds. In conclusion, foliar application of methyl jasmonate improved must nitrogen composition. This finding suggests that methyl jasmonate treatment might be conducive to obtain wines of higher quality since must amino acid composition could affect the wine volatile composition and the fermentation kinetics. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Content of trans-Resveratrol in Leaves and Berries of Interspecific Grapevine (Vitis sp.) Varieties

    Czech Academy of Sciences Publication Activity Database

    Bábíková, P.; Vrchotová, Naděžda; Tříska, Jan; Kyseláková, M.

    26 2008, special (2008), s. 13-17 ISSN 1212-1800. [Quality of Moravian and Czech Wine s and their Future. Lednice, 11.09.2008-12.09.2008] R&D Projects: GA ČR GA525/06/1757 Institutional research plan: CEZ:AV0Z60870520 Keywords : trans-resveratrol * HPLC * wine Subject RIV: GM - Food Processing Impact factor: 0.472, year: 2008

  13. Pollination: a key event controlling the expression of genes related to phytohormone biosynthesis during grapevine berry formation.

    Science.gov (United States)

    Kühn, Nathalie; Arce-Johnson, Patricio

    2012-01-01

    Berry formation is the process of ovary conversion into a functional fruit, and is characterized by abrupt changes in the content of several phytohormones, associated with pollination and fertilization. Much effort has been made in order to improve our understanding of berry development, particularly from veraison to post-harvest time. However, the period of berry formation has been poorly investigated, despite its importance. Phytohormones are involved in the control of fruit formation; hence it is important to understand the regulation of their content at this stage. Grapevine is an excellent fleshy-fruit plant model since its fruits have particularities that differentiate them from those of commonly studied organisms. For instance, berries are prepared to cope with stress by producing several antioxidants and they are non-climacteric fruits. Also its genome is fully sequenced, which allows to identify genes involved in developmental processes. In grapevine, no link has been established between pollination and phytohormone biosynthesis, until recently. Here we highlight relevant findings regarding pollination effect on gene expression related to phytohormone biosynthesis, and present unpublished results showing how quickly this effect is achieved.

  14. A Long-Term Follow-Up of the Efficacy of Nature-Based Therapy for Adults Suffering from Stress-Related Illnesses on Levels of Healthcare Consumption and Sick-Leave Absence: A Randomized Controlled Trial

    Science.gov (United States)

    Corazon, Sus Sola; Nyed, Patrik Karlsson; Sidenius, Ulrik

    2018-01-01

    Stress-related illnesses are a growing health problem in the Western world; which also has economic significance for society. As a consequence; there is a growing demand for effective treatments. The study investigates the long-term efficacy of the Nacadia® nature-based therapy (NNBT) by comparing it to the efficacy of a validated cognitive behavioral therapy, called STreSS. The study is designed as a randomized controlled trial in which 84 participants are randomly allocated between the treatments. Long-term efficacy is investigated through data extracts from the national database of Statistics Denmark on the sick leave and the health-care consumption. The results show that both the NNBT and the STreSS lead to a significant decrease in number of contacts with a general practitioner in the period from twelve months prior to treatment to twelve months after treatment; and, a significant decrease in long-term sick leave from the month prior to treatment to twelve months after treatment. The positive long-term effects provide validation for the NNBT as an efficient treatment of stress-related illnesses. PMID:29342952

  15. A Long-Term Follow-Up of the Efficacy of Nature-Based Therapy for Adults Suffering from Stress-Related Illnesses on Levels of Healthcare Consumption and Sick-Leave Absence: A Randomized Controlled Trial

    Directory of Open Access Journals (Sweden)

    Sus Sola Corazon

    2018-01-01

    Full Text Available Stress-related illnesses are a growing health problem in the Western world; which also has economic significance for society. As a consequence; there is a growing demand for effective treatments. The study investigates the long-term efficacy of the Nacadia® nature-based therapy (NNBT by comparing it to the efficacy of a validated cognitive behavioral therapy, called STreSS. The study is designed as a randomized controlled trial in which 84 participants are randomly allocated between the treatments. Long-term efficacy is investigated through data extracts from the national database of Statistics Denmark on the sick leave and the health-care consumption. The results show that both the NNBT and the STreSS lead to a significant decrease in number of contacts with a general practitioner in the period from twelve months prior to treatment to twelve months after treatment; and, a significant decrease in long-term sick leave from the month prior to treatment to twelve months after treatment. The positive long-term effects provide validation for the NNBT as an efficient treatment of stress-related illnesses.

  16. A Long-Term Follow-Up of the Efficacy of Nature-Based Therapy for Adults Suffering from Stress-Related Illnesses on Levels of Healthcare Consumption and Sick-Leave Absence: A Randomized Controlled Trial.

    Science.gov (United States)

    Corazon, Sus Sola; Nyed, Patrik Karlsson; Sidenius, Ulrik; Poulsen, Dorthe Varning; Stigsdotter, Ulrika Karlsson

    2018-01-15

    Stress-related illnesses are a growing health problem in the Western world; which also has economic significance for society. As a consequence; there is a growing demand for effective treatments. The study investigates the long-term efficacy of the Nacadia ® nature-based therapy (NNBT) by comparing it to the efficacy of a validated cognitive behavioral therapy, called STreSS. The study is designed as a randomized controlled trial in which 84 participants are randomly allocated between the treatments. Long-term efficacy is investigated through data extracts from the national database of Statistics Denmark on the sick leave and the health-care consumption. The results show that both the NNBT and the STreSS lead to a significant decrease in number of contacts with a general practitioner in the period from twelve months prior to treatment to twelve months after treatment; and, a significant decrease in long-term sick leave from the month prior to treatment to twelve months after treatment. The positive long-term effects provide validation for the NNBT as an efficient treatment of stress-related illnesses.

  17. Shoot growth of Merlot and Cabernet Sauvignon grapevine varieties

    OpenAIRE

    Marcelo Borghezan; Olavo Gavioli; Hamilton Justino Vieira; Aparecido Lima da Silva

    2012-01-01

    The objective of this work was to evaluate shoot growth of the grapevine varieties Merlot and Cabernet Sauvignon, during 2006/2007, and Cabernet Sauvignon, during 2008/2009, in São Joaquim, SC, Brazil. The experiment was carried out in a commercial vineyard trained on a vertical trellis system. The shoots of the central part of the plants were selected, and the lengths from the base to the apex of 20 shoots per cultivar were evaluated. In 2006/2007, monitoring began at pruning, on 9/15/2006, ...

  18. Nitrogen nutrition of the grape-vine (Vitis vinifera spp)

    International Nuclear Information System (INIS)

    Conradie, W.J.

    1985-12-01

    A thorough knowledge concerning the nitrogen relationship in the grape-vine is essential in order to appreciate how different patterns of uptake, assimilation, storage and utilisation of nitrogen might be advantageous in particular environmental situations. The 15 N-isotope technique has been used to determine the uptake and distribution of nitrogen absorbed during early spring, early summer and autumn. Apart from the total N fraction, protein N and soluble N were determined as well. The utilisation of labelled N applied in the field, was determined for vineyards on heavier and lighter soils

  19. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    OpenAIRE

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-01-01

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that o...

  20. Comparison of Sensitivity to Photoinhibition and UV-B Stress between Developing and Mature Leaves of Red Pepper (Capsicum annuum L.) Plants from Control and Gamma-Irradiated Seeds

    International Nuclear Information System (INIS)

    Kim, J.H.; Baek, M.H.; Chung, B.Y.; Kim, J.S.; Lee, Y.B.

    2004-01-01

    The stress-resistance of red pepper (Capsicum annuum L. cv. Yeomyung and Joheung) plants from the seeds irradiated with low doses of gamma-radiation (2, 4, 8, and 16 Gy) was examined under the conditions of photoinhibition and UV-B stress. To induce photoinhibition, the leaves acclimated overnight with a dim light were exposed to a photon flux density (PFD) of 200 μmol · m-² · s-¹ at 25℃ for 1 h. Then, they were further exposed to the same PFD with supplementary UV-B irradiance at 25℃ for 3 h (UV-B stress). The gamma-irradiation stimulated the early growth of the plants in both cultivars at 2, 4, and 8 Gy

  1. VARYING DEGREE OF GRAFTING COMPATIBILITY BETWEEN CV. CHARDONNAY, MERLOT AND DIFFERENT GRAPEVINE ROOTSTOCKS

    Directory of Open Access Journals (Sweden)

    Slavica TODIĆ

    2006-02-01

    Full Text Available Level of affi nity between grapevine rootstock and Vitis vinifera as scion, quality of reproductive materials and technological actions in grapevine rootstock production process determine success in grapevine rootstock production in large extent. Practical training showed that difference in level of compatibility between grapevine rootstock and grafted Vitis vinifera cultivars are existing. Direct effects of these differences are unequal yield of fi rst class grafted grapevine rootlings. In this paper, level of compatibility in nursery between clones of cv. Chardonnay BCL 75, VCR4 and cv. Merlot R18, MCL 519 and grapevine rootstocks Kober 5BB (Vitis berlandieri x V. riparia, SO4 (V. berlandieri x V. riparia and 41B (Chasselas x V.berlandieri were investigated. The trial was conducted in commercial grapevine nursery located in Velika Drenova, Serbia. As an index of compatibility, grade of high quality grapevine grafted rootlings, dry matter in mature shoots and root system development were used. Grafting was done by `tongue grafting` indoor technique. Stratifi cation was done in sand, on temperature of the stratifi cation material of 26-28oC, and humidity of around 90%. Grafted cuttings were waxed twice: before stratifi cation, and before planting in the nursery. Grafted rootlings were classed in two classes according to regulations of quality, (Yugoslav Offi cial Register, 26/79. Grafted rootlings that did not satisfi ed standard criteria were discarded. Both clones of cv. Chardonnay gave the highest percentage of I class grafted rootlings on grapevine rootstock 41B: clone BCL 75 – 60% and clone VCR4 – 61%. In the same combination, those grapevine grafted rootlings had the highest weight of the root system. Lower percentage of obtained I class grafted rootlings was established on rootstock Kober 5BB, while statistically signifi cantly lower yields were obtained on grapevine rootstock SO4: clone BCL75 – 43% and clone VCR4 – 48%. Dry

  2. Stress

    Science.gov (United States)

    ... can be life-saving. But chronic stress can cause both physical and mental harm. There are at least three different types of stress: Routine stress related to the pressures of work, family, and other daily responsibilities Stress brought about ...

  3. Identification of a novel vitivirus from grapevines in New Zealand.

    Science.gov (United States)

    Blouin, Arnaud G; Keenan, Sandi; Napier, Kathryn R; Barrero, Roberto A; MacDiarmid, Robin M

    2018-01-01

    We report a sequence of a novel vitivirus from Vitis vinifera obtained using two high-throughput sequencing (HTS) strategies on RNA. The initial discovery from small-RNA sequencing was confirmed by HTS of the total RNA and Sanger sequencing. The new virus has a genome structure similar to the one reported for other vitiviruses, with five open reading frames (ORFs) coding for the conserved domains described for members of that genus. Phylogenetic analysis of the complete genome sequence confirmed its affiliation to the genus Vitivirus, with the closest described viruses being grapevine virus E (GVE) and Agave tequilana leaf virus (ATLV). However, the virus we report is distinct and shares only 51% amino acid sequence identity with GVE in the replicase polyprotein and 66.8% amino acid sequence identity with ATLV in the coat protein. This is well below the threshold determined by the ICTV for species demarcation, and we propose that this virus represents a new species. It is provisionally named "grapevine virus G".

  4. Shoot growth of Merlot and Cabernet Sauvignon grapevine varieties

    Directory of Open Access Journals (Sweden)

    Marcelo Borghezan

    2012-02-01

    Full Text Available The objective of this work was to evaluate shoot growth of the grapevine varieties Merlot and Cabernet Sauvignon, during 2006/2007, and Cabernet Sauvignon, during 2008/2009, in São Joaquim, SC, Brazil. The experiment was carried out in a commercial vineyard trained on a vertical trellis system. The shoots of the central part of the plants were selected, and the lengths from the base to the apex of 20 shoots per cultivar were evaluated. In 2006/2007, monitoring began at pruning, on 9/15/2006, and ended on 2/6/2007, totalizing 144 days of evaluation. During the 2008/2009 cycle, phenology and shoot growth for 'Cabernet Sauvignon' were assessed from grape development (1/13/2009 (pea-sized grapes until shoot vegetative growth had ceased. Budburst occurred in the second half of September, and shoot-growth cessation occurred during ripening. Higher growth rates (about 4 cm per day were observed in pre- and post-flowering, followed by reduction due to the competition for photosynthates for the formation of flowers and bunches. Temperature and photoperiod induce grapevine shoots to cease growth in the highland regions of Santa Catarina State, Brazil.

  5. Dissipation of glyphosate from grapevine soils in Sonora, Mexico

    Directory of Open Access Journals (Sweden)

    Norma J. Salazar López

    2016-10-01

    Full Text Available Grapevine is one of the important crops in Sonora, due to revenue generation from its export to foreign countries. Among the most widely used herbicides for this crop is glyphosate, which is considered moderately toxic and persistent. The present research evaluates the dissipation of glyphosate in grapevine planted soil at three depths (5, 30 and 60 cm. Sampling was carried out before glyphosate application, and 5, 10, 18, 27, and 65 days after. Glyphosate was extracted from soil samples using ammonium hydroxide. The derivate extracts were partitioned with dichloromethane and analyzed using gas chromatography with pulsed flame photometric detector (PFPD. The results showed that average glyphosate residues are significantly greater at 5 cm (0.09 mg kg-1 than the other depths (30 and 60 cm, having a difference of 0.078 mg kg-1 between them (P < 0.03. Glyphosate concentration time profiles were similar; it reached maximum soil concentration in a range of 10 to 18 days after application. The half-life of glyphosate in soil has an average of 39 days at all depths. Our data suggests that the release in soil of glyphosate applied to weeds delays its transference to soil by 14 days, and extends residue half life to 55 days after application. These results could be the basis for further research, including more environmental parameters that could affect the dissipation or degradation process in soil.

  6. Phytotoxins Produced by Fungi Associated with Grapevine Trunk Diseases

    Science.gov (United States)

    Andolfi, Anna; Mugnai, Laura; Luque, Jordi; Surico, Giuseppe; Cimmino, Alessio; Evidente, Antonio

    2011-01-01

    Up to 60 species of fungi in the Botryosphaeriaceae family, genera Cadophora, Cryptovalsa, Cylindrocarpon, Diatrype, Diatrypella, Eutypa, Eutypella, Fomitiporella, Fomitiporia, Inocutis, Phaeoacremonium and Phaeomoniella have been isolated from decline-affected grapevines all around the World. The main grapevine trunk diseases of mature vines are Eutypa dieback, the esca complex and cankers caused by the Botryospheriaceae, while in young vines the main diseases are Petri and black foot diseases. To understand the mechanism of these decline-associated diseases and the symptoms associated with them, the toxins produced by the pathogens involved in these diseases were isolated and characterised chemically and biologically. So far the toxins of only a small number of these decline fungi have been studied. This paper presents an overview of the toxins produced by the most serious of these vine wood pathogens: Eutypa lata, Phaeomoniella chlamydospora, Phaeoacremonium aleophilum and some taxa in the Botryosphaeriaceae family, and examines how these toxins produce decline symptoms. The chemical structure of these metabolites and in some cases their vivotoxin nature are also discussed. PMID:22295177

  7. Phytotoxins Produced by Fungi Associated with Grapevine Trunk Diseases

    Directory of Open Access Journals (Sweden)

    Antonio Evidente

    2011-12-01

    Full Text Available Up to 60 species of fungi in the Botryosphaeriaceae family, genera Cadophora, Cryptovalsa, Cylindrocarpon, Diatrype, Diatrypella, Eutypa, Eutypella, Fomitiporella, Fomitiporia, Inocutis, Phaeoacremonium and Phaeomoniella have been isolated from decline-affected grapevines all around the World. The main grapevine trunk diseases of mature vines are Eutypa dieback, the esca complex and cankers caused by the Botryospheriaceae, while in young vines the main diseases are Petri and black foot diseases. To understand the mechanism of these decline-associated diseases and the symptoms associated with them, the toxins produced by the pathogens involved in these diseases were isolated and characterised chemically and biologically. So far the toxins of only a small number of these decline fungi have been studied. This paper presents an overview of the toxins produced by the most serious of these vine wood pathogens: Eutypa lata, Phaeomoniella chlamydospora, Phaeoacremonium aleophilum and some taxa in the Botryosphaeriaceae family, and examines how these toxins produce decline symptoms. The chemical structure of these metabolites and in some cases their vivotoxin nature are also discussed.

  8. A Cluster-Randomised Trial Evaluating an Intervention for Patients with Stress-Related Mental Disorders and Sick Leave in Primary Care

    NARCIS (Netherlands)

    Bakker, I.M.; Terluin, B.; Marwijk, van H.W.J.; Windt, van der D.A.W.M.; Rijmen, F.; Mechelen, van W.; Stalman, W.A.B.

    2007-01-01

    Objective: Mental health problems often affect functioning to such an extent that they result in sick leave. The worldwide reported prevalence of mental health problems in the working population is 10%–18%. In developed countries, mental health problems are one of the main grounds for receiving

  9. Genetic structure of the fungal grapevine pathogen Eutypa lata from four continents

    Science.gov (United States)

    The generalist ascomycete fungus Eutypa lata causes Eutypa dieback of grapevine (Vitis vinifera) worldwide. To decipher the cosmopolitan distribution of this fungus, the population genetic structure of 17 geographic samples was investigated from four continental regions (Australia, California, Europ...

  10. Xylella fastidiosa requires polygalacturonase for colonization and pathogenicity in Vitis vinifera grapevines.

    Science.gov (United States)

    Roper, M Caroline; Greve, L Carl; Warren, Jeremy G; Labavitch, John M; Kirkpatrick, Bruce C

    2007-04-01

    Xylella fastidiosa is the causal agent of Pierce's disease of grape, an economically significant disease for the grape industry. X. fastidiosa systemically colonizes the xylem elements of grapevines and is able to breach the pit pore membranes separating xylem vessels by unknown mechanisms. We hypothesized that X. fastidiosa utilizes cell wall degrading enzymes to break down pit membranes, based on the presence of genes involved in plant cell wall degradation in the X. fastidiosa genome. These genes include several beta-1,4 endoglucanases, several xylanases, several xylosidases, and one polygalacturonase (PG). In this study, we demonstrated that the pglA gene encodes a functional PG. A mutant in pglA lost pathogenicity and was compromised in its ability to systemically colonize Vitis vinifera grapevines. The results indicate that PG is required for X. fastidiosa to successfully infect grapevines and is a critical virulence factor for X. fastidiosa pathogenesis in grapevine.

  11. ‘Bois noir’: new phytoplasma disease of grapevine in Iran

    Directory of Open Access Journals (Sweden)

    Mirchenari Seyed Mehdi

    2015-01-01

    Full Text Available Recently, grapevines showing symptoms suggesting the ‘bois noir’ phytoplasma disease were observed in vineyards located in several central provinces of Iran. Polymerase chain reaction assays using phytoplasma universal primer pair P1A/P7A followed by primer pair R16F2n/R16R2 in nested PCR, confirmed the association of phytoplasmas with symptomatic grapevines. The results of RFLP analyses using HpaII, HinfI, MseI, RsaI, and TaqI restriction enzymes, indicated that grapevine phytoplasma isolates in these regions could be related to the 16SrXII group. Sequence analyses of the partial 16S rRNA gene confirmed that Iranian grapevine phytoplasmas are associated with ‘Candidatus Phytoplasma solani’. This is the first report of the ‘bois noir’ disease outbreak in Iran

  12. Berry Phenolics of Grapevine under Challenging Environments

    Directory of Open Access Journals (Sweden)

    Hernâni Gerós

    2013-09-01

    Full Text Available Plant phenolics have been for many years a theme of major scientific and applied interest. Grape berry phenolics contribute to organoleptic properties, color and protection against environmental challenges. Climate change has already caused significant warming in most grape-growing areas of the world, and the climatic conditions determine, to a large degree, the grape varieties that can be cultivated as well as wine quality. In particular, heat, drought and light/UV intensity severely affect phenolic metabolism and, thus, grape composition and development. In the variety Chardonnay, water stress increases the content of flavonols and decreases the expression of genes involved in biosynthesis of stilbene precursors. Also, polyphenolic profile is greatly dependent on genotype and environmental interactions. This review deals with the diversity and biosynthesis of phenolic compounds in the grape berry, from a general overview to a more detailed level, where the influence of environmental challenges on key phenolic metabolism pathways is approached. The full understanding of how and when specific phenolic compounds accumulate in the berry, and how the varietal grape berry metabolism responds to the environment is of utmost importance to adjust agricultural practices and thus, modify wine profile.

  13. Root-associated bacteria promote grapevine growth: from the laboratory to the field

    KAUST Repository

    Rolli, Eleonora

    2016-08-18

    Background and Aims: Laboratory and greenhouse experiments have shown that root-associated bacteria have beneficial effects on grapevine growth; however, these effects have not been tested in the field. Here, we aimed to demonstrate whether bacteria of different geographical origins derived from different crop plants can colonize grapevine to gain a beneficial outcome for the plant leading to promote growth at the field scale. Methods: To link the ecological functions of bacteria to the promotion of plant growth, we sorted fifteen bacterial strains from a larger isolate collection to study in vitro Plant Growth Promoting (PGP) traits. We analysed the ability of these strains to colonise the root tissues of grapevine and Arabidopsis using green-fluorescent-protein-labelled strain derivatives and a cultivation independent approach. We assessed the ability of two subsets randomly chosen from the 15 selected strains to promote grapevine growth in two field-scale experiments in north and central Italy over two years. Parameters of plant vigour were measured during the vegetative season in de novo grafted vine cuttings and adult productive plants inoculated with the bacterial strains. Results: Beneficial bacteria rapidly and intimately colonized the rhizoplane and the root system of grapevine. In the field, plants inoculated with bacteria isolated from grapevine roots out-performed untreated plants. In both the tested vineyards, bacteria-promotion effects largely rely in the formation of an extended epigeal system endowed of longer shoots with larger diameters and more nodes than non-inoculated plants. Conclusions: PGP bacteria isolated in the laboratory can be successfully used to promote growth of grapevines in the field. The resulting larger canopy potentially increased the photosynthetic surface of the grapevine, promoting growth.

  14. Microscope image based fully automated stomata detection and pore measurement method for grapevines

    Directory of Open Access Journals (Sweden)

    Hiranya Jayakody

    2017-11-01

    Full Text Available Abstract Background Stomatal behavior in grapevines has been identified as a good indicator of the water stress level and overall health of the plant. Microscope images are often used to analyze stomatal behavior in plants. However, most of the current approaches involve manual measurement of stomatal features. The main aim of this research is to develop a fully automated stomata detection and pore measurement method for grapevines, taking microscope images as the input. The proposed approach, which employs machine learning and image processing techniques, can outperform available manual and semi-automatic methods used to identify and estimate stomatal morphological features. Results First, a cascade object detection learning algorithm is developed to correctly identify multiple stomata in a large microscopic image. Once the regions of interest which contain stomata are identified and extracted, a combination of image processing techniques are applied to estimate the pore dimensions of the stomata. The stomata detection approach was compared with an existing fully automated template matching technique and a semi-automatic maximum stable extremal regions approach, with the proposed method clearly surpassing the performance of the existing techniques with a precision of 91.68% and an F1-score of 0.85. Next, the morphological features of the detected stomata were measured. Contrary to existing approaches, the proposed image segmentation and skeletonization method allows us to estimate the pore dimensions even in cases where the stomatal pore boundary is only partially visible in the microscope image. A test conducted using 1267 images of stomata showed that the segmentation and skeletonization approach was able to correctly identify the stoma opening 86.27% of the time. Further comparisons made with manually traced stoma openings indicated that the proposed method is able to estimate stomata morphological features with accuracies of 89.03% for area

  15. Genetic and functional diversity of soil microbial communities associated to grapevine plants and wine quality

    Science.gov (United States)

    Mocali, Stefano; Fabiani, Arturo; Kuramae, Eiko; de Hollander, Mattias; Kowalchuk, George A.; Vignozzi, Nadia; Valboa, Giuseppe; Costantini, Edoardo

    2013-04-01

    Despite the economic importance of vineyards in Italy, the wine sector is facing severe challenges from increased global competition and climate changes. The quality of the grape at harvest has a strong direct impact on wine final quality and the strong relationship between wine composition, aroma, taste, and soil properties has been outlined in the "Terroir concept". However, information on the impact of soil microbial communities on soil functions, grapevine plants, and wine quality is generally lacking. In the current study, soils from two close sites in Central Tuscany (BRO11 and BRO12) cultivated with the same grapevine cultivar Sangiovese, but with contrasting wine quality, were examined. Although the BRO12 site provided a better wine quality than the BRO11, the two soils showed similar physical, chemical, and hydrological properties. Also soil humidity, as determined by FDR (Frequency Domain Reflectometry) sensors, indicated a similar water availability in the first 75 cm during a three years trial (2000-2010). Interestingly, the mean three years value of the ratio between the two stable carbon isotopes 13C/12C, measured in the alcohol of the wines, was significantly higher in BRO12 than in BRO11 (-28,3‰ and -24,4‰, respectively), indicating the presence of a relatively higher water stress in the BRO11 soil. Functional GeoChip microarray analyses revealed higher presence of Actinobacteria in the BRO12 than in the BRO11 soil, where the alfa-Proteobacteria were more abundant. Furthermore, a consistent difference in genes involved in S cycling, with a significant overrepresentation of sulphur-oxidation genes in BRO11 and increased levels of sulphate reduction genes BRO12 was detected. These results are consistent with the high content of sulphates and the abundance of Firmicutes such as Sulfobacillus thermosulfidooxidans in the BRO11 soil. Therefore, the different microbiology of the two soils could be related to the different redox conditions of the two

  16. SOYBEAN AND CASEIN HYDROLYSATES INDUCE GRAPEVINE IMMUNE RESPONSES AND RESISTANCE AGAINST PLASMOPARA VITICOLA

    Directory of Open Access Journals (Sweden)

    Nihed eLachhab

    2014-12-01

    Full Text Available Plasmopara viticola, the causal agent of grapevine downy mildew, is one of the most devastating grape pathogen in Europe and North America. Although phytochemicals are used to control pathogen infections, the appearance of resistant strains and the concern for possible adverse effects on environment and human health are increasing the search for alternative strategies. In the present investigation, we successfully tested two protein hydrolysates from soybean (soy and casein (cas to trigger grapevine resistance against P. viticola. On Vitis vinifera cv. Marselan plants, the application of soy and cas reduced the infected leaf surface by 76 and 63%, as compared to the control, respectively. Since both hydrolysates might trigger the plant immunity, we investigated their ability to elicit grapevine defence responses. On grapevine cell suspensions, a different free cytosolic calcium signature was recorded for each hydrolysate, whereas a similar transient phosphorylation of two MAP kinases of 45 and 49 kDa was observed. These signalling events were followed by transcriptome reprogramming, including the up-regulation of defence genes encoding pathogenesis-related (PR proteins and the stilbene synthase enzyme responsible for the biosynthesis of resveratrol, the main grapevine phytoalexin. Liquid chromatography analyses confirmed the production of resveratrol and its dimer metabolites, δ- and ε-viniferins. Overall, soy effects were more pronounced as compared to the cas one. Both hydrolysates proved to act as elicitors to enhance grapevine immunity against pathogen attack.

  17. The effect of strobilurins on leaf gas exchange, water use efficiency and ABA content in grapevine under field conditions.

    Science.gov (United States)

    Diaz-Espejo, Antonio; Cuevas, María Victoria; Ribas-Carbo, Miquel; Flexas, Jaume; Martorell, Sebastian; Fernández, José Enrique

    2012-03-01

    Strobilurins are one of the most important classes of agricultural fungicides. In addition to their anti-fungal effect, strobilurins have been reported to produce simultaneous effects in plant physiology. This study investigated whether the use of strobilurin fungicide improved water use efficiency in leaves of grapevines grown under field conditions in a Mediterranean climate in southern Spain. Fungicide was applied three times in the vineyard and measurements of leaf gas exchange, plant water status, abscisic acid concentration in sap ([ABA]), and carbon isotope composition in leaves were performed before and after applications. No clear effect on stomatal conductance, leaf water potential and intrinsic water use efficiency was found after three fungicide applications. ABA concentration was observed to increase after fungicide application on the first day, vanishing three days later. Despite this transient effect, evolution of [ABA] matched well with the evolution of leaf carbon isotope ratio, which can be used as a surrogate for plant water use efficiency. Morning stomatal conductance was negatively correlated to [ABA]. Yield was enhanced in strobilurin treated plants, whereas fruit quality remained unaltered. Published by Elsevier GmbH.

  18. Whole genome amplification and microsatellite genotyping of herbarium DNA revealed the identity of an ancient grapevine cultivar

    Science.gov (United States)

    Malenica, Nenad; Šimon, Silvio; Besendorfer, Višnja; Maletić, Edi; Karoglan Kontić, Jasminka; Pejić, Ivan

    2011-09-01

    Reconstruction of the grapevine cultivation history has advanced tremendously during the last decade. Identification of grapevine cultivars by using microsatellite DNA markers has mostly become a routine. The parentage of several renowned grapevine cultivars, like Cabernet Sauvignon and Chardonnay, has been elucidated. However, the assembly of a complete grapevine genealogy is not yet possible because missing links might no longer be in cultivation or are even extinct. This problem could be overcome by analyzing ancient DNA from grapevine herbarium specimens and other historical remnants of once cultivated varieties. Here, we present the first successful genotyping of a grapevine herbarium specimen and the identification of the corresponding grapevine cultivar. Using a set of nine grapevine microsatellite markers, in combination with a whole genome amplification procedure, we found the 90-year-old Tribidrag herbarium specimen to display the same microsatellite profile as the popular American cultivar Zinfandel. This work, together with information from several historical documents, provides a new clue of Zinfandel cultivation in Croatia as early as the beginning of fifteenth century, under the native name Tribidrag. Moreover, it emphasizes substantial information potential of existing grapevine and other herbarium collections worldwide.

  19. Photoprotection against the UVB-induced oxidative stress and epidermal damage in mice using leaves of three different varieties of Lepidium meyenii (maca).

    Science.gov (United States)

    Gonzales-Castañeda, Cynthia; Rivera, Valery; Chirinos, Ana Lucía; Evelson, Pablo; Gonzales, Gustavo Francisco

    2011-08-01

    Skin exposure to ultraviolet (UV) B radiation leads to epidermal damage and generation of reactive oxygen species. The photoprotective effect of extracts of three varieties of leaves (red, yellow, and black) from maca (Lepidium meyenii), a plant from the Peruvian highlands, was assessed in mouse skin exposed to UVB radiation. The hydroalcoholic extracts of three varieties of maca leaves were applied topically to the dorsal skin of young-adult male mice prior to exposition to UVB radiation. The three varieties had UVA/UVB absorptive properties and presented antioxidant activity, being highest with red maca, followed by black and yellow maca. The three varieties of maca leaves prevented the development of sunburn cells, epidermal hyperplasia, leukocytic infiltration, and other alterations produced by UVB radiation. Mice treated with black maca showed the highest superoxide dismutase levels, and mice treated with black and yellow maca showed higher catalase levels in skin, whereas red maca protected the skin and liver against significant increases in the lipid peroxidation activity observed in the unprotected animals. The presence of significant antioxidant activity and the inhibition of lipid peroxidation suggest that the observed protection could be partly attributable to this mechanism. © 2011 The International Society of Dermatology.

  20. VvGONST-A and VvGONST-B are Golgi-localised GDP-sugar transporters in grapevine (Vitis vinifera L.).

    Science.gov (United States)

    Utz, Daniella; Handford, Michael

    2015-02-01

    Plant nucleotide-sugar transporters (NSTs) are responsible for the import of nucleotide-sugar substrates into the Golgi lumen, for subsequent use in glycosylation reactions. NSTs are specific for either GDP- or UDP-sugars, and almost all transporters studied to date have been isolated from Arabidopsis thaliana L. In order to determine the conservation of the import mechanism in other higher plant species, here we report the identification and characterisation of VvGONST-A and VvGONST-B from grapevine (Vitis vinifera L. cv. Thompson Seedless), which are the orthologues of the GDP-sugar transporters GONST3 and GONST4 in Arabidopsis. Both grapevine NSTs possess the molecular features characteristic of GDP-sugar transporters, including a GDP-binding domain (GXL/VNK) towards the C-terminal. VvGONST-A and VvGONST-B expression is highest at berry setting and decreases throughout berry development and ripening. Moreover, we show using green fluorescent protein (GFP) tagged versions and brefeldin A treatments, that both are localised in the Golgi apparatus. Additionally, in vitro transport assays after expression of both NSTs in tobacco leaves indicate that VvGONST-A and VvGONST-B are capable of transporting GDP-mannose and GDP-glucose, respectively, but not a range of other UDP- and GDP-sugars. The possible functions of these NSTs in glucomannan synthesis and/or glycosylation of sphingolipids are discussed. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  1. Unmanned Aerial Vehicle (UAV-based remote sensing to monitor grapevine leaf stripe disease within a vineyard affected by esca complex

    Directory of Open Access Journals (Sweden)

    Salvatore F. DI GENNARO

    2016-07-01

    Full Text Available Foliar symptoms of grapevine leaf stripe disease (GLSD, a disease within the esca complex are linked to drastic alteration of photosynthetic function and activation of defense responses in affected grapevines several days before the appearance of the first visible symptoms on leaves. The present study suggests a methodology to investigate the relationships between high-resolution multispectral images (0.05 m/pixel acquired using an Unmanned Aerial Vehicle (UAV, and GLSD foliar symptoms monitored by ground surveys. This approach showed high correlation between Normalized Differential Vegetation Index (NDVI acquired by the UAV and GLSD symptoms, and discrimination between symptomatic from asymptomatic plants. High-resolution multispectral images were acquired during June and July of 2012 and 2013, in an experimental vineyard heavily affected by GLSD, located in Tuscany (Italy, where vines had been surveyed and mapped since 2003. Each vine was located with a global positioning system, and classified for appearance of foliar symptoms and disease severity at weekly intervals from the beginning of each season. Remote sensing and ground observation data were analyzed to promptly identify the early stages of disease, even before visual detection. This work suggests an innovative methodology for quantitative and qualitative analysis of spatial distribution of symptomatic plants. The system may also be used for exploring the physiological bases of GLSD, and predicting the onset of this disease. 

  2. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    Science.gov (United States)

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-10-11

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein.

  3. VitisNet: "Omics" integration through grapevine molecular networks.

    Directory of Open Access Journals (Sweden)

    Jérôme Grimplet

    Full Text Available BACKGROUND: Genomic data release for the grapevine has increased exponentially in the last five years. The Vitis vinifera genome has been sequenced and Vitis EST, transcriptomic, proteomic, and metabolomic tools and data sets continue to be developed. The next critical challenge is to provide biological meaning to this tremendous amount of data by annotating genes and integrating them within their biological context. We have developed and validated a system of Grapevine Molecular Networks (VitisNet. METHODOLOGY/PRINCIPAL FINDINGS: The sequences from the Vitis vinifera (cv. Pinot Noir PN40024 genome sequencing project and ESTs from the Vitis genus have been paired and the 39,424 resulting unique sequences have been manually annotated. Among these, 13,145 genes have been assigned to 219 networks. The pathway sets include 88 "Metabolic", 15 "Genetic Information Processing", 12 "Environmental Information Processing", 3 "Cellular Processes", 21 "Transport", and 80 "Transcription Factors". The quantitative data is loaded onto molecular networks, allowing the simultaneous visualization of changes in the transcriptome, proteome, and metabolome for a given experiment. CONCLUSIONS/SIGNIFICANCE: VitisNet uses manually annotated networks in SBML or XML format, enabling the integration of large datasets, streamlining biological functional processing, and improving the understanding of dynamic processes in systems biology experiments. VitisNet is grounded in the Vitis vinifera genome (currently at 8x coverage and can be readily updated with subsequent updates of the genome or biochemical discoveries. The molecular network files can be dynamically searched by pathway name or individual genes, proteins, or metabolites through the MetNet Pathway database and web-portal at http://metnet3.vrac.iastate.edu/. All VitisNet files including the manual annotation of the grape genome encompassing pathway names, individual genes, their genome identifier, and chromosome

  4. Burgundy regional climate change and its potential impact on grapevines

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Yiwen [University of Burgundy, Center for Climate Research, UMR 5210 CNRS, Dijon (France); G.C. Rieber Climate Institute at the Nansen Environment and Remote Sensing Center, Bergen (Norway); Castel, Thierry [University of Burgundy, Center for Climate Research, UMR 5210 CNRS, Dijon (France); AgroSup, Department of Agriculture and Environment, Dijon (France); Richard, Yves; Cuccia, Cedric [University of Burgundy, Center for Climate Research, UMR 5210 CNRS, Dijon (France); Bois, Benjamin [University of Burgundy, Center for Climate Research, UMR 5210 CNRS, Dijon (France); IUVV, University of Burgundy, Dijon (France)

    2012-10-15

    ARPEGE general circulation model simulations were dynamically downscaled by The Weather Research and Forecasting Model (WRF) for the study of climate change and its impact on grapevine growth in Burgundy region in France by the mid twenty-first century. Two time periods were selected: 1970-1979 and 2031-2040. The WRF model driven by ERA-INTERIM reanalysis data was validated against in situ surface temperature observations. The daily maximum and minimum surface temperature (T{sub max} and T{sub min}) were simulated by the WRF model at 8 x 8 km horizontal resolution. The averaged daily T{sub max} for each month during 1970-1979 have good agreement with observations, the averaged daily T{sub min} have a warm bias about 1-2 K. The daily T{sub max} and T{sub min} for each month (domain averaged) during 2031-2040 show a general increase. The largest increment ({proportional_to}3 K) was found in summer. The smallest increments (<1 K) were found in spring and fall. The spatial distribution of temperature increment shows a strong meridional gradient, high in south in summer, reversing in winter. The resulting potential warming rate in summer is equivalent to 4.7 K/century under the IPCC A2 emission scenario. The dynamically downscaled T{sub max} and T{sub min} were used to simulate the grape (Pinot noir grape variety) flowering and veraison dates. For 2031-2040, the projected dates are 8 and 12 days earlier than those during 1970-1979, respectively. The simulated hot days increase more than 50% in the two principal grapevine regions. They show strong impact on Pinot noir development. (orig.)

  5. Seasonal Dynamics of Stress Proteins in Leaves of Medicinal Plants in a Natural Environment of Irkutsk and on the Shores of the Lake Baikal

    Directory of Open Access Journals (Sweden)

    M.A. Zhivetiev

    2014-12-01

    Full Text Available We study leafs of five plant species, growing in Irkutsk city and on the southeastern shore of Lake Baikal. These species are Achillea asiatica Serg., Taraxacum officinale Wigg., Plantago major L., Veronica chamaedrys L. and Alchemilla subcrenata Buser. In its leafs we identify some types of stress-induced proteins. In autumn, the accumulation of stress proteins in leafs of plants both from shores of Lake Baikal and from Irkutsk have been registered.

  6. Parental Leave in Denmark

    DEFF Research Database (Denmark)

    Rostgaard, Tine; Christoffersen, Mogens; Weise, Hanne

    This artcle considders the political aims for different leave schemes and reviews studies af these schemes. The use of parental leave is sensitive to the financial loss involved in taking leave: a decrease in the benefit payments has had a significant influence on take-up, while, in general, fami......, families'' loss of income is less if leave is taken up by the mothers. Only few fathers participate in parental leave....

  7. Evaluation of five protocols for DNA extraction from leaves of Malus sieversii, Vitis vinifera, and Armeniaca vulgaris.

    Science.gov (United States)

    Aubakirova, K; Omasheva, M; Ryabushkina, N; Tazhibaev, T; Kampitova, G; Galiakparov, N

    2014-02-27

    Leaves of Malus sieversii, Vitis vinifera, and Armeniaca vulgaris contain substantial amounts of secondary metabolites, which limit the high-quality DNA extraction performance. In this study, five extraction protocols were compared for their ability to produce good quality DNA from fresh and dried (with silica gel) leaves of these species. The modified protocol of Dellaporta et al., using polyvinylpyrrolidone to bind the phenolic compounds and a high molar concentration of potassium acetate to inhibit co-precipitation of polysaccharides with DNA, produced the best DNA quality for all species tested. DNA extracted by this method had a 1.77-1.96 A260/280 nm ratio and successful amplification of the 18S ribosomal DNA gene. DNA concentrations of dried leaves were lower than those obtained from fresh leaves, which was likely due to aspects of the drying procedure. All five methods for grapevine produced DNA of obvious better quality from green canes compared to leaves, due to the relatively low content of secondary metabolites in the former. For grapevine and apricot, three methods can be equally used to obtain DNA of good quality: the Doyle and Doyle modified method using CTAB and high concentration of NaCl, the Jobes et al. modified method, and the sodium dodecyl sulfate mini preparation method of Edwards et al. The protocol of Jobes et al. using LiCl for RNA removal showed the best results for most of the M. sieversii samples examined.

  8. Characterization of Cadophora luteo-olivacea and C. melinii isolates obtained from grapevines and environmental samples from grapevine nurseries in Spain

    Directory of Open Access Journals (Sweden)

    David GRAMAJE

    2011-12-01

    Full Text Available Fifty-eight Cadophora luteo-olivacea and three C. melinii isolates were recovered from grapevines showing black vascular streaking and decline symptoms characteristic of Petri disease, and from different stages of the grapevine nursery process in Spain. The isolates were studied by means of phenotypical characterization, DNA analysis and pathogenicity tests. The morphological characters studied included conidiophore, phialide and conidial morphology. Colony characters and pigment production on MEA, PDA and OA were also examined. Phenotypical data were subjected to cluster analysis, which clearly separated C.luteo-olivacea isolates into four groups. Mating tests were performed on all possible combinations for each Cadophora species but no sexual fruiting bodies were produced. Partial sequences of the nuclear ribosomal internal transcribed spacer (ITS, beta-tubulin (BT and the elongation factor 1a (EF were analysed, but no genetic variation occurred within the C. luteo-olivacea isolates or within the C. melinii isolates in any of the regions studied. Pathogenicity tests were conducted on 1-year-old grapevine cuttings of four different rootstocksusing four C. luteo-olivacea isolates and one isolate of C. melinii. All Cadophora isolates except the C.melinii isolate caused significantly longer lesions in the xylem of grapevine rootstocks than in the controls.

  9. Stress

    Science.gov (United States)

    ... taking care of an aging parent. With mental stress, the body pumps out hormones to no avail. Neither fighting ... with type 1 diabetes. This difference makes sense. Stress blocks the body from releasing insulin in people with type 2 ...

  10. NO accumulation alleviates H2 O2 -dependent oxidative damage induced by Ca(NO3 )2 stress in the leaves of pumpkin-grafted cucumber seedlings.

    Science.gov (United States)

    Li, Lin; Shu, Sheng; Xu, Qing; An, Ya-Hong; Sun, Jin; Guo, Shi-Rong

    2017-05-01

    Nitric oxide (NO) and hydrogen peroxide (H 2 O 2 ), two important signaling molecules, are stimulated in plants by abiotic stresses. In this study, we investigated the role of NO and its interplay with H 2 O 2 in the response of self-grafted (S-G) and salt-tolerant pumpkin-grafted (Cucurbita maxima × C. moschata) cucumber seedlings to 80 mM Ca(NO 3 ) 2 stress. Endogenous NO and H 2 O 2 production in S-G seedlings increased in a time-dependent manner, reaching maximum levels after 24 h of Ca(NO 3 ) 2 stress. In contrast, a transient increase in NO production, accompanied by H 2 O 2 accumulation, was observed at 2 h in rootstock-grafted plants. N w -Nitro-l-Arg methyl ester hydrochloride (l-NAME), an inhibitor of nitric oxide synthase (NOS), tungstate, an inhibitor of nitrate reductase (NR), and 2-(4-carboxyphenyl)-4,4,5,5-tetramethy-limidazoline-1-oxyl-3-oxide (cPTIO), a scavenger of NO, were found to significantly inhibit NO accumulation induced by salt stress in rootstock-grafted seedlings. H 2 O 2 production was unaffected by these stress conditions. Ca(NO 3 ) 2 stress-induced NO accumulation was blocked by pretreatment with an H 2 O 2 scavenger (dimethylthiourea, DMTU) and an inhibitor of NADPH oxidase (diphenyleneiodonium, DPI). In addition, maximum quantum yield of PSII (Fv/Fm), as well as the activities and transcript levels of antioxidant enzymes, were significantly decreased by salt stress in rootstock grafted seedlings after pretreatment with these above inhibitors; antioxidant enzyme transcript levels and activities were higher in rootstock-grafted seedlings compared with S-G seedlings. These results suggest that rootstock grafting could alleviate the oxidative damage induced by Ca(NO 3 ) 2 stress in cucumber seedlings, an effect that may be attributable to the involvement of NO in H 2 O 2 -dependent antioxidative metabolism. © 2016 Scandinavian Plant Physiology Society.

  11. Multi-gene analysis and morphology reveal novel Ilyonectria species associated with black foot disease of grapevines

    NARCIS (Netherlands)

    Cabral, A.; Rego, C.; Nascimento, T.; Oliveira, H.; Groenewald, J.Z.; Crous, P.W.

    2012-01-01

    Black foot is an important disease of grapevines, which has in recent years been recorded with increased incidence and severity throughout the world, affecting grapevines both in nurseries and young vineyards. In the past the disease has been associated with infections by Ilyonectria macrodidyma,

  12. Destino do nitrogênio em videiras 'chardonnay' e 'riesling renano' quando aplicado no inchamento das gemas Nitrogen destiny in 'chardonnay' and 'riesling renano' grapevines, when applied in bud break

    Directory of Open Access Journals (Sweden)

    Gustavo Brunetto

    2006-12-01

    Chardonnay and Riesling Renano grapevines, at a Udorthent soil in, Bento Gonçalves, Southern Brazil. The vines received the application of 15.91g N plant-1, 40 kg N ha-1, with 4% atoms 15N, in bud break. The buds and leaves were collected in the central parts of the year branch eight different times in the Chardonnay grapes and seven times in the Riesling Renano grapes. The grapevines in the last collection of the leaves were separated in leaves, fruits, year branches, branches with two years and stem, and then were oven-dried, weighted and analyzed total N and 15N contents. The results showed that the larger percentage of N in the leaves of the Chardonnay and the Riesling Renano grapevines, since the beginning of the bud break until harvest is derived of different forms of N from those applied in the bud break. The highest quantity of N accumulated in the annual and perennial part of the grapevines is derived of the soil N, being very small the amounts of N applied in the bud break stored in the perennial parts.

  13. Effects of potentially acidic air pollutants on the intracellular distribution and transport of plant growth regulators in mesophyll cells of leaves. Consequences on stress- and developmental physiology

    Energy Technology Data Exchange (ETDEWEB)

    Kremer, H.; Pfanz, H.; Hartung, W.

    1987-07-11

    The influence of SO/sub 2/ on the intracellular distribution of abscisic acid (ABA) and indole-acetic acid (IAA) in mesophyll cells of Picea abies, Tsuga americana and Hordeum vulgare was investigated. The compartmentation of ABA and IAA depends on intracellular pH-gradients. The hydrophilic anions ABA and IAA are accumulated in the alkaline cell compartments cytosol and chloroplasts, which act as anion traps for weak acids. Uptake of sulfur dioxide into leaves leads to an acidification of alkaline cell compartments, thus decreasing intracellular pH-gradients. Consequently this results in an increased release of plant growth regulators from the cell interior into the apoplast. Therefore the target cells of plant hormones i.e. meristems and stomates are exposed to altered hormone concentrations. Obviously this influences the regulation of cellular metabolism plant development and growth.

  14. Comparison of physiological and anatomical changes of C3 (Oryza sativa [L.]) and C4 (Echinochloa crusgalli [L.]) leaves in response to drought stress

    Science.gov (United States)

    Hamim, Hamim; Banon, Sri; Dorly, Dorly

    2016-01-01

    The experiment aimed to analyse the different response of C3 (Oryza sativa L.) and C4 (Echinochloa crusgalli L.) species to drought stress based on physiological and anatomical properties. Seeds of rice (Oryza sativa) and Echinochloa (Echinochloa crusgalli) were grown in 15 cm (D) pot for 6 weeks under well-watered conditions. After 6 weeks the plants were divided into two groups, (1) well-watered which were watered daily, and (2) drought stress which were withheld from watering for 6 days. After 6 days of drought, the plants were then re-watered to analyse plant recovery. During drought period, the plants were analysed for growth, leaf relative water content (RWC), photosynthesis, and leaf anatomy. Drought stress significantly reduced leaf RWC of both species, but the reduction was bigger in rice than in Echinochloa. The maximum efficiency of photosynthesis (Fv/Fm) was decrease significantly in response to drought stress by about 48.04% in rice, while it was only 34.40% in Echinochloa. Anatomical analysis showed drought treatment tended to reduce leaf thickness in the area of bulliform cell, major- as well as intervein and xylem diameter, more in Echinochloa than in rice, suggesting that the decrease of vein and xylem diameter is among the anatomical parameters that is important to overcome from drought stress in Echinochloa. The number of chloroplast in the mesophyll cell and bundle sheath cell (BSC) was different between these two species, where in Echinochloa chloroplast was found in both mesophyll as well as BSC, while in rice it was only found in mesophyll cell, confirmed that Echinochloa is a C4 and rice is a C3 species. Interestingly, in Echinochloa, the number of chloroplast was significantly increased due to drought stress in BSC, but not in mesophyll cell. The number of starch granules also dramatically increased in response to drought in the mesophyll cells of rice and Echinochloa, and in the bundle sheath cell of Echinochloa which indicate that C3

  15. Evaluation of the Antioxidant and Anti-glication Effects of the Hexane Extract from Piper auritum Leaves in Vitro and Beneficial Activity on Oxidative Stress and Advanced Glycation End-Product-Mediated Renal Injury in Streptozotocin-Treated Diabetic Rats

    Directory of Open Access Journals (Sweden)

    Adriana Maria Neira Gonzalez

    2012-10-01

    Full Text Available The aim of this study was to investigate the antioxidant activity of hexane extracts from leaves of Piper auritum (HS. Eight complementary in vitro test methods were used, including inhibition of DPPH· radicals, nitric oxide, superoxide anion, ion-chelating, ABTS, oxygen radical absorbance capacity, β-carotene bleaching and peroxy radical scavenging. The results indicated that HS possesses high antioxidant activity. To add to these finding we tested the effect against oxidative stress in liver, pancreas and kidney in diabetic rats. Low levels of SOD, CAT, GPx and GSH in diabetic rats were reverted to near normal values after treatment with HS. These results suggest that P. auritum prevents oxidative stress, acting as a suppressor of liver cell damage. Given the link between glycation and oxidation, we proposed that HS might possess significant in vitro antiglycation activity. Our data confirmed the inhibitory effect of HS on bovine serum albumin, serum glycosylated protein, glycation of LDL, and glycation hemoglobin. The effect of HS on diabetic renal damage was investigated using streptozotocin-induced diabetic rats. The oral administration of HS at a dose of 200 and 400 mg/kg body weight/day for 28 days significantly reduced advanced glycation endproduct (AGE formation, elevated renal glucose and thiobarbituric acid-reactive substance levels in the kidneys of diabetic rats. This implies that HS would alleviate the oxidative stress under diabetes through the inhibition of lipid peroxidation. These findings indicate that oxidative stress is increased in the diabetic rat kidney and that HS can prevent renal damage associated with diabetes by attenuating the oxidative stress.

  16. Effect of ploughing-down of grapevine chips on soil structure when using special agricultural machinery

    Directory of Open Access Journals (Sweden)

    Barbora Badalíková

    2012-01-01

    Full Text Available Within the period of 2008–2011, changes in soil structure were studied in two selected localities: one of them was situated in vineyards of the University Training Farm of Mendel University in Žabčice near Brno, the other was in vineyards situated in the cadastre of wine-growing municipality Velké Bílovice. Established were altogether three variants of experiments with application of crushed grapevine wood (chips: Variant 1 – control; Variant 2 – crushed grapevine wood ploughed down to the depth of 0.10 m; Variant 3 – crushed grapevine wood + grass spread on the soil surface as a mulch. Grapevine canes were crushed to chips using a special agricultural machinery while the soil in inter-rows was processed using conventional tilling machines. The obtained results showed that the best coefficient of structurality (expressing the degree of destruction of soil structure was recorded in Variants 2 in both localities. Considering values of this coefficient it could be concluded that just this variant showed a positive effect on soil structure. This variant reduced the compaction of soil caused by the movement of agricultural machines in vineyard inter-rows Crushed grapevine waste wood can therefore compensate losses of organic matter in soil. Better values of structurality coefficient were recorded in the locality Žabčice.

  17. Differential expression of genes of Xylella fastidiosa in xylem fluid of citrus and grapevine.

    Science.gov (United States)

    Shi, Xiangyang; Bi, Jianlong; Morse, Joseph G; Toscano, Nick C; Cooksey, Donald A

    2010-03-01

    Xylella fastidiosa causes a serious Pierce's disease (PD) in grapevine. Xylella fastidiosa cells from a PD strain were grown in a pure xylem fluid of a susceptible grapevine cultivar vs. xylem fluid from citrus, which is not a host for this strain of X. fastidiosa. When grown in grapevine xylem fluid, cells of the PD strain formed clumps and biofilm formed to a greater extent than in citrus xylem fluid, although the PD strain did grow in xylem fluid of three citrus varieties. The differential expression of selected genes of a PD X. fastidiosa strain cultured in the two xylem fluids was analyzed using a DNA macroarray. Compared with citrus xylem fluid, grapevine xylem fluid stimulated the expression of X. fastidiosa genes involved in virulence regulation, such as gacA, algU, xrvA, and hsq, and also genes involved in the biogenesis of pili and twitching motility, such as fimT, pilI, pilU, and pilY1. Increased gene expression likely contributes to PD expression in grapevine, whereas citrus xylem fluid did not support or possibly suppressed the expression of these virulence genes.

  18. Genetic characterization of autochthonous grapevine cultivars from Eastern Turkey by simple sequence repeats (SSRs

    Directory of Open Access Journals (Sweden)

    Sadiye Peral Eyduran

    2016-01-01

    Full Text Available In this research, two well-recognized standard grape cultivars, Cabernet Sauvignon and Merlot, together with eight historical autochthonous grapevine cultivars from Eastern Anatolia in Turkey, were genetically characterized by using 12 pairs of simple sequence repeat (SSR primers in order to evaluate their genetic diversity and relatedness. All of the used SSR primers produced successful amplifications and revealed DNA polymorphisms, which were subsequently utilized to evaluate the genetic relatedness of the grapevine cultivars. Allele richness was implied by the identification of 69 alleles in 8 autochthonous cultivars with a mean value of 5.75 alleles per locus. The average expected heterozygosity and observed heterozygosity were found to be 0.749 and 0.739, respectively. Taking into account the generated alleles, the highest number was recorded in VVC2C3 and VVS2 loci (nine and eight alleles per locus, respectively, whereas the lowest number was recorded in VrZAG83 (three alleles per locus. Two main clusters were produced by using the unweighted pair-group method with arithmetic mean dendrogram constructed on the basis of the SSR data. Only Cabernet Sauvignon and Merlot cultivars were included in the first cluster. The second cluster involved the rest of the autochthonous cultivars. The results obtained during the study illustrated clearly that SSR markers have verified to be an effective tool for fingerprinting grapevine cultivars and carrying out grapevine biodiversity studies. The obtained data are also meaningful references for grapevine domestication.

  19. Loss in photosynthesis during senescence is accompanied by an increase in the activity of β-galactosidase in leaves of Arabidopsis thaliana: modulation of the enzyme activity by water stress.

    Science.gov (United States)

    Pandey, Jitendra Kumar; Dash, Sidhartha Kumar; Biswal, Basanti

    2017-07-01

    The precise nature of the developmental modulation of the activity of cell wall hydrolases that breakdown the wall polysaccharides to maintain cellular sugar homeostasis under sugar starvation environment still remains unclear. In this work, the activity of β-galactosidase (EC 3.2.1.23), a cell-wall-bound enzyme known to degrade the wall polysaccharides, has been demonstrated to remarkably enhance during senescence-induced loss in photosynthesis in Arabidopsis thaliana. The enhancement in the enzyme activity reaches a peak at the terminal phase of senescence when the rate of photosynthesis is at its minimum. Although the precise nature of chemistry of the interface between the decline in photosynthesis and enhancement in the activity of the enzyme could not be fully resolved, the enhancement in its activity in dark and its suppression in light or with exogenous sugars may indicate the involvement of loss of photosynthetic production of sugars as a key factor that initiates and stimulates the activity of the enzyme. The hydrolase possibly participates in the catabolic network of cell wall polysaccharides to produce sugars for execution of energy-dependant senescence program in the background of loss of photosynthesis. Drought stress experienced by the senescing leaves accelerates the decline in photosynthesis with further stimulation in the activity of the enzyme. The stress recovery of photosynthesis and suppression of the enzyme activity on withdrawal of stress support the proposition of photosynthetic modulation of the cell-wall-bound enzyme activity.

  20. Management of Botryosphaeriaceae species infection in grapevine propagation materials

    Directory of Open Access Journals (Sweden)

    Regina BILLONES-BAAIJENS

    2015-09-01

    Full Text Available In New Zealand grapevine propagation nurseries, Botryosphaeriaceae species have been reported to infect the source blocks of the nursery propagators leading to infection of the propagation materials. This research investigated the efficacy of different control methods which could prevent infection or eradicate the pathogen from harvested canes prior to plant propagation. In the source blocks, attempts to reduce infection of shoots by protecting trimming wounds were partially successful (P=0.036, with 19.5% incidence in fungicide-treated shoots and 24.3% infection in the control shoots. Further sampling showed that overall 19.9% of these infections were in the bark and 9.6% in the wood. Hot water treatment (HWT of dormant rootstock 5C canes, previously infected with Neofusicoccum luteum and N. parvum, at 50°C for 30 min resulted in internal infection incidences of 55 and 100%, respectively. HWT at 53°C reduced infection incidence to 0 and 8.5%, respectively, but killed the buds. In naturally infected canes, HWT of 50°C for 30 min reduced infection incidence from 35% in controls, to 0–15% over all Botryosphaeriaceae species. Shorter periods of HWT, at 55°C for 10 min, designed to kill bark infections, were effective in Sauvignon blanc but killed the buds of Pinot noir. Sauvignon blanc canes superficially infected with N. luteum were soaked for 30 min in the fungicides carbendazim, tebuconazole, thiophanate methyl and flusilazole, with and without a polyether-modified trisiloxane adjuvant. Results showed that carbendazim with no adjuvant and tebuconazole with 0.5 mL L-1 adjuvant eliminated 100% of bark infections. A further experiment that soaked 2,000 canes (Sauvignon blanc and Pinot noir in a carbendazim solution prior to rooting found that all canes were free of Botryosphaeriaceae species infection, compared to 17% natural incidence. These results have indicated the potential efficacy of several methods for preventing or reducing infection

  1. Transcriptional analysis of late ripening stages of grapevine berry

    Science.gov (United States)

    2011-01-01

    Background The composition of grapevine berry at harvest is a major determinant of wine quality. Optimal oenological maturity of berries is characterized by a high sugar/acidity ratio, high anthocyanin content in the skin, and low astringency. However, harvest time is still mostly determined empirically, based on crude biochemical composition and berry tasting. In this context, it is interesting to identify genes that are expressed/repressed specifically at the late stages of ripening and which may be used as indicators of maturity. Results Whole bunches and berries sorted by density were collected in vineyard on Chardonnay (white cultivar) grapevines for two consecutive years at three stages of ripening (7-days before harvest (TH-7), harvest (TH), and 10-days after harvest (TH+10)). Microvinification and sensory analysis indicate that the quality of the wines made from the whole bunches collected at TH-7, TH and TH+10 differed, TH providing the highest quality wines. In parallel, gene expression was studied with Qiagen/Operon microarrays using two types of samples, i.e. whole bunches and berries sorted by density. Only 12 genes were consistently up- or down-regulated in whole bunches and density sorted berries for the two years studied in Chardonnay. 52 genes were differentially expressed between the TH-7 and TH samples. In order to determine whether these genes followed a similar pattern of expression during the late stages of berry ripening in a red cultivar, nine genes were selected for RT-PCR analysis with Cabernet Sauvignon grown under two different temperature regimes affecting the precocity of ripening. The expression profiles and their relationship to ripening were confirmed in Cabernet Sauvignon for seven genes, encoding a carotenoid cleavage dioxygenase, a galactinol synthase, a late embryogenesis abundant protein, a dirigent-like protein, a histidine kinase receptor, a valencene synthase and a putative S-adenosyl-L-methionine:salicylic acid carboxyl

  2. Transcriptional analysis of late ripening stages of grapevine berry

    Directory of Open Access Journals (Sweden)

    Guillaumie Sabine

    2011-11-01

    Full Text Available Abstract Background The composition of grapevine berry at harvest is a major determinant of wine quality. Optimal oenological maturity of berries is characterized by a high sugar/acidity ratio, high anthocyanin content in the skin, and low astringency. However, harvest time is still mostly determined empirically, based on crude biochemical composition and berry tasting. In this context, it is interesting to identify genes that are expressed/repressed specifically at the late stages of ripening and which may be used as indicators of maturity. Results Whole bunches and berries sorted by density were collected in vineyard on Chardonnay (white cultivar grapevines for two consecutive years at three stages of ripening (7-days before harvest (TH-7, harvest (TH, and 10-days after harvest (TH+10. Microvinification and sensory analysis indicate that the quality of the wines made from the whole bunches collected at TH-7, TH and TH+10 differed, TH providing the highest quality wines. In parallel, gene expression was studied with Qiagen/Operon microarrays using two types of samples, i.e. whole bunches and berries sorted by density. Only 12 genes were consistently up- or down-regulated in whole bunches and density sorted berries for the two years studied in Chardonnay. 52 genes were differentially expressed between the TH-7 and TH samples. In order to determine whether these genes followed a similar pattern of expression during the late stages of berry ripening in a red cultivar, nine genes were selected for RT-PCR analysis with Cabernet Sauvignon grown under two different temperature regimes affecting the precocity of ripening. The expression profiles and their relationship to ripening were confirmed in Cabernet Sauvignon for seven genes, encoding a carotenoid cleavage dioxygenase, a galactinol synthase, a late embryogenesis abundant protein, a dirigent-like protein, a histidine kinase receptor, a valencene synthase and a putative S

  3. Exogenous Calcium Alleviates Photoinhibition of PSII by Improving the Xanthophyll Cycle in Peanut (Arachis Hypogaea) Leaves during Heat Stress under High Irradiance

    Science.gov (United States)

    Yang, Sha; Wang, Fang; Guo, Feng; Meng, Jing-Jing; Li, Xin-Guo; Dong, Shu-Ting; Wan, Shu-Bo

    2013-01-01

    Peanut is one of the calciphilous plants. Calcium (Ca) serves as a ubiquitous central hub in a large number of signaling pathways. The effect of exogenous calcium nitrate [Ca(NO3)2] (6 mM) on the dissipation of excess excitation energy in the photosystem II (PSII) antenna, especially on the level of D1 protein and the xanthophyll cycle in peanut plants under heat (40°C) and high irradiance (HI) (1 200 µmol m−2 s−1) stress were investigated. Compared with the control plants [cultivated in 0 mM Ca(NO3)2 medium], the maximal photochemical efficiency of PSII (Fv/Fm) in Ca2+-treated plants showed a slighter decrease after 5 h of stress, accompanied by higher non-photochemical quenching (NPQ), higher expression of antioxidative genes and less reactive oxygen species (ROS) accumulation. Meanwhile, higher content of D1 protein and higher ratio of (A+Z)/(V+A+Z) were also detected in Ca2+-treated plants under such stress. These results showed that Ca2+ could help protect the peanut photosynthetic system from severe photoinhibition under heat and HI stress by accelerating the repair of D1 protein and improving the de-epoxidation ratio of the xanthophyll cycle. Furthermore, EGTA (a chelant of Ca ion), LaCl3 (a blocker of Ca2+ channel in cytoplasmic membrane), and CPZ [a calmodulin (CaM) antagonist] were used to analyze the effects of Ca2+/CaM on the variation of (A+Z)/(V+A+Z) (%) and the expression of violaxanthin de-epoxidase (VDE). The results indicated that CaM, an important component of the Ca2+ signal transduction pathway, mediated the expression of the VDE gene in the presence of Ca to improve the xanthophyll cycle. PMID:23940721

  4. Exogenous calcium alleviates photoinhibition of PSII by improving the xanthophyll cycle in peanut (Arachis hypogaea leaves during heat stress under high irradiance.

    Directory of Open Access Journals (Sweden)

    Sha Yang

    Full Text Available Peanut is one of the calciphilous plants. Calcium (Ca serves as a ubiquitous central hub in a large number of signaling pathways. The effect of exogenous calcium nitrate [Ca(NO32] (6 mM on the dissipation of excess excitation energy in the photosystem II (PSII antenna, especially on the level of D1 protein and the xanthophyll cycle in peanut plants under heat (40°C and high irradiance (HI (1 200 µmol m(-2 s(-1 stress were investigated. Compared with the control plants [cultivated in 0 mM Ca(NO32 medium], the maximal photochemical efficiency of PSII (Fv/Fm in Ca(2+-treated plants showed a slighter decrease after 5 h of stress, accompanied by higher non-photochemical quenching (NPQ, higher expression of antioxidative genes and less reactive oxygen species (ROS accumulation. Meanwhile, higher content of D1 protein and higher ratio of (A+Z/(V+A+Z were also detected in Ca(2+-treated plants under such stress. These results showed that Ca(2+ could help protect the peanut photosynthetic system from severe photoinhibition under heat and HI stress by accelerating the repair of D1 protein and improving the de-epoxidation ratio of the xanthophyll cycle. Furthermore, EGTA (a chelant of Ca ion, LaCl3 (a blocker of Ca(2+ channel in cytoplasmic membrane, and CPZ [a calmodulin (CaM antagonist] were used to analyze the effects of Ca(2+/CaM on the variation of (A+Z/(V+A+Z (% and the expression of violaxanthin de-epoxidase (VDE. The results indicated that CaM, an important component of the Ca(2+ signal transduction pathway, mediated the expression of the VDE gene in the presence of Ca to improve the xanthophyll cycle.

  5. Melatonin Improves the Photosynthetic Apparatus in Pea Leaves Stressed by Paraquat via Chlorophyll Breakdown Regulation and Its Accelerated de novo Synthesis

    Directory of Open Access Journals (Sweden)

    Katarzyna Szafrańska

    2017-05-01

    Full Text Available The positive effect of melatonin on the function of the photosynthetic apparatus is known, but little is known about the specific mechanisms of melatonin's action in plants. The influence of melatonin on chlorophyll metabolism of 24-day-old Pisum sativum L. seedlings during paraquat (PQ-induced oxidative stress was investigated in this study. Seeds were hydro-primed with water (H, 50 and 200 μM melatonin/water solutions (H-MEL50, H-MEL200, while non-primed seeds were used as controls (C. Increases in chlorophyllase activity (key enzyme in chlorophyll degradation and 5-aminolevulinic acid contents (the first compound in the porphyrin synthesis pathway were observed in H-MEL50 and H-MEL200 leaf disks. This suggests that melatonin may accelerate damaged chlorophyll breakdown and its de novo synthesis during the first hours of PQ treatment. Elevated level of pheophytin in control leaf disks following 24 h of PQ incubation probably was associated with an enhanced rate of chlorophyll degradation through formation of pheophytin as a chlorophyll derivative. This validates the hypothesis that chlorophyllide, considered for many years, as a first intermediate of chlorophyll breakdown is not. This is indicated by the almost unchanged chlorophyll to chlorophyllide ratio after 24 h of PQ treatment. However, prolonged effects of PQ-induced stress (48 h revealed extensive discolouration of control and water-treated leaf disks, while melatonin treatment alleviated PQ-induced photobleaching. Also the ratio of chlorophyll to chlorophyllide and porphyrin contents were significantly higher in plants treated with melatonin, which may indicate that this indoleamine both retards chlorophyll breakdown and stimulates its de novo synthesis during extended stress. We concluded that melatonin added into the seeds enhances the ability of pea seedlings to accelerate chlorophyll breakdown and its de novo synthesis before stress appeared and for several hours after, while

  6. Goodbye, Mandatory Maternity Leaves

    Science.gov (United States)

    Nation's Schools, 1972

    1972-01-01

    In precedent-setting decrees, courts and federal and State authorities have branded compulsory maternity leaves either unconstitutional or illegal. School administrators are urged to prod boards of education to adopt more lenient maternity leave policies -- now. (Author)

  7. Leaving home in Denmark

    DEFF Research Database (Denmark)

    Nielsen, Rikke Skovgaard

    2015-01-01

    The paper focuses on ethnic differences in the timing and patterns of leaving the parental home. Leaving home is a key transition in the life course of the individual, and extensive research has been conducted on the timing and patterns of leaving it. However, ethnic differences in these patterns...... of leaving home. Results showed that while some differences disappeared when controlling for covariates, others persisted, thus indicating ethnic differences in home-leaving patterns. A strong link between leaving home and marriage was substantiated for Turks, but not for Somalis. The home-leaving patterns...... of Somalis were much more similar to those of Danes. Overall, Turkish descendants were similar to Turkish immigrants but with some differentiation. The analyses identified the existence of ethnic differences in home-leaving patterns but also found evidence of a shift towards less traditional patterns, i...

  8. The effects of callus age, UV irradiation and incubation time on trans-resveratol production in grapevine callus culture

    International Nuclear Information System (INIS)

    Keskin, N.; Kunter, B.

    2009-01-01

    In this study, the effects of callus age, ultraviolet (UV) irradiation and incubation time were investigated for the induction of trans-resveratrol production in callus cultures of Kalecik karası (Clone 12) Vitis vinifera L. grape cultivar. Part of leaves (~1 cm 2 ) were taken from one year old grapevines grown in greenhouse and then were cultured in Gamborg B-5 media including 2% saccarose, 0.8% agar, 1.0 μM BAP (6-benzylaminopurine) and 0.1 μM 2, 4-D (2, 4-dichlorophenoxy-acetic acid). After the second subculture, 12 and 15 days old callus tissues were exposed to 254 nm UV light at 10 cm distance from the source for 10 and 15 min. Trans-resveratrol was measured at 0, 24, 48 and 72 hours of incubation by using High Pressure Liquid Chromatography (HPLC). Trans-resveratrol concentration of control callus ranged from 0.56 to 0.96 μg g fw -1 . The highest trans-resveratrol production was obtained from 12 and 15 days-old callus irradiated for 10 min. at the 48th hours of incubation (2.42 μg g fw -1 ). Considering the highest value of trans-resveratrol concentration in controls and experiments, it was determined that UV irraditation in Kalecik karası elicitated the trans-resveratrol production by 2.5 times. (author) [tr

  9. Vascular development of the grapevine (Vitis vinifera L.) inflorescence rachis in response to flower number, plant growth regulators and defoliation.

    Science.gov (United States)

    Gourieroux, Aude M; Holzapfel, Bruno P; McCully, Margaret E; Scollary, Geoffrey R; Rogiers, Suzy Y

    2017-09-01

    The grapevine inflorescence is a determinate panicle and as buds emerge, shoot, flower and rachis development occur simultaneously. The growth and architecture of the rachis is determined by genetic and environmental factors but here we examined the role of flower and leaf number as well as hormones on its elongation and vascular development. The consequences of rachis morphology and vascular area on berry size and composition were also assessed. One week prior to anthesis, Merlot and Cabernet Sauvignon field vines were exposed to manual flower removal, exogenous plant growth regulators or pre-bloom leaf removal. Manual removal of half the flowers along the vertical axis of the inflorescence resulted in a shorter rachis in both cultivars. Conversely, inflorescences treated with gibberellic acid (GA 3 ) and the synthetic cytokinin, 6-benzylaminopurine (BAP) resulted in a longer rachis while pre-bloom removal of all leaves on the inflorescence-bearing shoot did not alter rachis length relative to untreated inflorescences. Across the treatments, the cross-sectional areas of the conducting xylem and phloem in the rachis were positively correlated to rachis girth, flower number at anthesis, bunch berry number, bunch berry fresh mass and bunch sugar content at harvest. Conversely, average berry size and sugar content were not linked to rachis vascular area. These data indicate that the morphological and vascular development of the rachis was more responsive to flower number and plant growth regulators than to leaf removal.

  10. Transmission of Xylella fastidiosa to Grapevine by the Meadow Spittlebug.

    Science.gov (United States)

    Cornara, D; Sicard, A; Zeilinger, A R; Porcelli, F; Purcell, A H; Almeida, R P P

    2016-11-01

    There is little information available on Xylella fastidiosa transmission by spittlebugs (Hemiptera, Cercopoidea). This group of insect vectors may be of epidemiological relevance in certain diseases, so it is important to better understand the basic parameters of X. fastidiosa transmission by spittlebugs. We used grapevines as a host plant and the aphrophorid Philaenus spumarius as a vector to estimate the effect of plant access time on X. fastidiosa transmission to plants; in addition, bacterial population estimates in the heads of vectors were determined and correlated with plant infection status. Results show that transmission efficiency of X. fastidiosa by P. spumarius increased with plant access time, similarly to insect vectors in another family (Hemiptera, Cicadellidae). Furthermore, a positive correlation between pathogen populations in P. spumarius and transmission to plants was observed. Bacterial populations in insects were one to two orders of magnitude lower than those observed in leafhopper vectors, and population size peaked within 3 days of plant access period. These results suggest that P. spumarius has either a limited number of sites in the foregut that may be colonized, or that fluid dynamics in the mouthparts of these insects is different from that in leafhoppers. Altogether our results indicate that X. fastidiosa transmission by spittlebugs is similar to that by leafhoppers. In addition, the relationship between cell numbers in vectors and plant infection may have under-appreciated consequences to pathogen spread.

  11. VESPUCCI: exploring patterns of gene expression in grapevine

    Directory of Open Access Journals (Sweden)

    Marco eMoretto

    2016-05-01

    Full Text Available Large-scale transcriptional studies aim to decipher the dynamic cellular responses to a stimulus, like different environmental conditions. In the era of high-throughput omics biology, the most used technologies for these purposes are microarray and RNA-Seq, whose data are usually required to be deposited in public repositories upon publication. Such repositories have the enormous potential to provide a comprehensive view of how different experimental conditions lead to expression changes, by comparing gene expression across all possible measured conditions. Unfortunately, this task is greatly impaired by differences among experimental platforms that make direct comparisons difficult.In this paper we present the Vitis Expression Studies Platform Using COLOMBOS Compendia Instances (VESPUCCI, a gene expression compendium for grapevine which was built by adapting an approach originally developed for bacteria, and show how it can be used to investigate complex gene expression patterns. We integrated nearly all publicly available microarray and RNA-Seq expression data: 1608 gene expression samples from 10 different technological platforms. Each sample has been manually annotated using a controlled vocabulary developed ad hoc to ensure both human readability and computational tractability. Expression data in the compendium can be visually explored using several tools provided by the web interface or can be programmatically accessed using the REST interface. VESPUCCI is freely accessible at http://vespucci.colombos.fmach.it.

  12. A Fundamental Step in IPM on Grapevine: Evaluating the Side Effects of Pesticides on Predatory Mites

    Directory of Open Access Journals (Sweden)

    Alberto Pozzebon

    2015-10-01

    Full Text Available Knowledge on side effects of pesticides on non-target beneficial arthropods is a key point in Integrated Pest Management (IPM. Here we present the results of four experiments conducted in vineyards where the effects of chlorpyrifos, thiamethoxam, indoxacarb, flufenoxuron, and tebufenozide were evaluated on the generalist predatory mites Typhlodromus pyri Scheuten and Amblyseius andersoni (Chant, key biocontrol agents of herbivorous mites on grapevines. Results show that indoxacarb and tebufenozide had a low impact on the predatory mites considered here, while a significant impact was observed for chlorpyrifos, flufenoxuron, and thiamethoxam. The information obtained here should be considered in the design of IPM strategies on grapevine.

  13. Aqueous Extract of Phyllanthus niruri Leaves Displays In Vitro Antioxidant Activity and Prevents the Elevation of Oxidative Stress in the Kidney of Streptozotocin-Induced Diabetic Male Rats

    Directory of Open Access Journals (Sweden)

    Nelli Giribabu

    2014-01-01

    Full Text Available P. niruri has been reported to possess antidiabetic and kidney protective effects. In the present study, the phytochemical constituents and in vitro antioxidant activity of P. niruri leaf aqueous extract were investigated together with its effect on oxidative stress and antioxidant enzymes levels in diabetic rat kidney. Results. Treatment of diabetic male rats with P. niruri leaf aqueous extract (200 and 400 mg/kg for 28 consecutive days prevents the increase in the amount of lipid peroxidation (LPO product, malondialdehyde (MDA, and the diminution of superoxide dismutase (SOD, catalase (CAT, and glutathione peroxidase (GPx activity levels in the kidney of diabetic rats. The amount of LPO showed strong negative correlation with SOD, CAT, and GPx activity levels. P. niruri leaf aqueous extract exhibits in vitro antioxidant activity with IC50 slightly lower than ascorbic acid. Phytochemical screening of plant extract indicates the presence of polyphenols. Conclusion. P. niruri leaf extract protects the kidney from oxidative stress induced by diabetes.

  14. Comportamento vegetativo e produtivo de videiras 'Cabernet sauvignon' cultivadas sob cobertura plástica Vegetative growth and yield of 'Cabernet sauvignon' grapevine under overhead plastic covering

    Directory of Open Access Journals (Sweden)

    Clenilso Sehnen Mota

    2008-03-01

    Full Text Available O uso de cobertura plástica no cultivo de videira encontra-se em expansão no Rio Grande do Sul, por ser uma alternativa que visa a proteger as plantas da precipitação pluvial e do granizo. O objetivo deste estudo foi avaliar os impactos de uma cobertura plástica translúcida e impermeável sobre a fenologia, o crescimento (de ramos, folhas, cachos e bagas e a produtividade em videiras 'Cabernet Sauvignon' (Vitis vinifera L., com cinco anos de idade, conduzidas em sistema 'Y', sobre porta-enxerto Paulsen 1103. O experimento, conduzido no município de Caxias do Sul-RS, seguiu o delineamento em blocos ao acaso, tendo os tratamentos sem e com cobertura plástica, com quatro repetições de 15 plantas (unidade experimental. As alterações microclimáticas impostas pela cobertura plástica não foram expressivas para alterar a fenologia da videira. As plantas cultivadas sob cobertura plástica apresentaram maiores valores de comprimento e massa fresca de ramos e de área, e massa seca foliar em comparação às plantas descobertas. O peso e o diâmetro de bagas foram superiores nas videiras cobertas apenas no início do ciclo e não diferiram próximo da colheita. As demais variáveis analisadas não foram afetadas pela cobertura plástica. A cobertura plástica interferiu no crescimento vegetativo das plantas, mas não afetou a produção.There is an increasing adoption of overhead plastic covering for grapevines in the State of Rio Grande do Sul, Southern Brazil, to protect the plants from rain and hail storms. This study was carried out to evaluate the impacts of overhead plastic covering with a translucent and water-proof plastic film on phenological, growth (of branch, leaves, clusters, and berries, and yield attributes of five years old 'Cabernet Sauvignon' grapevines (Vitis vinifera L. on Paulsen 1103 rootstock raised as 'Y' management system. The experiment was carried out in Caxias do Sul, State of Rio Grande do Sul, and followed a

  15. Expression of ABA synthesis and metabolism genes under different irrigation strategies and atmospheric VPDs is associated with stomatal conductance in grapevine (Vitis vinifera L. cv Cabernet Sauvignon).

    Science.gov (United States)

    Speirs, Jim; Binney, Allan; Collins, Marisa; Edwards, Everard; Loveys, Brian

    2013-04-01

    The influence of different levels of irrigation and of variation in atmospheric vapour pressure deficit (VPD) on the synthesis, metabolism, and transport of abscisic acid (ABA) and the effects on stomatal conductance were examined in field-grown Cabernet Sauvignon grapevines. Xylem sap, leaf tissue, and root tissue were collected at regular intervals during two seasons in conjunction with measurements of leaf water potential (Ψleaf) and stomatal conductance (gs). The different irrigation levels significantly altered the Ψleaf and gs of the vines across both seasons. ABA abundance in the xylem sap was correlated with gs. The expression of genes associated with ABA synthesis, NCED1 and NCED2, was higher in the roots than in the leaves throughout and highest in the roots in mid January, a time when soil moisture declined and VPD was at its highest. Their expression in roots was also inversely related to the levels of irrigation and correlated with ABA abundance in the roots, xylem sap, and leaves. Three genes encoding ABA 8'-hydroxylases were isolated and their identities confirmed by expression in yeast cells. The expression of one of these, Hyd1, was elevated in leaves when VPD was below 2.0-2.5 kPa and minimal at higher VPD levels. The results provide evidence that ABA plays an important role in linking stomatal response to soil moisture status and that changes in ABA catabolism at or near its site of action allows optimization of gas exchange to current environmental conditions.

  16. Screening of Salt-stress, Antioxidant Enzyme, and Antimicrobial Activity of Leave extracts of Mangroves Avicennia marina L. from Hodaidah, Yemen

    Directory of Open Access Journals (Sweden)

    Maher A. Al Maqtari

    2014-05-01

    Full Text Available In the present study the salinity stress, antioxidant enzyme and antimicrobial activities of leaf extract of Avicennia marinawere investigated. As visualized from SDS-PAGE, no differences was found in number of protein band, but the intensities of several protein bands having apparent molecular mass by reduced severely in salt treated samples with enhanced activities of CAT, POX and GPX. Escherichia coli (ATCC8739, Staphylococus aureus (ATCC 6538, and Bacillus subtilis (ATCC6633 and fungus (Candida albicans ATCC 2091, and Aspergillus niger ATCC 16404 were used as the test pathogenic bacteria and fungi, respectively in this study. The Avicennia marina extract possessed antibacterial activity against E. coli, S. aureus, and B. subtilis (12, 6, and 7 mm respectively, with antifungal activity against C. albicans and A. niger (9 and 10 mm.

  17. The effect of aqueous extract of Avicennia marina (Forsk. Vierh. leaves on liver enzymes' activity, oxidative stress parameters and liver histopathology in male diabetic rats

    Directory of Open Access Journals (Sweden)

    Akram Hamzevi

    2017-12-01

    Full Text Available Background: Avicennia marina has antioxidant and anti-diabetic properties. This study was conducted to examine the effect of aqueous extract of A. marina on liver enzymes' activity, oxidative stress parameters and liver histopathology in diabetic rats. Materials and Methods: In this experimental study, 28 male rats were allocated into the equal groups of control, diabetic control and experimental diabetic 1 and 2. The diabetes in diabetic control and experimental diabetic groups was induced using an intraperitoneal injection of 120 mg/kg alloxan. The experimental diabetic groups received the aqueous extract of A. marina (100 and 200 mg/kg, i.p. in alternate days for one month. Sterile distilled water was injected to the animals of control and diabetic control groups. At the end of the treatment period, serum levels of ALT, AST, GGT and ALP were measured. Then, levels of SOD, GST, CAT and MDA were measured in the liver tissue. The liver sections were prepared and examined by an optical microscope. Results: Results showed that administration of the A. marina extract (100 and 300 mg/kg, ip to the diabetic rats significantly decreased the serum levels of liver enzymes and tissue level of MDA. Also, the activity of the liver tissue's antioxidant enzymes was increased (P<0.05. The A. marina extract dose-dependently decreased liver damages in diabetic rats. Conclusion: Administration of the A. marina extract improves liver tissue oxidative stress indices and decreases the serum level of liver enzymes. Also, A. marina extract improves liver tissue injuries induced by diabetes.

  18. Laser induced fluorescence of some plant leaves

    International Nuclear Information System (INIS)

    Helmi, M.S.; Mohamed, M.M.; Amer, R.; Elshazly, O.; Elraey, M.

    1992-01-01

    Laser induced fluorescence (LIF) is successfully used as a technique for remote detection of spectral characteristics of some plants. A pulsed nitrogen laser at 337.1 nm is used to excite cotton, corn and rice leaves. The fluorescence spectrum is detected in the range from 340 nm to 820 nm. It is found that, these plant leaves have common fluorescence maxima at 440 nm, 685 nm and 740 nm. plant leaves are also found to be identifiable by the ratio of the fluorescence intensity at 440 nm to that at 685 nm. The present technique can be further used as a means of assessing, remotely, plant stresses. 5 fig

  19. Grapevine rootstocks differentially affect the rate of ripening and modulate auxin-related genes in Cabernet Sauvignon berries

    Directory of Open Access Journals (Sweden)

    Massimiliano eCorso

    2016-02-01

    Full Text Available In modern viticulture, grafting commercial grapevine varieties on interspecific rootstocks is a common practice required for conferring resistance to many biotic and abiotic stresses. Nevertheless, the use of rootstocks to gain these essential traits is also known to impact grape berry development and quality, although the underlying mechanisms are still poorly understood. In grape berries, the onset of ripening (véraison is regulated by a complex network of mobile signals including hormones such as auxins, ethylene, abscisic acid and brassinosteroids. Recently, a new rootstock, designated M4, was selected based on its enhanced tolerance to water stress and medium vigour. This study investigates the effect of M4 on Cabernet Sauvignon (CS berry development in comparison to the commercial 1103P rootstock. Physical and biochemical parameters showed that the ripening rate of CS berries is faster when grafted onto M4. A multifactorial analysis performed on mRNA-Seq data obtained from skin and pulp of berries grown in both graft combinations revealed that genes controlling auxin action (ARF and Aux/IAA represent one of main categories affected by the rootstock genotype. Considering that the level of auxin tightly regulates the transcription of these genes, we investigated the behaviour of the main gene families involved in auxin biosynthesis and conjugation. Molecular and biochemical analyses confirmed a link between the rate of berry development and the modulation of auxin metabolism. Moreover the data indicate that this phenomenon appears to be particularly pronounced in skin tissue in comparison to the flesh.

  20. Grapevine Rootstocks Differentially Affect the Rate of Ripening and Modulate Auxin-Related Genes in Cabernet Sauvignon Berries.

    Science.gov (United States)

    Corso, Massimiliano; Vannozzi, Alessandro; Ziliotto, Fiorenza; Zouine, Mohamed; Maza, Elie; Nicolato, Tommaso; Vitulo, Nicola; Meggio, Franco; Valle, Giorgio; Bouzayen, Mondher; Müller, Maren; Munné-Bosch, Sergi; Lucchin, Margherita; Bonghi, Claudio

    2016-01-01

    In modern viticulture, grafting commercial grapevine varieties on interspecific rootstocks is a common practice required for conferring resistance to many biotic and abiotic stresses. Nevertheless, the use of rootstocks to gain these essential traits is also known to impact grape berry development and quality, although the underlying mechanisms are still poorly understood. In grape berries, the onset of ripening (véraison) is regulated by a complex network of mobile signals including hormones such as auxins, ethylene, abscisic acid, and brassinosteroids. Recently, a new rootstock, designated M4, was selected based on its enhanced tolerance to water stress and medium vigor. This study investigates the effect of M4 on Cabernet Sauvignon (CS) berry development in comparison to the commercial 1103P rootstock. Physical and biochemical parameters showed that the ripening rate of CS berries is faster when grafted onto M4. A multifactorial analysis performed on mRNA-Seq data obtained from skin and pulp of berries grown in both graft combinations revealed that genes controlling auxin action (ARF and Aux/IAA) represent one of main categories affected by the rootstock genotype. Considering that the level of auxin tightly regulates the transcription of these genes, we investigated the behavior of the main gene families involved in auxin biosynthesis and conjugation. Molecular and biochemical analyses confirmed a link between the rate of berry development and the modulation of auxin metabolism. Moreover, the data indicate that this phenomenon appears to be particularly pronounced in skin tissue in comparison to the flesh.

  1. Genome-wide analysis of the expansin gene superfamily reveals grapevine-specific structural and functional characteristics.

    Directory of Open Access Journals (Sweden)

    Silvia Dal Santo

    Full Text Available BACKGROUND: Expansins are proteins that loosen plant cell walls in a pH-dependent manner, probably by increasing the relative movement among polymers thus causing irreversible expansion. The expansin superfamily (EXP comprises four distinct families: expansin A (EXPA, expansin B (EXPB, expansin-like A (EXLA and expansin-like B (EXLB. There is experimental evidence that EXPA and EXPB proteins are required for cell expansion and developmental processes involving cell wall modification, whereas the exact functions of EXLA and EXLB remain unclear. The complete grapevine (Vitis vinifera genome sequence has allowed the characterization of many gene families, but an exhaustive genome-wide analysis of expansin gene expression has not been attempted thus far. METHODOLOGY/PRINCIPAL FINDINGS: We identified 29 EXP superfamily genes in the grapevine genome, representing all four EXP families. Members of the same EXP family shared the same exon-intron structure, and phylogenetic analysis confirmed a closer relationship between EXP genes from woody species, i.e. grapevine and poplar (Populus trichocarpa, compared to those from Arabidopsis thaliana and rice (Oryza sativa. We also identified grapevine-specific duplication events involving the EXLB family. Global gene expression analysis confirmed a strong correlation among EXP genes expressed in mature and green/vegetative samples, respectively, as reported for other gene families in the recently-published grapevine gene expression atlas. We also observed the specific co-expression of EXLB genes in woody organs, and the involvement of certain grapevine EXP genes in berry development and post-harvest withering. CONCLUSION: Our comprehensive analysis of the grapevine EXP superfamily confirmed and extended current knowledge about the structural and functional characteristics of this gene family, and also identified properties that are currently unique to grapevine expansin genes. Our data provide a model for the

  2. Differential responses between mature and young leaves of sunflower plants to oxidative stress caused by water deficit Diferentes respostas entre folhas adultas e jovens de plantas de girassol ao estresse oxidativo causado pelo déficit hídrico

    Directory of Open Access Journals (Sweden)

    Inês Cechin

    2010-06-01

    Full Text Available The effects of water stress and rehydration on leaf gas exchange characteristics along with changes in lipid peroxidation and pirogalol peroxidase (PG-POD were studied in mature and in young leaves of sunflower (Helianthus annuus L., which were grown in a greenhouse. Water stress reduced photosynthesis (Pn, stomatal conductance (g s, and transpiration (E in both young and mature leaves. However, the amplitude of the reduction was dependent on leaf age. The intercellular CO2 concentration (Ci was increased in mature leaves but it was not altered in young leaves. Instantaneous water use efficiency (WUE in mature stressed leaves was reduced when compared to control leaves while in young stressed leaves it was maintained to the same level as the control. After 24h of rehydration, most of the parameters related to gas exchange recovered to the same level as the unstressed plants except gs and E in mature leaves. Water stress did not activated PG-POD independently of leaf age. However, after rehydration the enzyme activity was increased in mature leaves and remained to the same as the control in young leaves. Malondialdehyde (MDA content was increased by water stress in both mature and young leaves. The results suggest that young leaves are more susceptible to water stress in terms of gas exchange characteristics than mature leaves although both went through oxidative estresse.Os efeitos do estresse hídrico e da reidratação nas trocas gasosas juntamente com alterações na lipoperoxidação e atividade da pirogalol peroxidase (PG-POD foram estudados em folhas adultas e jovens de plantas de girassol (Helianthus annuus L. cultivadas em casa de vegetação. O estresse hídrico reduziu a fotossíntese (P N, a condutância estomática (g s e a transpiração (E nas folhas adultas e jovens. No entanto, a amplitude da redução foi dependente da idade da folha. A concentração intercelular de CO2 (Ci aumentou nas folhas adultas, mas não apresentou

  3. Grapevine rootstocks shape underground bacterial microbiome and networking but not potential functionality.

    Science.gov (United States)

    Marasco, Ramona; Rolli, Eleonora; Fusi, Marco; Michoud, Grégoire; Daffonchio, Daniele

    2018-01-03

    The plant compartments of Vitis vinifera, including the rhizosphere, rhizoplane, root endosphere, phyllosphere and carposphere, provide unique niches that drive specific bacterial microbiome associations. The majority of phyllosphere endophytes originate from the soil and migrate up to the aerial compartments through the root endosphere. Thus, the soil and root endosphere partially define the aerial endosphere in the leaves and berries, contributing to the terroir of the fruit. However, V. vinifera cultivars are invariably grafted onto the rootstocks of other Vitis species and hybrids. It has been hypothesized that the plant species determines the microbiome of the root endosphere and, as a consequence, the aerial endosphere. In this work, we test the first part of this hypothesis. We investigate whether different rootstocks influence the bacteria selected from the surrounding soil, affecting the bacterial diversity and potential functionality of the rhizosphere and root endosphere. Bacterial microbiomes from both the root tissues and the rhizosphere of Barbera cultivars, both ungrafted and grafted on four different rootstocks, cultivated in the same soil from the same vineyard, were characterized by 16S rRNA high-throughput sequencing. To assess the influence of the root genotype on the bacterial communities' recruitment in the root system, (i) the phylogenetic diversity coupled with the predicted functional profiles and (ii) the co-occurrence bacterial networks were determined. Cultivation-dependent approaches were used to reveal the plant-growth promoting (PGP) potential associated with the grafted and ungrafted root systems. Richness, diversity and bacterial community networking in the root compartments were significantly influenced by the rootstocks. Complementary to a shared bacterial microbiome, different subsets of soil bacteria, including those endowed with PGP traits, were selected by the root system compartments of different rootstocks. The interaction

  4. Grapevine rootstocks shape underground bacterial microbiome and networking but not potential functionality

    KAUST Repository

    Marasco, Ramona; Rolli, Eleonora; Fusi, Marco; Michoud, Gregoire; Daffonchio, Daniele

    2018-01-01

    The plant compartments of Vitis vinifera, including the rhizosphere, rhizoplane, root endosphere, phyllosphere and carposphere, provide unique niches that drive specific bacterial microbiome associations. The majority of phyllosphere endophytes originate from the soil and migrate up to the aerial compartments through the root endosphere. Thus, the soil and root endosphere partially define the aerial endosphere in the leaves and berries, contributing to the terroir of the fruit. However, V. vinifera cultivars are invariably grafted onto the rootstocks of other Vitis species and hybrids. It has been hypothesized that the plant species determines the microbiome of the root endosphere and, as a consequence, the aerial endosphere. In this work, we test the first part of this hypothesis. We investigate whether different rootstocks influence the bacteria selected from the surrounding soil, affecting the bacterial diversity and potential functionality of the rhizosphere and root endosphere.Bacterial microbiomes from both the root tissues and the rhizosphere of Barbera cultivars, both ungrafted and grafted on four different rootstocks, cultivated in the same soil from the same vineyard, were characterized by 16S rRNA high-throughput sequencing. To assess the influence of the root genotype on the bacterial communities' recruitment in the root system, (i) the phylogenetic diversity coupled with the predicted functional profiles and (ii) the co-occurrence bacterial networks were determined. Cultivation-dependent approaches were used to reveal the plant-growth promoting (PGP) potential associated with the grafted and ungrafted root systems.Richness, diversity and bacterial community networking in the root compartments were significantly influenced by the rootstocks. Complementary to a shared bacterial microbiome, different subsets of soil bacteria, including those endowed with PGP traits, were selected by the root system compartments of different rootstocks. The interaction

  5. Grapevine rootstocks shape underground bacterial microbiome and networking but not potential functionality

    KAUST Repository

    Marasco, Ramona

    2018-01-03

    The plant compartments of Vitis vinifera, including the rhizosphere, rhizoplane, root endosphere, phyllosphere and carposphere, provide unique niches that drive specific bacterial microbiome associations. The majority of phyllosphere endophytes originate from the soil and migrate up to the aerial compartments through the root endosphere. Thus, the soil and root endosphere partially define the aerial endosphere in the leaves and berries, contributing to the terroir of the fruit. However, V. vinifera cultivars are invariably grafted onto the rootstocks of other Vitis species and hybrids. It has been hypothesized that the plant species determines the microbiome of the root endosphere and, as a consequence, the aerial endosphere. In this work, we test the first part of this hypothesis. We investigate whether different rootstocks influence the bacteria selected from the surrounding soil, affecting the bacterial diversity and potential functionality of the rhizosphere and root endosphere.Bacterial microbiomes from both the root tissues and the rhizosphere of Barbera cultivars, both ungrafted and grafted on four different rootstocks, cultivated in the same soil from the same vineyard, were characterized by 16S rRNA high-throughput sequencing. To assess the influence of the root genotype on the bacterial communities\\' recruitment in the root system, (i) the phylogenetic diversity coupled with the predicted functional profiles and (ii) the co-occurrence bacterial networks were determined. Cultivation-dependent approaches were used to reveal the plant-growth promoting (PGP) potential associated with the grafted and ungrafted root systems.Richness, diversity and bacterial community networking in the root compartments were significantly influenced by the rootstocks. Complementary to a shared bacterial microbiome, different subsets of soil bacteria, including those endowed with PGP traits, were selected by the root system compartments of different rootstocks. The interaction

  6. Negative leave balances

    CERN Multimedia

    Human Resources Department

    2005-01-01

    Members of the personnel entitled to annual leave and, where appropriate, saved leave and/or compensatory leave are requested to take note of the new arrangements described below, which were recommended by the Standing Concertation Committee (SCC) at its meeting on 1Â September 2005 and subsequently approved by the Director-General. The changes do not apply to members of the personnel participating in the Progressive Retirement Programme (PRP) or the Part-time Work as a pre-retirement measure, for whom the specific provisions communicated at the time of joining will continue to apply. Â Negative balances in annual leave, saved leave and/or compensatory leave accounts at the end of the leave year (30th September) and on the date on which bonuses are credited to the saved leave account (31st December): Where members of the personnel have a leave account with a negative balance on 30Â September and/or 31Â December, leave will automatically be transferred from one account to another on the relevant dates i...

  7. Negative leave balances

    CERN Multimedia

    Human Resources Department

    2005-01-01

    Members of the personnel entitled to annual leave and, where appropriate, saved leave and/or compensatory leave are requested to take note of the new arrangements described below, which were recommended by the Standing Concertation Committee (SCC) at its meeting on 1 September 2005 and subsequently approved by the Director-General. The changes do not apply to members of the personnel participating in the Progressive Retirement Programme (PRP) or the Part-time Work as a pre-retirement measure, for whom the specific provisions communicated at the time of joining will continue to apply.  Negative balances in annual leave, saved leave and/or compensatory leave accounts at the end of the leave year (30th September) and on the date on which bonuses are credited to the saved leave account (31st December): Where members of the personnel have a leave account with a negative balance on 30 September and/or 31 December, leave will automatically be transferred from one account to another on the relevant dates in or...

  8. Stress

    DEFF Research Database (Denmark)

    Keller, Hanne Dauer

    2015-01-01

    Kapitlet handler om stress som følelse, og det trækker primært på de få kvalitative undersøgelser, der er lavet af stressforløb.......Kapitlet handler om stress som følelse, og det trækker primært på de få kvalitative undersøgelser, der er lavet af stressforløb....

  9. Stress !!!

    OpenAIRE

    Fledderus, M.

    2012-01-01

    Twee op de vijf UT-studenten hebben last van ernstige studiestress, zo erg zelfs dat het ze in hun privéleven belemmert. Die cijfers komen overeen met het landelijk beeld van stress onder studenten. Samen met 14 andere universiteits- en hogeschoolbladen enquêteerde UT Nieuws bijna 5500 studenten. Opvallend is dat mannelijke studenten uit Twente zich veel minder druk lijken te maken over hun studie. Onder vrouwen ligt de stress juist erg hoog ten opzichte van het landelijk gemiddelde.

  10. Studies on retranslocation of accumulated assimilates in 'Delaware' grapevines, (1)

    International Nuclear Information System (INIS)

    Yang, Yau-Shiang; Hori, Yutaka

    1979-01-01

    Potted Delaware grapevines were supplied with 14 CO 2 in summer or autumn, and the accumulation and retranslocation of 14 C-assimilates were investigated. At pruning time, 14 C-assimilates were distributed to the roots at higher ratio than to the trunks and canes, and this trend was more marked in the autumn feeding than the summer feeding. The respiratory consumption and retranslocation of 14 C during the growth period of new shoots were evaluated as the percentage of 14 C found in the vines just after pruning. The percentage of the respiratory consumption of 14 C was evidently higher in the autumn feeding. The retranslocation began with the bud burst, and reached maximum at the 6- to 8-leaf stages in the vines fed 14 CO 2 in autumn and at the 10-leaf stage in those fed in summer. The retranslocation in both groups ceased by the flowering stage. Such course of the retranslocation with time was recognized in radioautographs of the new shoots. The maximum percentage of the translocation to the newly developed shoots was 5.1 - 5.2 and 15.3 - 10.7 in the vines fed 14 CO 2 in summer and autumn, respectively. It was peculiar to the new shoots that nearly half of their ethanol-soluble 14 C was found in amino acids unlike the one-sided distribution to soluble carbohydrates in the trunks and roots. It was assumed that amino acids were retranslocated to the new shoots after they had been synthesized in the roots. (Kaihara, S.)

  11. Complete sequence of RNA1 of grapevine Anatolian ringspot virus.

    Science.gov (United States)

    Digiaro, Michele; Nahdi, Sabrine; Elbeaino, Toufic

    2012-10-01

    The nucleotide sequence of RNA1 of grapevine Anatolian ringspot virus (GARSV), a nepovirus of subgroup B, was determined from cDNA clones. It is 7,288 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame (ORF), extending from nucleotides 272 to 7001, encoding a polypeptide of 2,243 amino acids with a predicted molecular mass of 250 kDa. The primary structure of the polyprotein, compared with that of other viral polyproteins, revealed the presence of all the characteristic domains of members of the order Picornavirales, i.e., the NTP-binding protein (1B(Hel)), the viral genome-linked protein (1C(VPg)), the proteinase (1D(Prot)), the RNA-dependent RNA polymerase (1E(Pol)), and of the protease cofactor (1A(Pro-cof)) shared by members of the subfamily Comovirinae within the family Secoviridae. The cleavage sites predicted within the polyprotein were found to be in agreement with those previously reported for nepoviruses of subgroup B, processing from 1A to 1E proteins of 67, 64, 3, 23 and 92 kDa, respectively. The RNA1-encoded polyprotein (p1) shared the highest amino acid sequence identity (66 %) with tomato black ring virus (TBRV) and beet ringspot virus (BRSV). The 5'- and 3'-noncoding regions (NCRs) of GARSV-RNA1 shared 89 % and 95 % nucleotide sequence identity respectively with the corresponding regions in RNA2. Phylogenetic analysis confirmed the close relationship of GARSV to members of subgroup B of the genus Nepovirus.

  12. Manejo do dossel vegetativo da videira e seu efeito na composição do vinho Merlot Grapevine canopy management effects on Merlot wine composition

    Directory of Open Access Journals (Sweden)

    Alberto Miele

    2009-05-01

    Full Text Available O objetivo deste trabalho foi avaliar o efeito de modalidades de poda verde da videira (Vitis vinifera L. na composição do vinho Merlot. Um experimento foi conduzido de 1993/1994 a 1996/1997, em Bento Gonçalves, RS, com uma testemunha e 11 modalidades de poda verde em vinhedo conduzido em latada. A análise de componentes principais mostrou que o efeito da poda verde variou conforme o ano. Considerando a média dos quatro anos avaliados, os três principais componentes foram responsáveis por 72% da variação total. Adesbrota, desponta e desfolha realizada no início da floração, com eliminação de todas as folhas abaixo dos cachos foi a modalidade de poda que apresentou os valores mais elevados de intensidade de cor, absorbâncias a 280 e 520 nm, antocianinas, taninos, álcool, 3-metil-1-butanol/2-metil-1-propanol, álcool em peso/extrato seco reduzido e fósforo, e foi a mais indicada para a produção de vinho Merlot.The objective of this work was to evaluate the effect of grapevine (Vitis vinifera L. summer pruning on Merlot wine composition. An experiment was carried out from 1993/1994 to 1996/1997 in Bento Gonçalves, RS, Brazil, using a control and 11 summer pruning in grapevines trained in pergola system. Principal component analysis showed that the summer pruning effects varied by year. Considering the average of the four years, the first three principal components were responsible for 72% of the total variation. Sprouting, topping, and removal of all leaves below grapevine clusters at the beginning of bloom had high values of color intensity, absorbances at 280 and 520 nm, anthocyanins, tannins, alcohol, 3-methyl-1-butanol/2-methyl-1-propanol, alcohol in weight/reduced dry extract, and phosphorus and was the best alternative for the production of quality Merlot wine.

  13. The Temporary Leave Dilemma -

    DEFF Research Database (Denmark)

    Amilon, Anna

    2010-01-01

    Lone mothers have to take care of a sick child with little or no help from the child’s other parent and have to carry all costs connected to leave-taking. This paper empirically tests whether lone mothers take more temporary parental leave to care for sick children than partnered mothers...... and whether parental leave is associated with a signaling cost. The results from this study of Swedish mothers show that lone mothers use more temporary parental leave than partnered mothers. Further, within the group of lone mothers, those with higher socioeconomic status take less temporary parental leave...... than those with lower socioeconomic status, whereas no such differences are found within the group of partnered mothers. One possible interpretation is that signaling costs negatively influence the utilization of temporary parental leave for lone mothers....

  14. Magnetic resonance imaging of water ascent in embolized xylem vessels of grapevine stem segments

    Science.gov (United States)

    Mingtao Wang; Melvin T. Tyree; Roderick E. Wasylishen

    2013-01-01

    Temporal and spatial information about water refilling of embolized xylem vessels and the rate of water ascent in these vessels is critical for understanding embolism repair in intact living vascular plants. High-resolution 1H magnetic resonance imaging (MRI) experiments have been performed on embolized grapevine stem segments while they were...

  15. Restructuring of endophytic bacterial communities in grapevine yellows-diseased and recovered Vitis vinifera L. plants.

    Science.gov (United States)

    Bulgari, Daniela; Casati, Paola; Crepaldi, Paola; Daffonchio, Daniele; Quaglino, Fabio; Brusetti, Lorenzo; Bianco, Piero Attilio

    2011-07-01

    Length heterogeneity-PCR assays, combined with statistical analyses, highlighted that the endophytic bacterial community associated with healthy grapevines was characterized by a greater diversity than that present in diseased and recovered plants. The findings suggest that phytoplasmas can restructure the bacterial community by selecting endophytic strains that could elicit a plant defense response.

  16. Species of Diatrypaceae associated with grapevine trunk diseases in Eastern Spain

    Directory of Open Access Journals (Sweden)

    Jordi LUQUE

    2013-01-01

    Full Text Available The presence and diversity of Diatrypaceae species occurring on grapevines in Eastern Spain were investigated. Several species were identified on the basis of morphological characters and phylogenetic analyses of the complete sequence of the internal transcribed spacers of the ribosomal DNA and part of the β-tubulin gene. Five species of Diatrypaceae isolated from the wood of diseased grapevines, pruning debris and/or perithecia were identified, including Anthostoma decipiens, Cryptovalsa ampelina, Eutypa lata, Eutypella citricola and Eutypella microtheca. Additionally, four taxa could not be identified to the species level but were closely related to Eutypa tetragona based on phylogenetic analyses. Eutypa lata was the most prevalent species and showed the greatest degree of genetic diversity. Cryptovalsa ampelina and E. microtheca ranked second in the frequency of isolations, while all the remaining species were less frequently isolated. Eutypella citricola and E. microtheca are reported for the first time as occurring on grapevine in Spain and this is the first report of A. decipiens occurring on grapevine.

  17. Deep amplicon sequencing reveals mixed phytoplasma infection within single grapevine plants

    DEFF Research Database (Denmark)

    Nicolaisen, Mogens; Contaldo, Nicoletta; Makarova, Olga

    2011-01-01

    The diversity of phytoplasmas within single plants has not yet been fully investigated. In this project, deep amplicon sequencing was used to generate 50,926 phytoplasma sequences from 11 phytoplasma-infected grapevine samples from a PCR amplicon in the 5' end of the 16S region. After clustering ...

  18. The distribution and symptomatology of grapevine trunk disease pathogens are influenced by climate

    NARCIS (Netherlands)

    van Niekerk, J.M.; Bester, W.; Halleen, F.; Crous, P.W.; Fourie, P.H.

    2011-01-01

    Grapevine trunk diseases, caused by a range of phytopathogenic fungi, represent a serious impediment to wine and table grape production wherever these crops are cultivated. Previous studies have shown that the distribution of these pathogens is influenced by climate and that they are associated with

  19. Root-associated bacteria promote grapevine growth: from the laboratory to the field

    KAUST Repository

    Rolli, Eleonora; Marasco, Ramona; Saderi, Stefano; Corretto, Erika; Mapelli, Francesca; Cherif, Ameur; Borin, Sara; Valenti, Leonardo; Sorlini, Claudia; Daffonchio, Daniele

    2016-01-01

    of different geographical origins derived from different crop plants can colonize grapevine to gain a beneficial outcome for the plant leading to promote growth at the field scale. Methods: To link the ecological functions of bacteria to the promotion of plant

  20. Presence and uses of wild grapevine (Vitis spp. in the central region of Veracruz in Mexico

    Directory of Open Access Journals (Sweden)

    Juan Guillermo Cruz-Castillo

    2009-06-01

    Significance and impact of study: The exploration of Vitis spp. in the area studied raises the possibility of finding new hybrids or multi-hybrids between species. Wild grapevines could be used to produce natural products that could be sold on the market.

  1. Predicting the occurrence of iron chlorosis in grapevine with tests based on soil iron forms

    Directory of Open Access Journals (Sweden)

    Isabel Díaz de la Torre

    2010-06-01

    Significance and impact of study: This study has shown the limited usefulness of tests based on the contents and reactivity of the soil carbonate to predict the occurrence of Fe chlorosis in grapevine; tests capable of estimating the contents of the labile soil Fe forms constitute the best alternative.

  2. Design and validation of an STR hexaplex assay for DNA profiling of grapevine cultivars

    Czech Academy of Sciences Publication Activity Database

    Drábek, A.; Smolíková, M.; Kalendar, R.; Pinto, F. A. L.; Pavloušek, P.; Klepárník, Karel; Frébort, I.

    2016-01-01

    Roč. 37, 23-24 (2016), s. 3059-3067 ISSN 0173-0835 Institutional support: RVO:68081715 Keywords : grapevine DNA analysis * multiplex PCR * STRs * Vitis vinifera L Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 2.744, year: 2016

  3. Fatty Acid Methyl Ester (FAME) analyses for characterization and detection of grapevine pathogens

    Science.gov (United States)

    Grapevines can become infected by a variety of devastating pathogens, including the bacterium Xylella fastidiosa and canker fungi. Multiple strains of Xylella fastidiosa exist, each causing different diseases on various hosts. Although sequence-based genotyping can assist in distinguishing these str...

  4. A polyphasic approach for the characterization of endophytic Alternaria strains isolated from grapevines

    DEFF Research Database (Denmark)

    Polizzotto, Rachele; Andersen, Birgitte; Martini, Marta

    2012-01-01

    A polyphasic approach was set up and applied to characterize 20 fungal endophytes belonging to the genus Alternaria, recovered from grapevine in different Italian regions.Morphological, microscopical, molecular and chemical investigations were performed and the obtained results were combined in a...

  5. Abscisic acid biosynthesis in leaves and roots of Xanthium strumarium

    International Nuclear Information System (INIS)

    Creelman, R.A.; Gage, D.A.; Stults, J.T.; Zeevaart, J.A.D.

    1987-01-01

    Research on the biosynthesis of abscisic acid (ABA) has focused primarily on two pathways: (a) the direct pathway from farnesyl pyrophosphate, and (b) the indirect pathway involving a carotenoid precursor. The authors have investigated which biosynthetic pathway is operating in turgid and stressed Xanthium leaves, and in stressed Xanthium roots using long-term incubations in 18 O 2 . It was found that in stressed leaves three atoms of 18 O from 18 O 2 are incorporated into the ABA molecule, and that the amount of 18 O incorporated increases with time. One 18 O atom is incorporated rapidly into the carboxyl group of ABA, whereas the other two atoms are very slowly incorporated into the ring oxygens. The fourth oxygen atom in the carboxyl group of ABA is derived from water. ABA from stressed roots of Xanthium incubated in 18 O 2 shows a labeling pattern similar to that of ABA in stressed leaves, but with incorporation of more 18 O into the tertiary hydroxyl group at C-1' after 6 and 12 hours than found in ABA from stressed leaves. It is proposed that the precursors to stress-induced ABA are xanthophylls, and that a xanthophyll lacking an oxygen function at C-6 plays a crucial role in ABA biosynthesis in Xanthium roots. In turgid Xanthium leaves, 18 O is incorporated into ABA to a much lesser extent that it is in stressed leaves, whereas exogenously applied 14 C-ABA is completely catabolized within 48 hours. This suggests that ABA in turgid leaves is either (a) made via a biosynthetic pathway which is different from the one in stressed leaves, or (b) has a half-life on the order of days as compared with a half-life of 15.5 hours in water-stressed Xanthium leaves. Phaseic acid showed a labeling pattern similar to that of ABA, but with an additional 18 O incorporated during 8'-hydroxylation of ABA to phaseic acid

  6. Abscisic Acid Biosynthesis in Leaves and Roots of Xanthium strumarium.

    Science.gov (United States)

    Creelman, R A; Gage, D A; Stults, J T; Zeevaart, J A

    1987-11-01

    RESEARCH ON THE BIOSYNTHESIS OF ABSCISIC ACID (ABA) HAS FOCUSED PRIMARILY ON TWO PATHWAYS: (a) the direct pathway from farnesyl pyrophosphate, and (b) the indirect pathway involving a carotenoid precursor. We have investigated which biosynthetic pathway is operating in turgid and stressed Xanthium leaves, and in stressed Xanthium roots using long-term incubations in (18)O(2). It was found that in stressed leaves three atoms of (18)O from (18)O(2) are incorporated into the ABA molecule, and that the amount of (18)O incorporated increases with time. One (18)O atom is incorporated rapidly into the carboxyl group of ABA, whereas the other two atoms are very slowly incorporated into the ring oxygens. The fourth oxygen atom in the carboxyl group of ABA is derived from water. ABA from stressed roots of Xanthium incubated in (18)O(2) shows a labeling pattern similar to that of ABA in stressed leaves, but with incorporation of more (18)O into the tertiary hydroxyl group at C-1' after 6 and 12 hours than found in ABA from stressed leaves. It is proposed that the precursors to stress-induced ABA are xanthophylls, and that a xanthophyll lacking an oxygen function at C-6 (carotenoid numbering scheme) plays a crucial role in ABA biosynthesis in Xanthium roots. In turgid Xanthium leaves, (18)O is incorporated into ABA to a much lesser extent than it is in stressed leaves, whereas exogenously applied (14)C-ABA is completely catabolized within 48 hours. This suggests that ABA in turgid leaves is either (a) made via a biosynthetic pathway which is different from the one in stressed leaves, or (b) has a half-life on the order of days as compared with a half-life of 15.5 hours in water-stressed Xanthium leaves. Phaseic acid showed a labeling pattern similar to that of ABA, but with an additional (18)O incorporated during 8'-hydroxylation of ABA to phaseic acid.

  7. Spatio-temporal effects of soil and bedrock variability on grapevine water status in hillslope vineyards.

    Science.gov (United States)

    Brillante, Luca; Bois, Benjamin; Mathieu, Olivier; Leveque, Jean

    2014-05-01

    Hillslope vineyards show various and complex water dynamics between soil and plants, and in order to gain further insight into this phenomenon, 8 grapevine plots were monitored during three vintages, from 2010 to 2013, on Corton Hill, Burgundy, France. Plots were distributed along a topolithosequence from 330 to 270 metres a.s.l. Grapevine water status was monitored weekly by surveying water potential, and, at the end of the season, by the use of the δ13C analysis of grape juice. Soil profile of each plot was described and analysed (soil texture, gravel content, organic carbon, total nitrogen, pH, CEC). Soil volumetric humidity was measured weekly, using TDR probes. A pedotransfer function was developed to transform Electrical Resistivity Imaging (ERI) into soil volume wetness and therefore to spatialise and observe variation in the Fraction of Transpirable Soil Water (FTSW). During the three years of monitoring, grapevines experienced great variation in water status, which ranged from low to considerable water deficit (as expressed by pre-dawn leaf water potential and δ13C analysis of grape juice). With ERI imaging, it was possible to observe differences in water absorption pattern by roots, in different soils, and at different depth. In addition, significant differences were observed in grapevine water status in relation to variations in the physical characteristics of the terroir along the hillslope (i.e. the geo-pedological context, the elevation etc.). Grapevine water behaviour and plant-soil water relationships on the hillslope of Corton Hill have been extensively characterised in this study by ultimate technologies, allowing to present this terroir as a very interesting example for future generalisation and modelling of the hillslope vineyard water dynamics.

  8. Physical mapping in highly heterozygous genomes: a physical contig map of the Pinot Noir grapevine cultivar

    Directory of Open Access Journals (Sweden)

    Jurman Irena

    2010-03-01

    Full Text Available Abstract Background Most of the grapevine (Vitis vinifera L. cultivars grown today are those selected centuries ago, even though grapevine is one of the most important fruit crops in the world. Grapevine has therefore not benefited from the advances in modern plant breeding nor more recently from those in molecular genetics and genomics: genes controlling important agronomic traits are practically unknown. A physical map is essential to positionally clone such genes and instrumental in a genome sequencing project. Results We report on the first whole genome physical map of grapevine built using high information content fingerprinting of 49,104 BAC clones from the cultivar Pinot Noir. Pinot Noir, as most grape varieties, is highly heterozygous at the sequence level. This resulted in the two allelic haplotypes sometimes assembling into separate contigs that had to be accommodated in the map framework or in local expansions of contig maps. We performed computer simulations to assess the effects of increasing levels of sequence heterozygosity on BAC fingerprint assembly and showed that the experimental assembly results are in full agreement with the theoretical expectations, given the heterozygosity levels reported for grape. The map is anchored to a dense linkage map consisting of 994 markers. 436 contigs are anchored to the genetic map, covering 342 of the 475 Mb that make up the grape haploid genome. Conclusions We have developed a resource that makes it possible to access the grapevine genome, opening the way to a new era both in grape genetics and breeding and in wine making. The effects of heterozygosity on the assembly have been analyzed and characterized by using several complementary approaches which could be easily transferred to the study of other genomes which present the same features.

  9. Use of Endophytic and Rhizosphere Actinobacteria from Grapevine Plants To Reduce Nursery Fungal Graft Infections That Lead to Young Grapevine Decline.

    Science.gov (United States)

    Álvarez-Pérez, José Manuel; González-García, Sandra; Cobos, Rebeca; Olego, Miguel Ángel; Ibañez, Ana; Díez-Galán, Alba; Garzón-Jimeno, Enrique; Coque, Juan José R

    2017-12-15

    Endophytic and rhizosphere actinobacteria isolated from the root system of 1-year-old grafted Vitis vinifera plants were evaluated for their activities against fungi that cause grapevine trunk diseases. A total of 58 endophytic and 94 rhizosphere isolates were tested. Based on an in vitro bioassay, 15.5% of the endophytic isolates and 30.8% of the rhizosphere isolates exhibited antifungal activity against the fungal pathogen Diplodia seriata , whereas 13.8% of the endophytic isolates and 16.0% of the rhizosphere isolates showed antifungal activity against Dactylonectria macrodidyma (formerly Ilyonectria macrodidyma ). The strains which showed the greatest in vitro efficacy against both pathogens were further analyzed for their ability to inhibit the growth of Phaeomoniella chlamydospora and Phaeoacremonium minimum (formerly Phaeoacremonium aleophilum ). Based on their antifungal activity, three rhizosphere isolates and three endophytic isolates were applied on grafts in an open-root field nursery in a 3-year trial. The field trial led to the identification of one endophytic strain, Streptomyces sp. VV/E1, and two rhizosphere isolates, Streptomyces sp. VV/R1 and Streptomyces sp. VV/R4, which significantly reduced the infection rates produced by the fungal pathogens Dactylonectria sp., Ilyonectria sp., P. chlamydospora , and P. minimum , all of which cause young grapevine decline. The VV/R1 and VV/R4 isolates also significantly reduced the mortality level of grafted plants in the nursery. This study shows that certain actinobacteria could represent a promising new tool for controlling fungal trunk pathogens that infect grapevine plants through the root system in nurseries. IMPORTANCE Grapevine trunk diseases are a major threat to the wine and grape industry worldwide. They cause a significant reduction in yields as well as in grape quality, and they can even cause plant death. Trunk diseases are caused by fungal pathogens that enter through pruning wounds and/or the

  10. Stress !!!

    NARCIS (Netherlands)

    Fledderus, M.

    2012-01-01

    Twee op de vijf UT-studenten hebben last van ernstige studiestress, zo erg zelfs dat het ze in hun privéleven belemmert. Die cijfers komen overeen met het landelijk beeld van stress onder studenten. Samen met 14 andere universiteits- en hogeschoolbladen enquêteerde UT Nieuws bijna 5500 studenten.

  11. Vegetative, productive and qualitative performance of grapevine "Cabernet Sauvignon" according to the use of winter cover crops

    OpenAIRE

    Bettoni, Jean Carlos; Feldberg, Nelson Pires; Nava, Gilberto; Veiga, Milton da; Wildner, Leandro do Prado

    2016-01-01

    ABSTRACT To study the effect of winter cover crops on the vegetative, productive and qualitative behavior of "Cabernet Sauvignon" grapevines, an experiment was conducted in two wine harvests by sowing different species of winter cover crops and additional treatments with manual weeding and mechanical mowing in an experimental vineyard located at the Experimental Station of Epagri in Videira, state of Santa Catarina, Brazil. Plant attributes of the grapevine, such as number of rods and weight ...

  12. Dehydrin from citrus, which confers in vitro dehydration and freezing protection activity, is constitutive and highly expressed in the flavedo of fruit but responsive to cold and water stress in leaves.

    Science.gov (United States)

    Sanchez-Ballesta, Maria Teresa; Rodrigo, Maria Jesus; Lafuente, Maria Teresa; Granell, Antonio; Zacarias, Lorenzo

    2004-04-07

    A cDNA encoding a dehydrin was isolated from the flavedo of the chilling-sensitive Fortune mandarin fruit (Citrus clementina Hort. Ex Tanaka x Citrus reticulata Blanco) and designed as Crcor15. The predicted CrCOR15 protein is a K2S member of a closely related dehydrin family from Citrus, since it contains two tandem repeats of the unusual Citrus K-segment and one S-segment (serine cluster) at an unusual C-terminal position. Crcor15 mRNA is consistently and highly expressed in the flavedo during fruit development and maturation. The relative abundance of Crcor15 mRNA in the flavedo was estimated to be higher than 1% of total RNA. The high mRNA level remained unchanged during fruit storage at chilling (2 degrees C) and nonchilling (12 degrees C) temperatures, and it was depressed by a conditioning treatment (3 days at 37 degrees C) that induced chilling tolerance. Therefore, the expression of Crcor15 appears not to be related to the acquisition of chilling tolerance in mandarin fruits. However, Crcor15, which was barely detected in unstressed mandarin leaves, was rapidly induced in response to both low temperature and water stress. COR15 protein was expressed in Escherichia coli, and the purified protein conferred in vitro protection against freezing and dehydration inactivation. The potential role of Citrus COR15 is discussed.

  13. Movement of Water from Old to Young Leaves in Three Species of Succulents

    Science.gov (United States)

    RABAS, A. R.; MARTIN, C. E.

    2003-01-01

    A hypothetical adaptive response of succulent plants to drought‐stress is the redistribution of water from old to young leaves. We examined the effects of possible movement of water from old to young leaves in three succulent species, Carpobrotus edulis (weak CAM‐inducible), Kalanchoe tubiflora (CAM) and Sedum spectabile (possibly a CAM‐cycler or CAM‐inducible). Old leaves were removed from plants, and photosynthesis, transpiration, f. wt : d. wt ratios, diurnal acid fluctuations, stomatal conductance and internal CO2 concentrations of the remaining young leaves were measured during drought‐stress. Comparison was made with plants retaining old leaves. There was no evidence that water moved from old to young leaves during drought‐stress as previously hypothesized. Only in drought‐stressed plants of K. tubiflora, were photosynthetic and transpiration rates of young leaves greater on shoots with old leaves removed compared with attached. There was a trend in all species for greater fluctuations in acidity in young leaves on shoots that lacked older leaves. For two of the three species studied, the f. wt : d. wt ratios of young leaves were greater under drought‐stress, on shoots with old leaves removed than with them attached. Absence of old leaves may reduce competition for water with young leaves, which consequently have higher water content and greater photosynthetic rates. PMID:12907468

  14. Historical introgression of the downy mildew resistance gene Rpv12 from the Asian species Vitis amurensis into grapevine varieties.

    Directory of Open Access Journals (Sweden)

    Silvia Venuti

    Full Text Available The Amur grape (Vitis amurensis Rupr. thrives naturally in cool climates of Northeast Asia. Resistance against the introduced pathogen Plasmopara viticola is common among wild ecotypes that were propagated from Manchuria into Chinese vineyards or collected by Soviet botanists in Siberia, and used for the introgression of resistance into wine grapes (Vitis vinifera L.. A QTL analysis revealed a dominant gene Rpv12 that explained 79% of the phenotypic variance for downy mildew resistance and was inherited independently of other resistance genes. A Mendelian component of resistance-a hypersensitive response in leaves challenged with P. viticola-was mapped in an interval of 0.2 cM containing an array of coiled-coil NB-LRR genes on chromosome 14. We sequenced 10-kb genic regions in the Rpv12(+ haplotype and identified polymorphisms in 12 varieties of V. vinifera using next-generation sequencing. The combination of two SNPs in single-copy genes flanking the NB-LRR cluster distinguished the resistant haplotype from all others found in 200 accessions of V. vinifera, V. amurensis, and V. amurensis x V. vinifera crosses. The Rpv12(+ haplotype is shared by 15 varieties, the most ancestral of which are the century-old 'Zarja severa' and 'Michurinets'. Before this knowledge, the chromosome segment around Rpv12(+ became introgressed, shortened, and pyramided with another downy mildew resistance gene from North American grapevines (Rpv3 only by phenotypic selection. Rpv12(+ has an additive effect with Rpv3(+ to protect vines against natural infections, and confers foliar resistance to strains that are virulent on Rpv3(+ plants.

  15. Stress.

    Science.gov (United States)

    Chambers, David W

    2008-01-01

    We all experience stress as a regular, and sometimes damaging and sometimes useful, part of our daily lives. In our normal ups and downs, we have our share of exhaustion, despondency, and outrage--matched with their corresponding positive moods. But burnout and workaholism are different. They are chronic, dysfunctional, self-reinforcing, life-shortening habits. Dentists, nurses, teachers, ministers, social workers, and entertainers are especially susceptible to burnout; not because they are hard-working professionals (they tend to be), but because they are caring perfectionists who share control for the success of what they do with others and perform under the scrutiny of their colleagues (they tend to). Workaholics are also trapped in self-sealing cycles, but the elements are ever-receding visions of control and using constant activity as a barrier against facing reality. This essay explores the symptoms, mechanisms, causes, and successful coping strategies for burnout and workaholism. It also takes a look at the general stress response on the physiological level and at some of the damage American society inflicts on itself.

  16. Falling for Clay Leaves.

    Science.gov (United States)

    Kernan, Christine

    2002-01-01

    Describes an art project that integrated science and art education. Explains that students create ceramic bowls by using real leaves. Discusses the process of creating the ceramic bowls, including how to glaze the bowls. Includes a list of materials. (CMK)

  17. Maternity Leave Policies

    Science.gov (United States)

    Strang, Lucy; Broeks, Miriam

    2017-01-01

    Abstract Over recent years many European Union countries have made changes to the design of the maternity leave provision. These policy developments reflect calls for greater gender equality in the workforce and more equal share of childcare responsibilities. However, while research shows that long period of leave can have negative effects on women's labour market attachment and career advancements, early return to work can be seen as a factor preventing exclusive breastfeeding, and therefore, potentially having negative health impacts for babies. Indeed, the World Health Organisation recommends exclusive breastfeeding up to 6 months of age to provide babies with the nutrition for healthy growth and brain development, protection from life-threatening ailments, obesity and non-communicable diseases such as asthma and diabetes. Therefore, labour market demands on women may be at odds with the health benefits for children gained by longer periods of maternity leave. The aim of this article is to examine the relationship between leave provision and health benefits for children. We examine maternity and parental leave provision across European countries and its potential impact on the breastfeeding of very young babies (up to 6-months of age). We also consider economic factors of potential extension of maternity leave provision to 6 months, such as costs to businesses, effects on the female labour market attachment, and wider consequences (benefits and costs) for individuals, families, employers and the wider society. PMID:28983432

  18. Metabolic changes associated with ozone injury of bean leaves

    Energy Technology Data Exchange (ETDEWEB)

    Craker, L.E.; Starbuck, J.S.

    1972-07-01

    Metabolic processes in primary leaves of bean plants (Phaseolus vulgaris) were altered by ozone stress. Decreases in levels of ribonucleic acid (RNA) and protein, and increases in ribonuclease (RNase) and free amine groups were associated with visible oxidant injury to the leaves. It appears that some air pollution injury to plants may result from changes in metabolic processes. 23 references, 5 figures, 2 tables.

  19. Gene expression profiling in susceptible interaction of grapevine with its fungal pathogen Eutypa lata: Extending MapMan ontology for grapevine

    Directory of Open Access Journals (Sweden)

    Usadel Björn

    2009-08-01

    Full Text Available Abstract Background Whole genome transcriptomics analysis is a very powerful approach because it gives an overview of the activity of genes in certain cells or tissue types. However, biological interpretation of such results can be rather tedious. MapMan is a software tool that displays large datasets (e.g. gene expression data onto diagrams of metabolic pathways or other processes and thus enables easier interpretation of results. The grapevine (Vitis vinifera genome sequence has recently become available bringing a new dimension into associated research. Two microarray platforms were designed based on the TIGR Gene Index database and used in several physiological studies. Results To enable easy and effective visualization of those and further experiments, annotation of Vitis vinifera Gene Index (VvGI version 5 to MapMan ontology was set up. Due to specificities of grape physiology, we have created new pictorial representations focusing on three selected pathways: carotenoid pathway, terpenoid pathway and phenylpropanoid pathway, the products of these pathways being important for wine aroma, flavour and colour, as well as plant defence against pathogens. This new tool was validated on Affymetrix microarrays data obtained during berry ripening and it allowed the discovery of new aspects in process regulation. We here also present results on transcriptional profiling of grape plantlets after exposal to the fungal pathogen Eutypa lata using Operon microarrays including visualization of results with MapMan. The data show that the genes induced in infected plants, encode pathogenesis related proteins and enzymes of the flavonoid metabolism, which are well known as being responsive to fungal infection. Conclusion The extension of MapMan ontology to grapevine together with the newly constructed pictorial representations for carotenoid, terpenoid and phenylpropanoid metabolism provide an alternative approach to the analysis of grapevine gene expression

  20. Electronic nose as an innovative tool for the diagnosis of grapevine crown gall

    Energy Technology Data Exchange (ETDEWEB)

    Blasioli, S., E-mail: sonia.blasioli@unibo.it [Dipartimento di Scienze e Tecnologie Agroambientali, Universita di Bologna, V.le Fanin, 44, 40127 Bologna (Italy); Biondi, E., E-mail: erbiondi@tin.it [Dipartimento di Scienze e Tecnologie Agroambientali, Universita di Bologna, V.le Fanin, 44, 40127 Bologna (Italy); Braschi, I., E-mail: ilaria.braschi@unibo.it [Dipartimento di Scienze e Tecnologie Agroambientali, Universita di Bologna, V.le Fanin, 44, 40127 Bologna (Italy); Mazzucchi, U., E-mail: umberto.mazzucchi@unibo.it [Dipartimento di Scienze e Tecnologie Agroambientali, Universita di Bologna, V.le Fanin, 44, 40127 Bologna (Italy); Bazzi, C., E-mail: carlo.bazzi@unibo.it [Dipartimento di Scienze e Tecnologie Agroambientali, Universita di Bologna, V.le Fanin, 44, 40127 Bologna (Italy); Gessa, C.E., E-mail: carloemanuele.gessa@unibo.it [Dipartimento di Scienze e Tecnologie Agroambientali, Universita di Bologna, V.le Fanin, 44, 40127 Bologna (Italy)

    2010-07-05

    For the first time, a portable electronic nose was used to discriminate between healthy and galled grapevines, experimentally inoculated with two tumourigenic strains of Agrobacterium vitis. The volatile profile of target cutting samples was analysed by headspace solid phase microextraction coupled with gas chromatography-mass spectrometry. Spectra from tumoured samples revealed the presence of styrene which is compatible with decarboxylation of cinnamic acid involved in secondary metabolism of plants. Principal Component Analysis confirmed the difference in volatile profiles of infected vines and their healthy controls. Linear Discriminant Analysis allowed the correct discrimination between healthy and galled grapevines (83.3%, cross-validation). Although a larger number of samples should be analysed to create a more robust model, our results give novel interesting clues to go further with research on the diagnostic potential of this innovative system associated with multi-dimensional chemometric techniques.

  1. Characterization of Campylocarpon pseudofasciculare associated with black foot of grapevine in southern Brazil

    Directory of Open Access Journals (Sweden)

    Ricardo Feliciano dos SANTOS

    2015-01-01

    Full Text Available The incidence and severity of black foot has been recently increasing in nurseries and vineyards of southern Brazil. The goal of the present study was to characterize Campylocarpon isolates associated with black foot of grapevines (Vitis spp. using multi-gene DNA analysis (internal transcribed spacers [ITS rDNA], β-tubulin and histone H3 and morphological characteristics, and to test the pathogenicity of the isolates in grapevine (Vitis labrusca cv. Bordô. The three DNA regions analyzed indicated that all the isolates belonged to Campylocarpon pseudofasciculare. Their morphology was similar to descriptions published for the species. Isolates exhibited umber- to chestnut-coloured colonies and macroconidia (38.0 × 7.0 μm predominantly with three septa. All the isolates inoculated in V. labrusca cv. Bordô caused typical symptoms of black foot. This is the first report of Campylocarpon pseudofasciculare in southern Brazil.

  2. The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13.

    Science.gov (United States)

    Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L

    1989-04-01

    The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.

  3. HONEY BEE CONTRIBUTION TO ‘BORDÔ’ GRAPEVINE FRUIT PRODUCTION IN SOUTHERN BRAZIL

    OpenAIRE

    MARTIGNAGO, MIRELI; MARTINS, RAFAEL; HARTER-MARQUES, BIRGIT

    2017-01-01

    ABSTRACT The production of fruits and seeds of many crops is increased when bees visit their flowers pollinating them. The aim of this study was to evaluate the effect of different pollination treatments on ‘Bordô’ grapevine (Vitis labrusca L.) fruit quantity and quality. Quantitative and qualitative fruit production parameters of plants visited by Apis mellifera L., manually self- and cross-pollinated plants and plants without pollination were analyzed and compared. Fruit production was hig...

  4. ROOTSTOCK-SCION INTERACTION: 1. EFFECT ON THE YIELD COMPONENTS OF CABERNET SAUVIGNON GRAPEVINE

    Directory of Open Access Journals (Sweden)

    ALBERTO MIELE

    Full Text Available ABSTRACT The interaction between rootstock, scion and environment can induce different responses to the grapevine physiology. Thus, the aim of this study was to determine the rootstock effect on the yield components of Cabernet Sauvignon (CS grapevine grown in the Serra Gaúcha viticultural region. The experimental design was completely randomized blocks, with 15 treatments, three replicates and ten vines per plot. The results show that all variables evaluated were significantly affected by the year and the rootstock. The CS/Solferino was among other combinations influenced by the year and had higher significant yield/ vine. Indeed, it was higher than that CS/Rupestris du Lot, CS/101-14 Mgt., CS/3309 C, CS/5BB K, CS/161- 49 C, CS/1103 P. and CS/Isabel. The number of clusters/bud, per burst bud and per vine and the weight of clusters were affected by the rootstock as well. Pruning weight/vine, yield/pruning weight, leaf area/vine, leaf area index and leaf area/fresh fruit weight are variables related to the physiology of grapevine which were also affected by the rootstock. In general, rootstocks had adapted well to the environment where the experiment was carried out, giving vigor and high yield to Cabernet Sauvignon grapevine, which means that they may be used by grape growers in this region. However, the choice of the right rootstock depends on various aspects, such as those related to the soil characteristics, climate conditions, grape varieties, and even clones, and production purposes.

  5. Determination of the activity signature of key carbohydrate metabolism enzymes in phenolic-rich grapevine tissues

    DEFF Research Database (Denmark)

    Covington, Elizabeth Dunn; Roitsch, Thomas Georg; Dermastia, Marina

    2016-01-01

    Physiological studies in plants often require enzyme extraction from tissues containing high concentrations of phenols and polyphenols. Unless removed or neutralized, such compounds may hinder extraction, inactivate enzymes, and interfere with enzyme detection. The following protocol for activity...... assays for enzymes of primary carbohydrate metabolism, while based on our recently published one for quantitative measurement of activities using coupled spectrophotometric assays in a 96-well format, is tailored to the complexities of phenolic- and anthocyanin-rich extracts from grapevine leaf...

  6. Poly(lactic-co-glycolic) acid nanoparticles uptake by Vitis vinifera and grapevine-pathogenic fungi

    International Nuclear Information System (INIS)

    Valletta, Alessio; Chronopoulou, Laura; Palocci, Cleofe; Baldan, Barbara; Donati, Livia; Pasqua, Gabriella

    2014-01-01

    Poly(lactic-co-glycolic) acid (PLGA)-based NPs are currently considered among the most promising drug carriers, nevertheless their use in plants has never been investigated. In this work, for the first time, we demonstrated the ability of PLGA NPs to cross the plant cell wall and membrane of Vitis vinifera cell cultures and grapevine-pathogenic fungi. By means of fluorescence microscopy, we established that PLGA NPs can enter in grapevine leaf tissues through stomata openings and that they can be absorbed by the roots and transported to the shoot through vascular tissues. TEM analysis on cultured cells showed that NPs ≤ 50 nm could enter cells, while bigger ones remained attached to the cell wall. Viability tests demonstrated that PLGA NPs were not cytotoxic for V. vinifera-cultured cells. The cellular uptake of PLGA NPs by some important grapevine-pathogenic fungi has also been observed, thus suggesting that PLGA NPs could be used to deliver antifungal compounds within fungal cells. Overall the results reported suggest that such NPs may play a key role in future developments of agrobiotechnologies, as it is currently happening in biomedicine

  7. Poly(lactic-co-glycolic) acid nanoparticles uptake by Vitis vinifera and grapevine-pathogenic fungi

    Energy Technology Data Exchange (ETDEWEB)

    Valletta, Alessio [“Sapienza” University of Rome, Department of Environmental Biology (Italy); Chronopoulou, Laura; Palocci, Cleofe, E-mail: cleofe.palocci@uniroma1.it [“Sapienza” University of Rome, Department of Chemistry (Italy); Baldan, Barbara [University of Padua, Department of Biology (Italy); Donati, Livia; Pasqua, Gabriella [“Sapienza” University of Rome, Department of Environmental Biology (Italy)

    2014-12-15

    Poly(lactic-co-glycolic) acid (PLGA)-based NPs are currently considered among the most promising drug carriers, nevertheless their use in plants has never been investigated. In this work, for the first time, we demonstrated the ability of PLGA NPs to cross the plant cell wall and membrane of Vitis vinifera cell cultures and grapevine-pathogenic fungi. By means of fluorescence microscopy, we established that PLGA NPs can enter in grapevine leaf tissues through stomata openings and that they can be absorbed by the roots and transported to the shoot through vascular tissues. TEM analysis on cultured cells showed that NPs ≤ 50 nm could enter cells, while bigger ones remained attached to the cell wall. Viability tests demonstrated that PLGA NPs were not cytotoxic for V. vinifera-cultured cells. The cellular uptake of PLGA NPs by some important grapevine-pathogenic fungi has also been observed, thus suggesting that PLGA NPs could be used to deliver antifungal compounds within fungal cells. Overall the results reported suggest that such NPs may play a key role in future developments of agrobiotechnologies, as it is currently happening in biomedicine.

  8. Association of RGA-SSCP markers with resistance to downy mildew and anthracnose in grapevines.

    Science.gov (United States)

    Tantasawat, P A; Poolsawat, O; Prajongjai, T; Chaowiset, W; Tharapreuksapong, A

    2012-07-02

    Downy mildew (Plasmopara viticola) and anthracnose (Sphaceloma ampelinum) are two major diseases that severely affect most grapevine (Vitis vinifera) cultivars grown commercially in Thailand. Progress of conventional breeding programs of grapevine for improved resistance to these diseases can be speeded up by selection of molecular markers associated with resistance traits. We evaluated the association between 13 resistance gene analog (RGA)-single-strand conformation polymorphism (SSCP) markers with resistance to downy mildew and anthracnose in 71 segregating progenies of seven cross combinations between susceptible cultivars and resistant lines. F(1) hybrids from each cross were assessed for resistance to downy mildew and anthracnose (isolates Nk4-1 and Rc2-1) under laboratory conditions. Association of resistance traits with RGA-SSCP markers was evaluated using simple linear regression analysis. Three RGA-SSCP markers were found to be significantly correlated with anthracnose resistance, whereas significant correlation with downy mildew resistance was observed for only one RGA-SSCP marker. These results demonstrate the usefulness of RGA-SSCP markers. Four candidate markers with significant associations to resistance to these two major diseases of grapevine were identified. However, these putative associations between markers and resistance need to be verified with larger segregating populations before they can be used for marker-assisted selection.

  9. Isolation and pathogenicity of Xylella fastidiosa from grapevine and almond in Iran

    Directory of Open Access Journals (Sweden)

    Naser AMANIFAR

    2014-09-01

    Full Text Available Symptoms similar to those of Pierce’s disease (PD of grapevine and leaf scorch of almond were observed in vineyards and almond orchards in several provinces of Iran. Grafting of scions from symptomatic almond trees onto seedlings of a local almond (cv. Mamaee under greenhouse conditions resulted in the transmission of the leaf scorch agent. A number of symptomatic samples from orchard and greenhouse plants were positive for presence of Xylella fastidiosa when tested by DAS-ELISA and PCR with X. fastidiosa specific antibodies and primers. A Gram-negative bacterium similar to X. fastidiosa was isolated on ‘periwinkle wilt’ (PW medium. Selected isolates induced symptoms similar to those caused by X. fastidiosa when inoculated on Nicotiana tabacum, seedlings of almond and grapevine under greenhouse conditions. DAS-ELISA and PCR confirmed the identity of the isolated bacteria. On the basis of disease symptoms, graft transmission, isolation on specific X. fastidiosa culture medium, pathogenicity tests and positive reactions in DAS-ELISA and PCR, X. fastidiosa is associated with almond leaf scorch and Pierce’s disease in grapevine in Iran. This is the first report on the presence of X. fastidiosa in the Middle East and western Asia.

  10. Climate vs grapevine pests and diseases worldwide: the first results of a global survey

    Directory of Open Access Journals (Sweden)

    Benjamin Bois

    2017-05-01

    Methods and results: Based on the answer of respondent about the main reported diseases/pests in their region, a severity index was calculated. Each region was geolocalised and data were compared to the WorldClim gridded climate database to document the range of climate conditions (growing season temperature and rainfall associated to the main diseases/pests. The potential climatic-induced changes of grapevine disease and pest geography by 2050 are assessed using agro-climate projections from the ARPEGE CNRM model, using the RCP 4.5 scenario. The preliminary results allow to determine the distribution of diseases as function of agroclimatic indicators. Conclusion: While the distribution of diseases differs according to the region of the world, the current analysis suggests that mildews remain the major phytosanitary threat in most of the regions. Powdery mildew, trunk diseases and viruses were reported in extremely diverse climatic conditions, including intermediate and wet regions.  Significance and impact of the study: This paper present an original methodology to address the relationship between grapevine disease and pest occurrences and climate. Such documentation is scarce in the current literature. Further analysis is currently being performed, including additional survey answers, climate indices and supplementary data collected (spatial extension, frequency of treatments… to better depict the challenges of grapevine phytosanitary management in a changing climate.

  11. Comparative response of six grapevine rootstocks to inoculation with arbuscular mycorrhizal fungi based on root traits

    Science.gov (United States)

    Pogiatzis, Antreas; Bowen, Pat; Hart, Miranda; Holland, Taylor; Klironomos, John

    2017-04-01

    Arbuscular mycorrhizal (AM) symbiosis has been proven to be essential in grapevines, sustaining plant growth especially under abiotic and biotic stressors. The mycorrhizal growth response of young grapevines varies among rootstock cultivars and the underlying mechanisms involved in this variation are unknown. We predicted that this variation in mycorrhizal response may be explained by differences in root traits among rootstocks. We analyzed the entire root system of six greenhouse-grown rootstocks (Salt Creek, 3309 Couderc, Riparia Gloire, 101-14 Millardet et de Grasset, Swarzmann, Teleki 5C), with and without AM fungal inoculation (Rhizophagus irregularis) and characterized their morphological and architectural responses. Twenty weeks after the inoculation, aboveground growth was enhanced by AM colonization. The rootstock varieties were distinctly different in their response to AM fungi, with Salt Creek receiving the highest growth benefit, while Schwarzmann and 5C Teleki receiving the lowest. Plant responsiveness to AM fungi was negatively correlated with branching intensity (fine roots per root length). Furthermore, there was evidence that mycorrhizas can influence the expression of root traits, inducing a higher branching intensity and a lower root to shoot ratio. The results of this study will help to elucidate how interactions between grapevine rootstocks and AM fungi may benefit the establishment of new vineyards.

  12. Radicinin from Cochliobolus sp. inhibits Xylella fastidiosa, the causal agent of Pierce's Disease of grapevine.

    Science.gov (United States)

    Aldrich, Thomas J; Rolshausen, Philippe E; Roper, M Caroline; Reader, Jordan M; Steinhaus, Matthew J; Rapicavoli, Jeannette; Vosburg, David A; Maloney, Katherine N

    2015-08-01

    The fastidious phytopathogenic bacterium, Xylella fastidiosa, poses a substantial threat to many economically important crops, causing devastating diseases including Pierce's Disease of grapevine. Grapevines (Vitis vinifera L.) planted in an area under Pierce's Disease pressure often display differences in disease severity and symptom expression, with apparently healthy vines growing alongside the dying ones, despite the fact that all the vines are genetic clones of one another. Under the hypothesis that endophytic microbes might be responsible for this non-genetic resistance to X. fastidiosa, endophytic fungi were isolated from vineyard cvs. 'Chardonnay' and 'Cabernet Sauvignon' grown under high Pierce's Disease pressure. A Cochliobolus sp. isolated from a Cabernet Sauvignon grapevine inhibited the growth of X. fastidiosa in vitro. Bioassay-guided isolation of an organic extract of Cochliobolus sp. yielded the natural product radicinin as the major active compound. Radicinin also inhibited proteases isolated from the culture supernatant of X. fastidiosa. In order to assess structure-activity relationships, three semi-synthetic derivatives of radicinin were prepared and tested for activity against X. fastidiosa in vitro. Assay results of these derivatives are consistent with enzyme inactivation by conjugate addition to carbon-10 of radicinin, as proposed previously. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Evaluation of pollen dispersal and cross pollination using transgenic grapevine plants.

    Science.gov (United States)

    Harst, Margit; Cobanov, Beatrix-Axinja; Hausmann, Ludger; Eibach, Rudolf; Töpfer, Reinhard

    2009-01-01

    Public debate about the possible risk of genetically modified plants often concerns putative effects of pollen dispersal and out-crossing into conventional fields in the neighborhood of transgenic plants. Though Vitis vinifera (grapevine) is generally considered to be self-pollinating, it cannot be excluded that vertical gene transfer might occur. For monitoring pollen flow and out-crossing events, transgenic plants of Vitis vinifera cv. 'Dornfelder' harboring the gus-int gene were planted in the center of a field experiment in Southwest Germany in 1999. The rate of pollen dispersal was determined by pollen traps placed at radial distances of 5-150 m from the pollen-donor plants, at 1.00 and 1.80 m above ground. Transgenic pollen was evaluated by GUS staining, and could clearly be distinguished from pollen originating from non-transgenic grapevine plants. Transgenic pollen was observed up to 150 m from the pollen donors. The rate of out-crossing was determined by sampling seeds of selected grapevines at a distance of 10 m to the pollen source, and of a sector at 20 m distance, respectively, followed by GUS analysis of seedlings. The average cross-pollination rate during the experiment (2002-2004) was 2.7% at a distance of 20 m. The results of this first pilot study present a good base for further assessment under the conditions of normal viticulture practice.

  14. Sesquiterpene volatile organic compounds (VOCs are markers of elicitation by sulfated laminarine in grapevine

    Directory of Open Access Journals (Sweden)

    Malik eChalal

    2015-05-01

    Full Text Available Inducing resistance in plants by application of elicitors of defense reactions is an attractive plant protection strategy, especially for grapevine (Vitis vinifera which is susceptible to severe fungal diseases. Though induced resistance (IR can be successful in controlled conditions, under outdoor conditions IR is in most cases not effective enough for practical disease control. Progress in the application of IR requires a better understanding of grapevine defense mechanisms and the ability to monitor defense markers in order to identify factors (physiological, environmental… that can impact IR in the vineyard.Volatile organic compounds (VOCs are well-known plant defenses compounds that have only received little or no attention in the case of grape-pathogen interactions to date. This prompted us to investigate whether an elicitor, the sulfated laminarin (PS3, actually induces the production of VOCs in grapevine. Online analysis (PTR-QMS of VOC emissions in dynamic cuvettes and passive sampling in gas tight bags with solid phase micro extraction (SPME-GC-MS under greenhouse conditions showed that PS3 elicited emission of VOCs. Some of them (as (E,E-α-farnesene might be good candidates as biomarkers of elicitor-IR whereas methyl salicylate appears to be rather a biomarker of downy mildew infection. A negative correlation between VOC emission and disease severity suggests a positive role of VOCs in grape defense against diseases.

  15. Phylogeny of geminivirus coat protein sequences and digital PCR aid in identifying Spissistilus festinus (Say) as a vector of Grapevine red blotch-associated virus

    Science.gov (United States)

    Grapevine red blotch-associated virus (GRBaV) is a newly identified virus of grapevines, and a putative member of a new genus within the family Geminiviridae. This virus is associated with red blotch disease that was first reported in California in 2008. It affects the profitability of vineyards by ...

  16. TRAVEL AND HOME LEAVE

    CERN Multimedia

    Human Resources Division

    2002-01-01

    Administrative procedures for : Travel to the home station and home leave (hl) Additional travel to the home station (at) Travel to the home station and home leave for family reasons (hlf) As part of the process of simplifying administrative procedures, HR and AS Divisions have devised a new, virtually automatic procedure for payment of travel expenses to the home station. The changes are aimed at rationalising administrative procedures and not at reducing benefits. The conditions of eligibility are unchanged. The new procedure, which will be operational with effect from 1st June 2002, will greatly simplify the administrative processing of claims for travel expenses and the recording of home leaves. Currently, requests for payment are introduced manually into the Advances and Claims system (AVCL) by divisional secretariats. All travel to the home station starting prior to 1st June 2002 will be processed according to the existing system whereas that starting on 1st June and after will be processed accordi...

  17. Genome-wide identification of WRKY family genes and their response to cold stress in Vitis vinifera

    Science.gov (United States)

    WRKY transcription factors are one of the largest families of transcriptional regulators in plants. WRKY genes are not only found to play significant roles in biotic and abiotic stress response, but also regulate growth and development. Grapevine (Vitis vinifera) production is largely limited by str...

  18. GRAPEVINE FE-CHLOROSIS ON PODUNAVLJE VINEGROWING AREA

    OpenAIRE

    Mato Drenjančević

    2012-01-01

    The characteristic of Podunavlje vinegrowing area in the far east of the Republic of Croatia is carbonate soil with loess as a parent substrate. Chlorosis is common on this soil and it is often caused by excess concentrations of calcium and magnesium and deficiency of iron and zinc. It can also be resulted by inactivation, if it is transformed so that a plant can not use it. The lack of iron in grape vine is resulted in leaf vein, first in younger leaves where the venation remains green, and ...

  19. How Streptomyces anulatus Primes Grapevine Defenses to Cope with Gray Mold: A Study of the Early Responses of Cell Suspensions

    Directory of Open Access Journals (Sweden)

    Parul Vatsa-Portugal

    2017-06-01

    Full Text Available Gray mold, caused by Botrytis cinerea, is one of the most destructive diseases of grapevine and is controlled with an intense application of fungicides. As alternatives to chemicals, beneficial microbes may promote plant health by stimulating the plant’s immune system. An actinomycete, Streptomyces anulatus S37, has been screened from the rhizosphere microbiome of healthy Vitis vinifera on the basis of its ability to promote grapevine growth and to induce resistance against various phytopathogens, including B. cinerea. However, molecular mechanisms involved locally after direct perception of these bacteria by plant cells still remain unknown. This study focuses on local defense events induced in grapevine cells during interactions with S. anulatus S37 before and after pathogen challenge. We demonstrated that S. anulatus S37 induced early responses including oxidative burst, extracellular alkalinization, activation of protein kinases, induction of defense gene expression and phytoalexin accumulation, but not the programmed cell death. Interestingly, upon challenge with the B. cinerea, the S. anulatus S37 primed grapevine cells for enhanced defense reactions with a decline in cell death. In the presence of the EGTA, a calcium channel inhibitor, the induced oxidative burst, and the protein kinase activity were inhibited, but not the extracellular alkalinization, suggesting that Ca2+ may also contribute upstream to the induced defenses. Moreover, desensitization assays using extracellular pH showed that once increased by S. anulatus S37, cells became refractory to further stimulation by B. cinerea, suggesting that grapevine cells perceive distinctly beneficial and pathogenic microbes.

  20. Does Leave Work?

    NARCIS (Netherlands)

    Heleen van Luijn; Saskia Keuzenkamp

    2004-01-01

    More and more people have to combine work and care responsibilities, and work part-time or use daycare and after-school care facilities to help them do so. The Work and Care Act, which came into force on 1 December 2001, combined all the existing schemes - such as parental and maternity leave -

  1. Maternity Leave in Taiwan

    Science.gov (United States)

    Feng, Joyce Yen; Han, Wen-Jui

    2010-01-01

    Using the first nationally representative birth cohort study in Taiwan, this paper examines the role that maternity leave policy in Taiwan plays in the timing of mothers returning to work after giving birth, as well as the extent to which this timing is linked to the amount of time mothers spend with their children and their use of breast milk…

  2. REMINDER: Saved Leave Scheme (SLS)

    CERN Multimedia

    2003-01-01

    Transfer of leave to saved leave accounts Under the provisions of the voluntary saved leave scheme (SLS), a maximum total of 10 days'* annual and compensatory leave (excluding saved leave accumulated in accordance with the provisions of Administrative Circular No 22B) can be transferred to the saved leave account at the end of the leave year (30 September). We remind you that unused leave of all those taking part in the saved leave scheme at the closure of the leave year accounts is transferred automatically to the saved leave account on that date. Therefore, staff members have no administrative steps to take. In addition, the transfer, which eliminates the risk of omitting to request leave transfers and rules out calculation errors in transfer requests, will be clearly shown in the list of leave transactions that can be consulted in EDH from October 2003 onwards. Furthermore, this automatic leave transfer optimizes staff members' chances of benefiting from a saved leave bonus provided that they ar...

  3. Protective effect of the leaves of Vitex negundo against ethanol ...

    African Journals Online (AJOL)

    The present study investigated the effect of the various fractions of hydromethanolic extract of the leaves of Vitex negundo (Verbenaceae) against ethanol-induced cerebral oxidative stress in rats. Cerebral oxidative stress was induced by the administration of 20% ethanol (5 ml/100g bw) for a period of 28 days.

  4. Abscisic acid biosynthesis in leaves and roots of Xanthium strumarium

    Energy Technology Data Exchange (ETDEWEB)

    Creelman, R.A.; Gage, D.A.; Stults, J.T.; Zeevaart, J.A.D.

    1987-11-01

    Research on the biosynthesis of abscisic acid (ABA) has focused primarily on two pathways: (a) the direct pathway from farnesyl pyrophosphate, and (b) the indirect pathway involving a carotenoid precursor. The authors have investigated which biosynthetic pathway is operating in turgid and stressed Xanthium leaves, and in stressed Xanthium roots using long-term incubations in /sup 18/O/sub 2/. It was found that in stressed leaves three atoms of /sup 18/O from /sup 18/O/sub 2/ are incorporated into the ABA molecule, and that the amount of /sup 18/O incorporated increases with time. One /sup 18/O atom is incorporated rapidly into the carboxyl group of ABA, whereas the other two atoms are very slowly incorporated into the ring oxygens. The fourth oxygen atom in the carboxyl group of ABA is derived from water. ABA from stressed roots of Xanthium incubated in /sup 18/O/sub 2/ shows a labeling pattern similar to that of ABA in stressed leaves, but with incorporation of more /sup 18/O into the tertiary hydroxyl group at C-1' after 6 and 12 hours than found in ABA from stressed leaves. It is proposed that the precursors to stress-induced ABA are xanthophylls, and that a xanthophyll lacking an oxygen function at C-6 plays a crucial role in ABA biosynthesis in Xanthium roots. In turgid Xanthium leaves, /sup 18/O is incorporated into ABA to a much lesser extent that it is in stressed leaves, whereas exogenously applied /sup 14/C-ABA is completely catabolized within 48 hours. This suggests that ABA in turgid leaves is either (a) made via a biosynthetic pathway which is different from the one in stressed leaves, or (b) has a half-life on the order of days as compared with a half-life of 15.5 hours in water-stressed Xanthium leaves. Phaseic acid showed a labeling pattern similar to that of ABA, but with an additional /sup 18/O incorporated during 8'-hydroxylation of ABA to phaseic acid.

  5. Root Proteomic Analysis of Grapevine Rootstocks Inoculated with Rhizophagus irregularis and Fusarium oxysporum f. sp. herbemontis

    Directory of Open Access Journals (Sweden)

    Elisa Vilvert

    Full Text Available ABSTRACT Grapevine decline and death caused by the pathogenic fungus Fusarium oxysporum f. sp. herbemontis is among the main phytosanitary problem for viticulture in southern Brazil. The eradication of infected plants is presently the most common procedure for disease control in vineyards. Inoculation with arbuscular mycorrhizal fungi is an option to reduce or neutralize the negative impacts of soil pathogenic microorganisms, but the mechanisms of plant response involved in this process are not yet completely elucidated. In order to better understand these mechanisms, an experiment was carried out to identify proteins related to plant defence induced by the mycorrhizal fungus after infection with the pathogenic fungus. We used the grapevine rootstocks SO4 and R110 (susceptible and resistant to the pathogenic fungus, respectively inoculated or not inoculated with the mycorrhizal fungus Rhizophagus irregularis, and inoculated or not inoculated with Fusarium oxysporum f. sp. herbemontis. Growth of the rootstocks’ shoot and root and presence of pathogenic symptoms were evaluated. The protein profiles of roots were characterized by two-dimensional electrophoresis and proteins were identified using mass spectrometry. The grapevine rootstocks inoculated with R. irregularis had higher biomass production and lower level of pathogenic symptoms. The R110 rootstock differentially accumulated 73 proteins, while SO4 accumulated 59 proteins. Nine plant-defence proteins were expressed by SO4 rootstock, and six were expressed by R110 rootstock plants. The results confirm the effect of mycorrhizal fungi in plant growth promotion and their potential for biological control against soil pathogenic fungus. Protein expression is dependent on rootstock characteristics and on the combination of plant material with the fungi.

  6. New insights into thermal growing conditions of Portuguese grapevine varieties under changing climates

    Science.gov (United States)

    Santos, João A.; Costa, Ricardo; Fraga, Helder

    2018-03-01

    New decision support tools for Portuguese viticulture are urging under a climate change context. In the present study, heat and chilling accumulation conditions of a collection of 44 grapevine cultivars currently grown in Portugal are assessed at very high spatial resolution ( 1 km) and for 1981-2015. Two bioclimatic indices that incorporate non-linear plant-temperature relationships are selected for this purpose: growing degree hours—GDH (February-October) and chilling portions—CP (October-February). The current thermal growing conditions of each variety are examined and three clusters of grapevine cultivars are identified based on their GDH medians, thus assembling varieties with close heat accumulation requirements and providing more physiologically consistent information when compared to previous studies, as non-linear plant-temperature relationships are herein taken into account. These new clusters are also a complement to previous bioclimatic zoning. Ensemble mean projections under two anthropogenic-driven scenarios (RCP4.5 and RCP8.5, 2041-2070), from four EURO-CORDEX simulations, reveal a widespread increase of GDH and decrease of CP, but with spatial heterogeneities. The spatial variability of these indices throughout Portugal is projected to decrease (strongest increases of GDH in the coolest regions of the northeast) and to increase (strongest decreases of CP in the warmest regions of the south and west), respectively. The typical heat accumulation conditions of each cluster are projected to gradually shift north-eastwards and to higher-elevation areas, whereas insufficient chilling may represent a new challenge in warmer future climates. An unprecedented level of detail for a large collection of grapevine varieties in Portugal is provided, thus promoting a better planning of climate change adaptation measures.

  7. Effects of hot water treatments on dormant grapevine propagation materials used for grafted vine production

    Directory of Open Access Journals (Sweden)

    Soltekin Oguzhan

    2017-01-01

    Full Text Available Agrobacterium vitis is responsible for the crown gall disease of grapevine which breaks the grapevine trunk vascular system. Nutrient flow is prevented by crown gall and it leads to weak growth and death of the plants. It can be destructive disease often encountered in vineyards and it can be spread in cuttings for propagation. Thermotherapy treatment is an alternative method for eradicating A. vitis from grapevine cuttings but effects of thermotherapy treatments on dormant vine tissue, bud vitality, rooting and shooting of the propagation materials are not yet fully understood. In this research, it is aimed to determine the effects of thermotherapy treatment (Hot water treatment on callus formation (at the basal part and grafting point, grafted vine quality (shoot length, shoot width, root number, shooting and rooting development, fresh and dry weight of shoots and roots and final take in the grafted vine production. Experiment was conducted in the nursery of Manisa Viticultural Research Institute. Rootstocks (Kober 5BB, Couderc 1613 and 41B and scions (Sultan 7 and Manisa sultanı were hot-water treated at 50°C for 30 minutes which is the most common technique against Agrobacterium vitis. After thermotherapy treatment, all rootstocks were grafted with Sultan 7 and Manisa sultanıvarieties. They were kept for 22 days in callusing room for callus development and then they were planted in polyethlyene bags for rooting. At the end of the study, significant treatment x rootstock interaction were observed for the final take of Sultan 7 variety. Thermotherapy treated of 1613C/Sultan 7 combinations had more final take than the control (untreated group. For instance, hot water treated cuttings of 1613C/Sultan 7 combinations had 75% final take while the control group had the 70%. Also there were not observed any adverse effects of HWT on bud and tissue vitality.

  8. Evaluation of biocontrol agents for grapevine pruning wound protection against trunk pathogen infection.

    Directory of Open Access Journals (Sweden)

    Charl KOTZE

    2011-12-01

    Full Text Available Trunk diseases of grapevine are caused by numerous pathogens, including Eutypa lata, Phaeomoniella chlamydospora, and species of Botryosphaeriaceae (incl. Botryosphaeria and aggregate genera, Phomopsis and Phaeoacremonium. Since infections occur mainly through pruning wounds, that have been shown by previous research to stay susceptible for up to 16 weeks after pruning, long-term pruning wound protection is required for prevention of infection. This study evaluated several biocontrol agents against a range of trunk disease pathogens in dual plate laboratory trials to determine macroscopic and microscopic interactions. The biocontrol agents had a substantial effect on all the pathogens, with a wide range of macroscopic and microscopic interactions observed. The best performing biocontrol agents were tested in two field trials. Fresh pruning wounds were treated with benomyl, Trichoderma products (Biotricho®, Vinevax® and ECO 77® and isolates (USPP-T1 and -T2, identified as T. atroviride and Bacillus subtilis. Seven days after treatment the pruning wounds were inoculated by spraying with spore suspensions of Neofusicoccum australe, N. parvum, Diplodia seriata, Lasiodiplodia theobromae, Eutypa lata, Phaeomoniella chlamydospora or Phomopsis viticola. Eight months after inoculation, the treatments were evaluated by isolation onto potato dextrose agar. The efficacy of the biocontrol agents was in most cases similar or superior to that observed for benomyl. Isolate USPP-T1, in particular, was very effective, reducing incidence of Ph. viticola, E. lata, Pa. chlamydospora, N. australe, N. parvum, D. seriata and L. theobromae by 69, 76, 77, 78, 80, 85 and 92%, respectively. This is the first report of biological protection of grapevine pruning wounds against this group of grapevine trunk disease pathogens.

  9. Ectopic expression of Arabidopsis broad-spectrum resistance gene RPW8.2 improves the resistance to powdery mildew in grapevine (Vitis vinifera).

    Science.gov (United States)

    Hu, Yang; Li, Yajuan; Hou, Fengjuan; Wan, Dongyan; Cheng, Yuan; Han, Yongtao; Gao, Yurong; Liu, Jie; Guo, Ye; Xiao, Shunyuan; Wang, Yuejin; Wen, Ying-Qiang

    2018-02-01

    Powdery mildew is the most economically important disease of cultivated grapevines worldwide. Here, we report that the Arabidopsis broad-spectrum disease resistance gene RPW8.2 could improve resistance to powdery mildew in Vitis vinifera cv. Thompson Seedless. The RPW8.2-YFP fusion gene was stably expressed in grapevines from either the constitutive 35S promoter or the native promoter (NP) of RPW8.2. The grapevine shoots and plantlets transgenic for 35S::RPW8.2-YFP showed reduced rooting and reduced growth at later development stages in the absence of any pathogens. Infection tests with an adapted grapevine powdery mildew isolate En NAFU1 showed that hyphal growth and sporulation were significantly restricted in transgenic grapevines expressing either of the two constructs. The resistance appeared to be attributable to the ectopic expression of RPW8.2, and associated with the enhanced encasement of the haustorial complex (EHC) and onsite accumulation of H 2 O 2 . In addition, the RPW8.2-YFP fusion protein showed focal accumulation around the fungal penetration sites. Transcriptome analysis revealed that ectopic expression of RPW8.2 in grapevines not only significantly enhanced salicylic acid-dependent defense signaling, but also altered expression of other phytohormone-associated genes. Taken together, our results indicate that RPW8.2 could be utilized as a transgene for improving resistance against powdery mildew in grapevines. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Weed control and cover crop management affect mycorrhizal colonization of grapevine roots and arbuscular mycorrhizal fungal spore populations in a California vineyard.

    Science.gov (United States)

    Baumgartner, Kendra; Smith, Richard F; Bettiga, Larry

    2005-03-01

    Arbuscular mycorrhizal (AM) fungi naturally colonize grapevines in California vineyards. Weed control and cover cropping may affect AM fungi directly, through destruction of extraradical hyphae by soil disruption, or indirectly, through effects on populations of mycorrhizal weeds and cover crops. We examined the effects of weed control (cultivation, post-emergence herbicides, pre-emergence herbicides) and cover crops (Secale cereale cv. Merced rye, x Triticosecale cv.Trios 102) on AM fungi in a Central Coast vineyard. Seasonal changes in grapevine mycorrhizal colonization differed among weed control treatments, but did not correspond with seasonal changes in total weed frequency. Differences in grapevine colonization among weed control treatments may be due to differences in mycorrhizal status and/or AM fungal species composition among dominant weed species. Cover crops had no effect on grapevine mycorrhizal colonization, despite higher spring spore populations in cover cropped middles compared to bare middles. Cover crops were mycorrhizal and shared four AM fungal species (Glomus aggregatum, G. etunicatum, G. mosseae, G. scintillans) in common with grapevines. Lack of contact between grapevine roots and cover crop roots may have prevented grapevines from accessing higher spore populations in the middles.

  11. Detection of a divergent variant of grapevine virus F by next-generation sequencing.

    Science.gov (United States)

    Molenaar, Nicholas; Burger, Johan T; Maree, Hans J

    2015-08-01

    The complete genome sequence of a South African isolate of grapevine virus F (GVF) is presented. It was first detected by metagenomic next-generation sequencing of field samples and validated through direct Sanger sequencing. The genome sequence of GVF isolate V5 consists of 7539 nucleotides and contains a poly(A) tail. It has a typical vitivirus genome arrangement that comprises five open reading frames (ORFs), which share only 88.96 % nucleotide sequence identity with the existing complete GVF genome sequence (JX105428).

  12. Proteomic analysis of shoot tissue during photoperiod induced growth cessation in V. riparia Michx. grapevines

    Directory of Open Access Journals (Sweden)

    Victor Kim J

    2010-08-01

    Full Text Available Abstract Background Growth cessation, cold acclimation and dormancy induction in grapevines and other woody perennial plants native to temperate continental climates is frequently triggered by short photoperiods. The early induction of these processes by photoperiod promotes winter survival of grapevines in cold temperate zones. Examining the molecular processes, in particular the proteomic changes in the shoot, will provide greater insight into the signaling cascade that initiates growth cessation and dormancy induction. To begin understanding transduction of the photoperiod signal, Vitis riparia Michx. grapevines that had grown for 35 days in long photoperiod (long day, LD, 15 h were subjected to either a continued LD or a short photoperiod (short day, SD, 13 h treatment. Shoot tips (4-node shoot terminals were collected from each treatment at 7 and 28 days of LD and SD for proteomic analysis via two-dimensional (2D gel electrophoresis. Results Protein profiles were characterized in V. riparia shoot tips during active growth or SD induced growth cessation to examine physiological alterations in response to differential photoperiod treatments. A total of 1054 protein spots were present on the 2D gels. Among the 1054 proteins, 216 showed differential abundance between LD and SD (≥ two-fold ratio, p-value ≤ 0.05. After 7 days, 39 protein spots were more abundant in LD and 30 were more abundant in SD. After 28 days, 93 protein spots were more abundant in LD and 54 were more abundant in SD. MS/MS spectrometry was performed to determine the functions of the differentially abundant proteins. Conclusions The proteomics analysis uncovered a portion of the signal transduction involved in V. riparia grapevine growth cessation and dormancy induction. Different enzymes of the Calvin-Benson cycle and glutamate synthetase isoforms were more abundant either in LD or SD treatments. In LD tissues the significantly differentially more abundant proteins

  13. Arsenic and trace elements in soil, water, grapevine and onion in Jáchal, Argentina.

    Science.gov (United States)

    Funes Pinter, Iván; Salomon, M Victoria; Gil, Raúl; Mastrantonio, Leandro; Bottini, Rubén; Piccoli, Patricia

    2018-02-15

    Contamination by trace elements (TE) is an increasing concern worldwide. In some areas, crop production could be limited by the presence of metals and metalloids, so it is important to determine their concentrations and mobility. The region of Jáchal, province of San Juan, Argentina, has good growing conditions for onion and grapevine production, but their quality and yield are affected by high TE concentration in soils and water. Soils, water, grapevine and onion were sampled and TE content determined. In soils elevated As, B, Cr, Hg, and Tl concentrations were detected (506±46, 149±3, 2714±217, 16±7, and 12±3μgg -1 , respectively, for maximum values measured), and physicochemical properties of the soil promotes these elements mobility. Water samples had high As, B, Cr, and Fe concentrations (1438±400, 10,871±471, 11,516±2363, and 3071±257μgL -1 , respectively, for maximum values measured) while in onion bulbs and grapevine berries, As, Cr, Cu, and Fe (92±7 and 171±20, 1412±18 and 2965±32, 17±3 and 126±88, and 418±204 and 377±213μgg -1 , respectively, for maximum values measured) exceeded the limits for food consumption established by Argentinian law. Correlation analyses indicated that: i) there is a common source of TE in this area, ii) each elements concentration in plants is associated with different soil variables and different soils depths, and iii) the lack of correlation between soil and water indicates that concentration in water is not constant over the time and/or there exists a differential accumulation of elements in soils depending on their own properties. Data obtained demonstrate very high concentration of TE in soil, grapevines, and onion plants in Jáchal region, and different remediation techniques are necessary to stabilize and minimize the bioavailability of these elements. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Survival of FUngi Associated with Grapevine Decline in Pruned Wood after Composting

    Directory of Open Access Journals (Sweden)

    P. Lecomte

    2006-04-01

    Full Text Available Recycling vine wood pruned in winter in the vineyard, after grinding and composting, might pose a risk of recontamination with fungi associated with grapevine decline. The survival of four ascomycete fungi (Botryosphaeria obtusa, Phaeomoniella chlamydospora, Phaeoacremonium aleophilum and Eutypa lata in composted material was investigated in a 3-year study conducted in the Bordeaux area. Naturally and artificially infested material was examined before and after composting using classical isolation procedures. Results clearly showed that a composting process can eradicate the four target fungi efficiently.

  15. Proteomic analysis of shoot tissue during photoperiod induced growth cessation in V. riparia Michx. grapevines

    Science.gov (United States)

    2010-01-01

    Background Growth cessation, cold acclimation and dormancy induction in grapevines and other woody perennial plants native to temperate continental climates is frequently triggered by short photoperiods. The early induction of these processes by photoperiod promotes winter survival of grapevines in cold temperate zones. Examining the molecular processes, in particular the proteomic changes in the shoot, will provide greater insight into the signaling cascade that initiates growth cessation and dormancy induction. To begin understanding transduction of the photoperiod signal, Vitis riparia Michx. grapevines that had grown for 35 days in long photoperiod (long day, LD, 15 h) were subjected to either a continued LD or a short photoperiod (short day, SD, 13 h) treatment. Shoot tips (4-node shoot terminals) were collected from each treatment at 7 and 28 days of LD and SD for proteomic analysis via two-dimensional (2D) gel electrophoresis. Results Protein profiles were characterized in V. riparia shoot tips during active growth or SD induced growth cessation to examine physiological alterations in response to differential photoperiod treatments. A total of 1054 protein spots were present on the 2D gels. Among the 1054 proteins, 216 showed differential abundance between LD and SD (≥ two-fold ratio, p-value ≤ 0.05). After 7 days, 39 protein spots were more abundant in LD and 30 were more abundant in SD. After 28 days, 93 protein spots were more abundant in LD and 54 were more abundant in SD. MS/MS spectrometry was performed to determine the functions of the differentially abundant proteins. Conclusions The proteomics analysis uncovered a portion of the signal transduction involved in V. riparia grapevine growth cessation and dormancy induction. Different enzymes of the Calvin-Benson cycle and glutamate synthetase isoforms were more abundant either in LD or SD treatments. In LD tissues the significantly differentially more abundant proteins included flavonoid

  16. Employer Provisions for Parental Leave.

    Science.gov (United States)

    Meisenheimer, Joseph R., II

    1989-01-01

    Slightly more than one-third of full-time employees in medium and large firms in private industry were covered by maternity- or paternity-leave policies; days off were usually leave without pay. (Author)

  17. Efeito do porta-enxerto no teor de nutrientes em tecidos da videira "cabernet sauvignon" Effect of rootstock on nutrient content of 'cabernet sauvignon' grapevine tissues

    Directory of Open Access Journals (Sweden)

    Alberto Miele

    2009-12-01

    Full Text Available A nutrição mineral da videira constitui-se em importante fator para a qualidade dos vinhos. Devido a isso, avaliou-se o efeito de porta-enxertos no teor de nutrientes em diferentes tecidos da videira 'Cabernet Sauvignon' (Vitis vinifera L. na Serra Gaúcha. o experimento foi conduzido durante o ciclo vegetativo de 2004/2005, com os porta-enxertos Rupestris du lot, 101-14, 3309, 420A, Kober 5BB, 161-49, So4 e Paulsen 1103, enxertados em 1993 com a cv. 'Cabernet Sauvignon'. o delineamento experimental foi em blocos ao acaso, com oito tratamentos e três repetições, sendo quatro plantas/parcela. Coletaram-se folhas - separando-se os pecíolos dos limbos -, cachos - separando-se as bagas das ráquis - e ramos, os quais foram posteriormente secados em estufa e pesados. Analisaram-se os nutrientes n, P, K, Ca e Mg. os resultados mostram que houve efeito significativo do porta-enxerto nos teores de N, P, K, Ca e Mg no limbo, pecíolo, ráquis e baga da videira 'Cabernet Sauvignon' e que este efeito variou em função do nutriente e do tecido considerado. Entretanto, não houve efeito significativo do porta-enxerto no teor desses nutrientes no ramo da videira. Além disso, a ordem de grandeza do teor dos nutrientes variou em função do tecido avaliado. Assim, os teores de n e de Ca foram maiores no limbo; os de P e K, na ráquis; e o de Mg, no pecíolo.Grapevine mineral nutrition is an important factor influencing wine quality. For this, the effect of rootstocks on the nutrient content in different tissues of 'Cabernet Sauvignon' grapevines (Vitis vinifera L. grown in the Serra Gaúcha region was evaluated. The experiment was carried out during the 2004/2005 vegetative cycle with the rootstocks Rupestris du Lot, 101-14, 3309, 420A, Kober 5BB, 161-49, SO4, and Paulsen 1103. The experimental design was in randomized blocks, with eight treatments, three replicates, four plants/plot. leaves - petioles were separated from the limbs -, clusters - berries

  18. REMINDER Saved Leave Scheme (SLS) : Transfer of leave to saved leave accounts

    CERN Multimedia

    HR Division

    2002-01-01

    Under the provisions of the voluntary saved leave scheme (SLS), a maximum total of 10 days'*) annual and compensatory leave (excluding saved leave accumulated in accordance with the provisions of Administrative Circular No. 22B) can be transferred to the saved leave account at the end of the leave year (30 September). We remind you that, since last year, unused leave of all those taking part in the saved leave scheme at the closure of the leave-year accounts is transferred automatically to the saved leave account on that date. Therefore, staff members have no administrative steps to take. In addition, the transfer, which eliminates the risk of omitting to request leave transfers and rules out calculation errors in transfer requests, will be clearly shown in the list of leave transactions that can be consulted in EDH from October 2002 onwards. Furthermore, this automatic leave transfer optimizes staff members' chances of benefiting from a saved leave bonus provided that they are still participants in the schem...

  19. Saved Leave Scheme (SLS) : Simplified procedure for the transfer of leave to saved leave accounts

    CERN Multimedia

    HR Division

    2001-01-01

    As part of the process of streamlining procedures, the HR and AS Divisions have jointly developed a system whereby annual and compensatory leave will henceforth be automatically transferred1) to saved leave accounts. Under the provisions of the voluntary saved leave scheme (SLS), a maximum total of 10 days'2) annual and compensatory leave (excluding saved leave accumulated in accordance with the provisions of Administrative Circular No. 22 B) can be transferred to the saved leave account at the end of the leave year (30 September). Previously, every person taking part in the scheme has been individually issued with a form for the purposes of requesting the transfer of leave to the leave account and the transfer has then had to be done manually by HR Division. To streamline the procedure, unused leave of all those taking part in the saved leave scheme at the closure of of the leave-year accounts will henceforth be transferred automatically to the saved leave account on that date. This simplification is in the ...

  20. 77 FR 55829 - Western Area Power Administration; Grapevine Canyon Wind Project Record of Decision (DOE/EIS-0427)

    Science.gov (United States)

    2012-09-11

    ... DEPARTMENT OF ENERGY Western Area Power Administration; Grapevine Canyon Wind Project Record of... one or more phases, dependent on one or more power sale contracts. The proposed wind park would... that limit construction vehicle speed limits. Foresight indicated that the wind park contractor will...

  1. Identification of the female-produced sex pheromone of the leafminer Holocacista capensis infesting grapevine in South Africa

    NARCIS (Netherlands)

    Wang, H.-L.; Geertsema, H.; Nieukerken, van E.J.; Löfstedt, C.

    2015-01-01

    We report the first identification of a sex pheromone in a heliozelid moth, Holocacista capensis van Nieukerken & Geertsema. This leafminer recently infested grapevine in South Africa. Compared to solvent extraction of pheromone glands, solid phase microextraction (SPME) proved to be highly

  2. Restructuring of Endophytic Bacterial Communities in Grapevine Yellows-Diseased and Recovered Vitis vinifera L. Plants ▿

    Science.gov (United States)

    Bulgari, Daniela; Casati, Paola; Crepaldi, Paola; Daffonchio, Daniele; Quaglino, Fabio; Brusetti, Lorenzo; Bianco, Piero Attilio

    2011-01-01

    Length heterogeneity-PCR assays, combined with statistical analyses, highlighted that the endophytic bacterial community associated with healthy grapevines was characterized by a greater diversity than that present in diseased and recovered plants. The findings suggest that phytoplasmas can restructure the bacterial community by selecting endophytic strains that could elicit a plant defense response. PMID:21622794

  3. Review of invasive grapevine aphid, Aphis illinoisensis Shimer, and native parasitoids in the Mediterranean (Hemiptera, Aphididae; Hymenoptera, Braconidae, Aphidiinae)

    Czech Academy of Sciences Publication Activity Database

    Havelka, Jan; Shukshuk, A. H.; Ghaliow, M. E.; Laamari, M.; Kavallieratos, N. G.; Tomanović, Ž.; Rakhshani, E.; Pons, X.; Starý, Petr

    2011-01-01

    Roč. 63, č. 1 (2011), s. 269-274 ISSN 0354-4664 Grant - others:Ministry of Science and Technological Development of the Republic of Serbia(CS) 43001 Institutional research plan: CEZ:AV0Z50070508 Keywords : invasions * Aphis illinoisensis * grapevine Subject RIV: EH - Ecology, Behaviour Impact factor: 0.360, year: 2011

  4. Treatment of grapevines with prohexadione calcium as a growth regulator. The influence on production, winemaking and sensory characteristics of wines

    Directory of Open Access Journals (Sweden)

    Luis Vaquero-Fernández

    2009-09-01

    Significance and impact of study: ProCa as a growth regulator may be an option for a quality vitiviniculture. No previous studies have been published on applications of ProCa in grapevines in either Europe or in cv. Tempranillo. Additionally, studies with other varieties have not demonstrated sensory improvements in wines obtained from treated vines.

  5. Parental leave and child health.

    Science.gov (United States)

    Ruhm, C J

    2000-11-01

    This study investigates whether rights to parental leave improve pediatric health. Aggregate data are used for 16 European countries over the 1969 through 1994 period. More generous paid leave is found to reduce deaths of infants and young children. The magnitudes of the estimated effects are substantial, especially where a causal effect of leave is most plausible. In particular, there is a much stronger negative relationship between leave durations and post-neonatal or child fatalities than for perinatal mortality, neonatal deaths, or low birth weight. The evidence further suggests that parental leave may be a cost-effective method of bettering child health.

  6. Silencing Agrobacterium oncogenes in transgenic grapevine results in strain-specific crown gall resistance.

    Science.gov (United States)

    Galambos, A; Zok, A; Kuczmog, A; Oláh, R; Putnoky, P; Ream, W; Szegedi, E

    2013-11-01

    Grapevine rootstock transformed with an Agrobacterium oncogene-silencing transgene was resistant to certain Agrobacterium strains but sensitive to others. Thus, genetic diversity of Agrobacterium oncogenes may limit engineering crown gall resistance. Crown gall disease of grapevine induced by Agrobacterium vitis or Agrobacterium tumefaciens causes serious economic losses in viticulture. To establish crown gall-resistant lines, somatic proembryos of Vitis berlandieri × V. rupestris cv. 'Richter 110' rootstock were transformed with an oncogene-silencing transgene based on iaaM and ipt oncogene sequences from octopine-type, tumor-inducing (Ti) plasmid pTiA6. Twenty-one transgenic lines were selected, and their transgenic nature was confirmed by polymerase chain reaction (PCR). These lines were inoculated with two A. tumefaciens and three A. vitis strains. Eight lines showed resistance to octopine-type A. tumefaciens A348. Resistance correlated with the expression of the silencing genes. However, oncogene silencing was mostly sequence specific because these lines did not abolish tumorigenesis by A. vitis strains or nopaline-type A. tumefaciens C58.

  7. Cloning, expression, purification and crystallization of dihydrodipicolinate synthase from the grapevine Vitis vinifera

    International Nuclear Information System (INIS)

    Atkinson, Sarah C.; Dogovski, Con; Newman, Janet; Dobson, Renwick C. J.; Perugini, Matthew A.

    2011-01-01

    Dihydrodipicolinate synthase from the common grapevine V. vinifera has been cloned, expressed, purified and crystallized in the presence of the substrate pyruvate by in-drop hexahistidine-tag cleavage. A diffraction data set has been collected to a resolution of 2.2 Å. Dihydrodipicolinate synthase (DHDPS) catalyses the first committed step of the lysine-biosynthesis pathway in bacteria, plants and some fungi. This study describes the cloning, expression, purification and crystallization of DHDPS from the grapevine Vitis vinifera (Vv-DHDPS). Following in-drop cleavage of the hexahistidine tag, cocrystals of Vv-DHDPS with the substrate pyruvate were grown in 0.1 M Bis-Tris propane pH 8.2, 0.2 M sodium bromide, 20%(w/v) PEG 3350. X-ray diffraction data in space group P1 at a resolution of 2.2 Å are presented. Preliminary diffraction data analysis indicated the presence of eight molecules per asymmetric unit (V M = 2.55 Å 3 Da −1 , 52% solvent content). The pending crystal structure of Vv-DHDPS will provide insight into the molecular evolution in quaternary structure of DHDPS enzymes

  8. SNP high-throughput screening in grapevine using the SNPlex™ genotyping system

    Directory of Open Access Journals (Sweden)

    Velasco Riccardo

    2008-01-01

    Full Text Available Abstract Background Until recently, only a small number of low- and mid-throughput methods have been used for single nucleotide polymorphism (SNP discovery and genotyping in grapevine (Vitis vinifera L.. However, following completion of the sequence of the highly heterozygous genome of Pinot Noir, it has been possible to identify millions of electronic SNPs (eSNPs thus providing a valuable source for high-throughput genotyping methods. Results Herein we report the first application of the SNPlex™ genotyping system in grapevine aiming at the anchoring of an eukaryotic genome. This approach combines robust SNP detection with automated assay readout and data analysis. 813 candidate eSNPs were developed from non-repetitive contigs of the assembled genome of Pinot Noir and tested in 90 progeny of Syrah × Pinot Noir cross. 563 new SNP-based markers were obtained and mapped. The efficiency rate of 69% was enhanced to 80% when multiple displacement amplification (MDA methods were used for preparation of genomic DNA for the SNPlex assay. Conclusion Unlike other SNP genotyping methods used to investigate thousands of SNPs in a few genotypes, or a few SNPs in around a thousand genotypes, the SNPlex genotyping system represents a good compromise to investigate several hundred SNPs in a hundred or more samples simultaneously. Therefore, the use of the SNPlex assay, coupled with whole genome amplification (WGA, is a good solution for future applications in well-equipped laboratories.

  9. Identification of Agrobacterium vitis as a causal agent of grapevine crown gall in Serbia

    Directory of Open Access Journals (Sweden)

    Kuzmanović N.

    2012-01-01

    Full Text Available In 2010, a serious outbreak of crown gall disease was observed on grapevines (Vitis vinifera L. cv. Cabernet Sauvignon in several commercial vineyards located in the Vojvodina province, Serbia. Bacteria were isolated from the young tumor tissue on nonselective YMA medium and five representative strains were selected for further identification. Tumorigenic (Ti plasmid was detected in all strains by PCR using primers designed to amplify the virC pathogenicity gene, producing a 414-bp PCR product. The strains were identified as Agrobacterium vitis using differential physiological and biochemical tests, and a multiplex PCR assay targeting 23S rRNA gene sequences. In the pathogenicity assay, all strains induced characteristic symptoms on inoculated tomato and grapevine plants. They were less virulent on tomato plants in comparison to the reference strains of A. tumefaciens and A. vitis. [Ministarstva nauke Republike Srbije, br. III46008: Development of integrated management of harmful organisms in plant production in order to overcome resistance and to improve food quality and safety

  10. Production of Polyclonal Antibody against Grapevine fanleaf virus Movement Protein Expressed in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Davoud Koolivand

    2016-10-01

    Full Text Available The genomic region of Grapevine fanleaf virus (GFLV encoding the movement protein (MP was cloned into pET21a and transformed into Escherichia coli strain BL21 (DE3 to express the protein. Induction was made with a wide range of isopropyl-β-D-thiogalactopyranoside (IPTG concentrations (1, 1.5, and 2 mM each for duration of 4, 6, or 16 h. However, the highest expression level was achieved with 1 mM IPTG for 4 h. Identity of the expressed protein was confirmed by sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE followed by Western blotting. The expressed 41 kDa protein was purified under denaturing condition by affinity chromatography, reconfirmed by Western blotting and plate-trapped antigen enzyme-linked immunosorbent assay (PTA-ELISA before being used as a recombinant antigen to raise polyclonal antibodies in rabbits. Purified anti-GFLV MP immunoglobulines (IgGs and conjugated IgGs detected the expressed MP and GFLV virions in infected grapevines when used in PTA-ELISA, double antibody sandwich-ELISA, and Western blotting. This is the first report on the production of anti-GFLV MP polyclonal antibodies and application for the virus detection.

  11. Climate Change and Crop Exposure to Adverse Weather: Changes to Frost Risk and Grapevine Flowering Conditions.

    Science.gov (United States)

    Mosedale, Jonathan R; Wilson, Robert J; Maclean, Ilya M D

    2015-01-01

    The cultivation of grapevines in the UK and many other cool climate regions is expected to benefit from the higher growing season temperatures predicted under future climate scenarios. Yet the effects of climate change on the risk of adverse weather conditions or events at key stages of crop development are not always captured by aggregated measures of seasonal or yearly climates, or by downscaling techniques that assume climate variability will remain unchanged under future scenarios. Using fine resolution projections of future climate scenarios for south-west England and grapevine phenology models we explore how risks to cool-climate vineyard harvests vary under future climate conditions. Results indicate that the risk of adverse conditions during flowering declines under all future climate scenarios. In contrast, the risk of late spring frosts increases under many future climate projections due to advancement in the timing of budbreak. Estimates of frost risk, however, were highly sensitive to the choice of phenology model, and future frost exposure declined when budbreak was calculated using models that included a winter chill requirement for dormancy break. The lack of robust phenological models is a major source of uncertainty concerning the impacts of future climate change on the development of cool-climate viticulture in historically marginal climatic regions.

  12. Inheritance of downy mildew (Plasmopara viticola) and anthracnose (Sphaceloma ampelinum) resistance in grapevines.

    Science.gov (United States)

    Poolsawat, O; Mahanil, S; Laosuwan, P; Wongkaew, S; Tharapreuksapong, A; Reisch, B I; Tantasawat, P A

    2013-12-13

    Downy mildew (Plasmopara viticola) and anthracnose (Sphaceloma ampelinum) are two of the major diseases of most grapevine (Vitis vinifera L.) cultivars grown in Thailand. Therefore, breeding grapevines for improved downy mildew and anthracnose resistance is crucial. Factorial crosses were made between three downy mildew and/or anthracnose resistant lines ('NY88.0517.01', 'NY65.0550.04', and 'NY65.0551.05'; male parents) and two or three susceptible cultivars of V. vinifera ('Black Queen', 'Carolina Black Rose', and/or 'Italia'; female parents). F1 hybrid seedlings were evaluated for downy mildew and anthracnose resistance using a detached/excised leaf assay. For both diseases, the general combining ability (GCA) variance among male parents was significant, while the variance of GCA among females and the specific combining ability (SCA) variance were not significant, indicating the prevalence of additive over non-additive gene actions. The estimated narrow sense heritabilities of downy mildew and anthracnose resistance were 55.6 and 79.2%, respectively, suggesting that downy mildew/anthracnose resistance gene(s) were highly heritable. The 'Carolina Black Rose x NY65.0550.04' cross combination is recommended for future use.

  13. VitiCanopy: A Free Computer App to Estimate Canopy Vigor and Porosity for Grapevine.

    Science.gov (United States)

    De Bei, Roberta; Fuentes, Sigfredo; Gilliham, Matthew; Tyerman, Steve; Edwards, Everard; Bianchini, Nicolò; Smith, Jason; Collins, Cassandra

    2016-04-23

    Leaf area index (LAI) and plant area index (PAI) are common and important biophysical parameters used to estimate agronomical variables such as canopy growth, light interception and water requirements of plants and trees. LAI can be either measured directly using destructive methods or indirectly using dedicated and expensive instrumentation, both of which require a high level of know-how to operate equipment, handle data and interpret results. Recently, a novel smartphone and tablet PC application, VitiCanopy, has been developed by a group of researchers from the University of Adelaide and the University of Melbourne, to estimate grapevine canopy size (LAI and PAI), canopy porosity, canopy cover and clumping index. VitiCanopy uses the front in-built camera and GPS capabilities of smartphones and tablet PCs to automatically implement image analysis algorithms on upward-looking digital images of canopies and calculates relevant canopy architecture parameters. Results from the use of VitiCanopy on grapevines correlated well with traditional methods to measure/estimate LAI and PAI. Like other indirect methods, VitiCanopy does not distinguish between leaf and non-leaf material but it was demonstrated that the non-leaf material could be extracted from the results, if needed, to increase accuracy. VitiCanopy is an accurate, user-friendly and free alternative to current techniques used by scientists and viticultural practitioners to assess the dynamics of LAI, PAI and canopy architecture in vineyards, and has the potential to be adapted for use on other plants.

  14. Comparative evaluation of oxidative enzyme activities during adventitious rooting in the cuttings of grapevine rootstocks.

    Science.gov (United States)

    Kose, Cafer; Erdal, Serkan; Kaya, Ozkan; Atici, Okkeş

    2011-03-15

    This study investigated changes in peroxidase (POX) and polyphenol oxidase (PPO) activities through adventitious rooting in hardwood cuttings of grapevine rootstocks. Three grapevine rootstocks with different propensity to produce adventitious roots were selected: recalcitrant (Ramsey), non-recalcitrant (Rupestris du Lot) and intermediate (99R) cultivars. The averages of root number at 65 days were 96 in Lot, 76 in 99R and 30 in Ramsey. Both enzyme activities characteristically increased before adventitious rooting, regardless of rooting ability of the rootstocks, and then decreased. POX activity increased in Ramsey cuttings at 22 days, in Lot and 99R cuttings at 14 days after planting, and then decreased gradually until 51 days. The highest POX activity was determined in Ramsey rootstock with the highest rooting ability and the lowest activity was determined in the rootstocks with the lowest rooting ability. PPO activity gradually increased in Ramsey rootstock cuttings from 10 days to 22 days, in Lot and 99R cuttings at 14 days, and then decreased until 51 days. A significant correlation was identified between high POX activity and adventitious rooting capability in rootstocks, but the same result was not determined with PPO activity. A recalcitrant rooting variety cannot increase POX activity sufficiently before rooting. Therefore applications that could increase POX activity in stem cuttings during rooting may facilitate increased rooting in such rootstocks. Copyright © 2011 Society of Chemical Industry.

  15. RNA2 of grapevine fanleaf virus: sequence analysis and coat protein cistron location.

    Science.gov (United States)

    Serghini, M A; Fuchs, M; Pinck, M; Reinbolt, J; Walter, B; Pinck, L

    1990-07-01

    The nucleotide sequence of the genomic RNA2 (3774 nucleotides) of grapevine fanleaf virus strain F13 was determined from overlapping cDNA clones and its genetic organization was deduced. Two rapid and efficient methods were used for cDNA cloning of the 5' region of RNA2. The complete sequence contained only one long open reading frame of 3555 nucleotides (1184 codons, 131K product). The analysis of the N-terminal sequence of purified coat protein (CP) and identification of its C-terminal residue have allowed the CP cistron to be precisely positioned within the polyprotein. The CP produced by proteolytic cleavage at the Arg/Gly site between residues 680 and 681 contains 504 amino acids (Mr 56019) and has hydrophobic properties. The Arg/Gly cleavage site deduced by N-terminal amino acid sequence analysis is the first for a nepovirus coat protein and for plant viruses expressing their genomic RNAs by polyprotein synthesis. Comparison of GFLV RNA2 with M RNA of cowpea mosaic comovirus and with RNA2 of two closely related nepoviruses, tomato black ring virus and Hungarian grapevine chrome mosaic virus, showed strong similarities among the 3' non-coding regions but less similarity among the 5' end non-coding sequences than reported among other nepovirus RNAs.

  16. Genetic diversity and geographical dispersal in grapevine clones revealed by microsatellite markers.

    Science.gov (United States)

    Moncada, Ximena; Pelsy, Frédérique; Merdinoglu, Didier; Hinrichsen, Patricio

    2006-11-01

    Intravarietal genetic diversification associated with geographical dispersal of a vegetatively propagated species was studied using grapevine Vitis vinifera L. 'Cabernet Sauvignon' as a model. Fifty-nine clonal samples obtained from 7 countries (France, Chile, Spain, Australia, Hungary, USA, and Italy) were analyzed using 84 microsatellite markers. Eighteen polymorphic microsatellite loci (21.4%) were detected, finding 22 different genotypes in the population analyzed with a genetic similarity of over 97%. The presence of chimeric clones was evidenced at locus VMC5g7 by means of a segregation analysis of descendants by self-pollination of a triallelic Chilean clone and by somatic embryogenesis analysis, showing a mutation in L2 cell layer. Only 2 clones (obtained from France and Australia) presented the ancestral genotype, and the most divergent genotype was exhibited by another French clone, which had accumulated 5 somatic mutations. The 2 largest populations considered (from France and Chile) showed a clear divergency in the polymorphisms detected. These antecedents enabled the tracing of geographical dispersal with a phylogenetic hypothesis supporting France as the center of origin of diversification of Cabernet Sauvignon. The results obtained could help to explain diversification processes in other grapevine cultivars. The possibility that this kind of genetic variability occurs in other vegetatively propagated species is discussed, focusing on possible fingerprinting applications.

  17. Characterization of the largest relic Eurasian wild grapevine reservoir in Southern Iberian Peninsula

    Energy Technology Data Exchange (ETDEWEB)

    Arroyo-García, R.; Cantos, M.; Lara, M.; López, M.A.; Gallardo, A.; Ocete, C.A.; Pérez, A.; Bánáti, B.; García, J.L.; Ocete, R.

    2016-11-01

    Wild grapevine is becoming a threatened species in the Iberian Peninsula due to human impacts. The aim of this work was to carry out a holistic study for six years of the largest wild grapevine population found up to date in SW Iberian Peninsula. This population has 115 vines. Ampelographic and soil characteristics have been studied. Evaluation of its environment has also been studied by describing the main parasitic species and natural enemies of pests. The ability of this plant material for its micropropagation and storage in slow-growth conditions has been tested. Microvinification resulted in a wine with good acidity and medium color intensity, two interesting characteristics under a warm climatology. Finally, the identification of private alleles in this wild population, absent in other locations from the Northern and Southern Iberian territories, is a very valuable feature and confirms the importance of establishing conservation programs. The population here studied is genetically unique and potentially useful for commercial rootstocks and cultivars breeding that would improve viticulture and enology. (Author)

  18. Statistical modelling of grapevine yield in the Port Wine region under present and future climate conditions

    Science.gov (United States)

    Santos, João A.; Malheiro, Aureliano C.; Karremann, Melanie K.; Pinto, Joaquim G.

    2011-03-01

    The impact of projected climate change on wine production was analysed for the Demarcated Region of Douro, Portugal. A statistical grapevine yield model (GYM) was developed using climate parameters as predictors. Statistically significant correlations were identified between annual yield and monthly mean temperatures and monthly precipitation totals during the growing cycle. These atmospheric factors control grapevine yield in the region, with the GYM explaining 50.4% of the total variance in the yield time series in recent decades. Anomalously high March rainfall (during budburst, shoot and inflorescence development) favours yield, as well as anomalously high temperatures and low precipitation amounts in May and June (May: flowering and June: berry d