MALDI-TOF mass spectrometry for differentiation between Streptococcus pneumoniae and Streptococcus pseudopneumoniae.

Science.gov (United States)

van Prehn, Joffrey; van Veen, Suzanne Q; Schelfaut, Jacqueline J G; Wessels, Els

2016-05-01

We compared the Vitek MS and Microflex MALDI-TOF mass spectrometry platform for species differentiation within the Streptococcus mitis group with PCR assays targeted at lytA, Spn9802, and recA as reference standard. The Vitek MS correctly identified 10/11 Streptococcus pneumoniae, 13/13 Streptococcus pseudopneumoniae, and 12/13 S. mitis/oralis. The Microflex correctly identified 9/11 S. pneumoniae, 0/13 S. pseudopneumoniae, and 13/13 S. mitis/oralis. MALDI-TOF is a powerful tool for species determination within the mitis group. Diagnostic accuracy varies depending on platform and database used. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Bacteremia with Streptococcus pneumoniae

DEFF Research Database (Denmark)

Christensen, J S; Jensen, T G; Kolmos, H J

2012-01-01

We conducted a hospital-based cohort study among adult patients with first-time Streptococcus pneumoniae bacteremia (SPB) from 2000 through 2008. Patients were identified in a population-based bacteremia database and followed up for mortality through the Danish Civil Registration System (CRS...

Gene Regulation in Streptococcus pneumoniae: interplay between nutrition and virulence

NARCIS (Netherlands)

W.T. Hendriksen (Wouter)

2010-01-01

textabstractStreptococcus pneumoniae (the pneumococcus) is a Gram-positive bacterium, which belongs to the species of streptococci. Other pathogenic bacteria belonging to this class include Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus suis, Streptococcus uberis, Streptococcus

Monoclonal Idiotope Vaccine against Streptococcus pneumoniae Infection

Science.gov (United States)

McNamara, Mary K.; Ward, Ronald E.; Kohler, Heinz

1984-12-01

A monoclonal anti-idiotope antibody coupled to a carrier protein was used to immunize BALB/c mice against a lethal Streptococcus pneumoniae infection. Vaccinated mice developed a high titer of antibody to phosphorylcholine, which is known to protect against infection with Streptococcus pneumoniae. Measurement of the median lethal dose of the bacteria indicated that anti-idiotope immunization significantly increased the resistance of BALB/c mice to the bacterial challenge. Antibody to an idiotope can thus be used as an antigen substitute for the induction of protective immunity.

Penicillin resistance and serotype distribution of Streptococcus pneumoniae in Ghanaian children less than six years of age

DEFF Research Database (Denmark)

Dayie, Nicholas T. K. D.; Arhin, Reuben E.; Newman, Mercy J.

2013-01-01

Background: The objective of this study was to determine the prevalence of nasopharyngeal carriage, serotype distribution, and penicillin resistance of Streptococcus pneumoniae in children 2 mu g/ml and were classified as fully penicillin resistant with 45% of the isolates having intermediate...... serotypes detected. The two penicillin resistant isolates (MIC 32 mu g/ml) were serotypes included in both PCV-13 and PPV-23. A nationwide monitoring system of penicillin susceptibility patterns and pneumococcal serotypes is recommended....

Genetic diversity of penicillin-binding protein 2B and 2X genes from Streptococcus pneumoniae in South Africa.

OpenAIRE

Smith, A M; Klugman, K P; Coffey, T J; Spratt, B G

1993-01-01

Streptococcus pneumoniae (the pneumococcus) is believed to have developed resistance to penicillin by the production of altered forms of penicillin-binding proteins (PBPs) that have decreased affinity for penicillin. Sixty-eight clinical isolates of serogroup 6 and 19 pneumococci (MICs, < 0.015 to 8 micrograms/ml) were randomly selected from hospitals across South Africa which are at substantial geographic distance from each other. The polymerase chain reaction was used to isolate the penicil...

LiF Reduces MICs of Antibiotics against Clinical Isolates of Gram-Positive and Gram-Negative Bacteria

Directory of Open Access Journals (Sweden)

H. C. Syed

2012-01-01

Full Text Available Antibiotic resistance is an ever-growing problem yet the development of new antibiotics has slowed to a trickle, giving rise to the use of combination therapy to eradicate infections. The purpose of this study was to evaluate the combined inhibitory effect of lithium fluoride (LiF and commonly used antimicrobials on the growth of the following bacteria: Enterococcus faecalis, Staphyloccoccus aureus, Escherichia coli, Pseudomonas aeruginosa, Acinetobacter baumannii, Klebsiella pneumoniae, Serratia marcescens, and Streptococcus pneumoniae. The in vitro activities of ceftazidime, sulfamethoxazole-trimethoprim, streptomycin, erythromycin, amoxicillin, and ciprofloxacin, doxycycline, alone or combined with LiF were performed by microdilution method. MICs were determined visually following 18–20 h of incubation at 37°C. We observed reduced MICs of antibiotics associated with LiF ranging from two-fold to sixteen-fold. The strongest decreases of MICs observed were for streptomycin and erythromycin associated with LiF against Acinetobacter baumannii and Streptococcus pneumoniae. An eight-fold reduction was recorded for streptomycin against S. pneumoniae whereas an eight-fold and a sixteen-fold reduction were obtained for erythromycin against A. baumannii and S. pneumoniae. This suggests that LiF exhibits a synergistic effect with a wide range of antibiotics and is indicative of its potential as an adjuvant in antibiotic therapy.

Factors associated with colonization of Streptococcus pneumoniae ...

African Journals Online (AJOL)

with schooling and presence chronic diseases. ... Streptococcus pneumoniae is a leading cause of serious community-acquired infections such as ... large number of individuals are still suffering from infections caused by these bacteria, especially ... samples of children with severe pneumonia (Nantanda et al., 2008).

Detection and quantification of Streptococcus pneumoniae from ...

African Journals Online (AJOL)

The aim of this study was to develop a real time polymerase chain reaction (PCR) for quantitative detection of Streptococcus pneumoniae from clinical respiratory specimens. Initially, 184 respiratory specimens from patients with community acquired pneumonia (CAP) (n = 129) and 55 cases with hospital associated ...

Seeing Streptococcus pneumoniae, a Common Killer Bacteria

DEFF Research Database (Denmark)

Kjærgaard, Rikke Schmidt; Andersen, Ebbe Sloth

2014-01-01

Look around you. The diversity and complexity of life on earth is overwhelming and data continues to grow. In our desire to understand and explain everything scientifically from molecular evolution to supernovas we depend on visual representations. This paper investigates visual representations...... of the bacteria Streptococcus pneumoniae by use of ink, watercolours and computer graphics. We propose a novel artistic visual rendering of Streptococcus pneumoniae and ask what the value of these kind of representations are compared to traditional scientific data. We ask if drawings and computer......-assisted representations can add to our scientific knowledge about this dangerous bacteria. Is there still a role for the scientific illustrator in the scientific process and synthesis of scientific knowledge?...

Serotype-specific mortality from invasive Streptococcus pneumoniae disease revisited

DEFF Research Database (Denmark)

Martens, Pernille; Worm, Signe Westring; Lundgren, Bettina

2004-01-01

Serotype-specific mortality from invasive Streptococcus pneumoniae disease revisited.Martens P, Worm SW, Lundgren B, Konradsen HB, Benfield T. Department of Infectious Diseases 144, Hvidovre University Hospital, DK-2650 Hvidovre, Denmark. pernillemartens@yahoo.com BACKGROUND: Invasive infection...... with Streptococcus pneumoniae (pneumococci) causes significant morbidity and mortality. Case series and experimental data have shown that the capsular serotype is involved in the pathogenesis and a determinant of disease outcome. METHODS: Retrospective review of 464 cases of invasive disease among adults diagnosed...

NEW VIRULENCE FACTORS OF STREPTOCOCCUS PNEUMONIAE

NARCIS (Netherlands)

Hermans, Peter Wilhelmus Maria; Bootsma, Jeanette Hester; Burghout, Pieter Jan; Kuipers, Oscar; Bijlsma, Johanna Jacoba Elisabeth; Kloosterman, Tomas Gerrit; Andersen, Christian O.

2011-01-01

The present invention provides proteins/genes, which are essential for survival, and consequently, for virulence of Streptococcus pneumoniae in vivo, and thus are ideal vaccine candidates for a vaccine preparation against pneumococcal infection. Further, also antibodies against said protein(s) are

Lung abscess due to Streptococcus pneumoniae: a case series and brief review of the literature.

Science.gov (United States)

Nicolini, Antonello; Cilloniz, Catia; Senarega, Renata; Ferraioli, Gianluca; Barlascini, Cornelius

2014-01-01

Anaerobes used to be the most common cause of community-acquired lung abscess, and Streptococcus species used to be the second most common cause. In recent years, this has been changing. Klebsiella pneumoniae is now an increasing cause of community- acquired lung abscess, but Streptococcus species continue to be major pathogens. Necrotizing pneumonia has generally been regarded as a rare complication of pneumococcal infection in adults. Type 3 Streptococcus pneumoniae was the single most common type implicated in necrosis; however, many other serotypes were implicated. This entity predominately infects children, but is present also in adults. Lung abscess in adults due to Streptococcus pneumoniae is not common. In this regard we present a case series of pulmonary cavitation due to Streptococcus pneumoniae and discuss the possible pathogenic mechanism of the disease.

Telithromycin resistance in Streptococcus pneumoniae is conferred by a deletion in the leader sequence of erm(B) that increases rRNA methylation

DEFF Research Database (Denmark)

Wolter, Nicole; Smith, Anthony M; Farrell, David J

2008-01-01

A telithromycin-resistant clinical isolate of Streptococcus pneumoniae (strain P1501016) has been found to contain a version of erm(B) that is altered by a 136-bp deletion in the leader sequence. By allele replacement mutagenesis, a second strain of S. pneumoniae (PC13) with a wild-type erm(B) gene...... was transformed to the telithromycin-resistant phenotype by introduction of the mutant erm(B) gene. Whereas the wild-type PC13 strain showed slight telithromycin resistance only after induction by erythromycin (telithromycin MIC increased from 0.06 to 0.5 microg/ml), the transformed PC13 strain is constitutively...... resistant (MIC of 16 mug/ml). Expression of erm(B) was quantified by real-time reverse transcription-PCR in the presence of erythromycin or telithromycin; erm(B) expression was significantly higher in the transformed PC13 strain than the wild-type strain. Furthermore, the transformed strain had...

Host-pathogen interaction during Streptococcus pneumoniae colonization and infection

NARCIS (Netherlands)

D. Bogaert (Debby)

2004-01-01

markdownabstract__Abstract__ Streptococcus pneumoniae was discovered by Sternberg and Pasteur in 1880. It took another six years to discover that this microorganism, called the pneumococcus, was the actual cause of bacterial pneumonia . Subsequently, this bacterium has been shown to provoke an

A Visual Review of the Human Pathogen Streptococcus pneumoniae

DEFF Research Database (Denmark)

Engholm, Ditte Høyer; Kilian, Mogens; Goodsell, David

2017-01-01

Being the principal causative agent of bacterial pneumonia, otitis media, meningitis and septicemia, the bacterium Streptococcus pneumoniae is a major global health problem. To highlight the molecular basis of this problem, we have portrayed essential biological processes of the pneumococcal life...

Distribución de serotipos de Streptococcus pneumoniae aislados de infecciones invasoras en el Hospital de Niños de Santa Fe Serotype distribution of Streptococcus pneumoniae isolated from invasive infections at the Hospital de Niños of Santa Fe.

Directory of Open Access Journals (Sweden)

C. Mayoral

2008-03-01

Full Text Available Con la introducción de vacunas conjugadas antineumocócicas se observó, en muchos países, disminución de aislamientos de Streptococcus pneumoniae del serotipo 14 y aumento de aislamientos correspondientes a serotipos no incluidos en esas vacunas. En 1993, el Hospital de Niños de Santa Fe comenzó la vigilancia de la distribución de serotipos de Streptococcus pneumoniae invasores. En este trabajo se estudió la correlación entre serotipo y a patología (neumonía/meningitis, b edad (menor o mayor de dos años, y c CIM de penicilina, para los serotipos aislados en el período 2003-2005. El serotipo predominante fue el 14, seguido del 1, 6B, 18C, 7F, 19F y 5. El serotipo 14 mostró asociación estadísticamente significativa con valores de CIM de penicilina entre 0,5 y 2 mg/l, no así con alguna patología, aunque se lo halló con mayor frecuencia en neumonías que en meningitis. Los serotipos 14 y 1 prevalecieron en niños menores y mayores de 2 años, respectivamente. La CIM de penicilina = 2 mg/l se observó más en neumonías que en meningitis. La frecuencia relativa de los diferentes serotipos hallados fue semejante a la observada en el período 1993-99; no obstante, los serotipos 18C, 4, 12F y 22F no se habían encontrado antes. La aparición de nuevos serotipos convierte en importante la vigilancia, dada la necesidad de formular vacunas que los incluyan y que efectivamente prevengan las infecciones neumocócicas más comunes.The serotype distribution of Streptococcus pneumoniae varies through time. The introduction of pneumococcal conjugate vaccines showed a decreased prevalence of pneumococcal invasive isolates belonging to serotype 14 and an increase of serotypes not therein included. In 1993, the Hospital de Niños of Santa Fe began surveillance of the serotype distribution of invasive S. pneumoniae disease. In the period 2003 - 2005, 76 isolates were analysed by studying the correlation between serotype and pathology, age and MIC

Evolution of Streptococcus pneumoniae and its close commensal relatives

DEFF Research Database (Denmark)

Kilian, Mogens; Poulsen, Knud; Blomqvist, Trinelise

2008-01-01

Streptococcus pneumoniae is a member of the Mitis group of streptococci which, according to 16S rRNA-sequence based phylogenetic reconstruction, includes 12 species. While other species of this group are considered prototypes of commensal bacteria, S. pneumoniae is among the most frequent microbial...

In vitro activity of Ceftaroline against bacterial pathogens isolated from patients with skin and soft tissue and respiratory tract infections in African and Middle Eastern countries: AWARE global surveillance program 2012-2014.

Science.gov (United States)

Karlowsky, James A; Biedenbach, Douglas J; Bouchillon, Samuel K; Hackel, Meredith; Iaconis, Joseph P; Sahm, Daniel F

2016-10-01

The objective of this report was to document antimicrobial susceptibility testing surveillance data for ceftaroline and comparative agents from the AWARE (Assessing Worldwide Antimicrobial Resistance Evaluation) global surveillance program for bacterial pathogens causing skin and soft tissue and respiratory tract infections in African and Middle Eastern countries from 2012 through 2014. Pathogen identities were confirmed by MALDI-TOF and antimicrobial susceptibility testing performed by CLSI broth microdilution methodology in a central laboratory. All methicillin-susceptible Staphylococcus aureus (MSSA) (n= 923; MIC90, 0.25 μg/mL) and 91.8% of methicillin-resistant S. aureus (MRSA) (n= 1161; MIC90, 1 μg/mL) tested were susceptible to ceftaroline. The maximum ceftaroline MIC observed for isolates of MRSA was 2 μg/mL. All Streptococcus pyogenes (n= 174; MIC90, 0.008 μg/mL), Streptococcus agalactiae (n= 44; MIC90, 0.015 μg/mL), Streptococcus pneumoniae (n= 351; MIC90, 0.25 μg/mL), and Haemophilus influenzae (n= 84; MIC90, ≤0.015 μg/mL) were susceptible to ceftaroline. Rates of susceptibility to ceftaroline among ESBL-negative Escherichia coli (n= 338), Klebsiella pneumoniae (n= 241), and Klebsiella oxytoca (n= 97) were 89.1% (MIC90, 1 μg/mL), 94.2% (MIC90, 0.5 μg/mL), and 99.0% (MIC90, 0.5 μg/mL), respectively. Copyright © 2016. Published by Elsevier Inc.

Structure of a conjugative element in Streptococcus pneumoniae

Energy Technology Data Exchange (ETDEWEB)

Vijayakumar, M.N.; Priebe, S.D.; Guild, W.R.

1986-06-01

The authors have cloned and mapped a 69-kilobase (kb) region of the chromosome of Streptococcus pneumoniae DP1322, which carries the conjugative Omega(cat-tet) insertion from S. pneumoniae BM6001. This element proved to be 65.5 kb in size. Location of the junctions was facilitated by cloning a preferred target region from the wild-type strain Rx1 recipient genome. This target site was preferred by both the BM6001 element and the cat-erm-tet element from Streptococcus agalactiae B109. Within the BM6001 element cat and tet were separated by 30 kb, and cat was flanked by two copies of a sequence that was also present in the recipient strain Rx1 DNA. Another sequence at least 2.4 kb in size was found inside the BM6001 element and at two places in the Rx1 genome. Its role is unknown. The ends of the BM6001 element appear to be the same as those of the B109 element, both as seen after transfer to S. pneumoniae and as mapped by others in pDP5 after transposition in Streptococcus faecalis. No homology is seen between the ends of the BM6001 element and no evidence found suggesting that it ever circularizes.

Uji Daya Hambat Ekstrak Buah Belimbing Manis (Averrhoa carambola terhadap Pertumbuhan Bakteri Streptococcus pneumoniae secara In Vitro

Directory of Open Access Journals (Sweden)

Rita Risandi

2016-09-01

Full Text Available AbstrakBuah belimbing manis (Averrhoa carambola merupakan salah satu tanaman Indonesia yang diyakini memiliki khasiat obat. Salah satu manfaat yang dapat diambil dari sari buah belimbing manis (Averrhoa carambola adalah dapat mengobati radang tenggorokan. Radang tenggorokan merupakan salah satu infeksi yang disebabkan oleh bakteri Streptococcus pneumoniae. Tujuan penelitian ini adalah menentukan daya hambat ekstrak buah belimbing manis (Averrhoa carambola terhadap pertumbuhan bakteri Streptococcus pneumoniae  secara in vitro. Metode studi ini ialah eksperimental dengan desain postest only control group design yang dilakukan di Laboratorium Biota Sumatera Universitas Andalas dan Laboratorium Mikrobiologi Fakultas Kedokteran Universitas Andalas dari Agustus sampai Oktober 2014. Hasil penelitian menunjukkan bahwa ekstrak buah belimbing manis (Averrhoa carambola dengan konsentrasi yaitu 5%, 10%, 15% dan 20% tidak memiliki daya hambat terhadap pertumbuhan bakteri Streptococcus pneumoniae.  Hal ini terbukti karena tidak terbentuk zona hambat pada agar darah dan tidak terdapat pengaruh lama kontak ekstrak buah belimbing manis (Averrhoa carambola  terhadap pertumbuhan bakteri Streptococcus pneumoniae secara in vitro. Ekstrak buah belimbing manis tidak memiliki efek antibakteri terhadap pertumbuhan bakteri Streptococcus pneumoniae.Kata kunci: ekstrak buah belimbing manis, Streptococcus pneumoniae, daya hambat Abstract             Star fruit (Averrhoa carambola is a Indonesian plant that is believed to have medicinal properties. One of the benefits that can be drawn from the juice of star fruit (Averrhoa carambola is the ability to treat strep throat. Strep throat is a bacterial infection caused by Streptococcus pneumoniae. The objective of this study was to determine the inhibitory extract of star fruit (Averrhoa carambola on the growth of the bacterium Streptococcus pneumoniae in vitro. This was an experimental  research  with design

Nasopharyngeal carriage of Streptococcus pneumonia in pneumonia-prone age groups in Semarang, Java Island, Indonesia.

Science.gov (United States)

Farida, Helmia; Severin, Juliëtte A; Gasem, M Hussein; Keuter, Monique; Wahyono, Hendro; van den Broek, Peterhans; Hermans, Peter W M; Verbrugh, Henri A

2014-01-01

Streptococcus pneumoniae is a worldwide occurring pathogen Nasopharyngeal carriage of Streptococcus pneumoniae precedes pneumonia and other pneumococcal diseases in the community. Little is known about S. pneumoniae carriage in Indonesia, complicating strategies to control pneumococcal diseases. We investigated nasopharyngeal carriage of S. pneumoniae in Semarang, Indonesia. A population-based survey was performed in Semarang, Indonesia. Nasopharyngeal swabs and questionnaires were taken from 496 healthy young (6-60 month-old) children and 45-70 year-old adults. Forty-three percent of children aged 6-60 months and 11% of adults aged 45-75 years carried S. pneumoniae. Determinants of carriage were being a child (OR 7.7; 95% CI = 4.5-13.0), passive smoking (OR 2.1; 95% CI = 1.3-3.4), and contact with toddler(s) at home (OR 3.0; 95% CI = 1.9-4.7). The most frequent serotypes found were 6A/B and 15B/C. The current commercially available vaccines cover <50% serotypes found in children. Twenty-four percent of S. pneumoniae strains were penicillin non-susceptible, and 45% were resistant to cotrimoxazol. The limited coverage of commercially available vaccines against the serotypes found in this population, and the high proportion of non-susceptibility to penicillin and cotrimoxazol suggest the need for region-specific information and strategies to control S. pneumoniae.

Streptococcus pneumoniae-associated pneumonia complicated by purulent pericarditis: case series

Energy Technology Data Exchange (ETDEWEB)

Cilloniz, Catia; Torres, Antoni [Servicio de Neumologia, Hospital Clinic de Barcelona, Ciber de Enfermedades Respiratorias (CIBERES), Instituto de Investigacion Biomedica Agusti Pi i Sunyer, Universidad de Barcelona (Spain); Rangel, Ernesto [Facultad de Medicina, Universidad Autonoma de Nayarit, Tepic (Mexico); Barlascini, Cornelius [Servizio di Igiene e Sanita Pubblica, Ospedale Generale di Sestri Levante, Sestri Levante (Italy); Piroddi, Ines Maria Grazia; Nicolini, Antonello, E-mail: antonellonicolini@gmail.com [Servizio di Pneumologia, Ospedale Generale di Sestri Levante, Sestri Levante (Italy)

2015-07-15

Objective: In the antibiotic era, purulent pericarditis is a rare entity. However, there are still reports of cases of the disease, which is associated with high mortality, and most such cases are attributed to delayed diagnosis. Approximately 40-50% of all cases of purulent pericarditis are caused by Gram-positive bacteria, Streptococcus pneumoniae in particular. Methods: We report four cases of pneumococcal pneumonia complicated by pericarditis, with different clinical features and levels of severity. Results: In three of the four cases, the main complication was cardiac tamponade. Microbiological screening (urinary antigen testing and pleural fluid culture) confirmed the diagnosis of severe pneumococcal pneumonia complicated by purulent pericarditis. Conclusions: In cases of pneumococcal pneumonia complicated by pericarditis, early diagnosis is of paramount importance to avoid severe hemodynamic compromise. The complications of acute pericarditis appear early in the clinical course of the infection. The most serious complications are cardiac tamponade and its consequences. Antibiotic therapy combined with pericardiocentesis drastically reduces the mortality associated with purulent pericarditis. (author)

Streptococcus pneumoniae-associated pneumonia complicated by purulent pericarditis: case series

International Nuclear Information System (INIS)

Cilloniz, Catia; Torres, Antoni; Rangel, Ernesto; Barlascini, Cornelius; Piroddi, Ines Maria Grazia; Nicolini, Antonello

2015-01-01

Objective: In the antibiotic era, purulent pericarditis is a rare entity. However, there are still reports of cases of the disease, which is associated with high mortality, and most such cases are attributed to delayed diagnosis. Approximately 40-50% of all cases of purulent pericarditis are caused by Gram-positive bacteria, Streptococcus pneumoniae in particular. Methods: We report four cases of pneumococcal pneumonia complicated by pericarditis, with different clinical features and levels of severity. Results: In three of the four cases, the main complication was cardiac tamponade. Microbiological screening (urinary antigen testing and pleural fluid culture) confirmed the diagnosis of severe pneumococcal pneumonia complicated by purulent pericarditis. Conclusions: In cases of pneumococcal pneumonia complicated by pericarditis, early diagnosis is of paramount importance to avoid severe hemodynamic compromise. The complications of acute pericarditis appear early in the clinical course of the infection. The most serious complications are cardiac tamponade and its consequences. Antibiotic therapy combined with pericardiocentesis drastically reduces the mortality associated with purulent pericarditis. (author)

Methylation of 23S rRNA nucleotide G748 by RlmAII methyltransferase renders Streptococcus pneumoniae telithromycin susceptible.

Science.gov (United States)

Takaya, Akiko; Sato, Yoshiharu; Shoji, Tatsuma; Yamamoto, Tomoko

2013-08-01

Several posttranscriptional modifications of bacterial rRNAs are important in determining antibiotic resistance or sensitivity. In all Gram-positive bacteria, dimethylation of nucleotide A2058, located in domain V of 23S rRNA, by the dimethyltransferase Erm(B) results in low susceptibility and resistance to telithromycin (TEL). However, this is insufficient to produce high-level resistance to TEL in Streptococcus pneumoniae. Inactivation of the methyltransferase RlmA(II), which methylates the N-1 position of nucleotide G748, located in hairpin 35 of domain II of 23S rRNA, results in increased resistance to TEL in erm(B)-carrying S. pneumoniae. Sixteen TEL-resistant mutants (MICs, 16 to 32 μg/ml) were obtained from a clinically isolated S. pneumoniae strain showing low TEL susceptibility (MIC, 2 μg/ml), with mutation resulting in constitutive dimethylation of A2058 because of nucleotide differences in the regulatory region of erm(B) mRNA. Primer extension analysis showed that the degree of methylation at G748 in all TEL-resistant mutants was significantly reduced by a mutation in the gene encoding RlmA(II) to create a stop codon or change an amino acid residue. Furthermore, RNA footprinting with dimethyl sulfate and a molecular modeling study suggested that methylation of G748 may contribute to the stable interaction of TEL with domain II of 23S rRNA, even after dimethylation of A2058 by Erm(B). This novel finding shows that methylation of G748 by RlmA(II) renders S. pneumoniae TEL susceptible.

Streptococcus pneumoniae and Haemophilus influenzae as etiological agents of conjunctivitis outbreaks in the region of Ribeirão Preto, SP, Brazil

Directory of Open Access Journals (Sweden)

Marta I. C. MEDEIROS

1998-01-01

Full Text Available In the study of conjunctivitis outbreaks occurring from September 1994 to September 1996 in the region of Ribeirão Preto, conjunctival exudates of 92 patients were cultivated in Instituto Adolfo Lutz Laboratory I, Ribeirão Preto. Most cases occurred in the age range 2-7 years. The etiological agents which were most frequently isolated from the analyzed cases were: Streptococcus pneumoniae and Haemophilus influenzae, in 40.22% and 21.74%, respectively. 51.35% of the S. pneumoniae isolated strains were not typable. The oxacillin-resistant S. pneumoniae strains were submitted to the minimum inhibitory concentration test (MIC and three of them presented intermediate resistance, whereas only one was highly resistant to penicillin.No estudo de surtos de conjuntivite ocorridos no período de setembro de 1994 a setembro de 1996, na região de Ribeirão Preto, foram semeadas no Instituto Adolfo Lutz Laboratório I, Ribeirão Preto, exsudatos conjuntivais de 92 pacientes, sendo que a maioria dos casos estava na faixa etária de 2-7 anos. Os agentes etiológicos mais freqüentemente isolados dos casos analisados foram: Streptococcus pneumoniae e Haemophilus influenzae em 40,22% e 21,74% respectivamente. 51,35% das cepas de S. pneumoniae isoladas foram não tipáveis. As cepas de S. pneumoniae oxacilina resistente foram submetidas ao teste de concentração inibitória mínima (CIM, sendo que três apresentaram resistência intermediária e apenas uma foi altamente resistente à penicilina.

Drug-resistance in Streptococcus pneumoniae isolates among Spanish middle aged and older adults with community-acquired pneumonia

Directory of Open Access Journals (Sweden)

Raga-Luria Xavier

2009-03-01

Full Text Available Abstract Background Pneumococcal diseases remain a major cause of morbidity and mortality worldwide. Updated data on drug-resistance from different populations may be important to recognize changes in disease patterns. This study assessed current levels of penicilin resistance among Streptococcus Pneumoniae causing pneumonia in Spanish middle age and older adults. Methods Antimicrobial susceptibility was tested for 104 consecutive isolates of Streptococcus pneumoniae recovered from patients 50 years or older with radiographically confirmed pneumonia in the region of Tarragona (Spain between 2002 and 2007. According to the minimum inhibitory concentration of tested antimicrobials (penicillin, erythromycin, cefotaxime and levofloxacin strains were classified as susceptible or resistant. Antimicrobial resistance was determined for early cases (2002–2004 and contemporary cases (2005–2007. Results Twenty-seven (25.9% were penicillin-resistant strains (19 strains with intermediate resistance and 8 strains with high resistance. Penicillin-resistance was higher in 2002–2004 than in 2005–2007 (39.5% vs 18.2%, p = 0.017. Of 27 penicillin-resistant strains, 10 (37% were resistant to erythromycin, 8 (29.6% to cefotaxime, 2 (7.4% to levofloxacin, and 4 (14.8% were identified as multidrug resistant. Case-fatality rate was higher among those patients who had an infection caused by any penicillin susceptible strain (16.9% than in those with infections due to penicillin-resistant strains. Conclusion Resistance to penicillin among Streptococcus pneumoniae remains high, but such resistance does not result in increased mortality in patients with pneumococcal pneumonia.

Determination of Trimethoprim-Sulfamethoxazole Resistance in Streptococcus pneumoniae by Using the E Test with Mueller-Hinton Agar Supplemented with Sheep or Horse Blood May Be Unreliable

Science.gov (United States)

Lovgren, M.; Dell’Acqua, L.; Palacio, R.; Echániz-Aviles, G.; Soto-Noguerón, A.; Castañeda, E.; Agudelo, C. I.; Heitmann, I.; Brandileone, M. C.; Zanella, R. C.; Rossi, A.; Pace, J.; Talbot, J. A.

1999-01-01

An international, multicenter study compared trimethoprim-sulfamethoxazole MICs for 743 Streptococcus pneumoniae isolates (107 to 244 isolates per country) by E test, using Mueller-Hinton agar supplemented with 5% defibrinated horse blood or 5% defibrinated sheep blood, with MICs determined by the National Committee for Clinical Laboratory Standards broth microdilution reference method. Agreement within 1 log2 dilution and minor error rates were 69.3 and 15.5%, respectively, on sheep blood-supplemented agar and 76.9 and 13.6%, respectively, with horse blood as the supplement. Significant interlaboratory variability was observed. E test may not be a reliable method for determining the resistance of pneumococci to trimethoprim-sulfamethoxazole. PMID:9854095

Streptococcus pneumoniae, mecanismos de resistencia antimicrobiana

Directory of Open Access Journals (Sweden)

Amauri Noda Albelo

2011-09-01

Full Text Available El Streptococcus pneumoniae, principal agente causal de la neumonía comunitaria, líder en la etiología de la otitis media y la meningitis, en las últimas 3 décadas ha incrementado, de manera importante, su resistencia a los agentes terapéuticos más utilizados, como los betalactámicos, macrólidos, azálidos y fluroquinolonas. La versatilidad adaptativa del microorganismo le ha permitido crear mecanismos capaces de sobreponerse a cualquiera de estas agresiones terapéuticas con un grado variable de eficacia. Se realiza una revisión de los mecanismos más importantes implicados en la adquisición de resistencia antimicrobiana por S. pneumoniae, y se precisan algunos de los factores de riesgo implicados en infección por S. pneumoniae resistente.

The post-vaccine microevolution of invasive Streptococcus pneumoniae

NARCIS (Netherlands)

Cremers, Amelieke J H; Mobegi, Fredrick M; de Jonge, Marien I; van Hijum, Sacha A F T; Meis, Jacques F; Hermans, Peter W M; Ferwerda, Gerben; Bentley, Stephen D; Zomer, Aldert L

2015-01-01

The 7-valent pneumococcal conjugated vaccine (PCV7) has affected the genetic population of Streptococcus pneumoniae in pediatric carriage. Little is known however about pneumococcal population genomics in adult invasive pneumococcal disease (IPD) under vaccine pressure. We sequenced and serotyped

Characterisation of Invasive Streptococcus pneumoniae Isolated from Cambodian Children between 2007 - 2012.

Science.gov (United States)

Moore, Catrin E; Giess, Adam; Soeng, Sona; Sar, Poda; Kumar, Varun; Nhoung, Pheakdey; Bousfield, Rachel; Turner, Paul; Stoesser, Nicole; Day, Nicholas P J; Parry, Christopher M

2016-01-01

The 13-valent pneumococcal vaccine (PCV13) was introduced in Cambodia in January 2015. There are limited data concerning the common serotypes causing invasive pneumococcal disease (IPD). Knowledge of the circulating pneumococcal serotypes is important to monitor epidemiological changes before and after vaccine implementation. All episodes of IPD defined by the isolation of Streptococcus pneumoniae from blood, cerebrospinal fluid or other sterile site in Cambodian children admitted to the Angkor Hospital for Children in Siem Reap, Northwestern Cambodia, between 1st January 2007 and 1st July 2012 were retrospectively studied. Streptococcus pneumoniae isolates that could be retrieved underwent phenotypic typing and whole genome sequencing. There were 90 Cambodian children hospitalized with IPD with a median (IQR) age of 2.3 years (0.9-6.2). The case fatality was 15.6% (95% CI 8-23). Of 50 Streptococcus pneumoniae isolates available for further testing, 46% were penicillin non-susceptible and 8% were ceftriaxone non-susceptible, 78% were cotrimoxazole resistant, 30% were erythromycin resistant and 30% chloramphenicol resistant. There were no significant changes in resistance levels over the five-year period. The most common serotypes were 1 (11/50; 22%), 23F (8/50; 16%), 14 (6/50; 12%), 5 (5/50; 10%) and 19A (3/50; 6%). Coverage by PCV7, PCV10 and PCV13 was 44%, 76% and 92% respectively. We identified novel multilocus sequence types and resistotypes using whole genome sequencing. This study suggests IPD is an important disease in Cambodian children and can have a significant mortality. PCV13 coverage of the serotypes determined in studied strains was high and consistent with another recent study. The phenotypic resistance patterns observed were similar to other regional studies. The use of whole genome sequencing in the present study provides additional typing and resistance information together with the description of novel sequence types and resistotypes.

Characterisation of Invasive Streptococcus pneumoniae Isolated from Cambodian Children between 2007 - 2012.

Directory of Open Access Journals (Sweden)

Catrin E Moore

Full Text Available The 13-valent pneumococcal vaccine (PCV13 was introduced in Cambodia in January 2015. There are limited data concerning the common serotypes causing invasive pneumococcal disease (IPD. Knowledge of the circulating pneumococcal serotypes is important to monitor epidemiological changes before and after vaccine implementation.All episodes of IPD defined by the isolation of Streptococcus pneumoniae from blood, cerebrospinal fluid or other sterile site in Cambodian children admitted to the Angkor Hospital for Children in Siem Reap, Northwestern Cambodia, between 1st January 2007 and 1st July 2012 were retrospectively studied. Streptococcus pneumoniae isolates that could be retrieved underwent phenotypic typing and whole genome sequencing.There were 90 Cambodian children hospitalized with IPD with a median (IQR age of 2.3 years (0.9-6.2. The case fatality was 15.6% (95% CI 8-23. Of 50 Streptococcus pneumoniae isolates available for further testing, 46% were penicillin non-susceptible and 8% were ceftriaxone non-susceptible, 78% were cotrimoxazole resistant, 30% were erythromycin resistant and 30% chloramphenicol resistant. There were no significant changes in resistance levels over the five-year period. The most common serotypes were 1 (11/50; 22%, 23F (8/50; 16%, 14 (6/50; 12%, 5 (5/50; 10% and 19A (3/50; 6%. Coverage by PCV7, PCV10 and PCV13 was 44%, 76% and 92% respectively. We identified novel multilocus sequence types and resistotypes using whole genome sequencing.This study suggests IPD is an important disease in Cambodian children and can have a significant mortality. PCV13 coverage of the serotypes determined in studied strains was high and consistent with another recent study. The phenotypic resistance patterns observed were similar to other regional studies. The use of whole genome sequencing in the present study provides additional typing and resistance information together with the description of novel sequence types and resistotypes.

Correlations between computed tomography findings and clinical manifestations of Streptococcus pneumoniae pneumonia

International Nuclear Information System (INIS)

Yagihashi, Kunihiro; Kurihara, Yasuyuki; Fujikawa, Atsuko; Matsuoka, Shin; Nakajima, Yasuo

2011-01-01

The aim of this study was to characterize the imaging features and compare computed tomography (CT) findings with clinical features of patients with Streptococcus pneumoniae pneumonia. We retrospectively reviewed 75 patients (44 men, 31 women; mean age 67 years) diagnosed with S. pneumoniae pneumonia who underwent chest CT scanning at our institution between January 2007 and August 2008. Diagnoses were based on detection of the S. pneumoniae antigen in urine. Chest CT scans revealed abnormalities in all patients. The predominant opacity patterns were an airspace pneumonia pattern (48%) and a bronchopneumonia pattern (48%), followed by an interstitial pneumonia pattern (4%). Consolidation was observed most frequently (84%) followed by ground glass opacity (82.7%), bronchial wall thickening (61.3%), and centrilobular nodules (49.3%). Airway dilatation (21.6%), pleural effusion (33.3%), lymphadenopathy (34.8%), and pulmonary emphysema (21.3%) were also observed. Pulmonary emphysema was significantly less frequent in patients with the bronchopneumonia pattern than in those without (p=0.007). The clinical features and CT findings did not differ significantly. CT image analysis showed that patients with S. pneumoniae pneumonia exhibited the bronchopneumonia and airspace pneumonia patterns with equal frequency. Bronchopneumonia pattern was less common in patients with preexisting emphysema. (author)

Carrier state of Haemophilus influenzae type b (Hib, Streptococcus pneumoniae, Streptococcus pyogenes, Neisseria meningitidis and Corynebacterium diphtheriae among school children in Pokhara, Nepal

Directory of Open Access Journals (Sweden)

Dharm Raj Bhatta

2014-02-01

Full Text Available Objective: To determine the incidence of carrier state of Haemophilus influenzae type b, Streptococcus pneumoniae (S. pneumoniae, Streptococcus pyogenes, Neisseria meningitidis and Corynebacterium diphtheriae among school children. Methods: Specimen from posterior pharyngeal wall and tonsils were collected on calcium alginate coated swabs from 1 02 participants. Processing of specimen and antimicrobial susceptibility testing was done by standard procedures. Results: Potential pathogens isolated in our study were S. pneumoniae (14.7%, Staphylococcus aureus (12.7%, Corynebacterium diphtheriae (3.9%, Streptococcus pyogenes (3.9% and Haemophilus influenzae (1.9%. Important findings in antibiogram include high resistance of S. pneumoniae to penicillin (73% and resistance of Staphylococcus aureus to oxacillin (23%. Conclusions: Pharyngeal colonization by S. pneumoniae among school children was found high and there is need of introduction of pneumococcal vaccines among children. Despite expected universal vaccination, pharyngeal colonization by Corynebacterium diphtheriae is possible and there is possibility of transmission.

Flomoxef showed excellent in vitro activity against clinically important gram-positive and gram-negative pathogens causing community- and hospital-associated infections.

Science.gov (United States)

Yang, Qiwen; Zhang, Hui; Cheng, Jingwei; Xu, Zhipeng; Hou, Xin; Xu, Yingchun

2015-04-01

The objective of this study was to better understand the in vitro activity of flomoxef against clinical pathogens. A total of 545 clinical isolates, including Escherichia coli, Klebsiella pneumoniae, Proteus mirabilis, methicillin-susceptible Staphylococcus aureus (MSSA), methicillin-resistant S. aureus, Streptococcus pneumoniae, and Streptococcus pyogenes, were isolated consecutively from clinical specimens from Peking Union Medical College Hospital in 2013. MICs were determined using broth microdilution method. esbl and ampC genes were detected by polymerase chain reaction and sequencing. Flomoxef showed excellent activity against E. coli, K. pneumoniae, and P. mirabilis isolates, with susceptibility rate of 88.8%, 88.3%, and 97.7%, separately. Moreover, flomoxef exhibited great activity against extended-spectrum beta-lactamase (ESBL) producers, with MIC50/MIC90 of 0.125/(0.5-1) μg/mL. Flomoxef showed MIC50/MIC90 of 0.5/0.5 μg/mL against MSSA, 0.125/0.25 μg/mL against S. pyogenes, and 2/16 μg/mL against S. pneumoniae. In conclusion, flomoxef is one of the cephamycins showing excellent activity against ESBL-producing or ESBL-nonproducing E. coli, K. pneumoniae, and P. mirabilis and was also potent against MSSA, S. pyogenes, and S. pneumoniae. Copyright © 2015 Elsevier Inc. All rights reserved.

Evolution of Streptococcus pneumoniae and its close commensal relatives

DEFF Research Database (Denmark)

Kilian, Mogens; Poulsen, Knud; Blomqvist, Trinelise

2008-01-01

Streptococcus pneumoniae is a member of the Mitis group of streptococci which, according to 16S rRNA-sequence based phylogenetic reconstruction, includes 12 species. While other species of this group are considered prototypes of commensal bacteria, S. pneumoniae is among the most frequent microbial...... of unique genes and their origin support the model that the entire cluster of S. pneumoniae, S. pseudopneumoniae, and S. mitis lineages evolved from pneumococcus-like bacteria presumably pathogenic to the common immediate ancestor of hominoids. During their adaptation to a commensal life style, most...

Dyrkningsnegativ Streptococcus pneumoniae endokarditis diagnosticeret med polymerasekaedereaktion

DEFF Research Database (Denmark)

Rasmussen, Rasmus Vedby; Kemp, Michael; Bangsborg, Jette Marie

2008-01-01

A 60-year old man was admitted with sepsis and meningitis of unknown aetiology. Underlying aortic valve endocarditis was diagnosed by echocardiography and severe insufficiency led to aortic valve replacement. Application of broad-range PCR to cusp tissue revealed a DNA product, and a diagnosis of...... of Streptococcus pneumoniae endocarditis was obtained by DNA sequencing....

Purification, crystallization and preliminary X-ray analysis of 3-hydroxy-3-methylglutaryl-coenzyme A reductase of Streptococcus pneumoniae

International Nuclear Information System (INIS)

Zhang, Liping; Feng, Lingling; Zhou, Li; Gui, Jie; Wan, Jian; Hu, Xiaopeng

2010-01-01

3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) reductase of Streptococcus pneumoniae has been cloned, overexpressed and purified to homogeneity using Ni–NTA affinity chromatography. Crystals were obtained using the hanging-drop vapour-diffusion method. Class II 3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) reductases are potential targets for novel antibiotic development. In order to obtain a precise structural model for use in virtual screening and inhibitor design, HMG-CoA reductase of Streptococcus pneumoniae was cloned, overexpressed and purified to homogeneity using Ni–NTA affinity chromatography. Crystals were obtained using the hanging-drop vapour-diffusion method. A complete data set was collected from a single frozen crystal on a home X-ray source. The crystal diffracted to 2.3 Å resolution and belonged to the orthorhombic space group C222 1 , with unit-cell parameters a = 773.4836, b = 90.3055, c = 160.5592 Å, α = β = γ = 90°. Assuming the presence of two molecules in the asymmetric unit, the solvent content was estimated to be 54.1% (V M = 2.68 Å 3 Da −1 )

JST Thesaurus Headwords and Synonyms: Streptococcus pneumoniae [MeCab user dictionary for science technology term[Archive

Lifescience Database Archive (English)

Full Text Available MeCab user dictionary for science technology term Streptococcus pneumoniae 名詞 一般 * ...* * * 肺炎球菌 ハイエンキュウキン ハイエンキューキン Thesaurus2015 200906003627228649 C LS07 UNKNOWN_2 Streptococcus pneumoniae

Epidemiology of Streptococcus pneumoniae and Staphylococcus aureus colonization in healthy Venezuelan children

OpenAIRE

Quintero, B.; Araque, M.; van der Gaast-de Jongh, C.; Escalona, F.; Correa, M.; Morillo-Puente, S.; Vielma, S.; Hermans, P. W. M.

2010-01-01

Streptococcus pneumoniae and Staphylococcus aureus cause significant morbidity and mortality worldwide. We investigated both the colonization and co-colonization characteristics for these pathogens among 250 healthy children from 2 to 5?years of age in Merida, Venezuela, in 2007. The prevalence of S. pneumoniae colonization, S. aureus colonization, and S. pneumoniae?S. aureus co-colonization was 28%, 56%, and 16%, respectively. Pneumococcal serotypes 6B (14%), 19F (12%), 23F (12%), 15 (9%), 6...

Lung abscess due to Streptococcus pneumoniae simulating pulmonary tuberculosis: presentation of two cases

Directory of Open Access Journals (Sweden)

Alessandro Perazzo

2014-03-01

Full Text Available In the past, anaerobes were the most common cause of community-acquired lung abscess; Streptococcus species were the second most common cause. In recent years, this has changed. Klebsiella pneumoniae is now most common cause of community- acquired lung abscess, although Streptococcus species remain pathogen of major importance. We present two cases of pulmonary cavitation due to Streptococcus pneumoniae which resembled pulmonary tuberculosis with regards to their history and radiological findings. These are examples of a common diagnosis presenting in an uncommon way. Our cases had some peculiarities: they had a clinical picture strongly suggestive of pulmonary tuberculosis or lung cancer rather than necrotizing infectious pneumonia in patients with no comorbidities or underlying diseases (including oral or dental pathologies. Radiological findings did not help the clinicians: pulmonary tuberculosis was the first diagnostic hypothesis in both cases. An underlying lung cancer was excluded in the first case only after invasive pulmonary procedures.

Outbreak of Streptococcus pneumoniae in a Psychiatric Unit

Centers for Disease Control (CDC) Podcasts

2012-11-02

Dr. Katherine Fleming-Dutra, an epidemiologist at CDC, discusses her investigation of a Streptococcus pneumoniae outbreak in a pediatric psychiatric unit.  Created: 11/2/2012 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID); National Center for Immunization and Respiratory Diseases (NCIRD).   Date Released: 11/5/2012.

Bright fluorescent Streptococcus pneumoniae for live cell imaging of host-pathogen interactions

NARCIS (Netherlands)

Kjos, M.; Aprianto, R.; Fernandes, V.E.; Andrew, P.W.; Strijp, van J.A.G.; Nijland, R.; Veening, J.W.

2015-01-01

Streptococcus pneumoniae is a common nasopharyngeal resident in healthy people, but at the same time one of the major causes of infectious diseases such as pneumonia, meningitis and sepsis. The shift from commensal to pathogen and its interaction with host cells is poorly understood. One of the

Bright Fluorescent Streptococcus pneumoniae for Live-Cell Imaging of Host-Pathogen Interactions

NARCIS (Netherlands)

Kjos, Morten; Aprianto, Rieza; Fernandes, Vitor E.; Andrew, Peter W.; van Strijp, Jos A. G.; Nijland, Reindert; Veening, Jan-Willem

Streptococcus pneumoniae is a common nasopharyngeal resident in healthy people but, at the same time, one of the major causes of infectious diseases such as pneumonia, meningitis, and sepsis. The shift from commensal to pathogen and its interaction with host cells are poorly understood. One of the

Characterization and transfer studies of macrolide resistance genes in Streptococcus pneumoniae from Denmark

DEFF Research Database (Denmark)

Nielsen, Karen L; Hammerum, Anette M; Lambertsen, Lotte M

2010-01-01

Over the last decade, erythromycin resistance has been increasing in frequency in Streptococcus pneumoniae in Denmark. In the present study, 49 non-related erythromycin-resistant S. pneumoniae isolates from invasive sites and 20 isolates from non-invasive sites were collected; antimicrobial...

Utilización de la penicilina en la infección extrameníngea por Streptococcus pneumoniae Use of penicillin in the extrameningeal infection from Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Amauri Lázaro Noda Albelo

2011-12-01

Full Text Available La resistencia del Streptococcus pneumoniae a los antibióticos betalactámicos es relativa, y puede ser superada si se incrementa la dosis de esta clase de medicamentos. La definición de susceptibilidad y resistencia del Streptococcus pneumoniae se creó originalmente para predecir respuesta al tratamiento de la infección del sistema nervioso central. La infección fuera del sistema nervioso central por la mayoría de las cepas de S. pneumoniae responde a las dosis habituales de antibióticos betalactámicos. Se realiza una revisión de los nuevos puntos de corte del Laboratory Standars Institute para sensibilidad a penicilina del patógeno, y se analiza su implicación en la terapéutica actual de la enfermedad extrameníngea por S. pneumoniae.The beta-lactamase resistance of Strepcoccus pneumoniae is relative and may to be overcome if the dose of this type of drugs is increased. The definition of oversensitivity and of resistance of above mentioned bacteria was originally created to predict the infection response of central nervous system (CNS to treatment. The infection outside of the CNS by most of strains of S. pneumoniae responds to habitual dose of betalactamic antibiotics. A review of the new cut points of Laboratory Standards Institute for the sensitivity to pathogen penicillin and its implication in current therapy of extrameningeal disease by S. pneumoniae is analyzed.

Evaluation of a PCR Assay for Detection of Streptococcus pneumoniae in Respiratory and Nonrespiratory Samples from Adults with Community-Acquired Pneumonia

OpenAIRE

Murdoch, David R.; Anderson, Trevor P.; Beynon, Kirsten A.; Chua, Alvin; Fleming, Angela M.; Laing, Richard T. R.; Town, G. Ian; Mills, Graham D.; Chambers, Stephen T.; Jennings, Lance C.

2003-01-01

Streptococcus pneumoniae is the most common cause of community-acquired pneumonia, but it is undoubtedly underdiagnosed. We used a nested PCR assay (targeting the pneumolysin gene) to detect S. pneumoniae DNA in multiple sample types from 474 adults with community-acquired pneumonia and 183 control patients who did not have pneumonia. Plasma or buffy coat samples were PCR positive in only 6 of the 21 patients with positive blood cultures for S. pneumoniae and in 12 other patients (4 of whom h...

Neutrophil evasion strategies by Streptococcus pneumoniae and Staphylococcus aureus.

Science.gov (United States)

Lewis, Megan L; Surewaard, Bas G J

2018-03-01

Humans are well equipped to defend themselves against bacteria. The innate immune system employs diverse mechanisms to recognize, control and initiate a response that can destroy millions of different microbes. Microbes that evade the sophisticated innate immune system are able to escape detection and could become pathogens. The pathogens Streptococcus pneumoniae and Staphylococcus aureus are particularly successful due to the development of a wide variety of virulence strategies for bacterial pathogenesis and they invest significant efforts towards mechanisms that allow for neutrophil evasion. Neutrophils are a primary cellular defense and can rapidly kill invading microbes, which is an indispensable function for maintaining host health. This review compares the key features of Streptococcus pneumoniae and Staphylococcus aureus in epidemiology, with a specific focus on virulence mechanisms utilized to evade neutrophils in bacterial pathogenesis. It is important to understand the complex interactions between pathogenic bacteria and neutrophils so that we can disrupt the ability of pathogens to cause disease.

Streptococcus pneumoniae – caused CAP in hospitalised patients: mortality predictors

Directory of Open Access Journals (Sweden)

Sandra Figueiredo

2008-09-01

Full Text Available Probably the most important decision in the management of Community-Acquired Pneumonia (CAP is patient site of care. Patients with Streptococcus pneumoniae-caused CAP admitted to our hospital between 1st January and 31st December 2006 were retrospectively analysed. Samples of blood, sputum, bronchial and bronchoalveolar lavage and urine were collected for microbiological testing using standard culture techniques and urine antigen detection. Pneumonia Severity Index (PSI and British Thoracic Society (BTS CURB-65 scoring tools were evaluated. The statistical treatment was performed using the SPSS 14.0 program. We included 104 patients, 67.3% male, median age 63 years old, mortality 13.4%. There was a significant association between the PSI and CURB-65 score and mortality. Despite advances, CAP is still an important health problem with a high atten - dant morbi-mortality. This study confirms the value of PSI and CURB-65 in the prediction of severe pneumonia. Resumo: A avaliação da gravidade perante qualquer caso de pneumonia adquirida na comunidade (PAC é de suma importância, pois dela decorrem decisões como a necessidade de internamento e o tratamento empírico inicial. Os autores apresentam um estudo retrospectivo, que incluiu doentes internados devido a pneumonia por Streptococcus pneumoniae durante o ano de 2006, no Hospital de São João. A confirmação etiológica de infecção foi feita por isolamentos no sangue, líquido pleural, secreções traqueobrônquicas, lavado brônquico, lavado broncoalveolar e pesquisa de antigenúria. Foram analisados os factores de risco e avaliados, com base nas normas PSI (Pneumonia Severity Index e da British Thoracic Society (BTS - CURB-65. A análise estatística foi efectuada utilizando teste T para amostras independentes e ANOVA, usando o programa de análise estatística SPSS 14.0.Foram incluídos 104 doentes com idade mediana de 63 anos, sendo 67

Antibiotic resistance of Streptococcus pneumoniae in children with acute otitis media treatment failure.

Science.gov (United States)

Zielnik-Jurkiewicz, Beata; Bielicka, Anna

2015-12-01

The emergence of antibiotic-resistant bacteria is a major cause of treatment failure in children with acute otitis media (AOM). This study aimed to analyze the types of bacterial strains in fluid isolated from the middle ear of children with AOM who did not respond to oral antibiotic treatment. We also determined the antibiotic resistance of the most frequently isolated bacterial strain (Streptococcus pneumoniae) found in these children. This was a prospective study of 157 children with AOM aged from 6 months to 7 years admitted due to unsuccessful oral antibiotic treatment. All children underwent a myringotomy, and samples of the middle ear fluid were collected for bacteriological examination. Positive bacterial cultures were obtained in 104 patients (66.2%), with Streptococcus pneumoniae (39.69%), Haemophilus influenzae (16.03%) Staphylococcus aureus (16.03%), Staphylococcus haemolyticus (6.9%) and Streptococcus pyogenes (5.34%) found most frequently. The majority (65.4%) of S. pneumoniae strains were penicillin-intermediate-resistant or penicillin-resistant, and 67.2% strains of S. pneumoniae were multidrug-resistant. We identified S. pneumoniae as the most frequently isolated pathogen from the middle ear in children with AOM treatment failure and determined that the majority of strains were antibiotic-resistant. We propose that the microbiological identification of bacterial strains and their degree of antibiotic resistance should be performed prior to therapy in order to choose the most appropriate antibiotic therapy for children with AOM treatment failure. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Characterisation of Invasive Streptococcus pneumoniae Isolated from Cambodian Children between 2007 – 2012

Science.gov (United States)

Giess, Adam; Soeng, Sona; Sar, Poda; Kumar, Varun; Nhoung, Pheakdey; Bousfield, Rachel; Turner, Paul; Stoesser, Nicole; Day, Nicholas P. J.; Parry, Christopher M.

2016-01-01

Background The 13-valent pneumococcal vaccine (PCV13) was introduced in Cambodia in January 2015. There are limited data concerning the common serotypes causing invasive pneumococcal disease (IPD). Knowledge of the circulating pneumococcal serotypes is important to monitor epidemiological changes before and after vaccine implementation. Methods All episodes of IPD defined by the isolation of Streptococcus pneumoniae from blood, cerebrospinal fluid or other sterile site in Cambodian children admitted to the Angkor Hospital for Children in Siem Reap, Northwestern Cambodia, between 1st January 2007 and 1st July 2012 were retrospectively studied. Streptococcus pneumoniae isolates that could be retrieved underwent phenotypic typing and whole genome sequencing. Results There were 90 Cambodian children hospitalized with IPD with a median (IQR) age of 2.3 years (0.9–6.2). The case fatality was 15.6% (95% CI 8–23). Of 50 Streptococcus pneumoniae isolates available for further testing, 46% were penicillin non-susceptible and 8% were ceftriaxone non-susceptible, 78% were cotrimoxazole resistant, 30% were erythromycin resistant and 30% chloramphenicol resistant. There were no significant changes in resistance levels over the five-year period. The most common serotypes were 1 (11/50; 22%), 23F (8/50; 16%), 14 (6/50; 12%), 5 (5/50; 10%) and 19A (3/50; 6%). Coverage by PCV7, PCV10 and PCV13 was 44%, 76% and 92% respectively. We identified novel multilocus sequence types and resistotypes using whole genome sequencing. Conclusions This study suggests IPD is an important disease in Cambodian children and can have a significant mortality. PCV13 coverage of the serotypes determined in studied strains was high and consistent with another recent study. The phenotypic resistance patterns observed were similar to other regional studies. The use of whole genome sequencing in the present study provides additional typing and resistance information together with the description of novel

Molecular epidemiology of penicillin-nonsusceptible Streptococcus pneumoniae among children in Greece

NARCIS (Netherlands)

D. Bogaert (Debby); G.A. Syrogiannopoulos; I.N. Grivea; R. de Groot (Ronald); N.G. Beratis; P.W.M. Hermans (Peter)

2000-01-01

textabstractA total of 145 penicillin-nonsusceptible Streptococcus pneumoniae strains were isolated from young carriers in Greece and analyzed by antibiotic susceptibility testing, serotyping, restriction fragment end labeling (RFEL), and penicillin-binding protein

[Mutant prevention concentrations of antibacterial agents to ocular pathogenic bacteria].

Science.gov (United States)

Liang, Qing-Feng; Wang, Zhi-Qun; Li, Ran; Luo, Shi-Yun; Deng, Shi-Jing; Sun, Xu-Guang

2009-01-01

To establish a method to measure mutant prevention concentration (MPC) in vitro, and to measure MPC of antibacterial agents for ocular bacteria caused keratitis. It was an experimental study. Forty strains of ocular bacteria were separated from cornea in Beijing Institute of Ophthalmology, which included 8 strains of Staphylococcus aureus, Staphylococcus epidermidis, Streptococcus pneumoniae, Pseudomonas aeruginosa and Klebsiella pneumoniae respectively. The minimal inhibitory concentration (MIC) of the levofloxacin (LVF), ofloxacin (OFL), ciprofloxacin (CIP), norfloxacin (NFL), tobramycin (TOB) and chloromycetin (CHL) were determined by agar dilution method from National Committee of Clinical Laboratory Standard (NCCLS). The MPC were measured by accumulate-bacterial methods with bacterial population inoculated more than 1.2 x 10(10) colony forming units per milliliter with Mueller-Hinton broth and tryptic soy agar plate. With the software of SPSS 11.0, the datum such as the range of MIC, MPC, MIC90 and MPC90 were calculated, and the selection index (MPC90/ MI90) and mutant selection window (MSW) were obtained. The MI90 of LVF and TOB (4 mg/L) to Staphylococcus aureus strains were the lowest. CIP showed the lowest MIC90 (0.25 mg/L) to Pseudomonas aeruginosa among six kinds of antibacterial agents. The MIC90 of LVF to Staphylococcus epidermidis (256 mg/L), Streptococcus pneumoniae (1 mg/L) and Klebsiella pneumoniae (0.25 mg/L) were lower than other antibacterial agents. The MPC90, MSW and the MPC90/MIC90 of levofloxacin showed lower values compared with other antibacterial medicines. From all the datum, the MIC90 of CHL was the highest and the activity was the weakest. Although the activity of LVF was higher to every kind of bacteria, CIP had the highest activity antibacterial to Pseudomonas aeruginosa. The capacity of CHL and TOB was weaker than Quinolones for restricting resistant mutants on ocular bacteria. LVF had the strongest capacity for restricting resistant

The Streptococcus pneumoniae Competence Regulatory System Influences Respiratory Tract Colonization ▿

OpenAIRE

Kowalko, J. E.; Sebert, M. E.

2008-01-01

The Streptococcus pneumoniae ComDE two-component signaling system controls the development of genetic competence in the bacterium and affects virulence in models of pneumonia and bacteremia. We have investigated the impact of the competence pathway during colonization of the nasopharynx, the principal ecological niche of the pneumococcus. Previous work showed that deletion of the pneumococcal CiaRH signaling system inhibited colonization and increased expression of genes required for competen...

Quorum Sensing Regulation of Competence and Bacteriocins in Streptococcus pneumoniae and mutans

Science.gov (United States)

Shanker, Erin; Federle, Michael J.

2017-01-01

The human pathogens Streptococcus pneumoniae and Streptococcus mutans have both evolved complex quorum sensing (QS) systems that regulate the production of bacteriocins and the entry into the competent state, a requirement for natural transformation. Natural transformation provides bacteria with a mechanism to repair damaged genes or as a source of new advantageous traits. In S. pneumoniae, the competence pathway is controlled by the two-component signal transduction pathway ComCDE, which directly regulates SigX, the alternative sigma factor required for the initiation into competence. Over the past two decades, effectors of cellular killing (i.e., fratricides) have been recognized as important targets of the pneumococcal competence QS pathway. Recently, direct interactions between the ComCDE and the paralogous BlpRH pathway, regulating bacteriocin production, were identified, further strengthening the interconnections between these two QS systems. Interestingly, a similar theme is being revealed in S. mutans, the primary etiological agent of dental caries. This review compares the relationship between the bacteriocin and the competence QS pathways in both S. pneumoniae and S. mutans, and hopes to provide clues to regulatory pathways across the genus Streptococcus as a potential tool to efficiently investigate putative competence pathways in nontransformable streptococci. PMID:28067778

Translation quality control is maintained by the penicillin resistance factor MurM in Streptococcus pneumoniae

DEFF Research Database (Denmark)

Shepherd, Jennifer; Ibba, Michael

2013-01-01

Streptococcus pneumoniae is a causative agent of nosocomial infections such as pneumonia, meningitis and septicaemia. Penicillin resistance in S. pneumoniae depends in part upon MurM, an aminoacyl-tRNA-ligase that attaches L-serine or L-alanine to the stem peptide lysine of Lipid II in cell wall...

Cloning, expression, purification, crystallization and preliminary X-ray analysis of the pilus-associated sortase C from Streptococcus pneumoniae

International Nuclear Information System (INIS)

Neiers, F.; Madhurantakam, C.; Fälker, S.; Normark, S.; Henriques-Normark, B.; Achour, A.

2008-01-01

Crystallization conditions and preliminary X-ray diffraction analysis of the S. pneumoniae-derived pilus-associated protein sortase C are reported. The pilus-associated sortase C from Streptococcus pneumoniae (SrtC or Srt-2) acts as a polymerase for the pilus subunit proteins RrgA and RrgB. Here, the crystallization and preliminary X-ray diffraction analysis of three crystal forms of SrtC are reported. One crystal form belongs to space group P2 1 2 1 2 1 , with unit-cell parameters a = 48.9, b = 96.9, c = 98.9 Å, α = β = γ = 90°. The other two crystal forms belong to space group P222, with unit-cell parameters a = 48.8, b = 97.2, c = 99.2 Å, α = β = γ = 90° and a = 48.6, b = 96.5, c = 98.8 Å, α = β = γ = 90°, respectively. Preliminary analysis indicates the presence of two molecules in the asymmetric unit of the crystal for all three forms

N-acetylglucosamine-Mediated Expression of nagA and nagB in Streptococcus pneumoniae

NARCIS (Netherlands)

Afzal, Muhammad; Shafeeq, Sulman; Manzoor, Irfan; Henriques-Normark, Birgitta; Kuipers, Oscar P

2016-01-01

In this study, we have explored the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylglucosamine (NAG). Transcriptome comparison of S. pneumoniae D39 wild-type grown in chemically defined medium (CDM) in the presence of 0.5% NAG to that grown in the presence of 0.5% glucose

Septic arthritis of shoeulder caused by Streptococcus pneumoniae serotype 23F in a female infant. Report of a case

Directory of Open Access Journals (Sweden)

Flores Nava Gerardo

2014-07-01

Full Text Available We present the case of a female infant previously vaccinated against Streptococcus pneumoniae who developed a septic arthritis in the right shoulder. An artrothomy was performed. The culture of the sy- novial fluid was positive for serotype 23F Streptococcus pneumonia.

Radiolabeling of gemifloxacin with technetium-99m and biological evaluation in artificially Streptococcus pneumoniae infected rats

International Nuclear Information System (INIS)

Syed Qaiser Shah; Muhammad Rafiullah Khan

2011-01-01

In the current investigation complexation of the gemifloxacin (GIN) with technetium-99 m ( 99m Tc) and its biological evaluation in artificially Streptococcus pneumoniae (S. pneumoniae) infected rats was assessed as potential S. pneumoniae infection radiotracer. Radiochemically the 99m Tc-GIN complex was further analyzed in terms of stability in saline, in vitro stability in serum at 37 deg C, in vitro binding with S. pneumoniae and biodistribution in artificially S. pneumoniae (living and heat killed) infected rats. The complex was found 97.25 ± 0.25% radiochemically stable in saline at 30 min after reconstitution. The stability of the 99m Tc-GIN complex was decreased to 90.50 ± 0.20% within 240 min after reconstitution. In serum the 99m Tc-GIN complex showed stable profile with the appearance of 18.85% free tracer within 16 h of incubation. The 99m Tc-GIN complex showed saturated in vitro binding with S. pneumoniae after different intervals. Almost five fold uptake was observed in living S. pneumoniae infected muscle of the rats as compared to the inflamed and normal muscle. No significant difference in the uptake of heat killed S. pneumoniae infected, inflamed and normal muscles of the rats. The high RCP yield in saline, in vitro permanence in serum, in vitro binding with living S. pneumoniae and biodistribution in artificially S. pneumoniae infected rats we recommend the 99m Tc-GIN as potential S. pneumoniae infection radiotracer. (author)

Utilización de la penicilina en la infección extrameníngea por Streptococcus pneumoniae

OpenAIRE

Amauri Lázaro Noda Albelo; Lázaro Arturo Vidal Tallet; Joan Iavier Vidal Casal; Leanet Hernández Álvarez

2011-01-01

La resistencia del Streptococcus pneumoniae a los antibióticos betalactámicos es relativa, y puede ser superada si se incrementa la dosis de esta clase de medicamentos. La definición de susceptibilidad y resistencia del Streptococcus pneumoniae se creó originalmente para predecir respuesta al tratamiento de la infección del sistema nervioso central. La infección fuera del sistema nervioso central por la mayoría de las cepas de S. pneumoniae responde a las dosis habituales de antibióticos beta...

Overexpression, purification and crystallization of a choline-binding protein CbpI from Streptococcus pneumoniae

International Nuclear Information System (INIS)

Paterson, Neil G.; Riboldi-Tunicliffe, Alan; Mitchell, Timothy J.; Isaacs, Neil W.

2006-01-01

The choline-binding protein CbpI from S. pneumoniae has been purified and crystallized and diffraction data have been collected to 3.5 Å resolution. The choline-binding protein CbpI from Streptococcus pneumoniae is a 23.4 kDa protein with no known function. The protein has been successfully purified initially using Ni–NTA chromatography and to homogeneity using Q-Sepharose ion-exchange resin as an affinity column. CbpI was crystallized using PEG 3350 as a precipitant and X-ray crystallographic analysis showed that the crystals belonged to the tetragonal space group P4, with unit-cell parameters a = b = 83.31, c = 80.29 Å, α = β = γ = 90°. The crystal contains two molecules in the asymmetric unit with a solvent content of 55.7% (V M = 2.77 Å 3 Da −1 ) and shows a diffraction limit of 3.5 Å

Overexpression, purification and crystallization of a choline-binding protein CbpI from Streptococcus pneumoniae

Energy Technology Data Exchange (ETDEWEB)

Paterson, Neil G., E-mail: neison@chem.gla.ac.uk; Riboldi-Tunicliffe, Alan [Department of Chemistry and WestCHEM, Glasgow Biomedical Research Centre (GBRC), University of Glasgow, 120 University Place, Glasgow G12 8TA,Scotland (United Kingdom); Mitchell, Timothy J. [Division of Infection and Immunity (IBLS), Glasgow Biomedical Research Centre (GBRC), University of Glasgow, 120 University Place, Glasgow G12 8TA,Scotland (United Kingdom); Isaacs, Neil W. [Department of Chemistry and WestCHEM, Glasgow Biomedical Research Centre (GBRC), University of Glasgow, 120 University Place, Glasgow G12 8TA,Scotland (United Kingdom)

2006-07-01

The choline-binding protein CbpI from S. pneumoniae has been purified and crystallized and diffraction data have been collected to 3.5 Å resolution. The choline-binding protein CbpI from Streptococcus pneumoniae is a 23.4 kDa protein with no known function. The protein has been successfully purified initially using Ni–NTA chromatography and to homogeneity using Q-Sepharose ion-exchange resin as an affinity column. CbpI was crystallized using PEG 3350 as a precipitant and X-ray crystallographic analysis showed that the crystals belonged to the tetragonal space group P4, with unit-cell parameters a = b = 83.31, c = 80.29 Å, α = β = γ = 90°. The crystal contains two molecules in the asymmetric unit with a solvent content of 55.7% (V{sub M} = 2.77 Å{sup 3} Da{sup −1}) and shows a diffraction limit of 3.5 Å.

The Proteasome-Ubiquitin System Is Required for Efficient Killing of Intracellular Streptococcus pneumoniae by Brain Endothelial Cells

NARCIS (Netherlands)

Iovino, Federico; Gradstedt, Henrik; Bijlsma, Jetta J.

2014-01-01

Streptococcus pneumoniae (pneumococcus) is a Gram-positive bacterium that causes serious invasive diseases, such as pneumonia, bacteremia, and meningitis, with high morbidity and mortality throughout the world. Before causing invasive disease, S. pneumoniae encounters cellular barriers, which are

The comparative development of elevated resistance to macrolides in community-acquired pneumonia caused by Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Yayan J

2014-10-01

Full Text Available Josef Yayan Department of Internal Medicine, Division of Pulmonary, Allergy and Sleep Medicine, Saarland University Medical Center, Homburg/Saar, Germany Background: Community-acquired pneumonia (CAP is an acute inflammation of the lungs, which is often caused by Streptococcus pneumoniae. CAP is the leading cause of death by infectious disease in industrialized countries. Therefore, an immediate and effective antibiotic therapy is of great importance for the nonfatal outcome of the disease. The literature contains increasing data about the development of resistance to antibiotics that are used for the treatment of CAP caused by S. pneumoniae; this article also examines the possible development of resistance to antibiotics in S. pneumoniae in recent years.Methods: Within the study period of 2004–2014, all hospital charts from patients with CAP caused by S. pneumoniae were collected from the Department of Internal Medicine, Saarland University Medical Center, Homburg/Saar, Germany. The tracheal secretions of S. pneumoniae in CAP patients were obtained by bronchoalveolar lavage; bronchial aspirates were obtained through flexible bronchoscopy and directly from sputum, and blood cultures were examined microbiologically for microorganisms.Results: From a total of 100 patients with CAP caused by S. pneumoniae, 23 (53.49% [34.78% female], 95% confidence interval, 38.58–68.4 patients with a mean age of 59.78±15.77 years met the inclusion criteria of this investigation. These patients were compared to a total of 20 (46.51% [35% female], 95% confidence interval, 31.6–61.42 patients with a mean age of 58.9±13.36 years with CAP who were infested with S. pneumoniae. In the latter group, the streptococcal antigen was detected in pulmonary aspirations by bronchoscopy or in urine using polymerase chain reaction and a rapid pneumococcal test. Penicillin G and vancomycin had a high rate of sensitivity on the antibiogram for S. pneumoniae, which was

SUSCEPTIBILITY OF RESPIRATORY ISOLATES OF STREPTOCOCCUS PNEUMONIAE ISOLATED FROM CHILDREN HOSPITALIZED IN THE CLINICAL CENTER NIS.

Science.gov (United States)

Dinić, Marina M; Mladenović Antić, Snezana; Kocić, Branislava; Stanković Dordević, Dobrila; Vrbić, Miodrag; Bogdanović, Milena

2016-01-01

Streptococcus pneumoniae is one of the most common causes of respiratory infections. The aim was to study the susceptibility to antimicrobial agents of respiratory isolates ofStreptococcus pneumoniae obtained from hospitalized children. A total of 190 respiratory pneumococcal isolates obtained from children aged from 0 to 14 years were isolated and identified by using standard microbiological methods. Susceptibility to oxacillin, erythromycin, clindamycin, tetracycline, cotrimoxazole, ofloxacin and rifampicin was tested by disc diffusion method. Minimal inhibitory concentrations for amoxicillin and ceftriaxone were determined by means of E test. The macrolide-resistant phenotype was detected by double disc diffusion test. All tested isolates were susceptible to amoxicillin and ceftriaxone. The minimal amoxicillin concentration inhibiting the growth of 50% of isolates and of 90% of isolates was 0.50 microg/ml and 1.0 microg/ml, respectively and the minimal ceftriaxone concentration inhibiting the growth of 50% of isolates and of 90% of isolates was 0.25 microg/ml and 0.50 microg/ml, respectively. Susceptibility to erythromycin and clindamycin was observed in 21.6% and 29.47% of isolates, respectively. The resistence to macrolides-M phenotype was detected in 10.07% of isolates and constitutive macrolide-lincosamide-streptogramin phenotype (constitutive MLS phenotype) was found in 89.93% of isolates. All tested isolates were susceptible to ofloxacin and rifampicin. Amoxicillin could be the therapy of choice in pediatric practice. The macrolides should not be recommended for the empirical therapy of pneumococcal respiratory tract infection in our local area.

Streptococcus pneumoniae aislados durante 2002-2006: serotipos y resistencia antibiótica. Correlación con las vacunas existentes

Directory of Open Access Journals (Sweden)

José María Guevara-Duncan

2008-03-01

Full Text Available Objetivos: Identificar los serotipos de S. pneumoniae aislados, correlacionándolos con los incluidos en las vacunas existentes y su resistencia antimicrobiana. Diseño: Estudio descriptivo, observacional y longitudinal. Lugar: Instituto de Medicina Tropical Daniel A. Carrión, Facultad de Medicina, UNMSM. Material biológico: Cepas de Streptococcus pneumoniae. Intervenciones: Cuarenta Streptococcus pneumoniae de nuestro cepario, aislados entre el 2002 y 2006, fueron serotipificados en el Instituto de Salud Carlos III en Madrid -España; 15 fueron invasivos, 11 aislados de infecciones localizadas, 6 de portadores y 8 eran multiresistentes. Principales medidas de resultados: Protección de las vacunas existentes en nuestro medio a las infecciones causadas por Streptococcus pneumoniae. Resultados: Hubo 14 serotipos diferentes y los serogrupos más identificados fueron 23, 19 y 6. El 28,6% estaba contenido en la vacuna 7-valente, 42,9% en la 9-valente, 50% en la 11-valente y el 71,4% en la 23-valente; 57,5% fue resistente a la penicilina y 30% a eritromicina. El grupo de Streptococcus invasivo resultó más sensible a los antibióticos que los otros grupos. Los serotipos asociados a multirresistencia fueron 19F y 23F. Conclusiones: Ninguna de las vacunas protege a todas las infecciones causadas por Streptococcus pneumoniae, en nuestro medio.

Purification, crystallization and preliminary X-ray diffraction analysis of RafE, a sugar-binding lipoprotein from Streptococcus pneumoniae

International Nuclear Information System (INIS)

Paterson, Neil G.; Riboldi-Tunnicliffe, Alan; Mitchell, Timothy J.; Isaacs, Neil W.

2006-01-01

The mature form of RafE has been expressed, purified and crystallized. X-ray diffraction data have been collected to 3.65 and 2.90 Å resolution from native and selenomethionine-derivative crystals, respectively. Streptococcus pneumoniae contains a large number of sugar-transport systems and the system responsible for raffinose uptake has recently been identified. The substrate-binding protein component of this system shares strong sequence homology with the multiple sugar metabolism substrate-binding protein MsmE from S. mutans and contains a lipoprotein-attachment site at cysteine residue 23. A truncated form (residues 24–419) of RafE from S. pneumoniae was cloned and overexpressed in Escherichia coli. Native and selenomethionine-labelled protein have been crystallized in the hexagonal space group P6 1 22. Diffraction data have been successfully phased to 2.90 Å using Se SAD data and model building is in progress

Purification, crystallization and preliminary X-ray diffraction analysis of RafE, a sugar-binding lipoprotein from Streptococcus pneumoniae

Energy Technology Data Exchange (ETDEWEB)

Paterson, Neil G., E-mail: neison@chem.gla.ac.uk; Riboldi-Tunnicliffe, Alan [Department of Chemistry and WestCHEM, Glasgow Biomedical Research Centre (GBRC), University of Glasgow, 120 University Place, Glasgow G12 8TA,Scotland (United Kingdom); Mitchell, Timothy J. [Division of Infection and Immunity (IBLS), Glasgow Biomedical Research Centre (GBRC), University of Glasgow, 120 University Place, Glasgow G12 8TA,Scotland (United Kingdom); Isaacs, Neil W. [Department of Chemistry and WestCHEM, Glasgow Biomedical Research Centre (GBRC), University of Glasgow, 120 University Place, Glasgow G12 8TA,Scotland (United Kingdom)

2006-07-01

The mature form of RafE has been expressed, purified and crystallized. X-ray diffraction data have been collected to 3.65 and 2.90 Å resolution from native and selenomethionine-derivative crystals, respectively. Streptococcus pneumoniae contains a large number of sugar-transport systems and the system responsible for raffinose uptake has recently been identified. The substrate-binding protein component of this system shares strong sequence homology with the multiple sugar metabolism substrate-binding protein MsmE from S. mutans and contains a lipoprotein-attachment site at cysteine residue 23. A truncated form (residues 24–419) of RafE from S. pneumoniae was cloned and overexpressed in Escherichia coli. Native and selenomethionine-labelled protein have been crystallized in the hexagonal space group P6{sub 1}22. Diffraction data have been successfully phased to 2.90 Å using Se SAD data and model building is in progress.

Regulation of gene expression in Streptococcus pneumoniae by response regulator 09 is strain dependent

NARCIS (Netherlands)

W.T. Hendriksen (Wouter); N. Silva (Nuno); H.J. Bootsma (Hester); C.E. Blue (Clare); G.K. Paterson (Gavin); A.R. Kerr (Alison); A.S. de Jong (Arjan); O.P. Kuipers (Oscar); P.W.M. Hermans (Peter); T.J. Mitchell

2007-01-01

textabstractRecent murine studies have demonstrated that the role of response regulator 09 (RR09) of Streptococcus pneumoniae in virulence is different in different strains. In the present study, we used a murine pneumonia model of infection to assess the virulence of a TIGR4 rr09 mutant, and we

Regulation of gene expression in Streptococcus pneumoniae by response regulator 09 is strain dependent

NARCIS (Netherlands)

Hendriksen, Wouter T.; Silva, Nuno; Bootsma, Hester J.; Blue, Clare E.; Paterson, Gavin K.; Kerr, Alison R.; de Jong, Anne; Kuipers, Oscar P.; Hermans, Peter W. M.; Mitchell, Tim J.

Recent murine studies have demonstrated that the role of response regulator 09 (RR09) of Streptococcus pneumoniae in virulence is different in different strains. In the present study, we used a murine pneumonia model of infection to assess the virulence of a TIGR4 rr09 mutant, and we found that

N-acetylgalatosamine-Mediated Regulation of the aga Operon by AgaR in Streptococcus pneumoniae

NARCIS (Netherlands)

Afzal, Muhammad; Shafeeq, Sulman; Ahmed, Hifza; Kuipers, Oscar P

2016-01-01

Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa). Transcriptome comparison of S. pneumoniae D39 grown in NAGaM17 (0.5% NAGa + M17) to that grown in GM17 (0.5% Glucose + M17) revealed the elevated expression of various carbon metabolic

Streptococcus pneumoniae Supragenome Hybridization Arrays for Profiling of Genetic Content and Gene Expression.

Science.gov (United States)

Kadam, Anagha; Janto, Benjamin; Eutsey, Rory; Earl, Joshua P; Powell, Evan; Dahlgren, Margaret E; Hu, Fen Z; Ehrlich, Garth D; Hiller, N Luisa

2015-02-02

There is extensive genomic diversity among Streptococcus pneumoniae isolates. Approximately half of the comprehensive set of genes in the species (the supragenome or pangenome) is present in all the isolates (core set), and the remaining is unevenly distributed among strains (distributed set). The Streptococcus pneumoniae Supragenome Hybridization (SpSGH) array provides coverage for an extensive set of genes and polymorphisms encountered within this species, capturing this genomic diversity. Further, the capture is quantitative. In this manner, the SpSGH array allows for both genomic and transcriptomic analyses of diverse S. pneumoniae isolates on a single platform. In this unit, we present the SpSGH array, and describe in detail its design and implementation for both genomic and transcriptomic analyses. The methodology can be applied to construction and modification of SpSGH array platforms, as well to other bacterial species as long as multiple whole-genome sequences are available that collectively capture the vast majority of the species supragenome. Copyright © 2015 John Wiley & Sons, Inc.

Streptococcus pneumoniae: A Cause of Primary Lung Abscess in a Child

OpenAIRE

MacDonald, Kelly S; de Carvalho, Volia M; Liebert, Lawrence; Embree, Joanne E

1993-01-01

A case of primary pneumococcal lung abscess in a five-year-old child is described. Secondary anaerobic infection as a cause of cavitation was excluded by bronchoscopic culture of the cavity. Streptococcus pneumoniae is a rare but recognized cause of lung abscess in healthy children.

Transcriptional and metabolic effects of glucose on Streptococcus pneumoniae sugar metabolism

NARCIS (Netherlands)

Paixão, Laura; Caldas, José; Kloosterman, Tomas G; Kuipers, Oscar P; Vinga, Susana; Neves, Ana R

2015-01-01

Streptococcus pneumoniae is a strictly fermentative human pathogen that relies on carbohydrate metabolism to generate energy for growth. The nasopharynx colonized by the bacterium is poor in free sugars, but mucosa lining glycans can provide a source of sugar. In blood and inflamed tissues glucose

Streptococcus pneumoniae-induced ototoxicity in organ of Corti explant cultures.

Science.gov (United States)

Perny, Michael; Solyga, Magdalena; Grandgirard, Denis; Roccio, Marta; Leib, Stephen L; Senn, Pascal

2017-07-01

Hearing loss remains the most common long-term complication of pneumococcal meningitis (PM) reported in up to 30% of survivors. Streptococcus pneumoniae have been shown to possess different ototoxic properties. Here we present a novel ex vivo experimental setup to examine in detail the pattern of hair cell loss upon exposure to different S. pneumoniae strains, therefore recapitulating pathogen derived aspects of PM-induced hearing loss. Our results show a higher susceptibility towards S. pneumoniae-induced cochlear damage for outer hair cells (OHC) compared to inner hair cells (IHC), which is consistent with in vivo data. S. pneumoniae-induced hair cell loss was both time and dose-dependent. Moreover, we have found significant differences in the level of cell damage between tissue from the basal and the apical turns. This shows that the higher vulnerability of hair cells located at high frequency regions observed in vivo cannot be explained solely by the spatial organisation and bacterial infiltration from the basal portion of the cochlea. Using a wild type D39 strain and a mutant defective for the pneumolysin (PLY) gene, we also have shown that the toxin PLY is an important factor involved in ototoxic damages. The obtained results indicate that PLY can cause both IHC and OHC loss. Finally, we are reporting here for the first time a higher vulnerability of HC located at the basal and middle cochlear region to pneumolysin-induced damage. The detailed description of the susceptibility of hair cells to Streptococcus pneumoniae provided in this report can in the future determine the choice and the development of novel otoprotective therapies during pneumococcal meningitis. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Comparative genomic analysis of multidrug-resistant Streptococcus pneumoniae isolates

Directory of Open Access Journals (Sweden)

Pan F

2018-05-01

Full Text Available Fen Pan,1 Hong Zhang,1 Xiaoyan Dong,2 Weixing Ye,3 Ping He,4 Shulin Zhang,4 Jeff Xianchao Zhu,5 Nanbert Zhong1,2,6 1Department of Clinical Laboratory, Shanghai Children’s Hospital, Shanghai Jiaotong University, Shanghai, China; 2Department of Respiratory, Shanghai Children’s Hospital, Shanghai Jiaotong University, Shanghai, China; 3Shanghai Personal Biotechnology Co., Ltd, Shanghai, China; 4Department of Medical Microbiology and Immunology, Shanghai Jiao Tong University School of Medicine, Shanghai, China; 5Zhejiang Bioruida Biotechnology co. Ltd, Zhejiang, China; 6New York State Institute for Basic Research in Developmental Disabilities, Staten Island, NY, USA Introduction: Multidrug resistance in Streptococcus pneumoniae has emerged as a serious problem to public health. A further understanding of the genetic diversity in antibiotic-resistant S. pneumoniae isolates is needed. Methods: We conducted whole-genome resequencing for 25 pneumococcal strains isolated from children with different antimicrobial resistance profiles. Comparative analysis focus on detection of single-nucleotide polymorphisms (SNPs and insertions and deletions (indels was conducted. Moreover, phylogenetic analysis was applied to investigate the genetic relationship among these strains. Results: The genome size of the isolates was ~2.1 Mbp, covering >90% of the total estimated size of the reference genome. The overall G+C% content was ~39.5%, and there were 2,200–2,400 open reading frames. All isolates with different drug resistance profiles harbored many indels (range 131–171 and SNPs (range 16,103–28,128. Genetic diversity analysis showed that the variation of different genes were associated with specific antibiotic resistance. Known antibiotic resistance genes (pbps, murMN, ciaH, rplD, sulA, and dpr were identified, and new genes (regR, argH, trkH, and PTS-EII closely related with antibiotic resistance were found, although these genes were primarily annotated

PK-PD Integration Modeling and Cutoff Value of Florfenicol against Streptococcus suis in Pigs

Directory of Open Access Journals (Sweden)

Zhixin Lei

2018-01-01

Full Text Available The aims of the present study were to establish optimal doses and provide an alternate COPD for florfenicol against Streptococcus suis based on pharmacokinetic-pharmacodynamic integration modeling. The recommended dose (30 mg/kg b.w. were administered in healthy pigs through intramuscular and intravenous routes for pharmacokinetic studies. The main pharmacokinetic parameters of Cmax, AUC0-24h, AUC, Ke, t1/2ke, MRT, Tmax, and Clb, were estimated as 4.44 μg/ml, 88.85 μg⋅h/ml, 158.56 μg⋅h/ml, 0.048 h-1, 14.46 h, 26.11 h, 4 h and 0.185 L/h⋅kg, respectively. The bioavailability of florfenicol was calculated to be 99.14% after I.M administration. A total of 124 Streptococcus suis from most cities of China were isolated to determine the minimum inhibitory concentration (MIC of florfenicol. The MIC50 and MIC90 were calculated as 1 and 2 μg/ml. A serotype 2 Streptococcus suis (WH-2, with MIC value similar to MIC90, was selected as a representative for an in vitro and ex vivo pharmacodynamics study. The MIC values of WH-2 in TSB and plasma were 2 μg/ml, and the MBC/MIC ratios were 2 in TSB and plasma. The MPC was detected to be 3.2 μg/ml. According to inhibitory sigmoid Emax model, plasma AUC0-24h/MIC values of florfenicol versus Streptococcus suis were 37.89, 44.02, and 46.42 h for the bactericidal, bacteriostatic, and elimination activity, respectively. Monte Carlo simulations the optimal doses for bactericidal, bacteriostatic, and elimination effects were calculated as 16.5, 19.17, and 20.14 mg/kg b.w. for 50% target attainment rates (TAR, and 21.55, 25.02, and 26.85 mg/kg b.w. for 90% TAR, respectively. The PK-PD cutoff value (COPD analyzed from MCS for florfenicol against Streptococcus suis was 1 μg/ml which could provide a sensitivity cutoff value. These results contributed an optimized alternative to clinical veterinary medicine and showed that the dose of 25.02 mg/kg florfenicol for 24 h could have a bactericidal action against

Susceptibilidad a antimicrobianos en aislamientos de Streptococcus pneumoniae invasor en Colombia

OpenAIRE

Aura Lucía Leal; Castañeda Elizabeth

1999-01-01

Se realizó un estudio para determinar los patrones de susceptibilidad a los antimicrobianos de los aislamientos de Streptococcus pneumoniae causante de enfermedad invasora diagnosticada en Colombia en niños menores de 5 años entre 1994 y 1996 y para establecer la distribución de los tipos capsulares de los aislamientos resistentes. Se analizaron 324 aislamientos recuperados durante la ejecución del Protocolo Nacional de Serotipificación de S. pneumoniae realizado en Santa Fe de Bogotá, Medell...

[Yearly changes in antibacterial activities of cefozopran against various clinical isolates between 1996 and 2000--I. Gram-positive bacteria].

Science.gov (United States)

Suzuki, Yumiko; Nishinari, Chisato; Endo, Harumi; Tamura, Chieko; Jinbo, Keiko; Hiramatsu, Nobuyoshi; Akiyama, Kazumitsu; Koyama, Tsuneo

2002-04-01

The in vitro antibacterial activities of cefozopran (CZOP), an agent of cephems, against various clinical isolates obtained between 1996 and 2000 were yearly evaluated and compared with those of other cephems, oxacephems, carbapenems, and penicillins. Fifteen species, 1,062 strains, of Gram-positive bacteria were isolated from the clinical materials annually collected from January to December, and consisted of methicillin-susceptible Staphylococcus aureus (MSSA; n = 127), methicillin-resistant Staphylococcus aureus (MRSA; n = 123), Staphylococcus epidermidis (n = 104), Staphylococcus haemolyticus (n = 58), Streptococcus pyogenes (n = 100), Streptococcus agalactiae (n = 50), Streptococcus pneumoniae (n = 125), Enterococcus faecalis (n = 150), Enterococcus faecium (n = 50), Enterococcus avium (n = 50), and Peptostreptococcus spp. (P. anaerobius, P. asaccharolyticus, P. magnus, P. micros, P. prevotii; n = 125). CZOP possessed stable antibacterial activities against all strains tested throughout 5 years. The MIC90 of CZOP against MRSA and S. haemolyticus tended to decrease while against S. pneumoniae and Peptostreptococcus spp., tended to increase year by year. However, the MIC90 just changed a little and were consistent with the results from the studies performed until the new drug application approval. Increases in the MIC90 against S. pneumoniae were also observed with cefpirome (CPR), cefepime (CFPM), flomoxef (FMOX), sulbactam/cefoperazone (SBT/CPZ), and imipenem (IPM). Increases in the MIC90 against Peptostreptococcus spp. were also observed with ceftazidime (CAZ), CPR, CFPM, FMOX, SBT/CPZ, and IPM. The decreases in the sensitivities were not always considered to depend upon generation of resistant bacteria because the annual MIC range of each antibacterial agent was almost generally wide every year and the annual sensitivity of each strain to the agents extremely varied. In conclusion, the annual antibacterial activities of CZOP against the Gram

The enhanced pneumococcal LAMP assay: a clinical tool for the diagnosis of meningitis due to Streptococcus pneumoniae.

Directory of Open Access Journals (Sweden)

Dong Wook Kim

Full Text Available BACKGROUND: Streptococcus pneumoniae is a leading cause of invasive bacterial disease in developed and developing countries. We studied the loop-mediated isothermal amplification (LAMP technique to assess its suitability for detecting S. pneumoniae nucleic acid in cerebrospinal fluid (CSF. METHODOLOGY/PRINCIPAL FINDINGS: We established an improved LAMP assay targeting the lytA gene (Streptococcus pneumoniae [Sp] LAMP. The analytical specificity of the primers was validated by using 32 reference strains (10 Streptococcus and seven non-Streptococcus species plus 25 clinical alpha-hemolytic streptococcal strains, including four S. pneumoniae strains and 21 other strains (3 S. oralis, 17 S. mitis, and one Streptococcus species harboring virulence factor-encoding genes (lytA or ply. Within 30 minutes, the assay could detect as few as 10 copies of both purified DNA and spiked CSF specimens with greater sensitivity than conventional polymerase chain reaction (PCR. The linear determination range for this assay is 10 to 1,000,000 microorganisms per reaction mixture using real-time turbidimetry. We evaluated the clinical sensitivity and specificity of the Sp LAMP assay using 106 randomly selected CSF specimens from children with suspected meningitis in Korea, China and Vietnam. For comparison, CSF specimens were also tested against conventional PCR and culture tests. The detection rate of the LAMP method was substantially higher than the rates of PCR and culture tests. In this small sample, relative to the LAMP assay, the clinical sensitivity of PCR and culture tests was 54.5% and 33.3%, respectively, while clinical specificity of the two tests was 100%. CONCLUSIONS/SIGNIFICANCE: Compared to PCR, Sp LAMP detected S. pneumoniae with higher analytical and clinical sensitivity. This specific and sensitive LAMP method offers significant advantages for screening patients on a population basis and for diagnosis in clinical settings.

Internamento devido a PAC por Streptococcus pneumoniae - Avaliação de factores de mortalidade Streptococcus pneumoniae - caused CAP in hospitalised patients: mortality predictors

Directory of Open Access Journals (Sweden)

Sandra Figueiredo

2008-10-01

Full Text Available A avaliação da gravidade perante qualquer caso de pneumonia adquirida na comunidade (PAC é de suma importância, pois dela decorrem decisões como a necessidade de internamento e o tratamento empírico inicial. Os autores apresentam um estudo retrospectivo, que incluiu doentes internados devido a pneumonia por Streptococcus pneumoniae durante o ano de 2006, no Hospital de São João. A confirmação etiológica de infecção foi feita por isolamentos no sangue, líquido pleural, secreções traqueobrônquicas, lavado brônquico, lavado broncoalveolar e pesquisa de antigenúria. Foram analisados os factores de risco e avaliados, com base nas normas PSI (Pneumonia Severity Index e da British Thoracic Society (BTS - CURB-65. A análise estatística foi efectuada utilizando teste T para amostras independentes e ANOVA, usando o programa de análise estatística SPSS 14.0. Foram incluídos 104 doentes com idade mediana de 63 anos, sendo 67,3% do sexo masculino. O estudo revelou existir uma associação com significado estatístico entre os resultados de PSI e CURB-65 e a evolução para a mortalidade. Apesar da melhoria dos meios diagnósticos e profilácticos, e da terapêutica antibiótica, a pneumonia pneumocócica permanece uma entidade de grande morbilidade e mortalidade. O valor preditivo das normas PSI e CURB-65 foi confirmado nesta população de doentes, documentando uma correlação entre o número de factores de risco e a evolução da doença.Probably the most important decision in the management of Community-Acquired Pneumonia (CAP is patient site of care. Patients with Streptococcus pneumoniae-caused CAP admitted to our hospital between 1st January and 31st December 2006 were retrospectively analysed. Samples of blood, sputum, bronchial and bronchoalveolar lavage and urine were collected for microbiological testing using standard culture techniques and urine antigen detection. Pneumonia Severity Index (PSI and British Thoracic Society

Antibiotic susceptibility of Streptococcus pneumoniae colonizing the nasopharynx of Colombian children with pneumonia Susceptibilidad antimicrobiana de Streptococcus pneumoniae colonizante de nasofaringe en niños colombianos con neumonía

Directory of Open Access Journals (Sweden)

Aura Lucía Leal

1997-10-01

Full Text Available Streptococcus pneumoniae is one of the principal causal agents of acute respiratory infection (ARI in children, and its resistance to antibiotics has increased worldwide. This study examined the patterns of susceptibility to antibiotics of S. pneumoniae that had colonized the upper respiratory tract of 272 children hospitalized for pneumonia in two hospitals in Santafé de Bogotá. S. pneumoniae was isolated from 114 patients (42%. Diminished susceptibility to penicillin was noted in 19 isolates (17%, with 12 (11% having an intermediate level of sensitivity and 7 (6% showing outright resistance. Only 1 of the 19 isolates resistant to penicillin also showed resistance to ceftriaxone. There was diminished sensitivity to erythromycin in 3 isolates (3%, to chloramphenicol in 6 (5%, and to co-trimoxazole (trimethoprim + sulfamethoxazole in 46 (40%. Resistance to multiple drugs was found in 7 isolates (6%. The most commonly encountered penicillin-resistant serotype was 23F (68.4%. An association was observed between age, prior use of antibiotics, and colonization by S. pneumoniae with reduced penicillin sensitivity or multiple-drug resistance. This study confirmed the presence of antibiotic-resistant S. pneumoniae in Colombia and highlights the importance of the rational use of antibiotics and of the implementation of epidemiologic surveillance for this agent.Streptococcus pneumoniae es uno de los principales agentes causales de infección respiratoria aguda (IRA en niños y su resistencia a antibióticos se ha incrementado en todo el mundo. En este estudio se determinaron los patrones de susceptibilidad a antimicrobianos de S. pneumoniae colonizante de las vías respiratorias altas en 272 niños hospitalizados por neumonía en dos hospitales de Santafé de Bogotá. Se aisló S. pneumoniae en 114 pacientes (42%. Se observó susceptibilidad disminuida a la penicilina en 19 aislamientos (17%, con sensibilidad intermedia en 12 (11% y franca resistencia

Susceptibilidad antimicrobiana de Streptococcus pneumoniae colonizante de nasofaringe en niños colombianos con neumonía Antibiotic susceptibility of Streptococcus pneumoniae colonizing the nasopharynx of Colombian children with pneumonia

Directory of Open Access Journals (Sweden)

Aura Lucía Leal

1997-04-01

Full Text Available Streptococcus pneumoniae es uno de los principales agentes causales de infección respiratoria aguda (IRA en niños y su resistencia a antibióticos se ha incrementado en todo el mundo. En este estudio se determinaron los patrones de susceptibilidad a antimicrobianos de S. pneumoniae colonizante de las vías respiratorias altas en 272 niños hospitalizados por neumonía en dos hospitales de Santafé de Bogotá. Se aisló S. pneumoniae en 114 pacientes (42%. Se observó susceptibilidad disminuida a la penicilina en 19 aislamientos (17%, con sensibilidad intermedia en 12 (11% y franca resistencia en 7 (6%. Solo 1 de los 19 aislamientos resistentes a penicilina mostró también resistencia a la ceftriaxona. Se observó sensibilidad disminuida a la eritromicina en 3 aislamientos (3%, al cloranfenicol en 6 (5% y al cotrimoxazol (trimetoprima + sulfametoxazol en 46 (40%. Se encontró multirresistencia en 7 aislamientos (6%. El serotipo con sensibilidad disminuida a la penicilina que se halló con mayor frecuencia fue el 23F (68,4%. Se observó una asociación entre la edad, el uso previo de antibióticos y la colonización con S. pneumoniae con susceptibilidad disminuida a la penicilina o multirresistencia. Este estudio confirma la presencia de resistencia antimicrobiana de S. pneumoniae en Colombia y resalta la importancia del uso racional de los antibióticos y de la implementación de la vigilancia epidemiológica sobre este agente.Streptococcus pneumoniae is one of the principal causal agents of acute respiratory infection (ARI in children, and its resistance to antibiotics has increased worldwide. This study examined the patterns of susceptibility to antibiotics of S. pneumoniae that had colonized the upper respiratory tract of 272 children hospitalized for pneumonia in two hospitals in Santafé de Bogotá. S. pneumoniae was isolated from 114 patients (42%. Diminished susceptibility to penicillin was noted in 19 isolations (17%, with 12 (11

Streptococcus pneumoniae sepsis as the initial presentation of systemic lupus erythematosus

Directory of Open Access Journals (Sweden)

Erdem I

2016-09-01

Full Text Available Ilknur Erdem,1 Senay Elbasan Omar,1 Ridvan Kara Ali,1 Hayati Gunes,2 Aynur Eren Topkaya2 1Department of Infectious Diseases, 2Department of Medical Microbiology, Faculty of Medicine, Namik Kemal University, Tekirdag, Turkey Objective: Infections are among the most important causes of morbidity and mortality in patients with systemic lupus erythematosus (SLE but are rare initial presentation of the disease. Therefore, in this study, we describe a case of Streptococcus pneumoniae sepsis in a young woman with previously undiagnosed SLE. Case report: A 23-year-old female patient was admitted to our outpatient clinic complaining of high fever (40°C, chills, fatigue, generalized myalgia, and cough with brown sputum for 5 days. Blood cultures grew gram-positive coccus defined as S. pneumoniae using standard procedures. Antinuclear antibody was positive at a titer of 1/1,000, and anti-double-stranded DNA was positive at 984 IU/mL. She was diagnosed with SLE. Her respiratory symptoms and pleural effusion were considered to be due to pulmonary manifestation of SLE. Conclusion: The underlying immunosuppression caused by SLE could have predisposed the patient to invasive pneumococcal disease. It may also occur as a primary presenting feature, although a rare condition. Keywords: Streptococcus pneumoniae, sepsis, systemic lupus erythematosus

Epidemiology of Streptococcus pneumoniae and Staphylococcus aureus colonization in healthy Venezuelan children

NARCIS (Netherlands)

Quintero, B.; Araque, M.; Gaast-de Jongh, C.E. van der; Escalona, F.; Correa, M.; Morillo-Puente, S.; Vielma, S.; Hermans, P.W.M.

2011-01-01

Streptococcus pneumoniae and Staphylococcus aureus cause significant morbidity and mortality worldwide. We investigated both the colonization and co-colonization characteristics for these pathogens among 250 healthy children from 2 to 5 years of age in Merida, Venezuela, in 2007. The prevalence of

In vitro activity of tigecycline and comparator agents against a global collection of Gram-negative and Gram-positive organisms: tigecycline Evaluation and Surveillance Trial 2004 to 2007.

Science.gov (United States)

Garrison, Mark W; Mutters, Reinier; Dowzicky, Michael J

2009-11-01

The Tigecycline Evaluation and Surveillance Trial began in 2004 to monitor the in vitro activity of tigecycline and comparator agents against a global collection of Gram-negative and Gram-positive pathogens. Against Gram negatives (n = 63 699), tigecycline MIC(90)'s ranged from 0.25 to 2 mg/L for Escherichia coli, Haemophilus influenzae, Acinetobacter baumannii, Klebsiella oxytoca, Enterobacter cloacae, Klebsiella pneumoniae, and Serratia marcescens (but was > or =32 for Pseudomonas aeruginosa). Against Gram-positive organisms (n = 32 218), tigecycline MIC(90)'s were between 0.06 and 0.25 mg/L for Streptococcus pneumoniae, Enterococcus faecium, Streptococcus agalactiae, Staphylococcus aureus, and Enterococcus faecalis. The in vitro activity of tigecycline was maintained against resistant phenotypes, including multidrug-resistant A. baumannii (9.2% of isolates), extended-spectrum beta-lactamase-producing E. coli (7.0%) and K. pneumoniae (14.0%), beta-lactamase-producing H. influenzae (22.2%), methicillin-resistant S. aureus (44.5%), vancomycin-resistant E. faecium (45.9%) and E. faecalis (2.8%), and penicillin-resistant S. pneumoniae (13.8%). Tigecycline represents a welcome addition to the armamentarium against difficult to treat organisms.

Acute suppurative parotitis caused by Streptococcus pneumoniae in an HIV-infected man.

Science.gov (United States)

Guzman Vinasco, Luis; Bares, Sara; Sandkovsky, Uriel

2015-03-02

We report a case of a 32-year-old man who presented with progressive unilateral parotid gland enlargement and subsequently tested positive for HIV. A CT scan of the neck performed with contrast showed a phlegmon in the region of the right parotid tail measuring approximately 2.5×2.4 cm. Cultures of the aspirated fluid grew Streptococcus pneumoniae and the S. pneumoniae urinary antigen test was also positive. The patient underwent surgical debridement and received antimicrobial therapy with complete resolution of the parotitis. Parotitis caused by S. pneumoniae is rare, and HIV infection should be suspected in any case of invasive pneumococcal disease. 2015 BMJ Publishing Group Ltd.

Fallos vacunales a vacunas conjugadas de Streptococcus pneumoniae y Haemophilus influenzae tipo b

Directory of Open Access Journals (Sweden)

Gonzalo Angulo

2016-11-01

Full Text Available Haemophilus influenzae type b and Streptococcus pneumoniae are the main cause agents of otitis, pneumonia, sepsis and meningitis, affecting mainly children under 5 years. Conjugate vaccines for encapsulated germs have dramatically decreased, the various diseases caused by these germs. Despite the decrease in morbidity and mortality, vaccine failures were observed. Children who experienced vaccine failures to Haemophilus influenzae type b had associated comorbidities more frequently than the general population (prematurity, HIV, Down syndrome, tumors, etc.. Nevertheless, most of these children have no medical history or immunological disorders. There is no consensus on whether all patients with vaccine failures should be assessed immunologically and how. There are recommendations to indicate a booster dose to patients with certain comorbidities and patients experiencing vaccine failure even in the absence of theses. Of the vaccine preparations available for Haemophilus influenzae type b association with acellular Bordetella pertussis proved to be less immunogenic and is currently being discouraged. Streptococcus pneumoniae serotypes 6B and 19F are less immunogenics and explain most of the vaccine failures in some series.

A necrotic lung ball caused by co-infection with Candida and Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Yokoyama T

2011-12-01

Full Text Available Toshinobu Yokoyama, Jun Sasaki, Keita Matsumoto, Chie Koga, Yusuke Ito, Yoichiro Kaku, Morihiro Tajiri, Hiroki Natori, Masashi HirokawaDivision of Respirology, Neurology and Rheumatology, Department of Internal Medicine, Kurume University School of Medicine, Kurume, JapanIntroduction: A necrotic lung ball is a rare radiological feature that is sometimes seen in cases of pulmonary aspergillosis. This paper reports a rare occurrence of a necrotic lung ball in a young male caused by Candida and Streptococcus pneumoniae.Case report: A 28-year-old male with pulmonary candidiasis was found to have a lung ball on computed tomography (CT of the chest. The patient was treated with ß-lactams and itraconazole and then fluconazole, which improved his condition (as found on a following chest CT scan and serum ß-D-glucan level. The necrotic lung ball was suspected to have been caused by co-infection with Candida and S. pneumoniae.Conclusion: A necrotic lung ball can result from infection by Candida and/or S. pneumoniae, indicating that physicians should be aware that patients may still have a fungal infection of the lungs that could result in a lung ball, even when they do not have either Aspergillus antibodies or antigens.Keywords: lung ball, necrotic lung ball, Candida, Streptococcus pneumoniae

Concentrations in plasma, epithelial lining fluid, alveolar macrophages and bronchial mucosa after a single intravenous dose of 1.6 mg/kg of iclaprim (AR-100) in healthy men.

Science.gov (United States)

Andrews, J; Honeybourne, D; Ashby, J; Jevons, G; Fraise, A; Fry, P; Warrington, S; Hawser, S; Wise, R

2007-09-01

A validated microbiological assay was used to measure concentrations of iclaprim (AR-100) in plasma, bronchial mucosa (BM), alveolar macrophages (AM) and epithelial lining fluid (ELF) after a single 1.6 mg/kg intravenous 60 min iv infusion of iclaprim. Male volunteers were randomly allocated to three nominal sampling time intervals 1-2 h (Group A), 3-4 h (Group B) and 5.5-7.0 h (Group C) after the start of the drug infusion. Mean iclaprim concentrations in plasma, BM, AM and ELF, respectively, were for Group A 0.59 mg/L (SD 0.18), 0.51 mg/kg (SD 0.17), 24.51 mg/L (SD 21.22) and 12.61 mg/L (SD 7.33); Group B 0.24 mg/L (SD 0.05), 0.35 mg/kg (SD 0.17), 7.16 mg/L (SD 1.91) and 6.38 mg/L (SD 5.17); and Group C 0.14 mg/L (SD 0.05), no detectable level in BM, 5.28 mg/L (SD 2.30) and 2.66 mg/L (SD 2.08). Iclaprim concentrations in ELF and AM exceeded the MIC(90) for penicillin-susceptible Streptococcus pneumoniae (MIC90 0.06 mg/L), penicillin-intermediate S. pneumoniae (MIC90 2 mg/L), penicillin-resistant S. pneumoniae (MIC90 4 mg/L) for 7, 7 and 4 h, respectively, and Chlamydia pneumoniae (MIC90 0.5 mg/L) for 7 h. Mean iclaprim concentrations in ELF exceeded the MIC90 for Haemophilus influenzae (MIC90 4 mg/L) and Moraxella catarrhalis (MIC90 8 mg/L) for up to 4 and 2 h, respectively; in AM the MIC90 was exceeded for up to 7 h. Furthermore, the MIC90 for methicillin-resistant Staphylococcus aureus of 0.12 mg/L was exceeded at all sites for up to 7 h. These data suggest that iclaprim reaches lung concentrations that should be effective in the treatment of community-acquired pneumonia.

Utilización de la penicilina en la infección extrameníngea por Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Amauri Lázaro Noda Albelo

2011-12-01

Full Text Available La resistencia del Streptococcus pneumoniae a los antibióticos betalactámicos es relativa, y puede ser superada si se incrementa la dosis de esta clase de medicamentos. La definición de susceptibilidad y resistencia del Streptococcus pneumoniae se creó originalmente para predecir respuesta al tratamiento de la infección del sistema nervioso central. La infección fuera del sistema nervioso central por la mayoría de las cepas de S. pneumoniae responde a las dosis habituales de antibióticos betalactámicos. Se realiza una revisión de los nuevos puntos de corte del Laboratory Standars Institute para sensibilidad a penicilina del patógeno, y se analiza su implicación en la terapéutica actual de la enfermedad extrameníngea por S. pneumoniae.

Influence of impaired lipoprotein biogenesis on surface and exoproteome of Streptococcus pneumoniae

NARCIS (Netherlands)

Pribyl, Thomas; Moche, Martin; Dreisbach, Annette; Bijlsma, Jetta J E; Saleh, Malek; Abdullah, Mohammed R; Hecker, Michael; van Dijl, Jan Maarten; Becher, Dörte; Hammerschmidt, Sven

2014-01-01

Surface proteins are important for the fitness and virulence of the Gram-positive pathogen Streptococcus pneumoniae. They are crucial for interaction of the pathogen with its human host during infection. Therefore, the analysis of the pneumococcal surface proteome is an important task that requires

Streptococcus pneumoniae enhances human respiratory syncytial virus infection in vitro and in vivo

NARCIS (Netherlands)

D.T. Nguyen (Tien); R.P.L. Louwen (Rogier); Elberse, K. (Karin); G. van Amerongen (Geert); S. Yüksel (Selma); A. Luijendijk (Ad); A.D.M.E. Osterhaus (Albert); W.P. Duprex (William Paul); R.L. de Swart (Rik)

2015-01-01

textabstractHuman respiratory syncytial virus (HRSV) and Streptococcus pneumoniae are important causative agents of respiratory tract infections. Both pathogens are associated with seasonal disease outbreaks in the pediatric population, and can often be detected simultaneously in infants

[Antibacterial activity of cefpodoxime against clinical isolates in 2000 and 2001].

Science.gov (United States)

Abe, Tomomi; Fukuoka, Takashi; Sato, Yuki; Ito, Kazuyoshi; Sei, Masami

2002-12-01

As the post-marketing surveillance of cefpodoxime proxetil (Banan), MICs of cefpodoxime (CPDX, an active form of Banan) against 1090 clinical isolates of 22 species from 15 medical institutions all over Japan from June 2000 to March 2001 were measured using the broth microdilution method approved by the Japanese Society of Chemotherapy and compared with those of oral cephem antibacterials, cefaclor, cefdinir, cefditoren, and cefcapene. In this study, remarkable change in the activity of CPDX was observed in Streptococcus pneumoniae and Haemophilus influenzae compared with the susceptibility in the studies before Banan was launched. This cause is considered to be the increase in the incidence of the following resistant strains: penicillin-intermediate S. pneumoniae (47.3%), penicillin-resistant S. pneumoniae (PRSP, 15.1%), and beta-lactamase-negative ampicillin-resistant (BLNAR) H. influenzae (24.0%), which were scarcely isolated in 1989 when Banan was launched. Other tested drugs also exhibited low activity against these resistant strains. However, CPDX showed comparatively good activity with MIC90 of 2 micrograms/mL against PRSP. Against methicillin-susceptible Staphylococcus spp., Streptococcus pyogenes, Streptococcus agalactiae, and Moraxella catarrhalis, CPDX also showed comparatively good activity with MIC90 of marketing. Against quinolones-resistant Neisseria gonorrhoeae, CPDX showed excellent activity with MIC90 of 0.5 microgram/mL. Against members of the family Enterobacteriaceae except for Citrobacter freundii, Enterobacter spp., Proteus vulgaris, and Morganella morganii, CPDX showed good activity. However, in Escherichia coli, Klebsiella spp. Proteus spp., and Providencia spp., there are some high-resistant strains to all tested drugs including CPDX. Against Peptostreptococcus spp., MIC90 of CPDX was 8 micrograms/mL and its MIC range was widely distributed from 0.03 to 32 micrograms/mL, which were similar to those in the studies before its marketing. In

Comparison of the in vitro activities of several new fluoroquinolones against respiratory pathogens and their abilities to select fluoroquinolone resistance.

Science.gov (United States)

Boswell, F J; Andrews, J M; Jevons, G; Wise, R

2002-10-01

In this study the in vitro activities and pharmacodynamic properties of moxifloxacin, levofloxacin, gatifloxacin and gemifloxacin were compared on recently isolated respiratory pathogens and strains of Streptococcus pneumoniae with known mechanisms of fluoroquinolone resistance. In addition, the resistance selection frequencies of moxifloxacin and levofloxacin on three recently isolated respiratory pathogens and four strains of S. pneumoniae with known mechanisms of fluoroquinolone resistance were investigated. The four fluoroquinolones had similar activities against both Moraxella catarrhalis (MIC(90)s 0.015-0.06 mg/L) and Haemophilus influenzae (MIC(90)s 0.008-0.03 mg/L). More marked differences in activity were noted with S. pneumoniae, with MIC(90)s of 0.25, 1, 0.5 and 0.03 mg/L for moxifloxacin, levofloxacin, gatifloxacin and gemifloxacin, respectively. With the S. pneumoniae strains, the four fluoroquinolones exhibited similar concentration-dependent time-kill kinetics. The resistance selection frequencies of levofloxacin were higher than those of moxifloxacin at concentrations equivalent to those at the end of the dosing interval. Therefore moxifloxacin may have less of an impact on the development of resistance than levofloxacin.

Carriage of Streptococcus pneumoniae 3 Years after Start of Vaccination Program, the Netherlands

NARCIS (Netherlands)

Spijkerman, J.; van Gils, E.J.M.; Veenhoven, R.H.; Hak, E.; Yzerman, E.P.F.; van den Ende, A.; Wijmenga-Monsuur, A.J.; van den Dobbelsteen, G.P.J.M.; Sanders, E.A.M.

2011-01-01

To evaluate the effectiveness of the 7-valent pneumococcal conjugate vaccine (PCV7) program, we conducted a cross-sectional observational study on nasopharyngeal carriage of Streptococcus pneumoniae 3 years after implementation of the program in the Netherlands. We compared pneumococcal serotypes in

Epidemiological Studies of Potent Environmental Pathogen: Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Nazir A. Brohi

2016-12-01

Full Text Available A general survey for six months was undertaken for the prevalence of environmental bacterium Streptococcus pneumoniae among the different age groups (3-65 years including both sexes from various hospitals of Hyderabad city. Laboratory examinations revealed S. pneumoniae as most potent environmental pathogen from the sputum and throat swabs of old aged patients and children respectively. During observations, 39 specimens were growth positive; the biochemistry of isolates revealed that they were coagulase, catalase and oxidase negative, TSI, gel hydrolysis positive and were able to ferment glucose, lactose, maltose, galactose, fructose, sucrose, starch and raffinose. The results of antimicrobial activity showed that pneumococci were resistant to the cefspan, septran, cravit, pipemetic acid, azomax, bacitracin, and penicillin and a clear zone of inhibition was observed on clithromycin, optochin, cefizox, genatamycin, minocyclin, levoflaxacin, and vancomycin. There were intermediate zone of inhibition found on claforan, nalidixic acid, amoxycillin, fosfomycin, fortum, and erythromycin on Mueller Hinton’s agar after 24 hours incubation

Epidemiological studies of potent environment pathogen streptococcus pneumoniae

International Nuclear Information System (INIS)

Brohi, N.A.; Tunio, S.A.

2016-01-01

A general survey for six months was undertaken for the prevalence of environmental bacterium Streptococcus pneumoniae among the different age groups (3-65 years) including both sexes from various hospitals of Hyderabad city. Laboratory examinations revealed S. pneumoniae as most potent environmental pathogen from the sputum and throat swabs of old aged patients and children respectively. During observations, 39 specimens were growth positive; the biochemistry of isolates revealed that they were coagulase, catalase and oxidase negative, TSI, gel hydrolysis positive and were able to ferment glucose, lactose, maltose, galactose, fructose, sucrose, starch and raffinose. The results of antimicrobial activity showed that pneumococci were resistant to the cefspan, septran, cravit, pipemetic acid, azomax, bacitracin, and penicillin and a clear zone of inhibition was observed on clithromycin, optochin, cefizox, genatamycin, minocyclin, levoflaxacin, and vancomycin. There were intermediate zone of inhibition found on claforan, nalidixic acid, amoxycillin, fosfomycin, fortum, and erythromycin on Mueller Hinton's agar after 24 hours incubation. (author)

AdcAII of Streptococcus pneumoniae Affects Pneumococcal Invasiveness.

Directory of Open Access Journals (Sweden)

Lindsey R Brown

Full Text Available Across bacterial species, metal binding proteins can serve functions in pathogenesis in addition to regulating metal homeostasis. We have compared and contrasted the activities of zinc (Zn2+-binding lipoproteins AdcA and AdcAII in the Streptococcus pneumoniae TIGR4 background. Exposure to Zn2+-limiting conditions resulted in delayed growth in a strain lacking AdcAII (ΔAdcAII when compared to wild type bacteria or a mutant lacking AdcA (ΔAdcA. AdcAII failed to interact with the extracellular matrix protein laminin despite homology to laminin-binding proteins of related streptococci. Deletion of AdcA or AdcAII led to significantly increased invasion of A549 human lung epithelial cells and a trend toward increased invasion in vivo. Loss of AdcAII, but not AdcA, was shown to negatively impact early colonization of the nasopharynx. Our findings suggest that expression of AdcAII affects invasiveness of S. pneumoniae in response to available Zn2+ concentrations.

[Post-marketing surveillance of antibacterial activities of cefozopran against various clinical isolates--I. Gram-positive bacteria].

Science.gov (United States)

Igari, Jun; Oguri, Toyoko; Hiramatsu, Nobuyoshi; Akiyama, Kazumitsu; Koyama, Tsuneo

2003-10-01

As a post-marketing surveillance, the in vitro antibacterial activities of cefozopran (CZOP), an agent of cephems, against various clinical isolates were yearly evaluated and compared with those of other cephems, oxacephems, penicillins, and carbapenems. Changes in the bacterial susceptibility for CZOP were also evaluated with the resistance ratio calculated with breakpoint MIC. Sixteen species (2,363 strains) of Gram-positive bacteria were isolated from the clinical materials annually collected from 1996 to 2001, and consisted of methicillin-susceptible Staphylococcus aureus (MSSA), methicillin-resistant Staphylococcus aureus (MRSA), methicillin-susceptible Staphylococcus epidermidis (MSSE), methicillin-resistant Staphylococcus epidermidis (MRSE), Staphylococcus haemolyticus, Staphylococcus saprophyticus, Enterococcus faecalis, Enterococcus faecium, Enterococcus avium, Streptococcus pyogenes, Streptococcus agalactiae, penicillin-susceptible Streptococcus pneumoniae (PSSP), penicillin-intermediate resistant S. pneumoniae (PISP), penicillin-resistant S. pneumoniae (PRSP), Streptococcus milleri group and Peptostreptococcus spp. The antibacterial activity of CZOP either against MSSA or MSSE was preferable (MIC90: 2 or 0.5 micrograms/mL) and comparable to those of other cephems. CZOP was also effective on MRSE (MIC90: 16 micrograms/mL) but not on MRSA. CZOP and other cephems had low antibacterial activity against S. haemolyticus (MIC90: 64 micrograms/mL). The antibacterial activity of CZOP against S. saprophyticus was comparable to or higher than those of other cephems, but the MIC90 of CZOP in 2001 was higher than those in 1996-2000 (32 vs 1-2 micrograms/mL). The antibacterial activity of CZOP against E. faecalis was comparable to that of cefpirome (CPR; MIC90: 16 micrograms/mL) and higher than those of other cephems. No antibacterial activity of CZOP against E. faecium and E. avium was observed, like other drugs. The antibacterial activity of CZOP against S. pyogenes

Bilateral Acromioclavicular Septic Arthritis as an Initial Presentation of Streptococcus pneumoniae Endocarditis

Directory of Open Access Journals (Sweden)

Neda Hashemi-Sadraei

2014-01-01

Full Text Available Infective endocarditis (IE is infrequently associated with septic arthritis. Moreover, septic arthritis of the acromioclavicular (AC joint is rarely reported in the literature. We report a case of Streptococcus pneumoniae IE in a patient who presented with bilateral AC joint septic arthritis and we review the literature on the topic.

Streptococcus pneumoniae aislados de infecciones invasivas: serotipos y resistencia antimicrobiana Streptococcus pneumoniae isolated from invasive infections: serotypes and antimicrobial resistance

Directory of Open Access Journals (Sweden)

Gladys Antonia Cueto Montoya

2007-03-01

Full Text Available Las meningoencefalitis bacterianas constituyen una enfermedad invasiva importante, quizás no tanto por su frecuencia, como por la gravedad de su cuadro. Los cambios en la epidemiología de los síndromes neurológicos infecciosos en Cuba a partir de la vacunación contra meningococo BC y Haemophilus influenzae b han hecho que el Streptococcus pneumoniae constituya el agente causal más frecuente. Debido al incremento de la resistencia de este microorganismo a los antibióticos habituales, se realizaron modificaciones al régimen terapéutico convencional, fundamentalmente en las meningitis pediátricas. Es necesario lograr el aislamiento en cultivo de este agente para conocer los serotipos más frecuentes en el país, y lograr una vacuna neumocócica conjugada, así como para la vigilancia de las cepas frente a los antimicrobianos.The bacterial meningoencephalitis is an important invasive disease, not only because of its frequency, but also because of the severity of its picture. The changes in the epidemiology of the neurological infectious syndromes in Cuba starting from the vaccination against meningococcus BC and Haemophilus infuenzae b have made that Streptococcus pneumoniae be the most frequent causal agent. Due to the increase of the resistance of this microorganism to habitual antibiotics, modifications were made in the conventional therapeutic regimen, mainly in the pediatric meningitis. It is necessary to achieve the isolation in culture of this agent to know the most common serotypes in the country, to attain a conjugated pneumococcal vaccine, and to keep the surveillance of the strains against the antimicrobials.

Identification of proteins in Streptococcus pneumoniae by reverse vaccinology and genetic diversity of these proteins in clinical isolates.

Science.gov (United States)

Argondizzo, Ana Paula Corrêa; da Mota, Fabio Faria; Pestana, Cristiane Pinheiro; Reis, Joice Neves; de Miranda, Antonio Basílio; Galler, Ricardo; Medeiros, Marco Alberto

2015-02-01

Streptococcus pneumoniae is a major cause of morbidity and mortality worldwide. Virulence-associated proteins common and conserved among all capsular types now represent the best strategy to combat pneumococcal infections. Our aim was to identify conserved targets in pneumococci that showed positive prediction for lipoprotein and extracellular subcellular location using bioinformatics programs and verify the distribution and the degree of conservation of these targets in pneumococci. These targets can be considered potential vaccine candidate to be evaluated in the future. A set of 13 targets were analyzed and confirmed the presence in all pneumococci tested. These 13 genes were highly conserved showing around >96 % of amino acid and nucleotide identity, but they were also present and show high identity in the closely related species Streptococcus mitis, Streptococcus oralis, and Streptococcus pseudopneumoniae. S. oralis clusters away from S. pneumoniae, while S. pseudopneumoniae and S. mitis cluster closer. The divergence between the selected targets was too small to be observed consistently in phylogenetic groups between the analyzed genomes of S. pneumoniae. The proteins analyzed fulfill two of the initial criteria of a vaccine candidate: targets are present in a variety of different pneumococci strains including different serotypes and are conserved among the samples evaluated.

Pyruvate Oxidase Influences the Sugar Utilization Pattern and Capsule Production in Streptococcus pneumoniae

NARCIS (Netherlands)

Carvalho, Sandra M.; Farshchi Andisi, Vahid; Gradstedt, Henrik; Neef, Jolanda; Kuipers, Oscar P.; Neves, Ana R.; Bijlsma, Jetta J. E.

2013-01-01

Pyruvate oxidase is a key function in the metabolism and lifestyle of many lactic acid bacteria and its activity depends on the presence of environmental oxygen. In Streptococcus pneumoniae the protein has been suggested to play a major role in metabolism and has been implicated in virulence,

Meropenem susceptibility of Neisseria meningitidis and Streptococcus pneumoniae from meningitis patients in The Netherlands

NARCIS (Netherlands)

van de Beek, D.; Hensen, E. F.; Spanjaard, L.; de Gans, J.; Enting, R. H.; Dankert, J.

1997-01-01

In-vitro susceptibility of 299 Neisseria meningitidis and 157 Streptococcus pneumoniae strains from meningitis patients in The Netherlands in 1993 and 1994 to meropenem was determined using the Etest. Susceptibility to penicillin, ceftriaxone, and chloramphenicol was also determined. Rifampicin

Characterization of a Multipeptide Lantibiotic Locus in Streptococcus pneumoniae.

Science.gov (United States)

Maricic, Natalie; Anderson, Erica S; Opipari, AnneMarie E; Yu, Emily A; Dawid, Suzanne

2016-01-26

Bacterial communities are established through a combination of cooperative and antagonistic interactions between the inhabitants. Competitive interactions often involve the production of antimicrobial substances, including bacteriocins, which are small antimicrobial peptides that target other community members. Despite the nearly ubiquitous presence of bacteriocin-encoding loci, inhibitory activity has been attributed to only a small fraction of gene clusters. In this study, we characterized a novel locus (the pld locus) in the pathogen Streptococcus pneumoniae that drives the production of a bacteriocin called pneumolancidin, which has broad antimicrobial activity. The locus encodes an unusual tandem array of four inhibitory peptides, three of which are absolutely required for antibacterial activity. The three peptide sequences are similar but appear to play distinct roles in regulation and inhibition. A modification enzyme typically found in loci encoding a class of highly modified bacteriocins called lantibiotics was required for inhibitory activity. The production of pneumolancidin is controlled by a two-component regulatory system that is activated by the accumulation of modified peptides. The locus is located on a mobile element that has been found in many pneumococcal lineages, although not all elements carry the pld genes. Intriguingly, a minimal region containing only the genes required for pneumolancidin immunity was found in several Streptococcus mitis strains. The pneumolancidin-producing strain can inhibit nearly all pneumococci tested to date and provided a competitive advantage in vivo. These peptides not only represent a unique strategy for bacterial competition but also are an important resource to guide the development of new antimicrobials. Successful colonization of a polymicrobial host surface is a prerequisite for the subsequent development of disease for many bacterial pathogens. Bacterial factors that directly inhibit the growth of neighbors

The Response Regulator YycF Inhibits Expression of the Fatty Acid Biosynthesis Repressor FabT in Streptococcus pneumoniae

Science.gov (United States)

Mohedano, Maria L.; Amblar, Mónica; de la Fuente, Alicia; Wells, Jerry M.; López, Paloma

2016-01-01

The YycFG (also known as WalRK, VicRK, MicAB, or TCS02) two-component system (TCS) is highly conserved among Gram-positive bacteria with a low G+C content. In Streptococcus pneumoniae the YycF response regulator has been reported to be essential due to its control of pcsB gene expression. Previously we showed that overexpression of yycF in S. pneumoniae TIGR4 altered the transcription of genes involved in cell wall metabolism and fatty acid biosynthesis, giving rise to anomalous cell division and increased chain length of membrane fatty acids. Here, we have overexpressed the yycFG system in TIGR4 wild-type strain and yycF in a TIGR4 mutant depleted of YycG, and analyzed their effects on expression of proteins involved in fatty acid biosynthesis during activation of the TCS. We demonstrate that transcription of the fab genes and levels of their products were only altered in the YycF overexpressing strain, indicating that the unphosphorylated form of YycF is involved in the regulation of fatty acid biosynthesis. In addition, DNA-binding assays and in vitro transcription experiments with purified YycF and the promoter region of the FabTH-acp operon support a direct inhibition of transcription of the FabT repressor by YycF, thus confirming the role of the unphosphorylated form in transcriptional regulation. PMID:27610104

Susceptibility to antimicrobial agents of Streptococcus suis capsular type 2 strains isolated from pigs.

Science.gov (United States)

Seol, B; Kelneric, Z; Hajsig, D; Madic, J; Naglic, T

1996-03-01

The minimal inhibitory concentrations (MICs) for thirty-three epidemiologicaly unrelated clinical isolates of Streptococcus suis capsular type 2 were determined in relation to ampicillin, ampicillin-sulbactam, amoxicillin, clavulanate-amoxicillin, penicillin G, cephalexin, gentamicin, streptomycin, erythromycin, tylosin and doxycycline, using the microtitre broth dilution procedure described by the U.S. National Committee for Clinical Laboratory Standards (NCCLS). Gentamicin was the most active compound tested, with an MIC for 90% of the strains tested (MIC(90)) of 0.4 mg/L. Overall, 70% of strains were resistant to doxycycline (MIC(90) > or = 100.0 mg/L), followed by penicillin G (51% of strains) (MIC(90) + or = 100.0 mg/L). Resistance to amoxicillin and ampicillin was 36.4% (MIC(90) 12.5 mg/L) and 33.3% (MIC(90) 50.0 mg/L), respectively. 15.2% of S. suis strains were resistant to streptomycin, tylosin and cephalexin with MIC90 values of 25.0 mg/L, 12.5 mg/L and 25.0 mg/L, respectively. A combination of ampicillin and sulbactam (MIC(90) 6.3 mg/L) and a combination of amoxicillin and clavulanate (MIC(90) 3.1 mg/L) as well as erythromycin (1.6 mg/L) were of the same efficacy, with a total of 9.1% resistant S. suis strains. This high percentage of resistance to doxycycline and penicillin G precludes the use of these antibiotics as empiric therapy of swine diseases.

The Importance of TLR2 and Macrophages in Modulating a Humoral Response after Encountering Streptococcus pneumoniae

Science.gov (United States)

2008-03-26

Chapter 3 Submited as: Sam Vasilevsky, Jesus Colino, Roman Puliaev, David H. Canaday, and Clifford M...general microbiology 138:249- 259. 7. Musher , D. M. 1992. Infections caused by Streptococcus pneumoniae: clinical spectrum, pathogenesis, immunity, and...Pneumonia and Its Implications for Antimicrobial Resistance Chest 115:1-2. 230. Musher , D. M., I. Alexandraki, E. A. Graviss, N. Yanbeiy, A. Eid, L

Impacto de Streptococcus pneumoniae en las neumonías del niño latinoamericano Impact of Streptococcus pneumoniae in pneumonias of Latin American children

Directory of Open Access Journals (Sweden)

María Hortal

2000-09-01

Full Text Available La neumonía adquirida en la comunidad es una de las principales causas de morbilidad y mortalidad en la infancia. Estudios realizados en países en desarrollo indican que los cuadros de neumonía más graves se asocian a causas bacterianas, con predominio de Streptococcus pneumoniae, seguido por Haemophilus influenzae tipo b. El manejo de esas infecciones en los menores de 2 años se ve dificultado por la carencia de vacunas apropiadas y por la disminución de la susceptibilidad de S. pneumoniae a la penicilina y a otros antibióticos. En 1993, por iniciativa del Sistema Regional de Vacunas (SIREVA de la Organización Panamericana de la Salud y con la financiación de la Agencia Canadiense para el Desarrollo Internacional (Canadian International Development Agency: CIDA, se diseñó un estudio para identificar los tipos capsulares de S. pneumoniae que causan enfermedad invasora en los niños latinoamericanos menores de 5 años, con el propósito de determinar tanto la composición ideal de una vacuna conjugada que pudiera emplearse en la Región como la susceptibilidad a la penicilina de los aislados de S. pneumoniae. La iniciativa fue aceptada por Argentina, Brasil, Colombia, Chile, México y Uruguay. En este informe se analiza la información sobre la neumonía por S. pneumoniae generada en los países participantes. Se captaron 3 393 niños con infecciones sistémicas por S. pneumoniae, de las cuales 1 578 correspondían a neumonías. El análisis se concentró en los 1 409 casos de neumonía de Argentina, Brasil, Colombia, México y Uruguay. La distribución por edades evidenció un franco predominio de los menores de 2 años (63,8%. Se identificaron 12 tipos capsulares prevalentes, de los cuales los serotipos 14, 5 y 1 ocuparon los tres primeros lugares en la mayoría de los países. En el período 1993-1998, la resistencia a la penicilina aumentó en los cinco países; al comienzo del estudio, los mayores porcentajes correspondieron a M�

[Examination about utility of a Streptococcus pneumoniae capsular antigen swiftness search kit urine in a pneumonia patient].

Science.gov (United States)

Hashikita, Giichi; Yamaguti, Toshiyuki; Tachi, Yoshimi; Kishi, Etsuko; Kawamura, Toru; Takahashi, Shun; Arai, Yukie; Koyama, Sachie; Huruhata, Toshihumi; Itabashi, Akira; Oka, Yoko; Yamazaki, Tsutomu; Maesaki, Sigefumi

2005-01-01

We investigated the usefullness of Binax NOW urine antigen test, an immunochromatographic assay that binds any soluble Streptococcus pneumoniae antigen (C polysaccharide) for the diagnosis of penumoniae form September 2003 to March 2005. We used 372 samples form the patinets with pneumoniae diagnosed for blood or sputum cultuter or gram-stained sputum smear. Out of 24 culture positive specimens, Binax NOW urine antigen test, showed positive in 18 (75%) specimens. The sensitivity of sputum and blood culture was 71.7% and 83.3%, respectively. Binax NOW urine antigen test was seemed false positives in 55 samples, false negatives in 6 samples. The specificity of Binax NOW urine antigen test was evaluated 84.1%. Overall agreement among tests was 83.6%. When compared to culture, false negative urine antigen may be the result of colonizing S. pneumoniae in sputum or pneumonia caused by an agent other than S. pneumoniae. CRP values for cases were both urine antigen and culture were positive ranged from 40 mg/dl to 10 mg/dl while urine antigen and culture negative cases were predominantly less than 10 mg/dl. Positive blood and pleural fluid culture cases were consistently associated with strongly positive urine antigen tests. Non-agreement between urine antigen, culture, and microscopy may be the result of specimen quality, labile nature of S. pneumoniae and antimicrobial therapy.

Validation of the Infectious Diseases Society of America/American Thoracic Society criteria to predict severe community-acquired pneumonia caused by Streptococcus pneumoniae.

Science.gov (United States)

Kontou, Paschalina; Kuti, Joseph L; Nicolau, David P

2009-10-01

Severe community-acquired pneumonia (CAP) is usually defined as pneumonia that requires intensive care unit (ICU) admission; the primary pathogen responsible for ICU admission is Streptococcus pneumoniae. In this study, the 2007 Infectious Diseases Society of America/American Thoracic Society (IDSA/ATS) consensus criteria for ICU admission were compared with other severity scores in predicting ICU admission and mortality. We retrospectively studied 158 patients with pneumococcal CAP (1999-2003). Clinical and laboratory features at the emergency department were recorded and used to calculate the 2007 IDSA/ATS rule, the 2001 ATS rule, 2 modified 2007 IDSA/ATS rules, the Pneumonia Severity Index (PSI), and the CURB (confusion, urea, respiratory rate, blood pressure) score. The sensitivity, specificity, positive predictive value, and negative predictive value (NPV) were assessed for the various indices. We also determined the criteria that were independently predictive of ICU admission and of mortality in our population. The 2007 IDSA/ATS criteria performed as well as the 2001 ATS rule in predicting ICU admission both demonstrated high sensitivity (90%) and NPV (97%). For the prediction of mortality, the best tool proved to be the PSI score (sensitivity, 95%; NPV, 99%). The variables associated with ICU admission in this patient population included tachypnea, confusion, Pao(2)/Fio(2) ratio of 250 or lower, and hypotension requiring fluid resuscitation. Mechanical ventilation and PSI class V were independently associated with mortality. This study confirms the usefulness of the new criteria in predicting severe CAP. The 2001 ATS criteria seem an attractive alternative because they are simple and as effective as the 2007 IDSA/ATS criteria.

Genome-wide identification of Streptococcus pneumoniae genes essential for bacterial replication during experimental meningitis

DEFF Research Database (Denmark)

Molzen, T E; Burghout, P; Bootsma, H J

2010-01-01

Meningitis is the most serious of invasive infections caused by the Gram-positive bacterium Streptococcus pneumoniae. Vaccines protect only against a limited number of serotypes, and evolving bacterial resistance to antimicrobials impedes treatment. Further insight into the molecular pathogenesis...... as targets for future therapy and prevention of pneumococcal meningitis, since their mutants were attenuated in both models of infection as well as in competitive growth in human cerebrospinal fluid in vitro.......Meningitis is the most serious of invasive infections caused by the Gram-positive bacterium Streptococcus pneumoniae. Vaccines protect only against a limited number of serotypes, and evolving bacterial resistance to antimicrobials impedes treatment. Further insight into the molecular pathogenesis...... genes mutants of which had become attenuated or enriched, respectively, during infection. The results point to essential roles for capsular polysaccharides, nutrient uptake, and amino acid biosynthesis in bacterial replication during experimental meningitis. The GAF phenotype of a subset of identified...

Genotyping and serotyping of macrolide and multidrug resistant Streptococcus pneumoniae isolated from carrier children

Directory of Open Access Journals (Sweden)

S F Swedan

2016-01-01

Full Text Available Aims: Streptococcus pneumoniae, an opportunistic pathogen commonly carried asymptomatically in the nasopharynx of children, is associated with increasing rates of treatment failures due to a worldwide increase in drug resistance. We investigated the carriage of S. pneumoniae in children 5 years or younger, the identity of prevalent serotypes, the rates of resistance to macrolides and other antimicrobial agents and the genotypes responsible for macrolide resistance. Materials and Methods: Nasopharyngeal swabs were collected from 157 children under 5 years for cultural isolation of S. pneumoniae. Antibiogram of isolates  was determined using the disk diffusion test, and the minimal inhibitory concentration to macrolides was determined using the E-test. Isolate serotypes and macrolide resistance genes, erm(B and mef(E, were identified using multiplex polymerase chain reactions. Results: S. pneumoniae was recovered from 33.8% of children; 41.9% among males and 21.9% among females (P = 0.009. The highest carriage rate occurred among age groups 7-12 months and 49-60 months. Most frequent serotypes were 19F, 6A/B, 11A, 19A, 14 and 15B/C.  Resistance to macrolides was 60.4%. Resistance to oxacillin, trimethoprim/sulfamethoxazole and clindamycin was present among 90.6%, 54.7% and 32.1% of isolates, respectively. All isolates were susceptible to chloramphenicol, levofloxacin and vancomycin. Isolates resistant to one or more macrolide drugs were more likely to be multidrug resistant. Resistance to clindamycin or oxacillin coexisted with macrolide resistance. Among the erythromycin-resistant isolates, erm(B, mef(E and erm(B and mef(E genes were present at rates of 43.8%, 37.5% and 6.3%, respectively. Erm(B and mef(E were associated with very high level and moderate-to-high level resistance to macrolides, respectively. Conclusion: A significant proportion of children harboured macrolide and multidrug-resistant S. pneumoniae.

Concurrent Infection with Hepatitis C Virus and Streptococcus pneumoniae.

Science.gov (United States)

Marrie, Thomas J; Tyrrell, Gregory J; Majumdar, Sumit R; Eurich, Dean T

2017-07-01

Little is known about concurrent infection with hepatitis C virus (HCV) and Streptococcus pneumoniae, which causes invasive pneumococcal disease (IPD). We hypothesized that co-infection with HCV and S. pneumoniae would increase risk for death and complications. We captured sociodemographic and serologic data for adults with IPD in a population-based cohort study in northern Alberta, Canada, during 2000-2014. IPD patients infected with HCV were compared with IPD patients not infected with HCV for risk of in-hospital deaths and complications by using multivariable logistic regression. A total of 355 of 3,251 patients with IPD were co-infected with HCV. The in-hospital mortality rate was higher for IPD patients infected with HCV. Prevalence of most IPD-related complications (e.g., cellulitis, acute kidney injury, mechanical ventilation) was also higher in HCV-infected patients. Infection with HCV is common in patients with IPD, and HCV is independently associated with an increased risk for serious illness and death.

Antibiotic susceptibility of periodontal Streptococcus constellatus and Streptococcus intermedius clinical isolates.

Science.gov (United States)

Rams, Thomas E; Feik, Diane; Mortensen, Joel E; Degener, John E; van Winkelhoff, Arie J

2014-12-01

Streptococcus constellatus and Streptococcus intermedius in subgingival dental plaque biofilms may contribute to forms of periodontitis that resist treatment with conventional mechanical root debridement/surgical procedures and may additionally participate in some extraoral infections. Because systemic antibiotics are often used in these clinical situations, and little is known of the antibiotic susceptibility of subgingival isolates of these two bacterial species, this study determined the in vitro susceptibility to six antibiotics of fresh S. constellatus and S. intermedius clinical isolates from human periodontitis lesions. A total of 33 S. constellatus and 17 S. intermedius subgingival strains, each recovered from separate patients with severe chronic periodontitis (n = 50) before treatment, were subjected to antibiotic gradient strip susceptibility testing with amoxicillin, azithromycin, clindamycin, ciprofloxacin, and doxycycline on blood-supplemented Mueller-Hinton agar and to the inhibitory effects of metronidazole at 16 mg/L in an enriched Brucella blood agar dilution assay. Clinical and Laboratory Standards Institute and European Committee on Antimicrobial Susceptibility Testing interpretative standards were used to assess the results. Clindamycin was the most active antibiotic against S. constellatus (minimum inhibitory concentration at 90% [MIC90] 0.25 mg/L), and amoxicillin was most active against S. intermedius (MIC90 0.125 mg/L). A total of 30% of the S. constellatus and S. intermedius clinical isolates were resistant in vitro to doxycycline, 98% were only intermediate in susceptibility to ciprofloxacin, and 90% were resistant to metronidazole at 16 mg/L. Subgingival S. constellatus and S. intermedius exhibited variable antibiotic susceptibility profiles, potentially complicating empirical selection of periodontitis antibiotic therapy in patients who are species positive.

Detection of Streptococcus pneumoniae in whole blood by PCR.

Science.gov (United States)

Zhang, Y; Isaacman, D J; Wadowsky, R M; Rydquist-White, J; Post, J C; Ehrlich, G D

1995-03-01

Streptococcus pneumoniae is a major cause of bacteremia in both children and adults. Currently, the diagnosis of pneumococcal bacteremia relies on the isolation and identification of the bacteria from blood cultures. We have developed a sensitive assay for the detection of S. pneumoniae in whole blood by the PCR. A specific primer-probe set (JM201 and JM202 primers with JM204 probe) designed from the penicillin-binding protein 2B gene was demonstrated to reproducibly detect between 10 and 100 fg of input purified S. pneumoniae DNA. This assay system was shown to be inclusive for all strains of S. pneumoniae evaluated, including 15 different serotypes and a battery of penicillin-resistant and -sensitive strains. The specificity of this PCR-based assay was demonstrated by its inability to support amplification from a series of human, bacterial, and yeast genomic DNAs. A general specimen preparation method which should be suitable for the purification of DNA from any pathogens in whole blood was developed. With this protocol it was possible to detect S. pneumoniae-specific DNA from whole blood specimens inoculated with as little as 4 CFU/ml. Copurified human blood DNA, ranging from 0 to 4.5 micrograms per PCR, did not affect the sensitivity of S. pneumoniae detection by PCR. A blinded clinical trial was used to compare the PCR-based assay with standard microbiological blood culture for the detection of S. pneumoniae bacteremia in 36 specimens obtained from pediatric patients seen in the emergency room of Children's Hospital of Pittsburgh. With culture as the "gold standard," the PCR-based assay had a sensitivity of 80% (4 of 5 culture-positive specimens were PCR positive) and a specificity of 84% (26 of 31 culture-negative specimens were PCR negative). However, three patients whose specimens were PCR positive and culture negative had histories suggestive of bacteremia, including recent positive blood cultures, treatment with antibiotics, cellulitis, and multiple

Feasibility and Safety of Local Treatment with Recombinant Human Tissue Factor Pathway Inhibitor in a Rat Model of Streptococcus pneumoniae Pneumonia.

Directory of Open Access Journals (Sweden)

Florry E van den Boogaard

Full Text Available Pulmonary coagulopathy is intrinsic to pulmonary injury including pneumonia. Anticoagulant strategies could benefit patients with pneumonia, but systemic administration of anticoagulant agents may lead to suboptimal local levels and may cause systemic hemorrhage. We hypothesized nebulization to provide a safer and more effective route for local administration of anticoagulants. Therefore, we aimed to examine feasibility and safety of nebulization of recombinant human tissue factor pathway inhibitor (rh-TFPI in a well-established rat model of Streptococcus (S. pneumoniae pneumonia. Thirty minutes before and every 6 hours after intratracheal instillation of S. pneumonia causing pneumonia, rats were subjected to local treatment with rh-TFPI or placebo, and sacrificed after 42 hours. Pneumonia was associated with local as well as systemic activation of coagulation. Nebulization of rh-TFPI resulted in high levels of rh-TFPI in bronchoalveolar lavage fluid, which was accompanied by an attenuation of pulmonary coagulation. Systemic rh-TFPI levels remained undetectable, and systemic TFPI activity and systemic coagulation were not affected. Histopathology revealed no bleeding in the lungs. We conclude that nebulization of rh-TFPI seems feasible and safe; local anticoagulant treatment with rh-TFPI attenuates pulmonary coagulation, while not affecting systemic coagulation in a rat model of S. pneumoniae pneumonia.

The alpha-tocopherol form of vitamin E boosts elastase activity of human PMNs and their ability to kill Streptococcus pneumoniae

Science.gov (United States)

Despite the availability of vaccines, Streptococcus pneumoniae remains a leading cause of life-threatening infections such as pneumonia, bacteremia and meningitis. Polymorphonuclear leukocytes (PMNs) are a key determinant of disease course, because optimal host defense requires an initial robust pul...

Crystallization and preliminary X-ray crystallographic studies of DnaJ from Streptococcus pneumoniae

International Nuclear Information System (INIS)

Zhao, Shasha; Jin, Li; Niu, Siqiang; Yang, Wei; Zhang, Shaocheng; Guo, Zhen; Zhang, Hongpeng; Huang, Ailong; Yin, Yibing; Wang, Deqiang

2013-01-01

DnaJ from Streptococcus pneumoniae (SpDnaJ) is involved in the infectious disease process and is being developed as a potential vaccine to prevent bacterial infection. Here the expression, purification, crystallization and preliminary crystallographic analysis of SpDnaJ are reported. DnaJ, cooperating with DnaK and GrpE, promotes the folding of unfolded hydrophobic polypeptides, dissociates protein complexes and translocates protein across membranes. Additionally, DnaJ from Streptococcus pneumoniae (SpDnaJ) is involved in the infectious disease process and is being developed as a potential vaccine to prevent bacterial infection. Here the expression, purification, crystallization and preliminary crystallographic analysis of SpDnaJ are reported. The crystals belong to space groups I222 or I2 1 2 1 2 1 and the diffraction resolution is 3.0 Å with unit-cell parameters a = 47.68, b = 104.45, c = 234.57 Å. The crystal most likely contains one molecule in the asymmetric unit, with a V M value of 3.24 Å 3 Da −1 and a solvent content of 62.1%

Comparative study of five different DNA fingerprint techniques for molecular typing of Streptococcus pneumoniae strains

NARCIS (Netherlands)

P.W.M. Hermans (Peter); M. Sluijter (Marcel); T. Hoogenboezem (Theo); H. Heersma; A.F. van Belkum (Alex); R. de Groot (Ronald)

1995-01-01

textabstractThe aim of this study was to identify the strengths and weaknesses of five DNA fingerprint methods for epidemiological typing of Streptococcus pneumoniae. We investigated the usefulness of (i) ribotyping, (ii) BOX fingerprinting with the BOX repetitive sequence of S.

Evaluation of a PCR Assay for Detection of Streptococcus pneumoniae in Respiratory and Nonrespiratory Samples from Adults with Community-Acquired Pneumonia

Science.gov (United States)

Murdoch, David R.; Anderson, Trevor P.; Beynon, Kirsten A.; Chua, Alvin; Fleming, Angela M.; Laing, Richard T. R.; Town, G. Ian; Mills, Graham D.; Chambers, Stephen T.; Jennings, Lance C.

2003-01-01

Streptococcus pneumoniae is the most common cause of community-acquired pneumonia, but it is undoubtedly underdiagnosed. We used a nested PCR assay (targeting the pneumolysin gene) to detect S. pneumoniae DNA in multiple sample types from 474 adults with community-acquired pneumonia and 183 control patients who did not have pneumonia. Plasma or buffy coat samples were PCR positive in only 6 of the 21 patients with positive blood cultures for S. pneumoniae and in 12 other patients (4 of whom had no other laboratory evidence of S. pneumoniae infection). Buffy coat samples from two control patients (neither having evidence of S. pneumoniae infection), but no control plasma samples, were PCR positive. Although pneumococcal antigen was detected in the urine from 120 of 420 (29%) patients, only 4 of 227 (2%) urine samples tested were PCR positive. Overall, 256 of 318 (81%) patients had PCR-positive sputum samples, including 58 of 59 samples from which S. pneumoniae was cultured. Throat swab samples from 229 of 417 (55%) patients were PCR positive and, in those who produced sputum, 96% also had positive PCR results from sputum. Throat swabs from 73 of 126 (58%) control patients were also PCR positive. We conclude that the pneumolysin PCR assay adds little to existing diagnostic tests for S. pneumoniae and is unable to distinguish colonization from infection when respiratory samples are tested. PMID:12517826

Post-infective transverse myelitis following Streptococcus pneumoniae meningitis with radiological features of acute disseminated encephalomyelitis: a case report

Directory of Open Access Journals (Sweden)

Williams Thomas

2012-09-01

Full Text Available Abstract Introduction Post-infectious autoimmune demyelination of the central nervous system is a rare neurological disorder typically associated with exanthematous viral infections. We report an unusual presentation of the condition and a previously undocumented association with Streptococcus pneumonia meningitis. Case presentation A 50-year-old Caucasian woman presented to our facility with an acute myelopathy three days after discharge following acute Streptococcus pneumoniae meningitis. Imaging studies of the spine ruled out an infective focus and no other lesions were seen within the cord. Diffuse, bilateral white matter lesions were seen within the cerebral hemispheres, and our patient was diagnosed as having a post-infective demyelination syndrome that met the diagnostic criteria for an acute transverse myelitis. Our patient clinically and radiologically improved following treatment with steroids. Conclusions The novel association of a Streptococcus pneumoniae infection with post-infectious autoimmune central nervous system demyelination should alert the reader to the potentially causative role of this common organism, and gives insights into the pathogenesis. The unusual dissociation between the clinical presentation and the location of the radiological lesions should also highlight the potential for the condition to mimic the presentation of others, and stimulates debate on the definitions of acute transverse myelitis and acute disseminated encephalomyelitis, and their potential overlap.

C3b/iC3b deposition on Streptococcus pneumoniae is not affected by HIV infection.

Directory of Open Access Journals (Sweden)

Catherine Hyams

2010-01-01

Full Text Available Streptococcus pneumoniae is a common cause of infection in both HIV positive patients and those with complement deficiencies. We hypothesised that HIV positive individuals might exhibit reduced opsonisation of pneumococcus with complement due to reduced levels of S. pneumoniae specific IgG. We discovered no difference in C3 deposition on S. pneumoniae between HIV positive or negative individuals, and furthermore C3 deposition remained unchanged as HIV progressed towards AIDS. We found no correlation between C3 deposition on S. pneumoniae and CD4 cell count in HIV infected individuals. Hence we have demonstrated no failure of complement immunity in HIV positive patients.

Expression of Streptococcus pneumoniae Bacteriocins Is Induced by Antibiotics via Regulatory Interplay with the Competence System

NARCIS (Netherlands)

Kjos, Morten; Miller, Eric; Slager, Jelle; Lake, Frank B; Gericke, Oliver; Roberts, Ian S; Rozen, Daniel E; Veening, Jan-Willem

2016-01-01

Pneumococcal bacteriocins (pneumocins) are antibacterial toxins that mediate intra-species competition within the human host. However, the triggers of pneumocin expression are poorly understood. Using RNA-sequencing, we mapped the regulon of the pneumocin cluster (blp) of Streptococcus pneumoniae

Strain-specific impact of PsaR of Streptococcus pneumoniae on global gene expression and virulence.

NARCIS (Netherlands)

Hendriksen, W.T.; Bootsma, H.J.; Diepen, A. van; Estevao, S.; Kuipers, O.P.; Groot, R. de; Hermans, P.W.M.

2009-01-01

Previous studies have indicated that PsaR of Streptococcus pneumoniae is a manganese-dependent regulator, negatively affecting the expression of at least seven genes. Here, we extended these observations by transcriptome and proteome analysis of psaR mutants in strains D39 and TIGR4. The microarray

Multiplex quantitative PCR for detection of lower respiratory tract infection and meningitis caused by Streptococcus pneumoniae, Haemophilus influenzae and Neisseria meningitidis.

Science.gov (United States)

Abdeldaim, Guma M K; Strålin, Kristoffer; Korsgaard, Jens; Blomberg, Jonas; Welinder-Olsson, Christina; Herrmann, Björn

2010-12-03

Streptococcus pneumoniae and Haemophilus influenzae cause pneumonia and as Neisseria meningitidis they are important agents of meningitis. Although several PCR methods have been described for these bacteria the specificity is an underestimated problem. Here we present a quantitative multiplex real-time PCR (qmPCR) for detection of S. pneumoniae (9802 gene fragment), H. influenzae (omp P6 gene) and N. meningitidis (ctrA gene). The method was evaluated on bronchoalveolar lavage (BAL) samples from 156 adults with lower respiratory tract infection (LRTI) and 31 controls, and on 87 cerebrospinal fluid (CSF) samples from meningitis patients. The analytical sensitivity was not affected by using a combined mixture of reagents and a combined DNA standard (S. pneumoniae/H. influenzae/N. meningitidis) in single tubes. By blood- and BAL-culture and S. pneumoniae urinary antigen test, S. pneumoniae and H. influenzae were aetiological agents in 21 and 31 of the LTRI patients, respectively. These pathogens were identified by qmPCR in 52 and 72 of the cases, respectively, yielding sensitivities and specificities of 95% and 75% for S. pneumoniae, and 90% and 65% for H. influenzae, respectively. When using a cut-off of 10⁵ genome copies/mL for clinical positivity the sensitivities and specificities were 90% and 80% for S. pneumoniae, and 81% and 85% for H. influenzae, respectively. Of 44 culture negative but qmPCR positive for H. influenzae, 41 were confirmed by fucK PCR as H. influenzae. Of the 103 patients who had taken antibiotics prior to sampling, S. pneumoniae and H. influenzae were identified by culture in 6% and 20% of the cases, respectively, and by the qmPCR in 36% and 53% of the cases, respectively.In 87 CSF samples S. pneumoniae and N. meningitidis were identified by culture and/or 16 S rRNA in 14 and 10 samples and by qmPCR in 14 and 10 samples, respectively, giving a sensitivity of 100% and a specificity of 100% for both bacteria. The PCR provides increased

Multiplex quantitative PCR for detection of lower respiratory tract infection and meningitis caused by Streptococcus pneumoniae, Haemophilus influenzae and Neisseria meningitidis

Directory of Open Access Journals (Sweden)

Welinder-Olsson Christina

2010-12-01

Full Text Available Abstract Background Streptococcus pneumoniae and Haemophilus influenzae cause pneumonia and as Neisseria meningitidis they are important agents of meningitis. Although several PCR methods have been described for these bacteria the specificity is an underestimated problem. Here we present a quantitative multiplex real-time PCR (qmPCR for detection of S. pneumoniae (9802 gene fragment, H. influenzae (omp P6 gene and N. meningitidis (ctrA gene. The method was evaluated on bronchoalveolar lavage (BAL samples from 156 adults with lower respiratory tract infection (LRTI and 31 controls, and on 87 cerebrospinal fluid (CSF samples from meningitis patients. Results The analytical sensitivity was not affected by using a combined mixture of reagents and a combined DNA standard (S. pneumoniae/H. influenzae/N. meningitidis in single tubes. By blood- and BAL-culture and S. pneumoniae urinary antigen test, S. pneumoniae and H. influenzae were aetiological agents in 21 and 31 of the LTRI patients, respectively. These pathogens were identified by qmPCR in 52 and 72 of the cases, respectively, yielding sensitivities and specificities of 95% and 75% for S. pneumoniae, and 90% and 65% for H. influenzae, respectively. When using a cut-off of 105 genome copies/mL for clinical positivity the sensitivities and specificities were 90% and 80% for S. pneumoniae, and 81% and 85% for H. influenzae, respectively. Of 44 culture negative but qmPCR positive for H. influenzae, 41 were confirmed by fucK PCR as H. influenzae. Of the 103 patients who had taken antibiotics prior to sampling, S. pneumoniae and H. influenzae were identified by culture in 6% and 20% of the cases, respectively, and by the qmPCR in 36% and 53% of the cases, respectively. In 87 CSF samples S. pneumoniae and N. meningitidis were identified by culture and/or 16 S rRNA in 14 and 10 samples and by qmPCR in 14 and 10 samples, respectively, giving a sensitivity of 100% and a specificity of 100% for both

Structure of the Streptococcus pneumoniae Surface Protein and Adhesin PfbA

OpenAIRE

Suits, Michael D.; Boraston, Alisdair B.

2013-01-01

PfbA (plasmin- and fibronectin-binding protein A) is an extracellular Streptococcus pneumoniae cell-wall attached surface protein that binds to fibronectin, plasmin, and plasminogen. Here we present a structural analysis of the surface exposed domains of PfbA using a combined approach of X-ray crystallography and small-angle X-ray scattering (SAXS). The crystal structure of the PfbA core domain, here called PfbAβ, determined to 2.28 Å resolution revealed an elongated 12-stranded parallel β-he...

Frequency of Streptococcus pneumonia and Haemophilus influenza in acute exacerbation of chronic obstructive airway disease and their sensitivity to levofloxacin

International Nuclear Information System (INIS)

Furqan, S.; Paracha, S.A.U.

2014-01-01

Objective: To determine the frequency of Streptococcus pneumoniae and Haemophilus influenzae in acute exacerbation of chronic obstructive pulmonary disease and their sensitivity to levofloxacin. Methods: The cross-sectional study was conducted at the Department of Medicine, AbbasiShaheed Hospital, Karachi, between July 2009 and January 2010. Patients already diagnosed with chronic obstructive pulmonary disease and admitted with symptoms of acute exacerbation were included in the study and their sputum samples were sent for microbiological evaluation. SPSS 16 was used for statistical analysis. Results: Of the total 105 patients in the study, 90 (85.17%) were males. Overall mean age at presentation was 62+-10.2 years. S. pneumoniae was isolated from sputum culture of 33 (31.4%) patients, while 13 (12.4%) patients showed growth of H. influenzae. Out of the 33 sputum specimens of S. pneumoniae, 32 (97.0%) were sensitive to levofloxacin, while 1 (3.0%) was resistant. All the 13 isolates of H. influenzae were sensitive to levofloxacin. Conclusion: S. pneumoniae and H. influenzae are still the most prevalent organisms isolated in acute exacerbation of chronic obstructive pulmonary disease in our population. Levofloxacin is still considered a highly sensitive antibiotic against these common micro-organisms in our population, but S. pneumoniae has started developing resistance against levofloxacin. Therefore, intermittent surveillance regarding development of resistance pattern of common micro-organisms against commonly prescribed antibiotics is required. (author)

Novel role for the Streptococcus pneumoniae toxin pneumolysin in the assembly of biofilms.

Science.gov (United States)

Shak, Joshua R; Ludewick, Herbert P; Howery, Kristen E; Sakai, Fuminori; Yi, Hong; Harvey, Richard M; Paton, James C; Klugman, Keith P; Vidal, Jorge E

2013-09-10

Streptococcus pneumoniae is an important commensal and pathogen responsible for almost a million deaths annually in children under five. The formation of biofilms by S. pneumoniae is important in nasopharyngeal colonization, pneumonia, and otitis media. Pneumolysin (Ply) is a toxin that contributes significantly to the virulence of S. pneumoniae and is an important candidate as a serotype-independent vaccine target. Having previously demonstrated that a luxS knockout mutant was unable to form early biofilms and expressed less ply mRNA than the wild type, we conducted a study to investigate the role of Ply in biofilm formation. We found that Ply was expressed in early phases of biofilm development and localized to cellular aggregates as early as 4 h postinoculation. S. pneumoniae ply knockout mutants in D39 and TIGR4 backgrounds produced significantly less biofilm biomass than wild-type strains at early time points, both on polystyrene and on human respiratory epithelial cells, cultured under static or continuous-flow conditions. Ply's role in biofilm formation appears to be independent of its hemolytic activity, as S. pneumoniae serotype 1 strains, which produce a nonhemolytic variant of Ply, were still able to form biofilms. Transmission electron microscopy of biofilms grown on A549 lung cells using immunogold demonstrated that Ply was located both on the surfaces of pneumococcal cells and in the extracellular biofilm matrix. Altogether, our studies demonstrate a novel role for pneumolysin in the assembly of S. pneumoniae biofilms that is likely important during both carriage and disease and therefore significant for pneumolysin-targeting vaccines under development. The bacterium Streptococcus pneumoniae (commonly known as the pneumococcus) is commonly carried in the human nasopharynx and can spread to other body sites to cause disease. In the nasopharynx, middle ear, and lungs, the pneumococcus forms multicellular surface-associated structures called biofilms

Circulation of Streptococcus pneumoniae clone Colombia5 ST289 in nine Latin American countries Circulación de Streptococcus pneumoniae clon Colombia5 ST289 en nueve países de América Latina

Directory of Open Access Journals (Sweden)

Carolina Firacative

2009-04-01

Full Text Available OBJECTIVE: To determine genetic relatedness of clone Colombia5 ST289 with invasive Streptococcus pneumoniae serotype 5 isolates recovered in nine Latin American countries. METHODS: Forty-four invasive S. pneumoniae serotype 5 isolates recovered from children under 5 years of age in Bolivia, Chile, Dominican Republic, Ecuador, Nicaragua, Panama, Paraguay, Peru, and Venezuela were studied. Pulsed-field gel electrophoresis patterns of DNA treated with SmaI restriction enzyme were classified using Tenover's criteria and analyzed with the Fingerprinting II program to determine their genetic relatedness with the Colombian clone. RESULTS: All isolates had a genetic similarity of 78.5% or more with the Colombian clone. Thirteen electrophoretic subtypes derived of pattern A were identified, and five of them (A5, A6, A8, A13, A27 comprised 61.4% of the isolates. CONCLUSIONS: Clone Colombia5 ST289 is disseminated in Latin America. This is important because S. pneumoniae serotype 5 frequently causes invasive disease in the region and is associated with trimethoprim-sulfamethoxazole resistance.OBJETIVO: Determinar la relación genética del clon Colombia5 ST289 con los aislamientos invasores de Streptococcus pneumoniae serotipo 5 provenientes de nueve países latinoamericanos. MÉTODOS: Se estudiaron 45 aislamientos invasores de Streptococcus pneumoniae serotipo 5 procedentes de niños menores de 5 años de Bolivia, Chile, Ecuador, Nicaragua, Panamá, Paraguay, Perú, República Dominicana y Venezuela. Los patrones en electroforesis en gel de campo pulsante del ADN tratado con la enzima de restricción SmaI se clasificaron mediante el criterio de Tenover y se analizaron con el programa Fingerprinting II para determinar su relación genética con el clon colombiano. RESULTADOS: Todos los aislamientos tuvieron una similitud genética de 78,5% o mayor con el clon colombiano. Se identificaron 13 subtipos electroforéticos derivados del patrón A y cinco de ellos

Serotipos prevalentes de Streptococcus pneumoniae colonizadores de nasofaringe, en niños del Distrito Federal Prevalence of Streptococcus pneumoniae serotypes on nasopharyngeal colonization in children of Mexico City

Directory of Open Access Journals (Sweden)

Fortino Solórzano-Santos

2005-07-01

Full Text Available OBJETIVO: Determinar frecuencia, serotipos y susceptibilidad a ocho antimicrobianos en Streptococcus pneumoniae aislados de la nasofaringe de una muestra representativa de niños menores de cinco años de edad residentes en el Distrito Federal. MATERIAL Y MÉTODOS: Estudio transversal, hecho de febrero de 2002 a enero de 2003. Se incluyeron niños de 2 meses a 5 años. A los seleccionados se les tomó una muestra de exudado faríngeo con hisopo de alginato de calcio. Bajo técnicas ya establecidas se realizó identificación, tipificación y susceptibilidad a ocho antimicrobianos de los aislamientos de S. pneumoniae. Se utilizó estadística descriptiva, prueba de Ji cuadrada y razón de momios (IC 95% para los factores de riesgo. RESULTADOS: Se estudiaron 573 niños. En 122/573 (21.4% niños se aisló S. pneumoniae. Los serotipos más frecuentes fueron el 23F, 35, 19F, 11A y 15A; 46% de los serotipos encontrados no son cubiertos con la vacuna heptavalente. Se encontró 12% de susceptibilidad reducida a la penicilina, con 3% de cepas con alta resistencia; la resistencia a eritromicina fue >30% y para trimetoprim-sulfametoxazol (TMP/SMX >40%. No hubo cepas resistentes a vancomicina, cefotaxima, amoxicilina-clavulanato, cloranfenicol o ampicilina. CONCLUSIONES: El porcentaje de serotipos de S. pneumoniae en portadores nasofaríngeos no cubiertos por la vacuna heptavalente es alto, y la resistencia a macrólidos y TMP/SMX es elevada, lo que debe alertar al grupo médico.OBJECTIVE: To determine the frequency, serotypes and susceptibility profiles to eight antimicrobials in Streptococcus pneumoniae nasopharyngeal isolates from a representative sample of children under 5 years of age, residents of Mexico City. PATIENTS AND METHODS: A cross-sectional survey was conducted in 573 children aged 2 months to 5 years. A nasopharyngeal sample was taken. S. pneumoniae identification, capsular serotyping and antimicrobial susceptibility to eight antimicrobials

Association between nasopharyngeal load of Streptococcus pneumoniae, viral coinfection, and radiologically confirmed pneumonia in Vietnamese children.

Science.gov (United States)

Vu, Huong Thi Thu; Yoshida, Lay Myint; Suzuki, Motoi; Nguyen, Hien Anh Thi; Nguyen, Cat Dinh Lien; Nguyen, Ai Thi Thuy; Oishi, Kengo; Yamamoto, Takeshi; Watanabe, Kiwao; Vu, Thiem Dinh

2011-01-01

The interplay between nasopharyngeal bacterial carriage, viral coinfection, and lower respiratory tract infections (LRTIs) is poorly understood. We explored this association in Vietnamese children aged less than 5 years. A hospital-based case-control study of pediatric LRTIs was conducted in Nha Trang, Vietnam. A total of 550 hospitalized children (274 radiologically confirmed pneumonia [RCP] and 276 other LRTIs) were enrolled and 350 healthy controls were randomly selected from the community. Polymerase chain reaction-based methods were used to measure bacterial loads of Streptococcus pneumoniae (SP), Haemophilus influenzae, and Moraxella catarrhalis and to detect 13 respiratory viruses and bacterial serotypes in nasopharyngeal samples of study participants. The median nasopharyngeal bacterial load of SP was substantially higher in children with RCP compared with healthy controls or children with other LRTIs (P RCP or other LRTIs groups. An increased load of SP in the nasopharynx was associated with RCP, viral coinfection, and presence of pneumococcal capsule.

Silica desiccant packets for storage and transport of Streptococcus pneumoniae and other clinically relevant species.

Directory of Open Access Journals (Sweden)

Casey L Pell

Full Text Available Bacterial isolates are often transported between laboratories for research and diagnostic purposes. Silica desiccant packets (SDPs, which are inexpensive and do not require freezing, were evaluated for storage and recovery of bacterial isolates. Conditions such as inoculum size, swab type and temperature of storage were investigated using ten Streptococcus pneumoniae isolates. The optimized protocol was then tested using 49 additional S. pneumoniae isolates representing 40 serogroups. Overall, S. pneumoniae growth was considered satisfactory (>100 colony forming units for 98/109 (89.9% and 20/20 (100% swabs after 14 days at room temperature or 28 days at 4° C, respectively. Storage in SDPs did not impact on the ability of S. pneumoniae isolates to be subsequently serotyped. When the survival of nine other clinically relevant bacterial species was tested, seven were viable after 28 days at room temperature, the exceptions being Neisseria gonorrhoeae and Haemophilus influenzae. SDPs are suitable for transport and short-term storage of bacterial species including S. pneumoniae.

Molecular Detection of Streptococcus pneumoniae on Dried Blood Spots from Febrile Nigerian Children Compared to Culture.

Directory of Open Access Journals (Sweden)

Pui-Ying Iroh Tam

Full Text Available Nigeria has one of the highest burdens of pneumococcal disease in the world, but accurate surveillance is lacking. Molecular detection of infectious pathogens in dried blood spots (DBS is an ideal method for surveillance of infections in resource-limited settings because of its low cost, minimal blood volumes involved, and ease of storage at ambient temperature. Our study aim was to evaluate a Streptococcus pneumoniae real-time polymerase chain reaction (rt-PCR assay on DBS from febrile Nigerian children on Whatman 903 and FTA filter papers, compared to the gold standard of culture.Between September 2011 to May 2015, blood was collected from children 5 years of age or under who presented to six hospital study sites throughout northern and central Nigeria with febrile illness, and inoculated into blood culture bottles or spotted onto Whatman 903 or FTA filter paper. Culture and rt-PCR were performed on all samples.A total of 537 DBS specimens from 535 children were included in the study, of which 15 were culture-positive for S. pneumoniae. The rt-PCR assay detected S. pneumoniae in 12 DBS specimens (2.2%. One positive rt-PCR result was identified in a culture-negative specimen from a high-risk subject, and two positive rt-PCR results were negative on repeat testing. Six culture-confirmed cases of S. pneumoniae bacteremia were missed. Compared to culture, the overall sensitivities of Whatman 903 and FTA DBS for detection of S. pneumoniae were 57.1% (95% CI 18.4-90.1% and 62.5% (95% CI 24.5-91.5%, respectively. Nonspecific amplification was noted in an additional 22 DBS (4.1%. Among these, six were positive for a non-S. pneumoniae pathogen on culture.Rt-PCR was able to detect S. pneumoniae from clinical DBS specimens, including from a culture-negative specimen. Our findings show promise of this approach as a surveillance diagnostic, but also raise important cautionary questions. Several DBS specimens were detected as S. pneumoniae by rt-PCR despite

Molecular Detection of Streptococcus pneumoniae on Dried Blood Spots from Febrile Nigerian Children Compared to Culture.

Science.gov (United States)

Iroh Tam, Pui-Ying; Hernandez-Alvarado, Nelmary; Schleiss, Mark R; Hassan-Hanga, Fatimah; Onuchukwu, Chuma; Umoru, Dominic; Obaro, Stephen K

2016-01-01

Nigeria has one of the highest burdens of pneumococcal disease in the world, but accurate surveillance is lacking. Molecular detection of infectious pathogens in dried blood spots (DBS) is an ideal method for surveillance of infections in resource-limited settings because of its low cost, minimal blood volumes involved, and ease of storage at ambient temperature. Our study aim was to evaluate a Streptococcus pneumoniae real-time polymerase chain reaction (rt-PCR) assay on DBS from febrile Nigerian children on Whatman 903 and FTA filter papers, compared to the gold standard of culture. Between September 2011 to May 2015, blood was collected from children 5 years of age or under who presented to six hospital study sites throughout northern and central Nigeria with febrile illness, and inoculated into blood culture bottles or spotted onto Whatman 903 or FTA filter paper. Culture and rt-PCR were performed on all samples. A total of 537 DBS specimens from 535 children were included in the study, of which 15 were culture-positive for S. pneumoniae. The rt-PCR assay detected S. pneumoniae in 12 DBS specimens (2.2%). One positive rt-PCR result was identified in a culture-negative specimen from a high-risk subject, and two positive rt-PCR results were negative on repeat testing. Six culture-confirmed cases of S. pneumoniae bacteremia were missed. Compared to culture, the overall sensitivities of Whatman 903 and FTA DBS for detection of S. pneumoniae were 57.1% (95% CI 18.4-90.1%) and 62.5% (95% CI 24.5-91.5%), respectively. Nonspecific amplification was noted in an additional 22 DBS (4.1%). Among these, six were positive for a non-S. pneumoniae pathogen on culture. Rt-PCR was able to detect S. pneumoniae from clinical DBS specimens, including from a culture-negative specimen. Our findings show promise of this approach as a surveillance diagnostic, but also raise important cautionary questions. Several DBS specimens were detected as S. pneumoniae by rt-PCR despite growth of

Total synthesis of a Streptococcus pneumoniae serotype 12F CPS repeating unit hexasaccharide

Directory of Open Access Journals (Sweden)

Peter H. Seeberger

2017-01-01

Full Text Available The Gram-positive bacterium Streptococcus pneumoniae causes severe disease globally. Vaccines that prevent S. pneumoniae infections induce antibodies against epitopes within the bacterial capsular polysaccharide (CPS. A better immunological understanding of the epitopes that protect from bacterial infection requires defined oligosaccharides obtained by total synthesis. The key to the synthesis of the S. pneumoniae serotype 12F CPS hexasaccharide repeating unit that is not contained in currently used glycoconjugate vaccines is the assembly of the trisaccharide β-D-GalpNAc-(1→4-[α-D-Glcp-(1→3]-β-D-ManpNAcA, in which the branching points are equipped with orthogonal protecting groups. A linear approach relying on the sequential assembly of monosaccharide building blocks proved superior to a convergent [3 + 3] strategy that was not successful due to steric constraints. The synthetic hexasaccharide is the starting point for further immunological investigations.

Identification of the smallest structure capable of evoking opsonophagocytic antibodies against Streptococcus pneumoniae type 14

NARCIS (Netherlands)

Safari, D.; Dekker, H.A.T.; Joosten, J.A.; Michalik, D.; de Souza, A.C.; Adamo, R.; Lahmann, M.; Oscarson, S.; Kamerling, J.P.|info:eu-repo/dai/nl/070433941; Snippe, H.

2008-01-01

Synthetic overlapping oligosaccharide fragments of Streptococcus pneumoniae serotype 14 capsular polysaccharide (Pn14PS), {6)-[β-D-Galp-(14)-]β-D-GlcpNAc-(13)-β-D-Galp-(14)-β-D-Glcp-(1}n, were conjugated to CRM197 protein and injected into mice to determine the smallest immunogenic structure. The

Characterization of Streptococcus pneumoniae isolates from Austrian companion animals and horses.

Science.gov (United States)

Ginders, Maximilian; Leschnik, Michael; Künzel, Frank; Kampner, Doris; Mikula, Claudia; Steindl, Georg; Eichhorn, Inga; Feßler, Andrea T; Schwarz, Stefan; Spergser, Joachim; Loncaric, Igor

2017-11-14

The aim of the present study was to investigate the genetic relatedness and the antimicrobial resistance profiles of a collection of Austrian Streptococcus pneumoniae isolates from companion animals and horses. A total of 12 non-repetitive isolates presumptively identified as S. pneumoniae were obtained during routinely diagnostic activities between March 2009 and January 2017. Isolates were confirmed as S. pneumoniae by bile solubility and optochin susceptibility testing, matrix-assisted laser desorption-ionization-time of flight (MALDI-TOF) mass spectrometry and sequence analysis of a part recA and the 16S rRNA genes. Isolates were further characterized by pneumolysin polymerase chain reaction (PCR) and genotyped by multilocus sequence typing (MLST). Antimicrobial susceptibility testing was performed and resistance genes were detected by specific PCR assays. All isolates were serotyped. Four sequence types (ST) (ST36, ST3546, ST6934 and ST6937) and four serotypes (3, 19A, 19F and 23F) were detected. Two isolates from twelve displayed a multidrug-resistance pheno- and genotype. This study represents the first comprehensive investigation on characteristics of S. pneumoniae isolates recovered from Austrian companion animals and horses. The obtained results indicate that common human sero- (23F) and sequence type (ST36) implicated in causing invasive pneumococcal disease (IPD) may circulate in dogs. Isolates obtained from other examined animals seem to be host-adapted.

Bactericidal effect of bovine lactoferrin and synthetic peptide lactoferrin chimera in Streptococcus pneumoniae and the decrease in luxS gene expression by lactoferrin

NARCIS (Netherlands)

León-Sicairos, N.; Angulo-Zamudio, U.A.; Vidal, J.E.; López-Torres, C.A.; Bolscher, J.G.M.; Nazmi, K.; Reyes-Cortes, R.; Reyes-López, M.; de la Garza, M.; Canizalez-Román, A.

2014-01-01

Streptococcus pneumoniae (pneumococcus) is responsible for nearly one million child deaths annually. Pneumococcus causes infections such as pneumonia, otitis media, meningitis, and sepsis. The human immune system includes antibacterial peptides and proteins such as lactoferrin (LF), but its activity

A type IV pilus mediates DNA binding during natural transformation in Streptococcus pneumoniae.

Directory of Open Access Journals (Sweden)

Raphaël Laurenceau

Full Text Available Natural genetic transformation is widely distributed in bacteria and generally occurs during a genetically programmed differentiated state called competence. This process promotes genome plasticity and adaptability in Gram-negative and Gram-positive bacteria. Transformation requires the binding and internalization of exogenous DNA, the mechanisms of which are unclear. Here, we report the discovery of a transformation pilus at the surface of competent Streptococcus pneumoniae cells. This Type IV-like pilus, which is primarily composed of the ComGC pilin, is required for transformation. We provide evidence that it directly binds DNA and propose that the transformation pilus is the primary DNA receptor on the bacterial cell during transformation in S. pneumoniae. Being a central component of the transformation apparatus, the transformation pilus enables S. pneumoniae, a major Gram-positive human pathogen, to acquire resistance to antibiotics and to escape vaccines through the binding and incorporation of new genetic material.

A visual review of the human pathogen Streptococcus pneumoniae.

Science.gov (United States)

Engholm, Ditte Høyer; Kilian, Mogens; Goodsell, David S; Andersen, Ebbe Sloth; Kjærgaard, Rikke Schmidt

2017-11-01

Being the principal causative agent of bacterial pneumonia, otitis media, meningitis and septicemia, the bacterium Streptococcus pneumoniae is a major global health problem. To highlight the molecular basis of this problem, we have portrayed essential biological processes of the pneumococcal life cycle in eight watercolor paintings. The paintings are done to a consistent nanometer scale based on currently available data from structural biology and proteomics. In this review article, the paintings are used to provide a visual review of protein synthesis, carbohydrate metabolism, cell wall synthesis, cell division, teichoic acid synthesis, virulence, transformation and pilus synthesis based on the available scientific literature within the field of pneumococcal biology. Visualization of the molecular details of these processes reveals several scientific questions about how molecular components of the pneumococcal cell are organized to allow biological function to take place. By the presentation of this visual review, we intend to stimulate scientific discussion, aid in the generation of scientific hypotheses and increase public awareness. A narrated video describing the biological processes in the context of a whole-cell illustration accompany this article. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Análise das cepas de Streptococcus pneumoniae causadores de pneumonia invasiva: sorotipos e sensibilidade aos antimicrobianos

Directory of Open Access Journals (Sweden)

Cristina R. M. Yoshioka

2011-02-01

Full Text Available OBJETIVOS: Identificar os sorotipos de pneumococo mais frequentemente isolados de crianças internadas com pneumonia invasiva, comparar os sorotipos com os incluídos em vacinas conjugadas e analisar sua sensibilidade aos antimicrobianos mais utilizados na faixa etária pediátrica. MÉTODOS: Estudo descritivo, retrospectivo das pneumonias pneumocócicas identificadas em crianças internadas no hospital universitário da Universidade de São Paulo, no período de janeiro de 2003 a outubro de 2008. Os critérios de inclusão foram: faixa etária de 29 dias até 15 anos incompletos com diagnóstico clínico e radiológico de pneumonia e com cultura de sangue e/ou líquido pleural com crescimento de Streptococcus pneumoniae. RESULTADOS: Foram incluídas no estudo 107 crianças. Os sorotipos mais frequentes foram: 14 (36,5%, 1 (16,7%, 5 (14,6%, 6B (6,3% e 3 (4,2%. A proporção de sorotipos contidos na vacina conjugada heptavalente seria de 53,1%, na vacina 10-valente de 86,5% e na 13-valente seria de 96,9%. De acordo com os padrões do Clinical and Laboratory Standards Institute 2008, 100 cepas (93,5% de pneumococos foram sensíveis à penicilina (concentração inibitória mínima, CIM 8 µg/mL. Verificamos alta taxa de sensibilidade para as cepas testadas para vancomicina, rifampicina, ceftriaxone, clindamicina, cloranfenicol e eritromicina. CONCLUSÕES: Nossos resultados confirmam um expressivo impacto potencial das vacinas conjugadas, principalmente pela 10-valente e 13-valente, sobre os casos de pneumonias invasivas. Os resultados de sensibilidade à penicilina evidenciam que a opção terapêutica de escolha para o tratamento das pneumonias invasivas continua sendo a penicilina.

The Host Immune Response to Streptococcus pneumoniae: Bridging Innate and Adaptive Immunity

Science.gov (United States)

2006-07-06

P.J. (1989) Effect of Streptococcus pneumoniae on human respiratory epithelium in vitro. Infect. Immun. 57: 2006-2013. Stoop, J.N., van der Molen ...antibiotics. Clin. Microbiol. Rev. 3: 171-196. Knapp, S., Wieland, C.W., van ’t Veer, C., Takeuchi, O., Akira, S., Florquin, S., and van der Poll...R.G., Baan, C.C., van der Laan, L.J., Kuipers, E.J., Kusters, J.G., and Janssen, H.L. (2005) Regulatory T cells contribute to the impaired immune

Internamento devido a PAC por Streptococcus pneumoniae – Avaliação de factores de mortalidade

Directory of Open Access Journals (Sweden)

Sandra Figueiredo

2008-09-01

Full Text Available Resumo: A avaliação da gravidade perante qualquer caso de pneumonia adquirida na comunidade (PAC é de suma importância, pois dela decorrem decisões como a necessidade de internamento e o tratamento empírico inicial. Os autores apresentam um estudo retrospectivo, que incluiu doentes internados devido a pneumonia por Streptococcus pneumoniae durante o ano de 2006, no Hospital de São João. A confirmação etiológica de infecção foi feita por isolamentos no sangue, líquido pleural, secreções traqueobrônquicas, lavado brônquico, lavado broncoalveolar e pesquisa de antigenúria. Foram analisados os factores de risco e avaliados, com base nas normas PSI (Pneumonia Severity Index e da British Thoracic Society (BTS -CURB-65. A análise estatística foi efectuada utilizando teste T para amostras independentes e ANOVA, usando o programa de análise estatística SPSS 14.0.Foram incluídos 104 doentes com idade mediana de 63 anos, sendo 67,3% do sexo masculino. O estudo revelou existir uma associação com significado estatístico entre os resultados de PSI e CURB-65 e a evolução para a mortalidade.Apesar da melhoria dos meios diagnósticos e profilácticos, e da terapêutica antibiótica, a pneumonia pneumocócica permanece uma entidade de grande morbilidade e mortalidade. O valor preditivo das normas PSI e CURB-65 foi confirmado nesta população de doentes, documentando uma correlação entre o número de factores de risco e a evolução da doença.Rev Port Pneumol 2008; XIV (5: 601-615 Abstract: Probably the most important decision in the management of Community-Acquired Pneumonia (CAP is patient site of care. Patients with Streptococcus pneumoniae-caused CAP admitted to our hospital between 1st January and 31st December 2006 were retrospectively analysed. Samples of blood, sputum, bronchial and bronchoalveolar lavage and urine were collected for

A reação em cadeia da polimerase na detecção da resistência à penicilina em Streptococcus pneumoniae

OpenAIRE

Zettler,Eduardo Walker; Scheibe,Rosane M.; Dias,Cícero A. G.; Santafé,Patrícia; Moreira,José da Silva; Santos,Diógenes S.; Fritscher,Carlos Cezar

2004-01-01

INTRODUÇÃO: O Streptococcus pneumoniae é o mais freqüente agente etiológico de infecções respiratórias adquiridas na comunidade e sua resistência aos antimicrobianos tem aumentado nos últimos anos. A determinação da resistência é feita rotineiramente por método lento que depende do crescimento em cultura e determinação da concentração inibitória mínima (CIM). A reação em cadeia da polimerase (PCR) detecta os genes responsáveis pela resistência do Streptococcus pneumoniae a penicilina em cerca...

Demographic profile of healthy children with nasopharyngeal colonisation of Streptococcus pneumoniae: A research paper

Directory of Open Access Journals (Sweden)

Radhika Raman

2017-01-01

Full Text Available Background: Pneumonia is a preventable cause of mortality in children. Streptococcus pneumoniae colonising the nasopharynx of healthy children can cause invasive diseases and the serotype distribution of colonisation isolates should be an indicator of invasive disease, antibiotic resistance profiles, and potential vaccine coverage. Identifying factors influencing nasopharyngeal colonisation, the serotypes and antimicrobial resistance pattern can improve rational preventive strategies. Objectives: Identify risk factors associated with nasopharyngeal colonisation of S.pneumoniae in healthy children between 6 months to 5 years of age. Determine the serotype and antibiotic sensitivity of S. pneumoniae isolated from nasopharynx of healthy children. Methods: This prospective observational included 500 healthy children, 6months to 5 years of age. Demographic features of the study population, the serotypes and antimicrobial sensitivity pattern of S.Pneumoniae isolated from cultures of nasopharyngeal swabs were subjected to statistical analysis. Results: S. pneumoniae was isolated in 9% of 450 children. Increased nasopharyngeal carriage rate was associated with overcrowding 48.8% and poor ventilation 35.5%. 6B (n=16 was the most common serotype isolated. 69% were serogroups known to cause invasive disease All S. pneumoniae isolates were susceptible to vancomycin and linezolid. Antimicrobial susceptibility of PCV 7 serotypes were greater than non PCV 7 serotypes for almost all antimicrobials tested. Penicillin resistance was 11 % and MDR 51%

The Small Molecule DAM Inhibitor, Pyrimidinedione, Disrupts Streptococcus pneumoniae Biofilm Growth In Vitro.

Directory of Open Access Journals (Sweden)

Mukesh Kumar Yadav

Full Text Available Streptococcus pneumoniae persist in the human nasopharynx within organized biofilms. However, expansion to other tissues may cause severe infections such as pneumonia, otitis media, bacteremia, and meningitis, especially in children and the elderly. Bacteria within biofilms possess increased tolerance to antibiotics and are able to resist host defense systems. Bacteria within biofilms exhibit different physiology, metabolism, and gene expression profiles than planktonic cells. These differences underscore the need to identify alternative therapeutic targets and novel antimicrobial compounds that are effective against pneumococcal biofilms. In bacteria, DNA adenine methyltransferase (Dam alters pathogenic gene expression and catalyzes the methylation of adenine in the DNA duplex and of macromolecules during the activated methyl cycle (AMC. In pneumococci, AMC is involved in the biosynthesis of quorum sensing molecules that regulate competence and biofilm formation. In this study, we examine the effect of a small molecule Dam inhibitor, pyrimidinedione, on Streptococcus pneumoniae biofilm formation and evaluate the changes in global gene expression within biofilms via microarray analysis. The effects of pyrimidinedione on in vitro biofilms were studied using a static microtiter plate assay, and the architecture of the biofilms was viewed using confocal and scanning electron microscopy. The cytotoxicity of pyrimidinedione was tested on a human middle ear epithelium cell line by CCK-8. In situ oligonucleotide microarray was used to compare the global gene expression of Streptococcus pneumoniae D39 within biofilms grown in the presence and absence of pyrimidinedione. Real-time RT-PCR was used to study gene expression. Pyrimidinedione inhibits pneumococcal biofilm growth in vitro in a concentration-dependent manner, but it does not inhibit planktonic cell growth. Confocal microscopy analysis revealed the absence of organized biofilms, where cell

Roles of the Essential Protein FtsA in Cell Growth and Division in Streptococcus pneumoniae

Czech Academy of Sciences Publication Activity Database

Mura, Andrea; Fadda, D.; Perez, A.J.; Danforth, M.L.; Musu, D.; Rico, A.I.; Krupka, M.; Denapaite, D.; Tsui, H-Ch.T.; Winkler, M.E.; Branny, Pavel; Vicente, M.; Margolin, W.; Massidda, O.

2017-01-01

Roč. 199, č. 3 (2017), č. článku UNSP e00608. ISSN 0021-9193 R&D Projects: GA ČR GAP302/12/0256; GA MŠk LH12055 Institutional support: RVO:61388971 Keywords : FtsA * Gram-positive cocci * Streptococcus pneumoniae Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 3.143, year: 2016

Time and dose-dependent risk of pneumococcal pneumonia following influenza: a model for within-host interaction between influenza and Streptococcus pneumoniae

OpenAIRE

Shrestha, Sourya; Foxman, Betsy; Dawid, Suzanne; Aiello, Allison E.; Davis, Brian M.; Berus, Joshua; Rohani, Pejman

2013-01-01

A significant fraction of seasonal and in particular pandemic influenza deaths are attributed to secondary bacterial infections. In animal models, influenza virus predisposes hosts to severe infection with both Streptococcus pneumoniae and Staphylococcus aureus. Despite its importance, the mechanistic nature of the interaction between influenza and pneumococci, its dependence on the timing and sequence of infections as well as the clinical and epidemiological consequences remain unclear. We e...

LocZ is a new cell division protein involved in proper septum placement in Streptococcus pneumoniae

Czech Academy of Sciences Publication Activity Database

Holečková, Nela; Doubravová, Linda; Massidda, Orietta; Molle, Virginie; Buriánková, Karolína; Benada, Oldřich; Kofroňová, Olga; Ulrych, Aleš; Branny, Pavel

2015-01-01

Roč. 6, č. 1 (2015), s. 1-13 ISSN 2150-7511 R&D Projects: GA ČR GAP207/12/1568; GA ČR GAP302/12/0256 Institutional support: RVO:61388971 Keywords : cell division * septum placement * Streptococcus pneumoniae Subject RIV: EE - Microbiology, Virology Impact factor: 6.975, year: 2015

UlaR activates expression of the ula operon in Streptococcus pneumoniae in the presence of ascorbic acid

NARCIS (Netherlands)

Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P

In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased

Delineation of Streptococcus dysgalactiae, its subspecies, and its clinical and phylogenetic relationship to Streptococcus pyogenes

DEFF Research Database (Denmark)

Jensen, Anders; Kilian, Mogens

2011-01-01

The close phylogenetic relationship of the important pathogen Streptococcus pneumoniae and several species of commensal streptococci, particularly Streptococcus mitis and Streptococcus pseudopneumoniae, and the recently demonstrated sharing of genes and phenotypic traits previously considered...

Colonização e resistência antimicrobiana de Streptococcus pneumoniae isolado em nasofaringe de crianças com rinofaringite aguda Nasopharyngeal colonization and antimicrobial resistance of Streptococcus pneumoniae isolated in children with acute rinofaringitis

Directory of Open Access Journals (Sweden)

Lêda Lúcia M. Ferreira

2001-06-01

ças com infecção respiratória alta podem ser usados na vigilância da resistência antimicrobiana numa determinada comunidade.OBJECTIVE: to determine the prevalence and risk factors for nasopharyngeal colonization by, and to evaluate antimicrobial susceptibility of Streptococcus pneumoniae strains in children with acute rhinopharyngitis. METHODS: we collected nasopharyngeal swab specimens from 400 children aged 3 months to 5 years and with clinical status of acute rhinopharyngitis from June 16, 1997 to May 20, 1998 at the outpatient clinics of two hospitals in the city of São Paulo. Nasopharyngeal specimens were collected pernasally using a calcium alginate swab and plated immediately after collection onto trypticose soy agar with 5% sheep blood and garamicin 5 mcg/ml. Penicillin susceptibility was determined by oxacillin 1 mcg disk screening test and the minimal inhibitory concentration by the E-test. RESULTS: Pneumococci were recovered from 139 children, indicating a colonization prevalence of 35%. The risk factors analyzed indicated that the colonization was more prevalent in children attending day-care centers, children with siblings younger than 5 years, and children with recent use of antimicrobial agents. The prevalence of penicillin non-susceptible strains was of 16 % (20 strains. All strains were intermediately resistant (0.1mcg/ ml < MIC < 1.0 mcg/ ml. Out of the penicillin intermediately resistant strains, 7 (37% showed intermediate resistance to cotrimoxazol and 2 (11% full resistance to trimethoprim-sulfamethoxazole. No strains were resistant to ceftriaxone, amoxicillin, clarithromicin, or chloramphenicol. CONCLUSIONS: our findings indicate that the prevalence of nasopharyngeal colonization by Streptococcus pneumoniae in children with upper respiratory infections was of 34.8%. Children attending day-care centers and children with younger siblings showed higher levels of colonization The results of prevalence of bacterial resistance were similar to those

Validation of an immunodiagnostic assay for detection of 13 Streptococcus pneumoniae serotype-specific polysaccharides in human urine.

Science.gov (United States)

Pride, Michael W; Huijts, Susanne M; Wu, Kangjian; Souza, Victor; Passador, Sherry; Tinder, Chunyan; Song, Esther; Elfassy, Arik; McNeil, Lisa; Menton, Ronald; French, Roger; Callahan, Janice; Webber, Chris; Gruber, William C; Bonten, Marc J M; Jansen, Kathrin U

2012-08-01

To improve the clinical diagnosis of pneumococcal infection in bacteremic and nonbacteremic community-acquired pneumonia (CAP), a Luminex technology-based multiplex urinary antigen detection (UAD) diagnostic assay was developed and validated. The UAD assay can simultaneously detect 13 different serotypes of Streptococcus pneumoniae by capturing serotype-specific S. pneumoniae polysaccharides (PnPSs) secreted in human urine. Assay specificity is achieved by capturing the polysaccharides with serotype-specific monoclonal antibodies (MAbs) on spectrally unique microspheres. Positivity for each serotype was based on positivity cutoff values calculated from a standard curve run on each assay plate together with positive- and negative-control urine samples. The assay is highly specific, since significant signals are detected only when each PnPS was paired with its homologous MAb-coated microspheres. Validation experiments demonstrated excellent accuracy and precision. The UAD assay and corresponding positivity cutoff values were clinically validated by assessing 776 urine specimens obtained from patients with X-ray-confirmed CAP. The UAD assay demonstrated 97% sensitivity and 100% specificity using samples obtained from patients with bacteremic, blood culture-positive CAP. Importantly, the UAD assay identified Streptococcus pneumoniae (13 serotypes) in a proportion of individuals with nonbacteremic CAP, a patient population for which the pneumococcal etiology of CAP was previously difficult to assess. Therefore, the UAD assay provides a specific, noninvasive, sensitive, and reproducible tool to support vaccine efficacy as well as epidemiological evaluation of pneumococcal disease, including CAP, in adults.

Epidemiology of Streptococcus pneumoniae and Staphylococcus aureus colonization in healthy Venezuelan children.

Science.gov (United States)

Quintero, B; Araque, M; van der Gaast-de Jongh, C; Escalona, F; Correa, M; Morillo-Puente, S; Vielma, S; Hermans, P W M

2011-01-01

Streptococcus pneumoniae and Staphylococcus aureus cause significant morbidity and mortality worldwide. We investigated both the colonization and co-colonization characteristics for these pathogens among 250 healthy children from 2 to 5 years of age in Merida, Venezuela, in 2007. The prevalence of S. pneumoniae colonization, S. aureus colonization, and S. pneumoniae-S. aureus co-colonization was 28%, 56%, and 16%, respectively. Pneumococcal serotypes 6B (14%), 19F (12%), 23F (12%), 15 (9%), 6A (8%), 11 (8%), 23A (6%), and 34 (6%) were the most prevalent. Non-respiratory atopy was a risk factor for S. aureus colonization (p = 0.017). Vaccine serotypes were negatively associated with preceding respiratory infection (p = 0.02) and with S. aureus colonization (p = 0.03). We observed a high prevalence of pneumococcal resistance against trimethoprim-sulfamethoxazole (40%), erythromycin (38%), and penicillin (14%). Semi-quantitative measurement of pneumococcal colonization density showed that children with young siblings and low socioeconomic status were more densely colonized (p = 0.02 and p = 0.02, respectively). In contrast, trimethoprim-sulfamethoxazole- and multidrug-resistant-pneumococci colonized children sparsely (p = 0.03 and p = 0.01, respectively). Our data form an important basis to monitor the future impact of pneumococcal vaccination on bacterial colonization, as well as to recommend a rationalized and restrictive antimicrobial use in our community.

Dominance of multidrug resistant CC271 clones in macrolide-resistant streptococcus pneumoniae in Arizona

Directory of Open Access Journals (Sweden)

Bowers Jolene R

2012-01-01

Full Text Available Abstract Background Rates of resistance to macrolide antibiotics in Streptococcus pneumoniae are rising around the world due to the spread of mobile genetic elements harboring mef(E and erm(B genes and post-vaccine clonal expansion of strains that carry them. Results Characterization of 592 clinical isolates collected in Arizona over a 10 year period shows 23.6% are macrolide resistant. The largest portion of the macrolide-resistant population, 52%, is dual mef(E/erm(B-positive. All dual-positive isolates are multidrug-resistant clonal lineages of Taiwan19F-14, mostly multilocus sequence type 320, carrying the recently described transposon Tn2010. The remainder of the macrolide resistant S. pneumoniae collection includes 31% mef(E-positive, and 9% erm(B-positive strains. Conclusions The dual-positive, multidrug-resistant S. pneumoniae clones have likely expanded by switching to non-vaccine serotypes after the heptavalent pneumococcal conjugate vaccine release, and their success limits therapy options. This upsurge could have a considerable clinical impact in Arizona.

Development of new synthetic oligosaccharide vaccines : the immunogenicity of oligosaccharide-CRM197 neoconjugates and oligosaccharide/peptide hybrid gold nanoparticles based on the capsular polysaccharide structure of Streptococcus pneumoniae type 14

NARCIS (Netherlands)

Safari, D.

2010-01-01

Streptococcus pneumoniae is a leading cause of bacterial pneumonia, meningitis, and sepsis in children worldwide. Nowadays, the antibiotic resistance of S. pneumoniae bacteria has increased worldwide. This makes treatment of S. pneumoniae infections more difficult and stresses the importance of the

[Susceptibility surveillance of clinical isolates to fluoroquinolone antimicrobial agents from 2003 to 2008: post-marketing study of prulifloxacin].

Science.gov (United States)

Kawai, Shin; Yoshida, Atsushi; Okazaki, Mitsuhiro; Tsujihara, Yoshito; Inuzuka, Kazuhisa; Takeuchi, Kazuhide; Yamashita, Naoko; Onodera, Makoto; Hiraishi, Toru; Ida, Takashi; Maebashi, Kazunori

2010-06-01

Yearly changes in the susceptibility of clinical isolates to ulifloxacin (UFX) and other fluoroquinolones were examined through surveys over 3 periods. In the first survey, 534 strains derived from 19 species were collected from clinical specimens during 6 months from December 2003 to May 2004. In the same way, 805 strains were collected from December 2005 to May 2006 in the second survey, and 863 strains were from December 2007 to May 2008 in the third survey. Over these 3 study periods, the susceptibilities of fluoroquinolones against methicillin-susceptible Staphylococcus aureus and Escherichia coli were decreased. The isolation frequency of levofloxacin-nonsusceptible strain was increased from 0% to 11.8% and from 14.6% to 20.8%, respectively. MIC90s of UFX against these pathogens were also increased, but its MIC90 for E. coli was 2 to 4 times lower than that of levofloxacin. On the other hand, the susceptibility of strains of Klebsiella pneumoniae to UFX was increased. Among the fluoroquinolones tested, UFX showed the most potent activity against Pseudomonas aeruginosa, and no changes in the MIC90s occurred during the surveillance. Although one strain of Streptococcus pneumoniae isolated in the third study period showed levofloxacin-resistance (MIC, 8 microg/mL), there were nearly no changes in the MIC90s of any agents tested including UFX against S. pneumoniae during the surveillance. As for other bacterial species, a tendency to increase in resistance to UFX was not observed. The activity of UFX against Salmonella spp. and Shigella spp. was superior/equal to those of fluoroquinolones tested.

Changed Expression of Cytoskeleton Proteins During Lung Injury in a Mouse Model of Streptococcus pneumoniae Infection

Directory of Open Access Journals (Sweden)

Mario Ferrer-Navarro

2018-05-01

Full Text Available Infections by Streptococcus pneumoniae are a major cause of morbidity and mortality worldwide, often causing community-acquired pneumonia, otitis media and also bacteremia and meningitis. Studies on S. pneumoniae are mainly focused on its virulence or capacity to evade the host immune system, but little is known about the injury caused in lungs during a pneumococcal infection. Herein we investigated this issue comparing the proteome profile of lungs from S. pneumoniae-infected mice with control mice by means of difference gel electrophoresis (DIGE technology. In order to obtain reliable results three biological replicas were used, and four technical replicas were carried out in each biological replica. Proteomic comparison was performed at two time points: 24 and 48 h post infection. A total of 91 proteins were identified with different abundance. We found important changes in the protein profiles during pneumococcal infection mainly associated with regulation of vesicle-mediated transport, wound healing, and cytoskeleton organization. In conclusion, the results obtained show that the cytoskeleton of the host cell is modified in S. pneumoniae infection.

Platelet Endothelial Cell Adhesion Molecule-1, a Putative Receptor for the Adhesion of Streptococcus pneumoniae to the Vascular Endothelium of the Blood-Brain Barrier

NARCIS (Netherlands)

Iovino, Federico; Molema, Grietje; Bijlsma, Jetta J. E.

The Gram-positive bacterium Streptococcus pneumoniae is the main causative agent of bacterial meningitis. S. pneumoniae is thought to invade the central nervous system via the bloodstream by crossing the vascular endothelium of the blood-brain barrier. The exact mechanism by which pneumococci cross

A Multi-Scale Computational Study on the Mechanism of Streptococcus pneumoniae Nicotinamidase (SpNic)

OpenAIRE

Ion, Bogdan; Kazim, Erum; Gauld, James

2014-01-01

Nicotinamidase (Nic) is a key zinc-dependent enzyme in NAD metabolism that catalyzes the hydrolysis of nicotinamide to give nicotinic acid. A multi-scale computational approach has been used to investigate the catalytic mechanism, substrate binding and roles of active site residues of Nic from Streptococcus pneumoniae (SpNic). In particular, density functional theory (DFT), molecular dynamics (MD) and ONIOM quantum mechanics/molecular mechanics (QM/MM) methods have been employed. The o...

The Three Major Spanish Clones of Penicillin-Resistant Streptococcus pneumoniae Are the Most Common Clones Recovered in Recent Cases of Meningitis in Spain

Science.gov (United States)

Enright, Mark C.; Fenoll, Asunción; Griffiths, David; Spratt, Brian G.

1999-01-01

One hundred six isolates of Streptococcus pneumoniae recovered in Spain from patients with meningitis in 1997 and 1998 were characterized by multilocus sequence typing. A heterogeneous collection of genotypes was associated with meningitis in Spain: 65 different sequence types were resolved and, even at a genetic distance of 0.43, there were 37 distinct lineages. Thirty-eight percent of the isolates, including all isolates of serotypes 6B, 9V, 14, and 23F, were resistant to penicillin, and 24% of the isolates were members of the three major Spanish penicillin-resistant or multidrug-resistant clones of serotypes 6B, 9V, and 23F or serotype variants of these clones. These three clones (MICs, 1 to 2 μg of penicillin/ml) were the most common clones associated with pneumococcal meningitis in Spain during 1997 and 1998. Only two of the other clones associated with meningitis were penicillin resistant (MICs, 0.12 to 0.5 μg/ml). One of the two most prevalent penicillin-susceptible clones causing meningitis (serotype 3) has not been detected outside of Spain, whereas the other (serotype 18C) has been recovered from patients with meningitis in the United Kingdom, The Netherlands, and Denmark. The prevalence of meningitis caused by isolates of the three major Spanish penicillin-resistant or multiply antibiotic-resistant clones, which are now globally distributed, is disturbing and clearly establishes their ability to cause life-threatening disease. PMID:10488179

Purpura fulminans associated with Streptococcus pneumoniae septicemia in an asplenic pediatric patient.

Science.gov (United States)

Konda, S; Zell, D; Milikowski, C; Alonso-Llamazares, J

2013-09-01

Purpura fulminans is a rapidly progressive syndrome of small-vessel thrombosis and hemorrhagic necrosis of the skin accompanied by disseminated intravascular coagulation. We describe a case of Streptococcus pneumoniae septicemia in an asplenic 5-year-old boy on oral tacrolimus, with a past medical history of multivisceral organ transplantation and subsequent development of purpura fulminans on his chest and distal extremities. The acute infectious form of purpura fulminans is usually caused by gram-negative bacteria. Cases secondary to gram-positive encapsulated bacteria usually occur when individuals are immuno-suppressed or have anatomic or functional asplenia. Our patient had both, which likely increased his susceptibility, and he responded well to antimicrobial therapy in addition to prophylactic coverage in the setting of his immunosuppression. We review the literature for similar cases due to S. pneumoniae in the pediatric population and discuss the etiology and treatment of purpura fulminans. Copyright © 2011 Elsevier España, S.L. and AEDV. All rights reserved.

Recent epidemiology of Streptococcus pneumoniae in nasopharynxes of Korean children with acute otitis media.

Science.gov (United States)

Han, Seung Beom; Kim, Jong-Hyun; Kang, Jin Han; Ma, Sang Hyuk; Kim, Chun Soo; Kim, Kyung-Hyo; Kim, Hwang Min; Choi, Young Youn

2017-03-01

This prospective study was performed to evaluate serotype distribution, multilocus sequence typing, and antibiotic susceptibility of Streptococcus pneumoniae identified in Korean children with acute otitis media (AOM) after the introduction of a 7-valent pneumococcal conjugate vaccine (PCV7). Nasopharyngeal aspirates were collected from children diagnosed with AOM in seven hospitals in Korea. The bacteria identified in these samples and the serotypes, sequence types (STs), and antibiotic susceptibilities of S. pneumoniae isolates were evaluated. A total of 390 children were enrolled, and bacteria were identified in 376 (96.4%) children. S. pneumoniae, Haemophilus influenzae and Moraxella catarrhalis were identified in 155 (39.7%), 127 (32.6%) and 86 (22.1%) children, respectively. Serotype 19A (22.4%) was the most common S. pneumoniae serotype, with serogroups 11 (14.7%) and 15 (13.5%) following. ST320 (23.5%) was the most common ST; ST166 (17.0%) and ST83 (8.5%) followed. The overall susceptibility rates of S. pneumoniae to oral penicillin V and amoxicillin/clavulanate were 2.6% and 53.2%, respectively. The susceptibility rate to cefditoren was 91.0%; however, the rates for other cephalosporins were less than 10.0%. Compared with other serogroups, S. pneumoniae serogroups 19, 11, and 15 showed significantly lower susceptibility rates to all the antibiotics tested. S. pneumoniae serotype 19A, serogroups 11 and 15 were the major nasopharyngeal-colonizing bacteria in Korean children with AOM after the introduction of PCV7. These relatively prevalent serotype/serogroups showed lower antibiotic susceptibility rates. Copyright © 2016. Published by Elsevier Ltd.

Streptococcus pneumonia YlxR at 1.35 Å shows a putative new fold

OpenAIRE

Osipiuk, Jerzy; Górnicki, Piotr; Maj, Luke; Dementieva, Irina; Laskowski, Roman; Joachimiak, Andrzej

2001-01-01

The structure of the YlxR protein of unknown function from Streptococcus pneumonia was determined to 1.35 Å. YlxR is expressed from the nusA/infB operon in bacteria and belongs to a small protein family (COG2740) that shares a conserved sequence motif GRGA(Y/W). The family shows no significant amino-acid sequence similarity with other proteins. Three-wavelength diffraction MAD data were collected to 1.7 Å from orthorhombic crystals using synchrotron radiation and the structure was determined ...

A Community-acquired Lung Abscess Attributable to Streptococcus pneumoniae which Extended Directly into the Chest Wall.

Science.gov (United States)

Ko, Yuki; Tobino, Kazunori; Yasuda, Yuichiro; Sueyasu, Takuto; Nishizawa, Saori; Yoshimine, Kouhei; Munechika, Miyuki; Asaji, Mina; Yamaji, Yoshikazu; Tsuruno, Kosuke; Miyajima, Hiroyuki; Mukasa, Yosuke; Ebi, Noriyuki

We herein report the case of 75-year-old Japanese female with a community-acquired lung abscess attributable to Streptococcus pneumoniae (S. penumoniae) which extended into the chest wall. The patient was admitted to our hospital with a painful mass on the left anterior chest wall. A contrast-enhanced chest computed tomography scan showed a lung abscess in the left upper lobe which extended into the chest wall. Surgical debridement of the chest wall abscess and percutaneous transthoracic tube drainage of the lung abscess were performed. A culture of the drainage specimen yielded S. pneumoniae. The patient showed a remarkable improvement after the initiation of intravenous antibiotic therapy.

Interaction of SIGNR1 expressed by marginal zone macrophages with marginal zone B cells is essential to early IgM responses against Streptococcus pneumoniae

NARCIS (Netherlands)

Koppel, Estella A.; Litjens, Manja; van den Berg, Venice C.; van Kooyk, Yvette; Geijtenbeek, Teunis B. H.

2008-01-01

The spleen plays a pivotal role in the immune defense against encapsulated bacteria such as Streptococcus pneumoniae. Murine splenic marginal zone macrophages express the C-type lectin SIGNR1, which is crucial for the capture of S. pneumoniae from blood. In this study, we demonstrate that SIGNR1 is

[Nationwide sensitivity surveillance of ciprofloxacin and various parenteral antibiotics against bacteria isolated from patients with severe infections--the first Ciproxan IV special investigation in 2001].

Science.gov (United States)

Yamaguchi, Keizo; Ishii, Yoshikazu; Iinuma, Yoshitsugu; Yamanaka, Kiyoharu; Ichiyama, Satoshi; Watanabe, Naoki; Uehara, Nobuyuki; Kaku, Mitsuo; Kurokawa, Yukinori; Hayashi, Mutsumu; Hirakata, Yoichi

2003-12-01

The parenteral injection of ciprofloxacin (CPFX), a fluoroquinolone antimicrobial drug, was approved in September 2000 and a re-examination period of 6 years was set at that time. As a special investigation to apply for re-examination of this drug, it has been planned to conduct 3 nationwide surveillances during the re-examination period by collecting clinically isolated bacteria from patients with severe infections, to whom the drug was mainly indicated, and examining drug susceptibilities of the bacteria to various parenteral antimicrobial drugs including CPFX. This time, we determined the minimum inhibitory concentrations (MICs) of various parenteral antimicrobial drugs including CPFX against 1,220 strains isolated from patients with severe infections by the micro-liquid dilution method and compared susceptibilities of various clinically isolated bacteria to CPFX with those to other antimicrobial drugs. Gram-positive bacteria were less susceptible to CPFX than to carbapenems except 2 bacterial species, Enterococcus faecium and Enterococcus avium but susceptibilities of methicillin-susceptible Staphylococcus aureus (MSSA), Staphylococcus epidermidis and Enterococcus faecalis to CPFX were comparable to those to cefozopran. Susceptibility of Streptococcus pneumoniae to CPFX did not differ among ampicillin (ABPC)-susceptible Streptococcus pneumoniae (MIC of ABPC: MIC of ABPC: 0.25-2 micrograms/ml) and ABPC-resistant S. pneumoniae (MIC of ABPC: > or = 4 micrograms/ml) MIC90 of CPFX: 1 microgram/ml) and a decrease in the antimicrobial activity seen among cephem and carbapenem antimicrobial drugs against penicillin-intermediate strains was not noted with CPFX. Gram-negative bacteria were susceptible to CPFX similarly to carbapenems and the MIC90 values of CPFX were in the range from MIC90 was 2 micrograms/ml. CPFX also showed the lowest MIC90 value (0.5 microgram/ml) against beta-lactam-resistant P. aeruginosa among the drugs examined. When extended-spectrum beta

The effect of immunization with pneumococcal conjugated vaccines on Streptococcus pneumoniae resistance patterns in acute otitis media

Directory of Open Access Journals (Sweden)

Tal Marom

2017-10-01

Full Text Available Following the introduction of 7- and 13-pneumococcal conjugate vaccines (PCVs in Israel, we demonstrated that within Streptococcus pneumoniae (Sp positive middle ear cultures, obtained from young children with severe acute otitis media (AOM episodes, there were more penicillin-susceptible and less multi-drug resistant Sp isolates in PCV immunized children.

S-carboxymethylcysteine inhibits adherence of Streptococcus pneumoniae to human alveolar epithelial cells.

Science.gov (United States)

Sumitomo, Tomoko; Nakata, Masanobu; Yamaguchi, Masaya; Terao, Yutaka; Kawabata, Shigetada

2012-01-01

Streptococcus pneumoniae is a major pathogen of respiratory infections that utilizes platelet-activating factor receptor (PAFR) for firm adherence to host cells. The mucolytic agent S-carboxymethylcysteine (S-CMC) has been shown to exert inhibitory effects against infection by several respiratory pathogens including S. pneumoniae in vitro and in vivo. Moreover, clinical studies have implicated the benefits of S-CMC in preventing exacerbation of chronic obstructive pulmonary disease, which is considered to be related to respiratory infections. In this study, to assess whether the potency of S-CMC is attributable to inhibition of pneumococcal adherence to host cells, an alveolar epithelial cell line stimulated with interleukin-1α was used as a model of inflamed epithelial cells. Despite upregulation of PAFR by inflammatory activation, treatment with S-CMC efficiently inhibited pneumococcal adherence to host epithelial cells. In order to gain insight into the inhibitory mechanism, the effects of S-CMC on PAFR expression were also investigated. Following treatment with S-CMC, PAFR expression was reduced at both mRNA and post-transcriptional levels. Interestingly, S-CMC was also effective in inhibiting pneumococcal adherence to cells transfected with PAFR small interfering RNAs. These results indicate S-CMC as a probable inhibitor targeting numerous epithelial receptors that interact with S. pneumoniae.

Unusual Manifestation of Severe Conjugated Hyperbilirubinemia in an Infant with Streptococcus pneumoniae-associated Hemolytic Uremic Syndrome

Directory of Open Access Journals (Sweden)

Jung-Pin Chen

2007-01-01

Full Text Available Streptococcus pneumoniae is an uncommon etiologic organism in children with hemolytic uremic syndrome (HUS. Historically, severe S. pneumoniae-associated HUS usually has a poor clinical outcome. The clinical manifestations of marked jaundice and hepatic dysfunction in this form of HUS are extremely rare. We report a 10-month-old female infant with S. pneumoniae-associated HUS who had the unusual manifestation of severely elevated conjugated bilirubin and hepatic transaminases. Screening for viral hepatitis was negative, and evidence of biliary obstruction and hepatotoxic drug exposure was also absent. The patient was treated with antihypertensive agents for 2.5 months and required peritoneal dialysis for a period of 26 days. Hepatic function returned to normal on the 8th day of hospitalization. Renal function was mildly impaired at 1-year follow-up. Our report suggests that severe conjugated hyperbilirubinemia is a rare manifestation of S. pneumoniae-associated HUS in children. It is important for pediatricians that pneumococcal infection with severe hematologic and renal disorders should be investigated for evidence of S. pneumoniae-associated HUS. [J Formos Med Assoc 2007;106(2 Suppl:S17-S22

A Cross-sectional Survey Assessing Carriage of Streptococcus pneumoniae in a Healthy Population in Xinjiang Uygur Autonomous Region of China.

Science.gov (United States)

Xie, Na; Chen, Zhao Yun; Chen, Tao; Zhu, Bing Qing; Xu, Li; Gao, Yuan; Zhang, Ai Yu; Zhao, Pan; Liu, Ji Wen; Shao, Zhu Jun

2018-03-01

The carriage rate and serotype distribution of Streptococcus pneumoniae (S. pneumoniae) in a healthy population in China remains unclear. In this study, we collected the oropharyngeal swabs from 513 individuals in Xinjiang, China. Real-time PCR targeting the lytA gene and 12 serotypes were assessed to identify S. pneumoniae carriage. The total carriage rate of S. pneumoniae was 70.4% (361/513). The most prevalent serotypes were 19B/F, 18B/C, 5, and 6A/B. The highest carriage rate of S. pneumoniae was noted in children aged 6-10 years (88.6%), which merits further attention. The co-colonization rate of two or more S. pneumoniae serotypes was 79.8% (264/331). This study aimed to investigate the baseline pneumococcal carriage rate among healthy individuals in China to improve our understanding of the epidemiology of S. pneumoniae. Copyright © 2018 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

The putative proteinase maturation protein A of Streptococcus pneumoniae is a conserved surface protein with potential to elicit protective immune responses

NARCIS (Netherlands)

K. Overweg (Karin); A. Kerr; M. Sluijter (Marcel); M.H. Jackson; T.J. Mitchell; A.P. de Jong; R. de Groot (Ronald); P.W.M. Hermans (Peter)

2000-01-01

textabstractSurface-exposed proteins often play an important role in the interaction between pathogenic bacteria and their host. We isolated a pool of hydrophobic, surface-associated proteins of Streptococcus pneumoniae. The opsonophagocytic activity of hyperimmune

Effect of decreased BCAA synthesis through disruption of ilvC gene on the virulence of Streptococcus pneumoniae.

Science.gov (United States)

Kim, Gyu-Lee; Lee, Seungyeop; Luong, Truc Thanh; Nguyen, Cuong Thach; Park, Sang-Sang; Pyo, Suhkneung; Rhee, Dong-Kwon

2017-08-01

Streptococcus pneumoniae (pneumococcus) is responsible for significant morbidity and mortality worldwide. It causes a variety of life-threatening infections such as pneumonia, bacteremia, and meningitis. In bacterial physiology, the metabolic pathway of branched-chain amino acids (BCAAs) plays an important role in virulence. Nonetheless, the function of IlvC, one of the enzymes involved in the biosynthesis of BCAAs, in S. pneumoniae remains unclear. Here, we demonstrated that downregulation of BCAA biosynthesis by ilvC ablation can diminish BCAA concentration and expression of pneumolysin (Ply) and LytA, and subsequently attenuate virulence. Infection with an ilvC mutant showed significantly reduced mortality and colonization in comparison with strain D39 (serotype 2, wild type), suggesting that ilvC can potentiate S. pneumoniae virulence due to adequate BCAA synthesis. Taken together, these results suggest that the function of ilvC in BCAA synthesis is essential for virulence factor and could play an important role in the pathogenesis of respiratory infections.

Postantibiotic effects and postantibiotic sub-MIC effects of tilmicosin, erythromycin and tiamulin on erythromycin-resistant Streptococcus suis.

Science.gov (United States)

Wang, Liping; Zhang, Yuanshu

2009-10-01

The postantibiotic effects (PAEs) and postantibiotic sub-MIC effects (PA SMEs) of tilmicosin, erythromycin and tiamulin on erythromycin-susceptible and erythromycin-resistant strains of Streptococcus suis (M phenotype) were investigated in vitro. Tilmicosin and tiamulin induced significantly longer PAE and PA SME against both erythromycin-susceptible and erythromycin-resistant strains than did erythromycin. The durations of PAE and PA SMEs were proportional to the concentrations of drugs used for exposure. The PA SMEs were substantially longer than PAEs on S. suis (P<0.05) regardless of the antimicrobial used for exposure. The results indicated that the PAE and PA SME could help in the design of efficient control strategies for infection especially caused by erythromycin-resistant S. suis and that they may provide additional valuable information for the rational drug use in clinical practice.

Meningitis and pneumonia in Guatemalan children: the importance of Haemophilus influenzae type b and Streptococcus pneumoniae Meningitis y neumonía en niños guatemaltecos: importancia de Haemophilus influenzae tipo b y de Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Edwin J. Asturias

2003-12-01

Full Text Available OBJECTIVE: To determine the epidemiology of Haemophilus influenzae type b (Hib and Streptococcus pneumoniae invasive infections in hospitalized Guatemalan children. This is an important issue since Hib vaccine has not been incorporated into the routine immunization program in Guatemala and information from hospital records in 1995 indicated a low incidence of Hib and S. pneumoniae as causes of meningitis and invasive infections. METHODS: Children who were hospitalized in Guatemala City with clinical signs compatible with bacterial infections were evaluated for evidence of Hib or S. pneumoniae infection. Normally sterile body fluids were cultured, and antigen detection was performed on cerebrospinal fluid (CSF and pleural fluid. RESULTS: Of 1 203 children 1-59 months of age hospitalized over a 28-month period, 725 of them (60.3% had a primary diagnosis of pneumonia, 357 (29.7% of meningitis, 60 (5.0% of cellulitis, and 61 (5.1% of sepsis and other conditions. Hib was identified in 20.0% of children with meningitis and S. pneumoniae in 12.9%. The average annual incidence of Hib meningitis was 13.8 cases per 100 000 children under 5 years of age, and 32.4% of meningitides caused by Hib and 58.7% of S. pneumoniae meningitides occurred prior to 6 months of age. Case fatality rates were 14.1%, 37.0%, and 18.0%, respectively, for children with Hib, S. pneumoniae, and culture-negative and antigen-negative meningitis. Prior antibiotic therapy was common and was associated with significant reductions in CSF-culture-positive results for children with other evidence of Hib or S. pneumoniae meningitis. CONCLUSIONS: Improvements in case detection, culture methods, and latex agglutination for antigen detection in CSF resulted in identification of Hib and S. pneumoniae as important causes of severe disease in Guatemalan children. Using a cutoff of > 10 white blood cells per cubic millimeter in CSF would improve the sensitivity for detection of bacterial

Uptake of extracellular DNA: Competence induced pili in natural transformation of Streptococcus pneumoniae

Science.gov (United States)

Muschiol, Sandra; Balaban, Murat; Normark, Staffan; Henriques-Normark, Birgitta

2015-01-01

Transport of DNA across bacterial membranes involves complex DNA uptake systems. In Gram-positive bacteria, the DNA uptake machinery shares fundamental similarities with type IV pili and type II secretion systems. Although dedicated pilus structures, such as type IV pili in Gram-negative bacteria, are necessary for efficient DNA uptake, the role of similar structures in Gram-positive bacteria is just beginning to emerge. Recently two essentially very different pilus structures composed of the same major pilin protein ComGC were proposed to be involved in transformation of the Gram-positive bacterium Streptococcus pneumoniae – one is a long, thin, type IV pilus-like fiber with DNA binding capacity and the other one is a pilus structure that was thicker, much shorter and not able to bind DNA. Here we discuss how competence induced pili, either by pilus retraction or by a transient pilus-related opening in the cell wall, may mediate DNA uptake in S. pneumoniae. PMID:25640084

The alpha-tocopherol form of vitamin E reverses age-associated susceptibility to Streptococcus pneumoniae lung infection by modulating pulmonary neutrophil recruitment

Science.gov (United States)

Streptococcus pneumonia infections are an important cause of morbidity and mortality in older patients. Uncontrolled neutrophil-driven pulmonary inflammation exacerbates this disease. To test whether the alpha-tocopherol (alpha-Toc) form of vitamin E, a regulator of immunity, can modulate neutrophil...

The cGAS/STING Pathway Detects Streptococcus pneumoniae but Appears Dispensable for Antipneumococcal Defense in Mice and Humans.

Science.gov (United States)

Ruiz-Moreno, Juan Sebastian; Hamann, Lutz; Jin, Lei; Sander, Leif E; Puzianowska-Kuznicka, Monika; Cambier, John; Witzenrath, Martin; Schumann, Ralf R; Suttorp, Norbert; Opitz, Bastian

2018-03-01

Streptococcus pneumoniae is a frequent colonizer of the upper respiratory tract and a leading cause of bacterial pneumonia. The innate immune system senses pneumococcal cell wall components, toxin, and nucleic acids, which leads to production of inflammatory mediators to initiate and control antibacterial defense. Here, we show that the cGAS (cyclic GMP-AMP [cGAMP] synthase)-STING pathway mediates detection of pneumococcal DNA in mouse macrophages to primarily stimulate type I interferon (IFN) responses. Cells of human individuals carrying HAQ TMEM173 , which encodes a common hypomorphic variant of STING, were largely or partly defective in inducing type I IFNs and proinflammatory cytokines upon infection. Subsequent analyses, however, revealed that STING was dispensable for restricting S. pneumoniae during acute pneumonia in mice. Moreover, explorative analyses did not find differences in the allele frequency of HAQ TMEM173 in nonvaccinated pneumococcal pneumonia patients and healthy controls or an association of HAQ TMEM173 carriage with disease severity. Together, our results indicate that the cGAS/STING pathway senses S. pneumoniae but plays no major role in antipneumococcal immunity in mice and humans. Copyright © 2018 American Society for Microbiology.

TLR-mediated inflammatory responses to Streptococcus pneumoniae are highly dependent on surface expression of bacterial lipoproteins.

Science.gov (United States)

Tomlinson, Gillian; Chimalapati, Suneeta; Pollard, Tracey; Lapp, Thabo; Cohen, Jonathan; Camberlein, Emilie; Stafford, Sian; Periselneris, Jimstan; Aldridge, Christine; Vollmer, Waldemar; Picard, Capucine; Casanova, Jean-Laurent; Noursadeghi, Mahdad; Brown, Jeremy

2014-10-01

Streptococcus pneumoniae infections induce inflammatory responses that contribute toward both disease pathogenesis and immunity, but the host-pathogen interactions that mediate these effects are poorly defined. We used the surface lipoprotein-deficient ∆lgt pneumococcal mutant strain to test the hypothesis that lipoproteins are key determinants of TLR-mediated immune responses to S. pneumoniae. We show using reporter assays that TLR2 signaling is dependent on pneumococcal lipoproteins, and that macrophage NF-κB activation and TNF-α release were reduced in response to the ∆lgt strain. Differences in TNF-α responses between Δlgt and wild-type bacteria were abrogated for macrophages from TLR2- but not TLR4-deficient mice. Transcriptional profiling of human macrophages revealed attenuated TLR2-associated responses to ∆lgt S. pneumoniae, comprising many NF-κB-regulated proinflammatory cytokine and chemokine genes. Importantly, non-TLR2-associated responses were preserved. Experiments using leukocytes from IL-1R-associated kinase-4-deficient patients and a mouse pneumonia model confirmed that proinflammatory responses were lipoprotein dependent. Our data suggest that leukocyte responses to bacterial lipoproteins are required for TLR2- and IL-1R-associated kinase-4-mediated inflammatory responses to S. pneumoniae. Copyright © 2014 The Authors.

LuxS impacts on LytA-dependent autolysis and on competence in Streptococcus pneumoniae.

Science.gov (United States)

Romao, Susana; Memmi, Guido; Oggioni, Marco R; Trombe, Marie-Claude

2006-02-01

The ubiquitous protein LuxS with S-ribosylhomocysteinase activity is involved in S-adenosyl methionine detoxification, C-1 unit recycling and the production of autoinducers that allow the cell to sense and respond to cell density. Independent reports describe the impact of LuxS deficiency on Streptococcus pneumoniae virulence in the mouse. In vitro, LuxS deficiency confers discrete phenotypes. A combined approach using genetic dissection and mixed-culture experiments allowed the involvement of LuxS in the developmental physiology of S. pneumoniae to be investigated. Functional LuxS was found to be related on the one hand to down-regulation of competence, and on the other hand to attenuation of autolysis in cultures entering stationary phase. The competence phenotype of luxS mutant bacteria was complemented by media conditioned by competence-defective ComAB0 bacteria, but not by BSA. The autolytic phenotype was complemented by BSA, but not by conditioned supernatants. It is suggested that the impact of LuxS on competence, but not on autolysis, involves cell-cell communication. The phenotype of luxS mutant strains reveals a hierarchy in the competence regulatory networks of S. pneumoniae.

Multicentre in-vitro evaluation of the susceptibility of Streptococcus pneumoniae, Haemophilus influenzae and Moraxella catarrhalis to ciprofloxacin, clarithromycin, co-amoxiclav and sparfloxacin

NARCIS (Netherlands)

HoogkampKorstanje, JAA; DirksGo, SIS; Kabel, P; Manson, WL; Stobberingh, EE; Vreede, RW; Davies, BI

Seven laboratories, including a reference laboratory, tested the susceptibility of Moraxella catarrhalis, Streptococcus pneumoniae and Haemophilus influenzae strains to ciprofloxacin, clarithromycin, co-amoxiclav and sparfloxacin with the Etest. A total of 976 strains were collected. The results

Characterization of a Multipeptide Lantibiotic Locus in Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Natalie Maricic

2016-01-01

Full Text Available Bacterial communities are established through a combination of cooperative and antagonistic interactions between the inhabitants. Competitive interactions often involve the production of antimicrobial substances, including bacteriocins, which are small antimicrobial peptides that target other community members. Despite the nearly ubiquitous presence of bacteriocin-encoding loci, inhibitory activity has been attributed to only a small fraction of gene clusters. In this study, we characterized a novel locus (the pld locus in the pathogen Streptococcus pneumoniae that drives the production of a bacteriocin called pneumolancidin, which has broad antimicrobial activity. The locus encodes an unusual tandem array of four inhibitory peptides, three of which are absolutely required for antibacterial activity. The three peptide sequences are similar but appear to play distinct roles in regulation and inhibition. A modification enzyme typically found in loci encoding a class of highly modified bacteriocins called lantibiotics was required for inhibitory activity. The production of pneumolancidin is controlled by a two-component regulatory system that is activated by the accumulation of modified peptides. The locus is located on a mobile element that has been found in many pneumococcal lineages, although not all elements carry the pld genes. Intriguingly, a minimal region containing only the genes required for pneumolancidin immunity was found in several Streptococcus mitis strains. The pneumolancidin-producing strain can inhibit nearly all pneumococci tested to date and provided a competitive advantage in vivo. These peptides not only represent a unique strategy for bacterial competition but also are an important resource to guide the development of new antimicrobials.

Postantibiotic effects and postantibiotic sub-MIC effects of tilmicosin, erythromycin and tiamulin on erythromycin-resistant Streptococcus suis

Directory of Open Access Journals (Sweden)

Liping Wang

2009-12-01

Full Text Available The postantibiotic effects (PAEs and postantibiotic sub-MIC effects (PA SMEs of tilmicosin, erythromycin and tiamulin on erythromycin-susceptible and erythromycin-resistant strains of Streptococcus suis (M phenotype were investigated in vitro. Tilmicosin and tiamulin induced significantly longer PAE and PA SME against both erythromycin-susceptible and erythromycin-resistant strains than did erythromycin. The durations of PAE and PA SMEs were proportional to the concentrations of drugs used for exposure. The PA SMEs were substantially longer than PAEs on S. suis (P<0.05 regardless of the antimicrobial used for exposure. The results indicated that the PAE and PA SME could help in the design of efficient control strategies for infection especially caused by erythromycin-resistant S. suis and that they may provide additional valuable information for the rational drug use in clinical practice.

Susceptibilidad a antimicrobianos en aislamientos de Streptococcus pneumoniae invasor en Colombia Susceptibility to antimicrobial agents in isolates of invasive Streptococcus pneumoniae in Colombia

Directory of Open Access Journals (Sweden)

Aura Lucía Leal

1999-03-01

Full Text Available Se realizó un estudio para determinar los patrones de susceptibilidad a los antimicrobianos de los aislamientos de Streptococcus pneumoniae causante de enfermedad invasora diagnosticada en Colombia en niños menores de 5 años entre 1994 y 1996 y para establecer la distribución de los tipos capsulares de los aislamientos resistentes. Se analizaron 324 aislamientos recuperados durante la ejecución del Protocolo Nacional de Serotipificación de S. pneumoniae realizado en Santa Fe de Bogotá, Medellín y Cali, Colombia, entre julio de 1994 y marzo de 1996. Se observó que 119 de todos los aislamientos (36,7% presentaban susceptibilidad disminuida por lo menos a un antimicrobiano, que 39 (12% presentaban susceptibilidad disminuida a la penicilina y que de estos últimos aislamientos, 29 presentaban resistencia intermedia y 10 resistencia alta. Nueve aislamientos (2,8% presentaban resistencia a la ceftriaxona, 80 (24,7% a la combinación de trimetoprima y sulfametoxazol (TMS, 49 (15,1% al cloranfenicol y 31 (9,6% a la eritromicina. Se observó resistencia a dos antimicrobianos en 31 aislamientos (9,6% y multirresistencia en 22 (6,7%. Estos 22 aislamientos mostraron resistencia al TMS. Las asociaciones más frecuentes fueron penicilina, TMS y eritromicina en 5 casos; penicilina, cloranfenicol, TMS y eritromicina en 4; penicilina, ceftriaxona, cloranfenicol y TMS en 3; y penicilina, ceftriaxona, cloranfenicol, TMS y eritromicina en 3 casos. Los serotipos más frecuentes en los aislamientos resistentes a la penicilina fueron: 23F (53,8%, 14 (25,6%, 6B (7,7%, 9V (5,1%, 19F (5,1% y 34 (2,6%. Los serotipos más frecuentes en los aislamientos resistentes a antimicrobianos distintos de la penicilina fueron: 5 (37,5%, 23F (7,5%, 14 (18,8% y 6B (13,8%. Esta diferencia en la distribución de los serotipos fue estadísticamente significativa (P A study was done to determine the patterns of susceptibility to antimicrobial agents in isolates of Streptococcus

Polyamine transporter potABCD is required for virulence of encapsulated but not nonencapsulated Streptococcus pneumoniae.

Directory of Open Access Journals (Sweden)

Haley R Pipkins

Full Text Available Streptococcus pneumoniae is commonly found in the human nasopharynx and is the causative agent of multiple diseases. Since invasive pneumococcal infections are associated with encapsulated pneumococci, the capsular polysaccharide is the target of licensed pneumococcal vaccines. However, there is an increasing distribution of non-vaccine serotypes, as well as nonencapsulated S. pneumoniae (NESp. Both encapsulated and nonencapsulated pneumococci possess the polyamine oligo-transport operon (potABCD. Previous research has shown inactivation of the pot operon in encapsulated pneumococci alters protein expression and leads to a significant reduction in pneumococcal murine colonization, but the role of the pot operon in NESp is unknown. Here, we demonstrate deletion of potD from the NESp NCC1 strain MNZ67 does impact expression of the key proteins pneumolysin and PspK, but it does not inhibit murine colonization. Additionally, we show the absence of potD significantly increases biofilm production, both in vitro and in vivo. In a chinchilla model of otitis media (OM, the absence of potD does not significantly affect MNZ67 virulence, but it does significantly reduce the pathogenesis of the virulent encapsulated strain TIGR4 (serotype 4. Deletion of potD also significantly reduced persistence of TIGR4 in the lungs but increased persistence of PIP01 in the lungs. We conclude the pot operon is important for the regulation of protein expression and biofilm formation in both encapsulated and NCC1 nonencapsulated Streptococcus pneumoniae. However, in contrast to encapsulated pneumococcal strains, polyamine acquisition via the pot operon is not required for MNZ67 murine colonization, persistence in the lungs, or full virulence in a model of OM. Therefore, NESp virulence regulation needs to be further established to identify potential NESp therapeutic targets.

Capsular Polysaccharide Expression in Commensal Streptococcus Species

DEFF Research Database (Denmark)

Skov Sørensen, Uffe B; Yao, Kaihu; Yang, Yonghong

2016-01-01

Expression of a capsular polysaccharide is considered a hallmark of most invasive species of bacteria, including Streptococcus pneumoniae, in which the capsule is among the principal virulence factors and is the basis for successful vaccines. Consequently, it was previously assumed that capsule....... pneumoniae evolved by import of cps fragments from commensal Streptococcus species, resulting in a mosaic of genes of different origins. The demonstrated antigenic identity of at least eight of the numerous capsular polysaccharide structures expressed by commensal streptococci with recognized serotypes of S...... of Streptococcus pneumoniae and is the basis for successful vaccines against infections caused by this important pathogen. Contrasting with previous assumptions, this study showed that expression of capsular polysaccharides by the same genetic mechanisms is a general property of closely related species...

Strain-specific impact of PsaR of Streptococcus pneumoniae on global gene expression and virulence

OpenAIRE

Hendriksen, Wouter T.; Bootsma, Hester J.; van Diepen, Angela; Estevao, Silvia; Kuipers, Oscar P.; de Groot, Ronald; Hermans, Peter W. M.

2009-01-01

Previous studies have indicated that PsaR of Streptococcus pneumoniae is a manganese-dependent regulator, negatively affecting the expression of at least seven genes. Here, we extended these observations by transcriptome and proteome analysis of psaR mutants in strains D39 and TIGR4. The microarray analysis identified three shared PsaR targets: the psa operon, pcpA and prtA. In addition, we found 31 genes to be regulated by PsaR in D39 only, most strikingly a cellobiose-specific phosphotrains...

Prevalence and serotype distribution of nasopharyngeal carriage of Streptococcus pneumoniae in China: a meta-analysis.

Science.gov (United States)

Wang, Lin; Fu, Jinjian; Liang, Zhuoxin; Chen, Jichang

2017-12-13

To explore the overall prevalence and serotype distribution of nasopharyngeal carriage of Streptococcus pneumoniae(S. pneumoniae) among healthy children. A search for pneumococcal nasopharyngeal carriage studies including children published up to July 31th, 2016 was conducted to describe carriage in China. The review also describes antibiotic resistance in and serotypes of S. pneumoniae and assesses the impact of vaccination on carriage in this region. Summary measures for overall prevalence, antibiotic resistance, and serotype distributions extracted from the analyzed data were determined with 95% confidence intervals (CIs) using random-effects models. Heterogeneity was assessed using I 2 test statistics. Thirty-seven studies were included in this review, and the majority of studies (64.9%) were located in the pre-introduction period of 7-valent pneumococcal conjugate vaccine (PCV7) in China. The pooled prevalence of S. pneumoniae nasopharyngeal carriage was 21.4% (95% CI: 18.3-24.4%). Carriage was highest in children attending kindergartens [24.5%, (19.7-29.3%)] and decreased with increasing age. Before the introduction of PCV7 into China, the prevalence of S. pneumoniae nasopharyngeal carriage was 25.8% (20.7-30.9%), the pooled carriage of S. pneumoniae sharply dropped into the 14.1% (11.3-16.9%) by PCV7 vaccination period (P China, the penicillin resistance rate in S. pneumoniae isolated from healthy children was 31.9% (21.2-42.6%); however, this rate sharply decreased after the introduction of PCV7 in China [21.6%, (7.4-35.9%)], and the difference between the rates during these two time periods was statistically significant (P value China. PCV7 immunization was found to be associated with reduction of nasopharyngeal colonization of S. pneumoniae. Conjugate vaccination coverage was slightly affected by the introduction of PCV7 into China because of low vaccination rate. The government should implement timely adjusted conjugate vaccination strategies based on

The in vitro activity of BMS-284756, a new des-fluorinated quinolone.

Science.gov (United States)

Weller, T M A; Andrews, J M; Jevons, G; Wise, R

2002-01-01

The in vitro activity of BMS-284756 (previously T-3811ME), a des-fluoro(6) quinolone, was investigated and compared with those of six other antimicrobial agents. Susceptibility tests were performed on 919 Gram-positive, Gram-negative (including nine quinolone-resistant Escherichia coli) and anaerobic bacteria, three Chlamydia isolates and four Mycobacteria spp. BMS-284756 was marginally less active against the Enterobacteriaceae, but was the most active quinolone against staphylococci, enterococci and peptostreptococci. Against Streptococcus pneumoniae, BMS-284756 and gemifloxacin were more active than other quinolones. The MIC(90) of BMS-284756 was > or = 2 mg/L for the following bacteria: E. coli (MIC(90) 16 mg/L), Acinetobacter spp. (8 mg/L), Pseudomonas aeruginosa (64 mg/L) and Enterococcus faecium (4 mg/L). The MIC of BMS-284756 for Mycobacterium spp. was within one dilution of the MIC of ciprofloxacin. BMS-284756 was markedly more active than ciprofloxacin against the Chlamydia isolates tested.

PENICILLIN-BINDING PROTEIN 2X OF STREPTOCOCCUS-PNEUMONIAE - EXPRESSION IN ESCHERICHIA-COLI AND PURIFICATION OF A SOLUBLE ENZYMATICALLY ACTIVE DERIVATIVE

NARCIS (Netherlands)

LAIBLE, G; KECK, W; LURZ, R; MOTTL, H; FRERE, JM; JAMIN, M; HAKENBECK, R

1992-01-01

A 2.5-kb DNA fragment including the structural gene coding for the penicillin-binding protein 2x (PBP 2x) of Streptococcus pneumoniae has been cloned into the vector pJDC9 and expressed in Escherichia coli. Mapping of RNA polymerase binding sites by electron microscopy indicated that the pbpX

Pyruvate oxidase influences the sugar utilization pattern and capsule production in Streptococcus pneumoniae.

Directory of Open Access Journals (Sweden)

Sandra M Carvalho

Full Text Available Pyruvate oxidase is a key function in the metabolism and lifestyle of many lactic acid bacteria and its activity depends on the presence of environmental oxygen. In Streptococcus pneumoniae the protein has been suggested to play a major role in metabolism and has been implicated in virulence, oxidative stress survival and death in stationary phase. Under semi-aerobic conditions, transcriptomic and metabolite profiling analysis of a spxB mutant grown on glucose showed minor changes compared to the wild type, apart from the significant induction of two operons involved in carbohydrate uptake and processing. This induction leads to a change in the sugar utilization capabilities of the bacterium, as indicated by the analysis of the growth profiles of the D39 parent and spxB mutant on alternative carbohydrates. Metabolic analysis and growth experiments showed that inactivation of SpxB has no effect on the glucose fermentation pattern, except under aerobic conditions. More importantly, we show that mutation of spxB results in the production of increased amounts of capsule, the major virulence factor of S. pneumoniae. Part of this increase can be attributed to induction of capsule operon (cps transcription. Therefore, we propose that S. pneumoniae utilizes pyruvate oxidase as an indirect sensor of the oxygenation of the environment, resulting in the adaption of its nutritional capability and the amount of capsule to survive in the host.

Pyruvate oxidase influences the sugar utilization pattern and capsule production in Streptococcus pneumoniae.

Science.gov (United States)

Carvalho, Sandra M; Farshchi Andisi, Vahid; Gradstedt, Henrik; Neef, Jolanda; Kuipers, Oscar P; Neves, Ana R; Bijlsma, Jetta J E

2013-01-01

Pyruvate oxidase is a key function in the metabolism and lifestyle of many lactic acid bacteria and its activity depends on the presence of environmental oxygen. In Streptococcus pneumoniae the protein has been suggested to play a major role in metabolism and has been implicated in virulence, oxidative stress survival and death in stationary phase. Under semi-aerobic conditions, transcriptomic and metabolite profiling analysis of a spxB mutant grown on glucose showed minor changes compared to the wild type, apart from the significant induction of two operons involved in carbohydrate uptake and processing. This induction leads to a change in the sugar utilization capabilities of the bacterium, as indicated by the analysis of the growth profiles of the D39 parent and spxB mutant on alternative carbohydrates. Metabolic analysis and growth experiments showed that inactivation of SpxB has no effect on the glucose fermentation pattern, except under aerobic conditions. More importantly, we show that mutation of spxB results in the production of increased amounts of capsule, the major virulence factor of S. pneumoniae. Part of this increase can be attributed to induction of capsule operon (cps) transcription. Therefore, we propose that S. pneumoniae utilizes pyruvate oxidase as an indirect sensor of the oxygenation of the environment, resulting in the adaption of its nutritional capability and the amount of capsule to survive in the host.

Ceftaroline activity tested against contemporary Latin American bacterial pathogens (2011

Directory of Open Access Journals (Sweden)

Robert K. Flamm

2014-03-01

Full Text Available A total of 2484 target bacterial pathogens were collected (one per patient episode from patients in 16 Latin American medical centers located in seven nations during 2011. Isolate identity was confirmed at a coordinating laboratory and susceptibility testing was performed for ceftaroline and comparator agents according to reference broth microdilution methods. A total of 30.0% of isolates were from respiratory tract, 29.4% from skin and skin structure, 21.4% from blood stream, 7.9% from urinary tract and 11.3% from other sites. Ceftaroline was active against Staphylococcus aureus (42.8% MRSA with 83.6% of the isolates at ≤1 mg/L and all isolates at ≤2 mg/L (MIC5090, 0.25/2 mg/L. National MRSA rates ranged from a low of 28.8% in Colombia to a high of 68.1% in Chile. All Streptococcus pyogenes and Streptococcus agalactiae were susceptible to ceftaroline (MIC50/90 values were at ≤0.015/≤0.015 mg/L for both. All Streptococcus pneumoniae were susceptible to ceftaroline, linezolid, tigecycline and vancomycin. Susceptibility to ceftriaxone was at 88.4% (CLSI non-meningitis interpretive criteria and 73.9% (CLSI meningitis interpretive criteria for all S. pneumoniae. Ceftriaxone susceptibility was only at 33.3% (CLSI non-meningitis interpretive criteria and 0.0% (CLSI meningitis interpretive criteria for penicillin-intermediate (penicillin MIC, 4 mg/L strains. All Haemophilus influenzae (29.4% β-lactamase-positive isolates were susceptible to ceftaroline, amoxicillin–clavulanate, ceftriaxone, and levofloxacin. For the Latin American region, the ESBL-phenotype rate was 37.6% for Escherichia coli and 53.3% for Klebsiella pneumoniae. Ceftaroline was not active against ESBL-phenotype strains but was active against >90.0% of the non-ESBL-phenotype. The spectrum of activity of ceftaroline against pathogens from Latin America indicates that it merits further study for its potential use in the Latin American region.

Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer

Directory of Open Access Journals (Sweden)

Helen Hencida Thangamony

2018-01-01

Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.

Phosphorylation of the Streptococcus pneumoniae cell wall biosynthesis enzyme MurC by a eukaryotic-like Ser/Thr kinase.

Science.gov (United States)

Falk, Shaun P; Weisblum, Bernard

2013-03-01

Streptococcus pneumoniae contains a single Ser/Thr kinase-phosphatase pair known as StkP-PhpP. Here, we report the interaction of StkP-PhpP with S. pneumoniae UDP-N-acetylmuramoyl:L-alanine ligase, MurC, an enzyme that synthesizes an essential intermediate of the cell wall peptidoglycan pathway. Combinatorial phage display using StkP as target selected the peptide sequence YEVCGSDTVGC as an interacting partner and subsequently confirmed by ELISA. The phage peptide sequence YEVCGSDTVGC aligns closely with the MurC motif spanning S. pneumoniae amino acid coordinates 31-37. We show that MurC is phosphorylated by StkP and that phosphoMurC is dephosphorylated by PhpP. These data suggest a link between StkP-PhpP with the coordinated regulation of cell wall biosynthesis via MurC. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Repeated extragenic sequences in prokaryotic genomes: a proposal for the origin and dynamics of the RUP element in Streptococcus pneumoniae.

Science.gov (United States)

Oggioni, M R; Claverys, J P

1999-10-01

A survey of all Streptococcus pneumoniae GenBank/EMBL DNA sequence entries and of the public domain sequence (representing more than 90% of the genome) of an S. pneumoniae type 4 strain allowed identification of 108 copies of a 107-bp-long highly repeated intergenic element called RUP (for repeat unit of pneumococcus). Several features of the element, revealed in this study, led to the proposal that RUP is an insertion sequence (IS)-derivative that could still be mobile. Among these features are: (1) a highly significant homology between the terminal inverted repeats (IRs) of RUPs and of IS630-Spn1, a new putative IS of S. pneumoniae; and (2) insertion at a TA dinucleotide, a characteristic target of several members of the IS630 family. Trans-mobilization of RUP is therefore proposed to be mediated by the transposase of IS630-Spn1. To account for the observation that RUPs are distributed among four subtypes which exhibit different degrees of sequence homogeneity, a scenario is invoked based on successive stages of RUP mobility and non-mobility, depending on whether an active transposase is present or absent. In the latter situation, an active transposase could be reintroduced into the species through natural transformation. Examination of sequences flanking RUP revealed a preferential association with ISs. It also provided evidence that RUPs promote sequence rearrangements, thereby contributing to genome flexibility. The possibility that RUP preferentially targets transforming DNA of foreign origin and subsequently favours disruption/rearrangement of exogenous sequences is discussed.

Prevalência de sorotipos e resistência antimicrobiana de cepas invasivas do Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Mantese Orlando C.

2003-01-01

� penicilina foi detectada em 15,5% das cepas e predominou em crianças abaixo de dois anos de idade. Foram identificados 23 diferentes sorotipos de Streptococcus pneumoniae em pacientes internados com doença invasiva, e a maioria dos sorotipos (82,6% e das cepas (90,2% está incluída na vacina polissacarídica 23-valente. As cifras para a vacina 7-valente, atualmente disponível (PN CRM7, são de 46,7% dos sorotipos e 63,6% das cepas, obtidos de crianças com até cinco anos de idade.

Construction of improved tools for protein localization studies in Streptococcus pneumoniae.

Directory of Open Access Journals (Sweden)

Mafalda X Henriques

Full Text Available We have constructed a set of plasmids that allow efficient expression of both N- and C-terminal fusions of proteins of interest to fluorescent proteins mCherry, Citrine, CFP and GFP in the Gram-positive pathogen Streptococcus pneumoniae. In order to improve expression of the fluorescent fusions to levels that allow their detection by fluorescence microscopy, we have introduced a 10 amino acid tag, named i-tag, at the N-terminal end of the fluorescent proteins. This caused increased expression due to improved translation efficiency and did not interfere with the protein localization in pneumococcal bacteria. Localizing fluorescent derivatives of FtsZ, Wzd and Wze in dividing bacteria validated the developed tools. The availability of the new plasmids described in this work should greatly facilitate studies of protein localization in an important clinical pathogen.

Frequent beneficial mutations during single-colony serial transfer of Streptococcus pneumoniae.

Directory of Open Access Journals (Sweden)

Kathleen E Stevens

2011-08-01

Full Text Available The appearance of new mutations within a population provides the raw material for evolution. The consistent decline in fitness observed in classical mutation accumulation studies has provided support for the long-held view that deleterious mutations are more common than beneficial mutations. Here we present results of a study using a mutation accumulation design with the bacterium Streptococcus pneumoniae in which the fitness of the derived populations increased. This rise in fitness was associated specifically with adaptation to survival during brief stationary phase periods between single-colony population bottlenecks. To understand better the population dynamics behind this unanticipated adaptation, we developed a maximum likelihood model describing the processes of mutation and stationary-phase selection in the context of frequent population bottlenecks. Using this model, we estimate that the rate of beneficial mutations may be as high as 4.8×10(-4 events per genome for each time interval corresponding to the pneumococcal generation time. This rate is several orders of magnitude higher than earlier estimates of beneficial mutation rates in bacteria but supports recent results obtained through the propagation of small populations of Escherichia coli. Our findings indicate that beneficial mutations may be relatively frequent in bacteria and suggest that in S. pneumoniae, which develops natural competence for transformation, a steady supply of such mutations may be available for sampling by recombination.

Novel carbapenem antibiotics for parenteral and oral applications: in vitro and in vivo activities of 2-aryl carbapenems and their pharmacokinetics in laboratory animals.

Science.gov (United States)

Fujimoto, Koichi; Takemoto, Koji; Hatano, Kazuo; Nakai, Toru; Terashita, Shigeyuki; Matsumoto, Masahiro; Eriguchi, Yoshiro; Eguchi, Ken; Shimizudani, Takeshi; Sato, Kimihiko; Kanazawa, Katsunori; Sunagawa, Makoto; Ueda, Yutaka

2013-02-01

SM-295291 and SM-369926 are new parenteral 2-aryl carbapenems with strong activity against major causative pathogens of community-acquired infections such as methicillin-susceptible Staphylococcus aureus, Streptococcus pneumoniae (including penicillin-resistant strains), Streptococcus pyogenes, Enterococcus faecalis, Klebsiella pneumoniae, Moraxella catarrhalis, Haemophilus influenzae (including β-lactamase-negative ampicillin-resistant strains), and Neisseria gonorrhoeae (including ciprofloxacin-resistant strains), with MIC(90)s of ≤ 1 μg/ml. Unlike tebipenem (MIC(50), 8 μg/ml), SM-295291 and SM-369926 had no activity against hospital pathogens such as Pseudomonas aeruginosa (MIC(50), ≥ 128 μg/ml). The bactericidal activities of SM-295291 and SM-369926 against penicillin-resistant S. pneumoniae and β-lactamase-negative ampicillin-resistant H. influenzae were equal or superior to that of tebipenem and greater than that of cefditoren. The therapeutic efficacies of intravenous administrations of SM-295291 and SM-369926 against experimentally induced infections in mice caused by penicillin-resistant S. pneumoniae and β-lactamase-negative ampicillin-resistant H. influenzae were equal or superior to that of tebipenem and greater than that of cefditoren, respectively, reflecting their in vitro activities. SM-295291 and SM-369926 showed intravenous pharmacokinetics similar to those of meropenem in terms of half-life in monkeys (0.4 h) and were stable against human dehydropeptidase I. SM-368589 and SM-375769, which are medoxomil esters of SM-295291 and SM-369926, respectively, showed good oral bioavailability in rats, dogs, and monkeys (4.2 to 62.3%). Thus, 2-aryl carbapenems are promising candidates that show an ideal broad spectrum for the treatment of community-acquired infections, including infections caused by penicillin-resistant S. pneumoniae and β-lactamase-negative ampicillin-resistant H. influenzae, have low selective pressure on antipseudomonal

Nonencapsulated Streptococcus pneumoniae causes otitis media during single-species infection and during polymicrobial infection with nontypeable Haemophilus influenzae.

Science.gov (United States)

Murrah, Kyle A; Pang, Bing; Richardson, Stephen; Perez, Antonia; Reimche, Jennifer; King, Lauren; Wren, John; Swords, W Edward

2015-07-01

Streptococcus pneumoniae strains lacking capsular polysaccharide have been increasingly reported in carriage and disease contexts. Since most cases of otitis media involve more than one bacterial species, we aimed to determine the capacity of a nonencapsulated S. pneumoniae clinical isolate to induce disease in the context of a single-species infection and as a polymicrobial infection with nontypeable Haemophilus influenzae. Using the chinchilla model of otitis media, we found that nonencapsulated S. pneumoniae colonizes the nasopharynx following intranasal inoculation, but does not readily ascend into the middle ear. However, when we inoculated nonencapsulated S. pneumoniae directly into the middle ear, the bacteria persisted for two weeks post-inoculation and induced symptoms consistent with chronic otitis media. During coinfection with nontypeable H. influenzae, both species persisted for one week and induced polymicrobial otitis media. We also observed that nontypeable H. influenzae conferred passive protection from killing by amoxicillin upon S. pneumoniae from within polymicrobial biofilms in vitro. Therefore, based on these results, we conclude that nonencapsulated pneumococci are a potential causative agent of chronic/recurrent otitis media, and can also cause mutualistic infection with other opportunists, which could complicate treatment outcomes. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Deletion analysis of Streptococcus pneumoniae late competence genes distinguishes virulence determinants that are dependent or independent of competence induction

OpenAIRE

Zhu, Luchang; Lin, Jingjun; Kuang, Zhizhou; Vidal, Jorge E.; Lau, Gee W.

2015-01-01

The competence regulon of Streptococcus pneumoniae (pneumococcus) is crucial for genetic transformation. During competence development, the alternative sigma factor ComX is activated, which in turn, initiates transcription of 80 “late” competence genes. Interestingly, only 16 late genes are essential for genetic transformation. We hypothesized that these late genes that are dispensable for competence are beneficial to pneumococcal fitness during infection. These late genes were systematically...

[Orbital cellulitis complicated by subperiosteal abscess due to Streptococcus pyogenes infection].

Science.gov (United States)

Ruíz Carrillo, José Daniel; Vázquez Guerrero, Edwin; Mercado Uribe, Mónica Cecilia

Orbital cellulitis is an infectious disease that is very common in pediatric patients, in which severe complications may develop. Etiological agents related to this disease are Haemophilus influenzae B, Staphylococcus aureus, Streptococcus pneumoniae and Moraxella catarrhalis, which correspond to 95% of cases. Moreover, Streptococcus beta hemolytic and anaerobic microorganisms may also be present corresponding to < 5% of the cases. We present an uncommon case of cellulitis complicated by sub-periosteal abscess caused by Streptococcus pyogenes (Group A beta hemolytic streptococcus). A 9-year-old male patient with a history of deficit disorder and hyperactivity since 5 years of age. His current condition started with erythema in the external edge of the right eye, increase in peri-orbicular volume with limitation of eyelid opening, progression to proptosis, pain with eye movements and conjunctival purulent discharge. Image studies reported subperiosteal abscess and preseptal right with extraocular cellulitis. The patient started with empirical antibiotic treatment, surgical drainage and culture of purulent material from which Streptococcus pyogenes was isolated. Due to the implementation of vaccination schemes against H. influenza and S. pneumoniae since the 90s, the cases by these pathogens have decreased, causing new bacteria to take place as the cause of the infection. The importance of considering S. pyogenes as an etiology of orbital cellulitis is the rapid progression to abscess formation, and the few cases described in the literature. Copyright © 2017 Hospital Infantil de México Federico Gómez. Publicado por Masson Doyma México S.A. All rights reserved.

Influence of impaired lipoprotein biogenesis on surface and exoproteome of Streptococcus pneumoniae.

Science.gov (United States)

Pribyl, Thomas; Moche, Martin; Dreisbach, Annette; Bijlsma, Jetta J E; Saleh, Malek; Abdullah, Mohammed R; Hecker, Michael; van Dijl, Jan Maarten; Becher, Dörte; Hammerschmidt, Sven

2014-02-07

Surface proteins are important for the fitness and virulence of the Gram-positive pathogen Streptococcus pneumoniae. They are crucial for interaction of the pathogen with its human host during infection. Therefore, the analysis of the pneumococcal surface proteome is an important task that requires powerful tools. In this study, two different methods, an optimized biotinylation approach and shaving with trypsin beads, were applied to study the pneumococcal surface proteome and to identify surface-exposed protein domains, respectively. The identification of nearly 95% of the predicted lipoproteins and 75% of the predicted sortase substrates reflects the high coverage of the two classical surface protein classes accomplished in this study. Furthermore, the biotinylation approach was applied to study the impact of an impaired lipoprotein maturation pathway on the cell envelope proteome and exoproteome. Loss of the lipoprotein diacylglyceryl transferase Lgt leads to striking changes in the lipoprotein distribution. Many lipoproteins disappear from the surface proteome and accumulate in the exoproteome. Further insights into lipoprotein processing in pneumococci are provided by immunoblot analyses of bacterial lysates and corresponding supernatant fractions. Taken together, the first comprehensive overview of the pneumococcal surface and exoproteome is presented, and a model for lipoprotein processing in S. pneumoniae is proposed.

Exposure to welding fumes and lower airway infection with Streptococcus pneumoniae.

Science.gov (United States)

Suri, Reetika; Periselneris, Jimstan; Lanone, Sophie; Zeidler-Erdely, Patti C; Melton, Geoffrey; Palmer, Keith T; Andujar, Pascal; Antonini, James M; Cohignac, Vanessa; Erdely, Aaron; Jose, Ricardo J; Mudway, Ian; Brown, Jeremy; Grigg, Jonathan

2016-02-01

Welders are at increased risk of pneumococcal pneumonia. The mechanism for this association is not known. The capacity of pneumococci to adhere to and infect lower airway cells is mediated by host-expressed platelet-activating factor receptor (PAFR). We sought to assess the effect of mild steel welding fumes (MS-WF) on PAFR-dependent pneumococcal adhesion and infection to human airway cells in vitro and on pneumococcal airway infection in a mouse model. The oxidative potential of MS-WF was assessed by their capacity to reduce antioxidants in vitro. Pneumococcal adhesion and infection of A549, BEAS-2B, and primary human bronchial airway cells were assessed by means of quantitative bacterial culture and expressed as colony-forming units (CFU). After intranasal instillation of MS-WF, mice were infected with Streptococcus pneumoniae, and bronchoalveolar lavage fluid (BALF) and lung CFU values were determined. PAFR protein levels were assessed by using immunofluorescence and immunohistochemistry, and PAFR mRNA expression was assessed by using quantitative PCR. PAFR was blocked by CV-3988, and oxidative stress was attenuated by N-acetylcysteine. MS-WF exhibited high oxidative potential. In A549 and BEAS-2B cells MS-WF increased pneumococcal adhesion and infection and PAFR protein expression. Both CV-3988 and N-acetylcysteine reduced MS-WF-stimulated pneumococcal adhesion and infection of airway cells. MS-WF increased mouse lung PAFR mRNA expression and increased BALF and lung pneumococcal CFU values. In MS-WF-exposed mice CV-3988 reduced BALF CFU values. Hypersusceptibility of welders to pneumococcal pneumonia is in part mediated by the capacity of welding fumes to increase PAFR-dependent pneumococcal adhesion and infection of lower airway cells. Copyright © 2015 American Academy of Allergy, Asthma & Immunology. All rights reserved.

Transcriptional and metabolic effects of glucose on Streptococcus pneumoniae sugar metabolism

Directory of Open Access Journals (Sweden)

Laura ePaixão

2015-10-01

Full Text Available Streptococcus pneumoniae is a strictly fermentative human pathogen that relies on carbohydrate metabolism to generate energy for growth. The nasopharynx colonised by the bacterium is poor in free sugars, but mucosa lining glycans can provide a source of sugar. In blood and inflamed tissues glucose is the prevailing sugar. As a result during progression from colonisation to disease S. pneumoniae has to cope with a pronounced shift in carbohydrate nature and availability. Thus, we set out to assess the pneumococcal response to sugars found in glycans and the influence of glucose (Glc on this response at the transcriptional, physiological and metabolic levels. Galactose (Gal, N-acetylglucosamine (GlcNAc and mannose (Man affected the expression of 8 to 14% of the genes covering cellular functions including central carbon metabolism and virulence. The pattern of end-products as monitored by in vivo 13C-NMR is in good agreement with the fermentation profiles during growth, while the pools of phosphorylated metabolites are consistent with the type of fermentation observed (homolactic vs. mixed and regulation at the metabolic level. Furthermore, the accumulation of α-Gal6P and Man6P indicate metabolic bottlenecks in the metabolism of Gal and Man, respectively. Glc added to cells actively metabolizing other sugar(s was readily consumed and elicited a metabolic shift towards a homolactic profile. The transcriptional response to Glc was large (over 5% of the genome. In central carbon metabolism (most represented category, Glc exerted mostly negative regulation. The smallest response to Glc was observed on a sugar mix, suggesting that exposure to varied sugars improves the fitness of S. pneumoniae. The expression of virulence factors was negatively controlled by Glc in a sugar-dependent manner. Overall, our results shed new light on the link between carbohydrate metabolism, adaptation to host niches and virulence.

Transcriptional and metabolic effects of glucose on Streptococcus pneumoniae sugar metabolism.

Science.gov (United States)

Paixão, Laura; Caldas, José; Kloosterman, Tomas G; Kuipers, Oscar P; Vinga, Susana; Neves, Ana R

2015-01-01

Streptococcus pneumoniae is a strictly fermentative human pathogen that relies on carbohydrate metabolism to generate energy for growth. The nasopharynx colonized by the bacterium is poor in free sugars, but mucosa lining glycans can provide a source of sugar. In blood and inflamed tissues glucose is the prevailing sugar. As a result during progression from colonization to disease S. pneumoniae has to cope with a pronounced shift in carbohydrate nature and availability. Thus, we set out to assess the pneumococcal response to sugars found in glycans and the influence of glucose (Glc) on this response at the transcriptional, physiological, and metabolic levels. Galactose (Gal), N-acetylglucosamine (GlcNAc), and mannose (Man) affected the expression of 8 to 14% of the genes covering cellular functions including central carbon metabolism and virulence. The pattern of end-products as monitored by in vivo (13)C-NMR is in good agreement with the fermentation profiles during growth, while the pools of phosphorylated metabolites are consistent with the type of fermentation observed (homolactic vs. mixed) and regulation at the metabolic level. Furthermore, the accumulation of α-Gal6P and Man6P indicate metabolic bottlenecks in the metabolism of Gal and Man, respectively. Glc added to cells actively metabolizing other sugar(s) was readily consumed and elicited a metabolic shift toward a homolactic profile. The transcriptional response to Glc was large (over 5% of the genome). In central carbon metabolism (most represented category), Glc exerted mostly negative regulation. The smallest response to Glc was observed on a sugar mix, suggesting that exposure to varied sugars improves the fitness of S. pneumoniae. The expression of virulence factors was negatively controlled by Glc in a sugar-dependent manner. Overall, our results shed new light on the link between carbohydrate metabolism, adaptation to host niches and virulence.

Meningitis neonatal e infección puerperal por Streptococcus pneumoniae: Presentación de un caso

Directory of Open Access Journals (Sweden)

Cecilia Ortiz Rodríguez

2003-06-01

Full Text Available Las infecciones neonatales causadas por Streptococcus pneumoniae constituyen un fenómeno raro, poco reportado en la literatura médica; en el presente trabajo se describe el caso de una meningoencefalitis purulenta de aparición precoz, en un neonato nacido por parto eutócico, a termino y de buen peso. Se aisló el microorganismo en la sangre y en el líquido cefalorraquídeo del recién nacido, así como en los loquios de la madre. Las 3 antibiotipias fueron idénticas. La evolución del niño fue desfavorable, el cual falleció a las 81 horas de vida, en un cuadro de fallo multiorgánico. La necropsia corroboró el diagnóstico. La madre desarrolló una endometritis puerperal a los 4 días, con buena evolución.Neonatal infections caused by Streptococcus pneumoniae are a rare phenomenon that is barely reported in the medical literature. The present paper describes a case of early purulent meningoencephalitis occurred in an adequate birthweight neonate born to term eutocic delivery. The microorganism was isolated in the newborn's blood and cerebrospinal fluid as well as in his mother's lochia. The three antibiotypes were identical. The newborn did not recover and died after 81 hours due to a multiple organ failure. Necropsy confirmed the diagnosis. The mother developed puerperal endometritis after 4 days but did recover.

Penicillin-resistant viridans streptococci have obtained altered penicillin-binding protein genes from penicillin-resistant strains of Streptococcus pneumoniae.

OpenAIRE

Dowson, C G; Hutchison, A; Woodford, N; Johnson, A P; George, R C; Spratt, B G

1990-01-01

Penicillin-resistant strains of Streptococcus pneumoniae possess altered forms of penicillin-binding proteins (PBPs) with decreased affinity for penicillin. The PBP2B genes of these strains have a mosaic structure, consisting of regions that are very similar to those in penicillin-sensitive strains, alternating with regions that are highly diverged. Penicillin-resistant strains of viridans groups streptococci (e.g., S. sanguis and S. oralis) that produce altered PBPs have also been reported. ...

Dual infection by streptococcus and atypical mycobacteria following Ahmed glaucoma valve surgery.

Science.gov (United States)

Rao, Aparna; Wallang, Batriti; Padhy, Tapas Ranjan; Mittal, Ruchi; Sharma, Savitri

2013-07-01

To report a case of late postoperative endophthalmitis caused by Streptococcus pneumoniae and conjunctival necrosis by Streptococcus pneumoniae and Mycobacterium fortuitum following Ahmed glaucoma valve (AGV) surgery in a young patient. Case report of a 13-year-old boy with purulent exudates and extensive conjunctival necrosis two months following amniotic membrane graft and conjunctival closure (for conjunctival retraction post AGV for secondary glaucoma). The conjunctiva showed extensive necrosis causing exposure of the tube and plate associated with frank exudates in the area adjoining the plate and anterior chamber mandating explantation of the plate along with intravitreal antibiotics. The vitreous aspirate grew Streptococcus pneumoniae while Streptococcus pneumoniae with Mycobacterium fortuitum was isolated from the explanted plate. Despite adequate control of infection following surgery, the final visual outcome was poor owing to disc pallor. Conjunctival necrosis and retraction post-AGV can cause late postoperative co-infections by fulminant and slow-growing organisms. A close follow-up is therefore essential in these cases to prevent sight-threatening complications.

Diversity of genotypes in CTX-M-producing Klebsiella pneumoniae isolated in different hospitals in Brazil

Directory of Open Access Journals (Sweden)

Thiago Pavoni Gomes Chagas

Full Text Available OBJECTIVE: The present study was undertaken to characterize CTX-M ESBL-producing Klebsiella pneumoniae collected from hospitals in different cities of Brazil. MATERIAL AND METHODS: Eighty-five K. pneumoniae strains isolated from hospitalized patients in six different hospitals of three cities of Brazil were analyzed. ESBL production was confirmed by the standard double-disk synergy test and the Etest®. The MIC50 and MIC90 for ESBL-producing isolates were determined by the Etest® method. The antimicrobial susceptibilities of bacterial isolates were determined using the agar diffusion method according to the CLSI. Screening for blaTEM, blaSHV, blaCTX-M genes and class 1 integron was performed by PCR amplification. To determine the genomic diversity of CTX-M-producers, isolates were analyzed by macrorestriction profile analysis following PFGE. RESULTS AND DISCUSSION: Seventy-one K. pneumoniae isolates were ESBL-producing. PCR and sequencing experiments detected 38 CTX-M-producing K. pneumoniae belonged to groups CTX-M 1, CTX-M 2, CTX-M 8 and CTX-M 9. The association of different types ESBL (CTX-M, SHV and TEM was frequent. All K. pneumoniae isolates carried class 1 integron. PFGE analysis revealed thirty-one clonal types among CTX-M-producing isolates. The data presented herein illustrate the diversity of genotypes of CTX-M producing K. pneumoniae among Brazilians hospitals.

IL-22 Defect During Streptococcus pneumoniae Infection Triggers Exacerbation of Chronic Obstructive Pulmonary Disease

Directory of Open Access Journals (Sweden)

Muriel Pichavant

2015-11-01

Full Text Available Progression of chronic obstructive pulmonary disease (COPD is linked to episodes of exacerbations caused by bacterial infections due to Streptococcus pneumoniae. Our objective was to identify during COPD, factors of susceptibility to bacterial infections among cytokine network and their role in COPD exacerbations. S. pneumoniae was used to sub-lethally challenge mice chronically exposed to air or cigarette smoke (CS and to stimulate peripheral blood mononuclear cells (PBMC from non-smokers, smokers and COPD patients. The immune response and the cytokine production were evaluated. Delayed clearance of the bacteria and stronger lung inflammation observed in infected CS-exposed mice were associated with an altered production of IL-17 and IL-22 by innate immune cells. This defect was related to a reduced production of IL-1β and IL-23 by antigen presenting cells. Importantly, supplementation with recombinant IL-22 restored bacterial clearance in CS-exposed mice and limited lung alteration. In contrast with non-smokers, blood NK and NKT cells from COPD patients failed to increase IL-17 and IL-22 levels in response to S. pneumoniae, in association with a defect in IL-1β and IL-23 secretion. This study identified IL-17 and IL-22 as susceptibility factors in COPD exacerbation. Therefore targeting such cytokines could represent a potent strategy to control COPD exacerbation.

Identification of a patient with Streptococcus pneumoniae bacteremia and meningitis by the polymerase chain reaction (PCR).

Science.gov (United States)

Isaacman, D J; Zhang, Y; Rydquist-White, J; Wadowsky, R M; Post, J C; Ehrlich, G D

1995-06-01

A polymerase chain reaction (PCR) assay based on the penicillin-binding protein gene PBP2B identified the presence of DNA specific for Streptococcus pneumoniae in the serum and CSF of a patient with culture-proven bacteremia and meningitis. Positive signals were seen to dilutions of 1:125 and 1:390,625 for the blood and CSF specimens, respectively. Potential advantages of PCR over conventional culture include exquisite sensitivity, faster results and the ability to identify the organisms by the presence of species-specific DNA even in patients pretreated with antibiotics.

Fluorescence Imaging of Streptococcus pneumoniae with the Helix pomatia agglutinin (HPA As a Potential, Rapid Diagnostic Tool

Directory of Open Access Journals (Sweden)

Mirian Domenech

2017-07-01

Full Text Available Streptococcus pneumoniae is a common human pathogen and a major causal agent of life-threatening infections that can either be respiratory or non-respiratory. It is well known that the Helix pomatia (edible snail agglutinin (HPA lectin shows specificity for terminal αGalNAc residues present, among other locations, in the Forssman pentasaccharide (αGalNAc1→3βGalNAc1→3αGal1→4βGal1→4βGlc. Based on experiments involving choline-independent mutants and different growth conditions, we propose here that HPA recognizes the αGalNAc terminal residues of the cell wall teichoic and lipoteichoic acids of S. pneumoniae. In addition, experimental evidence showing that pneumococci can be specifically labeled with HPA when growing as planktonic cultures as well as in mixed biofilms of S. pneumoniae and Haemophilus influenzae has been obtained. It should be underlined that pneumococci were HPA-labeled despite of the presence of a capsule. Although some non-pneumococcal species also bind the agglutinin, HPA-binding combined with fluorescence microscopy constitutes a suitable tool for identifying S. pneumoniae and, if used in conjunction with Gram staining and/or other suitable technique like antigen detection, it may potentially facilitate a fast and accurate diagnosis of pneumococcal infections.

Nasopharyngeal carriage of Streptococcus pneumoniae and other bacteria in the 7th year after implementation of the pneumococcal conjugate vaccine in the Netherlands

NARCIS (Netherlands)

Bosch, Astrid A T M; van Houten, Marlies A.; Bruin, Jacob P.; Wijmenga-Monsuur, Alienke J.; Trzciński, Krzysztof; Bogaert, Debby; Rots, Nynke Y.; Sanders, Elisabeth A M

2016-01-01

After introduction of the 7-valent pneumococcal conjugate vaccine (PCV7) in the infant national immunization program (NIP) in the Netherlands in 2006, Streptococcus pneumoniae strains of the non-vaccine serotype 19A emerged and became the dominant serotype in carriage in children and their parents.

Infection by Streptococcus pneumoniae in children with or without radiologically confirmed pneumonia

Directory of Open Access Journals (Sweden)

Dafne C. Andrade

2018-01-01

Conclusions: Among children with clinical diagnosis of community‐acquired pneumonia submitted to chest radiograph, those with radiologically confirmed pneumonia present a higher rate of infection by S. pneumoniae when compared with those with a normal chest radiograph.

Rapid Assessment of Resistance to Antibiotic Inhibitors of Protein Synthesis in the Gram-Positive Pathogens, Enterococcus faecalis and Streptococcus pneumoniae, Based on Evaluation of the Lytic Response.

Science.gov (United States)

Otero, Fátima; Tamayo, María; Santiso, Rebeca; Gosálvez, Jaime; Bou, Germán; Fernández, José Luis

2017-04-01

A novel assay for rapid determination of resistance to antibiotic inhibitors of protein synthesis was developed for the gram-positive pathogens, Enterococcus faecalis and Streptococcus pneumoniae. To this purpose, a lytic response was obtained by a brief incubation with lysozyme or a mixture of lysozyme, Triton X-100, and EDTA for E. faecalis (n = 82) and S. pneumoniae (n = 51), respectively. Lysis was quantified by visualizing the released nucleoids. Antibiotic-susceptible bacteria treated with Clinical and Laboratory Standards Institute (CLSI) breakpoint doses of erythromycin, azithromycin, or doxycycline that inhibited protein synthesis demonstrated a large reduction of lysed cells with respect to the control, that is, without antibiotics. However, cell lysis prevention was much lower in nonsusceptible strains, with unsuccessful inhibition of protein synthesis. ROC analysis showed that a reduction value of ≥35.6% and ≥40.4% discriminates susceptible and nonsusceptible strains for erythromycin and for doxycycline, respectively, in E. faecalis, whereas ≥20.0% is adequate for both macrolides and doxycycline in S. pneumoniae. Resistant stains were identified in 90-120 min with sensitivity and specificity between 91.7% and 100%. This is a proof of concept that evaluation of the lytic response may be a rapid and efficient test for determination of resistance to antibiotic inhibitors of protein synthesis.

Identification of Streptococcus pneumoniae lytA, plyA and psaA genes in pleural fluid by multiplex real-time PCR.

Science.gov (United States)

Sanz, Juan Carlos; Ríos, Esther; Rodríguez-Avial, Iciar; Ramos, Belén; Marín, Mercedes; Cercenado, Emilia

2017-08-14

The aim was to evaluate the utility of a multiplex real-time PCR to detect Streptococcus pneumoniae lytA, plyA and psaA genes in pleural fluid (PF). A collection of 81 PF samples was used. Sixty were considered positive for S. pneumoniae according to previous results (54 by an in-house lytA gene PCR and eight by universal rRNA PCR). The sensitivity for detection of the lytA, plyA and psaA genes by multiplex PCR was 100% (60/60), 98.3% (59/60) and 91.7% (55/60), respectively. The detection of all three genes was negative in 21 samples formerly confirmed as negative for S. pneumoniae (100% specificity) by the other procedures (9 by in-house lytA PCR and 12 by rRNA PCR). The use of this multiplex PCR may be a useful option to identify S. pneumoniae directly in PF samples. Copyright © 2017 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

In vitro activity of daptomycin against clinical isolates of Gram-positive bacteria.

Science.gov (United States)

Piper, Kerryl E; Steckelberg, James M; Patel, Robin

2005-08-01

We determined the activity of daptomycin, a recently FDA-approved antimicrobial agent, against clinical isolates of Gram-positive bacteria, including viridans group streptococci (16 Streptococcus mitis species group, 12 S. mutans species group, 9 S. anginosus species group, 8 S. sanguinis species group, 5 S. salivarius species group) from patients with infective endocarditis, 32 methicillin-resistant Staphylococcus aureus, 32 high-level penicillin-resistant Streptococcus pneumoniae, 38 vancomycin-resistant enterococci (including 1 linezolid-resistant isolate), and the following unusual Gram-positive bacteria: 3 Listeria monocytogenes, 4 Erysipelothrix rhusiopathiae, 9 Corynebacterium species, 10 Abiotrophia/Granulicatella species, 2 Rothia (Stomatococcus) mucilaginosus, and 4 Gemella morbillorum. Daptomycin minimum inhibitory concentration (MIC)(90) values for the viridans group streptococci, methicillin-resistant S. aureus, penicillin-resistant S. pneumoniae, and Enterococcus species were 0.5, 0.5, endocarditis as well as against several types of unusual Gram-positive bacteria that can cause endocarditis.

A novel computational method identifies intra- and inter-species recombination events in Staphylococcus aureus and Streptococcus pneumoniae.

Directory of Open Access Journals (Sweden)

Lisa Sanguinetti

Full Text Available Advances in high-throughput DNA sequencing technologies have determined an explosion in the number of sequenced bacterial genomes. Comparative sequence analysis frequently reveals evidences of homologous recombination occurring with different mechanisms and rates in different species, but the large-scale use of computational methods to identify recombination events is hampered by their high computational costs. Here, we propose a new method to identify recombination events in large datasets of whole genome sequences. Using a filtering procedure of the gene conservation profiles of a test genome against a panel of strains, this algorithm identifies sets of contiguous genes acquired by homologous recombination. The locations of the recombination breakpoints are determined using a statistical test that is able to account for the differences in the natural rate of evolution between different genes. The algorithm was tested on a dataset of 75 genomes of Staphylococcus aureus and 50 genomes comprising different streptococcal species, and was able to detect intra-species recombination events in S. aureus and in Streptococcus pneumoniae. Furthermore, we found evidences of an inter-species exchange of genetic material between S. pneumoniae and Streptococcus mitis, a closely related commensal species that colonizes the same ecological niche. The method has been implemented in an R package, Reco, which is freely available from supplementary material, and provides a rapid screening tool to investigate recombination on a genome-wide scale from sequence data.

Etiology of community-acquired pneumonia in hospitalized patients in Jordan

International Nuclear Information System (INIS)

Al-Ali, Musa K.; Batchoun, R. G.; Al-Nour, Tariq M.

2006-01-01

To ascertain the causative organisms of community acquired pneumonia (Cap) in Jordanian patients requiring hospital admission. A prospective study of both adults and children admitted to Princess Basma and Princess Rahma Teaching Hospitals in Irbid, Jordan with a diagnosis of CAP over a 6-month period from April to October 2002. A total of 35 adult patients were admitted with a mean age of 47 years, and 63 children with a mean age of 3 years. A pathogen was isolated from 25 (71%) adults, and from 17 (27%) children, and sputum cultures gave the best diagnostic yield. In adults Streptococcus pneumoniae was the most common isolate (26%), followed by Chlamydia pneumoniae (23%), Haemophilus influenzae (17%), Mycoplasma pneumoniae (9%), and Legionella pneumophila and Klebsiella pneumoniae (6%) each. Seven of the 9 gram negative isolates were from patients with some co morbid illness. While in children, Chlamydia pneumoniae was the most common (14%), followed by Mycoplasma pneumoniae (6%), and Streptococcus pneumoniae, Haemophilus influenzae, and Pseudomonas aeruginosa (3%) each. Streptococcus pneumoniae and atypical microorganisms are the most common cause of CAP in previously healthy adults; while in those with associated co morbid illness, gram negative organisms are the likely cause. In children, the overall detection rate of causative organisms was low with atypical microorganisms being the most common. (author)

99mTcN-gatifloxacin dithiocarbamate complex. A novel multi-drug-resistance Streptococcus pneumoniae (MRSP) infaction radiotracer

International Nuclear Information System (INIS)

Syed Qaiser Shah; Mohammad Rafiullah Khan

2011-01-01

Gatifloxacin (GTN) was derivatized to its dithiocarbamate derivative and its radiolabeling with technetium-99m ( 99m Tc) using the [ 99m Tc≡N] 2+ core was investigated. The appropriateness of the 99m TcN - gatifloxacin dithiocarbamate ( 99m TcN - GTND) complex as a potential multi-drug-resistance Streptococcus pneumoniae (MRSP) infection radiotracer was evaluated in terms of stability in saline, serum, in vitro binding with MRSP and biodistribution in artificially MRSP infected Male Wistar Rats (MWR). In saline the 99m TcN - GTND complex showed more than 90% labeling yield up to 4 h with a maximum yield of 98.25 ± 0.20%, after reconstitution. In serum the 99m TcN - GTND complex showed stability up to 16 h of incubation with the appearance of insignificant 15.95% undesirable side products. The 99m TcN - GTND complex demonstrated saturated in vitro binding with MRSP with a maximum value of 75.50 ± 1.00% (at 90 min). In MWR model of group A, almost six times higher uptake of the labeled GTND was monitored in the muscle of MWR infected with live MRSP as compared to the inflamed and normal muscles. Based on the higher labeling yield in saline, in vitro stability in serum, saturated in vitro binding with live MRSP and promising biodistribution in MWR model we recommend 99m TcN - gatifloxacin dithiocarbamate complex as a potential MRSP infection radiotracer. (author)

Septicaemia models using Streptococcus pneumoniae and Listeria monocytogenes: understanding the role of complement properdin.

Science.gov (United States)

Dupont, Aline; Mohamed, Fatima; Salehen, Nur'Ain; Glenn, Sarah; Francescut, Lorenza; Adib, Rozita; Byrne, Simon; Brewin, Hannah; Elliott, Irina; Richards, Luke; Dimitrova, Petya; Schwaeble, Wilhelm; Ivanovska, Nina; Kadioglu, Aras; Machado, Lee R; Andrew, Peter W; Stover, Cordula

2014-08-01

Streptococcus pneumoniae and Listeria monocytogenes, pathogens which can cause severe infectious disease in human, were used to infect properdin-deficient and wildtype mice. The aim was to deduce a role for properdin, positive regulator of the alternative pathway of complement activation, by comparing and contrasting the immune response of the two genotypes in vivo. We show that properdin-deficient and wildtype mice mounted antipneumococcal serotype-specific IgM antibodies, which were protective. Properdin-deficient mice, however, had increased survival in the model of streptococcal pneumonia and sepsis. Low activity of the classical pathway of complement and modulation of FcγR2b expression appear to be pathogenically involved. In listeriosis, however, properdin-deficient mice had reduced survival and a dendritic cell population that was impaired in maturation and activity. In vitro analyses of splenocytes and bone marrow-derived myeloid cells support the view that the opposing outcomes of properdin-deficient and wildtype mice in these two infection models is likely to be due to a skewing of macrophage activity to an M2 phenotype in the properdin-deficient mice. The phenotypes observed thus appear to reflect the extent to which M2- or M1-polarised macrophages are involved in the immune responses to S. pneumoniae and L. monocytogenes. We conclude that properdin controls the strength of immune responses by affecting humoral as well as cellular phenotypes during acute bacterial infection and ensuing inflammation.

Tigecycline activity tested against 26,474 bloodstream infection isolates: a collection from 6 continents.

Science.gov (United States)

Sader, Helio S; Jones, Ronald N; Stilwell, Matthew G; Dowzicky, Michael J; Fritsche, Thomas R

2005-07-01

The activity of tigecycline (formerly GAR936), a novel glycylcycline, was tested against recent bloodstream infection (BSI) pathogen isolates from 6 continents. Frequency of clinical occurrence of these pathogens was determined and their antibiograms assessed using reference broth microdilution methods. A total of 26474 strains were tested for tigecycline susceptibility according to the Clinical and Laboratory Standards Institute (formerly the National Committee for Clinical Laboratory Standards) by the M7-A6 guidelines with interpretations from M100-S15 and the package insert. The rank order of pathogens was Staphylococcus aureus (33.1%), Escherichia coli (14.0%), coagulase-negative staphylococci (13.5%), Enterococcus spp. (12.3%), Klebsiella spp. (5.7%), Pseudomonas aeruginosa (4.2%), Enterobacter spp. (3.0%), beta-hemolytic streptococci (2.9%), Streptococcus pneumoniae (2.3%), and viridans group streptococci (1.4%). Tigecycline exhibited a broader spectrum of activity against BSI isolates when compared to ciprofloxacin, tetracycline, aminoglycosides, and many beta-lactams (imipenem). Tigecycline was highly active against most pathogens tested, including staphylococci (MIC(90), 0.5 microg/mL), enterococci (MIC90, 0.25 microg/mL), streptococci (MIC(90), < or =0.12 microg/mL), Escherichia coli (MIC90, 0.25 microg/mL), Klebsiella spp. (MIC90, 1 mmicrog/mL), and Enterobacter spp. (MIC(90), 2 mmicrog/mL), but showed limited inhibition of Pseudomonas aeruginosa (MIC90, 16 microg/mL) and indole-positive or indole-negative Proteae (MIC90, 4-8 microg/mL). In summary, tigecycline exhibited a wide spectrum of antimicrobial potency versus BSI isolates collected worldwide. Serious infections in nosocomial environments should benefit from tigecycline use among the investigational phase 3 agents focused toward resistant strains.

Importance of Bacterial Replication and Alveolar Macrophage-Independent Clearance Mechanisms during Early Lung Infection with Streptococcus pneumoniae

Science.gov (United States)

Camberlein, Emilie; Cohen, Jonathan M.; José, Ricardo; Hyams, Catherine J.; Callard, Robin; Chimalapati, Suneeta; Yuste, Jose; Edwards, Lindsey A.; Marshall, Helina; van Rooijen, Nico; Noursadeghi, Mahdad

2015-01-01

Although the importance of alveolar macrophages for host immunity during early Streptococcus pneumoniae lung infection is well established, the contribution and relative importance of other innate immunity mechanisms and of bacterial factors are less clear. We have used a murine model of S. pneumoniae early lung infection with wild-type, unencapsulated, and para-amino benzoic acid auxotroph mutant TIGR4 strains to assess the effects of inoculum size, bacterial replication, capsule, and alveolar macrophage-dependent and -independent clearance mechanisms on bacterial persistence within the lungs. Alveolar macrophage-dependent and -independent (calculated indirectly) clearance half-lives and bacterial replication doubling times were estimated using a mathematical model. In this model, after infection with a high-dose inoculum of encapsulated S. pneumoniae, alveolar macrophage-independent clearance mechanisms were dominant, with a clearance half-life of 24 min compared to 135 min for alveolar macrophage-dependent clearance. In addition, after a high-dose inoculum, successful lung infection required rapid bacterial replication, with an estimated S. pneumoniae doubling time of 16 min. The capsule had wide effects on early lung clearance mechanisms, with reduced half-lives of 14 min for alveolar macrophage-independent and 31 min for alveolar macrophage-dependent clearance of unencapsulated bacteria. In contrast, with a lower-dose inoculum, the bacterial doubling time increased to 56 min and the S. pneumoniae alveolar macrophage-dependent clearance half-life improved to 42 min and was largely unaffected by the capsule. These data demonstrate the large effects of bacterial factors (inoculum size, the capsule, and rapid replication) and alveolar macrophage-independent clearance mechanisms during early lung infection with S. pneumoniae. PMID:25583525

Individual risk factors associated with nasopharyngeal colonization with Streptococcus pneumoniae and Haemophilus influenzae: a Japanese birth cohort study.

Science.gov (United States)

Otsuka, Taketo; Chang, Bin; Shirai, Takatoshi; Iwaya, Atsushi; Wada, Akihito; Yamanaka, Noboru; Okazaki, Minoru

2013-07-01

The first step in a bacterial disease is the establishment of nasopharyngeal carriage. We conducted a birth cohort study to identify factors associated with colonization in healthy children and evaluate the serotype distributions and resistances of Streptococcus pneumoniae/Haemophilus influenzae. Nasopharyngeal cultures were obtained from 349 subjects at 5 time points coinciding with health checkups (4, 7, 10, 18 and 36 months). A total of 551 S. pneumoniae (penicillin resistance rate: 46.3%) and 301 H. influenzae (ampicillin resistance rate: 44.5%) isolates were obtained from 1654 samples. In this study, 47.5% and 60.9% of S. pneumoniae isolates were included in the serotypes of 7- and 13-valent pneumococcal conjugate vaccines, respectively. Analyzing by Cox proportional hazards models, cohabiting older sibling(s) attending day-care (hazard ratios: 2.064-3.518, P rates. This data indicated that introduction of appropriate antimicrobial usage in areas of overuse of antimicrobials could contribute to lower colonization of S. pneumoniae/H. influenzae, resulting in a decrease in the absolute number of resistant isolates. Strategies to control transmission at day-care centers or from older sibling(s) as well as appropriate use of antimicrobials are essential for reducing colonization and the absolute number of resistant isolates.

N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Muhammad Afzal

2016-09-01

Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

Polarity of recombination in transformation of Streptococcus pneumoniae.

Science.gov (United States)

Pasta, F; Sicard, M A

1999-03-16

In transformation of Streptococcus pneumoniae DNA enters the cell as single-strand fragments and integrates into the chromosome by homologous recombination. Deletions and insertions of a few hundred base pairs frequently stop the recombination process of a donor strand. In this work we took advantage of such interruptions of recombination to compare the transformation efficiencies of the segments 5'- and 3'-ward from a deletion. The deletion was created in the center of a fragment of the ami locus, and sites around the deletion were labeled by a frameshift generating a restriction site. Heteroduplexes were constructed containing two restriction sites on one strand and two different ones on the complementary strand. ami+ bacteria were transformed with such heteroduplexes. ami- transformants were isolated and individually underwent amplification of the transformed ami region. We have obtained two kinds of amplification products: short when the deletion was integrated, long when recombination stops at the deletion. Each long fragment was tested by the four restriction enzymes to detect which strand and which side of the deletion had recombined. We found that 80% of the cuts were located 5' to the deletion, showing that, in vivo, the 5' side is strongly favored by recombination. Further results suggest that exchanges occurring from 5' to 3' relative to the donor strand are more efficient than in the opposite direction, thus accounting for the 5' preference.

Increased cefepime MIC for enterobacteriacae clinical isolates.

Science.gov (United States)

Najafi, Narges; Alikhani, Ahmad; Babamahmoudi, Farhang; Davoudi, Alireza; Ghasemiyan, Roya; Aliyan, Shahriar; Shoujaiifar, Arman

2013-01-01

Background : Cefepime was used as empirical treatment in ventilator-associated pneumonia (VAP) induced by gram-negative and gram-positive bacteria. This study aimed to determine the antimicrobial susceptibility pattern of cefepime against microorganism causing VAP in Mazandaran, North of Iran. This study was performed on VAP patients diagnosed with clinical pulmonary infection score (CPIS) scores in ICU of two hospitals. For each patient suspected of having VAP, quantitative culture of endotracheal aspiration (QEA) was performed and MIC was determined by micro dilution test. Data were collected and analyzed. Thirty- five cases of enterobacteriaceae were isolated orderly including E coli 13, P. aeruginosa 11, Enterobacter 7 and K. pneumonia 4 cases. All the isolated E. coli, Enterobacter and Klebsiella, 54.5% of P. aeruginosa isolated were fully resistant to cefepime. The results of this study show that cefepime is not a reasonable choice for empirical treatment of nosocomial pneumonia and VAP.

Susceptibilidad antimicrobiana de Streptococcus pneumoniae colonizante de nasofaringe en niños colombianos con neumonía

Directory of Open Access Journals (Sweden)

Aura Lucía Leal

1997-04-01

Full Text Available Streptococcus pneumoniae es uno de los principales agentes causales de infección respiratoria aguda (IRA en niños y su resistencia a antibióticos se ha incrementado en todo el mundo. En este estudio se determinaron los patrones de susceptibilidad a antimicrobianos de S. pneumoniae colonizante de las vías respiratorias altas en 272 niños hospitalizados por neumonía en dos hospitales de Santafé de Bogotá. Se aisló S. pneumoniae en 114 pacientes (42%. Se observó susceptibilidad disminuida a la penicilina en 19 aislamientos (17%, con sensibilidad intermedia en 12 (11% y franca resistencia en 7 (6%. Solo 1 de los 19 aislamientos resistentes a penicilina mostró también resistencia a la ceftriaxona. Se observó sensibilidad disminuida a la eritromicina en 3 aislamientos (3%, al cloranfenicol en 6 (5% y al cotrimoxazol (trimetoprima + sulfametoxazol en 46 (40%. Se encontró multirresistencia en 7 aislamientos (6%. El serotipo con sensibilidad disminuida a la penicilina que se halló con mayor frecuencia fue el 23F (68,4%. Se observó una asociación entre la edad, el uso previo de antibióticos y la colonización con S. pneumoniae con susceptibilidad disminuida a la penicilina o multirresistencia. Este estudio confirma la presencia de resistencia antimicrobiana de S. pneumoniae en Colombia y resalta la importancia del uso racional de los antibióticos y de la implementación de la vigilancia epidemiológica sobre este agente.

Antibacterial activity of Euphorbia hirta against Streptococcus ...

African Journals Online (AJOL)

This investigation was conducted to determine the in-vitro effect of aqueous, ethanol and methanol crude extracts of Euphorbia hirta at concentrations ranging from 10mg/ml – 100mg/ml against three pathogenic bacteria (Streptococcus pneumoniae, Klebsiella pneumoniae and Proteus vulgaris) using cup plate method.

Meningitis caused by streptococci other than Streptococcus pneumoniae: a retrospective clinical study

DEFF Research Database (Denmark)

Møller, Kirsten; Harder, Eva; Wandall, Johan

1999-01-01

We reviewed the medical records of 26 patients (median age 62 years, range 5-76 years) admitted to our institution during 1978-98 with acute bacterial meningitis (ABM) caused by streptococci other than Streptococcus pneumoniae (comprising 1.9% of all patients with ABM). 19 cases were community......-acquired and 7 were nosocomial. 73% had comorbid or predisposing conditions and 73% had an identifiable extracerebral focus; only in 2 patients no comorbid disease, primary focus or predisposing condition was present. Five patients had cerebral abscesses, and 5 had endocarditis. Beta-haemolytic streptococci were...... grown in 14 cases (serotype A: 4, B: 5, C: 1, G: 4) and were predominant among patients with endocarditis, whereas alpha- or non-haemolytic strains grew in 12 cases (S. mitis: 4, S. constellatus: 2, E. faecalis: 2, S. bovis: 1, unspecified: 3) and were predominant in patients with a brain abscess...

Standardisation and evaluation of a quantitative multiplex real-time PCR assay for the rapid identification of Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Feroze Ahmed Ganaie

2015-01-01

Full Text Available Rapid diagnosis of Streptococcus pneumoniae can play a significant role in decreasing morbidity and mortality of infection. The accurate diagnosis of pneumococcal disease is hampered by the difficulties in growing the isolates from clinical specimens and also by misidentification. Molecular methods have gained popularity as they offer improvement in the detection of causative pathogens with speed and ease. The present study aims at validating and standardising the use of 4 oligonucleotide primer-probe sets (pneumolysin [ply], autolysin [lytA], pneumococcal surface adhesion A [psaA] and Spn9802 [DNA fragment] in a single-reaction mixture for the detection and discrimination of S. pneumoniae. Here, we validate a quantitative multiplex real-time PCR (qmPCR assay with a panel consisting of 43 S. pneumoniae and 29 non-pneumococcal isolates, 20 culture positive, 26 culture negative and 30 spiked serum samples. A standard curve was obtained using S. pneumoniae ATCC 49619 strain and glyceraldehyde 3-phosphate dehydrogenase (GAPDH gene was used as an endogenous internal control. The experiment showed high sensitivity with lower limit of detection equivalent to 4 genome copies/µl. The efficiency of the reaction was 100% for ply, lytA, Spn9802 and 97% for psaA. The test showed sensitivity and specificity of 100% with culture isolates and serum specimens. This study demonstrates that qmPCR analysis of sera using 4 oligonucleotide primers appears to be an appropriate method for the genotypic identification of S. pneumoniae infection.

Alta prevalência de crianças portadoras de Streptococcus pneumoniae resistentes à penicilina em creches públicas High prevalence of children colonized with penicillin-resistant Streptococcus pneumoniae in public day-care centers

Directory of Open Access Journals (Sweden)

Patrícia A. G. Velasquez

2009-12-01

Full Text Available OBJETIVOS: Investigar a prevalência de Streptococcus pneumoniae (pneumococos na nasofaringe de crianças sadias atendidas em creches municipais da cidade de Umuarama (PR. Avaliar a susceptibilidade aos antimicrobianos dos pneumococos isolados. MÉTODOS: Secreção da nasofaringe de 212 crianças foi coletada no período de abril a outubro de 2008. Após semeadura dos espécimes em ágar sangue e incubação a 37 °C por 24-48 horas, as colônias suspeitas de pertencerem a S. pneumoniae foram identificadas pela α-hemólise, sensibilidade à optoquina e bile solubilidade. A susceptibilidade à penicilina foi investigada pelos testes de disco-difusão e de diluição. A susceptibilidade aos demais antimicrobianos indicados no tratamento das infecções pneumocócicas foi realizada por disco-difusão RESULTADOS: A prevalência de pneumococos na nasofaringe foi de 43,4% (92/212, sendo maior em crianças com idade entre 2 e 5 anos (p = 0,0005. Não houve diferença significativa entre os sexos. Resistência intermediária e resistência plena à penicilina foram encontradas respectivamente em 34,8 (32/92 e 22,8% (21/92 dos isolados. Sessenta e sete amostras (72,8% foram resistentes ao sulfametoxazol-trimetoprim, oito (8,7% à eritromicina e seis (6,5% à tetraciclina. Uma amostra apresentou resistência à clindamicina (1,1%, e outra ao cloranfenicol (1,1%. Todas as amostras foram sensíveis a levofloxacina, ofloxacina, rifampicina, telitromicina, linezolide e vancomicina. Nove amostras foram consideradas multirresistentes, por apresentarem resistência a três ou mais classes de antimicrobianos. CONCLUSÕES: O presente estudo registrou uma alta prevalência de crianças portadoras sadias de amostras de S. pneumoniae resistentes à penicilina que podem constituir importantes reservatórios desse patógeno na comunidade.OBJECTIVES: To investigate the prevalence of Streptococcus pneumoniae (pneumococci in the nasopharynx of healthy children enrolled

Efficacy of some synthetic antibiotics on Streptococcus pneumoniae ...

African Journals Online (AJOL)

Effects of some synthetic antibiotics on Streptococcus pnemoniae and Proteus mirabilis isolated from cultured Clarias gariepinus, an important food fish raised in a concrete tank was carried out to ascertain their remedies on mortalities of the Clarias gariepinus adult fish. Streptococcus pnemoniae and Proteus mirabilis were ...

Nasopharyngeal carriage, antibiogram & serotype distribution of Streptococcus pneumoniae among healthy under five children

Directory of Open Access Journals (Sweden)

K.L. Ravi Kumar

2014-01-01

Full Text Available Background & objectives: Information related to nasopharyngeal carriage of Streptococcus pneumoniae among healthy children is scanty in India. This prospective study was undertaken to determine the presence of asymptomatic nasopharyngeal colonization, assess serogroups/types (SGT and drug resistance of S. pneumoniae in children below five years of age. Methods: A total of 109 male and 81 female children in the age group of three months to five years belonging to different socio-economic classes were enrolled. They were recruited across all age groups from those attending paediatric OPD of a tertiary care and research centre for immunization program. Fifty three isolates identified as pneumococci were tested for their antimicrobial susceptibility pattern by Kirby-Bauer′s disc diffusion and E-Test methods. Serotyping was performed by detection of the quelling reaction with specific antiserum. Result: The pneumococcal carriage rate in the study population was 27.9 per cent. The isolation rate was associated with age being higher (49.2% in smaller children (3-12 months and among male (62.2%. The most prevalent SGTs were 19 followed by 10, 14 and 7; 21 per cent of isolates belonging to serotype 10 (n=7 were 11 (n=4 were not covered in any of the conjugate vaccines currently available in Indian market. Resistance to co-trimoxazole, tetracycline, penicillin and erythromycin was observed in 91 per cent (n=48, 36 per cent (n=19, 17 per cent (n=9 and 9 per cent (n=5 isolates, respectively. All the penicillin resistant isolates were found to be intermediately resistant by E-Test. Multidrug resistance was observed in 19 per cent (n=10 isolates. Interpretation & conclusions: High level of antibiotic resistance was present in S. pneumoniae isolated from healthy children below age five. A pneumococcal conjugate vaccine with the prevailing SGTs would help to reduce the pool of antibiotic resistant pneumococci. Continued surveillance of serotypes and tracking

Effect of Xylitol on Growth of Streptococcus pneumoniae in the Presence of Fructose and Sorbitol

Science.gov (United States)

Tapiainen, Terhi; Kontiokari, Tero; Sammalkivi, Laura; Ikäheimo, Irma; Koskela, Markku; Uhari, Matti

2001-01-01

Xylitol is effective in preventing acute otitis media by inhibiting the growth of Streptococcus pneumoniae. To clarify this inhibition we used fructose, which is known to block similar growth inhibition observed in Streptococcus mutans. In addition, we evaluated the efficacy of sorbitol in inhibiting the growth of pneumococci, as sorbitol is widely used for indications similar to those for which xylitol is used. The addition of 5% xylitol to the growth medium resulted in marked growth inhibition, an effect which was totally eliminated in the presence of 1, 2.5, or 5% fructose but not in the presence of 1 or 5% glucose, 1% galactose, or 1% sucrose. This finding implies that xylitol-induced inhibition of pneumococcal growth is mediated via the fructose phosphotransferase system in a way similar to that in which mutans group streptococcal growth is inhibited. The addition of sorbitol at concentrations of 1, 2.5, or 5% to the growth medium did not affect the growth of pneumococci and neither inhibited nor enhanced the xylitol-induced growth impairment. Thus, it seems that xylitol is the only commercially used sugar substitute proven to have an antimicrobial effect on pneumococci. PMID:11120960

Streptococcus pneumoniae-Induced Oxidative Stress in Lung Epithelial Cells Depends on Pneumococcal Autolysis and Is Reversible by Resveratrol.

Science.gov (United States)

Zahlten, Janine; Kim, Ye-Ji; Doehn, Jan-Moritz; Pribyl, Thomas; Hocke, Andreas C; García, Pedro; Hammerschmidt, Sven; Suttorp, Norbert; Hippenstiel, Stefan; Hübner, Ralf-Harto

2015-06-01

Streptococcus pneumoniae is the most common cause of community-acquired pneumonia worldwide. During pneumococcal pneumonia, the human airway epithelium is exposed to large amounts of H2O2 as a product of host and pathogen oxidative metabolism. Airway cells are known to be highly vulnerable to oxidant damage, but the pathophysiology of oxidative stress induced by S. pneumoniae and the role of nuclear factor erythroid 2-related factor 2 (Nrf2)-mediated antioxidant systems of the host are not well characterized. For gluthation/gluthathion disulfide analysis BEAS-2B cells, primary broncho-epithelial cells (pBEC), explanted human lung tissue and mouse lungs were infected with different S. pneumoniae strains (D39, A66, R6x, H2O2/pneumolysin/LytA- deficient mutants of R6x). Cell death was proven by LDH assay and cell viability by IL-8 ELISA. The translocation of Nrf2 and the expression of catalase were shown via Western blot. The binding of Nrf2 at the catalase promoter was analyzed by ChIP. We observed a significant induction of oxidative stress induced by S. pneumoniae in vivo, ex vivo, and in vitro. Upon stimulation, the oxidant-responsive transcription factor Nrf2 was activated, and catalase was upregulated via Nrf2. The pneumococci-induced oxidative stress was independent of S. pneumoniae-derived H2O2 and pneumolysin but depended on the pneumococcal autolysin LytA. The Nrf2 inducer resveratrol, as opposed to catalase, reversed oxidative stress in lung epithelial cells. These observations indicate a H2O2-independent induction of oxidative stress in lung epithelial cells via the release of bacterial factors of S. pneumoniae. Resveratrol might be an option for prevention of acute lung injury and inflammatory responses observed in pneumococcal pneumonia. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Predictors of mortality in patients with extensively drug-resistant Acinetobacter baumannii pneumonia receiving colistin therapy.

Science.gov (United States)

Choi, Ik Sung; Lee, Yu Ji; Wi, Yu Mi; Kwan, Byung Soo; Jung, Kae Hwa; Hong, Woong Pyo; Kim, June Myong

2016-08-01

The ratio of the area under the free (unbound) concentration-time curve to minimum inhibitory concentration (fAUC/MIC) was proposed to be the pharmacokinetic/pharmacodynamic index most strongly linked to the antibacterial effect of colistin against Acinetobacter baumannii. A retrospective study of patients who received colistin to treat pneumonia caused by extensively drug-resistant (XDR) A. baumannii over a 4-year period was performed to assess the impact of the colistin MIC on mortality. A total of 227 patients were included in the analysis. The 7-day and 14-day mortality rates of patients with XDR A. baumannii pneumonia receiving colistin therapy were 15.0% and 23.8%, respectively. In the multivariate analysis, Acute Physiology and Chronic Health Evaluation (APACHE) II score, days from index culture to first dose of colistin, underlying tumour and septic shock at presentation were independent predictors of mortality in patients with XDR A. baumannii pneumonia receiving colistin therapy. In the univariate analysis, the colistin dose based on ideal body weight (IBW) correlated with patient outcome. Therefore, the use of IBW appeared to be more appropriate to calculate the colistin dosage. In addition, these results highlight the clinical significance of colistin MIC in patients with XDR A. baumannii pneumonia receiving colistin therapy. Although MICs were in the 'susceptible' range, patients infected with isolates with high colistin MICs showed a poorer clinical response rate than patients infected with isolates with low colistin MICs. Further clinical studies are needed to evaluate the roles of colistin MIC for predicting mortality in XDR A. baumannii pneumonia with a high colistin MIC. Copyright © 2016 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.

Chemical and botanical characterization of Chilean propolis and biological activity on cariogenic bacteria Streptococcus mutans and Streptococcus sobrinus

Directory of Open Access Journals (Sweden)

Leticia Barrientos

2013-01-01

Full Text Available Propolis is a non-toxic natural substance with multiple pharmacological properties including anticancer, antioxidant, fungicidal, antibacterial, antiviral, and anti-inflammatory among others. The aim of this study was to determine the chemical and botanical characterization of Chilean propolis samples and to evaluate their biological activity against the cariogenic bacteria Streptococcus mutans and Streptococcus sobrinus. Twenty propolis samples were obtained from beekeeping producers from the central and southern regions of Chile. The botanical profile was determined by palynological analysis. Total phenolic contents were determined using colorimetric assays. Reverse phase HPLC and HPLC-MS were used to determine the chemical composition. The minimum inhibitory concentration (MIC was determined on S. mutans and S. sobrinus. All propolis samples were dominated by structures from native plant species. The characterization by HPLC/MS, evidenced the presence of quercetin, myricetin, kaempferol, rutine, pinocembrin, coumaric acid, caffeic acid and caffeic acid phenethyl ester, that have already been described in these propolis with conventional HPLC. Although all propolis samples inhibited the mutans streptococci growth, it was observed a wide spectrum of action (MIC 0.90 to 8.22 µgmL-1. Given that results it becomes increasingly evident the need of standardization procedures, where we combine both the determination of botanical and the chemical characterization of the extracts. Research conducted to date, describes a promising effectiveness of propolis in the prevention of caries and other diseases of the oral cavity, making it necessary to develop studies to identify and understand the therapeutic targets or mechanisms of molecular action of the various compounds present on them.

Chemical and botanical characterization of Chilean propolis and biological activity on cariogenic bacteria Streptococcus mutans and Streptococcus sobrinus.

Science.gov (United States)

Barrientos, Leticia; Herrera, Christian L; Montenegro, Gloria; Ortega, Ximena; Veloz, Jorge; Alvear, Marysol; Cuevas, Alejandro; Saavedra, Nicolás; Salazar, Luis A

2013-01-01

Propolis is a non-toxic natural substance with multiple pharmacological properties including anti-cancer, antioxidant, fungicidal, antibacterial, antiviral, and anti-inflammatory among others. The aim of this study was to determine the chemical and botanical characterization of Chilean propolis samples and to evaluate their biological activity against the cariogenic bacteria Streptococcus mutans and Streptococcus sobrinus. Twenty propolis samples were obtained from beekeeping producers from the central and southern regions of Chile. The botanical profile was determined by palynological analysis. Total phenolic contents were determined using colorimetric assays. Reverse phase HPLC and HPLC-MS were used to determine the chemical composition. The minimum inhibitory concentration (MIC) was determined on S. mutans and S. sobrinus. All propolis samples were dominated by structures from native plant species. The characterization by HPLC/MS, evidenced the presence of quercetin, myricetin, kaempferol, rutine, pinocembrin, coumaric acid, caffeic acid and caffeic acid phenethyl ester, that have already been described in these propolis with conventional HPLC. Although all propolis samples inhibited the mutans streptococci growth, it was observed a wide spectrum of action (MIC 0.90 to 8.22 μg mL(-1)). Given that results it becomes increasingly evident the need of standardization procedures, where we combine both the determination of botanical and the chemical characterization of the extracts. Research conducted to date, describes a promising effectiveness of propolis in the prevention of caries and other diseases of the oral cavity, making it necessary to develop studies to identify and understand the therapeutic targets or mechanisms of molecular action of the various compounds present on them.

Stress-triggered signaling affecting survival or suicide of Streptococcus pneumoniae.

Science.gov (United States)

Cortes, Paulo R; Piñas, Germán E; Cian, Melina B; Yandar, Nubia; Echenique, Jose

2015-01-01

Streptococcus pneumoniae is a major human pathogen that can survive to stress conditions, such as the acidic environment of inflammatory foci, and tolerates lethal pH through a mechanism known as the acid tolerance response. We previously described that S. pneumoniae activates acidic-stress induced lysis in response to acidified environments, favoring the release of cell wall compounds, DNA and virulence factors. Here, we demonstrate that F(0)F(1)-ATPase is involved in the response to acidic stress. Chemical inhibitors (DCCD, optochin) of this proton pump repressed the ATR induction, but caused an increased ASIL. Confirming these findings, mutants of the subunit c of this enzyme showed the same phenotypes as inhibitors. Importantly, we demonstrated that F(0)F(1)-ATPase and ATR are necessary for the intracellular survival of the pneumococcus in macrophages. Alternatively, a screening of two-component system (TCS) mutants showed that ATR and survival in pneumocytes were controlled in contrasting ways by ComDE and CiaRH, which had been involved in the ASIL mechanism. Briefly, CiaRH was essential for ATR (ComE represses activation) whereas ComE was necessary for ASIL (CiaRH protects against induction). They did not regulate F0F1-ATPase expression, but control LytA expression on the pneumococcal surface. These results suggest that both TCSs and F(0)F(1)-ATPase control a stress response and decide between a survival or a suicide mechanism by independent pathways, either in vitro or in pneumocyte cultures. This biological model contributes to the current knowledge about bacterial response under stress conditions in host tissues, where pathogens need to survive in order to establish infections. Copyright © 2014 Elsevier GmbH. All rights reserved.

Streptococcus pneumoniae Coinfection Is Correlated with the Severity of H1N1 Pandemic Influenza

Science.gov (United States)

Cisterna, Daniel; Savji, Nazir; Bussetti, Ana Valeria; Kapoor, Vishal; Hui, Jeffrey; Tokarz, Rafal; Briese, Thomas; Baumeister, Elsa; Lipkin, W. Ian

2009-01-01

Background Initial reports in May 2009 of the novel influenza strain H1N1pdm estimated a case fatality rate (CFR) of 0.6%, similar to that of seasonal influenza. In July 2009, however, Argentina reported 3056 cases with 137 deaths, representing a CFR of 4.5%. Potential explanations for increased CFR included virus reassortment or genetic drift, or infection of a more vulnerable population. Virus genomic sequencing of 26 Argentinian samples representing both severe and mild disease indicated no evidence of reassortment, mutations associated with resistance to antiviral drugs, or genetic drift that might contribute to virulence. Furthermore, no evidence was found for increased frequency of risk factors for H1N1pdm disease. Methods/Principal Findings We examined nasopharyngeal swab samples (NPS) from 199 cases of H1N1pdm infection from Argentina with MassTag PCR, testing for 33 additional microbial agents. The study population consisted of 199 H1N1pdm-infected subjects sampled between 23 June and 4 July 2009. Thirty-nine had severe disease defined as death (n = 20) or hospitalization (n = 19); 160 had mild disease. At least one additional agent of potential pathogenic importance was identified in 152 samples (76%), including Streptococcus pneumoniae (n = 62); Haemophilus influenzae (n = 104); human respiratory syncytial virus A (n = 11) and B (n = 1); human rhinovirus A (n = 1) and B (n = 4); human coronaviruses 229E (n = 1) and OC43 (n = 2); Klebsiella pneumoniae (n = 2); Acinetobacter baumannii (n = 2); Serratia marcescens (n = 1); and Staphylococcus aureus (n = 35) and methicillin-resistant S. aureus (MRSA, n = 6). The presence of S. pneumoniae was strongly correlated with severe disease. S. pneumoniae was present in 56.4% of severe cases versus 25% of mild cases; more than one-third of H1N1pdm NPS with S. pneumoniae were from subjects with severe disease (22 of 62 S. pneumoniae-positive NPS, p = 0

Prophage spontaneous activation promotes DNA release enhancing biofilm formation in Streptococcus pneumoniae.

Directory of Open Access Journals (Sweden)

Margarida Carrolo

Full Text Available Streptococcus pneumoniae (pneumococcus is able to form biofilms in vivo and previous studies propose that pneumococcal biofilms play a relevant role both in colonization and infection. Additionally, pneumococci recovered from human infections are characterized by a high prevalence of lysogenic bacteriophages (phages residing quiescently in their host chromosome. We investigated a possible link between lysogeny and biofilm formation. Considering that extracellular DNA (eDNA is a key factor in the biofilm matrix, we reasoned that prophage spontaneous activation with the consequent bacterial host lysis could provide a source of eDNA, enhancing pneumococcal biofilm development. Monitoring biofilm growth of lysogenic and non-lysogenic pneumococcal strains indicated that phage-infected bacteria are more proficient at forming biofilms, that is their biofilms are characterized by a higher biomass and cell viability. The presence of phage particles throughout the lysogenic strains biofilm development implicated prophage spontaneous induction in this effect. Analysis of lysogens deficient for phage lysin and the bacterial major autolysin revealed that the absence of either lytic activity impaired biofilm development and the addition of DNA restored the ability of mutant strains to form robust biofilms. These findings establish that limited phage-mediated host lysis of a fraction of the bacterial population, due to spontaneous phage induction, constitutes an important source of eDNA for the S. pneumoniae biofilm matrix and that this localized release of eDNA favors biofilm formation by the remaining bacterial population.

Meningitis caused by Neisseria Meningitidis, Hemophilus Influenzae Type B and Streptococcus Pneumoniae during 2005–2012 in Turkey

Science.gov (United States)

Ceyhan, Mehmet; Gürler, Nezahat; Ozsurekci, Yasemin; Keser, Melike; Aycan, Ahmet Emre; Gurbuz, Venhar; Salman, Nuran; Camcioglu, Yildiz; Dinleyici, Ener Cagri; Ozkan, Sengul; Sensoy, Gulnar; Belet, Nursen; Alhan, Emre; Hacimustafaoglu, Mustafa; Celebi, Solmaz; Uzun, Hakan; Faik Oner, Ahmet; Kurugol, Zafer; Ali Tas, Mehmet; Aygun, Denizmen; Oncel, Eda Karadag; Celik, Melda; Yasa, Olcay; Akin, Fatih; Coşkun, Yavuz

2014-01-01

Successful vaccination policies for protection from bacterial meningitis are dependent on determination of the etiology of bacterial meningitis. Cerebrospinal fluid (CSF) samples were obtained prospectively from children from 1 month to ≤ 18 years of age hospitalized with suspected meningitis, in order to determine the etiology of meningitis in Turkey. DNA evidence of Neisseria meningitidis (N. meningitidis), Streptococcus pneumoniae (S. pneumoniae), and Hemophilus influenzae type b (Hib) was detected using multiplex polymerase chain reaction (PCR). In total, 1452 CSF samples were evaluated and bacterial etiology was determined in 645 (44.4%) cases between 2005 and 2012; N. meningitidis was detected in 333 (51.6%), S. pneumoniae in 195 (30.2%), and Hib in 117 (18.1%) of the PCR positive samples. Of the 333 N. meningitidis positive samples 127 (38.1%) were identified as serogroup W-135, 87 (26.1%) serogroup B, 28 (8.4%) serogroup A and 3 (0.9%) serogroup Y; 88 (26.4%) were non-groupable. As vaccines against the most frequent bacterial isolates in this study are available and licensed, these results highlight the need for broad based protection against meningococcal disease in Turkey. PMID:25483487

Crystallization and preliminary crystallographic analysis of the transpeptidase domain of penicillin-binding protein 2B from Streptococcus pneumoniae

Energy Technology Data Exchange (ETDEWEB)

Yamada, Mototsugu, E-mail: mototsugu-yamada@meiji.co.jp; Watanabe, Takashi; Baba, Nobuyoshi; Miyara, Takako; Saito, Jun; Takeuchi, Yasuo [Pharmaceutical Research Center, Meiji Seika Kaisha Ltd, 760 Morooka-cho, Kohoku-ku, Yokohama 222-8567 (Japan)

2008-04-01

The selenomethionyl-substituted transpeptidase domain of penicillin-binding protein (PBP) 2B from S. pneumoniae was isolated from a limited proteolysis digest of the soluble form of recombinant PBP 2B and then crystallized. MAD data were collected to 2.4 Å resolution. Penicillin-binding protein (PBP) 2B from Streptococcus pneumoniae catalyzes the cross-linking of peptidoglycan precursors that occurs during bacterial cell-wall biosynthesis. A selenomethionyl (SeMet) substituted PBP 2B transpeptidase domain was isolated from a limited proteolysis digest of a soluble form of recombinant PBP 2B and then crystallized. The crystals belonged to space group P4{sub 3}2{sub 1}2, with unit-cell parameters a = b = 86.39, c = 143.27 Å. Diffraction data were collected to 2.4 Å resolution using the BL32B2 beamline at SPring-8. The asymmetric unit contains one protein molecule and 63.7% solvent.

Crystallization and preliminary crystallographic analysis of the transpeptidase domain of penicillin-binding protein 2B from Streptococcus pneumoniae

International Nuclear Information System (INIS)

Yamada, Mototsugu; Watanabe, Takashi; Baba, Nobuyoshi; Miyara, Takako; Saito, Jun; Takeuchi, Yasuo

2008-01-01

The selenomethionyl-substituted transpeptidase domain of penicillin-binding protein (PBP) 2B from S. pneumoniae was isolated from a limited proteolysis digest of the soluble form of recombinant PBP 2B and then crystallized. MAD data were collected to 2.4 Å resolution. Penicillin-binding protein (PBP) 2B from Streptococcus pneumoniae catalyzes the cross-linking of peptidoglycan precursors that occurs during bacterial cell-wall biosynthesis. A selenomethionyl (SeMet) substituted PBP 2B transpeptidase domain was isolated from a limited proteolysis digest of a soluble form of recombinant PBP 2B and then crystallized. The crystals belonged to space group P4 3 2 1 2, with unit-cell parameters a = b = 86.39, c = 143.27 Å. Diffraction data were collected to 2.4 Å resolution using the BL32B2 beamline at SPring-8. The asymmetric unit contains one protein molecule and 63.7% solvent

Differential recognition and hydrolysis of host carbohydrate antigens by Streptococcus pneumoniae family 98 glycoside hydrolases.

Science.gov (United States)

Higgins, Melanie A; Whitworth, Garrett E; El Warry, Nahida; Randriantsoa, Mialy; Samain, Eric; Burke, Robert D; Vocadlo, David J; Boraston, Alisdair B

2009-09-18

The presence of a fucose utilization operon in the Streptococcus pneumoniae genome and its established importance in virulence indicates a reliance of this bacterium on the harvesting of host fucose-containing glycans. The identities of these glycans, however, and how they are harvested is presently unknown. The biochemical and high resolution x-ray crystallographic analysis of two family 98 glycoside hydrolases (GH98s) from distinctive forms of the fucose utilization operon that originate from different S. pneumoniae strains reveal that one enzyme, the predominant type among pneumococcal isolates, has a unique endo-beta-galactosidase activity on the LewisY antigen. Altered active site topography in the other species of GH98 enzyme tune its endo-beta-galactosidase activity to the blood group A and B antigens. Despite their different specificities, these enzymes, and by extension all family 98 glycoside hydrolases, use an inverting catalytic mechanism. Many bacterial and viral pathogens exploit host carbohydrate antigens for adherence as a precursor to colonization or infection. However, this is the first evidence of bacterial endoglycosidase enzymes that are known to play a role in virulence and are specific for distinct host carbohydrate antigens. The strain-specific distribution of two distinct types of GH98 enzymes further suggests that S. pneumoniae strains may specialize to exploit host-specific antigens that vary from host to host, a factor that may feature in whether a strain is capable of colonizing a host or establishing an invasive infection.

Mechanisms and impact of genetic recombination in the evolution of Streptococcus pneumoniae.

Science.gov (United States)

Chaguza, Chrispin; Cornick, Jennifer E; Everett, Dean B

2015-01-01

Streptococcus pneumoniae (the pneumococcus) is a highly recombinogenic bacterium responsible for a high burden of human disease globally. Genetic recombination, a process in which exogenous DNA is acquired and incorporated into its genome, is a key evolutionary mechanism employed by the pneumococcus to rapidly adapt to selective pressures. The rate at which the pneumococcus acquires genetic variation through recombination is much higher than the rate at which the organism acquires variation through spontaneous mutations. This higher rate of variation allows the pneumococcus to circumvent the host innate and adaptive immune responses, escape clinical interventions, including antibiotic therapy and vaccine introduction. The rapid influx of whole genome sequence (WGS) data and the advent of novel analysis methods and powerful computational tools for population genetics and evolution studies has transformed our understanding of how genetic recombination drives pneumococcal adaptation and evolution. Here we discuss how genetic recombination has impacted upon the evolution of the pneumococcus.

Measuring coverage in MNCH: a prospective validation study in Pakistan and Bangladesh on measuring correct treatment of childhood pneumonia.

Directory of Open Access Journals (Sweden)

Tabish Hazir

Full Text Available Antibiotic treatment for pneumonia as measured by Demographic and Health Surveys (DHS and Multiple Indicator Cluster Surveys (MICS is a key indicator for tracking progress in achieving Millennium Development Goal 4. Concerns about the validity of this indicator led us to perform an evaluation in urban and rural settings in Pakistan and Bangladesh.Caregivers of 950 children under 5 y with pneumonia and 980 with "no pneumonia" were identified in urban and rural settings and allocated for DHS/MICS questions 2 or 4 wk later. Study physicians assigned a diagnosis of pneumonia as reference standard; the predictive ability of DHS/MICS questions and additional measurement tools to identify pneumonia versus non-pneumonia cases was evaluated. Results at both sites showed suboptimal discriminative power, with no difference between 2- or 4-wk recall. Individual patterns of sensitivity and specificity varied substantially across study sites (sensitivity 66.9% and 45.5%, and specificity 68.8% and 69.5%, for DHS in Pakistan and Bangladesh, respectively. Prescribed antibiotics for pneumonia were correctly recalled by about two-thirds of caregivers using DHS questions, increasing to 72% and 82% in Pakistan and Bangladesh, respectively, using a drug chart and detailed enquiry.Monitoring antibiotic treatment of pneumonia is essential for national and global programs. Current (DHS/MICS questions and proposed new (video and pneumonia score methods of identifying pneumonia based on maternal recall discriminate poorly between pneumonia and children with cough. Furthermore, these methods have a low yield to identify children who have true pneumonia. Reported antibiotic treatment rates among these children are therefore not a valid proxy indicator of pneumonia treatment rates. These results have important implications for program monitoring and suggest that data in its current format from DHS/MICS surveys should not be used for the purpose of monitoring antibiotic

Penicillin-Resistant trend of Streptococcus pneumoniae in Asia: A systematic review.

Science.gov (United States)

Mamishi, Setareh; Moradkhani, Sepideh; Mahmoudi, Shima; Hosseinpour-Sadeghi, Reihaneh; Pourakbari, Babak

2014-08-01

The high prevalence of resistance to penicillin by Streptococcus pneumoniaeis considered as a great concern, particularly in Asian countries. The aim of this study was to investigate the changing trend of penicillin-resistant S. pneumoniae (PRSP) in Asia over a 20 years period. A review of the literature was conducted using the PubMed database, Google Scholar, Scopus, two Persian scientific search engines "Scientific Information Database" (www.sid.ir), and "Mag Iran" (www.magiran.com) through 1993 to 2013. Our study provides a unique chance to investigate the changing trend in PSSP in Asia over a 20 years period. Susceptibility rates among different centers in each country varied widely. In Malaysia, the PSSP rate decreased from 97.2% in 1995-1996 to 69% in 2000. In Singapore, PSSP levels decreased from 72.6% in 1997 to 30.5% in 2007-2008. In Iran, PSSP ranged from 0% to 100%. In Taiwan, the rate of PSSP was 60.3% in 1995 and countries such as Vietnam, Singapore, Philippines, Pakistan, Nepal, Kuwait, Korea and Indonesia.

Meningoencephalitis caused by Streptococcus pneumoniae: a diagnostic and therapeutic challenge. Diagnosis with diffusion-weighted MRI leading to treatment with corticosteroids

International Nuclear Information System (INIS)

Jorens, Philippe G.; Demey, Hendrik E.; Parizel, Paul M.; Smets, Katrien; Jadoul, Kris; Verbeek, M.M.; Wevers, R.A.; Cras, Patrick

2005-01-01

Streptococcus pneumoniae is a common cause of bacterial meningitis but only rarely causes other infections such as brain abscess, encephalitis, encephalomyelitis or meningoencephalitis. We report on three adult patients with meningoencephalitis caused by S. pneumoniae. In all three, CT and MRI revealed widespread brain lesions, suggesting extensive parenchymal injury. Diffusion-weighted MRI showed lesions with restricted diffusion, reflecting local areas of ischaemia with cytotoxic oedema secondary to an immunologically mediated necrotising vasculitis and thrombosis. High levels of markers of neuronal, glial and myelin damage were found in the cerebrospinal fluid. According to the literature, brain parenchyma lesions in adults with pneumococcal meningoencephalitis are often associated with death or severe neurological deficit. Our patients were treated with pulse doses of glucocorticoids: this resulted in dramatic clinical improvement and an excellent final neurological recovery. (orig.)

Meningoencephalitis caused by Streptococcus pneumoniae: a diagnostic and therapeutic challenge. Diagnosis with diffusion-weighted MRI leading to treatment with corticosteroids

Energy Technology Data Exchange (ETDEWEB)

Jorens, Philippe G.; Demey, Hendrik E. [University Hospital of Antwerp, UZA, Department of Intensive Care Medicine, Edegem (Belgium); Parizel, Paul M. [University of Antwerp, Department of Radiology, Edegem (Belgium); Smets, Katrien [University of Antwerp, Department of Neurology, Edegem (Belgium); General Hospital AZ Middelares, Department of Neurology, Sint-Niklaas (Belgium); Jadoul, Kris [General Hospital AZ Middelares, Department of Neurology, Sint-Niklaas (Belgium); Verbeek, M.M.; Wevers, R.A. [University Hospital of Nijmegen, Laboratory of Paediatrics and Neurology, Nijmegen (Netherlands); Cras, Patrick [University of Antwerp, Department of Neurology, Edegem (Belgium)

2005-10-01

Streptococcus pneumoniae is a common cause of bacterial meningitis but only rarely causes other infections such as brain abscess, encephalitis, encephalomyelitis or meningoencephalitis. We report on three adult patients with meningoencephalitis caused by S. pneumoniae. In all three, CT and MRI revealed widespread brain lesions, suggesting extensive parenchymal injury. Diffusion-weighted MRI showed lesions with restricted diffusion, reflecting local areas of ischaemia with cytotoxic oedema secondary to an immunologically mediated necrotising vasculitis and thrombosis. High levels of markers of neuronal, glial and myelin damage were found in the cerebrospinal fluid. According to the literature, brain parenchyma lesions in adults with pneumococcal meningoencephalitis are often associated with death or severe neurological deficit. Our patients were treated with pulse doses of glucocorticoids: this resulted in dramatic clinical improvement and an excellent final neurological recovery. (orig.)

CT features of legionella pneumonia, compared with streptococcal pneumonia. A collaborative study

International Nuclear Information System (INIS)

Tokuda, Hitoshi; Sakai, Fumikazu; Goto, Hajime

2007-01-01

Legionella pneumophila pneumonia (LPP) is of serious concern for chest physicians for its potential lethality and difficulty of diagnosis. In spite of widespread use of urine antigen detection method, it remains one of the most difficult-to-treat disease among community acquired pneumonia. We investigated CT images of 38 cases of LPP, comparing them with wide spread Streptococcus pneumoniae pneumonia (SPP). We find that sharply demarcated consolidation scattered in ground-glass opacity is the most striking and pathognomonic feature of LPP, which is rarely found in SPP. Bronchiolitis was not found in LPP, while it is a relatively common finding in SPP, which could be the second clue of differentiation of these two diseases. (author)

The Viriato Study: Update of antimicrobial susceptibility data of bacterial pathogens from community-acquired respiratory tract infections in Portugal in 2003 and 2004

Directory of Open Access Journals (Sweden)

J. Melo-Cristino

2006-01-01

Full Text Available The Viriato Study is a nationwide, prospective, multicenter surveillance study of the antimicrobial susceptibility of bacterial pathogens commonly associated with community-acquired respiratory tract infections in Portugal. In 2003 and 2004 a total of 2945 isolates was recovered in the 29 laboratories that participated in the study. Testing was undertaken in a central laboratory. Of the 513 Streptococcus pyogenes strains isolated from patients with acute tonsillitis all were susceptible to penicillin and other beta-lactams but 18.9% were resistant to erythromycin, clarithromycin and azithromycin. The M phenotype dominated (67%, conferring resistance to erythromycin (MIC90 = 16 mg/L, clarythromycin and azithromycin, but susceptibility to clindamycin (MIC90 = 0.094 mg/L. From patients with lower respiratory tract infection 1,300 strains of Streptococcus pneumoniae, 829 of Haemophilus influenzae, and 303 of Moraxella catarrhalis were studied. Among S. pneumoniae isolates 18.4% were resistant to penicillin (3.5% showing high-level resistance, 7.1% to cefuroxime, 0.5% to amoxicillin and amoxicillin/clavulanate, 18.8% to erythromycin, clarithromycin and azithromycin, 14.9% to tetracycline, 16.5% to co-trimoxazol, and 0.4% to levofloxacin. Beta-lactamases were produced by 10.0% of H. influenzae and 96.4% of M. catarrhalis. In H. influenzae resistance to clarithromycin was 5.5% and to cotrimoxazole was 13.4%. Most strains were susceptible to amoxicillin/clavulanate, cefuroxime, azithromycin, tetracycline and ciprofloxacin. In M. catarrhalis resistance to co-trimoxazole was 27.1% and to tetracycline 1.0%. All strains were susceptible to amoxicillin/clavulanate, cefuroxime, clarithromycin, azithromycin and ciprofloxacin. Penicillin was the most active antimicrobial agent against S. pyogenes and amoxycillin / clavulanate and the quinolones the most active in vitro simultaneously against S. pneumoniae, H. influenza and M. catarrhalis. Resumo: O Estudo

Antibiotic treatment and the diagnosis of Streptococcus pneumoniae in lower respiratory tract infections in adults

DEFF Research Database (Denmark)

Korsgaard, Jens; Møller, Jens Kjølseth; Kilian, Mogens

2005-01-01

OBJECTIVE: To analyze the possible influence of antibiotic treatment on the results of different diagnostic tests for the diagnosis of lower respiratory tract infections with Streptococcus pneumoniae. MATERIAL AND METHODS: A prospective cohort of 159 unselected adult immunocompetent patients...... admitted to Silkeborg County Hospital in Denmark with community-acquired lower respiratory tract infections underwent microbiological investigations with fiber-optic bronchoscopy with bronchoalveolar lavage, blood and sputum culture and urine antigen test for type-specific polysaccharide capsular antigens...... was positive in both systems, making a total of 22 patients with documented pneumococcal infection. As a positive culture test was dependent on the absence of antibiotic treatment, whereas a positive urine antigen test depended on antibiotic treatment within 48 hours, the two tests were complementary...

Extended Spectrum β-Lactamase (ESBL) in Klebsiella Pneumoniae ...

African Journals Online (AJOL)

Pseudomonas aeruginosa, Streptococcus Pneumoniae and Serratia spp. Two of the children died in spite of early use of appropriate antibiotics as determined by antibiotic susceptibility testing. Phenotypic and molecualr investigation showed extended-spectrum β-lactamase (ESBL) producing K. pneumoniae to be ...

Components of Streptococcus pneumoniae suppress allergic airways disease and NKT cells by inducing regulatory T cells.

Science.gov (United States)

Thorburn, Alison N; Foster, Paul S; Gibson, Peter G; Hansbro, Philip M

2012-05-01

Asthma is an allergic airways disease (AAD) caused by dysregulated immune responses and characterized by eosinophilic inflammation, mucus hypersecretion, and airway hyperresponsiveness (AHR). NKT cells have been shown to contribute to AHR in some mouse models. Conversely, regulatory T cells (Tregs) control aberrant immune responses and maintain homeostasis. Recent evidence suggests that Streptococcus pneumoniae induces Tregs that have potential to be harnessed therapeutically for asthma. In this study, mouse models of AAD were used to identify the S. pneumoniae components that have suppressive properties, and the mechanisms underlying suppression were investigated. We tested the suppressive capacity of type-3-polysaccharide (T3P), isolated cell walls, pneumolysoid (Ply) and CpG. When coadministered, T3P + Ply suppressed the development of: eosinophilic inflammation, Th2 cytokine release, mucus hypersecretion, and AHR. Importantly, T3P + Ply also attenuated features of AAD when administered during established disease. We show that NKT cells contributed to the development of AAD and also were suppressed by T3P + Ply treatment. Furthermore, adoptive transfer of NKT cells induced AHR, which also could be reversed by T3P + Ply. T3P + Ply-induced Tregs were essential for the suppression of NKT cells and AAD, which was demonstrated by Treg depletion. Collectively, our results show that the S. pneumoniae components T3P + Ply suppress AAD through the induction of Tregs that blocked the activity of NKT cells. These data suggest that S. pneumoniae components may have potential as a therapeutic strategy for the suppression of allergic asthma through the induction of Tregs and suppression of NKT cells.

Chemical composition and antimicrobial activity of berry essential oil of Juniperus oxycedrus L. (Cupressaceae grown wild in Republic of Macedonia

Directory of Open Access Journals (Sweden)

Floresha Sela

2013-06-01

Full Text Available Chemical composition and antimicrobial activity of essential oil isolated from berries from 2 different samples of Juniperus oxycedrus L. (Cupressaceae, growing wild in Republic of Macedonia was investigated. Performing GC/FID/MS analysis, one hundred components were identified, representing 96.0-98.95% of the oil. The major components were α-pinene (22.54- 27.12%, myrcene (11.26- 15.13% and limonene (2.78-18.06%. Antimicrobial screening of the J. oxycedrus essential oils was made by disc diffusion and broth dilution method against 16 bacterial isolates of Gram positive and Gram negative bacteria and one strain of Candida albicans. The most sensitive bacteria was Haemophilus influenzae (MIC = 125 ml/ml. The essential oils showed moderate antimicrobial activity against Streptococcus pneumoniae, Staphylococcus aureus, Streptococcus agalactiae, Streptococcus pyogenes, Corynebacterium spp., Escherichia coli and Campilobacter jejuni (MIC > 500 ml/ml and no activity against Candida albicans, Staphylococcus epidermidis, Acinetobacter spp., Salmonella enteritidis, Shigella flexnery, Klebsiella pneumonia, Pseudomonas aeruginosa, Enterococcus and Proteus mirabilis.

Clonal relationships among penicillin-susceptible, multiresistant serotype 6B Streptococcus pneumoniae isolates recovered in Greece and France.

Science.gov (United States)

Syrogiannopoulos, G A; Doit, C; Grivea, I N; Geslin, P; Bingen, E

2001-01-01

In January 1996 the emergence of penicillin-susceptible, multiresistant serotype 6B Streptococcus pneumoniae isolates resistant to chloramphenicol, tetracycline, erythromycin, clindamycin and trimethoprim-sulfamethoxazole was observed in young carriers in the city of Patras, located in the southwestern region of Greece. Later, a significant spread of pneumococci with this unusual phenotype was noted in carriers living in various other areas of the country. Using restriction fragment length polymorphism of the ribosomal RNA genes, clonal relationships were found between these Greek strains and serotype 6B penicillin-susceptible, multiresistant pneumococci isolated in France between January 1992 and September 1996. The French and Greek isolates appear to have a common ancestry.

Live Streptococcus pneumoniae, Haemophilus influenzae, and Neisseria meningitidis activate the inflammatory response trhough Toll-like receptors 2, 4, and 9 in species-specific patterns

DEFF Research Database (Denmark)

Mogensen, T.H.; Paludan, Søren Riis; Kilian, Mogens

2006-01-01

activation by live bacteria. Here, we demonstrate that live Streptococcus pneumoniae, Haemophilus influenzae type b, and Neisseria meningitidis, the three principal causes of bacterial meningitis, use distinct sets of TLRs to trigger the inflammatory response. Using human embryonic kidney 293 cell lines......, each overexpressing one type of TLR, we found that S. pneumoniae triggered activation of the transcription factor nuclear factor-kappaB and expression of interleukin-8, only in cells expressing TLR2 or -9. The same response was evoked by H. influenzae in cells expressing TLR2 or -4 and by N...... and confirmed the essential role of these TLRs and also identified differential functions of TLRs in activation of the inflammatory response. Collectively, we here demonstrate that S. pneumoniae, H. influenzae, and N. meningitidis each activate several TLRs in species-specific patterns and show that infection...

Linezolid Surveillance Results for the United States (LEADER Surveillance Program 2014).

Science.gov (United States)

Flamm, Robert K; Mendes, Rodrigo E; Hogan, Patricia A; Streit, Jennifer M; Ross, James E; Jones, Ronald N

2016-04-01

Thelinezolidexperience andaccuratedetermination ofresistance (LEADER) surveillance program has monitored linezolid activity, spectrum, and resistance since 2004. In 2014, a total of 6,865 Gram-positive pathogens from 60 medical centers from 36 states were submitted. The organism groups evaluated wereStaphylococcus aureus(3,106), coagulase-negative staphylococci (CoNS; 797), enterococci (855),Streptococcus pneumoniae(874), viridans group streptococci (359), and beta-hemolytic streptococci (874). Susceptibility testing was performed by reference broth microdilution at the monitoring laboratory. Linezolid-resistant isolates were confirmed by repeat testing. PCR and sequencing were performed to detect mutations in 23S rRNA, L3, L4, and L22 proteins and acquired genes (cfrandoptrA). The MIC50/90forStaphylococcus aureuswas 1/1 μg/ml, with 47.2% of isolates being methicillin-resistantStaphylococcus aureus Linezolid was active against allStreptococcus pneumoniaestrains and beta-hemolytic streptococci with a MIC50/90of 1/1 μg/ml and against viridans group streptococci with a MIC50/90of 0.5/1 μg/ml. Among the linezolid-nonsusceptible MRSA strains, one strain harboredcfronly (MIC, 4 μg/ml), one harbored G2576T (MIC, 8 μg/ml), and one containedcfrand G2576T with L3 changes (MIC, ≥8 μg/ml). Among CoNS, 0.75% (six isolates) of all strains demonstrated linezolid MIC results of ≥4 μg/ml. Five of these were identified asStaphylococcus epidermidis, four of which containedcfrin addition to the presence of mutations in the ribosomal proteins L3 and L4, alone or in combination with 23S rRNA (G2576T) mutations. Six enterococci (0.7%) were linezolid nonsusceptible (≥4 μg/ml; five with G2576T mutations, including one with an additionalcfrgene, and one strain withoptrAonly). Linezolid demonstrated excellent activity and a sustained susceptibility rate of 99.78% overall. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Natural Genetic Transformation Generates a Population of Merodiploids in Streptococcus pneumoniae

Science.gov (United States)

Zomer, Aldert; Bootsma, Hester J.; Prudhomme, Marc; Granadel, Chantal; Hermans, Peter W. M.; Polard, Patrice; Martin, Bernard; Claverys, Jean-Pierre

2013-01-01

Partial duplication of genetic material is prevalent in eukaryotes and provides potential for evolution of new traits. Prokaryotes, which are generally haploid in nature, can evolve new genes by partial chromosome duplication, known as merodiploidy. Little is known about merodiploid formation during genetic exchange processes, although merodiploids have been serendipitously observed in early studies of bacterial transformation. Natural bacterial transformation involves internalization of exogenous donor DNA and its subsequent integration into the recipient genome by homology. It contributes to the remarkable plasticity of the human pathogen Streptococcus pneumoniae through intra and interspecies genetic exchange. We report that lethal cassette transformation produced merodiploids possessing both intact and cassette-inactivated copies of the essential target gene, bordered by repeats (R) corresponding to incomplete copies of IS861. We show that merodiploidy is transiently stimulated by transformation, and only requires uptake of a ∼3-kb DNA fragment partly repeated in the chromosome. We propose and validate a model for merodiploid formation, providing evidence that tandem-duplication (TD) formation involves unequal crossing-over resulting from alternative pairing and interchromatid integration of R. This unequal crossing-over produces a chromosome dimer, resolution of which generates a chromosome with the TD and an abortive chromosome lacking the duplicated region. We document occurrence of TDs ranging from ∼100 to ∼900 kb in size at various chromosomal locations, including by self-transformation (transformation with recipient chromosomal DNA). We show that self-transformation produces a population containing many different merodiploid cells. Merodiploidy provides opportunities for evolution of new genetic traits via alteration of duplicated genes, unrestricted by functional selective pressure. Transient stimulation of a varied population of merodiploids by

Natural genetic transformation generates a population of merodiploids in Streptococcus pneumoniae.

Directory of Open Access Journals (Sweden)

Calum Johnston

Full Text Available Partial duplication of genetic material is prevalent in eukaryotes and provides potential for evolution of new traits. Prokaryotes, which are generally haploid in nature, can evolve new genes by partial chromosome duplication, known as merodiploidy. Little is known about merodiploid formation during genetic exchange processes, although merodiploids have been serendipitously observed in early studies of bacterial transformation. Natural bacterial transformation involves internalization of exogenous donor DNA and its subsequent integration into the recipient genome by homology. It contributes to the remarkable plasticity of the human pathogen Streptococcus pneumoniae through intra and interspecies genetic exchange. We report that lethal cassette transformation produced merodiploids possessing both intact and cassette-inactivated copies of the essential target gene, bordered by repeats (R corresponding to incomplete copies of IS861. We show that merodiploidy is transiently stimulated by transformation, and only requires uptake of a ~3-kb DNA fragment partly repeated in the chromosome. We propose and validate a model for merodiploid formation, providing evidence that tandem-duplication (TD formation involves unequal crossing-over resulting from alternative pairing and interchromatid integration of R. This unequal crossing-over produces a chromosome dimer, resolution of which generates a chromosome with the TD and an abortive chromosome lacking the duplicated region. We document occurrence of TDs ranging from ~100 to ~900 kb in size at various chromosomal locations, including by self-transformation (transformation with recipient chromosomal DNA. We show that self-transformation produces a population containing many different merodiploid cells. Merodiploidy provides opportunities for evolution of new genetic traits via alteration of duplicated genes, unrestricted by functional selective pressure. Transient stimulation of a varied population of

Serum Vancomycin Levels Resulting from Continuous or Intermittent Infusion in Critically Ill Burn Patients With or Without Continuous Renal Replacement Therapy

Science.gov (United States)

2012-12-01

one (0.9%) was Streptococcus mutans , and one (0.9%) was an unidentified Enterococcus species. Organisms having MIC ≥ 2 μg/mL (as measured by the...coagulase-negative Staphylo- coccus, 13 (12.3%) were Enterococcus faecium, five (4.7%) were Enterococcus faecalis, four (3.8%) were Streptococcus ...pneumoniae, two (1.9%) were Strepto- coccus viridans, two (1.9%) were Streptococcus aga- lactiae, two (1.9%) were nonenterococcal Group D Streptococci

Journal of Chemical Sciences | Indian Academy of Sciences

Indian Academy of Sciences (India)

... specifically three Gram-positive bacteria (Streptococcus pneumoniae, Clostridium tetani, Bacillus subtilis), three Gram-negative bacteria (Salmonella typhi, Vibrio cholerae, Escherichia coli) and two fungi (Aspergillus fumigatus, Candida albicans) using broth microdilution MIC (minimum inhibitory concentration) method.

Transport of Streptococcus pneumoniae capsular polysaccharide in MHC Class II tubules.

Directory of Open Access Journals (Sweden)

Tom Li Stephen

2007-03-01

Full Text Available Bacterial capsular polysaccharides are virulence factors and are considered T cell-independent antigens. However, the capsular polysaccharide Sp1 from Streptococcus pneumoniae serotype 1 has been shown to activate CD4(+ T cells in a major histocompatibility complex (MHC class II-dependent manner. The mechanism of carbohydrate presentation to CD4(+ T cells is unknown. We show in live murine dendritic cells (DCs that Sp1 translocates from lysosomal compartments to the plasma membrane in MHCII-positive tubules. Sp1 cell surface presentation results in reduction of self-peptide presentation without alteration of the MHCII self peptide repertoire. In DM-deficient mice, retrograde transport of Sp1/MHCII complexes resulting in T cell-dependent immune responses to the polysaccharide in vitro and in vivo is significantly reduced. The results demonstrate the capacity of a bacterial capsular polysaccharide antigen to use DC tubules as a vehicle for its transport as an MHCII/saccharide complex to the cell surface for the induction of T cell activation. Furthermore, retrograde transport requires the functional role of DM in self peptide-carbohydrate exchange. These observations open new opportunities for the design of vaccines against microbial encapsulated pathogens.

Measuring Coverage in MNCH: A Prospective Validation Study in Pakistan and Bangladesh on Measuring Correct Treatment of Childhood Pneumonia

Science.gov (United States)

el Arifeen, Shams; Khan, Amira M.; Huque, M. Hamidul; Kazmi, Narjis; Roy, Sushmita; Abbasi, Saleem; Rahman, Qazi Sadeq-ur; Theodoratou, Evropi; Khorshed, Mahmuda Shayema; Rahman, Kazi Mizanur; Bari, Sanwarul; Kaiser, M. Mahfuzul Islam; Saha, Samir K.; Ahmed, A. S. M. Nawshad Uddin; Rudan, Igor; Bryce, Jennifer; Qazi, Shamim Ahmad; Campbell, Harry

2013-01-01

Background Antibiotic treatment for pneumonia as measured by Demographic and Health Surveys (DHS) and Multiple Indicator Cluster Surveys (MICS) is a key indicator for tracking progress in achieving Millennium Development Goal 4. Concerns about the validity of this indicator led us to perform an evaluation in urban and rural settings in Pakistan and Bangladesh. Methods and Findings Caregivers of 950 children under 5 y with pneumonia and 980 with “no pneumonia” were identified in urban and rural settings and allocated for DHS/MICS questions 2 or 4 wk later. Study physicians assigned a diagnosis of pneumonia as reference standard; the predictive ability of DHS/MICS questions and additional measurement tools to identify pneumonia versus non-pneumonia cases was evaluated. Results at both sites showed suboptimal discriminative power, with no difference between 2- or 4-wk recall. Individual patterns of sensitivity and specificity varied substantially across study sites (sensitivity 66.9% and 45.5%, and specificity 68.8% and 69.5%, for DHS in Pakistan and Bangladesh, respectively). Prescribed antibiotics for pneumonia were correctly recalled by about two-thirds of caregivers using DHS questions, increasing to 72% and 82% in Pakistan and Bangladesh, respectively, using a drug chart and detailed enquiry. Conclusions Monitoring antibiotic treatment of pneumonia is essential for national and global programs. Current (DHS/MICS questions) and proposed new (video and pneumonia score) methods of identifying pneumonia based on maternal recall discriminate poorly between pneumonia and children with cough. Furthermore, these methods have a low yield to identify children who have true pneumonia. Reported antibiotic treatment rates among these children are therefore not a valid proxy indicator of pneumonia treatment rates. These results have important implications for program monitoring and suggest that data in its current format from DHS/MICS surveys should not be used for the

Streptococcus pneumoniae biofilm formation and dispersion during colonization and disease

Science.gov (United States)

Chao, Yashuan; Marks, Laura R.; Pettigrew, Melinda M.; Hakansson, Anders P.

2015-01-01

Streptococcus pneumoniae (the pneumococcus) is a common colonizer of the human nasopharynx. Despite a low rate of invasive disease, the high prevalence of colonization results in millions of infections and over one million deaths per year, mostly in individuals under the age of 5 and the elderly. Colonizing pneumococci form well-organized biofilm communities in the nasopharyngeal environment, but the specific role of biofilms and their interaction with the host during colonization and disease is not yet clear. Pneumococci in biofilms are highly resistant to antimicrobial agents and this phenotype can be recapitulated when pneumococci are grown on respiratory epithelial cells under conditions found in the nasopharyngeal environment. Pneumococcal biofilms display lower levels of virulence in vivo and provide an optimal environment for increased genetic exchange both in vitro and in vivo, with increased natural transformation seen during co-colonization with multiple strains. Biofilms have also been detected on mucosal surfaces during pneumonia and middle ear infection, although the role of these biofilms in the disease process is debated. Recent studies have shown that changes in the nasopharyngeal environment caused by concomitant virus infection, changes in the microflora, inflammation, or other host assaults trigger active release of pneumococci from biofilms. These dispersed bacteria have distinct phenotypic properties and transcriptional profiles different from both biofilm and broth-grown, planktonic bacteria, resulting in a significantly increased virulence in vivo. In this review we discuss the properties of pneumococcal biofilms, the role of biofilm formation during pneumococcal colonization, including their propensity for increased ability to exchange genetic material, as well as mechanisms involved in transition from asymptomatic biofilm colonization to dissemination and disease of otherwise sterile sites. Greater understanding of pneumococcal biofilm

Trivalent pneumococcal protein recombinant vaccine protects against lethal Streptococcus pneumoniae pneumonia and correlates with phagocytosis by neutrophils during early pathogenesis.

Science.gov (United States)

Xu, Qingfu; Surendran, Naveen; Verhoeven, David; Klapa, Jessica; Ochs, Martina; Pichichero, Michael E

2015-02-18

Due to the fact that current polysaccharide-based pneumococcal vaccines have limited serotype coverage, protein-based vaccine candidates have been sought for over a decade to replace or complement current vaccines. We previously reported that a trivalent Pneumococcal Protein recombinant Vaccine (PPrV), showed protection against pneumonia and sepsis in an infant murine model. Here we investigated immunological correlates of protection of PPrV in the same model. C57BL/6J infant mice were intramuscularly vaccinated at age 1-3 weeks with 3 doses of PPrV, containing pneumococcal histidine triad protein D (PhtD), pneumococcal choline binding protein A (PcpA), and detoxified pneumolysin mutant PlyD1. 3-4 weeks after last vaccination, serum and lung antibody levels to PPrV components were measured, and mice were intranasally challenged with a lethal dose of Streptococcus pneumoniae (Spn) serotype 6A. Lung Spn bacterial burden, number of neutrophils and alveolar macrophages, phagocytosed Spn by granulocytes, and levels of cytokines and chemokines were determined at 6, 12, 24, and 48h after challenge. PPrV vaccination conferred 83% protection against Spn challenge. Vaccinated mice had significantly elevated serum and lung antibody levels to three PPrV components. In the first stage of pathogenesis of Spn induced pneumonia (6-24h after challenge), vaccinated mice had lower Spn bacterial lung burdens and more phagocytosed Spn in the granulocytes. PPrV vaccination led to lower levels of pro-inflammatory cytokines IL-6, IL-1β, and TFN-α, and other cytokines and chemokines (IL-12, IL-17, IFN-γ, MIP-1b, MIP-2 and KC, and G-CSF), presumably due to a lower lung bacterial burden. Trivalent PPrV vaccination results in increased serum and lung antibody levels to the vaccine components, a reduction in Spn induced lethality, enhanced early clearance of Spn in lungs due to more rapid and thorough phagocytosis of Spn by neutrophils, and correspondingly a reduction in lung inflammation

Antimicrobial resistance in Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis and group A beta-haemolytic streptococci in 2002-2003. Results of the multinational GRASP Surveillance Program

DEFF Research Database (Denmark)

Beekmann, Susan E; Heilmann, Kris P; Richter, Sandra S

2005-01-01

A multinational surveillance study, GRASP, was conducted between November 2002 and April 2003 with the aim of assessing rates of antimicrobial resistance among 2656 isolates of Streptococcus pneumoniae, 2486 isolates of group A beta-haemolytic streptococci, 1358 isolates of Haemophilus influenzae...... and 1047 of Moraxella catarrhalis from 20 countries in Europe, eastern Asia and southern Africa. Conspicuous differences between various countries were noted in the S. pneumoniae resistance rates observed for penicillin (0-79.2%) and erythromycin (4-66%), along with other antimicrobials. The percentage...... of MDR strains was above 25% in 8 of the 20 countries studied. Group A streptococcal macrolide resistance rates ranged from 0% to 35% by country, while rates of beta-lactamase production ranged from 0% to 39% for H. influenzae and 80-100% for M. catarrhalis. Antibiotic resistance in S. pneumoniae remains...

Streptococcus pneumoniae bacteraemia due to parotitis in a patient with systemic sclerosis and secondary Sjögren's syndrome.

Science.gov (United States)

Yii, Irene Yuen Lin; Tan, Jamie Bee Xian; Fong, Warren Weng Seng

2016-10-01

Invasive pneumococcal disease is an uncommon and notifiable disease in Singapore. It is often associated with significant morbidity and mortality. We report a rare case of invasive pneumococcal bacteraemia due to parotitis in a patient with systemic sclerosis and secondary Sjögren's syndrome. We also present a retrospective review of Streptococcus pneumoniae bacteraemia cases in Singapore General Hospital from January 2011 to April 2016. A 59-year-old Malay lady with a history of systemic sclerosis with secondary Sjögren's syndrome presented with fever and left parotid gland swelling. Clinical examination revealed poor salivary pooling and left parotid swelling without fluctuance. Ultrasound of the left parotid gland confirmed acute parotitis without evidence of abscess or sialolithiasis. Blood cultures were positive for S. pneumoniae . She was diagnosed to have invasive pneumococcal bacteraemia secondary to acute parotitis, and treated with intravenous benzylpenicillin with clearance of bacteraemia after 3 days. Upon discharge, her antibiotics were changed to intravenous ceftriaxone to facilitate outpatient parenteral antibiotic therapy for another 2 weeks. She responded favourably to antibiotics at follow-up, with no complications from the bacteraemia. A review of the microbiological records of the Singapore General Hospital revealed 116 cases of pneumococcal bacteraemia, most (80.3 %) of which were due to pneumonia. None were due to parotitis. S. pneumoniae parotitis and subsequent bacteraemia is rare. Prompt recognition of the disease and appropriate use of antibiotics are important. This case highlights that close communication between healthcare workers (microbiologist, rheumatologist and infectious disease specialist) is essential in ensuring good clinical outcomes in patients with a potentially fatal disease.

Vaccination for the control of childhood bacterial pneumonia - Haemophilus influenzae type b and pneumococcal vaccines

Directory of Open Access Journals (Sweden)

Diana C Otczyk

2013-01-01

Full Text Available Pneumonia in childhood is endemic in large parts of the world and in particular, in developing countries, as well as in many indigenous communities within developed nations. Haemophilus influenzae type b and Streptococcus pneumoniae conjugate vaccines are currently available against the leading bacterial causes of pneumonia.  The use of the vaccines in both industrialised and developing countries have shown a dramatic reduction in the burden of pneumonia and invasive disease in children.  However, the greatest threat facing pneumococcal conjugate vaccine effectiveness is serotype replacement.  The current vaccines provide serotype-specific, antibody–mediated protection against only a few of the 90+ capsule serotypes.  Therefore, there has been a focus in recent years to rapidly advance technologies that will result in broader disease coverage and more affordable vaccines that can be used in developing countries.  The next generation of pneumococcal vaccines have advanced to clinical trials.

Isolation of Streptococcus tigurinus - a novel member of Streptococcus mitis group from a case of periodontitis.

Science.gov (United States)

Dhotre, Shree V; Mehetre, Gajanan T; Dharne, Mahesh S; Suryawanshi, Namdev M; Nagoba, Basavraj S

2014-08-01

Streptococcus tigurinus is a new member of the Streptococcus viridians group and is closely related to Streptococcus mitis, Streptococcus pneumoniae, Streptococcus pseudopneumoniae, Streptococcus oralis, and Streptococcus infantis. The type strain AZ_3a(T) of S. tigurinus was originally isolated from a patient with infective endocarditis. Accurate identification of S. tigurinus is facilitated only by newer molecular methods like 16S rRNA gene analysis. During the course of study on bacteraemia and infective endocarditis with reference to periodontitis and viridians group of streptococci, a strain of S. tigurinus isolated from subgingival plaque of a patient with periodontitis identified by 16S rRNA gene analysis, which was originally identified as Streptococcus pluranimalium by Vitek 2. Confirmation by 16S rRNA gene analysis showed 99.39% similarity (1476/1485 bp) with S. tigurinus AZ_3a(T) (AORU01000002). To the best of our knowledge, this is the first report of isolation of S. tigurinus from the oral cavity of a periodontitis patient. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

Características laboratoriais das ceratites e conjuntivites causadas por Streptococcus sp Laboratorial findings of Streptococcus keratitis and conjunctivitis

Directory of Open Access Journals (Sweden)

Helena Parente Solari

2004-10-01

Full Text Available OBJETIVOS: Analisar os resultados laboratoriais de conjuntivites e ceratites com cultura positiva para Streptococcus sp, avaliando a incidência das diferentes espécies e os dados dos antibiogramas. MÉTODOS: Estudo retrospectivo de revisão de prontuários de pacientes encaminhados ao laboratório de Doenças Externas do Departamento de Oftalmologia da UNIFESP com resultado de cultivo bacteriano positivo de córnea ou conjuntiva e com identificação de alguma cepa do gênero Streptococcus sp, no período de janeiro de 1995 a dezembro de 2001. Analisou-se idade do paciente, espécie de Streptococcus e os testes de sensibilidade aos seguintes antibióticos: cefalotina, amicacina, gentamicina, tobramicina, ciprofloxacina, lomefloxacina, ofloxacina, norfloxacina e vancomicina. RESULTADOS: As espécies mais encontradas foram Streptococcus pneumoniae e Streptococcus viridans. Com relação aos antibióticos, a sensibilidade foi maior à cefalotina, às quinolonas e à vancomicina. CONCLUSÕES: Considerando-se os antibióticos tópicos comercialmente disponíveis, as quinolonas apresentam melhor espectro de ação quando comparadas aos aminoglicosídios.PURPOSE: To evaluate laboratorial findings of Streptococcus keratitis and conjunctivitis, analyzing the different species and the results of bacterial susceptibility to an antibiotics. METHODS: Retrospective study of the records from the External Disease Laboratory of the Ophthalmology Department of the Federal University of São Paulo, with conjunctival or corneal positive bacterial culture for Streptococcus sp, between January 1995 and December 2001. The collected data were age, Streptococcus species and the bacterial susceptibility to the following antibiotics: cephalotin, amikacin, gentamicin, tobramicin, ciprofloxacin, lomefloxacin, ofloxacin, norfloxacin and vancomicin. RESULTS: The most frequent species were Streptococcus pneumoniae and Streptococcus viridans. Regarding bacterial

In vitro activity of the siderophore monosulfactam BAL30072 against contemporary Gram-negative pathogens from New York City, including multidrug-resistant isolates.

Science.gov (United States)

Landman, David; Singh, Manisha; El-Imad, Badiaa; Miller, Ezra; Win, Thida; Quale, John

2014-06-01

The in vitro activity of BAL30072 was assessed against clinical isolates from NYC hospitals, including isolates from a citywide surveillance study and a collection of isolates with well-characterised resistance mechanisms. BAL30072 was the most active β-lactam against Pseudomonas aeruginosa (MIC50/90, 0.25/1 μg/mL), Acinetobacter baumannii (MIC50/90, 4/>64 μg/mL) and KPC-possessing Klebsiella pneumoniae (MIC50/90, 4/>64 μg/mL). Combining BAL30072 with meropenem resulted in a ≥ 4-fold decrease in the BAL30072 MIC90 both for A. baumannii and K. pneumoniae. For isolates with a BAL30072 MIC>4 μg/mL, addition of a sub-MIC concentration of colistin resulted in a four-fold decrease in the BAL30072 MIC in 44% of P. aeruginosa, 82% of A. baumannii and 23% of K. pneumoniae. Using sub-MIC concentrations, BAL30072 plus colistin was bactericidal against 4 of 11 isolates in time-kill studies. BAL30072 MICs were frequently lower for P. aeruginosa and K. pneumoniae when tested using Mueller-Hinton agar versus Iso-Sensitest agar or Mueller-Hinton broth. Against the well-characterised isolates, reduced susceptibility to BAL30072 correlated with mexA and mexX expression (P. aeruginosa), adeB expression (A. baumannii) and presence of SHV-type ESBLs (A. baumannii and K. pneumoniae). BAL30072 shows promising activity against contemporary Gram-negatives, including MDR P. aeruginosa, A. baumannii and K. pneumoniae. Enhanced activity was often present when BAL30072 was combined with meropenem or colistin. BAL30072 MICs were influenced by the testing method, particularly for P. aeruginosa and K. pneumoniae. Further in vivo studies are warranted to determine the potential clinical utility of BAL30072 alone and combined with other agents. Copyright © 2014 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

Competence in Streptococcus pneumoniae is regulated by the rate of ribosomal decoding errors.

Science.gov (United States)

Stevens, Kathleen E; Chang, Diana; Zwack, Erin E; Sebert, Michael E

2011-01-01

Competence for genetic transformation in Streptococcus pneumoniae develops in response to accumulation of a secreted peptide pheromone and was one of the initial examples of bacterial quorum sensing. Activation of this signaling system induces not only expression of the proteins required for transformation but also the production of cellular chaperones and proteases. We have shown here that activity of this pathway is sensitively responsive to changes in the accuracy of protein synthesis that are triggered by either mutations in ribosomal proteins or exposure to antibiotics. Increasing the error rate during ribosomal decoding promoted competence, while reducing the error rate below the baseline level repressed the development of both spontaneous and antibiotic-induced competence. This pattern of regulation was promoted by the bacterial HtrA serine protease. Analysis of strains with the htrA (S234A) catalytic site mutation showed that the proteolytic activity of HtrA selectively repressed competence when translational fidelity was high but not when accuracy was low. These findings redefine the pneumococcal competence pathway as a response to errors during protein synthesis. This response has the capacity to address the immediate challenge of misfolded proteins through production of chaperones and proteases and may also be able to address, through genetic exchange, upstream coding errors that cause intrinsic protein folding defects. The competence pathway may thereby represent a strategy for dealing with lesions that impair proper protein coding and for maintaining the coding integrity of the genome. The signaling pathway that governs competence in the human respiratory tract pathogen Streptococcus pneumoniae regulates both genetic transformation and the production of cellular chaperones and proteases. The current study shows that this pathway is sensitively controlled in response to changes in the accuracy of protein synthesis. Increasing the error rate during

Cloning, recombinant production, crystallization and preliminary X-ray diffraction analysis of a family 101 glycoside hydrolase from Streptococcus pneumoniae

International Nuclear Information System (INIS)

Gregg, Katie J.; Boraston, Alisdair B.

2009-01-01

The catalytic module of a family 101 glycoside hydrolase from S. pneumoniae was cloned, recombinantly produced and crystallized. Streptococcus pneumoniae is a serious human pathogen that is responsible for a wide range of diseases including pneumonia, meningitis, septicaemia and otitis media. The full virulence of this bacterium is reliant on carbohydrate processing and metabolism, as revealed by biochemical and genetic studies. One carbohydrate-processing enzyme is a family 101 glycoside hydrolase (SpGH101) that is responsible for catalyzing the liberation of galactosyl β1,3-N-acetyl-d-galactosamine (Galβ1,3GalNAc) α-linked to serine or threonine residues of mucin-type glycoproteins. The 124 kDa catalytic module of this enzyme (SpGH101CM) was cloned and overproduced in Escherichia coli and purified. Crystals were obtained in space group P2 1 and diffracted to 2.0 Å resolution, with unit-cell parameters a = 81.86, b = 88.91, c = 88.77 Å, β = 112.46°. SpGH101CM also qualitatively displayed good activity towards the synthetic substrate p-nitrophenyl-2-acetamido-2-deoxy-3-O-(β-d-galactopyranosyl) -α-d-galactopyranoside, which is consistent with the classification of this enzyme as an endo-α-N-acetylgalactosaminidase

Evaluación de un medio para la conservación de Streptococcus pneumoniae a partir de muestras nasofaríngeas

Directory of Open Access Journals (Sweden)

Nacxiry Fonseca

2000-09-01

Full Text Available La Organización Mundial de la Salud (OMS llegó a un consenso. en 1998, acerca de la metodologia general para el estudio de portadores de Streptococcus pneumoniae Esta metodología incluía un nuevo medio para el transporte y el almacenamiento de muestras nasofaringeas, compuesto portriptona, glucosa, glicerol y leche descremada, denominado STGG. Este medio fue evaluado oor nuestro laboratorio, en marzo de 1999. en un grupo de 15 niños menores de 5 años asistentes a una guarderia de Bogotá. Se les tomó una muestia nasofaringea que se colocó en el medio STGG y, posteriormente, se valoró el crecimiento de S. pneumoniae en cuatro momentos diferentes: 0, 5 , 10 y 30 días después de la toma de la muestra. La recuperación inicial de S. pneumoniae fue de 73% (11/15. En todas las 11 muestras de las que se obtuvo un crecimiento inicial, fue posible recuperar S. pneumoniae en los diferentes tiempos de observación, aún en las muestras con crecimiento en un solo cuadrante. En el tiempo 0 y a los 30 días, 7 de las 11 muestras presentaron un crecimiento de abundante a moderado. Con los datos obtenidos, se logró demostrar que el medio STGG es capaz de mantener, a largo plazo, la viabilidad de S. pneumoniae en muestras nasofaringeas de niños portadores de este microorganismo.

Antibacterial activity of Bixa orellana L. (achiote) against Streptococcus mutans and Streptococcus sanguinis

Institute of Scientific and Technical Information of China (English)

Dyanne Medina-Flores; Gabriela Ulloa-Urizar; Rosella Camere-Colarossi; Stefany Caballero-Garca; Frank Mayta-Tovalino; Juana del Valle-Mendoza

2016-01-01

Objective: To evaluate the cytotoxic and antibacterial effect of Bixa orellana L. (B. orellana) (achiote) methanol extract against Streptococcus mutans (ATCC 25175) (S. mutans) and Streptococcus sanguinis (ATCC 10556) (S. sanguinis). Methods: Two methanol extracts of B. orellana were prepared in vitro, from the seeds and leaves. The antibacterial activity of extracts against S. mutans and S. sanguinis was evaluated using the cup-plate agar diffusion method. The minimum inhibitory concen-tration (MIC) was determined using the microdilution method and the cytotoxic activity was determinated by using the cell line MDCK. Results: A stronger antibacterial effect was observed with the leaves methanolic extract with an inhibition zone of (19.97 ± 1.31) mm against S. mutans and (19.97 ± 1.26) mm against S. sanguinis. The methanolic extract of the seeds had an activity of (15.11 ± 1.03) mm and (16.15 ± 2.15) mm against S. mutans and S. sanguinis, respectively. The MIC of the leaf and the seed extracts against S. sanguinis was 62.5 and 125 mg/mL, respectively, and the MIC of the leaf extract against S. mutans was 62.5 mg/mL, and for the seed extract it was 31.25 mg/mL. The 50%cytotoxic concentration was 366.45 and 325.05 mg/mL for the leaves and seeds extracts, respectively. Conclusions: The experimental findings demonstrated the antibacterial effect of the methanolic extract of B. orellana (achiote) on S. mutans and S. sanguinis. The extract of this plant is cytotoxic at high concentrations.

Susceptibilidad a antimicrobianos en aislamientos de Streptococcus pneumoniae invasor en Colombia

Directory of Open Access Journals (Sweden)

Aura Lucía Leal

1999-03-01

Full Text Available Se realizó un estudio para determinar los patrones de susceptibilidad a los antimicrobianos de los aislamientos de Streptococcus pneumoniae causante de enfermedad invasora diagnosticada en Colombia en niños menores de 5 años entre 1994 y 1996 y para establecer la distribución de los tipos capsulares de los aislamientos resistentes. Se analizaron 324 aislamientos recuperados durante la ejecución del Protocolo Nacional de Serotipificación de S. pneumoniae realizado en Santa Fe de Bogotá, Medellín y Cali, Colombia, entre julio de 1994 y marzo de 1996. Se observó que 119 de todos los aislamientos (36,7% presentaban susceptibilidad disminuida por lo menos a un antimicrobiano, que 39 (12% presentaban susceptibilidad disminuida a la penicilina y que de estos últimos aislamientos, 29 presentaban resistencia intermedia y 10 resistencia alta. Nueve aislamientos (2,8% presentaban resistencia a la ceftriaxona, 80 (24,7% a la combinación de trimetoprima y sulfametoxazol (TMS, 49 (15,1% al cloranfenicol y 31 (9,6% a la eritromicina. Se observó resistencia a dos antimicrobianos en 31 aislamientos (9,6% y multirresistencia en 22 (6,7%. Estos 22 aislamientos mostraron resistencia al TMS. Las asociaciones más frecuentes fueron penicilina, TMS y eritromicina en 5 casos; penicilina, cloranfenicol, TMS y eritromicina en 4; penicilina, ceftriaxona, cloranfenicol y TMS en 3; y penicilina, ceftriaxona, cloranfenicol, TMS y eritromicina en 3 casos. Los serotipos más frecuentes en los aislamientos resistentes a la penicilina fueron: 23F (53,8%, 14 (25,6%, 6B (7,7%, 9V (5,1%, 19F (5,1% y 34 (2,6%. Los serotipos más frecuentes en los aislamientos resistentes a antimicrobianos distintos de la penicilina fueron: 5 (37,5%, 23F (7,5%, 14 (18,8% y 6B (13,8%. Esta diferencia en la distribución de los serotipos fue estadísticamente significativa (P < 0,0001. Los resultados de este estudio indican la necesidad de mantener una vigilancia activa de los patrones de

Phylogenetic analysis of emergent Streptococcus pneumoniae serotype 22F causing invasive pneumococcal disease using whole genome sequencing.

Directory of Open Access Journals (Sweden)

Walter H B Demczuk

Full Text Available Since implementation of the 13-valent polyvalent conjugate vaccine (PCV13 in Canada during 2010, the proportion of PCV13 serotypes causing invasive pneumococcal disease (IPD has declined from 55% (n = 1492 in 2010 to 31% (n = 764 in 2014. A concurrent increase of non-PCV13 serotypes has occurred and 22F has become the most prevalent serotype in Canada increasing from 7% (n = 183 to 11% (n = 283. Core single nucleotide variant phylogenetic analysis was performed on 137 Streptococcus pneumoniae serotype 22F isolates collected across Canada from 2005-2015. Six phylogenetic lineages (n = 117 were identified among a serotype 22F/ST433 clonal complex (CC, including a recently expanding erythromycin-resistant clone. Erythromycin-resistance was observed in 25 isolates possessing ermB, mef or a 23S rRNA A2061G point mutation; 2 penicillin-resistant isolates had recombinant pbp1a, pbp2a and/or pbp2x; 3 tetracycline-resistant isolates contained tetM; and 1 isolate was multidrug-resistant. Virulence factor analysis indicated a high level of homogeneity among the 22F/ST433 clonal complex strains. A group of 6 phylogenetic outlier strains had differing MLST, antimicrobial resistance and molecular profiles suggestive of capsule switching events. While capsule switch events among S. pneumoniae serotype 22F has been observed, increasing prevalence of S. pneumoniae serotype 22F can be attributed to an evolving homogenous clone expanding nationally through local transmission events.

Radiographic features of Mycoplasma pneumoniae pneumonia: differential diagnosis and performance timing

International Nuclear Information System (INIS)

Miyashita, Naoyuki; Sugiu, Tadaaki; Kawai, Yasuhiro; Oda, Keiko; Yamaguchi, Tetsuya; Ouchi, Kazunobu; Kobashi, Yoshihiro; Oka, Mikio

2009-01-01

The Japanese Respiratory Society guidelines propose a differential diagnosis for atypical pneumonia and bacterial pneumonia using a scoring system for the selection of appropriate antibiotic. In order to improve this scoring system, the guidelines are seeking new specific parameter. The purpose of this study was to clarify the pattern of abnormalities with Mycoplasma pneumoniae pneumonia on chest computed tomography (CT) and whether the radiographic findings could distinguish M. pneumoniae pneumonia from Streptococcus pneumoniae pneumonia. A retrospective review was performed of the CT findings of 64 cases and 68 cases where M. pneumoniae and S. pneumoniae, respectively, were the only pathogen identified by the panel of diagnostic tests used. Of the 64 patients with M. pneumoniae pneumonia, bronchial wall thickening was observed most frequently (81%), followed by centrilobular nodules (78%), ground-glass attenuation (78%), and consolidation (61%). Bronchial wall thickening and centrilobular nodules were observed more often in M. pneumoniae patients than in S. pneumoniae patients (p < 0.0001). The presence of bilateral bronchial wall thickening or centrilobular nodules was only seen in patients with M. pneumoniae pneumonia. Using the scoring system of the Japanese Respiratory Society guidelines and chest CT findings, 97% of M. pneumoniae patients were suspected to be M. pneumoniae pneumonia without serology. When comparing the CT findings between early stage and progressed stage in the same patients with severe pneumonia, the radiographic features of early stage M. pneumoniae pneumonia were not observed clearly in the progressed stage. The present results indicate that the diagnosis of M. pneumoniae pneumonia would appear to be reliable when found with a combination of bronchial wall thickening and centrilobular nodules in the CT findings. However, these CT findings are not observed in progressed severe M. pneumoniae pneumonia patients

Measuring coverage in MNCH: challenges in monitoring the proportion of young children with pneumonia who receive antibiotic treatment.

Science.gov (United States)

Campbell, Harry; El Arifeen, Shams; Hazir, Tabish; O'Kelly, James; Bryce, Jennifer; Rudan, Igor; Qazi, Shamim Ahmad

2013-01-01

Pneumonia remains a major cause of child death globally, and improving antibiotic treatment rates is a key control strategy. Progress in improving the global coverage of antibiotic treatment is monitored through large household surveys such as the Demographic and Health Surveys (DHS) and the Multiple Indicator Cluster Surveys (MICS), which estimate antibiotic treatment rates of pneumonia based on two-week recall of pneumonia by caregivers. However, these survey tools identify children with reported symptoms of pneumonia, and because the prevalence of pneumonia over a two-week period in community settings is low, the majority of these children do not have true pneumonia and so do not provide an accurate denominator of pneumonia cases for monitoring antibiotic treatment rates. In this review, we show that the performance of survey tools could be improved by increasing the survey recall period or by improving either overall discriminative power or specificity. However, even at a test specificity of 95% (and a test sensitivity of 80%), the proportion of children with reported symptoms of pneumonia who truly have pneumonia is only 22% (the positive predictive value of the survey tool). Thus, although DHS and MICS survey data on rates of care seeking for children with reported symptoms of pneumonia and other childhood illnesses remain valid and important, DHS and MICS data are not able to give valid estimates of antibiotic treatment rates in children with pneumonia.

Conservative sex and the benefits of transformation in Streptococcus pneumoniae.

Directory of Open Access Journals (Sweden)

Daniel J P Engelmoer

Full Text Available Natural transformation has significant effects on bacterial genome evolution, but the evolutionary factors maintaining this mode of bacterial sex remain uncertain. Transformation is hypothesized to have both positive and negative evolutionary effects on bacteria. It can facilitate adaptation by combining beneficial mutations into a single individual, or reduce the mutational load by exposing deleterious alleles to natural selection. Alternatively, it may expose transformed cells to damaged or otherwise mutated environmental DNA and is energetically expensive. Here, we examine the long-term effects of transformation in the naturally competent species Streptococcus pneumoniae by evolving populations of wild-type and competence-deficient strains in chemostats for 1000 generations. Half of these populations were exposed to periodic mild stress to examine context-dependent benefits of transformation. We find that competence reduces fitness gain under benign conditions; however, these costs are reduced in the presence of periodic stress. Using whole genome re-sequencing, we show that competent populations fix fewer new mutations and that competence prevents the emergence of mutators. Our results show that during evolution in benign conditions competence helps maintain genome stability but is evolutionary costly; however, during periods of stress this same conservativism enables cells to retain fitness in the face of new mutations, showing for the first time that the benefits of transformation are context dependent.

CRH Affects the Phenotypic Expression of Sepsis-Associated Virulence Factors by Streptococcus pneumoniae Serotype 1 In vitro

Directory of Open Access Journals (Sweden)

Colette G. Ngo Ndjom

2017-06-01

Full Text Available Sepsis is a life-threatening health condition caused by infectious pathogens of the respiratory tract, and accounts for 28–50% of annual deaths in the US alone. Current treatment regimen advocates the use of corticosteroids as adjunct treatment with antibiotics, for their broad inhibitory effect on the activity and production of pro-inflammatory mediators. However, despite their use, corticosteroids have not proven to be able to reverse the death incidence among septic patients. We have previously demonstrated the potential for neuroendocrine factors to directly influence Streptococcus pneumoniae virulence, which may in turn mediate disease outcome leading to sepsis and septic shock. The current study investigated the role of Corticotropin-releasing hormone (CRH in mediating key markers of pneumococcal virulence as important phenotypic determinants of sepsis and septic shock risks. In vitro cultures of serotype 1 pneumococcal strain with CRH promoted growth rate, increased capsule thickness and penicillin resistance, as well as induced pneumolysin gene expression. These results thus provide significant insights of CRH–pathogen interactions useful in understanding the underlying mechanisms of neuroendocrine factor's role in the onset of community acquired pneumonias (CAP, sepsis and septic shock.

Antibacterial Effects of Natural Herbal Extracts on Streptococcus mutans: Can They Be Potential Additives in Dentifrices?

Directory of Open Access Journals (Sweden)

Spoorthi Banavar Ravi

2017-01-01

Full Text Available Background. Many plants or herbs exhibit potent antimicrobial activity against various microorganisms. They have no side effects and presumably act against and modulate the factors that are crucial for microbial survival or their activity. Streptococcus mutans is a pioneer bacteria implicated in dental caries. This study aims to evaluate the antimicrobial activity of garlic bulbs, pudina leaves, and mango and eucalyptus twig extracts on Streptococcus mutans by evaluating their zone of inhibition and determining their minimum inhibitory concentration (MIC. Methods. Microbiological assay (well diffusion method to determine zone of inhibition against pure forms of Streptococcus mutans was performed. The antibacterial effects of methanolic extracts of mango twigs, eucalyptus twigs, pudina leaves, and garlic bulbs were studied. Test compounds were further evaluated for their MIC. Results. Extracts derived from mango and eucalyptus twigs showed significant antibacterial effects at test concentrations. Pudina and garlic extracts did not show any significant antibacterial effects at similar concentrations. Upon further evaluation of the 2 positive compounds for their MIC, mango twigs demonstrated more antimicrobial potential than eucalyptus twigs at a lower concentration. Conclusion. Our observations indicated that the mango twig extracts possess higher antibacterial effects against Streptococcus mutans than other compounds at specific test concentration.

A Novel Function for the Streptococcus pneumoniae Aminopeptidase N: Inhibition of T Cell Effector Function through Regulation of TCR Signaling

Directory of Open Access Journals (Sweden)

Lance K. Blevins

2017-11-01

Full Text Available Streptococcus pneumoniae (Spn causes a variety of disease states including fatal bacterial pneumonia. Our previous finding that introduction of Spn into an animal with ongoing influenza virus infection resulted in a CD8+ T cell population with reduced effector function gave rise to the possibility of direct regulation by pneumococcal components. Here, we show that treatment of effector T cells with lysate derived from Spn resulted in inhibition of IFNγ and tumor necrosis factor α production as well as of cytolytic granule release. Spn aminopeptidase N (PepN was identified as the inhibitory bacterial component and surprisingly, this property was independent of the peptidase activity found in this family of proteins. Inhibitory activity was associated with reduced activation of ZAP-70, ERK1/2, c-Jun N-terminal kinase, and p38, demonstrating the ability of PepN to negatively regulate TCR signaling at multiple points in the cascade. These results reveal a novel immune regulatory function for a bacterial aminopeptidase.

Atividade antimicrobiana in vitro de quinupristina/dalfopristina para cocos gram-positivos isolados de cinco centros brasileiros: resultado do estudo de vigilância L-SMART Antimicrobial in vitro activity of quinupristin/dalfopristin against gram-positive cocci isolated from 5 Brazilian centers: results from the local smart (L-SMART surveillance study

Directory of Open Access Journals (Sweden)

Caio Mendes

2002-07-01

Full Text Available Há alguns anos tem-se verificado um aumento progressivo da resistência de alguns cocos gram-positivos a determinados antimicrobianos. Este aumento da resistência tem sido observado principalmente no ambiente hospitalar, e as bactérias mais comumente envolvidas são os Staphylococcus spp. e os Enterococcus spp. Devido a este fato, novos antimicrobianos são avaliados para o tratamento de infecções causadas por estas cepas multirresistentes. A associação quinupristina/dalfopristina (Q/D, também conhecida como Synercid®, é um antibacteriano da classe das estreptograminas, de uso endovenoso, composto por dois derivados semi-sintéticos da pristinamicina. A combinação das estreptograminas B e A na razão de 30:70 tem atividade antimicrobiana voltada para cocos gram--positivos, como Staphylococcus spp., Streptococcus spp., incluindo S. pneumoniae e Enterococcus faecium, sendo o E. faecalis habitualmente resistente. Neste estudo foi avaliada a atividade in vitro de Q/D e outros oito antimicrobianos frente a 631 amostras de cocos gram-positivos isoladas de cinco centros brasileiros, complementadas com outras 20 cepas de E. faecium resistentes à vancomicina, provenientes dos Estados Unidos. Para a avaliação da sensibilidade aos antimicrobianos foi determinada a concentração inibitória mínima (MIC pelo método do Etest (AB Biodisk, Solna, Suécia e as cepas testadas foram: Staphylococcus aureus (n = 267, Staphylococcus coagulase negativo (n = 131, Streptococcus pneumoniae (n = 130, Streptococcus beta-hemolíticos (n = 28, Enterococcus faecalis (n = 44 e E. faecium (n = 51. A Q/D demonstrou excelente atividade contra Staphylococcus spp., independente de serem sensíveis ou resistentes à oxacilina. Para S. pneumoniae, a Q/D apresentou igualmente uma ótima atividade, inclusive para as cepas com resistência intermediária ou total para penicilina. Entre as cepas de E. faecium sensíveis à vancomicina, o MIC90 de Q/D obtido foi de 3µg

Susceptibility to antimicrobial agents among bovine mastitis pathogens isolated from North American dairy cattle, 2002-2010.

Science.gov (United States)

Lindeman, Cynthia J; Portis, Ellen; Johansen, Lacie; Mullins, Lisa M; Stoltman, Gillian A

2013-09-01

Approximately 8,000 isolates of Streptococcus agalactiae, Streptococcus dysgalactiae, Streptococcus uberis, Staphylococcus aureus, and Escherichia coli, isolated by 25 veterinary laboratories across North America between 2002 and 2010, were tested for in vitro susceptibility to beta-lactam, macrolide, and lincosamide drugs. The minimal inhibitory concentrations (MICs) of the beta-lactam drugs remained low against most of the Gram-positive strains tested, and no substantial changes in the MIC distributions were seen over time. Of the beta-lactam antimicrobial agents tested, only ceftiofur showed good in vitro activity against E. coli. The MICs of the macrolides and lincosamides also remained low against Gram-positive mastitis pathogens. While the MIC values given by 50% of isolates (MIC50) for erythromycin and pirlimycin and the streptococci were all low (≤0.5 µg/ml), the MIC values given by 90% of isolates (MIC90) were higher and more variable, but with no apparent increase over time. Staphylococcus aureus showed little change in erythromycin susceptibility over time, but there may be a small, numerical increase in pirlimycin MIC50 and MIC90 values. Overall, the results suggest that mastitis pathogens in the United States and Canada have not shown any substantial changes in the in vitro susceptibility to beta-lactam, macrolide, and lincosamide drugs tested over the 9 years of the study.

Mechanisms of genome evolution of Streptococcus.

Science.gov (United States)

Andam, Cheryl P; Hanage, William P

2015-07-01

The genus Streptococcus contains 104 recognized species, many of which are associated with human or animal hosts. A globally prevalent human pathogen in this group is Streptococcus pneumoniae (the pneumococcus). While being a common resident of the upper respiratory tract, it is also a major cause of otitis media, pneumonia, bacteremia and meningitis, accounting for a high burden of morbidity and mortality worldwide. Recent findings demonstrate the importance of recombination and selection in driving the population dynamics and evolution of different pneumococcal lineages, allowing them to successfully evade the impacts of selective pressures such as vaccination and antibiotic treatment. We highlight the ability of pneumococci to respond to these pressures through processes including serotype replacement, capsular switching and horizontal gene transfer (HGT) of antibiotic resistance genes. The challenge in controlling this pathogen also lies in the exceptional genetic and phenotypic variation among different pneumococcal lineages, particularly in terms of their pathogenicity and resistance to current therapeutic strategies. The widespread use of pneumococcal conjugate vaccines, which target only a small subset of the more than 90 pneumococcal serotypes, provides us with a unique opportunity to elucidate how the processes of selection and recombination interact to generate a remarkable level of plasticity and heterogeneity in the pneumococcal genome. These processes also play an important role in the emergence and spread of multi-resistant strains, which continues to pose a challenge in disease control and/or eradication. The application of population of genomic approaches at different spatial and temporal scales will help improve strategies to control this global pathogen, and potentially other pathogenic streptococci. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

Pharmacokinetic/pharmacodynamic integration and modelling of oxytetracycline for the porcine pneumonia pathogens Actinobacillus pleuropneumoniae and Pasteurella multocida.

Science.gov (United States)

Dorey, L; Pelligand, L; Cheng, Z; Lees, P

2017-10-01

Pharmacokinetic-pharmacodynamic (PK/PD) integration and modelling were used to predict dosage schedules of oxytetracycline for two pig pneumonia pathogens, Actinobacillus pleuropneumoniae and Pasteurella multocida. Minimum inhibitory concentration (MIC) and mutant prevention concentration (MPC) were determined in broth and porcine serum. PK/PD integration established ratios of average concentration over 48 h (C av0-48 h )/MIC of 5.87 and 0.27 μg/mL (P. multocida) and 0.70 and 0.85 μg/mL (A. pleuropneumoniae) for broth and serum MICs, respectively. PK/PD modelling of in vitro time-kill curves established broth and serum breakpoint values for area under curve (AUC 0-24 h )/MIC for three levels of inhibition of growth, bacteriostasis and 3 and 4 log 10 reductions in bacterial count. Doses were then predicted for each pathogen, based on Monte Carlo simulations, for: (i) bacteriostatic and bactericidal levels of kill; (ii) 50% and 90% target attainment rates (TAR); and (iii) single dosing and daily dosing at steady-state. For 90% TAR, predicted daily doses at steady-state for bactericidal actions were 1123 mg/kg (P. multocida) and 43 mg/kg (A. pleuropneumoniae) based on serum MICs. Lower TARs were predicted from broth MIC data; corresponding dose estimates were 95 mg/kg (P. multocida) and 34 mg/kg (A. pleuropneumoniae). © 2017 The Authors. Journal of Veterinary Pharmacology and Therapeutics Published by John Wiley & Sons Ltd.

CD4+ T-cell Responses Among Adults and Young Children In Response to Streptococcus pneumoniae and Haemophilus influenzae Vaccine Candidate Protein Antigens

OpenAIRE

Sharma, Sharad K.; Roumanes, David; Almudevar, Anthony; Mosmann, Tim R.; Pichichero, Michael E.

2013-01-01

We characterized cytokine profiles of CD4+ T-helper (h) cells in adults and young children to ascertain if responses occur to next-generation candidate vaccine antigens PspA, PcpA, PhtD, PhtE, Ply, LytB of Streptococcus pneumonia (Spn) and Protein D and OMP26 of non-typeable Haemophilus influenzae (NTHi). Adults had vaccine antigen-specific Th1 - and Th2 cells responsive to all antigens evaluated whereas young children had significant numbers of vaccine antigen-specific CD4+ T cells producing...

Measuring coverage in MNCH: challenges in monitoring the proportion of young children with pneumonia who receive antibiotic treatment.

Directory of Open Access Journals (Sweden)

Harry Campbell

Full Text Available Pneumonia remains a major cause of child death globally, and improving antibiotic treatment rates is a key control strategy. Progress in improving the global coverage of antibiotic treatment is monitored through large household surveys such as the Demographic and Health Surveys (DHS and the Multiple Indicator Cluster Surveys (MICS, which estimate antibiotic treatment rates of pneumonia based on two-week recall of pneumonia by caregivers. However, these survey tools identify children with reported symptoms of pneumonia, and because the prevalence of pneumonia over a two-week period in community settings is low, the majority of these children do not have true pneumonia and so do not provide an accurate denominator of pneumonia cases for monitoring antibiotic treatment rates. In this review, we show that the performance of survey tools could be improved by increasing the survey recall period or by improving either overall discriminative power or specificity. However, even at a test specificity of 95% (and a test sensitivity of 80%, the proportion of children with reported symptoms of pneumonia who truly have pneumonia is only 22% (the positive predictive value of the survey tool. Thus, although DHS and MICS survey data on rates of care seeking for children with reported symptoms of pneumonia and other childhood illnesses remain valid and important, DHS and MICS data are not able to give valid estimates of antibiotic treatment rates in children with pneumonia.

Antimicrobial susceptibility trends among gram-positive and -negative clinical isolates collected between 2005 and 2012 in Mexico: results from the Tigecycline Evaluation and Surveillance Trial.

Science.gov (United States)

Morfin-Otero, Rayo; Noriega, Eduardo Rodriguez; Dowzicky, Michael J

2015-12-15

The Tigecycline Evaluation and Surveillance Trial (T.E.S.T) is a global antimicrobial surveillance study of both gram-positive and gram-negative organisms. This report presents data on antimicrobial susceptibility among organisms collected in Mexico between 2005 and 2012 as part of T.E.S.T., and compares rates between 2005-2007 and 2008-2012. Each center in Mexico submitted at least 200 isolates per collection year; including 65 gram-positive isolates and 135 gram-negative isolates. Minimum inhibitory concentrations (MICs) were determined using Clinical Laboratory Standards Institute (CLSI) broth microdilution methodology and antimicrobial susceptibility was established using the 2013 CLSI-approved breakpoints. For tigecycline US Food and Drug Administration (FDA) breakpoints were applied. Isolates of E. coli and K. pneumoniae with a MIC for ceftriaxone of >1 mg/L were screened for ESBL production using the phenotypic confirmatory disk test according to CLSI guidelines. The rates of some key resistant phenotypes changed during this study: vancomycin resistance among Enterococcus faecium decreased from 28.6 % in 2005-2007 to 19.1 % in 2008-2012, while β-lactamase production among Haemophilus influenzae decreased from 37.6 to 18.9 %. Conversely, methicillin-resistant Staphylococcus aureus increased from 38.1 to 47.9 %, meropenem-resistant Acinetobacter spp. increased from 17.7 to 33.0 % and multidrug-resistant Acinetobacter spp. increased from 25.6 to 49.7 %. The prevalence of other resistant pathogens was stable over the study period, including extended-spectrum β-lactamase-positive Escherichia coli (39.0 %) and Klebsiella pneumoniae (25.0 %). The activity of tigecycline was maintained across the study years with MIC90s of ≤2 mg/L against Enterococcus spp., S. aureus, Streptococcus agalactiae, Streptococcus pneumoniae, Enterobacter spp., E. coli, K. pneumoniae, Klebsiella oxytoca, Serratia marcescens, H. influenzae, and Acinetobacter spp. All gram

Multidrug-resistant Streptococcus pneumoniae isolates from healthy Ghanaian preschool children

DEFF Research Database (Denmark)

Dayie, Nicholas Tete Kwaku Dzifa; Arhin, Reuben E.; Newman, Mercy J.

2015-01-01

in a previous study, to six antimicrobials was determined by disk diffusion test. Overall, 90.4% of isolates were intermediate penicillin resistant, 99.1% were trimethoprim resistant, 73.0% were tetracycline resistant, and 33.9% were sulfamethoxazole resistant. Low resistance was recorded for erythromycin (2...... of this study was to determine the antibiogram of S. pneumoniae recovered from Ghanaian children younger than six years of age and to what extent resistances were due to the spread of certain sero- and multilocus sequence typing (MLST) types. The susceptibility of 115 pneumococcal isolates, recovered...

The effect of subminimal inhibitory concentrations of penicillin on growth rate and haemolysin activity of group G Streptococcus

Directory of Open Access Journals (Sweden)

Verônica V. Vieira

1993-09-01

Full Text Available The influence of the subminimal inhibitory concentrations (1/3 and 1/4 of the MIC of penicillin on growth rate and on haemolysin production of a strain of group G Streptococcus was studied. It was shown that 1/3 of the MIC almost completely inhibited the bacterial growth, but it was not able to inhibit haemolysin activity in the culture supernate. The generation time of bacteria grown in 1/4 of the MIC was approximately twice longer than that of the control culture. In all cultures, the haemolysin, after being produced (or liberated, reached a peak and decreased to low levels, which could suggest that group G Streptococcus produces some end products of metabolism that are able to inhibit haemolysin activity.

Estudo Viriato: Actualização de dados de susceptibilidade aos antimicrobianos de bactérias responsáveis por infecções respiratórias adquiridas na comunidade em Portugal em 2003 e 2004

Directory of Open Access Journals (Sweden)

J. Melo-Cristino

2006-01-01

/ clavulanato, cefuroxima, claritromicina, azitromicina e ciprofloxacina. De entre o conjunto de antibióticos ensaiado, a penicilina continua a ser o mais activo contra S. pyogenes e a amoxicilina / clavulanato e as quinolonas os mais activos simultaneamente contra S. pneumoniae, H. influenzae e M. catarrhalis.Rev Port Pneumol 2006; XII (1: 9-29 Abstract: The Viriato Study is a nationwide, prospective, multicenter surveillance study of the antimicrobial susceptibility of bacterial pathogens commonly associated with community-acquired respiratory tract infections in Portugal. In 2003 and 2004 a total of 2945 isolates was recovered in the 29 laboratories that participated in the study. Testing was undertaken in a central laboratory. Of the 513 Streptococcus pyogenes strains isolated from patients with acute tonsillitis all were susceptible to penicillin and other beta-lactams but 18.9% were resistant to erythromycin, clarithromycin and azithromycin. The M phenotype dominated (67%, conferring resistance to erythromycin (MIC90=16 mg/L, clarythromycin and azithromycin, but susceptibility to clindamycin (MIC90=0.094 mg/L. From patients with lower respiratory tract infection 1,300 strains of Streptococcus pneumoniae, 829 of Haemophilus influenzae, and 303 of Moraxella catarrhalis were studied. Among S. pneumoniae isolates 18.4% were resistant to penicillin (3.5% showing high-level resistance, 7.1% to cefuroxime, 0.5% to amoxicillin and amoxicillin/ clavulanate, 18.8% to erythromycin, clarithromycin and azithromycin, 14.9% to tetracycline, 16.5% to co-trimoxazol, and 0.4% to levofloxacin. Beta-lactamases were produced by 10.0% of H. influenzae and 96.4% of M. catarrhalis. In H. influenzae resistance to clarithromycin was 5.5% and to cotrimoxazole was 13.4%. Most strains were susceptible to amoxicillin/clavulanate, cefuroxime, azithromycin, tetracycline and ciprofloxacin. In M. catarrhalis resistance to co-trimoxazole was 27.1% and to tetracycline 1.0%. All strains were susceptible

Tentative minimum inhibitory concentration and zone diameter breakpoints for moxifloxacin using BSAC criteria.

Science.gov (United States)

Andrews, J M; Ashby, J P; Jevons, G M; Wise, R

1999-12-01

Tentative MIC and zone diameter breakpoints were determined for moxifloxacin using BSAC criteria. An MIC breakpoint of or = 20 mm for Enterobacteriaceae and staphylococci, 18 mm for the respiratory pathogens (Streptococcus pneumoniae, Haemophilus influenzae and Moraxella catarrhalis) and 15 mm for enterococci. For Pseudomonas aeruginosa with a 5 microg disc, three bands are suggested for interpretation, that of > or = 25 mm (sensitive), 18-24 mm (intermediate) and < or = 17 mm (resistant).

Multiplex PCR to determine Streptococcus pneumoniae serotypes causing otitis media in the Republic of Ireland with further characterisation of antimicrobial susceptibilities and genotypes.

LENUS (Irish Health Repository)

Vickers, I

2011-03-01

The purpose of this study was to determine the serotypes, genotypes and antimicrobial susceptibilities of Streptococcus pneumoniae causing otitis media (OM) in children in Dublin, Ireland. S. pneumoniae isolates (n = 28) from spontaneously discharging OM were studied. Serotyping was performed using a previously undescribed multiplex polymerase chain reaction (PCR) scheme in combination with serological methods. Multilocus sequence typing (MLST) was performed using standard procedures. Antimicrobial susceptibility testing was performed using the Etest method. Fourteen different S. pneumoniae serotypes were identified. The five most common serotypes were 3, 19F, 19A, 14 and 6A, which accounted for 68% of all infections. The 7-valent pneumococcal conjugate vaccine (PCV7), 10-valent pneumococcal conjugate vaccine (PHiD-CV) and 13-valent pneumococcal conjugate vaccine (PCV13) provided potential coverages of 43%, 46% and 86%, respectively. Reduced susceptibility to penicillin was evident for 25% of isolates and was associated with serotypes 14, 19A, 19F and 9V. A total of 21 different sequence types (STs) were identified. Pneumococcal Molecular Epidemiology Network (PMEN) clones or their variants represented 54% (15\\/28) of all isolates. Continued monitoring and characterisation of S. pneumoniae causing OM in Ireland is warranted in order to guide future vaccine and treatment policies.

[Increasing incidence of community-acquired pneumonia caused by atypical microorganisms].

Science.gov (United States)

Tazón-Varela, M A; Alonso-Valle, H; Muñoz-Cacho, P; Gallo-Terán, J; Piris-García, X; Pérez-Mier, L A

2017-09-01

Knowing the most common microorganisms in our environment can help us to make proper empirical treatment decisions. The aim is to identify those microorganisms causing community-acquired pneumonia. An observational, descriptive and prospective study was conducted, including patients over 14 years with a clinical and radiographic diagnosis of community-acquired pneumonia during a 383 consecutive day period. A record was made of sociodemographic variables, personal history, prognostic severity scales, progress, and pathogenic agents. The aetiological diagnosis was made using blood cultures, detection of Streptococcus pneumoniae and Legionella pneumophila urinary antigens, sputum culture, influenza virus and Streptococcus pyogenes detection. Categorical variables are presented as absolute values and percentages, and continuous variables as their means and standard deviations. Of the 287 patients included in the study (42% women, mean age 66±22 years), 10.45% died and 70% required hospital admission. An aetiological diagnosis was achieved in 43 patients (14.98%), with 16 microorganisms found in 59 positive samples. The most frequently isolated pathogen was Streptococcus pneumonia (24/59, 41%), followed by gram-negative enteric bacilli, Klebsiella pneumonia, Escherichia coli, Serratia marcescens and Enterobacter cloacae isolated in 20% of the samples (12/59), influenza virus (5/59, 9%), methicillin-resistant Staphylococcus aureus (3/59, 5%), Pseudomonas aeruginosa (2/59, 3%), Moraxella catarrhalis (2/59, 3%), Legionella pneumophila (2/59, 3%), and Haemophilus influenza (2/59, 3%). Polymicrobial infections accounted for 14% (8/59). A high percentage of atypical microorganisms causing community-acquired pneumonia were found. Copyright © 2016 Sociedad Española de Médicos de Atención Primaria (SEMERGEN). Publicado por Elsevier España, S.L.U. All rights reserved.

Prevalence of mef and ermB genes in invasive pediatric erythromycin-resistant Streptococcus pneumoniae isolates from Argentina Prevalencia de los genes mef y ermB en aislamientos invasivos de Streptococcus pneumoniae resistentes a eritromicina recuperados de pacientes pediátricos en Argentina

Directory of Open Access Journals (Sweden)

A. Corso

2009-03-01

Full Text Available During the period 1993-2001, a total of 1,499 pneumococci isolates were recovered through the Argentinean surveillance of Streptococcus pneumoniae causing invasive disease in children under 6 years of age, 3.5% of which were erythromycin resistant. Among the 50 erythromycin-resistant strains available, 58% (n=29 harbored mefA/E genes (15 mefA, 30%; and 14 mefE, 28%, 34% (n=17 ermB, and 6% (n=3 both mefA/E plus ermB genes, while one isolate was negative for all the acquired genes studied. The England14-9 (42%, Poland6B-20 (20% and Spain9v-3 (16% clones were responsible for the emergence of pneumococcal macrolide resistance in pediatric population from Argentina.En el marco del programa de vigilancia regional SIREVA, se analizaron 1499 aislamientos de Streptococcus pneumoniae causantes de enfermedad invasiva en menores de 6 años, recuperados entre 1993 y 2001. Se detectó un 3,5% de resistencia a eritromicina. De los 50 aislamientos resistentes a eritromicina que pudieron ser estudiados, el 58% (n=29 tenían los genes mefA/E (15 mefA, 30% y 14 mefE, 28%, el 34% (n=17 el gen ermB y el 6% (n=3 la combinación de genes mefA/E y ermB. Sólo un aislamiento fue negativo para todos los genes analizados. Los clones internacionales England14-9, Poland6B-20 y Spain9v-3 representaron el 78% del total de aislamientos resistentes (42, 20 y 16%, respectivamente y se consideraron los responsables de la emergencia de la resistencia a macrólidos entre los neumococos que afectan a la población pediátrica de Argentina.

Resistance of Streptococcus sanguis biofilms to antimicrobial agents

DEFF Research Database (Denmark)

Larsen, T; Fiehn, N E

1996-01-01

of Streptococcus sanguis 804 and ATCC 10556 to amoxicillin, doxycycline and chlorhexidine was determined by a broth dilution method. Subsequently, S. sanguis biofilms established in an in vitro flow model were perfused with the antimicrobial agents for 48 h at concentrations equal to and up to 500 times the MIC...

Antimicrobial activity of innate immune molecules against Streptococcus pneumoniae, Moraxella catarrhalis and nontypeable Haemophilus influenzae

Directory of Open Access Journals (Sweden)

Teufert Karen

2004-05-01

Full Text Available Abstract Background Despite its direct connection to the nasopharynx which harbors otitis media pathogens as part of its normal flora, the middle ear cavity is kept free of these bacteria by as yet unknown mechanisms. Respiratory mucosal epithelia, including those of the middle ear and eustachian tube, secrete antimicrobial effectors including lysozyme, lactoferrin and β defensins-1 and -2. To elucidate the role of these innate immune molecules in the normal defense and maintenance of sterility of respiratory mucosa such as that of the middle ear, we assessed their effect on the respiratory pathogens nontypeable Haemophilus influenzae (NTHi 12, Moraxella catarrhalis 035E, and Streptococcus pneumoniae 3, and 6B. Methods Two assay methods, the radial assay and the liquid broth assay, were employed for testing the antimicrobial activity of the molecules. This was done in order to minimize the possibility that the observed effects were artifacts of any single assay system employed. Also, transmission electron microscopy (TEM was employed to evaluate the effect of antimicrobial innate immune molecules on OM pathogens. For the statistical analysis of the data, Student's t-test was performed. Results Results of the radial diffusion assay showed that β defensin-2 was active against all four OM pathogens tested, while treatment with β defensin-1 appeared to only affect M. catarrhalis. The radial assay results also showed that lysozyme was quite effective against S. pneumoniae 3 and 6B and was partially bacteriostatic/bactericidal against M. catarrhalis. Lysozyme however, appeared not to affect the growth of NTHi. Thus, lysozyme seems to have a more pronounced impact on the growth of the Gram-positive S. pneumoniae as compared to that of Gram-negative pathogens. Lactoferrin on the other hand, enhanced the growth of the bacteria tested. The results of the radial assays were confirmed using liquid broth assays for antimicrobial activity, and showed that

LocZ Is a New Cell Division Protein Involved in Proper Septum Placement in Streptococcus pneumoniae

Science.gov (United States)

Holečková, Nela; Molle, Virginie; Buriánková, Karolína; Benada, Oldřich; Kofroňová, Olga; Ulrych, Aleš; Branny, Pavel

2014-01-01

ABSTRACT How bacteria control proper septum placement at midcell, to guarantee the generation of identical daughter cells, is still largely unknown. Although different systems involved in the selection of the division site have been described in selected species, these do not appear to be widely conserved. Here, we report that LocZ (Spr0334), a newly identified cell division protein, is involved in proper septum placement in Streptococcus pneumoniae. We show that locZ is not essential but that its deletion results in cell division defects and shape deformation, causing cells to divide asymmetrically and generate unequally sized, occasionally anucleated, daughter cells. LocZ has a unique localization profile. It arrives early at midcell, before FtsZ and FtsA, and leaves the septum early, apparently moving along with the equatorial rings that mark the future division sites. Consistently, cells lacking LocZ also show misplacement of the Z-ring, suggesting that it could act as a positive regulator to determine septum placement. LocZ was identified as a substrate of the Ser/Thr protein kinase StkP, which regulates cell division in S. pneumoniae. Interestingly, homologues of LocZ are found only in streptococci, lactococci, and enterococci, indicating that this close phylogenetically related group of bacteria evolved a specific solution to spatially regulate cell division. PMID:25550321

The novel species Streptococcus tigurinus and its association with oral infection.

Science.gov (United States)

Zbinden, Andrea; Bostanci, Nagihan; Belibasakis, Georgios N

2015-01-01

Streptococcus tigurinus is a novel species of viridans streptococci, shown to cause severe invasive infections such as infective endocarditis, spondylodiscitis and meningitis. S. tigurinus belongs to the Streptococcus mitis group and is most closely related to Streptococcus mitis, Streptococcus oralis, Streptococcus pneumoniae, Streptococcus pseudopneumoniae and Streptococcus infantis. The presence of S. tigurinus in the human oral cavity has been documented, including in patients with periodontal disease. This review addresses the available scientific knowledge on S. tigurinus and its association with closely related streptococci, and discusses its putative involvement in common oral infections. While there is as yet no strong evidence on the involvement of S. tigurinus with oral infections, its presence in the oral cavity and its association with endocarditis warrants special attention for a link between oral and systemic infection.

Determination of Serotypes and Antibiotic Resistance in Streptococcus Pneumoniae

Directory of Open Access Journals (Sweden)

Deniz Akgun Karapinar

2016-01-01

Full Text Available Aim: In this study, the distribution of serogroup/serotype and antibiotic susceptibility testing of Streptococcus pneumoniae strains, recovered from pediatric and adult patients were evaluated. Material and Method: A total of 80 clinical isolates recovered from 19 pediatric and 61 adult patients were performed by latex aglutination method and antibiotic susceptibility tests in Istanbul University, Istanbul Faculty of Medicine, Medical Microbiology Laboratories. Results: Sixty-two strains (76 %, were serogroup/serotyped and 18 (23 % strains couldn%u2019t serogroup/serotyped. The most frequent identified serogroups were 19, 14, 23, 6, 4 in pediatrics, and 3, 19, 23 and 9 in adults. In adults, serogroups 3, 9, 5, 8, 18, 1, 15 were determined, but these serogroups weren%u2019t found in pediatrics. Vaccine serotypes rates were found as 53 % in pediatric and as 85 % in adults. The serogroups 2, 7, 10, 11, 12, 17, 20, 22, 33 were not detected, which are available in vaccine serotypes. Only 1 (1 % strain was found to exhibit low level resistance to penicillin and high level resistance wasn%u2019t found in any strain. Resistant results for trimethoprim-sulfamethoxazole, erythromycin, chloramphenicol and ofloxacin were found as 45 (56 %, 22 (27.5 %, 7 (9 %, 2 (2.5 %, respectively. All strains were found susceptible to vancomycin, linezolid and levofloxacin. The most resistant serogroups were 19, 23, 9 and 14 in the tested antibiotics. Multidrug resistance was found in 9 (11 % strains and these strains were found as serogroups 19, 23, 9, 6 and 14. Discussion: The epidemiological studies are important that the distribution of serotype and antibiotic resistance vary depending on many factors like age, and geographic region.

Prevalence of penicillin and erythromycin resistance among invasive Streptococcus pneumoniae isolates reported by laboratories in the southern and eastern Mediterranean region.

Science.gov (United States)

Borg, M A; Tiemersma, E; Scicluna, E; van de Sande-Bruinsma, N; de Kraker, M; Monen, J; Grundmann, H

2009-03-01

Information about the epidemiology of resistance in Streptococcus pneumoniae within southern and eastern countries of the Mediterranean region is incomplete, as reports have been sporadic and difficult to compare. Over a 36-month period, from 2003 to 2005, the ARMed project collected 1298 susceptibility test results of invasive isolates of S. pneumoniae from blood and spinal fluid cultures routinely processed within 59 participating laboratories situated in Algeria, Cyprus, Egypt, Jordan, Lebanon, Malta, Morocco, Tunisia and Turkey. Overall, 26% (335) of isolates were reported as non-susceptible to penicillin, with the highest proportions being reported from Algeria (44%) and Lebanon (40%). During the same time period, the highest proportions of pneumococci that were not susceptible to erythromycin were reported from Malta (46%) and Tunisia (39%). Proportions of dual non-susceptibility in excess of 5% were found in laboratories in Algeria, Tunisia, Lebanon, Jordan and Turkey. ARMed data on the antimicrobial resistance epidemiology of S. pneumoniae in the southern and eastern Mediterranean region provided evidence of high rates of resistance, especially to penicillin. This evidence calls for a greater focus on the identification of relevant drivers of resistance and on the implemention of effective practices in order to address the problem of resistence.

Serotype distribution and antibiotic susceptibility of Streptococcus pneumoniae strains in the south of Tunisia: A five-year study (2012–2016 of pediatric and adult populations

Directory of Open Access Journals (Sweden)

Sonia Ktari

2017-12-01

Full Text Available Objectives: To analyze the serotype distribution of Streptococcus pneumoniae clinical isolates collected in the south of Tunisia over a 5-year period in different age groups and to assess their antimicrobial susceptibility patterns. Methods: A total of 305 non-duplicate S. pneumoniae isolates were collected between January 2012 and December 2016 at the university hospital in Sfax, Tunisia. All isolates were serotyped by multiplex PCR. The antibiotic susceptibility of all isolates was determined using the disk diffusion test or Etest assay. Results: Among the 305 pneumococcal isolates, 76 (24.9% were invasive and 229 (75.1% were non-invasive. The most common serotypes were 19F (20%, 14 (16.7%, 3 (9.2%, 23F (7.5%, 19A (5.9%, and 6B (5.9%. Potential immunization coverage rates for pneumococcal conjugate vaccines PCV7, PCV10, and PCV13 were 58%, 59.3%, and 78.7%, respectively. Three-quarters (75.3% of pneumococcal isolates were non-susceptible to penicillin. The resistance rate to erythromycin was 71.4%. Only two isolates were resistant to levofloxacin. Conclusions: 19F and 14 were the most prevalent serotypes in the south of Tunisia. The inclusion of a PCV in the immunization program could be useful for reducing the burden of pneumococcal diseases. The high resistance rate to penicillin and macrolides is alarming. Prudent use of antibiotics is crucial to prevent the selection of multidrug-resistant pneumococci. Keywords: Streptococcus pneumoniae, Antibiotic, Serotype, PCV, Tunisia

TOC-39, a novel parenteral broad-spectrum cephalosporin with excellent activity against methicillin-resistant Staphylococcus aureus.

Science.gov (United States)

Hanaki, H; Akagi, H; Masaru, Y; Otani, T; Hyodo, A; Hiramatsu, K

1995-01-01

TOC-39, a new parenteral cephalosporin, is a hydroxyimino-type cephem antibiotic with vinylthio-pyridyl moiety at the 3 position. TOC-39 was evaluated for antibacterial activity against various clinically isolated strains. TOC-39 had excellent activity, stronger than that of methicillin, oxacillin, the cephalosporins tested, imipenem, gentamicin, minocycline, tobramycin, ofloxacin, and ciprofloxacin against methicillin-resistant Staphylococcus aureus (MRSA) and had an MIC comparable to that of vancomycin (the MICs of TOC-39 and vancomycin for 90% of the strains tested were 3.13 and 1.56 micrograms/ml, respectively). Against Enterococcus faecalis strains, which are resistant to cephalosporins, TOC-39 was twice as active as ampicillin. Against methicillin-susceptible S. aureus, coagulase-negative Staphylococcus spp., and Streptococcus pneumoniae, TOC-39 was twice as active as or more active than cefotiam, ceftazidime, flomoxef, and cefpirome. Against Streptococcus pyogenes, TOC-39 was superior to cefotiam, ceftazidime, and flomoxef and was similar to cefpirome. In addition, the activity of TOC-39 was equal to or greater than that of cefotiam, ceftazidime, flomoxef, and cefpirome against Haemophilus influenzae, Escherichia coli, Klebsiella pneumoniae, Proteus mirabilis, and Morganella morganii. In terms of bactericidal effect against MRSA, TOC-39 was superior to vancomycin. No mutant resistant to TOC-39 or vancomycin was obtained from susceptible MRSA strains. In murine systemic infection models, TOC-39 showed potent activity against S. aureus and E. coli. Against highly MRSA, the activity of TOC-39 was comparable to that of vancomycin. PMID:7625799

Commercial broth microdilution panel validation and reproducibility trials for NVP PDF-713 (LBM 415), a novel inhibitor of bacterial peptide deformylase.

Science.gov (United States)

Fritsche, T R; Moet, G J; Jones, R N

2004-09-01

NVP PDF-713 (LBM 415) is a peptide deformylase inhibitor being progressed into clinical trials. Dry-form broth microdilution panels of NVP PDF-713 were compared to reference MIC panels of 552 recent clinical isolates. Most (99.2%) dry-form MIC results were within +/- 1 log(2) dilution of the reference panel MICs. Of the bacteria tested, Streptococcus pneumoniae and Haemophilus influenzae showed a bias towards higher and lower MICs, respectively. Same-day and between-day reproducibility tests showed that 98.9% and 96.7% of MIC values, respectively, were within +/- 1 log(2) dilution step, thereby demonstrating a high degree of reliability of the dry-form MIC product for clinical studies.

Multistep resistance selection and postantibiotic-effect studies of the antipneumococcal activity of LBM415 compared to other agents.

Science.gov (United States)

Kosowska-Shick, Klaudia; Credito, Kim L; Pankuch, Glenn A; DeWasse, Bonifacio; McGhee, Pamela; Appelbaum, Peter C

2007-02-01

LBM415 is a peptide deformylase inhibitor active against gram-positive bacterial species and some gram-negative species. In multiselection studies, LBM415 had low MICs against all Streptococcus pneumoniae strains tested, regardless of their genotype, and selected resistant clones after 14 to 50 days. MIC increases correlated with changes mostly in the 70GXGXAAXQ77 motif in peptide deformylase. The postantibiotic effect of LBM415 ranged from 0.3 to 1.4 h.

The Receptor for Advanced Glycation End Products Impairs Host Defense in Pneumococcal Pneumonia

NARCIS (Netherlands)

van Zoelen, Marieke A. D.; Schouten, Marcel; de Vos, Alex F.; Florquin, Sandrine; Meijers, Joost C. M.; Nawroth, Peter P.; Bierhaus, Angelika; van der Poll, Tom

2009-01-01

Streptococcus pneumoniae is the most common cause of community-acquired pneumonia. The receptor for advanced glycation end products (RAGE) is a multiligand receptor that is expressed ubiquitously in the lungs. Engagement of RAGE leads to activation of multiple intracellular signaling pathways,

Chemical composition and antimicrobial activity of leaves essential oil of Juniperus communis (Cupressaceae grown in Republic of Macedonia

Directory of Open Access Journals (Sweden)

Floresha Sela

2013-07-01

Full Text Available Chemical composition and antimicrobial activity of essential oils isolated from leaves of three different samples of wild growing Juniperus communis L. (Cupressaceae from R. Macedonia was investigated. Essential oil yield ranged from 7.3 to 9.0 ml/kg. Performing GC/ FID/MS analysis, ninety components were identified, representing 86.07-93.31% of the oil. The major components of the leaves essential oil (LEO were α-pinene (21.37-28.68% and sabinene (2.29-16.27%, followed by limonene, terpinen-4-ol, β-elemene, trans-(E-caryophyllene, germacrene D and δ-cadinene. Antimicrobial screening of the LEO was made by disc diffusion and broth dilution method against 16 bacterial isolates of Gram positive and Gram negative bacteria and one strain of Candida albicans. Two bacteria, Staphylococcus aureus and Streptococcus pyogenes were sensitive to antimicrobial activity of LEO (MIC = 125 µl/ml. Additionally, LEO showed moderate antimicrobial activity against Streptococcus agalactiae, Haemophilus influnzae, Corynebacterium spp. and Campylobacter jejuni (MIC > 500 µl/ml. Candida albicans, Staphylococcus epidermidis, Acinetobacter spp., Salmonella enteritidis, Shigella flexneri, Klebsiella pneumonia, Pseudomonas aeruginosa and Proteus mirabilis were completely resistant to the antimicrobial effects of this.

[Macrolide-resistant Streptococcus pneumoniae on the islands of Gran Canaria and Lanzarote (Spain): molecular mechanisms and serogroup relationships].

Science.gov (United States)

Artiles, Fernando; Horcajada-Herrera, Iballa; Noguera-Catalán, Javier; Alamo-Antúnez, Isabel; Bordes-Benítez, Ana; Lafarga-Capuz, Bernardo

2007-11-01

Macrolide resistance in Streptococcus pneumoniae is coded by the ermB and mefA/E genes. The aim of this study was to determine the status of macrolide-resistance, the molecular mechanisms involved, the serogroup relationships, and the level of co-resistance in S. pneumoniae isolates from Gran Canaria and Lanzarote, in the Canary Islands, Spain. Macrolide resistance phenotypes were investigated in 261 S. pneumoniae clinical isolates over a two-year period (2004 and 2005). Genotypes were determined by PCR (detection of ermB and mefA/E genes). Overall macrolide resistance was 40.6% (106 isolates); 79.2% (84) of resistant isolates presented the MLSB phenotype (98.8% harbored the ermB gene), with a predominance of serogroup 19, and 20.8% (22) presented the M phenotype (77.3% displayed the mefA/E gene), all associated with serogroup 14. Worthy of note, the M phenotype was found in 8 invasive isolates from Lanzarote (80%) all from serogroup 14. The ermB and mefA/E genes were detected in 7 isolates belonging to serogroup 19. Absence of co-resistance was observed most frequently in serogroup 14 (66.7%). Co-resistance with penicillin G, tetracycline, and trimethoprim-sulfamethoxazole was associated with serogroup 19 (36.8%). Two isolates (0.8%) were resistant to telithromycin. The frequency of macrolide resistance mechanisms in the Canary Islands is different from that observed in the rest of Spain, particularly in Lanzarote, where 80% of isolates harbored the mefA/E gene and belonged to serogroup 14.

Vancomycin AUC/MIC ratio and 30-day mortality in patients with Staphylococcus aureus bacteremia.

Science.gov (United States)

Holmes, Natasha E; Turnidge, John D; Munckhof, Wendy J; Robinson, J Owen; Korman, Tony M; O'Sullivan, Matthew V N; Anderson, Tara L; Roberts, Sally A; Warren, Sanchia J C; Gao, Wei; Howden, Benjamin P; Johnson, Paul D R

2013-04-01

A ratio of the vancomycin area under the concentration-time curve to the MIC (AUC/MIC) of ≥ 400 has been associated with clinical success when treating Staphylococcus aureus pneumonia, and this target was recommended by recently published vancomycin therapeutic monitoring consensus guidelines for treating all serious S. aureus infections. Here, vancomycin serum trough levels and vancomycin AUC/MIC were evaluated in a "real-world" context by following a cohort of 182 patients with S. aureus bacteremia (SAB) and analyzing these parameters within the critical first 96 h of vancomycin therapy. The median vancomycin trough level at this time point was 19.5 mg/liter. There was a significant difference in vancomycin AUC/MIC when using broth microdilution (BMD) compared with Etest MIC (medians of 436.1 and 271.5, respectively; P AUC/MIC of ≥ 400 using BMD was not associated with lower 30-day all-cause or attributable mortality from SAB (P = 0.132 and P = 0.273, respectively). However, an alternative vancomycin AUC/MIC of >373, derived using classification and regression tree analysis, was associated with reduced mortality (P = 0.043) and remained significant in a multivariable model. This study demonstrated that we obtained vancomycin trough levels in the target therapeutic range early during the course of therapy and that obtaining a higher vancomycin AUC/MIC (in this case, >373) within 96 h was associated with reduced mortality. The MIC test method has a significant impact on vancomycin AUC/MIC estimation. Clinicians should be aware that the current target AUC/MIC of ≥ 400 was derived using the reference BMD method, so adjustments to this target need to be made when calculating AUC/MIC ratio using other MIC testing methods.

Replication of type 5 adenovirus promotes middle ear infection by Streptococcus pneumoniae in the chinchilla model of otitis media

Science.gov (United States)

Murrah, Kyle A.; Turner, Roberta L.; Pang, Bing; Perez, Antonia C.; Reimche, Jennifer L.; King, Lauren B.; Wren, John; Gandhi, Uma; Swords, W. Edward; Ornelles, David A.

2015-01-01

Adenoviral infection is a major risk factor for otitis media. We hypothesized that adenovirus promotes bacterial ascension into the middle ear through the disruption of normal function in the Eustachian tubes due to inflammation-induced changes. An intranasal infection model of the chinchilla was used to test the ability of type 5 adenovirus to promote middle ear infection by Streptococcus pneumoniae. The hyperinflammatory adenovirus mutant dl327 and the nonreplicating adenovirus mutant H5wt300ΔpTP were used to test the role of inflammation and viral replication, respectively, in promotion of pneumococcal middle ear infection. Precedent infection with adenovirus resulted in a significantly greater incidence of middle ear disease by S. pneumoniae as compared to nonadenovirus infected animals. Infection with the adenovirus mutant dl327 induced a comparable degree of bacterial ascension into the middle ear as did infection with the wild-type virus. By contrast, infection with the nonreplicating adenovirus mutant H5wt300ΔpTP resulted in less extensive middle ear infection compared to the wild-type adenovirus. We conclude that viral replication is necessary for adenoviral-induced pneumococcal middle ear disease. PMID:25251686

Comparative antianaerobic activities of doripenem determined by MIC and time-kill analysis.

Science.gov (United States)

Credito, Kim L; Ednie, Lois M; Appelbaum, Peter C

2008-01-01

Against 447 anaerobe strains, the investigational carbapenem doripenem had an MIC 50 of 0.125 microg/ml and an MIC 90 of 1 microg/ml. Results were similar to those for imipenem, meropenem, and ertapenem. Time-kill studies showed that doripenem had very good bactericidal activity compared to other carbapenems, with 99.9% killing of 11 strains at 2x MIC after 48 h.

Pharmacokinetic/pharmacodynamic integration and modelling of florfenicol for the pig pneumonia pathogens Actinobacillus pleuropneumoniae and Pasteurella multocida.

Directory of Open Access Journals (Sweden)

Lucy Dorey

Full Text Available Pharmacokinetic-pharmacodynamic (PK/PD integration and modelling were used to predict dosage schedules for florfenicol for two pig pneumonia pathogens, Actinobacillus pleuropneumoniae and Pasteurella multocida. Pharmacokinetic data were pooled for two bioequivalent products, pioneer and generic formulations, administered intramuscularly to pigs at a dose rate of 15 mg/kg. Antibacterial potency was determined in vitro as minimum inhibitory concentration (MIC and Mutant Prevention Concentration in broth and pig serum, for six isolates of each organism. For both organisms and for both serum and broth MICs, average concentration:MIC ratios over 48 h were similar and exceeded 2.5:1 and times greater than MIC exceeded 35 h. From in vitro time-kill curves, PK/PD modelling established serum breakpoint values for the index AUC24h/MIC for three levels of inhibition of growth, bacteriostasis and 3 and 4log10 reductions in bacterial count; means were 25.7, 40.2 and 47.0 h, respectively, for P. multocida and 24.6, 43.8 and 58.6 h for A. pleuropneumoniae. Using these PK and PD data, together with literature MIC distributions, doses for each pathogen were predicted for: (1 bacteriostatic and bactericidal levels of kill; (2 for 50 and 90% target attainment rates (TAR; and (3 for single dosing and daily dosing at steady state. Monte Carlo simulations for 90% TAR predicted single doses to achieve bacteriostatic and bactericidal actions over 48 h of 14.4 and 22.2 mg/kg (P. multocida and 44.7 and 86.6 mg/kg (A. pleuropneumoniae. For daily doses at steady state, and 90% TAR bacteriostatic and bactericidal actions, dosages of 6.2 and 9.6 mg/kg (P. multocida and 18.2 and 35.2 mg/kg (A. pleuropneumoniae were required. PK/PD integration and modelling approaches to dose determination indicate the possibility of tailoring dose to a range of end-points.

Outcome of meningitis caused by Streptococcus pneumoniae and Haemophilus influenzae type b in children in The Gambia.

Science.gov (United States)

Goetghebuer, T; West, T E; Wermenbol, V; Cadbury, A L; Milligan, P; Lloyd-Evans, N; Adegbola, R A; Mulholland, E K; Greenwood, B M; Weber, M W

2000-03-01

In developing countries, endemic childhood meningitis is a severe disease caused most commonly by Streptococcus pneumoniae or Haemophilus influenzae type b (Hib). Although many studies have shown that fatality rates associated with meningitis caused by these organisms are high in developing countries, little is known about the long-term outcome of survivors. The purpose of this study was to assess the importance of disabilities following pneumococcal and Hib meningitis in The Gambia. 257 children aged 0-12 years hospitalized between 1990 and 1995 with culture-proven S. pneumoniae (n = 134) or Hib (n = 123) meningitis were included retrospectively in the study. 48% of children with pneumococcal meningitis and 27% of children with Hib meningitis died whilst in hospital. Of the 160 survivors, 89 (55%) were followed up between September 1996 and October 1997. Of the children with pneumococcal meningitis that were traced, 58% had clinical sequelae; half of them had major disabilities preventing normal adaptation to social life. 38% of survivors of Hib meningitis had clinical sequelae, a quarter of whom had major disabilities. Major handicaps found were hearing loss, mental retardation, motor abnormalities and seizures. These data show that despite treatment with effective antibiotics, pneumococcal and Hib meningitis kill many Gambian children and leave many survivors with severe sequelae. Hib vaccination is now given routinely in The Gambia; an effective pneumococcal vaccine is needed.

Comparative Antianaerobic Activities of Doripenem Determined by MIC and Time-Kill Analysis▿

Science.gov (United States)

Credito, Kim L.; Ednie, Lois M.; Appelbaum, Peter C.

2008-01-01

Against 447 anaerobe strains, the investigational carbapenem doripenem had an MIC50 of 0.125 μg/ml and an MIC90 of 1 μg/ml. Results were similar to those for imipenem, meropenem, and ertapenem. Time-kill studies showed that doripenem had very good bactericidal activity compared to other carbapenems, with 99.9% killing of 11 strains at 2× MIC after 48 h. PMID:17938185

Antimicrobial Susceptibility/Resistance of Streptococcus Pneumoniae

Science.gov (United States)

Karcic, Emina; Aljicevic, Mufida; Bektas, Sabaheta; Karcic, Bekir

2015-01-01

Introduction: Pneumococcal infections are a major cause of morbidity and mortality worldwide, whose treatment is threatened with an increase in the number of strains resistant to antibiotic therapy. Goal: The main goal of this research was to investigate the presence of antimicrobial susceptibility/resistance of S. pneumoniae. Material and methods: Taken are swabs of the nose and nasopharynx, eye and ear. In vitro tests that were made in order to study the antimicrobial resistance of pneumococci are: disk diffusion method and E-test. Results: The resistance to inhibitors of cell wall synthesis was recorded at 39.17%, protein synthesis inhibitors 19.67%, folate antagonists 47.78% and quinolone in 1.11%. S. pneumoniae has shown drug resistance to erythromycin in 45%, clindamycin in 45%, chloramphenicol–0.56%, rifampicin–6.11%, tetracycline–4.67%, penicillin-G in 4.44%, oxacillin in 73.89%, ciprofloxacin in 1.11% and trimethoprim-sulfamethoxazole in 5.34% of cases. Conclusion: The highest resistance pneumococcus showed to erythromycin, clindamycin and trimethoprim-sulfamethoxazole and these should be avoided in the treatment. The least resistance pneumococcus showed to tetracycline, rifampicin, chloramphenicol, penicillin-G and ciprofloxacin. PMID:26236165

Economic aspects of hospital treated pneumococcal pneumonia and the results of Pneumo 23 vaccine use in Serbia

Directory of Open Access Journals (Sweden)

Adžić Tatjana

2008-01-01

Full Text Available INTRODUCTION In Serbia, there is a significant number of persons suffering of pneumococcal pneumonia. Persons aged 65 years or older, immunocompromised patients, patients with co-morbidities, such as chronic obstructive lung disease and congestive heart failure, are at the highest risk for developing pneumococcal pneumonia. Most of the patients are treated empirically, although it is often overlooked that Streptococcus pneumoniae can be resistant to the used antibiotics. The treatment costs of such inpatients and outpatients are very high. In Serbia, immunization of persons at risk to develop the diseases caused by Streptococcus pneumoniae is carried out using pneumococcus polysaccharide vaccine according to clinical indications. The exact number of immunized persons and the total number of registered patients are still unknown, but it is certain of being unjustifiably low. OBJECTIVE The goal of the study was to investigate, during a one-year period, the number and basic characteristics of persons hospitably treated for pneumonia, the type of cause of the infection, applied antibiotic medications, duration and costs of hospital treatment at the Institute for Lung Diseases and Tuberculosis of the Clinical Centre of Serbia in Belgrade. METHOD We retrospectively analyzed the medical records of patients with pneumonia treated at the Institute for Lung Diseases and Tuberculosis of the Clinical Centre of Serbia in Belgrade during 2006. RESULTS During the observed one-year period, 290 patients underwent hospital treatment, of whom the cause of the infection was confirmed in 116 (40%. The average duration of hospitalization was 12 days, with treatment cost of 32,031.74 RSD (402.42 EUR per patient. The treatment cost per patient including general and intensive care was 18,290.01 RSD (229.78 EUR. The distribution cost of Pneumo 23 vaccine in Serbia, without purchase tax, was 746.90 RSD (9.38 EUR. CONCLUSION Pneumococcal pneumonia is a significant medical

P40 and P90 from Mpn142 are Targets of Multiple Processing Events on the Surface of Mycoplasma pneumoniae

Directory of Open Access Journals (Sweden)

Michael Widjaja

2015-12-01

Full Text Available Mycoplasma pneumoniae is a significant cause of community acquired pneumonia globally. Despite having a genome less than 1 Mb in size, M. pneumoniae presents a structurally sophisticated attachment organelle that (i provides cell polarity, (ii directs adherence to receptors presented on respiratory epithelium, and (iii plays a major role in cell motility. The major adhesins, P1 (Mpn141 and P30 (Mpn453, are localised to the tip of the attachment organelle by the surface accessible cleavage fragments P90 and P40 derived from Mpn142. Two events play a defining role in the formation of P90 and P40; removal of a leader peptide at position 26 (23SLA↓NTY28 during secretion to the cell surface and cleavage at amino acid 455 (452GPL↓RAG457 generating P40 and P90. Liquid Chromatography Tandem Mass Spectrometry (LC-MS/MS analysis of tryptic peptides generated by digesting size-fractionated cell lysates of M. pneumoniae identified 15 cleavage fragments of Mpn142 ranging in mass from 9–84 kDa. Further evidence for the existence of cleavage fragments of Mpn142 was generated by mapping tryptic peptides to proteins recovered from size fractionated eluents from affinity columns loaded with heparin, fibronectin, fetuin, actin, plasminogen and A549 surface proteins as bait. To define the sites of cleavage in Mpn142, neo-N-termini in cell lysates of M. pneumoniae were dimethyl-labelled and characterised by LC-MS/MS. Our data suggests that Mpn142 is cleaved to generate adhesins that are auxiliary to P1 and P30.

P40 and P90 from Mpn142 are Targets of Multiple Processing Events on the Surface of Mycoplasma pneumoniae

Science.gov (United States)

Widjaja, Michael; Berry, Iain J.; Pont, Elsa J.; Padula, Matthew P.; Djordjevic, Steven P.

2015-01-01

Mycoplasma pneumoniae is a significant cause of community acquired pneumonia globally. Despite having a genome less than 1 Mb in size, M. pneumoniae presents a structurally sophisticated attachment organelle that (i) provides cell polarity, (ii) directs adherence to receptors presented on respiratory epithelium, and (iii) plays a major role in cell motility. The major adhesins, P1 (Mpn141) and P30 (Mpn453), are localised to the tip of the attachment organelle by the surface accessible cleavage fragments P90 and P40 derived from Mpn142. Two events play a defining role in the formation of P90 and P40; removal of a leader peptide at position 26 (23SLA↓NTY28) during secretion to the cell surface and cleavage at amino acid 455 (452GPL↓RAG457) generating P40 and P90. Liquid Chromatography Tandem Mass Spectrometry (LC-MS/MS) analysis of tryptic peptides generated by digesting size-fractionated cell lysates of M. pneumoniae identified 15 cleavage fragments of Mpn142 ranging in mass from 9–84 kDa. Further evidence for the existence of cleavage fragments of Mpn142 was generated by mapping tryptic peptides to proteins recovered from size fractionated eluents from affinity columns loaded with heparin, fibronectin, fetuin, actin, plasminogen and A549 surface proteins as bait. To define the sites of cleavage in Mpn142, neo-N-termini in cell lysates of M. pneumoniae were dimethyl-labelled and characterised by LC-MS/MS. Our data suggests that Mpn142 is cleaved to generate adhesins that are auxiliary to P1 and P30. PMID:28248283

Multistep Resistance Selection and Postantibiotic-Effect Studies of the Antipneumococcal Activity of LBM415 Compared to Other Agents▿

Science.gov (United States)

Kosowska-Shick, Klaudia; Credito, Kim L.; Pankuch, Glenn A.; DeWasse, Bonifacio; McGhee, Pamela; Appelbaum, Peter C.

2007-01-01

LBM415 is a peptide deformylase inhibitor active against gram-positive bacterial species and some gram-negative species. In multiselection studies, LBM415 had low MICs against all Streptococcus pneumoniae strains tested, regardless of their genotype, and selected resistant clones after 14 to 50 days. MIC increases correlated with changes mostly in the 70GXGXAAXQ77 motif in peptide deformylase. The postantibiotic effect of LBM415 ranged from 0.3 to 1.4 h. PMID:17116666

Efflux pump, the masked side of beta-lactam resistance in Klebsiella pneumoniae clinical isolates.

Directory of Open Access Journals (Sweden)

Jean-Marie Pages

Full Text Available BACKGROUND: Beta-lactamase production and porin decrease are the well-recognized mechanisms of acquired beta-lactam resistance in Klebsiella pneumoniae isolates. However, such mechanisms proved to be absent in K. pneumoniae isolates that are non susceptible to cefoxitin (FOX and susceptible to amoxicillin+clavulanic acid in our hospital. Assessing the role of efflux pumps in this beta-lactam phenotype was the aim of this study. METHODOLOGY/FINDINGS: MICs of 9 beta-lactams, including cloxacillin (CLX, and other antibiotic families were tested alone and with an efflux pump inhibitor (EPI, then with both CLX (subinhibitory concentrations and EPI against 11 unique bacteremia K. pneumoniae isolates displaying the unusual phenotype, and 2 ATCC strains. CLX and EPI-dose dependent effects were studied on 4 representatives strains. CLX MICs significantly decreased when tested with EPI. A similar phenomenon was observed with piperacillin+tazobactam whereas MICs of the other beta-lactams significantly decreased only in the presence of both EPI and CLX. Thus, FOX MICs decreased 128 fold in the K. pneumoniae isolates but also 16 fold in ATCC strain. Restoration of FOX activity was CLX dose-dependent suggesting a competitive relationship between CLX and the other beta-lactams with regard to their efflux. For chloramphenicol, erythromycin and nalidixic acid whose resistance was also due to efflux, adding CLX to EPI did not increase their activity suggesting differences between the efflux process of these molecules and that of beta-lactams. CONCLUSION: This is the first study demonstrating that efflux mechanism plays a key role in the beta-lactam susceptibility of clinical isolates of K. pneumoniae. Such data clearly evidence that the involvement of efflux pumps in beta-lactam resistance is specially underestimated in clinical isolates.

PASTA repeats of the protein kinase StkP interconnect cell constriction and separation of Streptococcus pneumoniae.

Science.gov (United States)

Zucchini, Laure; Mercy, Chryslène; Garcia, Pierre Simon; Cluzel, Caroline; Gueguen-Chaignon, Virginie; Galisson, Frédéric; Freton, Céline; Guiral, Sébastien; Brochier-Armanet, Céline; Gouet, Patrice; Grangeasse, Christophe

2018-02-01

Eukaryotic-like serine/threonine kinases (eSTKs) with extracellular PASTA repeats are key membrane regulators of bacterial cell division. How PASTA repeats govern eSTK activation and function remains elusive. Using evolution- and structural-guided approaches combined with cell imaging, we disentangle the role of each PASTA repeat of the eSTK StkP from Streptococcus pneumoniae. While the three membrane-proximal PASTA repeats behave as interchangeable modules required for the activation of StkP independently of cell wall binding, they also control the septal cell wall thickness. In contrast, the fourth and membrane-distal PASTA repeat directs StkP localization at the division septum and encompasses a specific motif that is critical for final cell separation through interaction with the cell wall hydrolase LytB. We propose a model in which the extracellular four-PASTA domain of StkP plays a dual function in interconnecting the phosphorylation of StkP endogenous targets along with septal cell wall remodelling to allow cell division of the pneumococcus.

In vitro activity of flomoxef and comparators against Escherichia coli, Klebsiella pneumoniae and Proteus mirabilis producing extended-spectrum β-lactamases in China.

Science.gov (United States)

Yang, Qiwen; Zhang, Hui; Cheng, Jingwei; Xu, Zhipeng; Xu, Yingchun; Cao, Bin; Kong, Haishen; Ni, Yuxing; Yu, Yunsong; Sun, Ziyong; Hu, Bijie; Huang, Wenxiang; Wang, Yong; Wu, Anhua; Feng, Xianju; Liao, Kang; Shen, Dingxia; Hu, Zhidong; Chu, Yunzhuo; Lu, Juan; Su, Jianrong; Gui, Bingdong; Duan, Qiong; Zhang, Shufang; Shao, Haifeng

2015-05-01

The objective of this study was to better understand the in vitro activity of flomoxef against clinical extended-spectrum β-lactamase (ESBL)-producing Enterobacteriaceae. A total of 401 ESBL-producing isolates, including 196 Escherichia coli, 124 Klebsiella pneumoniae and 81 Proteus mirabilis, were collected consecutively from 21 hospitals in China in 2013. Minimum inhibitory concentrations (MICs) were determined by broth microdilution methods. Phenotypic identification of ESBL production was detected as recommended by the Clinical and Laboratory Standards Institute (CLSI). ESBL genes were detected by PCR and sequencing. Flomoxef, doripenem, meropenem, ertapenem, cefmetazole and piperacillin/tazobactam exhibited good activity against ESBL-producing isolates, with susceptibility rates >90%. Tigecycline showed good activity against E. coli and K. pneumoniae (100% and 97.6%, respectively). Cefotaxime and cefepime showed very low activities against ESBL-producing isolates, with susceptibility rates of 0-0.8% and 1.0-13.6%, respectively. blaCTX-M were the major ESBL genes, with occurrence in 99.5% of E. coli, 91.1% of K. pneumoniae and 97.5% of P. mirabilis. blaCTX-M-14 was the predominant ESBL gene, detected in 46.9% (188/401) of the isolates, followed by blaCTX-M-15 (21.4%), blaCTX-M-55 (17.2%), blaCTX-M-65 (12.7%) and blaCTX-M-3 (6.7%). Flomoxef exhibited excellent activity against the different CTX-M-type ESBL-producing isolates, with MIC50 and MIC90 values of 0.064-0.125μg/mL and 0.25-0.5μg/mL, respectively. Against the isolates solely producing CTX-M-14, -15, -55, -3 or -65, flomoxef showed susceptibility rates of 98.6%, 98.0%, 98.1%, 100.0% and 97.4%, respectively. In conclusion, flomoxef showed good activity against ESBL-producing Enterobacteriaceae and may be a choice to treat infections caused by these isolates in China. Copyright © 2015 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

In Vitro Assessment of Combined Polymyxin B and Minocycline Therapy against Klebsiella pneumoniae Carbapenemase (KPC)-Producing K. pneumoniae.

Science.gov (United States)

Huang, Dennis; Yu, Brenda; Diep, John K; Sharma, Rajnikant; Dudley, Michael; Monteiro, Jussimara; Kaye, Keith S; Pogue, Jason M; Abboud, Cely Saad; Rao, Gauri G

2017-07-01

The multidrug resistance profiles of Klebsiella pneumoniae carbapenemase (KPC) producers have led to increased clinical polymyxin use. Combination therapy with polymyxins may improve treatment outcomes, but it is uncertain which combinations are most effective. Clinical successes with intravenous minocycline-based combination treatments have been reported for infections caused by carbapenemase-producing bacteria. The objective of this study was to evaluate the in vitro activity of polymyxin B and minocycline combination therapy against six KPC-2-producing K. pneumoniae isolates (minocycline MIC range, 2 to 32 mg/liter). Polymyxin B monotherapy (0.5, 1, 2, 4, and 16 mg/liter) resulted in a rapid reduction of up to 6 log in bactericidal activity followed by regrowth by 24 h. Minocycline monotherapy (1, 2, 4, 8, and 16 mg/liter) showed no reduction of activity of >1.34 log against all isolates, although concentrations of 8 and 16 mg/liter prolonged the time to regrowth. When the therapies were used in combination, rapid bactericidal activity was followed by slower regrowth, with synergy (60 of 120 combinations at 24 h, 19 of 120 combinations at 48 h) and additivity (43 of 120 combinations at 24 h, 44 of 120 combinations at 48 h) against all isolates. The extent of killing was greatest against the more susceptible polymyxin B isolates (MICs of ≤0.5 mg/liter) regardless of the minocycline MIC. The pharmacodynamic activity of combined polymyxin B-minocycline therapy against KPC-producing K. pneumoniae is dependent on polymyxin B susceptibility. Further in vitro and animal studies must be performed to fully evaluate the efficacy of this drug combination. Copyright © 2017 American Society for Microbiology.

[Microbiology of bronchoalveolar lavage in infants with bacterial community-acquired pneumonia with poor outcome].

Science.gov (United States)

García-Elorriaga, Guadalupe; Palma-Alaniz, Laura; García-Bolaños, Carlos; Ruelas-Vargas, Consuelo; Méndez-Tovar, Socorro; Del Rey-Pineda, Guillermo

Community-acquired pneumonia (CAP) is one of the most common infectious causes of morbidity and mortality in children <5 years of age. The aim of the study was to clarify the bacterial etiologic diagnosis in infants with CAP. A prospective, cross-sectional and descriptive study in patients 6 months to 2 years 11 months of age with CAP with poor outcome was conducted. Patients were admitted to the Pediatric Pneumology Service and underwent bronchoscopy with bronchoalveolar lavage (BAL), taking appropriate measures during the procedure to limit the risk of contamination. Aerobic bacteria isolated were Moraxella sp. 23%, Streptococcus mitis 23%, Streptococcus pneumoniae 18%, Haemophilus influenzae 12%, Streptococcus oralis 12%, and Streptococcus salivarius 12%. In contrast to other reports, we found Moraxella sp. to be a major bacterial pathogen, possibly because of improved detection with bronchoscopy plus BAL. Copyright © 2015 Hospital Infantil de México Federico Gómez. Publicado por Masson Doyma México S.A. All rights reserved.

Activación del polisacárido capsular de Streptococcus pneumoniae serotipo 23F para la obtención de vacunas conjugadas

Directory of Open Access Journals (Sweden)

Janoi Chang-Calderón

2017-04-01

Full Text Available En la actualidad, las vacunas conjugadas constituyen un gran hito en el desarrollo de fármacos que protegen contra las enfermedades infecciosas. Estas vacunas no solo disminuyen drásticamente la mortalidad y morbilidad de diferentes enfermedades causadas por bacterias en la población infantil; sino que también repercuten sobre la población no vacunada. Las vacunas conjugadas se basan en establecer una unión covalente entre un polisacárido y una proteína portadora para lo cual existen diferentes procedimientos químicos. Todos los procedimientos de conjugación requieren la presencia de grupos reactivos complementarios que muchas veces son generados en ambas macromoléculas. Este trabajo se enfoca en el estudio de la reacción de fragmentación y de la oxidación peryódica sobre el polisacárido capsular serotipo 23F de Streptococcus pneumoniae para su uso como antígeno vacunal. Se estableció la fragmentación del polisacárido mediante hidrólisis con ácido acético y trifluoroácetico. En el caso de la reacción de oxidación se encontró que la cantidad de moles de peryodato de sodio y la temperatura influyen de manera directamente proporcional sobre la generación de grupos carbonilos. Adicionalmente se demostró que el sustituyente glicerol-fosfatos presente en la estructura del serotipo 23F es relevante para conservar la antigenicidad. El procedimiento descrito permite obtener conjugados inmunogénicos a partir del polisacárido capsular de Streptococcus pneumoniae serotipo 23F en el modelo de conejos.

The impact of pneumolysin on the macrophage response to Streptococcus pneumoniae is strain-dependent.

Directory of Open Access Journals (Sweden)

Richard M Harvey

Full Text Available Streptococcus pneumoniae is the world's leading cause of pneumonia, bacteremia, meningitis and otitis media. A major pneumococcal virulence factor is the cholesterol-dependent cytolysin, which has the defining property of forming pores in cholesterol-containing membranes. In recent times a clinically significant and internationally successful serotype 1 ST306 clone has been found to express a non-cytolytic variant of Ply (Ply306. However, while the pneumococcus is a naturally transformable organism, strains of the ST306 clonal group have to date been virtually impossible to transform, severely restricting efforts to understand the role of non-cytolytic Ply in the success of this clone. In this study isogenic Ply mutants were constructed in the D39 background and for the first time in the ST306 background (A0229467 to enable direct comparisons between Ply variants for their impact on the immune response in a macrophage-like cell line. Strains that expressed cytolytic Ply were found to induce a significant increase in IL-1β release from macrophage-like cells compared to the non-cytolytic and Ply-deficient strains in a background-independent manner, confirming the requirement for pore formation in the Ply-dependent activation of the NLRP3 inflammasome. However, cytolytic activity in the D39 background was found to induce increased expression of the genes encoding GM-CSF (CSF2, p19 subunit of IL-23 (IL23A and IFNβ (IFNB1 compared to non-cytolytic and Ply-deficient D39 mutants, but had no effect in the A0229467 background. The impact of Ply on the immune response to the pneumococcus is highly dependent on the strain background, thus emphasising the importance of the interaction between specific virulence factors and other components of the genetic background of this organism.

A complex of equine lysozyme and oleic acid with bactericidal activity against Streptococcus pneumoniae.

Directory of Open Access Journals (Sweden)

Emily A Clementi

Full Text Available HAMLET and ELOA are complexes consisting of oleic acid and two homologous, yet functionally different, proteins with cytotoxic activities against mammalian cells, with HAMLET showing higher tumor cells specificity, possibly due to the difference in propensity for oleic acid binding, as HAMLET binds 5-8 oleic acid molecules per protein molecule and ELOA binds 11-48 oleic acids. HAMLET has been shown to possess bactericidal activity against a number of bacterial species, particularly those with a respiratory tropism, with Streptococcus pneumoniae displaying the greatest degree of sensitivity. We show here that ELOA also displays bactericidal activity against pneumococci, which at lower concentrations shows mechanistic similarities to HAMLET's bactericidal activity. ELOA binds to S. pneumoniae and causes perturbations of the plasma membrane, including depolarization and subsequent rupture, and activates an influx of calcium into the cells. Selective inhibition of calcium channels and sodium/calcium exchange activity significantly diminished ELOA's bactericidal activity, similar to what we have observed with HAMLET. Finally, ELOA-induced death was also accompanied by DNA fragmentation into high molecular weight fragments - an apoptosis-like morphological phenotype that is seen during HAMLET-induced death. Thus, in contrast to different mechanisms of eukaryote cell death induced by ELOA and HAMLET, these complexes are characterized by rather similar activities towards bacteria. Although the majority of these events could be mimicked using oleic acid alone, the concentrations of oleic acid required were significantly higher than those present in the ELOA complex, and for some assays, the results were not identical between oleic acid alone and the ELOA complex. This indicates that the lipid, as a common denominator in both complexes, is an important component for the complexes' bactericidal activities, while the proteins are required both to solubilize

Streptococcus pneumoniae serotype-2 childhood meningitis in Bangladesh: a newly recognized pneumococcal infection threat.

Directory of Open Access Journals (Sweden)

Samir K Saha

Full Text Available BACKGROUND: Streptococcus pneumoniae is a leading cause of meningitis in countries where pneumococcal conjugate vaccines (PCV targeting commonly occurring serotypes are not routinely used. However, effectiveness of PCV would be jeopardized by emergence of invasive pneumococcal diseases (IPD caused by serotypes which are not included in PCV. Systematic hospital based surveillance in Bangladesh was established and progressively improved to determine the pathogens causing childhood sepsis and meningitis. This also provided the foundation for determining the spectrum of serotypes causing IPD. This article reports an unprecedented upsurge of serotype 2, an uncommon pneumococcal serotype, without any known intervention. METHODS AND FINDINGS: Cases with suspected IPD had blood or cerebrospinal fluid (CSF collected from the beginning of 2001 till 2009. Pneumococcal serotypes were determined by capsular swelling of isolates or PCR of culture-negative CSF specimens. Multicenter national surveillance, expanded from 2004, identified 45,437 patients with suspected bacteremia who were blood cultured and 10,618 suspected meningitis cases who had a lumber puncture. Pneumococcus accounted for 230 culture positive cases of meningitis in children <5 years. Serotype-2 was the leading cause of pneumococcal meningitis, accounting for 20.4% (45/221; 95% CI 15%-26% of cases. Ninety eight percent (45/46 of these serotype-2 strains were isolated from meningitis cases, yielding the highest serotype-specific odds ratio for meningitis (29.6; 95% CI 3.4-256.3. The serotype-2 strains had three closely related pulsed field gel electrophoresis types. CONCLUSIONS: S. pneumoniae serotype-2 was found to possess an unusually high potential for causing meningitis and was the leading serotype-specific cause of childhood meningitis in Bangladesh over the past decade. Persisting disease occurrence or progressive spread would represent a major potential infection threat since serotype-2

Community-acquired pneumonia in children - a changing spectrum of disease.

Science.gov (United States)

le Roux, David M; Zar, Heather J

2017-10-01

Pneumonia remains the leading cause of death in children outside the neonatal period, despite advances in prevention and management. Over the last 20 years, there has been a substantial decrease in the incidence of childhood pneumonia and pneumonia-associated mortality. New conjugate vaccines against Haemophilus influenzae type b and Streptococcus pneumoniae have contributed to decreases in radiologic, clinical and complicated pneumonia cases and have reduced hospitalization and mortality. The importance of co-infections with multiple pathogens and the predominance of viral-associated disease are emerging. Better access to effective preventative and management strategies is needed in low- and middle-income countries, while new strategies are needed to address the residual burden of disease once these have been implemented.

Community-acquired pneumonia in children. A changing spectrum of disease

International Nuclear Information System (INIS)

Le Roux, David M.; Zar, Heather J.

2017-01-01

Pneumonia remains the leading cause of death in children outside the neonatal period, despite advances in prevention and management. Over the last 20 years, there has been a substantial decrease in the incidence of childhood pneumonia and pneumonia-associated mortality. New conjugate vaccines against Haemophilus influenzae type b and Streptococcus pneumoniae have contributed to decreases in radiologic, clinical and complicated pneumonia cases and have reduced hospitalization and mortality. The importance of co-infections with multiple pathogens and the predominance of viral-associated disease are emerging. Better access to effective preventative and management strategies is needed in low- and middle-income countries, while new strategies are needed to address the residual burden of disease once these have been implemented. (orig.)

Community-acquired pneumonia in children. A changing spectrum of disease

Energy Technology Data Exchange (ETDEWEB)

Le Roux, David M. [Red Cross War Memorial Children' s Hospital, Cape Town (South Africa); New Somerset Hospital, Department of Paediatrics, Cape Town (South Africa); Zar, Heather J. [Red Cross War Memorial Children' s Hospital, Cape Town (South Africa)

2017-10-15

Pneumonia remains the leading cause of death in children outside the neonatal period, despite advances in prevention and management. Over the last 20 years, there has been a substantial decrease in the incidence of childhood pneumonia and pneumonia-associated mortality. New conjugate vaccines against Haemophilus influenzae type b and Streptococcus pneumoniae have contributed to decreases in radiologic, clinical and complicated pneumonia cases and have reduced hospitalization and mortality. The importance of co-infections with multiple pathogens and the predominance of viral-associated disease are emerging. Better access to effective preventative and management strategies is needed in low- and middle-income countries, while new strategies are needed to address the residual burden of disease once these have been implemented. (orig.)

Application of Quaternion in improving the quality of global sequence alignment scores for an ambiguous sequence target in Streptococcus pneumoniae DNA

Science.gov (United States)

Lestari, D.; Bustamam, A.; Novianti, T.; Ardaneswari, G.

2017-07-01

DNA sequence can be defined as a succession of letters, representing the order of nucleotides within DNA, using a permutation of four DNA base codes including adenine (A), guanine (G), cytosine (C), and thymine (T). The precise code of the sequences is determined using DNA sequencing methods and technologies, which have been developed since the 1970s and currently become highly developed, advanced and highly throughput sequencing technologies. So far, DNA sequencing has greatly accelerated biological and medical research and discovery. However, in some cases DNA sequencing could produce any ambiguous and not clear enough sequencing results that make them quite difficult to be determined whether these codes are A, T, G, or C. To solve these problems, in this study we can introduce other representation of DNA codes namely Quaternion Q = (PA, PT, PG, PC), where PA, PT, PG, PC are the probability of A, T, G, C bases that could appear in Q and PA + PT + PG + PC = 1. Furthermore, using Quaternion representations we are able to construct the improved scoring matrix for global sequence alignment processes, by applying a dot product method. Moreover, this scoring matrix produces better and higher quality of the match and mismatch score between two DNA base codes. In implementation, we applied the Needleman-Wunsch global sequence alignment algorithm using Octave, to analyze our target sequence which contains some ambiguous sequence data. The subject sequences are the DNA sequences of Streptococcus pneumoniae families obtained from the Genebank, meanwhile the target DNA sequence are received from our collaborator database. As the results we found the Quaternion representations improve the quality of the sequence alignment score and we can conclude that DNA sequence target has maximum similarity with Streptococcus pneumoniae.

Cysteine-mediated gene expression and characterization of the CmbR regulon in Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Muhammad Afzal

2016-12-01

Full Text Available In this study, we investigated the transcriptomic response of Streptococcus pneumoniae D39 to cysteine. Transcriptome comparison of the D39 wild-type strain grown at a restricted concentration of cysteine (0.03 mM to one grown at a high concentration of cysteine (50 mM in chemically-define medium (CDM revealed elevated expression of various genes/operons, i.e. spd-0150, metQ, spd-0431, metEF, gshT, spd-0618, fhs, tcyB, metB-csd, metA, spd-1898, yvdE, and cysK, likely to be involved in the transport and utilization of cysteine and/or methionine. Microarray-based data were further confirmed by quantitative RT-PCR. Promoter lacZ-fusion studies and quantitative RT-PCR data showed that the transcriptional regulator CmbR acts as a transcriptional repressor of spd-0150, metEF, gshT, spd-0618, tcyB, metA, and yvdE, putatively involved in cysteine uptake and utilization. The operator site of CmbR in the promoter regions of CmbR-regulated genes is predicted and confirmed by mutating or deleting CmbR operator sites from the promoter regions of these genes.

Nasopharyngeal colonization and invasive disease are enhanced by the cell wall hydrolases LytB and LytC of Streptococcus pneumoniae.

Directory of Open Access Journals (Sweden)

Elisa Ramos-Sevillano

Full Text Available BACKGROUND: Streptococcus pneumoniae is a common colonizer of the human nasopharynx and one of the major pathogens causing invasive disease worldwide. Dissection of the molecular pathways responsible for colonization, invasion, and evasion of the immune system will provide new targets for antimicrobial or vaccine therapies for this common pathogen. METHODOLOGY/PRINCIPAL FINDINGS: We have constructed mutants lacking the pneumococcal cell wall hydrolases (CWHs LytB and LytC to investigate the role of these proteins in different phases of the pneumococcal pathogenesis. Our results show that LytB and LytC are involved in the attachment of S. pneumoniae to human nasopharyngeal cells both in vitro and in vivo. The interaction of both proteins with phagocytic cells demonstrated that LytB and LytC act in concert avoiding pneumococcal phagocytosis mediated by neutrophils and alveolar macrophages. Furthermore, C3b deposition was increased on the lytC mutant confirming that LytC is involved in complement evasion. As a result, the lytC mutant showed a reduced ability to successfully cause pneumococcal pneumonia and sepsis. Bacterial mutants lacking both LytB and LytC showed a dramatically impaired attachment to nasopharyngeal cells as well as a marked degree of attenuation in a mouse model of colonization. In addition, C3b deposition and phagocytosis was more efficient for the double lytB lytC mutant and its virulence was greatly impaired in both systemic and pulmonary models of infection. CONCLUSIONS/SIGNIFICANCE: This study confirms that the CWHs LytB and LytC of S. pneumoniae are essential virulence factors involved in the colonization of the nasopharynx and in the progress of invasive disease by avoiding host immunity.

SpxB is a suicide gene of Streptococcus pneumoniae and confers a selective advantage in an in vivo competitive colonization model.

Science.gov (United States)

Regev-Yochay, Gili; Trzcinski, Krzysztof; Thompson, Claudette M; Lipsitch, Marc; Malley, Richard

2007-09-01

The human bacterial pathogen Streptococcus pneumoniae dies spontaneously upon reaching stationary phase. The extent of S. pneumoniae death at stationary phase is unusual in bacteria and has been conventionally attributed to autolysis by the LytA amidase. In this study, we show that spontaneous pneumococcal death is due to hydrogen peroxide (H(2)O(2)), not LytA, and that the gene responsible for H(2)O(2) production (spxB) also confers a survival advantage in colonization. Survival of S. pneumoniae in stationary phase was significantly prolonged by eliminating H(2)O(2) in any of three ways: chemically by supplementing the media with catalase, metabolically by growing the bacteria under anaerobic conditions, or genetically by constructing DeltaspxB mutants that do not produce H(2)O(2). Likewise, addition of H(2)O(2) to exponentially growing S. pneumoniae resulted in a death rate similar to that of cells in stationary phase. While DeltalytA mutants did not lyse at stationary phase, they died at a rate similar to that of the wild-type strain. Furthermore, we show that the death process induced by H(2)O(2) has features of apoptosis, as evidenced by increased annexin V staining, decreased DNA content, and appearance as assessed by transmission electron microscopy. Finally, in an in vivo rat model of competitive colonization, the presence of spxB conferred a selective advantage over the DeltaspxB mutant, suggesting an explanation for the persistence of this gene. We conclude that a suicide gene of pneumococcus is spxB, which induces an apoptosis-like death in pneumococci and confers a selective advantage in nasopharyngeal cocolonization.

Deletion analysis of Streptococcus pneumoniae late competence genes distinguishes virulence determinants that are dependent or independent of competence induction.

Science.gov (United States)

Zhu, Luchang; Lin, Jingjun; Kuang, Zhizhou; Vidal, Jorge E; Lau, Gee W

2015-07-01

The competence regulon of Streptococcus pneumoniae (pneumococcus) is crucial for genetic transformation. During competence development, the alternative sigma factor ComX is activated, which in turn, initiates transcription of 80 'late' competence genes. Interestingly, only 16 late genes are essential for genetic transformation. We hypothesized that these late genes that are dispensable for competence are beneficial to pneumococcal fitness during infection. These late genes were systematically deleted, and the resulting mutants were examined for their fitness during mouse models of bacteremia and acute pneumonia. Among these, 14 late genes were important for fitness in mice. Significantly, deletion of some late genes attenuated pneumococcal fitness to the same level in both wild-type and ComX-null genetic backgrounds, suggesting that the constitutive baseline expression of these genes was important for bacterial fitness. In contrast, some mutants were attenuated only in the wild-type genetic background but not in the ComX-null background, suggesting that specific expression of these genes during competence state contributed to pneumococcal fitness. Increased virulence during competence state was partially caused by the induction of allolytic enzymes that enhanced pneumolysin release. These results distinguish the role of basal expression versus competence induction in virulence functions encoded by ComX-regulated late competence genes. © 2015 John Wiley & Sons Ltd.

Clinical presentation and prognostic factors of Streptococcus pneumoniae meningitis according to the focus of infection

Directory of Open Access Journals (Sweden)

Samuelsson Susanne

2005-10-01

Full Text Available Abstract Background We conducted a nationwide study in Denmark to identify clinical features and prognostic factors in patients with Streptococcus pneumoniae according to the focus of infection. Methods Based on a nationwide registration, clinical information's was prospectively collected from all reported cases of pneumococcal meningitis during a 2-year period (1999–2000. Clinical and laboratory findings at admission, clinical course and outcome of the disease including follow-up audiological examinations were collected retrospectively. The focus of infection was determined according to the clinical diagnosis made by the physicians and after review of the medical records. Results 187 consecutive cases with S. pneumoniae meningitis were included in the study. The most common focus was ear (30%, followed by lung (18%, sinus (8%, and other (2%. In 42% of cases a primary infection focus could not be determined. On admission, fever and an altered mental status were the most frequent findings (in 93% and 94% of cases, respectively, whereas back rigidity, headache and convulsion were found in 57%, 41% and 11% of cases, respectively. 21% of patients died during hospitalisation (adults: 27% vs. children: 2%, Fisher Exact Test, P P = 0.0005. Prognostic factors associated with fatal outcome in univariate logistic regression analysis were advanced age, presence of an underlying disease, history of headache, presence of a lung focus, absence of an otogenic focus, having a CT-scan prior to lumbar puncture, convulsions, requirement of assisted ventilation, and alterations in various CSF parameters (WBC P P = 0.005. Conclusion These results emphasize the prognostic importance of an early recognition of a predisposing focus to pneumococcal meningitis.

Molecular and antimicrobial susceptibility profiling of atypical Streptococcus species from porcine clinical specimens.

Science.gov (United States)

Moreno, Luisa Z; Matajira, Carlos E C; Gomes, Vasco T M; Silva, Ana Paula S; Mesquita, Renan E; Christ, Ana Paula G; Sato, Maria Inês Z; Moreno, Andrea M

2016-10-01

The Streptococcus species present broad phenotypic variation, making identification difficult using only traditional microbiological methods. Even though Streptococcus suis is the most important species for the worldwide swine industry, other Streptococcus species appear to be able to cause disease in swine and could represent a higher underestimated risk for porcine health. The aim of this study was to identify Streptococcus-like isolates by MALDI-TOF MS and 16S rRNA sequencing and further molecular and antibiotic susceptibility characterization of the atypical Streptococcus species capable of causing disease in swine. Fifty presumptive Streptococcus isolates from diseased pigs isolated from different Brazilian States between 2002 and 2014 were evaluated. Among the studied isolates, 26% were identified as Streptococcus hyovaginalis, 24% as Streptococcus plurianimalium, 12% as Streptococcus alactolyticus, 10% as Streptococcus hyointestinalis, and the remaining isolates belonged to Streptococcus henryi (6%), Streptococcus thoraltensis (6%), Streptococcus gallolyticus (6%), Streptococcus gallinaceus (4%), Streptococcus sanguinis (4%), and Streptococcus mitis (2%). The Streptococcus isolates were successfully identified by spectral cluster analysis and 16S rRNA sequencing with 96% of concordance between the techniques. The SE-AFLP analysis also supported Streptococcus species distinction and enabled further observation of higher genetic heterogeneity intra-species. The identified Streptococcus species presented variable MIC values to β-lactams, enrofloxacin and florfenicol, and high resistance rates to tetracyclines and macrolides, which appear to be directly related to the industry's antimicrobial usage and resistance selection. Copyright © 2016 Elsevier B.V. All rights reserved.

Protease-activated receptor-1 impairs host defense in murine pneumococcal pneumonia: a controlled laboratory study

NARCIS (Netherlands)

Schouten, Marcel; van't Veer, Cornelis; Roelofs, Joris J. T. H.; Levi, Marcel; van der Poll, Tom

2012-01-01

Streptococcus pneumoniae is the most common causative pathogen in community-acquired pneumonia. Protease-activated receptor-1 (PAR-1) is expressed by multiple cell types present in the lungs and can be activated by various proteases generated during acute inflammation. The cellular effect of PAR-1

Spectrum and potency of ceftaroline against leading pathogens causing community-acquired respiratory tract and skin and soft tissue infections in Latin America, 2010

Directory of Open Access Journals (Sweden)

Robert K. Flamm

Full Text Available Ceftaroline, the active metabolite of the prodrug ceftaroline fosamil, is a cephalosporin with in vitro bactericidal activity against Gram-positive organisms, including methicillinsusceptible and -resistant Staphylococcus aureus, β-haemolytic and viridans group streptococci, and Streptococcus pneumoniae, as well as common Gram-negative organisms. In this study a total of 986 isolates collected in 2010 from patients in 15 medical centers in five Latin American countries from the Assessing Worldwide Antimicrobial Resistance Evaluation Program were identified as community-acquired respiratory tract or skin and soft tissue infection pathogens. Ceftaroline was the most potent agent tested against S. pneumoniae with a MIC90 value (0.12 µg/mL that was eight-fold lower than ceftriaxone, levofloxacin, and linezolid. Its spectrum of coverage (100.0% susceptible was similar to tigecycline, linezolid, levofloxacin and vancomycin. Against Haemophilus influenzae and Moraxella catarrhalis, ceftaroline was the most active agent tested. The activity of ceftaroline against S. aureus (including MRSA was similar to that of vancomycin and tetracycline (MIC90,1 µg/mL and linezolid (MIC90,2 Jg/mL. The 1-haemolytic streptococci exhibited 100.0% susceptibility to ceftaroline. Ceftaroline activity against Escherichia coli, Klebsiella spp., and Enterobacter spp. was similar to that of ceftriaxone and ceftazidime. These parenteral cephalosporin agents have potent activity against non-extended-spectrum These parenteral cephalosporin agents have potent activity against non-extended-spectrum-lactamase-phenotype strains, but are not active against extended-spectrum β-lactamase-phenotype strains. These results confirm the in vitro activity of ceftaroline against pathogens common in communityacquired respiratory tract and skin and soft tissue infection in Latin America, and suggest that ceftaroline fosamil could be an important therapeutic option for these infections.

Global survey of Klebsiella pneumoniae major porins from ertapenem non-susceptible isolates lacking carbapenemases.

Science.gov (United States)

Wise, Mark G; Horvath, Elizabeth; Young, Katherine; Sahm, Daniel F; Kazmierczak, Krystyna M

2018-03-01

To understand the diversity of porin disruption in Klebsiella pneumoniae, the major outer membrane protein (OMP) porins, OmpK35 and OmpK36, were examined in a set of isolates that did not harbour traditional carbapenem-hydrolysing enzymes, but nevertheless tested non-susceptible to ertapenem. A world-wide collection of Klebsiella pneumoniae isolates that were part of the Study for Monitoring Antimicrobial Resistance Trends (SMART) surveillance project over the years 2008-2014 were characterised with regard to their β-lactamase gene carriage and potential permeability defects. Four hundred and eighty-seven isolates that did not carry carbapenemase genes, but were non-susceptible to ertapenem, were investigated by sequence analysis of the genes encoding OmpK35 and OmpK36. Isolates without obvious genetic lesions in either major porin gene were further examined by outer membrane protein SDS-PAGE. The majority of isolates, 83.0 % (404/487), exhibited clear genetic disruption in either or both of the ompK35 and ompK36 genes. Among the proportion of the collection with the highest ertapenem MIC value (>4 mg l -1 ), 60.5 % (115/190) showed mutation in both porin genes. Isolates without obvious genetic mutations were examined by SDS-PAGE, and 90.4 % (75/83) were found to lack or show altered expression of at least one of the major OMPs when compared to an ertapenem sensitive control strain. This study illustrates that porin deficiency in Klebsiella pneumoniae is a widespread phenomenon, and in combination with ESBLs and/or AmpC enzymes, likely accounts for the elevated ertapenem MICs observed in this study.

Caracterización molecular de aislamientos invasores colombianos de Streptococcus pneumoniae serotipo 5 recuperados entre 1994 y 2004.

Directory of Open Access Journals (Sweden)

Carolina Firacative

2006-06-01

Full Text Available Introducción. Streptococcus pneumoniae serotipo 5 es causa importante de enfermedad invasora en Colombia, donde se ha demostrado la circulación del clon 19-Colombia(5 susceptible a penicilina pero resistente a tetraciclina y a cloranfenicol. Objetivo. Establecer las relaciones genéticas de aislamientos invasores colombianos de S. pneumoniae serotipo 5 recuperados entre 1994 y 2004 con el clon 19-Colombia(5. Materiales y métodos. Se estudiaron 83 aislamientos que tenían datos de susceptibilidad a penicilina, vancomicina, ceftriaxona, eritromicina, trimetoprim sulfametoxazol, cloranfenicol y tetraciclina, de los cuales 29 fueron obtenidos de niños menores de cinco años. El patrón de restricción del ADN se determinó por electroforesis en gel de campo pulsado, usando la enzima Sma I. La similitud genética entre los aislamientos y el clon se estableció según los criterios de Tenover y utilizando el programa Fingerprinting II. Resultados. Todos los aislamientos se relacionaron con el clon 19-Colombia5 y se agruparon en el patrón electroforético A con 17 subtipos. El patrón A se estableció en 32 aislamientos (38,6%, el A8 en 18 (21,7% y el A5 en 10 (12%, los 15 patrones restantes agruparon los otros 23 aislamientos. Los 34 aislamientos resistentes a tetraciclina y cloranfenicol mostraron relación con los patrones electroforéticos A (n = 32, A16 (n = 1 y A28 (n = 1, caracterizados, al igual que el clon, por presentar una banda de 340 Kb. Conclusión. Estos resultados muestran la circulación continua en el país de aislamientos de S. pneumoniae serotipo 5 genéticamente relacionados con el clon 19-Colombia(5.

Genetic analysis of the capsular biosynthetic locus from all 90 pneumococcal serotypes.

Directory of Open Access Journals (Sweden)

Stephen D Bentley

2006-03-01

Full Text Available Several major invasive bacterial pathogens are encapsulated. Expression of a polysaccharide capsule is essential for survival in the blood, and thus for virulence, but also is a target for host antibodies and the basis for effective vaccines. Encapsulated species typically exhibit antigenic variation and express one of a number of immunochemically distinct capsular polysaccharides that define serotypes. We provide the sequences of the capsular biosynthetic genes of all 90 serotypes of Streptococcus pneumoniae and relate these to the known polysaccharide structures and patterns of immunological reactivity of typing sera, thereby providing the most complete understanding of the genetics and origins of bacterial polysaccharide diversity, laying the foundations for molecular serotyping. This is the first time, to our knowledge, that a complete repertoire of capsular biosynthetic genes has been available, enabling a holistic analysis of a bacterial polysaccharide biosynthesis system. Remarkably, the total size of alternative coding DNA at this one locus exceeds 1.8 Mbp, almost equivalent to the entire S. pneumoniae chromosomal complement.

Infección invasiva por Streptococcus pneumoniae: reporte de caso de un paciente con síndrome de Austrian

Directory of Open Access Journals (Sweden)

Daniel Echeverri

2015-03-01

Full Text Available Descrito inicialmente en 1957 por Robert Austrian, el síndrome que lleva su nombre se define como la tríada de neumonía, endocarditis y meningitis secundarias a una infección invasiva por Streptococcus pneumoniae. Desde entonces, y debido a su infrecuencia, se han reportado muy pocos casos en la literatura científica. A continuación se presenta el caso de un paciente de 61 años de edad con un cuadro inicial de meningitis bacteriana por S. pneumoniae, acompañado de neumonía bacteriana e insuficiencia mitral grave asociada a cuatro vegetaciones sobre la cara auricular de la valva posterior, con ruptura y prolapso de su festón central posterior. Se aisló S. pneumoniae, serotipo 18C, en líquido cefalorraquídeo y en dos hemocultivos. El paciente recibió antibióticos de amplio espectro y fue sometido a reemplazo valvular temprano con un resultado clínico satisfactorio. El principal factor pronóstico de esta condición lo determina el daño valvular subsecuente, sobre todo en pacientes con compromiso de la válvula aórtica, por lo que es necesario identificar tempranamente la extensión del compromiso valvular y definir oportunamente el tratamiento quirúrgico y antibiótico del paciente. En casos menos frecuentes, en los que solo hay compromiso de la válvula mitral, la evolución clínica es menos aguda y, por lo general, el tratamiento antibiótico dirigido y las medidas de soporte avanzado suelen ser suficientes para su control.

Emerging, Non-PCV13 Serotypes 11A and 35B of Streptococcus pneumoniae Show High Potential for Biofilm Formation In Vitro.

Directory of Open Access Journals (Sweden)

Mirian Domenech

Full Text Available Since the use of pneumococcal conjugate vaccines PCV7 and PCV13 in children became widespread, invasive pneumococcal disease (IPD has dramatically decreased. Nevertheless, there has been a rise in incidence of Streptococcus pneumoniae non-vaccine serotypes (NVT colonising the human nasopharynx. Nasopharyngeal colonisation, an essential step in the development of S. pneumoniae-induced IPD, is associated with biofilm formation. Although the capsule is the main pneumococcal virulence factor, the formation of pneumococcal biofilms might, in fact, be limited by the presence of capsular polysaccharide (CPS.We used clinical isolates of 16 emerging, non-PCV13 serotypes as well as isogenic transformants of the same serotypes. The biofilm formation capacity of isogenic transformants expressing CPSs from NVT was evaluated in vitro to ascertain whether this trait can be used to predict the emergence of NVT. Fourteen out of 16 NVT analysed were not good biofilm formers, presumably because of the presence of CPS. In contrast, serotypes 11A and 35B formed ≥45% of the biofilm produced by the non-encapsulated M11 strain.This study suggest that emerging, NVT serotypes 11A and 35B deserve a close surveillance.

The influence of Streptococcus pneumoniae nasopharyngeal colonization on the clinical outcome of the respiratory tract infections in preschool children.

Science.gov (United States)

Petraitiene, Sigita; Alasevicius, Tomas; Staceviciene, Indre; Vaiciuniene, Daiva; Kacergius, Tomas; Usonis, Vytautas

2015-09-30

Streptococcus pneumoniae (SPn) is an important pathogen causing a variety of clinical manifestations. The effects of SPn nasopharyngeal colonization on respiratory tract infections are poorly studied. We evaluated the association of SPn colonization with features of respiratory tract infections. Children under the age of 6 years who visited a primary care physician because of respiratory tract infections were enrolled in the study. History was taken, children were clinically assessed by the physician, and nasopharyngeal swabs were obtained and cultured for SPn. Positive samples were serotyped. Associations of SPn colonization with clinical signs and symptoms, recovery duration, absence from day care centre, frequencies of specific diagnoses, and treatment with antimicrobials were evaluated. In total 900 children were enrolled. The prevalence of SPn colonization was 40.8 % (n = 367). There were minor differences between male and female subjects (199 of 492, 40.4 % vs 168 of 408, 41.2 %, p = 0.825). Children with and without siblings had similar colonization rates (145 of 334, 43.4 % vs 219 of 562, 39.0 %, p = 0.187). Clinical signs and symptoms were not associated with SPn colonization. Children colonized with SPn had longer recovery duration compared to non-colonized children (114 of 367, 31.1 % vs 98 of 533, 18.4 %, p vs 94 of 284, 33.1 %, p = 0.001). Pneumonia, sinusitis, and acute otitis media were more frequently diagnosed in children colonized with SPn. Children attending day care centres had significantly higher prevalence of SPn colonization (270 of 367, 44.4 % vs 338 of 533, 33.1 %, p = 0.001). Children with pneumonia, sinusitis and acute otitis media were more frequently treated with antimicrobials than children with other diagnoses. SPn nasopharyngeal colonization has a negative impact on the course of respiratory tract infection, likely because of SPn being the cause of the disease or a complicating factor. It is also associated

Concentrations of moxifloxacin in serum and pulmonary compartments following a single 400 mg oral dose in patients undergoing fibre-optic bronchoscopy.

Science.gov (United States)

Soman, A; Honeybourne, D; Andrews, J; Jevons, G; Wise, R

1999-12-01

The concentrations of moxifloxacin achieved after a single 400 mg dose were measured in serum, epithelial lining fluid (ELF), alveolar macrophages (AM) and bronchial mucosa (BM). Concentrations were determined using a microbiological assay. Nineteen patients undergoing fibre-optic bronchoscopy were studied. Mean serum, ELF, AM and BM concentrations at 2.2, 12 and 24 h were as follows: 2.2 h: 3.2 mg/L, 20.7 mg/L, 56.7 mg/L, 5.4 mg/kg; 12 h: 1.1 mg/L, 5.9 mg/L, 54.1 mg/L, 2.0 mg/kg; 24 h: 0.5 mg/L, 3.6 mg/L, 35.9 mg/L, 1.1 mg/kg, respectively. These concentrations exceed the MIC(90)s for common respiratory pathogens such as Streptococcus pneumoniae (0.25 mg/L), Haemophilus influenzae (0.03 mg/L), Moraxella catarrhalis (0.12 mg/L), Chlamydia pneumoniae (0.12 mg/L) and Mycoplasma pneumoniae (0. 12 mg/L) and indicate that moxifloxacin should be effective in the treatment of community-acquired, lower respiratory tract infections.

The Streptococcus sanguinis Competence Regulon Is Not Required for Infective Endocarditis Virulence in a Rabbit Model

OpenAIRE

Callahan, Jill E.; Munro, Cindy L.; Kitten, Todd

2011-01-01

Streptococcus sanguinis is an important component of dental plaque and a leading cause of infective endocarditis. Genetic competence in S. sanguinis requires a quorum sensing system encoded by the early comCDE genes, as well as late genes controlled by the alternative sigma factor, ComX. Previous studies of Streptococcus pneumoniae and Streptococcus mutans have identified functions for the >100-gene com regulon in addition to DNA uptake, including virulence. We investigated this possibility i...

Recombinant human tissue factor pathway inhibitor exerts anticoagulant, anti-inflammatory and antimicrobial effects in murine pneumococcal pneumonia

NARCIS (Netherlands)

van den Boogaard, F. E.; Brands, X.; Schultz, M. J.; Levi, M. [=Marcel M.; Roelofs, J. J. T. H.; van 't Veer, C.; van der Poll, T.

2011-01-01

Background: Streptococcus (S.) pneumoniae is the most common causative pathogen in community-acquired pneumonia and a major cause of sepsis. Recombinant human tissue factor pathway inhibitor (rh-TFPI) attenuates sepsis-induced coagulation and has been evaluated in clinical trials involving patients

An Increase in Streptococcus pneumoniae Serotype 12F

Centers for Disease Control (CDC) Podcasts

2018-02-08

Dr. Cynthia Whitney, a CDC medical doctor and Epidemiologist, discusses serotype 12F pneumoniae.  Created: 2/8/2018 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 2/8/2018.

Streptococcus pneumonia YlxR at 1.35 A shows a putative new fold.

Science.gov (United States)

Osipiuk, J; Górnicki, P; Maj, L; Dementieva, I; Laskowski, R; Joachimiak, A

2001-11-01

The structure of the YlxR protein of unknown function from Streptococcus pneumonia was determined to 1.35 A. YlxR is expressed from the nusA/infB operon in bacteria and belongs to a small protein family (COG2740) that shares a conserved sequence motif GRGA(Y/W). The family shows no significant amino-acid sequence similarity with other proteins. Three-wavelength diffraction MAD data were collected to 1.7 A from orthorhombic crystals using synchrotron radiation and the structure was determined using a semi-automated approach. The YlxR structure resembles a two-layer alpha/beta sandwich with the overall shape of a cylinder and shows no structural homology to proteins of known structure. Structural analysis revealed that the YlxR structure represents a new protein fold that belongs to the alpha-beta plait superfamily. The distribution of the electrostatic surface potential shows a large positively charged patch on one side of the protein, a feature often found in nucleic acid-binding proteins. Three sulfate ions bind to this positively charged surface. Analysis of potential binding sites uncovered several substantial clefts, with the largest spanning 3/4 of the protein. A similar distribution of binding sites and a large sharply bent cleft are observed in RNA-binding proteins that are unrelated in sequence and structure. It is proposed that YlxR is an RNA-binding protein.

Over expression of AdeABC and AcrAB-TolC efflux systems confers tigecycline resistance in clinical isolates of Acinetobacter baumannii and Klebsiella pneumoniae

Directory of Open Access Journals (Sweden)

Yin Yuhan

2016-04-01

Full Text Available Abstract: INTRODUCTION: Due to the wide use of tigecycline in the treatment of severe infections caused by multidrug-resistant (MDR bacteria, clinical resistance to tigecycline has increased in recent years. Here, we investigated the relationship between tigecycline resistance and the expression of efflux pumps. METHODS: Clinical isolates of Acinetobacter baumannii and Klebsiella pneumoniae were consecutively collected from hospitalized patients in three hospitals. The minimum inhibitory concentration (MIC of tigecycline was determined using the broth microdilution method. Expression levels of efflux pump genes and regulators were examined by quantitative real-time reverse transcription polymerase chain reaction. The correlations between tigecycline MICs and gene expression levels were analyzed. RESULTS: Overall, 1,026 A. baumannii and 725 K. pneumoniae strains were collected. Most strains were isolated from sputum. The tigecycline resistance rate was 13.4% in A. baumannii isolates and 6.5% in K. pneumoniae isolates. Overexpression of AdeABC and AcrAB-TolC efflux systems was observed found in clinical tigecycline-resistant isolates. The tigecycline MIC had a linear relationship with the adeB expression level in A. baumannii isolates, but not with the acrB expression level in K. pneumoniae isolates. There were significant linear trends in the overexpression of ramA as the tigecycline MIC increased in K. pneumoniae isolates. CONCLUSIONS: Tigecycline resistance in A. baumannii and K. pneumoniae was strongly associated with the overexpression of efflux systems. More studies are needed to elucidate whether there are other regulators that affect the expression of adeB in A. baumannii and how ramA affects the expression of acrB in K. pneumoniae.

Escherichia coli, Streptococcus pneumoniae, 4(1.2%) Haemophilus ...

African Journals Online (AJOL)

pneumoniae, P.aeruginosa, and. S.aureus may also cause acute conjunctivitis in neonates or children3 In sexually active teenagers and adults,. C.trachomatis and N.gonorrhoea have been implicated. In young children, H.influenzae can cause ...

Increased Nasopharyngeal Density and Concurrent Carriage of Streptococcus pneumoniae, Haemophilus influenzae, and Moraxella catarrhalis Are Associated with Pneumonia in Febrile Children.

Science.gov (United States)

Chochua, Sopio; D'Acremont, Valérie; Hanke, Christiane; Alfa, David; Shak, Joshua; Kilowoko, Mary; Kyungu, Esther; Kaiser, Laurent; Genton, Blaise; Klugman, Keith P; Vidal, Jorge E

2016-01-01

We assessed nasopharyngeal (NP) carriage of five pathogens in febrile children with and without acute respiratory infection (ARI) of the upper (URTI) or lower tract, attending health facilities in Tanzania. NP swabs collected from children (N = 960) aged 2 months to 10 years, and with a temperature ≥38°C, were utilized to quantify bacterial density of S. pneumoniae (Sp), H. influenzae (Hi), M. catarrhalis (Mc), S. aureus (Sa), and N. meningitidis (Nm). We determined associations between presence of individual species, densities, or concurrent carriage of all species combination with respiratory diseases including clinical pneumonia, pneumonia with normal chest radiography (CXR) and endpoint pneumonia. Individual carriage, and NP density, of Sp, Hi, or Mc, but not Sa, or Nm, was significantly associated with febrile ARI and clinical pneumonia when compared to febrile non-ARI episodes. Density was also significantly increased in severe pneumonia when compared to mild URTI (Sp, p<0.002; Hi p<0.001; Mc, p = 0.014). Accordingly, concurrent carriage of Sp+, Hi+, and Mc+, in the absence of Sa- and Nm-, was significantly more prevalent in children with ARI (p = 0.03), or clinical pneumonia (p<0.001) than non-ARI, and in children with clinical pneumonia (p = 0.0007) than URTI. Furthermore, Sp+, Hi+, and Mc+ differentiated children with pneumonia with normal CXR, or endpoint pneumonia, from those with URTI, and non-ARI cases. Concurrent NP carriage of Sp, Hi, and Mc was a predictor of clinical pneumonia and identified children with pneumonia with normal CXR and endpoint pneumonia from those with febrile URTI, or non-ARI episodes.

Increased Nasopharyngeal Density and Concurrent Carriage of Streptococcus pneumoniae, Haemophilus influenzae, and Moraxella catarrhalis Are Associated with Pneumonia in Febrile Children.

Directory of Open Access Journals (Sweden)

Sopio Chochua

Full Text Available We assessed nasopharyngeal (NP carriage of five pathogens in febrile children with and without acute respiratory infection (ARI of the upper (URTI or lower tract, attending health facilities in Tanzania.NP swabs collected from children (N = 960 aged 2 months to 10 years, and with a temperature ≥38°C, were utilized to quantify bacterial density of S. pneumoniae (Sp, H. influenzae (Hi, M. catarrhalis (Mc, S. aureus (Sa, and N. meningitidis (Nm. We determined associations between presence of individual species, densities, or concurrent carriage of all species combination with respiratory diseases including clinical pneumonia, pneumonia with normal chest radiography (CXR and endpoint pneumonia.Individual carriage, and NP density, of Sp, Hi, or Mc, but not Sa, or Nm, was significantly associated with febrile ARI and clinical pneumonia when compared to febrile non-ARI episodes. Density was also significantly increased in severe pneumonia when compared to mild URTI (Sp, p<0.002; Hi p<0.001; Mc, p = 0.014. Accordingly, concurrent carriage of Sp+, Hi+, and Mc+, in the absence of Sa- and Nm-, was significantly more prevalent in children with ARI (p = 0.03, or clinical pneumonia (p<0.001 than non-ARI, and in children with clinical pneumonia (p = 0.0007 than URTI. Furthermore, Sp+, Hi+, and Mc+ differentiated children with pneumonia with normal CXR, or endpoint pneumonia, from those with URTI, and non-ARI cases.Concurrent NP carriage of Sp, Hi, and Mc was a predictor of clinical pneumonia and identified children with pneumonia with normal CXR and endpoint pneumonia from those with febrile URTI, or non-ARI episodes.

Health related quality of life in patients with community-acquired pneumococcal pneumonia in France

OpenAIRE

Andrade, Luiz Flavio; Saba, Grèce; Ricard, Jean-Damien; Messika, Jonathan; Gaillat, Jacques; Bonnin, Pierre; Chidiac, Christian; Illes, Hajnal-Gabriela; Laurichesse, Henri; Detournay, Bruno; Petitpretz, Patrick; de Pouvourville, Gérard

2018-01-01

Background Community Acquired Pneumococcal Pneumonia is a lung infection that causes serious health problems and can lead to complications and death. The aim of this study was to observe and analyze health related quality of life after a hospital episode for patients with community acquired pneumococcal pneumonia in France. Methods A total of 524 individuals were enrolled prospectively in the study and were followed for 12 months after hospital discharge. Presence of streptococcus pneumoniae ...

Monitoring changes in membrane polarity, membrane integrity, and intracellular ion concentrations in Streptococcus pneumoniae using fluorescent dyes.

Science.gov (United States)

Clementi, Emily A; Marks, Laura R; Roche-Håkansson, Hazeline; Håkansson, Anders P

2014-02-17

Membrane depolarization and ion fluxes are events that have been studied extensively in biological systems due to their ability to profoundly impact cellular functions, including energetics and signal transductions. While both fluorescent and electrophysiological methods, including electrode usage and patch-clamping, have been well developed for measuring these events in eukaryotic cells, methodology for measuring similar events in microorganisms have proven more challenging to develop given their small size in combination with the more complex outer surface of bacteria shielding the membrane. During our studies of death-initiation in Streptococcus pneumoniae (pneumococcus), we wanted to elucidate the role of membrane events, including changes in polarity, integrity, and intracellular ion concentrations. Searching the literature, we found that very few studies exist. Other investigators had monitored radioisotope uptake or equilibrium to measure ion fluxes and membrane potential and a limited number of studies, mostly in Gram-negative organisms, had seen some success using carbocyanine or oxonol fluorescent dyes to measure membrane potential, or loading bacteria with cell-permeant acetoxymethyl (AM) ester versions of ion-sensitive fluorescent indicator dyes. We therefore established and optimized protocols for measuring membrane potential, rupture, and ion-transport in the Gram-positive organism S. pneumoniae. We developed protocols using the bis-oxonol dye DiBAC4(3) and the cell-impermeant dye propidium iodide to measure membrane depolarization and rupture, respectively, as well as methods to optimally load the pneumococci with the AM esters of the ratiometric dyes Fura-2, PBFI, and BCECF to detect changes in intracellular concentrations of Ca(2+), K(+), and H(+), respectively, using a fluorescence-detection plate reader. These protocols are the first of their kind for the pneumococcus and the majority of these dyes have not been used in any other bacterial

Impact of the factor V Leiden mutation on the outcome of pneumococcal pneumonia: a controlled laboratory study

NARCIS (Netherlands)

Schouten, Marcel; van 't Veer, Cornelis; Roelofs, Joris Jth; Levi, Marcel; van der Poll, Tom

2010-01-01

Introduction: Streptococcus (S.) pneumoniae is the most common cause of community-acquired pneumonia. The factor V Leiden (FVL) mutation results in resistance of activated FV to inactivation by activated protein C and thereby in a prothrombotic phenotype. Human heterozygous FVL carriers have been

A Multi-Scale Computational Study on the Mechanism of Streptococcus pneumoniae Nicotinamidase (SpNic

Directory of Open Access Journals (Sweden)

Bogdan F. Ion

2014-09-01

Full Text Available Nicotinamidase (Nic is a key zinc-dependent enzyme in NAD metabolism that catalyzes the hydrolysis of nicotinamide to give nicotinic acid. A multi-scale computational approach has been used to investigate the catalytic mechanism, substrate binding and roles of active site residues of Nic from Streptococcus pneumoniae (SpNic. In particular, density functional theory (DFT, molecular dynamics (MD and ONIOM quantum mechanics/molecular mechanics (QM/MM methods have been employed. The overall mechanism occurs in two stages: (i formation of a thioester enzyme-intermediate (IC2 and (ii hydrolysis of the thioester bond to give the products. The polar protein environment has a significant effect in stabilizing reaction intermediates and in particular transition states. As a result, both stages effectively occur in one step with Stage 1, formation of IC2, being rate limiting barrier with a cost of 53.5 kJ•mol−1 with respect to the reactant complex, RC. The effects of dispersion interactions on the overall mechanism were also considered but were generally calculated to have less significant effects with the overall mechanism being unchanged. In addition, the active site lysyl (Lys103 is concluded to likely play a role in stabilizing the thiolate of Cys136 during the reaction.

A multi-scale computational study on the mechanism of Streptococcus pneumoniae Nicotinamidase (SpNic).

Science.gov (United States)

Ion, Bogdan F; Kazim, Erum; Gauld, James W

2014-09-29

Nicotinamidase (Nic) is a key zinc-dependent enzyme in NAD metabolism that catalyzes the hydrolysis of nicotinamide to give nicotinic acid. A multi-scale computational approach has been used to investigate the catalytic mechanism, substrate binding and roles of active site residues of Nic from Streptococcus pneumoniae (SpNic). In particular, density functional theory (DFT), molecular dynamics (MD) and ONIOM quantum mechanics/molecular mechanics (QM/MM) methods have been employed. The overall mechanism occurs in two stages: (i) formation of a thioester enzyme-intermediate (IC2) and (ii) hydrolysis of the thioester bond to give the products. The polar protein environment has a significant effect in stabilizing reaction intermediates and in particular transition states. As a result, both stages effectively occur in one step with Stage 1, formation of IC2, being rate limiting barrier with a cost of 53.5 kJ·mol-1 with respect to the reactant complex, RC. The effects of dispersion interactions on the overall mechanism were also considered but were generally calculated to have less significant effects with the overall mechanism being unchanged. In addition, the active site lysyl (Lys103) is concluded to likely play a role in stabilizing the thiolate of Cys136 during the reaction.

In vitro antibacterial activity of ceftobiprole against clinical isolates from French teaching hospitals: proposition of zone diameter breakpoints.

Science.gov (United States)

Lascols, C; Legrand, P; Mérens, A; Leclercq, R; Muller-Serieys, C; Drugeon, H B; Kitzis, M D; Reverdy, M E; Roussel-Delvallez, M; Moubareck, C; Brémont, S; Miara, A; Gjoklaj, M; Soussy, C-J

2011-03-01

The aims of this study were to determine the in vitro activity profile of ceftobiprole, a pyrrolidinone cephalosporin, against a large number of bacterial pathogens and to propose zone diameter breakpoints for clinical categorisation according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) minimum inhibitory concentration (MIC) breakpoints. MICs of ceftobiprole were determined by broth microdilution against 1548 clinical isolates collected in eight French hospitals. Disk diffusion testing was performed using 30 μg disks according to the method of the Comité de l'Antibiogramme de la Société Française de Microbiologie (CA-SFM). The in vitro activity of ceftobiprole, expressed by MIC(50/90) (MICs for 50% and 90% of the organisms, respectively) (mg/L), was as follows: meticillin-susceptible Staphylococcus aureus, 0.25/0.5; meticillin-resistant S. aureus (MRSA), 1/2; meticillin-susceptible coagulase-negative staphylococci (CoNS), 0.12/0.5; meticillin-resistant CoNS, 1/2; penicillin-susceptible Streptococcus pneumoniae, ≤ 0.008/0.03; penicillin-resistant S. pneumoniae, 0.12/0.5; viridans group streptococci, 0.03/0.12; β-haemolytic streptococci, ≤ 0.008/0.016; Enterococcus faecalis, 0.25/1; Enterococcus faecium, 64/128; Enterobacteriaceae, 0.06/32; Pseudomonas aeruginosa, 4/16; Acinetobacter baumannii, 0.5/64; Haemophilus influenzae, 0.03/0.12; and Moraxella catarrhalis, 0.25/0.5. According to the regression curve, zone diameter breakpoints could be 28, 26, 24 and 22 mm for MICs of 0.5, 1, 2 and 4 mg/L respectively. In conclusion, this study confirms the potent in vitro activity of ceftobiprole against many Gram-positive bacteria, including MRSA but not E. faecium, whilst maintaining a Gram-negative spectrum similar to the advanced-generation cephalosporins such as cefepime. Thus ceftobiprole appears to be well suited for the empirical treatment of a variety of healthcare-associated infections. Copyright © 2011 Elsevier B.V. and the

The antimicrobial sensitivity of Streptococcus mutans and Streptococcus sangius to colloidal solutions of different nanoparticles applied as mouthwashes

Directory of Open Access Journals (Sweden)

Farzaneh Ahrari

2015-01-01

Full Text Available Background: Metal nanoparticles have been recently applied in dentistry because of their antibacterial properties. This study aimed to evaluate antibacterial effects of colloidal solutions containing zinc oxide (ZnO, copper oxide (CuO, titanium dioxide (TiO 2 and silver (Ag nanoparticles on Streptococcus mutans and Streptococcus sangius and compare the results with those of chlorhexidine and sodium fluoride mouthrinses. Materials and Methods: After adding nanoparticles to a water-based solution, six groups were prepared. Groups I to IV included colloidal solutions containing nanoZnO, nanoCuO, nanoTiO 2 and nanoAg, respectively. Groups V and VI consisted of 2.0% sodium fluoride and 0.2% chlorhexidine mouthwashes, respectively as controls. We used serial dilution method to find minimum inhibitory concentrations (MICs and with subcultures obtained minimum bactericidal concentrations (MBCs of the solutions against S. mutans and S. sangius. The data were analyzed by analysis of variance and Duncan test and P < 0.05 was considered as significant. Results: The sodium fluoride mouthrinse did not show any antibacterial effect. The nanoTiO 2 -containing solution had the lowest MIC against both microorganisms and also displayed the lowest MBC against S. mutans (P < 0.05. The colloidal solutions containing nanoTiO 2 and nanoZnO showed the lowest MBC against S. sangius (P < 0.05. On the other hand, chlorhexidine showed the highest MIC and MBC against both streptococci (P < 0.05. Conclusion: The nanoTiO 2 -containing mouthwash proved to be an effective antimicrobial agent and thus it can be considered as an alternative to chlorhexidine or sodium fluoride mouthrinses in the oral cavity provided the lack of cytotoxic and genotoxic effects on biologic tissues.

Effect of experimental influenza A virus infection on isolation of Streptococcus pneumoniae and other aerobic bacteria from the oropharynges of allergic and nonallergic adult subjects.

Science.gov (United States)

Wadowsky, R M; Mietzner, S M; Skoner, D P; Doyle, W J; Fireman, P

1995-04-01

Intranasal challenge with both influenza A virus and Streptococcus pneumoniae promotes otitis media with S. pneumoniae in chinchillas. We investigated whether influenza A virus infection promotes oropharyngeal colonization with S. pneumoniae and other middle ear pathogens by selectively inhibiting commensal bacteria. On study day 0, 12 allergic and 15 nonallergic adult subjects were intranasally inoculated with influenza A/Kawasaki (H1N1) virus. Every subject was infected with the virus as demonstrated by nasal shedding or seroconversion. Average upper respiratory symptom scores and nasal secretion weights from the entire subject group were elevated between days 2 and 6 (acute phase) and were not significantly different between allergic and nonallergic subjects. S. pneumoniae was not isolated from any subject prior to the virus challenge but was isolated in heavy density from 4 (15%) subjects on day 6 (P = 0.055). Staphylococcus aureus was isolated more frequently from the nonallergic subjects than from the allergic subjects on days 2 (80 versus 25%, respectively) 4, (67 versus 17%, respectively), and 6 (73 versus 25%, respectively) (P < 0.05). The isolation rates of other middle ear pathogens were not significantly different before virus challenge and during the acute and resolution phases (days 27 to 30) of the experimental infection for the entire subject group or either the allergic or nonallergic subgroup. Densities and isolation rates of commensal bacteria from the entire subject group were similar throughout the observational period. These results suggest that the virus infection promoted S. pneumoniae colonization of the oropharynx and that nonallergic persons may be more vulnerable to colonization with S. aureus than allergic persons. The altered colonization rates were not attributed to inhibition of commensal bacteria.

Effects of deletion of the Streptococcus pneumoniae lipoprotein diacylglyceryl transferase gene lgt on ABC transporter function and on growth in vivo.

Directory of Open Access Journals (Sweden)

Suneeta Chimalapati

Full Text Available Lipoproteins are an important class of surface associated proteins that have diverse roles and frequently are involved in the virulence of bacterial pathogens. As prolipoproteins are attached to the cell membrane by a single enzyme, prolipoprotein diacylglyceryl transferase (Lgt, deletion of the corresponding gene potentially allows the characterisation of the overall importance of lipoproteins for specific bacterial functions. We have used a Δlgt mutant strain of Streptococcus pneumoniae to investigate the effects of loss of lipoprotein attachment on cation acquisition, growth in media containing specific carbon sources, and virulence in different infection models. Immunoblots of triton X-114 extracts, flow cytometry and immuno-fluorescence microscopy confirmed the Δlgt mutant had markedly reduced lipoprotein expression on the cell surface. The Δlgt mutant had reduced growth in cation depleted medium, increased sensitivity to oxidative stress, reduced zinc uptake, and reduced intracellular levels of several cations. Doubling time of the Δlgt mutant was also increased slightly when grown in medium with glucose, raffinose and maltotriose as sole carbon sources. These multiple defects in cation and sugar ABC transporter function for the Δlgt mutant were associated with only slightly delayed growth in complete medium. However the Δlgt mutant had significantly reduced growth in blood or bronchoalveolar lavage fluid and a marked impairment in virulence in mouse models of nasopharyngeal colonisation, sepsis and pneumonia. These data suggest that for S. pneumoniae loss of surface localisation of lipoproteins has widespread effects on ABC transporter functions that collectively prevent the Δlgt mutant from establishing invasive infection.

New Aspects of the Interplay between Penicillin Binding Proteins, murM, and the Two-Component System CiaRH of Penicillin-Resistant Streptococcus pneumoniae Serotype 19A Isolates from Hungary.

Science.gov (United States)

Schweizer, Inga; Blättner, Sebastian; Maurer, Patrick; Peters, Katharina; Vollmer, Daniela; Vollmer, Waldemar; Hakenbeck, Regine; Denapaite, Dalia

2017-07-01

The Streptococcus pneumoniae clone Hungary 19A -6 expresses unusually high levels of β-lactam resistance, which is in part due to mutations in the MurM gene, encoding a transferase involved in the synthesis of branched peptidoglycan. Moreover, it contains the allele ciaH232 , encoding the histidine kinase CiaH (M. Müller, P. Marx, R. Hakenbeck, and R. Brückner, Microbiology 157:3104-3112, 2011, https://doi.org/10.1099/mic.0.053157-0). High-level penicillin resistance primarily requires the presence of low-affinity (mosaic) penicillin binding protein (PBP) genes, as, for example, in strain Hu17, a closely related member of the Hungary 19A -6 lineage. Interestingly, strain Hu15 is β-lactam sensitive due to the absence of mosaic PBPs. This unique situation prompted us to investigate the development of cefotaxime resistance in transformation experiments with genes known to play a role in this phenotype, pbp2x , pbp1a , murM , and ciaH , and penicillin-sensitive recipient strains R6 and Hu15. Characterization of phenotypes, peptidoglycan composition, and CiaR-mediated gene expression revealed several novel aspects of penicillin resistance. The murM gene of strain Hu17 ( murM Hu17 ), which is highly similar to murM of Streptococcus mitis , induced morphological changes which were partly reversed by ciaH232. murM Hu17 conferred cefotaxime resistance only in the presence of the pbp2x o f strain Hu17 ( pbp2x Hu17 ). The ciaH232 allele contributed to a remarkable increase in cefotaxime resistance in combination with pbp2x Hu17 and pbp1a of strain Hu17 ( pbp1a Hu17 ), accompanied by higher levels of expression of CiaR-regulated genes, documenting that ciaH232 responds to PBP1a Hu17 -mediated changes in cell wall synthesis. Most importantly, the proportion of branched peptides relative to the proportion of linear muropeptides increased in cells containing mosaic PBPs, suggesting an altered enzymatic activity of these proteins. Copyright © 2017 Schweizer et al.

Carriage of Streptococcus pneumoniae and other respiratory bacterial pathogens in low and lower-middle income countries: a systematic review and meta-analysis.

Directory of Open Access Journals (Sweden)

Richard A Adegbola

Full Text Available Infection with Streptococcus pneumoniae is a major cause of childhood morbidity and mortality worldwide, especially in low income countries where pneumococcal conjugate vaccines (PCVs are still underused. In countries where PCVs have been introduced, much of their efficacy has resulted from their impact on nasopharyngeal carriage in vaccinated children. Understanding the epidemiology of carriage for S. pneumoniae and other common respiratory bacteria in developing countries is crucial for implementing appropriate vaccination strategies and evaluating their impact.We have systematically reviewed published studies reporting nasopharyngeal or oropharyngeal carriage of S. pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, Staphylococcus aureus, and Neisseria meningitidis in children and adults in low and lower-middle income countries. Studies reporting pneumococcal carriage for healthy children <5 years of age were selected for a meta-analysis. The prevalences of carriage for S. pneumoniae, H. influenzae, and M. catarrhalis were generally higher in low income than in lower-middle income countries and were higher in young children than in adults. The prevalence of S. aureus was high in neonates. Meta-analysis of data from young children before the introduction of PCVs showed a pooled prevalence estimate of 64.8% (95% confidence interval, 49.8%-76.1% in low income countries and 47.8% (95% confidence interval, 44.7%-50.8% in lower-middle income countries. The most frequent serotypes were 6A, 6B, 19A, 19F, and 23F.In low and lower-middle income countries, pneumococcal carriage is frequent, especially in children, and the spectrum of serotypes is wide. However, because data are limited, additional studies are needed to adequately assess the impact of PCV introduction on carriage of respiratory bacteria in these countries.

Population biology of Streptococcus pneumoniae in West Africa: multilocus sequence typing of serotypes that exhibit different predisposition to invasive disease and carriage.

Directory of Open Access Journals (Sweden)

Eric S Donkor

Full Text Available Little is known about the population biology of Streptococcus pneumoniae in developing countries, although the majority of pneumococcal infections occur in this setting. The aim of the study was to apply MLST to investigate the population biology of S. pneumoniae in West Africa.Seventy three invasive and carriage S. pneumoniae isolates from three West African countries including The Gambia, Nigeria and Ghana were investigated. The isolates covered seven serotypes (1, 3, 5, 6A, 11, 14, 23F and were subjected to multilocus sequence typing and antibiotic susceptibility testing.Overall, 50 different sequence types (STs were identified, of which 38% (29 were novel. The most common ST was a novel clone-ST 4012 (6.5%, and some clones including STs 913, 925, 1737, 2160 and 3310 appeared to be specific to the study region. Two STs including ST 63 and ST 4012 were associated with multiple serotypes indicating a history of serotype switching. ST 63 was associated with serotypes 3 and 23F, while ST 4012 was associated with serotypes 6A and 23. eBURST analyses using the stringent 6/7 identical loci definition grouped the 50 STs into 5 clonal complexes and 65 singletons, expressing a high level of genetic diversity among the isolates. Compared to the other serotypes, serotypes 1 and 5 isolates appeared to be more clonal. Internationally recognized antibiotic resistant clones of S. pneumoniae were generally absent in the population investigated and the only multidrug resistant isolate identified (1/66 belong to the Pneumocococcal Epidemiology Network clone ST 63.The pneumococcal population in West Africa is quite divergent, and serotypes that are common in invasive disease (such as serotypes 1 and 5 are more likely to be clonal than serotypes that are common in carriage.

Vancomycin AUC/MIC and Corresponding Troughs in a Pediatric Population.

Science.gov (United States)

Kishk, Omayma A; Lardieri, Allison B; Heil, Emily L; Morgan, Jill A

2017-01-01

Adult guidelines suggest an area under the curve/minimum inhibitory concentration (AUC/MIC) > 400 corresponds to a vancomycin trough serum concentration of 15 to 20 mg/L for methicillin-resistant Staphylococcus aureus infections, but obtaining these troughs in children are difficult. The primary objective of this study was to assess the likelihood that 15 mg/kg of vancomycin every 6 hours in a child achieves an AUC/MIC > 400. This retrospective chart review included pediatric patients >2 months to AUCs were calculated four times using three pharmacokinetic methods. A total of 36 patients with 99 vancomycin trough serum concentrations were assessed. Baseline characteristics were similar between groups. For troughs in group 1 (n = 55), the probability of achieving an AUC/MIC > 400 ranged from 16.4% to 90.9% with a median trough concentration of 11.4 mg/L, while in group 2 (n = 44) the probability of achieving AUC/MIC > 400 ranged from 15.9% to 54.5% with mean trough concentration of 9.2 mg/L. The AUC/MICs were not similar between the different pharmacokinetic methods used; however, a trapezoidal equation (Method A) yielded the highest correlation coefficient (r 2 = 0.59). When dosing every 6 hours, an AUC/MIC of 400 correlated to a trough serum concentration of 11 mg/L. The probability of achieving an AUC/MIC > 400 using only a trough serum concentration and an MIC with patients receiving 15 mg/kg every 6 hours is variable based on the method used to calculate the AUC. An AUC/MIC of 400 in children correlated to a trough concentration of 11 mg/L using a trapezoidal Method to calculate AUC.

Mutations Blocking Side Chain Assembly, Polymerization, or Transport of a Wzy-Dependent Streptococcus pneumoniae Capsule Are Lethal in the Absence of Suppressor Mutations and Can Affect Polymer Transfer to the Cell Wall▿

OpenAIRE

Xayarath, Bobbi; Yother, Janet

2007-01-01

Extracellular polysaccharides of many bacteria are synthesized by the Wzy polymerase-dependent mechanism, where long-chain polymers are assembled from undecaprenyl-phosphate-linked repeat units on the outer face of the cytoplasmic membrane. In gram-positive bacteria, Wzy-dependent capsules remain largely cell associated via membrane and peptidoglycan linkages. Like many Wzy-dependent capsules, the Streptococcus pneumoniae serotype 2 capsule is branched. In this study, we found that deletions ...

Antibacterial activity and mechanism of berberine against Streptococcus agalactiae.

Science.gov (United States)

Peng, Lianci; Kang, Shuai; Yin, Zhongqiong; Jia, Renyong; Song, Xu; Li, Li; Li, Zhengwen; Zou, Yuanfeng; Liang, Xiaoxia; Li, Lixia; He, Changliang; Ye, Gang; Yin, Lizi; Shi, Fei; Lv, Cheng; Jing, Bo

2015-01-01

The antibacterial activity and mechanism of berberine against Streptococcus agalactiae were investigated in this study by analyzing the growth, morphology and protein of the S. agalactiae cells treated with berberine. The antibacterial susceptibility test result indicated minimum inhibition concentration (MIC) of berberine against Streptococcus agalactiae was 78 μg/mL and the time-kill curves showed the correlation of concentration-time. After the bacteria was exposed to 78 μg/mL berberine, the fragmentary cell membrane and cells unequal division were observed by the transmission electron microscopy (TEM), indicating the bacterial cells were severely damaged. Sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) study demonstrated that berberine could damage bacterial cells through destroying cellular proteins. Meanwhile, Fluorescence microscope revealed that berberine could affect the synthesis of DNA. In conclusion, these results strongly suggested that berberine may damage the structure of bacterial cell membrane and inhibit synthesis of protein and DNA, which cause Streptococcus agalactiae bacteria to die eventually.

Triazenos e atividade antibacteriana Triazenes and antibacterial activity

Directory of Open Access Journals (Sweden)

Manfredo Hörner

2008-09-01

. saprophyticus, Corynebacterirum sp., E. cloacae, S. flenneri e S. sonnei. Os compostos 1-fenil-3-(4-acetilfeniltriazeno (6, 1,3-bis-(4-etoxicarbonilfenil triazeno (7 e 3-(4-carboxilatofenil-1-metiltriazeno 1-óxido de potássio tetraidratado (13 apresentaram CIMs iguais ou maiores que 128 µg/mL. Estes resultados demonstraram a potencial atividade biológica destes compostos contra bactérias Gram-positivas e Gram-negativas.Fifteen triazenes compounds were studied concerning their antibacterial activity by broth microdilution method. Minimum inhibitory concentration (MIC and minimum bactericidal concentration (MBC was determined with E. coli ATCC 25922, Staphylococcus aureus ATCC 25923, Pseudomonas aeruginosa ATCC 27853, Acinetobacter baumannii, Acinetobacter lwoffii, Ralstonia pickettii, Bordetella bronchiseptica, Micrococcus sp., Enterococcus sp., Staphylococcus epidermidis, Staphylococcus saprophyticus, Streptococcus agalactiae, Bacillus cereus, Corynebacterium sp., Rhodococcus sp., Salmonella sp., Serratia marcescens, Morganella morganii, Enterobacter cloacae, Shigella flexneri, Shigella sonnei, Shigella sp., Klebsiella pneumoniae, ESBL Klebsiella oxytoca 14, ESBL Klebsiella pneumoniae 23, ESBL Klebsiella pneumoniae 24, ESBL Klebsiella pneumoniae 25, ESBL Escherichia coli 26, ESBL Klebsiella pneumoniae 27, ESBL Klebsiella pneumoniae 31, ESBL Escherichia coli 32, ESBL Klebsiella pneumoniae 37 e ESBL Escherichia coli 38. The highest effect was evidenced by the compound 1-methyl-3-(p-carboxyphenyltriazene 1-oxide (2 against Streptococcus agalactiae (MIC = 16 µg/mL and MBC = 32 µg/mL. The compounds 1-phenyl-3-(4-nitrophenyltriazene-1-oxide (9, 1-(4-nitrophenyl-3-(4-carboxyphenyltriazene (10 e 1-(4-acethyl amine phenyl-3-(4-carboxyphenyltriazene (11 presented MIC between 32 and 64 µg/mL against S. edipermidis, S. saprophyticus, Rhodococcus sp. and E. cloacae. The compounds 1-methyl-3-phenyltriazene-1-oxide (1 , bis-1,3-(4-acethyl oximetriazene (3, bis-1,3 (4-acethyl

The Transcriptome of Streptococcus pneumoniae Induced by Local and Global Changes in Supercoiling

Directory of Open Access Journals (Sweden)

Adela G. de la Campa

2017-07-01

Full Text Available The bacterial chromosome is compacted in a manner optimal for DNA transactions to occur. The degree of compaction results from the level of DNA-supercoiling and the presence of nucleoid-binding proteins. DNA-supercoiling is homeostatically maintained by the opposing activities of relaxing DNA topoisomerases and negative supercoil-inducing DNA gyrase. DNA-supercoiling acts as a general cis regulator of transcription, which can be superimposed upon other types of more specific trans regulatory mechanism. Transcriptomic studies on the human pathogen Streptococcus pneumoniae, which has a relatively small genome (∼2 Mb and few nucleoid-binding proteins, have been performed under conditions of local and global changes in supercoiling. The response to local changes induced by fluoroquinolone antibiotics, which target DNA gyrase subunit A and/or topoisomerase IV, involves an increase in oxygen radicals which reduces cell viability, while the induction of global supercoiling changes by novobiocin (a DNA gyrase subunit B inhibitor, or by seconeolitsine (a topoisomerase I inhibitor, has revealed the existence of topological domains that specifically respond to such changes. The control of DNA-supercoiling in S. pneumoniae occurs mainly via the regulation of topoisomerase gene transcription: relaxation triggers the up-regulation of gyrase and the down-regulation of topoisomerases I and IV, while hypernegative supercoiling down-regulates the expression of topoisomerase I. Relaxation affects 13% of the genome, with the majority of the genes affected located in 15 domains. Hypernegative supercoiling affects 10% of the genome, with one quarter of the genes affected located in 12 domains. However, all the above domains overlap, suggesting that the chromosome is organized into topological domains with fixed locations. Based on its response to relaxation, the pneumococcal chromosome can be said to be organized into five types of domain: up-regulated, down

UlaR activates expression of the ula operon in Streptococcus pneumoniae in the presence of ascorbic acid.

Science.gov (United States)

Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P

2015-01-01

In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased in the presence of ascorbic acid as compared with the effects of other sugar sources including glucose. The ula operon consists of nine genes, including a transcriptional regulator UlaR, and is transcribed as a single transcriptional unit. We demonstrate the role of the transcriptional regulator UlaR as a transcriptional activator of the ula operon in the presence of ascorbic acid and show that activation of the ula operon genes by UlaR is CcpA-independent. Furthermore, we predict a 16 bp regulatory site (5'-AACAGTCCGCTGTGTA-3') for UlaR in the promoter region of ulaA. Deletion of the half or full UlaR regulatory site in PulaA confirmed that the UlaR regulatory site present in PulaA is functional. © 2015 The Authors.

Repertoire of intensive care unit pneumonia microbiota.

Directory of Open Access Journals (Sweden)

Sabri Bousbia

Full Text Available Despite the considerable number of studies reported to date, the causative agents of pneumonia are not completely identified. We comprehensively applied modern and traditional laboratory diagnostic techniques to identify microbiota in patients who were admitted to or developed pneumonia in intensive care units (ICUs. During a three-year period, we tested the bronchoalveolar lavage (BAL of patients with ventilator-associated pneumonia, community-acquired pneumonia, non-ventilator ICU pneumonia and aspiration pneumonia, and compared the results with those from patients without pneumonia (controls. Samples were tested by amplification of 16S rDNA, 18S rDNA genes followed by cloning and sequencing and by PCR to target specific pathogens. We also included culture, amoeba co-culture, detection of antibodies to selected agents and urinary antigen tests. Based on molecular testing, we identified a wide repertoire of 160 bacterial species of which 73 have not been previously reported in pneumonia. Moreover, we found 37 putative new bacterial phylotypes with a 16S rDNA gene divergence ≥ 98% from known phylotypes. We also identified 24 fungal species of which 6 have not been previously reported in pneumonia and 7 viruses. Patients can present up to 16 different microorganisms in a single BAL (mean ± SD; 3.77 ± 2.93. Some pathogens considered to be typical for ICU pneumonia such as Pseudomonas aeruginosa and Streptococcus species can be detected as commonly in controls as in pneumonia patients which strikingly highlights the existence of a core pulmonary microbiota. Differences in the microbiota of different forms of pneumonia were documented.

Epidemiology and outcome of pneumonia caused by methicillin-resistant Staphylococcus aureus (MRSA in Canadian hospitals.

Directory of Open Access Journals (Sweden)

Manal Tadros

Full Text Available BACKGROUND: MRSA remains a leading cause of hospital-acquired (HAP and healthcare-associated pneumonia (HCAP. We describe the epidemiology and outcome of MRSA pneumonia in Canadian hospitals, and identify factors contributing to mortality. METHODS: Prospective surveillance for MRSA pneumonia in adults was done for one year (2011 in 11 Canadian hospitals. Standard criteria for MRSA HAP, HCAP, ventilator-associated pneumonia (VAP, and community-acquired pneumonia (CAP were used to identify cases. MRSA isolates underwent antimicrobial susceptibility testing, and were characterized by pulsed-field gel electrophoresis (PFGE and Panton-Valentine leukocidin (PVL gene detection. The primary outcome was all-cause mortality at 30 days. A multivariable analysis was done to examine the association between various host and microbial factors and mortality. RESULTS: A total of 161 patients with MRSA pneumonia were identified: 90 (56% with HAP, 26 (16% HCAP, and 45 (28% CAP; 23 (14% patients had VAP. The mean (± SD incidence of MRSA HAP was 0.32 (± 0.26 per 10,000 patient-days, and of MRSA VAP was 0.30 (± 0.5 per 1,000 ventilator-days. The 30-day all-cause mortality was 28.0%. In multivariable analysis, variables associated with mortality were the presence of multiorgan failure (OR 8.1; 95% CI 2.5-26.0, and infection with an isolate with reduced susceptibility to vancomycin (OR 2.5, 95% CI 1.0-6.3. CONCLUSIONS: MRSA pneumonia is associated with significant mortality. Severity of disease at presentation, and infection caused by an isolate with elevated MIC to vancomcyin are associated with increased mortality. Additional studies are required to better understand the impact of host and microbial variables on outcome.

Resistencia a antibióticos no betalactámicos de aislamientos invasores de Streptococcus pneumoniae en niños latinoamericanos: SIREVA II, 2000-2005 Resistance to non-beta-lactam antibiotics in the clinical isolates of Streptococcus pneumoniae of children in Latin America: SIREVA II, 2000-2005

Directory of Open Access Journals (Sweden)

Clara Inés Agudelo

2009-04-01

Full Text Available OBJETIVO:Determinar la evolución de la resistencia a la eritromicina, el cloranfenicol, el trimetoprim-sulfametozaxol (SXT y la vancomicina de aislamientos invasores de Streptococcus pneumoniae obtenidos de niños de 10 países de América Latina y del Caribe en seis años de vigilancia. MÉTODOS: Se analizaron 8 993 aislamientos de S. pneumoniae recuperados entre 2000 y 2005 de niños menores de 6 años con infecciones invasoras, procedentes de Argentina, Brasil, Chile, Colombia, Cuba, México, Paraguay, República Dominicana, Uruguay y Venezuela. La sensibilidad a los antibióticos se determinó mediante los métodos establecidos y estandarizados en el proyecto SIREVA. La resistencia a múltiples antibióticos se definió como la resistencia a tres o más familias de antibióticos, de los no betalactámicos analizados en este estudio o de los betalactámicos evaluados en un estudio previo en el que 37,8% de estos aislamientos presentaron sensibilidad disminuida a la penicilina. RESULTADOS: Se encontró algún grado de resistencia al SXT y la eritromicina (56,4% y 15,4% de los aislamientos estudiados, respectivamente y 4,6% presentó alta resistencia al cloranfenicol. Todos los aislamientos fueron sensibles a la vancomicina. Se observó la mayor frecuencia de resistencia al SXT en los aislamientos de neumonía y a la eritromicina en los casos de sepsis (61,6% y 25,5%, respectivamente; P OBJECTIVE: To examine the development of resistance to erythromycin, chloramphenicol, trimethoprim-sulfamethoxazole (TMP-SMZ, and vancomycin of the invasive isolates of Streptococcus pneumoniae obtained from children in 10 Latin American/Caribbean countries during six years of surveillance. METHODS: Analysis of 8 993 isolates of S. pneumoniae recovered in 2000-2005 from children with invasive infections, who were less than 6 years of age, and from Argentina, Brazil, Chile, Colombia, Cuba, Dominican Republic, Mexico, Paraguay, Uruguay, or Venezuela. Antibiotic

Antibiotic resistant profile of Streptococcus pneumoniae from the ...

African Journals Online (AJOL)

The isolates were subjected to antimicrobial susceptibility testing using the disc diffusion method. Results: S. pneumoniae was isolated from 37(42.04%) of the 88 samples. Isolates showed the highest resistance of 12 (32.43%) to erythromycin and lowest resistance of 4(10.81%) to ciprofloxacin. The resistance profiles for ...

Crystallization and preliminary X-ray diffraction analysis of phosphoglycerate kinase from Streptococcus pneumoniae

International Nuclear Information System (INIS)

Bernardo-García, Noelia; Bartual, Sergio G.; Fulde, Marcus; Bergmann, Simone; Hermoso, Juan A.

2011-01-01

Phosphoglycerate kinase, a two-domain enzyme involved in the glycolytic pathway, has been crystallized. Both the N-terminal domain and a ternary complex of the full-length enzyme with substrates were crystallized by the sitting-drop vapour-diffusion method. Inclusion of the substrates was critical in order to obtain crystals of the full-length protein. Phosphoglycerate kinase (PGK) is a widespread two-domain enzyme that plays a critical role in the glycolytic pathway. Several glycolytic enzymes from streptococci have been identified as surface-exposed proteins that are involved in streptococcal virulence by their ability to bind host proteins. This binding allows pneumococcal cells to disseminate through the epithelial and endothelial layers. Crystallization of PGK from Streptococcus pneumoniae yielded orthorhombic crystals (space group I222, unit-cell parameters a = 62.73, b = 75.38, c = 83.63 Å). However, the unit cell of these crystals was not compatible with the presence of full-length PGK. Various analytical methods showed that only the N-terminal domain of PGK was present in the I222 crystals. The ternary complex of PGK with adenylyl imidodiphosphate (AMP-PNP) and 3-phospho-d-glycerate (3PGA) produced monoclinic crystals (space group P2 1 , unit-cell parameters a = 40.35, b = 78.23, c = 59.03 Å, β = 96.34°). Molecular replacement showed that this new crystal form contained full-length PGK, thereby indicating the relevance of including substrates in order to avoid proteolysis during the crystallization process

Community-acquired pneumonia among smokers.

Science.gov (United States)

Almirall, Jordi; Blanquer, José; Bello, Salvador

2014-06-01

Recent studies have left absolutely no doubt that tobacco increases susceptibility to bacterial lung infection, even in passive smokers. This relationship also shows a dose-response effect, since the risk reduces spectacularly 10 years after giving up smoking, returning to the level of non-smokers. Streptococcus pneumoniae is the causative microorganism responsible for community-acquired pneumonia (CAP) most frequently associated with smoking, particularly in invasive pneumococcal disease and septic shock. It is not clear how it acts on the progress of pneumonia, but there is evidence to suggest that the prognosis for pneumococcal pneumonia is worse. In CAP caused by Legionella pneumophila, it has also been observed that smoking is the most important risk factor, with the risk rising 121% for each pack of cigarettes smoked a day. Tobacco use may also favor diseases that are also known risk factors for CAP, such as periodontal disease and upper respiratory viral infections. By way of prevention, while giving up smoking should always be proposed, the use of the pneumococcal vaccine is also recommended, regardless of the presence of other comorbidities. Copyright © 2013 SEPAR. Published by Elsevier Espana. All rights reserved.

Penicillin-Binding Protein Transpeptidase Signatures for Tracking and Predicting β-Lactam Resistance Levels in Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Yuan Li

2016-06-01

Full Text Available β-Lactam antibiotics are the drugs of choice to treat pneumococcal infections. The spread of β-lactam-resistant pneumococci is a major concern in choosing an effective therapy for patients. Systematically tracking β-lactam resistance could benefit disease surveillance. Here we developed a classification system in which a pneumococcal isolate is assigned to a “PBP type” based on sequence signatures in the transpeptidase domains (TPDs of the three critical penicillin-binding proteins (PBPs, PBP1a, PBP2b, and PBP2x. We identified 307 unique PBP types from 2,528 invasive pneumococcal isolates, which had known MICs to six β-lactams based on broth microdilution. We found that increased β-lactam MICs strongly correlated with PBP types containing divergent TPD sequences. The PBP type explained 94 to 99% of variation in MICs both before and after accounting for genomic backgrounds defined by multilocus sequence typing, indicating that genomic backgrounds made little independent contribution to β-lactam MICs at the population level. We further developed and evaluated predictive models of MICs based on PBP type. Compared to microdilution MICs, MICs predicted by PBP type showed essential agreement (MICs agree within 1 dilution of >98%, category agreement (interpretive results agree of >94%, a major discrepancy (sensitive isolate predicted as resistant rate of <3%, and a very major discrepancy (resistant isolate predicted as sensitive rate of <2% for all six β-lactams. Thus, the PBP transpeptidase signatures are robust indicators of MICs to different β-lactam antibiotics in clinical pneumococcal isolates and serve as an accurate alternative to phenotypic susceptibility testing.

ADULT RESPIRATORY-DISTRESS SYNDROME (ARDS) DUE TO BACTEREMIC PNEUMOCOCCAL PNEUMONIA

NARCIS (Netherlands)

MANNES, GPM; BOERSMA, WG; BAUR, CHJM; POSTMUS, PE

We describe a patient, who had no pre-existing disease, with bacteraemic pneumococcal pneumonia and adult respiratory distress syndrome (ARDS), a rare complication. In spite of the use of antibiotics and intensive treatment the mortality rate of this kind of infection remains high. Streptococcus

ROLE OF STREPTOCOCCUS PNEUMONIAE IN THE STRUCTURE OF BACTERIAL INFECTIONS IN THE CHILDREN HOSPITALIZED TO INPATIENT HOSPITALS IN MOSCOW IN 2011–2012

Directory of Open Access Journals (Sweden)

A. A. Baranov

2013-01-01

Full Text Available Data on the spread of Streptococcus pneumoniae serotypes in the RF are extremely limited. 3 pneumococcal conjugated vaccines are approved inRussia; however, neither has yet been employed in the framework of the national population immunization program. At the same time, it is the dataon the serotype range of pneumococcal infections that may be considered the prognostic efficacy criterion for the national vaccination programs.The objective of this research is identification of the circulating S. pneumoniae serotypes and spread of pneumococcal etiology infections in the structure of bacterial infections in the infants hospitalized to 5 inpatient hospital of Moscow in 2011–2012. The trial involved 864 patients in tote. Vast majority of patients (86% had acute purulent otitis media and sinusitis. Community-acquired pneumonia was diagnosed in 9% of patients, sepsis and bacteremia — in 3.6%; purulent meningitis — 1.2% of patients. It has been revealed that S. pneumoniae is the primary pathogen in the structure of nasopharyngeal carriage in the children under 5 years of age hospitalized with acute bacterial infections, and the primary bacterial causative agent of acute otitis media at this age. Nasopharyngeal pneumococcal carriage analysis revealed the prevalent serotypes — 19F, 14, 23F, 3, 6A and B; they were present in 3/4 of all cases; 19F was the most frequent (> 20%. Diversity of the S. pneumoniae serotypes detected in middle ear liquid was less significant — 17 serotypes (in comparison with 24 serotypes in nasopharynx. The 5 prevalent serotypes were 19F, 3, 14, 23F, 6B and 19A (> 75% in tote. Detection rate of serotypes 3 and 19A in middle ear liquid significantly exceeded the detection rate of these serotypes in case of nasopharyngeal carriage. The study of invasive infections revealed serotypes 14, 23F, 3 and 15C. These data may be used as a benchmark for future monitoring and evaluation of effect of PCV vaccines on epidemiology of

Role of Streptococcus pneumoniae OM001 operon in capsular polysaccharide production, virulence and survival in human saliva.

Science.gov (United States)

Ahmad, Zuleeza; Harvey, Richard M; Paton, James C; Standish, Alistair J; Morona, Renato

2018-01-01

Streptococcus pneumoniae is the leading cause of community-acquired pneumonia in all ages worldwide, and with ever-increasing antibiotic resistance, the understanding of its pathogenesis and spread is as important as ever. Recently, we reported the presence of a Low Molecular Weight Tyrosine Phosphatase (LMWPTP) Spd1837 in the pneumococcus. This protein is encoded in an operon, OM001 with two other genes, with previous work implicating this operon as important for pneumococcal virulence. Thus, we set out to investigate the role of the individual genes in the operon during pneumococcal pathogenesis. As LMWPTPs play a major role in capsular polysaccharide (CPS) biosynthesis in many bacteria, we tested the effect of mutating spd1837 and its adjacent genes, spd1836 and spd1838 on CPS levels. Our results suggest that individual deletion of the genes, including the LMWPTP, did not modulate CPS levels, in multiple conditions, and in different strain backgrounds. Following in vivo studies, Spd1836 was identified as a novel virulence factor during pneumococcal invasive disease, in both the lungs and blood, with this protein alone responsible for the effects of operon's role in virulence. We also showed that a deletion in spd1836, spd1838 or the overall OM001 operon reduced survival in human saliva during the conditions that mimic transmission compared to the wildtype strain. With studies suggesting that survival in human saliva may be important for transmission, this study identifies Spd1836 and Spd1838 as transmission factors, potentially facilitating the spread of the pneumococcus from person to person. Overall, this study hopes to further our understanding of the bacterial transmission that precedes disease and outbreaks.

Redistribution of Streptococcus pneumoniae Serotypes After Nationwide 13-valent Pneumococcal Conjugate Vaccine Program in Children in Northern Taiwan.

Science.gov (United States)

Cho, Ying-Chun; Chiu, Nan-Chang; Lu, Chun-Yi; Huang, Daniel Tsung-Ning; Huang, Fu-Yuan; Chang, Luan-Yin; Huang, Li-Min; Chi, Hsin

2017-12-01

After the introduction of 13-valent pneumococcal conjugate vaccine (PCV13) against Streptococcus pneumoniae, public health officials in Taiwan monitored a decline in circulating vaccine serotypes and the emergence of nonvaccine serotypes in children with invasive pneumococcal disease. A gradually expanded PCV13 national immunization program was launched in 2013 in Taiwan. Here, we evaluate the changes in the distribution of pneumococcal serotypes and antimicrobial nonsusceptibility in children during the evolution of vaccination policy. S. pneumoniae isolates from children with pneumococcal disease were collected and serotyped from 2010 to 2015 in northern Taiwan. PCVs were administered at the recipients' expense between 2010 and 2012, and then PCV13 was partially reimbursed by the government beginning in 2013. The distribution and diversity of serotypes were analyzed along with their antimicrobial susceptibilities. Among a total of 498 isolates, the proportion of invasive pneumococcal disease isolates declined (47.1%-10.6%) during the study period, and serotype diversity increased after 2011. Between 2010 and 2012, the dominant serotypes were 19A, 19F, 3, 6B and 14, and serotype 19A rose from 44.1% to 57.5%. Serotypes 19A, 15A, 19F and 15B were more prevalent from 2013 to 2015, and serotype 19A decreased from 42.1% to 4.5%. Serotypes 19F and 15A became the most commonly detected serotypes in 2015. Overall, PCV13 additional serotypes were reduced by 80% (P program is effective against pneumococcal disease in Taiwanese children, mainly by reducing PCV13 additional serotypes.

Identification of PblB mediating galactose-specific adhesion in a successful Streptococcus pneumoniae clone.

Science.gov (United States)

Hsieh, Yu-Chia; Lin, Tzu-Lung; Lin, Che-Ming; Wang, Jin-Town

2015-07-21

The pneumococcal genome is variable and there are minimal data on the influence of the accessory genome on phenotype. Pneumococcal serotype 14 sequence type (ST) 46 had been the most prevalent clone causing pneumonia in children in Taiwan. A microarray was constructed using the genomic DNA of a clinical strain (NTUH-P15) of serotype 14 ST46. Using DNA hybridization, genomic variations in NTUH-P15 were compared to those of 3 control strains. Microarray analysis identified 7 genomic regions that had significant increases in hybridization signals in the NTUH-P15 strain compared to control strains. One of these regions encoded PblB, a phage-encoded virulence factor implicated (in Streptococcus mitis) in infective endocarditis. The isogenic pblB mutant decreased adherence to A549 human lung epithelial cell compared to wild-type NTUH-P15 strain (P = 0.01). Complementation with pblB restored the adherence. PblB is predicted to contain a galactose-binding domain-like region. Preincubation of NTUH-P15 with D-galactose resulted in decreases of adherence to A549 cell in a dose-dependent manner. Challenge of mice with NTUH-P15, isogenic pblB mutant and pblB complementation strains determined that PblB was required for bacterial persistence in the nasopharynx and lung. PblB, as an adhesin mediating the galactose-specific adhesion activity of pneumococci, promote pneumococcal clonal success.

Streptococcus pneumoniae carriage among healthy and sick pediatric patients before the generalized implementation of the 13-valent pneumococcal vaccine in Morocco from 2010 to 2011.

Science.gov (United States)

Jroundi, Imane; Mahraoui, Chafik; Benmessaoud, Rachid; Moraleda, Cinta; Munoz Almagro, Carmen; Seffar, Meryem; Tligui, Houssain; Kettani, Selma C; Benjelloun, Badr S; Alonso, Pedro L; Bassat, Quique

Nasopharyngeal carriage studies provide insights into the local prevalence of circulating pneumococcal serotypes. These data are critical to vaccination monitoring, as they allow for the prediction and assessment of impact. Very little data are available on the carriage of pneumococcal serotypes in Morocco. Here, we describe the prevalence of Streptococcus pneumoniae carriage and serotype distribution among 697 pediatric patients with ages ranging from 2 to 59 months who were admitted to a Moroccan hospital with severe pneumonia, as well as 195 healthy infants and young children who were recruited at a vaccination clinic. Carriage rates were 40.5% (79/195) for healthy children and 22.8% (159/697) for sick children. The most commonly observed circulating serotypes included 6A, 6B and 19F, all of which are included in the current 13-valent anti-pneumococcal conjugate vaccine that was recently introduced in Morocco. Monitoring of circulating serotypes remains necessary after vaccine introduction to assess whether serotype replacement is occurring. Copyright © 2016 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.

Streptococcus suis, an emerging drug-resistant animal and human pathogen

Directory of Open Access Journals (Sweden)

Claudio ePalmieri

2011-11-01

Full Text Available Streptococcus suis, a major porcine pathogen, has been receiving growing attention not only for its role in severe and increasingly reported infections in humans, but also for its involvement in drug resistance. Recent studies and the analysis of sequenced genomes have been providing important insights into the S. suis resistome, and have resulted in the identification of resistance determinants for tetracyclines, macrolides, aminoglycosides, chloramphenicol, antifolate drugs, streptothricin, and cadmium salts. Resistance gene-carrying genetic elements described so far include integrative and conjugative elements, transposons, genomic islands, phages, and chimeric elements. Some of these elements are similar to those reported in major streptococcal pathogens such as Streptococcus pyogenes, Streptococcus pneumoniae, and Streptococcus agalactiae and share the same chromosomal insertion sites. The available information strongly suggests that S. suis is an important antibiotic resistance reservoir that can contribute to the spread of resistance genes to the above-mentioned streptococci. S. suis is thus a paradigmatic example of possible intersections between animal and human resistomes.

Peritonitis in a llama caused by Streptococcus equi subsp. zooepidemicus.

Science.gov (United States)

Hewson, J; Cebra, C K

2001-01-01

A 7-month-old, male llama was diagnosed with peritonitis caused by Streptococcus equi subsp. zooepidemicus. Clinical findings, medical treatment, and case outcome are described. Hematogenous dissemination from suspected pneumonia is proposed as the route of infection in this case. Possible transmission of the organism through contact with horses is discussed. PMID:11424579

Virome and bacteriome characterization of children with pneumonia and asthma in Mexico City during winter seasons 2014 and 2015.

Science.gov (United States)

Romero-Espinoza, Jose A; Moreno-Valencia, Yazmin; Coronel-Tellez, Rodrigo H; Castillejos-Lopez, Manuel; Hernandez, Andres; Dominguez, Aaron; Miliar-Garcia, Angel; Barbachano-Guerrero, Arturo; Perez-Padilla, Rogelio; Alejandre-Garcia, Alejandro; Vazquez-Perez, Joel A

2018-01-01

Acute asthma exacerbations and pneumonia are important causes of morbidity and mortality in children and may coexist in the same children, although symptom overlap may lead to difficulties in diagnosis. Microbial and viral diversity and differential abundance of either may play an important role in infection susceptibility and the development of acute and chronic respiratory diseases. To describe the virome and bacteriome present in the upper respiratory tract of hospitalized children with a clinical diagnosis of asthma and pneumonia during an acute exacerbation and an acute respiratory illness ARI episode respectively. During the winter seasons of 2013-2014 and 2014-2015, 134 nasopharyngeal swabs samples of children pneumonia. The virome and bacteriome were characterized using Whole Genome Sequencing (WGS) and in-house bioinformatics analysis pipeline. The Asthma group was represented mainly by RV-C, BoV-1 and RSV-B and the pneumonia group by Bacteriophage EJ-1 and TTMV. TTV was found in both groups with a similar amount of reads. About bacterial composition Moraxella catarrhalis, Propionibacterium acnes and Acinetobacter were present in asthma and Veillonella parvula and Mycoplasma pneumoniae in pneumonia. Streptococcus pneumoniae and Haemophilus influenzae were mostly found with both asthma and pneumonia. Our results show a complex viral and bacterial composition in asthma and pneumonia groups with a strong association of RV-C presence in asthmatic children. We observed Streptococcus pneumoniae and Haemophilus influenzae concurrently in both groups.

Lung concentrations of telithromycin after oral dosing.

Science.gov (United States)

Khair, O A; Andrews, J M; Honeybourne, D; Jevons, G; Vacheron, F; Wise, R

2001-06-01

Concentrations of telithromycin were measured in plasma, bronchial mucosa (BM), epithelial lining fluid (ELF) and alveolar macrophages (AM) following multiple oral doses. Concentrations were determined using a microbiological assay. There were 20 subjects in the study, allocated to three nominal time periods: 2, 12 and 24 h. Mean concentrations in plasma, BM, ELF and AM for 2, 12 and 24 h were as follows: 2 h, 1.86 mg/L, 3.88 mg/kg, 14.89 mg/L and 69.32 mg/L; 12 h, 0.23 mg/L, 1.41 mg/kg, 3.27 mg/L and 318.1 mg/L; and 24 h, 0.08 mg/L, 0.78 mg/kg, 0.97 mg/L and 161.57 mg/L. These concentrations of telithromycin in BM and ELF exceeded for 24 h the mean MIC90s of the common respiratory pathogens Streptococcus pneumoniae (0.12 mg/L) and Moraxella catarrhalis (0.03 mg/L), as well as the atypical microorganism Mycoplasma pneumoniae (0.001 mg/L), and suggest that telithromycin may be effective for the treatment of community-acquired pneumonia and chronic obstructive pulmonary disease.

MDS MIC Catalog Inputs

Science.gov (United States)

Johnson-Throop, Kathy A.; Vowell, C. W.; Smith, Byron; Darcy, Jeannette

2006-01-01

This viewgraph presentation reviews the inputs to the MDS Medical Information Communique (MIC) catalog. The purpose of the group is to provide input for updating the MDS MIC Catalog and to request that MMOP assign Action Item to other working groups and FSs to support the MITWG Process for developing MIC-DDs.

Comparison of clinical characteristics between healthcare-associated pneumonia and community-acquired pneumonia in patients admitted to secondary hospitals

Directory of Open Access Journals (Sweden)

Jong Hoo Lee

Full Text Available BACKGROUND: Since healthcare-associated pneumonia (HCAP is heterogeneous, clinical characteristics and outcomes are different from region to region. There can also be differences between HCAP patients hospitalized in secondary or tertiary hospitals. This study aimed to evaluate the clinical characteristics of HCAP patients admitted into secondary community hospitals. METHODS: This was a retrospective study conducted in patients with HCAP or community-acquired pneumonia (CAP hospitalized in two secondary hospitals between March 2009 and January 2011. RESULTS: Of a total of 303 patients, 96 (31.7% had HCAP. 42 patients (43.7% resided in a nursing home or long-term care facility, 36 (37.5% were hospitalized in an acute care hospital for > 2 days within 90 days, ten received outpatient intravenous therapy, and eight attended a hospital clinic or dialysis center. HCAP patients were older. The rates of patients with CURB65 scores of 3 or more (22.9% vs. 9.1%; p = 0.001 and PSI class IV or more (82.2% vs. 34.7%; p < 0.001 were higher in the HCAP group. Drug-resistant pathogens were more frequently detected in the HCAP group (23.9% vs. 0.4%; p < 0.001. However, Streptococcus pneumoniae was the most common pathogen in both groups. The rates of antibiotic change, use of inappropriate antibiotics, and failure of initial antibiotic therapy in the HCAP group were significantly higher. Although the overall survival rate of the HCAP group was significantly lower (82.3% vs. 96.8%; p < 0.001, multivariate analyses failed to show that HCAP itself was a prognostic factor for mortality (p = 0.826. Only PSI class IV or more was associated with increased mortality (p = 0.005. CONCLUSIONS: HCAP should be distinguished from CAP because of the different clinical features. However, the current definition of HCAP does not appear to be a prognostic for death. In addition, the use of broad-spectrum antibiotics for HCAP should be reassessed because S. pneumoniae was most

Epidemiology of culture-confirmed infections of Streptococcus pneumoniae (2012-2015) and nasopharyngeal carriage in children and households in Taiwan (2014-2015).

Science.gov (United States)

Janapatla, Rajendra Prasad; Su, Lin-Hui; Chen, Hsin-Hang; Chang, Hsin-Ju; Tsai, Tian-Chi; Chen, Po-Yen; Chen, Chyi-Liang; Chiu, Cheng-Hsun

2017-06-01

An observational study was performed to investigate the carriage rate and serotypes of Streptococcus pneumoniae in the 13-valent pneumococcal conjugate vaccine (PCV13) era in Taiwan. From March 2014 to March 2015 a total of 500 healthy children and their households (631 adults) were enrolled from two large medical centres for nasopharyngeal carriage survey. Clinical isolates were prospectively collected from June 2012 to May 2015 at Chang Gung Memorial Hospital. We applied a multiplex polymerase chain reaction in addition to culture to detect S. pneumoniae. S. pneumoniae was isolated from 12.0 % of the children and 3.6 % of the households. In the children's cohort only 23.3 % of the isolates could be assigned to PCV13 serotypes; non-vaccine serotypes were predominant (76.6 %) and the most frequently detected non-vaccine serotypes were 15A/F and 15B/C (both 13.3 %), followed by 23A (6.7 %). In the household cohort, 21.7 % belonged to PCV13 serotypes, and 78.3 % to non-vaccine serotypes. Clinical analysis of culture-confirmed pneumococcal infection showed that infection caused by PCV13 serotypes decreased by 47 % from 83 % in 2012-2013 to 44 % in 2014-2015, while infection caused by non-PCV13 serotypes increased from 17 to 56 %. Among the carriage isolates a significantly higher percentage belonged to serogroup 15 compared to serogroup 19 (26.6 vs 6.66 %, 2014-2015; P=0.003). Therefore, clinical isolates belonging to serogroup 15 were more prevalent than those belonging to serogroup 19 (44.1 vs 32.3 %, 2014-2015; P=0.318). The isolation of non-vaccine serotypes and unknown serotypes after the introduction of PCV13 in children highlights the importance of continued surveillance for emerging serotypes.

GENES, IN ADDITION TO TOLL-LIKE RECEPTOR 2, PLAY A ROLE IN ANTIBACTERIAL DEFENSE TO STREPTOCOCCAL PNEUMONIA

Science.gov (United States)

Streptococcus infection in human populations continues to be a major cause of morbidity and mortality. To evaluate the effect of genetic background and toll-like receptor 2 (TLR2) on antibacterial defense to streptococcal infection, eight genetically diverse strains of mic...

Recurrent Streptococcus Pneumoniae Meningitis in a Child with Split Hand and Foot Malformation and Undiagnosed Mondini Dysplasia.

Science.gov (United States)

Katarzyna, Mazur-Melewska; Jarosław, Szydłowski; Katarzyna, Jończyk-Potoczna; Wojciech, Służewski; Magdalena, Figlerowicz

Recurrent bacterial meningitis is a life-threatening infection of the central nervous system that is mostly connected with anatomical abnormalities of the skull, chronic parameningeal infections and immunodeficiencies. It's rarely seen, but when it occurs an extensive investigation should be carried out to discover the responsible factor, so that further episodes can be prevented. We report on a child with split hand and foot (SHFM), confirmed incorrect karyotype 46, XY, t(7:12)(q21.2;q21.3) and a fourth episode of fulminant meningitis caused by penicillin-resistant Streptococcus pneumoniae . After a broad evaluation of factors predisposing to recurrent meningitis, the undiagnosed malformation of his inner and middle ears - Mondini dysplasia was found. We suggest examining all children with SHFM for hearing impairment before they develop recurrent meningitis. The time when the radiological procedure for searching for inner ear dysplasia should be performed could be a controversial issue: before or after the first episode of meningitis. From the epidemiological point of view, high-resolution computer tomography scanning of the temporal bones should be considered after the diagnosis of deafness in a child with SHFM related to 7q21 deletion.

The Streptococcus sanguinis competence regulon is not required for infective endocarditis virulence in a rabbit model.

Science.gov (United States)

Callahan, Jill E; Munro, Cindy L; Kitten, Todd

2011-01-01

Streptococcus sanguinis is an important component of dental plaque and a leading cause of infective endocarditis. Genetic competence in S. sanguinis requires a quorum sensing system encoded by the early comCDE genes, as well as late genes controlled by the alternative sigma factor, ComX. Previous studies of Streptococcus pneumoniae and Streptococcus mutans have identified functions for the >100-gene com regulon in addition to DNA uptake, including virulence. We investigated this possibility in S. sanguinis. Strains deleted for the comCDE or comX master regulatory genes were created. Using a rabbit endocarditis model in conjunction with a variety of virulence assays, we determined that both mutants possessed infectivity equivalent to that of a virulent control strain, and that measures of disease were similar in rabbits infected with each strain. These results suggest that the com regulon is not required for S. sanguinis infective endocarditis virulence in this model. We propose that the different roles of the S. sanguinis, S. pneumoniae, and S. mutans com regulons in virulence can be understood in relation to the pathogenic mechanisms employed by each species.

Ocular TRUST: nationwide antimicrobial susceptibility patterns in ocular isolates.

Science.gov (United States)

Asbell, Penny A; Colby, Kathryn A; Deng, Sophie; McDonnell, Peter; Meisler, David M; Raizman, Michael B; Sheppard, John D; Sahm, Daniel F

2008-06-01

Ocular Tracking Resistance in U.S. Today (TRUST) annually evaluates in vitro antimicrobial susceptibility of Staphylococcus aureus, Streptococcus pneumoniae, and Haemophilus influenzae to ciprofloxacin, gatifloxacin, levofloxacin, moxifloxacin, penicillin, azithromycin, tobramycin, trimethoprim, and polymyxin B in national samples of ocular isolates. Laboratory investigation. Prospectively collected ocular isolates (197 S. aureus, 49 S. pneumoniae, and 32 H. influenzae) from 35 institutions and archived ocular isolates (760 S. pneumoniae and 356 H. influenzae) from 34 institutions were tested by an independent, central laboratory. Mean minimum inhibitory concentrations that would inhibit growth of 90% of the tested isolates (MIC(90)) were interpreted as susceptible, intermediate, or resistant according to standardized breakpoints for systemic treatment. S. aureus isolates were classified as methicillin susceptible (MSSA) or methicillin resistant (MRSA). MSSA or MRSA susceptibility patterns were virtually identical for the fluoroquinolones, that is, MSSA susceptibility was 79.9% to 81.1% and MRSA susceptibility was 15.2%. Trimethoprim was the only agent tested with high activity against MRSA. All S. pneumoniae isolates were susceptible to gatifloxacin, levofloxacin, and moxifloxacin; 89.8% were susceptible to ciprofloxacin. H. influenzae isolates were 100% susceptible to all tested agents but trimethoprim. Ocular TRUST 1 data were consistent with the eight-year longitudinal sample of archived ocular isolates. The fluoroquinolones were consistently active in MSSA, S. pneumoniae, and H. influenzae. After more than a decade of intensive ciprofloxacin and levofloxacin use as systemic therapy, 100% of ocular S. pneumoniae isolates were susceptible to gatifloxacin, levofloxacin, and moxifloxacin; nonsusceptibility to ciprofloxacin was less than 15%. High-level in vitro MRSA resistance suggests the need to consider alternative therapy to fluoroquinolones when MRSA is a

Live Attenuated Influenza Vaccine Enhances Colonization of Streptococcus pneumoniae and Staphylococcus aureus in Mice