
Sample records for streptococcus pneumoniae capsule

  1. Recombination in Streptococcus pneumoniae Lineages Increase with Carriage Duration and Size of the Polysaccharide Capsule (United States)

    Andam, Cheryl P.; Harris, Simon R.; Cornick, Jennifer E.; Yang, Marie; Bricio-Moreno, Laura; Kamng’ona, Arox W.; French, Neil; Heyderman, Robert S.; Kadioglu, Aras; Everett, Dean B.; Bentley, Stephen D.


    ABSTRACT Streptococcus pneumoniae causes a high burden of invasive pneumococcal disease (IPD) globally, especially in children from resource-poor settings. Like many bacteria, the pneumococcus can import DNA from other strains or even species by transformation and homologous recombination, which has allowed the pneumococcus to evade clinical interventions such as antibiotics and pneumococcal conjugate vaccines (PCVs). Pneumococci are enclosed in a complex polysaccharide capsule that determines the serotype; the capsule varies in size and is associated with properties including carriage prevalence and virulence. We determined and quantified the association between capsule and recombination events using genomic data from a diverse collection of serotypes sampled in Malawi. We determined both the amount of variation introduced by recombination relative to mutation (the relative rate) and how many individual recombination events occur per isolate (the frequency). Using univariate analyses, we found an association between both recombination measures and multiple factors associated with the capsule, including duration and prevalence of carriage. Because many capsular factors are correlated, we used multivariate analysis to correct for collinearity. Capsule size and carriage duration remained positively associated with recombination, although with a reduced P value, and this effect may be mediated through some unassayed additional property associated with larger capsules. This work describes an important impact of serotype on recombination that has been previously overlooked. While the details of how this effect is achieved remain to be determined, it may have important consequences for the serotype-specific response to vaccines and other interventions. PMID:27677790

  2. Recombination in Streptococcus pneumoniae Lineages Increase with Carriage Duration and Size of the Polysaccharide Capsule

    Directory of Open Access Journals (Sweden)

    Chrispin Chaguza


    Full Text Available Streptococcus pneumoniae causes a high burden of invasive pneumococcal disease (IPD globally, especially in children from resource-poor settings. Like many bacteria, the pneumococcus can import DNA from other strains or even species by transformation and homologous recombination, which has allowed the pneumococcus to evade clinical interventions such as antibiotics and pneumococcal conjugate vaccines (PCVs. Pneumococci are enclosed in a complex polysaccharide capsule that determines the serotype; the capsule varies in size and is associated with properties including carriage prevalence and virulence. We determined and quantified the association between capsule and recombination events using genomic data from a diverse collection of serotypes sampled in Malawi. We determined both the amount of variation introduced by recombination relative to mutation (the relative rate and how many individual recombination events occur per isolate (the frequency. Using univariate analyses, we found an association between both recombination measures and multiple factors associated with the capsule, including duration and prevalence of carriage. Because many capsular factors are correlated, we used multivariate analysis to correct for collinearity. Capsule size and carriage duration remained positively associated with recombination, although with a reduced P value, and this effect may be mediated through some unassayed additional property associated with larger capsules. This work describes an important impact of serotype on recombination that has been previously overlooked. While the details of how this effect is achieved remain to be determined, it may have important consequences for the serotype-specific response to vaccines and other interventions.

  3. Pyruvate oxidase influences the sugar utilization pattern and capsule production in Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Sandra M Carvalho

    Full Text Available Pyruvate oxidase is a key function in the metabolism and lifestyle of many lactic acid bacteria and its activity depends on the presence of environmental oxygen. In Streptococcus pneumoniae the protein has been suggested to play a major role in metabolism and has been implicated in virulence, oxidative stress survival and death in stationary phase. Under semi-aerobic conditions, transcriptomic and metabolite profiling analysis of a spxB mutant grown on glucose showed minor changes compared to the wild type, apart from the significant induction of two operons involved in carbohydrate uptake and processing. This induction leads to a change in the sugar utilization capabilities of the bacterium, as indicated by the analysis of the growth profiles of the D39 parent and spxB mutant on alternative carbohydrates. Metabolic analysis and growth experiments showed that inactivation of SpxB has no effect on the glucose fermentation pattern, except under aerobic conditions. More importantly, we show that mutation of spxB results in the production of increased amounts of capsule, the major virulence factor of S. pneumoniae. Part of this increase can be attributed to induction of capsule operon (cps transcription. Therefore, we propose that S. pneumoniae utilizes pyruvate oxidase as an indirect sensor of the oxygenation of the environment, resulting in the adaption of its nutritional capability and the amount of capsule to survive in the host.

  4. Pyruvate oxidase influences the sugar utilization pattern and capsule production in Streptococcus pneumoniae. (United States)

    Carvalho, Sandra M; Farshchi Andisi, Vahid; Gradstedt, Henrik; Neef, Jolanda; Kuipers, Oscar P; Neves, Ana R; Bijlsma, Jetta J E


    Pyruvate oxidase is a key function in the metabolism and lifestyle of many lactic acid bacteria and its activity depends on the presence of environmental oxygen. In Streptococcus pneumoniae the protein has been suggested to play a major role in metabolism and has been implicated in virulence, oxidative stress survival and death in stationary phase. Under semi-aerobic conditions, transcriptomic and metabolite profiling analysis of a spxB mutant grown on glucose showed minor changes compared to the wild type, apart from the significant induction of two operons involved in carbohydrate uptake and processing. This induction leads to a change in the sugar utilization capabilities of the bacterium, as indicated by the analysis of the growth profiles of the D39 parent and spxB mutant on alternative carbohydrates. Metabolic analysis and growth experiments showed that inactivation of SpxB has no effect on the glucose fermentation pattern, except under aerobic conditions. More importantly, we show that mutation of spxB results in the production of increased amounts of capsule, the major virulence factor of S. pneumoniae. Part of this increase can be attributed to induction of capsule operon (cps) transcription. Therefore, we propose that S. pneumoniae utilizes pyruvate oxidase as an indirect sensor of the oxygenation of the environment, resulting in the adaption of its nutritional capability and the amount of capsule to survive in the host.

  5. Pyruvate Oxidase Influences the Sugar Utilization Pattern and Capsule Production in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Carvalho, Sandra M.; Farshchi Andisi, Vahid; Gradstedt, Henrik; Neef, Jolanda; Kuipers, Oscar P.; Neves, Ana R.; Bijlsma, Jetta J. E.


    Pyruvate oxidase is a key function in the metabolism and lifestyle of many lactic acid bacteria and its activity depends on the presence of environmental oxygen. In Streptococcus pneumoniae the protein has been suggested to play a major role in metabolism and has been implicated in virulence,

  6. Mutations Blocking Side Chain Assembly, Polymerization, or Transport of a Wzy-Dependent Streptococcus pneumoniae Capsule Are Lethal in the Absence of Suppressor Mutations and Can Affect Polymer Transfer to the Cell Wall▿


    Xayarath, Bobbi; Yother, Janet


    Extracellular polysaccharides of many bacteria are synthesized by the Wzy polymerase-dependent mechanism, where long-chain polymers are assembled from undecaprenyl-phosphate-linked repeat units on the outer face of the cytoplasmic membrane. In gram-positive bacteria, Wzy-dependent capsules remain largely cell associated via membrane and peptidoglycan linkages. Like many Wzy-dependent capsules, the Streptococcus pneumoniae serotype 2 capsule is branched. In this study, we found that deletions ...

  7. Bacteremia with Streptococcus pneumoniae

    DEFF Research Database (Denmark)

    Christensen, J S; Jensen, T G; Kolmos, H J


    We conducted a hospital-based cohort study among adult patients with first-time Streptococcus pneumoniae bacteremia (SPB) from 2000 through 2008. Patients were identified in a population-based bacteremia database and followed up for mortality through the Danish Civil Registration System (CRS...

  8. streptococcus pneumoniae , klebsiella pneumoniae proteus vulgaris

    African Journals Online (AJOL)


    2-20mm) on Streptococcus pneumoniae and Proteus vulgaris when compared to the ... The result from this preliminary study suggests that the plant contains active compounds that .... Veterinary and Medical Laboratory Technology, Vom,. Jos.

  9. Crystallization and preliminary crystallographic analysis of the bacterial capsule assembly-regulating tyrosine phosphatases Wzb of Escherichia coli and Cps4B of Streptococcus pneumoniae

    International Nuclear Information System (INIS)

    Huang, Hexian; Hagelueken, Gregor; Whitfield, Chris; Naismith, James H.


    The crystallization is reported of two bacterial tyrosine phosphatases which belong to different enzyme families despite their ability to catalyse identical reactions. Bacterial tyrosine kinases and their cognate phosphatases are key players in the regulation of capsule assembly and thus are important virulence determinants of these bacteria. Examples of the kinase/phosphatase pairing are found in Gram-negative bacteria such as Escherichia coli (Wzc and Wzb) and in Gram-positive bacteria such as Streptococcus pneumoniae (CpsCD and CpsB). Although Wzb and Cps4B are both predicted to dephosphorylate the C-terminal tyrosine cluster of their cognate tyrosine kinase, they appear on the basis of protein sequence to belong to quite different enzyme classes. Recombinant purified proteins Cps4B of S. pneumoniae TIGR4 and Wzb of E. coli K-30 have been crystallized. Wzb crystals belonged to space-group family P3 x 21 and diffracted to 2.7 Å resolution. Crystal form I of Cps4B belonged to space-group family P4 x 2 1 2 and diffracted to 2.8 Å resolution; crystal form II belonged to space group P2 1 2 1 2 1 and diffracted to 1.9 Å resolution

  10. Streptococcus pneumoniae Drugs Resistance in Acute Rhinosinusitis

    Directory of Open Access Journals (Sweden)

    Chong Jie Hao


    Full Text Available Background: Acute rhinosinusitis that usually caused by Streptococcus pneumoniae becomes the reason why patients seek for medical care. Drugs resistance in Streptococcus pneumoniae is increasing worldwide. This study was conducted to determine drugs resistance of Streptococcus pneumonia from acute rhinosinusitis in Dr. Hasan Sadikin General Hospital. Methods: A descriptive laboratory study was conducted in June–October 2014 at the Laboratory of Microbiology Faculty of Medicine Universitas Padjadjaran. The sample was taken using nasopharyngeal swabbing from 100 acute rhinosinusitis patients in Dr. Hasan Sadikin General Hospital and planted on tryptic soy agar containing 5% sheep blood and 5 μg/ml of gentamicin sulphate and then incubated in 5% CO2 incubator at 37°C for 24 hours. The identification of Streptococcus pneumonia was performed by optochin test. The susceptibility test against Streptococcus pneumoniae was done using disk diffusion method.The antibiotic disks were trimethoprim-sulfamethoxazole, oxacillin, levofloxacin, azithromycin, and doxycycline. Results: Out of 100 samples, 8 of them were tested positive for Streptococcus pneumoniae. Three of Streptococcus pneumoniae isolates died with unknown reason after it were stored at -80 .The drugs resistance test showed the resistance of Streptococcus pneumonia to oxacillin, azithromycin and trimethoprim were 6, whereas levofloxacin and doxycycline are 4. Conclusions: Streptococcus pneumonia drugs resistance in acute rhinosinusitis shows the resistance of Streptococcus pneumoniae to oxacillin, azithromycin and trimethoprim are 6, whereas the resistance to levofloxacin and doxycycline are 4.

  11. Gene Regulation in Streptococcus pneumoniae: interplay between nutrition and virulence

    NARCIS (Netherlands)

    W.T. Hendriksen (Wouter)


    textabstractStreptococcus pneumoniae (the pneumococcus) is a Gram-positive bacterium, which belongs to the species of streptococci. Other pathogenic bacteria belonging to this class include Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus suis, Streptococcus uberis, Streptococcus

  12. Mutations blocking side chain assembly, polymerization, or transport of a Wzy-dependent Streptococcus pneumoniae capsule are lethal in the absence of suppressor mutations and can affect polymer transfer to the cell wall. (United States)

    Xayarath, Bobbi; Yother, Janet


    Extracellular polysaccharides of many bacteria are synthesized by the Wzy polymerase-dependent mechanism, where long-chain polymers are assembled from undecaprenyl-phosphate-linked repeat units on the outer face of the cytoplasmic membrane. In gram-positive bacteria, Wzy-dependent capsules remain largely cell associated via membrane and peptidoglycan linkages. Like many Wzy-dependent capsules, the Streptococcus pneumoniae serotype 2 capsule is branched. In this study, we found that deletions of cps2K, cps2J, or cps2H, which encode a UDP-glucose dehydrogenase necessary for side chain synthesis, the putative Wzx transporter (flippase), and the putative Wzy polymerase, respectively, were obtained only in the presence of suppressor mutations. Most of the suppressor mutations were in cps2E, which encodes the initiating glycosyltransferase for capsule synthesis. The cps2K mutants containing the suppressor mutations produced low levels of high-molecular-weight polymer that was detected only in membrane fractions. cps2K-repaired mutants exhibited only modest increases in capsule production due to the effect of the secondary mutation, but capsule was detectable in both membrane and cell wall fractions. Lethality of the cps2K, cps2J, and cps2H mutations was likely due to sequestration of undecaprenyl-phosphate in the capsule pathway and either preclusion of its turnover for utilization in essential pathways or destabilization of the membrane due to an accumulation of lipid-linked intermediates. The results demonstrate that proper polymer assembly requires not only a functional transporter and polymerase but also complete repeat units. A central role for the initiating glycosyltransferase in controlling capsule synthesis is also suggested.

  13. Thermoregulation of Capsule Production by Streptococcus pyogenes (United States)

    Kang, Song Ok; Wright, Jordan O.; Tesorero, Rafael A.; Lee, Hyunwoo; Beall, Bernard; Cho, Kyu Hong


    The capsule of Streptococcus pyogenes serves as an adhesin as well as an anti-phagocytic factor by binding to CD44 on keratinocytes of the pharyngeal mucosa and the skin, the main entry sites of the pathogen. We discovered that S. pyogenes HSC5 and MGAS315 strains are further thermoregulated for capsule production at a post-transcriptional level in addition to the transcriptional regulation by the CovRS two-component regulatory system. When the transcription of the hasABC capsular biosynthetic locus was de-repressed through mutation of the covRS system, the two strains, which have been used for pathogenesis studies in the laboratory, exhibited markedly increased capsule production at sub-body temperature. Employing transposon mutagenesis, we found that CvfA, a previously identified membrane-associated endoribonuclease, is required for the thermoregulation of capsule synthesis. The mutation of the cvfA gene conferred increased capsule production regardless of temperature. However, the amount of the capsule transcript was not changed by the mutation, indicating that a post-transcriptional regulator mediates between CvfA and thermoregulated capsule production. When we tested naturally occurring invasive mucoid strains, a high percentage (11/53, 21%) of the strains exhibited thermoregulated capsule production. As expected, the mucoid phenotype of these strains at sub-body temperature was due to mutations within the chromosomal covRS genes. Capsule thermoregulation that exhibits high capsule production at lower temperatures that occur on the skin or mucosal surface potentially confers better capability of adhesion and invasion when S. pyogenes penetrates the epithelial surface. PMID:22615992

  14. Streptococcus pneumoniae urinary tract infection in pedeatrics. (United States)

    Pougnet, Richard; Sapin, Jeanne; De Parscau, Loïc; Pougnet, Laurence


    Streptococcus pneumoniae infections in children are most often lung infections or meningitis. Urinary tract infections are much rarer. We present the case of a urinary tract infection with Streptococcus pneumoniae. The clinical picture was classical. The urine culture showed the presence of Streptococcus pneumoniae in urine (10 4 UFC/mL; with 2 × 10 4 leucocytes/mL). The literature mentions a few cases of such infections. In some studies, the prevalence of Streptococcus pneumoniae in urine of children is less than 1%. Those children mostly present abnormalities of urinary tract. In our case, urinary ultrasound scan have shown the presence of an ectopic kidney in this child. The discussion between the clinician and the biologist has contributed to the discovery of this renal anomaly.

  15. Factors associated with colonization of Streptococcus pneumoniae ...

    African Journals Online (AJOL)

    with schooling and presence chronic diseases. ... Streptococcus pneumoniae is a leading cause of serious community-acquired infections such as ... large number of individuals are still suffering from infections caused by these bacteria, especially ... samples of children with severe pneumonia (Nantanda et al., 2008).

  16. Detection and quantification of Streptococcus pneumoniae from ...

    African Journals Online (AJOL)

    The aim of this study was to develop a real time polymerase chain reaction (PCR) for quantitative detection of Streptococcus pneumoniae from clinical respiratory specimens. Initially, 184 respiratory specimens from patients with community acquired pneumonia (CAP) (n = 129) and 55 cases with hospital associated ...

  17. Monoclonal Idiotope Vaccine against Streptococcus pneumoniae Infection (United States)

    McNamara, Mary K.; Ward, Ronald E.; Kohler, Heinz


    A monoclonal anti-idiotope antibody coupled to a carrier protein was used to immunize BALB/c mice against a lethal Streptococcus pneumoniae infection. Vaccinated mice developed a high titer of antibody to phosphorylcholine, which is known to protect against infection with Streptococcus pneumoniae. Measurement of the median lethal dose of the bacteria indicated that anti-idiotope immunization significantly increased the resistance of BALB/c mice to the bacterial challenge. Antibody to an idiotope can thus be used as an antigen substitute for the induction of protective immunity.

  18. Dyrkningsnegativ Streptococcus pneumoniae endokarditis diagnosticeret med polymerasekaedereaktion

    DEFF Research Database (Denmark)

    Rasmussen, Rasmus Vedby; Kemp, Michael; Bangsborg, Jette Marie


    A 60-year old man was admitted with sepsis and meningitis of unknown aetiology. Underlying aortic valve endocarditis was diagnosed by echocardiography and severe insufficiency led to aortic valve replacement. Application of broad-range PCR to cusp tissue revealed a DNA product, and a diagnosis of...... of Streptococcus pneumoniae endocarditis was obtained by DNA sequencing....


    NARCIS (Netherlands)

    Hermans, Peter Wilhelmus Maria; Bootsma, Jeanette Hester; Burghout, Pieter Jan; Kuipers, Oscar; Bijlsma, Johanna Jacoba Elisabeth; Kloosterman, Tomas Gerrit; Andersen, Christian O.


    The present invention provides proteins/genes, which are essential for survival, and consequently, for virulence of Streptococcus pneumoniae in vivo, and thus are ideal vaccine candidates for a vaccine preparation against pneumococcal infection. Further, also antibodies against said protein(s) are

  20. Seeing Streptococcus pneumoniae, a Common Killer Bacteria

    DEFF Research Database (Denmark)

    Kjærgaard, Rikke Schmidt; Andersen, Ebbe Sloth


    Look around you. The diversity and complexity of life on earth is overwhelming and data continues to grow. In our desire to understand and explain everything scientifically from molecular evolution to supernovas we depend on visual representations. This paper investigates visual representations...... of the bacteria Streptococcus pneumoniae by use of ink, watercolours and computer graphics. We propose a novel artistic visual rendering of Streptococcus pneumoniae and ask what the value of these kind of representations are compared to traditional scientific data. We ask if drawings and computer......-assisted representations can add to our scientific knowledge about this dangerous bacteria. Is there still a role for the scientific illustrator in the scientific process and synthesis of scientific knowledge?...

  1. Streptococcus pneumoniae, mecanismos de resistencia antimicrobiana

    Directory of Open Access Journals (Sweden)

    Amauri Noda Albelo


    Full Text Available El Streptococcus pneumoniae, principal agente causal de la neumonía comunitaria, líder en la etiología de la otitis media y la meningitis, en las últimas 3 décadas ha incrementado, de manera importante, su resistencia a los agentes terapéuticos más utilizados, como los betalactámicos, macrólidos, azálidos y fluroquinolonas. La versatilidad adaptativa del microorganismo le ha permitido crear mecanismos capaces de sobreponerse a cualquiera de estas agresiones terapéuticas con un grado variable de eficacia. Se realiza una revisión de los mecanismos más importantes implicados en la adquisición de resistencia antimicrobiana por S. pneumoniae, y se precisan algunos de los factores de riesgo implicados en infección por S. pneumoniae resistente.

  2. Streptococcus pneumoniae and Pseudomonas aeruginosa pneumonia induce distinct host responses. (United States)

    McConnell, Kevin W; McDunn, Jonathan E; Clark, Andrew T; Dunne, W Michael; Dixon, David J; Turnbull, Isaiah R; Dipasco, Peter J; Osberghaus, William F; Sherman, Benjamin; Martin, James R; Walter, Michael J; Cobb, J Perren; Buchman, Timothy G; Hotchkiss, Richard S; Coopersmith, Craig M


    Pathogens that cause pneumonia may be treated in a targeted fashion by antibiotics, but if this therapy fails, then treatment involves only nonspecific supportive measures, independent of the inciting infection. The purpose of this study was to determine whether host response is similar after disparate infections with similar mortalities. Prospective, randomized controlled study. Animal laboratory in a university medical center. Pneumonia was induced in FVB/N mice by either Streptococcus pneumoniae or two different concentrations of Pseudomonas aeruginosa. Plasma and bronchoalveolar lavage fluid from septic animals was assayed by a microarray immunoassay measuring 18 inflammatory mediators at multiple time points. The host response was dependent on the causative organism as well as kinetics of mortality, but the pro-inflammatory and anti-inflammatory responses were independent of inoculum concentration or degree of bacteremia. Pneumonia caused by different concentrations of the same bacteria, Pseudomonas aeruginosa, also yielded distinct inflammatory responses; however, inflammatory mediator expression did not directly track the severity of infection. For all infections, the host response was compartmentalized, with markedly different concentrations of inflammatory mediators in the systemic circulation and the lungs. Hierarchical clustering analysis resulted in the identification of five distinct clusters of the host response to bacterial infection. Principal components analysis correlated pulmonary macrophage inflammatory peptide-2 and interleukin-10 with progression of infection, whereas elevated plasma tumor necrosis factor sr2 and macrophage chemotactic peptide-1 were indicative of fulminant disease with >90% mortality within 48 hrs. Septic mice have distinct local and systemic responses to Streptococcus pneumoniae and Pseudomonas aeruginosa pneumonia. Targeting specific host inflammatory responses induced by distinct bacterial infections could represent a

  3. Association between nasopharyngeal load of Streptococcus pneumoniae, viral coinfection, and radiologically confirmed pneumonia in Vietnamese children. (United States)

    Vu, Huong Thi Thu; Yoshida, Lay Myint; Suzuki, Motoi; Nguyen, Hien Anh Thi; Nguyen, Cat Dinh Lien; Nguyen, Ai Thi Thuy; Oishi, Kengo; Yamamoto, Takeshi; Watanabe, Kiwao; Vu, Thiem Dinh


    The interplay between nasopharyngeal bacterial carriage, viral coinfection, and lower respiratory tract infections (LRTIs) is poorly understood. We explored this association in Vietnamese children aged less than 5 years. A hospital-based case-control study of pediatric LRTIs was conducted in Nha Trang, Vietnam. A total of 550 hospitalized children (274 radiologically confirmed pneumonia [RCP] and 276 other LRTIs) were enrolled and 350 healthy controls were randomly selected from the community. Polymerase chain reaction-based methods were used to measure bacterial loads of Streptococcus pneumoniae (SP), Haemophilus influenzae, and Moraxella catarrhalis and to detect 13 respiratory viruses and bacterial serotypes in nasopharyngeal samples of study participants. The median nasopharyngeal bacterial load of SP was substantially higher in children with RCP compared with healthy controls or children with other LRTIs (P RCP or other LRTIs groups. An increased load of SP in the nasopharynx was associated with RCP, viral coinfection, and presence of pneumococcal capsule.

  4. Lung abscess caused by Streptococcus pneumoniae serotype 6B

    Directory of Open Access Journals (Sweden)

    Yuhei Ito

    Full Text Available Lung abscess has been considered to be a rare complication of pneumococcal infection, and most cases are reported to be Streptococcus pneumoniae serotype 3. A 67-year-old man presented with fever and was diagnosed to have lung abscess caused by S. pneumoniae serotype 6B. The minimal inhibitory concentration (MIC of penicillin for the isolate was 1 μg/mL. He was treated with high-dose intravenous sulbactam/ampicillin as definitive therapy based on susceptibility testing for S. pneumoniae and recovered successfully without surgical intervention. S. pneumoniae serotype 6B can cause lung abscess. Keywords: Streptococcus pneumoniae, Lung abscess, Serotype 6B, Penicillin-resistant Streptococcus pneumoniae

  5. Case Report of Necrotizing Fasciitis Associated with Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Lei Jiao


    Full Text Available Necrotizing fasciitis, caused by Streptococcus pneumoniae, is an extremely rare and life-threatening bacterial soft tissue infection. We report a case of early necrotizing fasciitis associated with Streptococcus pneumoniae infection in a 26-year-old man who was immunocompromised with mixed connective tissue disease. The patient presented with acute, painful, erythematous, and edematous skin lesions of his right lower back, which rapidly progressed to the right knee. The patient underwent surgical exploration, and a diagnosis of necrotizing fasciitis was confirmed by pathological evidence of necrosis of the fascia and neutrophil infiltration in tissue biopsies. Cultures of fascial tissue biopsies and blood samples were positive for Streptococcus pneumoniae. To our knowledge, this is the first report of necrotizing fasciitis resulting from Streptococcus pneumoniae diagnosed at early phase; the patient recovered well without surgical debridement.

  6. The post-vaccine microevolution of invasive Streptococcus pneumoniae

    NARCIS (Netherlands)

    Cremers, Amelieke J H; Mobegi, Fredrick M; de Jonge, Marien I; van Hijum, Sacha A F T; Meis, Jacques F; Hermans, Peter W M; Ferwerda, Gerben; Bentley, Stephen D; Zomer, Aldert L


    The 7-valent pneumococcal conjugated vaccine (PCV7) has affected the genetic population of Streptococcus pneumoniae in pediatric carriage. Little is known however about pneumococcal population genomics in adult invasive pneumococcal disease (IPD) under vaccine pressure. We sequenced and serotyped

  7. Serotype-specific mortality from invasive Streptococcus pneumoniae disease revisited

    DEFF Research Database (Denmark)

    Martens, Pernille; Worm, Signe Westring; Lundgren, Bettina


    Serotype-specific mortality from invasive Streptococcus pneumoniae disease revisited.Martens P, Worm SW, Lundgren B, Konradsen HB, Benfield T. Department of Infectious Diseases 144, Hvidovre University Hospital, DK-2650 Hvidovre, Denmark. BACKGROUND: Invasive infection...... with Streptococcus pneumoniae (pneumococci) causes significant morbidity and mortality. Case series and experimental data have shown that the capsular serotype is involved in the pathogenesis and a determinant of disease outcome. METHODS: Retrospective review of 464 cases of invasive disease among adults diagnosed...

  8. Host-pathogen interaction during Streptococcus pneumoniae colonization and infection

    NARCIS (Netherlands)

    D. Bogaert (Debby)


    markdownabstract__Abstract__ Streptococcus pneumoniae was discovered by Sternberg and Pasteur in 1880. It took another six years to discover that this microorganism, called the pneumococcus, was the actual cause of bacterial pneumonia . Subsequently, this bacterium has been shown to provoke an

  9. Evolution of Streptococcus pneumoniae and its close commensal relatives

    DEFF Research Database (Denmark)

    Kilian, Mogens; Poulsen, Knud; Blomqvist, Trinelise


    Streptococcus pneumoniae is a member of the Mitis group of streptococci which, according to 16S rRNA-sequence based phylogenetic reconstruction, includes 12 species. While other species of this group are considered prototypes of commensal bacteria, S. pneumoniae is among the most frequent microbial...

  10. A Visual Review of the Human Pathogen Streptococcus pneumoniae

    DEFF Research Database (Denmark)

    Engholm, Ditte Høyer; Kilian, Mogens; Goodsell, David


    Being the principal causative agent of bacterial pneumonia, otitis media, meningitis and septicemia, the bacterium Streptococcus pneumoniae is a major global health problem. To highlight the molecular basis of this problem, we have portrayed essential biological processes of the pneumococcal life...

  11. Polysaccharide capsule-mediated resistance to opsonophagocytosis in Klebsiella pneumoniae.


    Domenico, P; Salo, R J; Cross, A S; Cunha, B A


    The polysaccharide capsule of Klebsiella pneumoniae is an important virulence factor that confers resistance to phagocytosis. The treatment of encapsulated bacteria with salicylate to inhibit capsule expression was found to enhance the phagocytosis of encapsulated bacteria by human neutrophils only in the presence of cell surface-specific antibodies. Both type-specific rabbit antisera and anticapsular human hyperimmune globulin were employed as opsonins. Salicylate significantly enhanced phag...

  12. Lung abscess caused by Streptococcus pneumoniae serotype 6B. (United States)

    Ito, Yuhei; Toyoshima, Hirokazu; Suzuki, Takehiro; Iwamoto, Keisuke; Sasano, Hajime; Itani, Hidetoshi; Kondo, Shigeto; Tanigawa, Motoaki


    Lung abscess has been considered to be a rare complication of pneumococcal infection, and most cases are reported to be Streptococcus pneumoniae serotype 3. A 67-year-old man presented with fever and was diagnosed to have lung abscess caused by S. pneumoniae serotype 6B. The minimal inhibitory concentration (MIC) of penicillin for the isolate was 1 μg/mL. He was treated with high-dose intravenous sulbactam/ampicillin as definitive therapy based on susceptibility testing for S. pneumoniae and recovered successfully without surgical intervention. S. pneumoniae serotype 6B can cause lung abscess.

  13. Streptococcus pneumoniae necrotizing fasciitis in systemic lupus erythematosus. (United States)

    Sánchez, A; Robaina, R; Pérez, G; Cairoli, E


    Necrotizing fasciitis is a rapidly progressive destructive soft tissue infection with high mortality. Streptococcus pneumoniae as etiologic agent of necrotizing fasciitis is extremely unusual. The increased susceptibility to Streptococcus pneumoniae infection in patients with systemic lupus erythematosus is probably a multifactorial phenomenon. We report a case of a patient, a 36-year-old Caucasian female with 8-year history of systemic lupus erythematosus who presented a fatal Streptococcus pneumoniae necrotizing fasciitis. The role of computed tomography and the high performance of blood cultures for isolation of the causative microorganism are emphasized. Once diagnosis is suspected, empiric antibiotic treatment must be prescribed and prompt surgical exploration is mandatory. © The Author(s) 2015.

  14. Evolution of Streptococcus pneumoniae and its close commensal relatives

    DEFF Research Database (Denmark)

    Kilian, Mogens; Poulsen, Knud; Blomqvist, Trinelise


    Streptococcus pneumoniae is a member of the Mitis group of streptococci which, according to 16S rRNA-sequence based phylogenetic reconstruction, includes 12 species. While other species of this group are considered prototypes of commensal bacteria, S. pneumoniae is among the most frequent microbial...... of unique genes and their origin support the model that the entire cluster of S. pneumoniae, S. pseudopneumoniae, and S. mitis lineages evolved from pneumococcus-like bacteria presumably pathogenic to the common immediate ancestor of hominoids. During their adaptation to a commensal life style, most...

  15. Outbreak of Streptococcus pneumoniae in a Psychiatric Unit

    Centers for Disease Control (CDC) Podcasts


    Dr. Katherine Fleming-Dutra, an epidemiologist at CDC, discusses her investigation of a Streptococcus pneumoniae outbreak in a pediatric psychiatric unit.  Created: 11/2/2012 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID); National Center for Immunization and Respiratory Diseases (NCIRD).   Date Released: 11/5/2012.

  16. Clinical behavior of Streptococcus pneumoniae meningoencephalitis Comportamiento clinico y terapéutico de la meningoencefalitis por Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Raisa Bu-Coifiu Fanego


    Full Text Available OBJECTIVE: There was an increased number of cases of meningoencephalitis caused by Streptococcus pneumoniae, after the successful vaccination campaigns against Neisseria meningitidis and Haemophilus influenzae. This paper aims at describing the clinical characteristics, the laboratory findings, the complications, and the therapeutic management of these patients, who have been suffering from this disease since 1993 to 2006. METHOD: Twelve children with Streptococcus pneumoniae meningoencephalitis admitted to the pediatric hospital of San Miguel del Padron, City of Havana in this period were assessed. RESULTS: Children under one year are the most frequently affected. Septic shock and brain edema were the most severe complications. Three patients died, implying that this disease has a serious course. Early treatment of brain edema is very important to reduce mortality. The elective drugs for treatment of these cases of Streptococcus pneumoniae meningoencephalitis were vancomycin combined with cephalosporin, cefotaxime or ceftriaxone type. CONCLUSION: Patients with Streptococcus pneumoniae meningoencephalitis show clinical characteristics, complications, and sequels that are different to other bacterial meningoencephalitis, meaning that they could be helpful for physicians considering the differential diagnosis of meningoencephalitis.OBJETIVO: Existe un incremento de la meningoencefalitis producida por Streptococcus pneumoniae, después de las campañas exitosas de vacunación contra Neisseria meningitidis y Haemophilus influenzae. El objetivo de este trabajo es describir las caracteristicas clinicas, los hallazgos de laboratorio, las complicaciones y el manejo terapéutico de los pacientes que sufrieron esta enfermedad desde 1993 a 2006. MÉTODO: Se estudiaron doce niños con meningoencefalitis por Streptococcus pneumoniae ingresados en el Hospital Pediátrico de San Miguel del Padrón, Ciudad de La Habana en este periodo. RESULTADOS: Los ni

  17. Nasopharyngeal carriage of Streptococcus pneumonia in pneumonia-prone age groups in Semarang, Java Island, Indonesia. (United States)

    Farida, Helmia; Severin, Juliëtte A; Gasem, M Hussein; Keuter, Monique; Wahyono, Hendro; van den Broek, Peterhans; Hermans, Peter W M; Verbrugh, Henri A


    Streptococcus pneumoniae is a worldwide occurring pathogen Nasopharyngeal carriage of Streptococcus pneumoniae precedes pneumonia and other pneumococcal diseases in the community. Little is known about S. pneumoniae carriage in Indonesia, complicating strategies to control pneumococcal diseases. We investigated nasopharyngeal carriage of S. pneumoniae in Semarang, Indonesia. A population-based survey was performed in Semarang, Indonesia. Nasopharyngeal swabs and questionnaires were taken from 496 healthy young (6-60 month-old) children and 45-70 year-old adults. Forty-three percent of children aged 6-60 months and 11% of adults aged 45-75 years carried S. pneumoniae. Determinants of carriage were being a child (OR 7.7; 95% CI = 4.5-13.0), passive smoking (OR 2.1; 95% CI = 1.3-3.4), and contact with toddler(s) at home (OR 3.0; 95% CI = 1.9-4.7). The most frequent serotypes found were 6A/B and 15B/C. The current commercially available vaccines cover <50% serotypes found in children. Twenty-four percent of S. pneumoniae strains were penicillin non-susceptible, and 45% were resistant to cotrimoxazol. The limited coverage of commercially available vaccines against the serotypes found in this population, and the high proportion of non-susceptibility to penicillin and cotrimoxazol suggest the need for region-specific information and strategies to control S. pneumoniae.

  18. MALDI-TOF mass spectrometry for differentiation between Streptococcus pneumoniae and Streptococcus pseudopneumoniae. (United States)

    van Prehn, Joffrey; van Veen, Suzanne Q; Schelfaut, Jacqueline J G; Wessels, Els


    We compared the Vitek MS and Microflex MALDI-TOF mass spectrometry platform for species differentiation within the Streptococcus mitis group with PCR assays targeted at lytA, Spn9802, and recA as reference standard. The Vitek MS correctly identified 10/11 Streptococcus pneumoniae, 13/13 Streptococcus pseudopneumoniae, and 12/13 S. mitis/oralis. The Microflex correctly identified 9/11 S. pneumoniae, 0/13 S. pseudopneumoniae, and 13/13 S. mitis/oralis. MALDI-TOF is a powerful tool for species determination within the mitis group. Diagnostic accuracy varies depending on platform and database used. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  19. Neutrophil evasion strategies by Streptococcus pneumoniae and Staphylococcus aureus. (United States)

    Lewis, Megan L; Surewaard, Bas G J


    Humans are well equipped to defend themselves against bacteria. The innate immune system employs diverse mechanisms to recognize, control and initiate a response that can destroy millions of different microbes. Microbes that evade the sophisticated innate immune system are able to escape detection and could become pathogens. The pathogens Streptococcus pneumoniae and Staphylococcus aureus are particularly successful due to the development of a wide variety of virulence strategies for bacterial pathogenesis and they invest significant efforts towards mechanisms that allow for neutrophil evasion. Neutrophils are a primary cellular defense and can rapidly kill invading microbes, which is an indispensable function for maintaining host health. This review compares the key features of Streptococcus pneumoniae and Staphylococcus aureus in epidemiology, with a specific focus on virulence mechanisms utilized to evade neutrophils in bacterial pathogenesis. It is important to understand the complex interactions between pathogenic bacteria and neutrophils so that we can disrupt the ability of pathogens to cause disease.

  20. Correlations between computed tomography findings and clinical manifestations of Streptococcus pneumoniae pneumonia

    International Nuclear Information System (INIS)

    Yagihashi, Kunihiro; Kurihara, Yasuyuki; Fujikawa, Atsuko; Matsuoka, Shin; Nakajima, Yasuo


    The aim of this study was to characterize the imaging features and compare computed tomography (CT) findings with clinical features of patients with Streptococcus pneumoniae pneumonia. We retrospectively reviewed 75 patients (44 men, 31 women; mean age 67 years) diagnosed with S. pneumoniae pneumonia who underwent chest CT scanning at our institution between January 2007 and August 2008. Diagnoses were based on detection of the S. pneumoniae antigen in urine. Chest CT scans revealed abnormalities in all patients. The predominant opacity patterns were an airspace pneumonia pattern (48%) and a bronchopneumonia pattern (48%), followed by an interstitial pneumonia pattern (4%). Consolidation was observed most frequently (84%) followed by ground glass opacity (82.7%), bronchial wall thickening (61.3%), and centrilobular nodules (49.3%). Airway dilatation (21.6%), pleural effusion (33.3%), lymphadenopathy (34.8%), and pulmonary emphysema (21.3%) were also observed. Pulmonary emphysema was significantly less frequent in patients with the bronchopneumonia pattern than in those without (p=0.007). The clinical features and CT findings did not differ significantly. CT image analysis showed that patients with S. pneumoniae pneumonia exhibited the bronchopneumonia and airspace pneumonia patterns with equal frequency. Bronchopneumonia pattern was less common in patients with preexisting emphysema. (author)

  1. Structure of a conjugative element in Streptococcus pneumoniae

    Energy Technology Data Exchange (ETDEWEB)

    Vijayakumar, M.N.; Priebe, S.D.; Guild, W.R.


    The authors have cloned and mapped a 69-kilobase (kb) region of the chromosome of Streptococcus pneumoniae DP1322, which carries the conjugative Omega(cat-tet) insertion from S. pneumoniae BM6001. This element proved to be 65.5 kb in size. Location of the junctions was facilitated by cloning a preferred target region from the wild-type strain Rx1 recipient genome. This target site was preferred by both the BM6001 element and the cat-erm-tet element from Streptococcus agalactiae B109. Within the BM6001 element cat and tet were separated by 30 kb, and cat was flanked by two copies of a sequence that was also present in the recipient strain Rx1 DNA. Another sequence at least 2.4 kb in size was found inside the BM6001 element and at two places in the Rx1 genome. Its role is unknown. The ends of the BM6001 element appear to be the same as those of the B109 element, both as seen after transfer to S. pneumoniae and as mapped by others in pDP5 after transposition in Streptococcus faecalis. No homology is seen between the ends of the BM6001 element and no evidence found suggesting that it ever circularizes.

  2. Antimicrobial Susceptibility/Resistance of Streptococcus Pneumoniae (United States)

    Karcic, Emina; Aljicevic, Mufida; Bektas, Sabaheta; Karcic, Bekir


    Introduction: Pneumococcal infections are a major cause of morbidity and mortality worldwide, whose treatment is threatened with an increase in the number of strains resistant to antibiotic therapy. Goal: The main goal of this research was to investigate the presence of antimicrobial susceptibility/resistance of S. pneumoniae. Material and methods: Taken are swabs of the nose and nasopharynx, eye and ear. In vitro tests that were made in order to study the antimicrobial resistance of pneumococci are: disk diffusion method and E-test. Results: The resistance to inhibitors of cell wall synthesis was recorded at 39.17%, protein synthesis inhibitors 19.67%, folate antagonists 47.78% and quinolone in 1.11%. S. pneumoniae has shown drug resistance to erythromycin in 45%, clindamycin in 45%, chloramphenicol–0.56%, rifampicin–6.11%, tetracycline–4.67%, penicillin-G in 4.44%, oxacillin in 73.89%, ciprofloxacin in 1.11% and trimethoprim-sulfamethoxazole in 5.34% of cases. Conclusion: The highest resistance pneumococcus showed to erythromycin, clindamycin and trimethoprim-sulfamethoxazole and these should be avoided in the treatment. The least resistance pneumococcus showed to tetracycline, rifampicin, chloramphenicol, penicillin-G and ciprofloxacin. PMID:26236165

  3. The Antiphagocytic Activity of SeM of Streptococcus equi Requires Capsule. (United States)

    Timoney, John F; Suther, Pranav; Velineni, Sridhar; Artiushin, Sergey C


    Resistance to phagocytosis is a crucial virulence property of Streptococcus equi (Streptococcus equi subsp. equi; Se), the cause of equine strangles. The contribution and interdependence of capsule and SeM to killing in equine blood and neutrophils were investigated in naturally occurring strains of Se. Strains CF32, SF463 were capsule and SeM positive, strains Lex90, Lex93 were capsule negative and SeM positive and strains Se19, Se1-8 were capsule positive and SeM deficient. Phagocytosis and killing of Se19, Se1-8, Lex90 and Lex93 in equine blood and by neutrophils suspended in serum were significantly (P ≤ 0.02) greater compared to CF32 and SF463. The results indicate capsule and SeM are both required for resistance to phagocytosis and killing and that the anti-phagocytic property of SeM is greatly reduced in the absence of capsule.

  4. Importance of Bacterial Replication and Alveolar Macrophage-Independent Clearance Mechanisms during Early Lung Infection with Streptococcus pneumoniae (United States)

    Camberlein, Emilie; Cohen, Jonathan M.; José, Ricardo; Hyams, Catherine J.; Callard, Robin; Chimalapati, Suneeta; Yuste, Jose; Edwards, Lindsey A.; Marshall, Helina; van Rooijen, Nico; Noursadeghi, Mahdad


    Although the importance of alveolar macrophages for host immunity during early Streptococcus pneumoniae lung infection is well established, the contribution and relative importance of other innate immunity mechanisms and of bacterial factors are less clear. We have used a murine model of S. pneumoniae early lung infection with wild-type, unencapsulated, and para-amino benzoic acid auxotroph mutant TIGR4 strains to assess the effects of inoculum size, bacterial replication, capsule, and alveolar macrophage-dependent and -independent clearance mechanisms on bacterial persistence within the lungs. Alveolar macrophage-dependent and -independent (calculated indirectly) clearance half-lives and bacterial replication doubling times were estimated using a mathematical model. In this model, after infection with a high-dose inoculum of encapsulated S. pneumoniae, alveolar macrophage-independent clearance mechanisms were dominant, with a clearance half-life of 24 min compared to 135 min for alveolar macrophage-dependent clearance. In addition, after a high-dose inoculum, successful lung infection required rapid bacterial replication, with an estimated S. pneumoniae doubling time of 16 min. The capsule had wide effects on early lung clearance mechanisms, with reduced half-lives of 14 min for alveolar macrophage-independent and 31 min for alveolar macrophage-dependent clearance of unencapsulated bacteria. In contrast, with a lower-dose inoculum, the bacterial doubling time increased to 56 min and the S. pneumoniae alveolar macrophage-dependent clearance half-life improved to 42 min and was largely unaffected by the capsule. These data demonstrate the large effects of bacterial factors (inoculum size, the capsule, and rapid replication) and alveolar macrophage-independent clearance mechanisms during early lung infection with S. pneumoniae. PMID:25583525

  5. Organization of the capsule biosynthesis gene locus of the oral streptococcus Streptococcus anginosus. (United States)

    Tsunashima, Hiroyuki; Miyake, Katsuhide; Motono, Makoto; Iijima, Shinji


    The capsular polysaccharide (CPS) of the important oral streptococcus Streptococcus anginosus, which causes endocarditis, and the genes for its synthesis have not been clarified. In this study, we investigated the gene locus required for CPS synthesis in S. anginosus. Southern hybridization using the cpsE gene of the well-characterized bacterium S. agalactiae revealed that there is a similar gene in the genome of S. anginosus. By using the colony hybridization technique and inverse PCR, we isolated the CPS synthesis (cps) genes of S. anginosus. This gene cluster consisted of genes containing typical regulatory genes, cpsA-D, and glycosyltransferase genes coding for glucose, rhamnose, N-acetylgalactosamine, and galactofuranose transferases. Furthermore, we confirmed that the cps locus is required for CPS synthesis using a mutant strain with a defective cpsE gene. The cps cluster was found to be located downstream the nrdG gene, which encodes ribonucleoside triphosphate reductase activator, as is the case in other oral streptococci such as S. gordonii and S. sanguinis. However, the location of the gene cluster was different from those of S. pneumonia and S. agalactiae. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  6. Lung abscess due to Streptococcus pneumoniae: a case series and brief review of the literature. (United States)

    Nicolini, Antonello; Cilloniz, Catia; Senarega, Renata; Ferraioli, Gianluca; Barlascini, Cornelius


    Anaerobes used to be the most common cause of community-acquired lung abscess, and Streptococcus species used to be the second most common cause. In recent years, this has been changing. Klebsiella pneumoniae is now an increasing cause of community- acquired lung abscess, but Streptococcus species continue to be major pathogens. Necrotizing pneumonia has generally been regarded as a rare complication of pneumococcal infection in adults. Type 3 Streptococcus pneumoniae was the single most common type implicated in necrosis; however, many other serotypes were implicated. This entity predominately infects children, but is present also in adults. Lung abscess in adults due to Streptococcus pneumoniae is not common. In this regard we present a case series of pulmonary cavitation due to Streptococcus pneumoniae and discuss the possible pathogenic mechanism of the disease.

  7. Epidemiological Studies of Potent Environmental Pathogen: Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Nazir A. Brohi


    Full Text Available A general survey for six months was undertaken for the prevalence of environmental bacterium Streptococcus pneumoniae among the different age groups (3-65 years including both sexes from various hospitals of Hyderabad city. Laboratory examinations revealed S. pneumoniae as most potent environmental pathogen from the sputum and throat swabs of old aged patients and children respectively. During observations, 39 specimens were growth positive; the biochemistry of isolates revealed that they were coagulase, catalase and oxidase negative, TSI, gel hydrolysis positive and were able to ferment glucose, lactose, maltose, galactose, fructose, sucrose, starch and raffinose. The results of antimicrobial activity showed that pneumococci were resistant to the cefspan, septran, cravit, pipemetic acid, azomax, bacitracin, and penicillin and a clear zone of inhibition was observed on clithromycin, optochin, cefizox, genatamycin, minocyclin, levoflaxacin, and vancomycin. There were intermediate zone of inhibition found on claforan, nalidixic acid, amoxycillin, fosfomycin, fortum, and erythromycin on Mueller Hinton’s agar after 24 hours incubation

  8. Epidemiological studies of potent environment pathogen streptococcus pneumoniae

    International Nuclear Information System (INIS)

    Brohi, N.A.; Tunio, S.A.


    A general survey for six months was undertaken for the prevalence of environmental bacterium Streptococcus pneumoniae among the different age groups (3-65 years) including both sexes from various hospitals of Hyderabad city. Laboratory examinations revealed S. pneumoniae as most potent environmental pathogen from the sputum and throat swabs of old aged patients and children respectively. During observations, 39 specimens were growth positive; the biochemistry of isolates revealed that they were coagulase, catalase and oxidase negative, TSI, gel hydrolysis positive and were able to ferment glucose, lactose, maltose, galactose, fructose, sucrose, starch and raffinose. The results of antimicrobial activity showed that pneumococci were resistant to the cefspan, septran, cravit, pipemetic acid, azomax, bacitracin, and penicillin and a clear zone of inhibition was observed on clithromycin, optochin, cefizox, genatamycin, minocyclin, levoflaxacin, and vancomycin. There were intermediate zone of inhibition found on claforan, nalidixic acid, amoxycillin, fosfomycin, fortum, and erythromycin on Mueller Hinton's agar after 24 hours incubation. (author)

  9. Analysis of invasive pneumonia-causing strains of Streptococcus pneumoniae: serotypes and antimicrobial susceptibility. (United States)

    Yoshioka, Cristina R M; Martinez, Marina B; Brandileone, Maria C C; Ragazzi, Selma B; Guerra, Maria L L S; Santos, Silvia R; Shieh, Huei H; Gilio, Alfredo E


    To identify the most common pneumococcal serotypes in children hospitalized with invasive pneumonia, correlate isolated serotypes with those included in conjugate vaccines, and ascertain the sensitivity of the isolated pneumococcal strains to penicillin and other antibiotics. From January 2003 to October 2008, a retrospective study of hospitalized children with a diagnosis of Streptococcus pneumoniae pneumonia was conducted at the university hospital of Universidade de São Paulo. Criteria for inclusion were: age greater than 29 days and less than 15 years, radiological and clinical diagnosis of pneumonia, and isolation of Streptococcus pneumoniae in blood cultures and/or pleural effusion. The study included 107 children. The most common serotypes were 14 (36.5%), 1 (16%), 5 (14.6%), 6B (6.3%) and 3 (4.2%). The proportion of identified serotypes contained in the heptavalent, 10-valent and 13-valent conjugate vaccines was 53.1, 86.5, and 96.9%, respectively. Pneumococcal strains were sensitive to penicillin (minimum inhibitory concentration, MIC ≤ 2 µg/mL) in 100 cases (93.5%) and displayed intermediate resistance (MIC = 4 µg/mL) in 7 cases (6.5%). No strains were penicillin-resistant (MIC ≥ 8 µg/mL) according to the Clinical and Laboratory Standards Institute 2008 standards. Tested isolates were highly sensitive to vancomycin, rifampicin, ceftriaxone, clindamycin, erythromycin, and chloramphenicol. Our results confirm a significant potential impact of conjugate vaccines, mainly 10-valent and 13-valent, on invasive pneumonia. Furthermore, susceptibility testing results show that penicillin is still the treatment of choice for invasive pneumonia in our setting.

  10. Detection of Streptococcus pneumoniae in whole blood by PCR. (United States)

    Zhang, Y; Isaacman, D J; Wadowsky, R M; Rydquist-White, J; Post, J C; Ehrlich, G D


    Streptococcus pneumoniae is a major cause of bacteremia in both children and adults. Currently, the diagnosis of pneumococcal bacteremia relies on the isolation and identification of the bacteria from blood cultures. We have developed a sensitive assay for the detection of S. pneumoniae in whole blood by the PCR. A specific primer-probe set (JM201 and JM202 primers with JM204 probe) designed from the penicillin-binding protein 2B gene was demonstrated to reproducibly detect between 10 and 100 fg of input purified S. pneumoniae DNA. This assay system was shown to be inclusive for all strains of S. pneumoniae evaluated, including 15 different serotypes and a battery of penicillin-resistant and -sensitive strains. The specificity of this PCR-based assay was demonstrated by its inability to support amplification from a series of human, bacterial, and yeast genomic DNAs. A general specimen preparation method which should be suitable for the purification of DNA from any pathogens in whole blood was developed. With this protocol it was possible to detect S. pneumoniae-specific DNA from whole blood specimens inoculated with as little as 4 CFU/ml. Copurified human blood DNA, ranging from 0 to 4.5 micrograms per PCR, did not affect the sensitivity of S. pneumoniae detection by PCR. A blinded clinical trial was used to compare the PCR-based assay with standard microbiological blood culture for the detection of S. pneumoniae bacteremia in 36 specimens obtained from pediatric patients seen in the emergency room of Children's Hospital of Pittsburgh. With culture as the "gold standard," the PCR-based assay had a sensitivity of 80% (4 of 5 culture-positive specimens were PCR positive) and a specificity of 84% (26 of 31 culture-negative specimens were PCR negative). However, three patients whose specimens were PCR positive and culture negative had histories suggestive of bacteremia, including recent positive blood cultures, treatment with antibiotics, cellulitis, and multiple

  11. The Proteasome-Ubiquitin System Is Required for Efficient Killing of Intracellular Streptococcus pneumoniae by Brain Endothelial Cells

    NARCIS (Netherlands)

    Iovino, Federico; Gradstedt, Henrik; Bijlsma, Jetta J.


    Streptococcus pneumoniae (pneumococcus) is a Gram-positive bacterium that causes serious invasive diseases, such as pneumonia, bacteremia, and meningitis, with high morbidity and mortality throughout the world. Before causing invasive disease, S. pneumoniae encounters cellular barriers, which are

  12. Translation quality control is maintained by the penicillin resistance factor MurM in Streptococcus pneumoniae

    DEFF Research Database (Denmark)

    Shepherd, Jennifer; Ibba, Michael


    Streptococcus pneumoniae is a causative agent of nosocomial infections such as pneumonia, meningitis and septicaemia. Penicillin resistance in S. pneumoniae depends in part upon MurM, an aminoacyl-tRNA-ligase that attaches L-serine or L-alanine to the stem peptide lysine of Lipid II in cell wall...

  13. Characterization of a Multipeptide Lantibiotic Locus in Streptococcus pneumoniae. (United States)

    Maricic, Natalie; Anderson, Erica S; Opipari, AnneMarie E; Yu, Emily A; Dawid, Suzanne


    Bacterial communities are established through a combination of cooperative and antagonistic interactions between the inhabitants. Competitive interactions often involve the production of antimicrobial substances, including bacteriocins, which are small antimicrobial peptides that target other community members. Despite the nearly ubiquitous presence of bacteriocin-encoding loci, inhibitory activity has been attributed to only a small fraction of gene clusters. In this study, we characterized a novel locus (the pld locus) in the pathogen Streptococcus pneumoniae that drives the production of a bacteriocin called pneumolancidin, which has broad antimicrobial activity. The locus encodes an unusual tandem array of four inhibitory peptides, three of which are absolutely required for antibacterial activity. The three peptide sequences are similar but appear to play distinct roles in regulation and inhibition. A modification enzyme typically found in loci encoding a class of highly modified bacteriocins called lantibiotics was required for inhibitory activity. The production of pneumolancidin is controlled by a two-component regulatory system that is activated by the accumulation of modified peptides. The locus is located on a mobile element that has been found in many pneumococcal lineages, although not all elements carry the pld genes. Intriguingly, a minimal region containing only the genes required for pneumolancidin immunity was found in several Streptococcus mitis strains. The pneumolancidin-producing strain can inhibit nearly all pneumococci tested to date and provided a competitive advantage in vivo. These peptides not only represent a unique strategy for bacterial competition but also are an important resource to guide the development of new antimicrobials. Successful colonization of a polymicrobial host surface is a prerequisite for the subsequent development of disease for many bacterial pathogens. Bacterial factors that directly inhibit the growth of neighbors

  14. Epidemiology of Streptococcus pneumoniae and Staphylococcus aureus colonization in healthy Venezuelan children


    Quintero, B.; Araque, M.; van der Gaast-de Jongh, C.; Escalona, F.; Correa, M.; Morillo-Puente, S.; Vielma, S.; Hermans, P. W. M.


    Streptococcus pneumoniae and Staphylococcus aureus cause significant morbidity and mortality worldwide. We investigated both the colonization and co-colonization characteristics for these pathogens among 250 healthy children from 2 to 5?years of age in Merida, Venezuela, in 2007. The prevalence of S. pneumoniae colonization, S. aureus colonization, and S. pneumoniae?S. aureus co-colonization was 28%, 56%, and 16%, respectively. Pneumococcal serotypes 6B (14%), 19F (12%), 23F (12%), 15 (9%), 6...

  15. Streptococcus pneumoniae-associated pneumonia complicated by purulent pericarditis: case series

    Energy Technology Data Exchange (ETDEWEB)

    Cilloniz, Catia; Torres, Antoni [Servicio de Neumologia, Hospital Clinic de Barcelona, Ciber de Enfermedades Respiratorias (CIBERES), Instituto de Investigacion Biomedica Agusti Pi i Sunyer, Universidad de Barcelona (Spain); Rangel, Ernesto [Facultad de Medicina, Universidad Autonoma de Nayarit, Tepic (Mexico); Barlascini, Cornelius [Servizio di Igiene e Sanita Pubblica, Ospedale Generale di Sestri Levante, Sestri Levante (Italy); Piroddi, Ines Maria Grazia; Nicolini, Antonello, E-mail: [Servizio di Pneumologia, Ospedale Generale di Sestri Levante, Sestri Levante (Italy)


    Objective: In the antibiotic era, purulent pericarditis is a rare entity. However, there are still reports of cases of the disease, which is associated with high mortality, and most such cases are attributed to delayed diagnosis. Approximately 40-50% of all cases of purulent pericarditis are caused by Gram-positive bacteria, Streptococcus pneumoniae in particular. Methods: We report four cases of pneumococcal pneumonia complicated by pericarditis, with different clinical features and levels of severity. Results: In three of the four cases, the main complication was cardiac tamponade. Microbiological screening (urinary antigen testing and pleural fluid culture) confirmed the diagnosis of severe pneumococcal pneumonia complicated by purulent pericarditis. Conclusions: In cases of pneumococcal pneumonia complicated by pericarditis, early diagnosis is of paramount importance to avoid severe hemodynamic compromise. The complications of acute pericarditis appear early in the clinical course of the infection. The most serious complications are cardiac tamponade and its consequences. Antibiotic therapy combined with pericardiocentesis drastically reduces the mortality associated with purulent pericarditis. (author)

  16. Streptococcus pneumoniae-associated pneumonia complicated by purulent pericarditis: case series

    International Nuclear Information System (INIS)

    Cilloniz, Catia; Torres, Antoni; Rangel, Ernesto; Barlascini, Cornelius; Piroddi, Ines Maria Grazia; Nicolini, Antonello


    Objective: In the antibiotic era, purulent pericarditis is a rare entity. However, there are still reports of cases of the disease, which is associated with high mortality, and most such cases are attributed to delayed diagnosis. Approximately 40-50% of all cases of purulent pericarditis are caused by Gram-positive bacteria, Streptococcus pneumoniae in particular. Methods: We report four cases of pneumococcal pneumonia complicated by pericarditis, with different clinical features and levels of severity. Results: In three of the four cases, the main complication was cardiac tamponade. Microbiological screening (urinary antigen testing and pleural fluid culture) confirmed the diagnosis of severe pneumococcal pneumonia complicated by purulent pericarditis. Conclusions: In cases of pneumococcal pneumonia complicated by pericarditis, early diagnosis is of paramount importance to avoid severe hemodynamic compromise. The complications of acute pericarditis appear early in the clinical course of the infection. The most serious complications are cardiac tamponade and its consequences. Antibiotic therapy combined with pericardiocentesis drastically reduces the mortality associated with purulent pericarditis. (author)

  17. Streptococcus pneumoniae enhances human respiratory syncytial virus infection in vitro and in vivo

    NARCIS (Netherlands)

    D.T. Nguyen (Tien); R.P.L. Louwen (Rogier); Elberse, K. (Karin); G. van Amerongen (Geert); S. Yüksel (Selma); A. Luijendijk (Ad); A.D.M.E. Osterhaus (Albert); W.P. Duprex (William Paul); R.L. de Swart (Rik)


    textabstractHuman respiratory syncytial virus (HRSV) and Streptococcus pneumoniae are important causative agents of respiratory tract infections. Both pathogens are associated with seasonal disease outbreaks in the pediatric population, and can often be detected simultaneously in infants

  18. Molecular epidemiology of penicillin-nonsusceptible Streptococcus pneumoniae among children in Greece

    NARCIS (Netherlands)

    D. Bogaert (Debby); G.A. Syrogiannopoulos; I.N. Grivea; R. de Groot (Ronald); N.G. Beratis; P.W.M. Hermans (Peter)


    textabstractA total of 145 penicillin-nonsusceptible Streptococcus pneumoniae strains were isolated from young carriers in Greece and analyzed by antibiotic susceptibility testing, serotyping, restriction fragment end labeling (RFEL), and penicillin-binding protein

  19. Meropenem susceptibility of Neisseria meningitidis and Streptococcus pneumoniae from meningitis patients in The Netherlands

    NARCIS (Netherlands)

    van de Beek, D.; Hensen, E. F.; Spanjaard, L.; de Gans, J.; Enting, R. H.; Dankert, J.


    In-vitro susceptibility of 299 Neisseria meningitidis and 157 Streptococcus pneumoniae strains from meningitis patients in The Netherlands in 1993 and 1994 to meropenem was determined using the Etest. Susceptibility to penicillin, ceftriaxone, and chloramphenicol was also determined. Rifampicin

  20. A visual review of the human pathogen Streptococcus pneumoniae. (United States)

    Engholm, Ditte Høyer; Kilian, Mogens; Goodsell, David S; Andersen, Ebbe Sloth; Kjærgaard, Rikke Schmidt


    Being the principal causative agent of bacterial pneumonia, otitis media, meningitis and septicemia, the bacterium Streptococcus pneumoniae is a major global health problem. To highlight the molecular basis of this problem, we have portrayed essential biological processes of the pneumococcal life cycle in eight watercolor paintings. The paintings are done to a consistent nanometer scale based on currently available data from structural biology and proteomics. In this review article, the paintings are used to provide a visual review of protein synthesis, carbohydrate metabolism, cell wall synthesis, cell division, teichoic acid synthesis, virulence, transformation and pilus synthesis based on the available scientific literature within the field of pneumococcal biology. Visualization of the molecular details of these processes reveals several scientific questions about how molecular components of the pneumococcal cell are organized to allow biological function to take place. By the presentation of this visual review, we intend to stimulate scientific discussion, aid in the generation of scientific hypotheses and increase public awareness. A narrated video describing the biological processes in the context of a whole-cell illustration accompany this article. © FEMS 2017. All rights reserved. For permissions, please e-mail:

  1. Concurrent Infection with Hepatitis C Virus and Streptococcus pneumoniae. (United States)

    Marrie, Thomas J; Tyrrell, Gregory J; Majumdar, Sumit R; Eurich, Dean T


    Little is known about concurrent infection with hepatitis C virus (HCV) and Streptococcus pneumoniae, which causes invasive pneumococcal disease (IPD). We hypothesized that co-infection with HCV and S. pneumoniae would increase risk for death and complications. We captured sociodemographic and serologic data for adults with IPD in a population-based cohort study in northern Alberta, Canada, during 2000-2014. IPD patients infected with HCV were compared with IPD patients not infected with HCV for risk of in-hospital deaths and complications by using multivariable logistic regression. A total of 355 of 3,251 patients with IPD were co-infected with HCV. The in-hospital mortality rate was higher for IPD patients infected with HCV. Prevalence of most IPD-related complications (e.g., cellulitis, acute kidney injury, mechanical ventilation) was also higher in HCV-infected patients. Infection with HCV is common in patients with IPD, and HCV is independently associated with an increased risk for serious illness and death.

  2. AdcAII of Streptococcus pneumoniae Affects Pneumococcal Invasiveness.

    Directory of Open Access Journals (Sweden)

    Lindsey R Brown

    Full Text Available Across bacterial species, metal binding proteins can serve functions in pathogenesis in addition to regulating metal homeostasis. We have compared and contrasted the activities of zinc (Zn2+-binding lipoproteins AdcA and AdcAII in the Streptococcus pneumoniae TIGR4 background. Exposure to Zn2+-limiting conditions resulted in delayed growth in a strain lacking AdcAII (ΔAdcAII when compared to wild type bacteria or a mutant lacking AdcA (ΔAdcA. AdcAII failed to interact with the extracellular matrix protein laminin despite homology to laminin-binding proteins of related streptococci. Deletion of AdcA or AdcAII led to significantly increased invasion of A549 human lung epithelial cells and a trend toward increased invasion in vivo. Loss of AdcAII, but not AdcA, was shown to negatively impact early colonization of the nasopharynx. Our findings suggest that expression of AdcAII affects invasiveness of S. pneumoniae in response to available Zn2+ concentrations.

  3. Streptococcus pneumoniae aislados de infecciones invasivas: serotipos y resistencia antimicrobiana Streptococcus pneumoniae isolated from invasive infections: serotypes and antimicrobial resistance

    Directory of Open Access Journals (Sweden)

    Gladys Antonia Cueto Montoya


    Full Text Available Las meningoencefalitis bacterianas constituyen una enfermedad invasiva importante, quizás no tanto por su frecuencia, como por la gravedad de su cuadro. Los cambios en la epidemiología de los síndromes neurológicos infecciosos en Cuba a partir de la vacunación contra meningococo BC y Haemophilus influenzae b han hecho que el Streptococcus pneumoniae constituya el agente causal más frecuente. Debido al incremento de la resistencia de este microorganismo a los antibióticos habituales, se realizaron modificaciones al régimen terapéutico convencional, fundamentalmente en las meningitis pediátricas. Es necesario lograr el aislamiento en cultivo de este agente para conocer los serotipos más frecuentes en el país, y lograr una vacuna neumocócica conjugada, así como para la vigilancia de las cepas frente a los antimicrobianos.The bacterial meningoencephalitis is an important invasive disease, not only because of its frequency, but also because of the severity of its picture. The changes in the epidemiology of the neurological infectious syndromes in Cuba starting from the vaccination against meningococcus BC and Haemophilus infuenzae b have made that Streptococcus pneumoniae be the most frequent causal agent. Due to the increase of the resistance of this microorganism to habitual antibiotics, modifications were made in the conventional therapeutic regimen, mainly in the pediatric meningitis. It is necessary to achieve the isolation in culture of this agent to know the most common serotypes in the country, to attain a conjugated pneumococcal vaccine, and to keep the surveillance of the strains against the antimicrobials.

  4. Comparative genomic analysis of multidrug-resistant Streptococcus pneumoniae isolates

    Directory of Open Access Journals (Sweden)

    Pan F


    Full Text Available Fen Pan,1 Hong Zhang,1 Xiaoyan Dong,2 Weixing Ye,3 Ping He,4 Shulin Zhang,4 Jeff Xianchao Zhu,5 Nanbert Zhong1,2,6 1Department of Clinical Laboratory, Shanghai Children’s Hospital, Shanghai Jiaotong University, Shanghai, China; 2Department of Respiratory, Shanghai Children’s Hospital, Shanghai Jiaotong University, Shanghai, China; 3Shanghai Personal Biotechnology Co., Ltd, Shanghai, China; 4Department of Medical Microbiology and Immunology, Shanghai Jiao Tong University School of Medicine, Shanghai, China; 5Zhejiang Bioruida Biotechnology co. Ltd, Zhejiang, China; 6New York State Institute for Basic Research in Developmental Disabilities, Staten Island, NY, USA Introduction: Multidrug resistance in Streptococcus pneumoniae has emerged as a serious problem to public health. A further understanding of the genetic diversity in antibiotic-resistant S. pneumoniae isolates is needed. Methods: We conducted whole-genome resequencing for 25 pneumococcal strains isolated from children with different antimicrobial resistance profiles. Comparative analysis focus on detection of single-nucleotide polymorphisms (SNPs and insertions and deletions (indels was conducted. Moreover, phylogenetic analysis was applied to investigate the genetic relationship among these strains. Results: The genome size of the isolates was ~2.1 Mbp, covering >90% of the total estimated size of the reference genome. The overall G+C% content was ~39.5%, and there were 2,200–2,400 open reading frames. All isolates with different drug resistance profiles harbored many indels (range 131–171 and SNPs (range 16,103–28,128. Genetic diversity analysis showed that the variation of different genes were associated with specific antibiotic resistance. Known antibiotic resistance genes (pbps, murMN, ciaH, rplD, sulA, and dpr were identified, and new genes (regR, argH, trkH, and PTS-EII closely related with antibiotic resistance were found, although these genes were primarily annotated

  5. Bright fluorescent Streptococcus pneumoniae for live cell imaging of host-pathogen interactions

    NARCIS (Netherlands)

    Kjos, M.; Aprianto, R.; Fernandes, V.E.; Andrew, P.W.; Strijp, van J.A.G.; Nijland, R.; Veening, J.W.


    Streptococcus pneumoniae is a common nasopharyngeal resident in healthy people, but at the same time one of the major causes of infectious diseases such as pneumonia, meningitis and sepsis. The shift from commensal to pathogen and its interaction with host cells is poorly understood. One of the

  6. Bright Fluorescent Streptococcus pneumoniae for Live-Cell Imaging of Host-Pathogen Interactions

    NARCIS (Netherlands)

    Kjos, Morten; Aprianto, Rieza; Fernandes, Vitor E.; Andrew, Peter W.; van Strijp, Jos A. G.; Nijland, Reindert; Veening, Jan-Willem

    Streptococcus pneumoniae is a common nasopharyngeal resident in healthy people but, at the same time, one of the major causes of infectious diseases such as pneumonia, meningitis, and sepsis. The shift from commensal to pathogen and its interaction with host cells are poorly understood. One of the

  7. Regulation of gene expression in Streptococcus pneumoniae by response regulator 09 is strain dependent

    NARCIS (Netherlands)

    W.T. Hendriksen (Wouter); N. Silva (Nuno); H.J. Bootsma (Hester); C.E. Blue (Clare); G.K. Paterson (Gavin); A.R. Kerr (Alison); A.S. de Jong (Arjan); O.P. Kuipers (Oscar); P.W.M. Hermans (Peter); T.J. Mitchell


    textabstractRecent murine studies have demonstrated that the role of response regulator 09 (RR09) of Streptococcus pneumoniae in virulence is different in different strains. In the present study, we used a murine pneumonia model of infection to assess the virulence of a TIGR4 rr09 mutant, and we

  8. Regulation of gene expression in Streptococcus pneumoniae by response regulator 09 is strain dependent

    NARCIS (Netherlands)

    Hendriksen, Wouter T.; Silva, Nuno; Bootsma, Hester J.; Blue, Clare E.; Paterson, Gavin K.; Kerr, Alison R.; de Jong, Anne; Kuipers, Oscar P.; Hermans, Peter W. M.; Mitchell, Tim J.

    Recent murine studies have demonstrated that the role of response regulator 09 (RR09) of Streptococcus pneumoniae in virulence is different in different strains. In the present study, we used a murine pneumonia model of infection to assess the virulence of a TIGR4 rr09 mutant, and we found that

  9. N-acetylgalatosamine-Mediated Regulation of the aga Operon by AgaR in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Afzal, Muhammad; Shafeeq, Sulman; Ahmed, Hifza; Kuipers, Oscar P


    Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa). Transcriptome comparison of S. pneumoniae D39 grown in NAGaM17 (0.5% NAGa + M17) to that grown in GM17 (0.5% Glucose + M17) revealed the elevated expression of various carbon metabolic

  10. N-acetylglucosamine-Mediated Expression of nagA and nagB in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Afzal, Muhammad; Shafeeq, Sulman; Manzoor, Irfan; Henriques-Normark, Birgitta; Kuipers, Oscar P


    In this study, we have explored the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylglucosamine (NAG). Transcriptome comparison of S. pneumoniae D39 wild-type grown in chemically defined medium (CDM) in the presence of 0.5% NAG to that grown in the presence of 0.5% glucose

  11. Characterization and transfer studies of macrolide resistance genes in Streptococcus pneumoniae from Denmark

    DEFF Research Database (Denmark)

    Nielsen, Karen L; Hammerum, Anette M; Lambertsen, Lotte M


    Over the last decade, erythromycin resistance has been increasing in frequency in Streptococcus pneumoniae in Denmark. In the present study, 49 non-related erythromycin-resistant S. pneumoniae isolates from invasive sites and 20 isolates from non-invasive sites were collected; antimicrobial...

  12. Characterization of a Multipeptide Lantibiotic Locus in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Natalie Maricic


    Full Text Available Bacterial communities are established through a combination of cooperative and antagonistic interactions between the inhabitants. Competitive interactions often involve the production of antimicrobial substances, including bacteriocins, which are small antimicrobial peptides that target other community members. Despite the nearly ubiquitous presence of bacteriocin-encoding loci, inhibitory activity has been attributed to only a small fraction of gene clusters. In this study, we characterized a novel locus (the pld locus in the pathogen Streptococcus pneumoniae that drives the production of a bacteriocin called pneumolancidin, which has broad antimicrobial activity. The locus encodes an unusual tandem array of four inhibitory peptides, three of which are absolutely required for antibacterial activity. The three peptide sequences are similar but appear to play distinct roles in regulation and inhibition. A modification enzyme typically found in loci encoding a class of highly modified bacteriocins called lantibiotics was required for inhibitory activity. The production of pneumolancidin is controlled by a two-component regulatory system that is activated by the accumulation of modified peptides. The locus is located on a mobile element that has been found in many pneumococcal lineages, although not all elements carry the pld genes. Intriguingly, a minimal region containing only the genes required for pneumolancidin immunity was found in several Streptococcus mitis strains. The pneumolancidin-producing strain can inhibit nearly all pneumococci tested to date and provided a competitive advantage in vivo. These peptides not only represent a unique strategy for bacterial competition but also are an important resource to guide the development of new antimicrobials.

  13. Capsule impairs efficient adherence of Streptococcus agalactiae to intestinal epithelium in tilapias Oreochromis sp. (United States)

    Barato, P; Martins, E R; Vasquez, G M; Ramirez, M; Melo-Cristino, J; Martínez, N; Iregui, C


    Streptococcosis caused by Streptococcus agalactiae is one of the most important diseases in the tilapia aquaculture industry. The role of the capsule of Streptococcus agalactiae in adherence to fish surfaces has not been evaluated and the mechanism of capsular regulation during adhesion has not been described. The aim of this study was to evaluate the role of the capsule of S. agalactiae during adhesion to intestinal epithelium of tilapia (Oreochromis sp.) in an ex vivo infection model. We show that the capsule impairs the adhesion of bacteria to host intestinal epithelium. Wild type (WT) strain SaTiBe08-18 (S. agalactiae recovered from tilapia) had reduced adhesion (P S. agalactiae to tilapia intestine and that the acidic milieu could regulate adherence of encapsulated strains. We found GlcNAc on the surface of adherent Δcps but not over the capsule in WT. This difference could be explained by the GlcNAc composition of Lancefield group B antigen and the peptidoglycan in GBS (Group B Streptococcus) and also may be related with better exposure of glycosylated adhesins in unencapsulated fish GBS. Understanding capsular regulation during adhesion of S. agalactiae may provide new leads to find a successful anti-adherence therapy to prevent streptococcosis in tilapia. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Streptococcus pneumoniae biofilm formation and dispersion during colonization and disease (United States)

    Chao, Yashuan; Marks, Laura R.; Pettigrew, Melinda M.; Hakansson, Anders P.


    Streptococcus pneumoniae (the pneumococcus) is a common colonizer of the human nasopharynx. Despite a low rate of invasive disease, the high prevalence of colonization results in millions of infections and over one million deaths per year, mostly in individuals under the age of 5 and the elderly. Colonizing pneumococci form well-organized biofilm communities in the nasopharyngeal environment, but the specific role of biofilms and their interaction with the host during colonization and disease is not yet clear. Pneumococci in biofilms are highly resistant to antimicrobial agents and this phenotype can be recapitulated when pneumococci are grown on respiratory epithelial cells under conditions found in the nasopharyngeal environment. Pneumococcal biofilms display lower levels of virulence in vivo and provide an optimal environment for increased genetic exchange both in vitro and in vivo, with increased natural transformation seen during co-colonization with multiple strains. Biofilms have also been detected on mucosal surfaces during pneumonia and middle ear infection, although the role of these biofilms in the disease process is debated. Recent studies have shown that changes in the nasopharyngeal environment caused by concomitant virus infection, changes in the microflora, inflammation, or other host assaults trigger active release of pneumococci from biofilms. These dispersed bacteria have distinct phenotypic properties and transcriptional profiles different from both biofilm and broth-grown, planktonic bacteria, resulting in a significantly increased virulence in vivo. In this review we discuss the properties of pneumococcal biofilms, the role of biofilm formation during pneumococcal colonization, including their propensity for increased ability to exchange genetic material, as well as mechanisms involved in transition from asymptomatic biofilm colonization to dissemination and disease of otherwise sterile sites. Greater understanding of pneumococcal biofilm

  15. Genomic analysis reveals the molecular basis for capsule loss in the group B Streptococcus population.

    Directory of Open Access Journals (Sweden)

    Roberto Rosini

    Full Text Available The human and bovine bacterial pathogen Streptococcus agalactiae (Group B Streptococcus, GBS expresses a thick polysaccharide capsule that constitutes a major virulence factor and vaccine target. GBS can be classified into ten distinct serotypes differing in the chemical composition of their capsular polysaccharide. However, non-typeable strains that do not react with anti-capsular sera are frequently isolated from colonized and infected humans and cattle. To gain a comprehensive insight into the molecular basis for the loss of capsule expression in GBS, a collection of well-characterized non-typeable strains was investigated by genome sequencing. Genome based phylogenetic analysis extended to a wide population of sequenced strains confirmed the recently observed high clonality among GBS lineages mainly containing human strains, and revealed a much higher degree of diversity in the bovine population. Remarkably, non-typeable strains were equally distributed in all lineages. A number of distinct mutations in the cps operon were identified that were apparently responsible for inactivation of capsule synthesis. The most frequent genetic alterations were point mutations leading to stop codons in the cps genes, and the main target was found to be cpsE encoding the portal glycosyl transferase of capsule biosynthesis. Complementation of strains carrying missense mutations in cpsE with a wild-type gene restored capsule expression allowing the identification of amino acid residues essential for enzyme activity.

  16. Klebsiella pneumoniae capsule expression is necessary for colonization of large intestines of streptomycin-treated mice

    DEFF Research Database (Denmark)

    Favre-Bonte, S.; Licht, Tine Rask; Forestier, C.


    The role of the Klebsiella pneumoniae capsular polysaccharide (K antigen) during colonization of the mouse large intestine was assessed with mild-type K. pneumoniae LM21 and its isogenic capsule-defective mutant. When bacterial strains were fed alone to mice, the capsulated bacteria persisted...... in the intestinal tract at levels of 10(8) CFU/g of feces while the capsule-defective strain colonized at low levels, 10(4) CFU/g of feces. In mixed-infection experiments, the mutant was rapidly outcompeted by the wild type. In situ hybridization on colonic sections revealed that bacterial cells of both strains...... were evenly distributed in the mucus layer at day 1 after infection, while at day 20 the wild type remained dispersed and the capsule-defective strain was seen in clusters in the mucus layer. These results suggest that capsular polysaccharide plays an important role in the gut colonization ability of K...

  17. Conservative sex and the benefits of transformation in Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Daniel J P Engelmoer

    Full Text Available Natural transformation has significant effects on bacterial genome evolution, but the evolutionary factors maintaining this mode of bacterial sex remain uncertain. Transformation is hypothesized to have both positive and negative evolutionary effects on bacteria. It can facilitate adaptation by combining beneficial mutations into a single individual, or reduce the mutational load by exposing deleterious alleles to natural selection. Alternatively, it may expose transformed cells to damaged or otherwise mutated environmental DNA and is energetically expensive. Here, we examine the long-term effects of transformation in the naturally competent species Streptococcus pneumoniae by evolving populations of wild-type and competence-deficient strains in chemostats for 1000 generations. Half of these populations were exposed to periodic mild stress to examine context-dependent benefits of transformation. We find that competence reduces fitness gain under benign conditions; however, these costs are reduced in the presence of periodic stress. Using whole genome re-sequencing, we show that competent populations fix fewer new mutations and that competence prevents the emergence of mutators. Our results show that during evolution in benign conditions competence helps maintain genome stability but is evolutionary costly; however, during periods of stress this same conservativism enables cells to retain fitness in the face of new mutations, showing for the first time that the benefits of transformation are context dependent.

  18. Polarity of recombination in transformation of Streptococcus pneumoniae. (United States)

    Pasta, F; Sicard, M A


    In transformation of Streptococcus pneumoniae DNA enters the cell as single-strand fragments and integrates into the chromosome by homologous recombination. Deletions and insertions of a few hundred base pairs frequently stop the recombination process of a donor strand. In this work we took advantage of such interruptions of recombination to compare the transformation efficiencies of the segments 5'- and 3'-ward from a deletion. The deletion was created in the center of a fragment of the ami locus, and sites around the deletion were labeled by a frameshift generating a restriction site. Heteroduplexes were constructed containing two restriction sites on one strand and two different ones on the complementary strand. ami+ bacteria were transformed with such heteroduplexes. ami- transformants were isolated and individually underwent amplification of the transformed ami region. We have obtained two kinds of amplification products: short when the deletion was integrated, long when recombination stops at the deletion. Each long fragment was tested by the four restriction enzymes to detect which strand and which side of the deletion had recombined. We found that 80% of the cuts were located 5' to the deletion, showing that, in vivo, the 5' side is strongly favored by recombination. Further results suggest that exchanges occurring from 5' to 3' relative to the donor strand are more efficient than in the opposite direction, thus accounting for the 5' preference.

  19. Fluorescence Imaging of Streptococcus pneumoniae with the Helix pomatia agglutinin (HPA As a Potential, Rapid Diagnostic Tool

    Directory of Open Access Journals (Sweden)

    Mirian Domenech


    Full Text Available Streptococcus pneumoniae is a common human pathogen and a major causal agent of life-threatening infections that can either be respiratory or non-respiratory. It is well known that the Helix pomatia (edible snail agglutinin (HPA lectin shows specificity for terminal αGalNAc residues present, among other locations, in the Forssman pentasaccharide (αGalNAc1→3βGalNAc1→3αGal1→4βGal1→4βGlc. Based on experiments involving choline-independent mutants and different growth conditions, we propose here that HPA recognizes the αGalNAc terminal residues of the cell wall teichoic and lipoteichoic acids of S. pneumoniae. In addition, experimental evidence showing that pneumococci can be specifically labeled with HPA when growing as planktonic cultures as well as in mixed biofilms of S. pneumoniae and Haemophilus influenzae has been obtained. It should be underlined that pneumococci were HPA-labeled despite of the presence of a capsule. Although some non-pneumococcal species also bind the agglutinin, HPA-binding combined with fluorescence microscopy constitutes a suitable tool for identifying S. pneumoniae and, if used in conjunction with Gram staining and/or other suitable technique like antigen detection, it may potentially facilitate a fast and accurate diagnosis of pneumococcal infections.

  20. Impacto de Streptococcus pneumoniae en las neumonías del niño latinoamericano Impact of Streptococcus pneumoniae in pneumonias of Latin American children

    Directory of Open Access Journals (Sweden)

    María Hortal


    Full Text Available La neumonía adquirida en la comunidad es una de las principales causas de morbilidad y mortalidad en la infancia. Estudios realizados en países en desarrollo indican que los cuadros de neumonía más graves se asocian a causas bacterianas, con predominio de Streptococcus pneumoniae, seguido por Haemophilus influenzae tipo b. El manejo de esas infecciones en los menores de 2 años se ve dificultado por la carencia de vacunas apropiadas y por la disminución de la susceptibilidad de S. pneumoniae a la penicilina y a otros antibióticos. En 1993, por iniciativa del Sistema Regional de Vacunas (SIREVA de la Organización Panamericana de la Salud y con la financiación de la Agencia Canadiense para el Desarrollo Internacional (Canadian International Development Agency: CIDA, se diseñó un estudio para identificar los tipos capsulares de S. pneumoniae que causan enfermedad invasora en los niños latinoamericanos menores de 5 años, con el propósito de determinar tanto la composición ideal de una vacuna conjugada que pudiera emplearse en la Región como la susceptibilidad a la penicilina de los aislados de S. pneumoniae. La iniciativa fue aceptada por Argentina, Brasil, Colombia, Chile, México y Uruguay. En este informe se analiza la información sobre la neumonía por S. pneumoniae generada en los países participantes. Se captaron 3 393 niños con infecciones sistémicas por S. pneumoniae, de las cuales 1 578 correspondían a neumonías. El análisis se concentró en los 1 409 casos de neumonía de Argentina, Brasil, Colombia, México y Uruguay. La distribución por edades evidenció un franco predominio de los menores de 2 años (63,8%. Se identificaron 12 tipos capsulares prevalentes, de los cuales los serotipos 14, 5 y 1 ocuparon los tres primeros lugares en la mayoría de los países. En el período 1993-1998, la resistencia a la penicilina aumentó en los cinco países; al comienzo del estudio, los mayores porcentajes correspondieron a M

  1. Determination of Serotypes and Antibiotic Resistance in Streptococcus Pneumoniae

    Directory of Open Access Journals (Sweden)

    Deniz Akgun Karapinar


    Full Text Available Aim: In this study, the distribution of serogroup/serotype and antibiotic susceptibility testing of Streptococcus pneumoniae strains, recovered from pediatric and adult patients were evaluated. Material and Method: A total of 80 clinical isolates recovered from 19 pediatric and 61 adult patients were performed by latex aglutination method and antibiotic susceptibility tests in Istanbul University, Istanbul Faculty of Medicine, Medical Microbiology Laboratories. Results: Sixty-two strains (76 %, were serogroup/serotyped and 18 (23 % strains couldn%u2019t serogroup/serotyped. The most frequent identified serogroups were 19, 14, 23, 6, 4 in pediatrics, and 3, 19, 23 and 9 in adults. In adults, serogroups 3, 9, 5, 8, 18, 1, 15 were determined, but these serogroups weren%u2019t found in pediatrics. Vaccine serotypes rates were found as 53 % in pediatric and as 85 % in adults. The serogroups 2, 7, 10, 11, 12, 17, 20, 22, 33 were not detected, which are available in vaccine serotypes. Only 1 (1 % strain was found to exhibit low level resistance to penicillin and high level resistance wasn%u2019t found in any strain. Resistant results for trimethoprim-sulfamethoxazole, erythromycin, chloramphenicol and ofloxacin were found as 45 (56 %, 22 (27.5 %, 7 (9 %, 2 (2.5 %, respectively. All strains were found susceptible to vancomycin, linezolid and levofloxacin. The most resistant serogroups were 19, 23, 9 and 14 in the tested antibiotics. Multidrug resistance was found in 9 (11 % strains and these strains were found as serogroups 19, 23, 9, 6 and 14. Discussion: The epidemiological studies are important that the distribution of serotype and antibiotic resistance vary depending on many factors like age, and geographic region.

  2. JST Thesaurus Headwords and Synonyms: Streptococcus pneumoniae [MeCab user dictionary for science technology term[Archive

    Lifescience Database Archive (English)

    Full Text Available MeCab user dictionary for science technology term Streptococcus pneumoniae 名詞 一般 * ...* * * 肺炎球菌 ハイエンキュウキン ハイエンキューキン Thesaurus2015 200906003627228649 C LS07 UNKNOWN_2 Streptococcus pneumoniae

  3. Septic arthritis of shoeulder caused by Streptococcus pneumoniae serotype 23F in a female infant. Report of a case

    Directory of Open Access Journals (Sweden)

    Flores Nava Gerardo


    Full Text Available We present the case of a female infant previously vaccinated against Streptococcus pneumoniae who developed a septic arthritis in the right shoulder. An artrothomy was performed. The culture of the sy- novial fluid was positive for serotype 23F Streptococcus pneumonia.

  4. Lung abscess due to Streptococcus pneumoniae simulating pulmonary tuberculosis: presentation of two cases

    Directory of Open Access Journals (Sweden)

    Alessandro Perazzo


    Full Text Available In the past, anaerobes were the most common cause of community-acquired lung abscess; Streptococcus species were the second most common cause. In recent years, this has changed. Klebsiella pneumoniae is now most common cause of community- acquired lung abscess, although Streptococcus species remain pathogen of major importance. We present two cases of pulmonary cavitation due to Streptococcus pneumoniae which resembled pulmonary tuberculosis with regards to their history and radiological findings. These are examples of a common diagnosis presenting in an uncommon way. Our cases had some peculiarities: they had a clinical picture strongly suggestive of pulmonary tuberculosis or lung cancer rather than necrotizing infectious pneumonia in patients with no comorbidities or underlying diseases (including oral or dental pathologies. Radiological findings did not help the clinicians: pulmonary tuberculosis was the first diagnostic hypothesis in both cases. An underlying lung cancer was excluded in the first case only after invasive pulmonary procedures.

  5. The comparative development of elevated resistance to macrolides in community-acquired pneumonia caused by Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Yayan J


    Full Text Available Josef Yayan Department of Internal Medicine, Division of Pulmonary, Allergy and Sleep Medicine, Saarland University Medical Center, Homburg/Saar, Germany Background: Community-acquired pneumonia (CAP is an acute inflammation of the lungs, which is often caused by Streptococcus pneumoniae. CAP is the leading cause of death by infectious disease in industrialized countries. Therefore, an immediate and effective antibiotic therapy is of great importance for the nonfatal outcome of the disease. The literature contains increasing data about the development of resistance to antibiotics that are used for the treatment of CAP caused by S. pneumoniae; this article also examines the possible development of resistance to antibiotics in S. pneumoniae in recent years.Methods: Within the study period of 2004–2014, all hospital charts from patients with CAP caused by S. pneumoniae were collected from the Department of Internal Medicine, Saarland University Medical Center, Homburg/Saar, Germany. The tracheal secretions of S. pneumoniae in CAP patients were obtained by bronchoalveolar lavage; bronchial aspirates were obtained through flexible bronchoscopy and directly from sputum, and blood cultures were examined microbiologically for microorganisms.Results: From a total of 100 patients with CAP caused by S. pneumoniae, 23 (53.49% [34.78% female], 95% confidence interval, 38.58–68.4 patients with a mean age of 59.78±15.77 years met the inclusion criteria of this investigation. These patients were compared to a total of 20 (46.51% [35% female], 95% confidence interval, 31.6–61.42 patients with a mean age of 58.9±13.36 years with CAP who were infested with S. pneumoniae. In the latter group, the streptococcal antigen was detected in pulmonary aspirations by bronchoscopy or in urine using polymerase chain reaction and a rapid pneumococcal test. Penicillin G and vancomycin had a high rate of sensitivity on the antibiogram for S. pneumoniae, which was

  6. Streptococcus pneumoniae PspC Subgroup Prevalence in Invasive Disease and Differences in Contribution to Complement Evasion. (United States)

    van der Maten, Erika; van den Broek, Bryan; de Jonge, Marien I; Rensen, Kim J W; Eleveld, Marc J; Zomer, Aldert L; Cremers, Amelieke J H; Ferwerda, Gerben; de Groot, Ronald; Langereis, Jeroen D; van der Flier, Michiel


    The pneumococcal capsular serotype is an important determinant of complement resistance and invasive disease potential, but other virulence factors have also been found to contribute. Pneumococcal surface protein C (PspC), a highly variable virulence protein that binds complement factor H to evade C3 opsonization, is divided into two subgroups: choline-bound subgroup I and LPxTG-anchored subgroup II. The prevalence of different PspC subgroups in invasive pneumococcal disease (IPD) and functional differences in complement evasion are unknown. The prevalence of PspC subgroups in IPD isolates was determined in a collection of 349 sequenced strains of Streptococcus pneumoniae isolated from adult patients. pspC deletion mutants and isogenic pspC switch mutants were constructed to study differences in factor H binding and complement evasion in relation to capsule thickness. Subgroup I pspC was far more prevalent in IPD isolates than subgroup II pspC The presence of capsule was associated with a greater ability of bound factor H to reduce complement opsonization. Pneumococcal subgroup I PspC bound significantly more factor H and showed more effective complement evasion than subgroup II PspC in isogenic encapsulated pneumococci. We conclude that variation in the PspC subgroups, independent of capsule serotypes, affects pneumococcal factor H binding and its ability to evade complement deposition. Copyright © 2018 American Society for Microbiology.

  7. The Importance of TLR2 and Macrophages in Modulating a Humoral Response after Encountering Streptococcus pneumoniae (United States)


    Chapter 3 Submited as: Sam Vasilevsky, Jesus Colino, Roman Puliaev, David H. Canaday, and Clifford M...general microbiology 138:249- 259. 7. Musher , D. M. 1992. Infections caused by Streptococcus pneumoniae: clinical spectrum, pathogenesis, immunity, and...Pneumonia and Its Implications for Antimicrobial Resistance Chest 115:1-2. 230. Musher , D. M., I. Alexandraki, E. A. Graviss, N. Yanbeiy, A. Eid, L

  8. The Streptococcus pneumoniae Competence Regulatory System Influences Respiratory Tract Colonization ▿


    Kowalko, J. E.; Sebert, M. E.


    The Streptococcus pneumoniae ComDE two-component signaling system controls the development of genetic competence in the bacterium and affects virulence in models of pneumonia and bacteremia. We have investigated the impact of the competence pathway during colonization of the nasopharynx, the principal ecological niche of the pneumococcus. Previous work showed that deletion of the pneumococcal CiaRH signaling system inhibited colonization and increased expression of genes required for competen...

  9. Radiolabeling of gemifloxacin with technetium-99m and biological evaluation in artificially Streptococcus pneumoniae infected rats

    International Nuclear Information System (INIS)

    Syed Qaiser Shah; Muhammad Rafiullah Khan


    In the current investigation complexation of the gemifloxacin (GIN) with technetium-99 m ( 99m Tc) and its biological evaluation in artificially Streptococcus pneumoniae (S. pneumoniae) infected rats was assessed as potential S. pneumoniae infection radiotracer. Radiochemically the 99m Tc-GIN complex was further analyzed in terms of stability in saline, in vitro stability in serum at 37 deg C, in vitro binding with S. pneumoniae and biodistribution in artificially S. pneumoniae (living and heat killed) infected rats. The complex was found 97.25 ± 0.25% radiochemically stable in saline at 30 min after reconstitution. The stability of the 99m Tc-GIN complex was decreased to 90.50 ± 0.20% within 240 min after reconstitution. In serum the 99m Tc-GIN complex showed stable profile with the appearance of 18.85% free tracer within 16 h of incubation. The 99m Tc-GIN complex showed saturated in vitro binding with S. pneumoniae after different intervals. Almost five fold uptake was observed in living S. pneumoniae infected muscle of the rats as compared to the inflamed and normal muscle. No significant difference in the uptake of heat killed S. pneumoniae infected, inflamed and normal muscles of the rats. The high RCP yield in saline, in vitro permanence in serum, in vitro binding with living S. pneumoniae and biodistribution in artificially S. pneumoniae infected rats we recommend the 99m Tc-GIN as potential S. pneumoniae infection radiotracer. (author)

  10. Drug-resistance in Streptococcus pneumoniae isolates among Spanish middle aged and older adults with community-acquired pneumonia

    Directory of Open Access Journals (Sweden)

    Raga-Luria Xavier


    Full Text Available Abstract Background Pneumococcal diseases remain a major cause of morbidity and mortality worldwide. Updated data on drug-resistance from different populations may be important to recognize changes in disease patterns. This study assessed current levels of penicilin resistance among Streptococcus Pneumoniae causing pneumonia in Spanish middle age and older adults. Methods Antimicrobial susceptibility was tested for 104 consecutive isolates of Streptococcus pneumoniae recovered from patients 50 years or older with radiographically confirmed pneumonia in the region of Tarragona (Spain between 2002 and 2007. According to the minimum inhibitory concentration of tested antimicrobials (penicillin, erythromycin, cefotaxime and levofloxacin strains were classified as susceptible or resistant. Antimicrobial resistance was determined for early cases (2002–2004 and contemporary cases (2005–2007. Results Twenty-seven (25.9% were penicillin-resistant strains (19 strains with intermediate resistance and 8 strains with high resistance. Penicillin-resistance was higher in 2002–2004 than in 2005–2007 (39.5% vs 18.2%, p = 0.017. Of 27 penicillin-resistant strains, 10 (37% were resistant to erythromycin, 8 (29.6% to cefotaxime, 2 (7.4% to levofloxacin, and 4 (14.8% were identified as multidrug resistant. Case-fatality rate was higher among those patients who had an infection caused by any penicillin susceptible strain (16.9% than in those with infections due to penicillin-resistant strains. Conclusion Resistance to penicillin among Streptococcus pneumoniae remains high, but such resistance does not result in increased mortality in patients with pneumococcal pneumonia.

  11. Efficacy of some synthetic antibiotics on Streptococcus pneumoniae ...

    African Journals Online (AJOL)

    Effects of some synthetic antibiotics on Streptococcus pnemoniae and Proteus mirabilis isolated from cultured Clarias gariepinus, an important food fish raised in a concrete tank was carried out to ascertain their remedies on mortalities of the Clarias gariepinus adult fish. Streptococcus pnemoniae and Proteus mirabilis were ...

  12. Infection by Streptococcus pneumoniae in children with or without radiologically confirmed pneumonia

    Directory of Open Access Journals (Sweden)

    Dafne C. Andrade


    Conclusions: Among children with clinical diagnosis of community‐acquired pneumonia submitted to chest radiograph, those with radiologically confirmed pneumonia present a higher rate of infection by S. pneumoniae when compared with those with a normal chest radiograph.

  13. Phylogenetic analysis of emergent Streptococcus pneumoniae serotype 22F causing invasive pneumococcal disease using whole genome sequencing.

    Directory of Open Access Journals (Sweden)

    Walter H B Demczuk

    Full Text Available Since implementation of the 13-valent polyvalent conjugate vaccine (PCV13 in Canada during 2010, the proportion of PCV13 serotypes causing invasive pneumococcal disease (IPD has declined from 55% (n = 1492 in 2010 to 31% (n = 764 in 2014. A concurrent increase of non-PCV13 serotypes has occurred and 22F has become the most prevalent serotype in Canada increasing from 7% (n = 183 to 11% (n = 283. Core single nucleotide variant phylogenetic analysis was performed on 137 Streptococcus pneumoniae serotype 22F isolates collected across Canada from 2005-2015. Six phylogenetic lineages (n = 117 were identified among a serotype 22F/ST433 clonal complex (CC, including a recently expanding erythromycin-resistant clone. Erythromycin-resistance was observed in 25 isolates possessing ermB, mef or a 23S rRNA A2061G point mutation; 2 penicillin-resistant isolates had recombinant pbp1a, pbp2a and/or pbp2x; 3 tetracycline-resistant isolates contained tetM; and 1 isolate was multidrug-resistant. Virulence factor analysis indicated a high level of homogeneity among the 22F/ST433 clonal complex strains. A group of 6 phylogenetic outlier strains had differing MLST, antimicrobial resistance and molecular profiles suggestive of capsule switching events. While capsule switch events among S. pneumoniae serotype 22F has been observed, increasing prevalence of S. pneumoniae serotype 22F can be attributed to an evolving homogenous clone expanding nationally through local transmission events.

  14. Epidemiology of Streptococcus pneumoniae and Staphylococcus aureus colonization in healthy Venezuelan children

    NARCIS (Netherlands)

    Quintero, B.; Araque, M.; Gaast-de Jongh, C.E. van der; Escalona, F.; Correa, M.; Morillo-Puente, S.; Vielma, S.; Hermans, P.W.M.


    Streptococcus pneumoniae and Staphylococcus aureus cause significant morbidity and mortality worldwide. We investigated both the colonization and co-colonization characteristics for these pathogens among 250 healthy children from 2 to 5 years of age in Merida, Venezuela, in 2007. The prevalence of

  15. Expression of Streptococcus pneumoniae Bacteriocins Is Induced by Antibiotics via Regulatory Interplay with the Competence System

    NARCIS (Netherlands)

    Kjos, Morten; Miller, Eric; Slager, Jelle; Lake, Frank B; Gericke, Oliver; Roberts, Ian S; Rozen, Daniel E; Veening, Jan-Willem


    Pneumococcal bacteriocins (pneumocins) are antibacterial toxins that mediate intra-species competition within the human host. However, the triggers of pneumocin expression are poorly understood. Using RNA-sequencing, we mapped the regulon of the pneumocin cluster (blp) of Streptococcus pneumoniae

  16. Identification of the smallest structure capable of evoking opsonophagocytic antibodies against Streptococcus pneumoniae type 14

    NARCIS (Netherlands)

    Safari, D.; Dekker, H.A.T.; Joosten, J.A.; Michalik, D.; de Souza, A.C.; Adamo, R.; Lahmann, M.; Oscarson, S.; Kamerling, J.P.|info:eu-repo/dai/nl/070433941; Snippe, H.


    Synthetic overlapping oligosaccharide fragments of Streptococcus pneumoniae serotype 14 capsular polysaccharide (Pn14PS), {6)-[β-D-Galp-(14)-]β-D-GlcpNAc-(13)-β-D-Galp-(14)-β-D-Glcp-(1}n, were conjugated to CRM197 protein and injected into mice to determine the smallest immunogenic structure. The

  17. Influence of impaired lipoprotein biogenesis on surface and exoproteome of Streptococcus pneumoniae

    NARCIS (Netherlands)

    Pribyl, Thomas; Moche, Martin; Dreisbach, Annette; Bijlsma, Jetta J E; Saleh, Malek; Abdullah, Mohammed R; Hecker, Michael; van Dijl, Jan Maarten; Becher, Dörte; Hammerschmidt, Sven


    Surface proteins are important for the fitness and virulence of the Gram-positive pathogen Streptococcus pneumoniae. They are crucial for interaction of the pathogen with its human host during infection. Therefore, the analysis of the pneumococcal surface proteome is an important task that requires

  18. Streptococcus pneumoniae: A Cause of Primary Lung Abscess in a Child


    MacDonald, Kelly S; de Carvalho, Volia M; Liebert, Lawrence; Embree, Joanne E


    A case of primary pneumococcal lung abscess in a five-year-old child is described. Secondary anaerobic infection as a cause of cavitation was excluded by bronchoscopic culture of the cavity. Streptococcus pneumoniae is a rare but recognized cause of lung abscess in healthy children.

  19. Comparative study of five different DNA fingerprint techniques for molecular typing of Streptococcus pneumoniae strains

    NARCIS (Netherlands)

    P.W.M. Hermans (Peter); M. Sluijter (Marcel); T. Hoogenboezem (Theo); H. Heersma; A.F. van Belkum (Alex); R. de Groot (Ronald)


    textabstractThe aim of this study was to identify the strengths and weaknesses of five DNA fingerprint methods for epidemiological typing of Streptococcus pneumoniae. We investigated the usefulness of (i) ribotyping, (ii) BOX fingerprinting with the BOX repetitive sequence of S.

  20. Bilateral Acromioclavicular Septic Arthritis as an Initial Presentation of Streptococcus pneumoniae Endocarditis

    Directory of Open Access Journals (Sweden)

    Neda Hashemi-Sadraei


    Full Text Available Infective endocarditis (IE is infrequently associated with septic arthritis. Moreover, septic arthritis of the acromioclavicular (AC joint is rarely reported in the literature. We report a case of Streptococcus pneumoniae IE in a patient who presented with bilateral AC joint septic arthritis and we review the literature on the topic.

  1. Carriage of Streptococcus pneumoniae 3 Years after Start of Vaccination Program, the Netherlands

    NARCIS (Netherlands)

    Spijkerman, J.; van Gils, E.J.M.; Veenhoven, R.H.; Hak, E.; Yzerman, E.P.F.; van den Ende, A.; Wijmenga-Monsuur, A.J.; van den Dobbelsteen, G.P.J.M.; Sanders, E.A.M.


    To evaluate the effectiveness of the 7-valent pneumococcal conjugate vaccine (PCV7) program, we conducted a cross-sectional observational study on nasopharyngeal carriage of Streptococcus pneumoniae 3 years after implementation of the program in the Netherlands. We compared pneumococcal serotypes in

  2. Transcriptional and metabolic effects of glucose on Streptococcus pneumoniae sugar metabolism

    NARCIS (Netherlands)

    Paixão, Laura; Caldas, José; Kloosterman, Tomas G; Kuipers, Oscar P; Vinga, Susana; Neves, Ana R


    Streptococcus pneumoniae is a strictly fermentative human pathogen that relies on carbohydrate metabolism to generate energy for growth. The nasopharynx colonized by the bacterium is poor in free sugars, but mucosa lining glycans can provide a source of sugar. In blood and inflamed tissues glucose

  3. Carrier state of Haemophilus influenzae type b (Hib, Streptococcus pneumoniae, Streptococcus pyogenes, Neisseria meningitidis and Corynebacterium diphtheriae among school children in Pokhara, Nepal

    Directory of Open Access Journals (Sweden)

    Dharm Raj Bhatta


    Full Text Available Objective: To determine the incidence of carrier state of Haemophilus influenzae type b, Streptococcus pneumoniae (S. pneumoniae, Streptococcus pyogenes, Neisseria meningitidis and Corynebacterium diphtheriae among school children. Methods: Specimen from posterior pharyngeal wall and tonsils were collected on calcium alginate coated swabs from 1 02 participants. Processing of specimen and antimicrobial susceptibility testing was done by standard procedures. Results: Potential pathogens isolated in our study were S. pneumoniae (14.7%, Staphylococcus aureus (12.7%, Corynebacterium diphtheriae (3.9%, Streptococcus pyogenes (3.9% and Haemophilus influenzae (1.9%. Important findings in antibiogram include high resistance of S. pneumoniae to penicillin (73% and resistance of Staphylococcus aureus to oxacillin (23%. Conclusions: Pharyngeal colonization by S. pneumoniae among school children was found high and there is need of introduction of pneumococcal vaccines among children. Despite expected universal vaccination, pharyngeal colonization by Corynebacterium diphtheriae is possible and there is possibility of transmission.

  4. Evaluation of a PCR Assay for Detection of Streptococcus pneumoniae in Respiratory and Nonrespiratory Samples from Adults with Community-Acquired Pneumonia


    Murdoch, David R.; Anderson, Trevor P.; Beynon, Kirsten A.; Chua, Alvin; Fleming, Angela M.; Laing, Richard T. R.; Town, G. Ian; Mills, Graham D.; Chambers, Stephen T.; Jennings, Lance C.


    Streptococcus pneumoniae is the most common cause of community-acquired pneumonia, but it is undoubtedly underdiagnosed. We used a nested PCR assay (targeting the pneumolysin gene) to detect S. pneumoniae DNA in multiple sample types from 474 adults with community-acquired pneumonia and 183 control patients who did not have pneumonia. Plasma or buffy coat samples were PCR positive in only 6 of the 21 patients with positive blood cultures for S. pneumoniae and in 12 other patients (4 of whom h...

  5. High Levels of Genetic Recombination during Nasopharyngeal Carriage and Biofilm Formation in Streptococcus pneumoniae (United States)

    Marks, Laura R.; Reddinger, Ryan M.; Hakansson, Anders P.


    ABSTRACT Transformation of genetic material between bacteria was first observed in the 1920s using Streptococcus pneumoniae as a model organism. Since then, the mechanism of competence induction and transformation has been well characterized, mainly using planktonic bacteria or septic infection models. However, epidemiological evidence suggests that genetic exchange occurs primarily during pneumococcal nasopharyngeal carriage, which we have recently shown is associated with biofilm growth, and is associated with cocolonization with multiple strains. However, no studies to date have comprehensively investigated genetic exchange during cocolonization in vitro and in vivo or the role of the nasopharyngeal environment in these processes. In this study, we show that genetic exchange during dual-strain carriage in vivo is extremely efficient (10−2) and approximately 10,000,000-fold higher than that measured during septic infection (10−9). This high transformation efficiency was associated with environmental conditions exclusive to the nasopharynx, including the lower temperature of the nasopharynx (32 to 34°C), limited nutrient availability, and interactions with epithelial cells, which were modeled in a novel biofilm model in vitro that showed similarly high transformation efficiencies. The nasopharyngeal environmental factors, combined, were critical for biofilm formation and induced constitutive upregulation of competence genes and downregulation of capsule that promoted transformation. In addition, we show that dual-strain carriage in vivo and biofilms formed in vitro can be transformed during colonization to increase their pneumococcal fitness and also, importantly, that bacteria with lower colonization ability can be protected by strains with higher colonization efficiency, a process unrelated to genetic exchange. PMID:23015736

  6. Uji Daya Hambat Ekstrak Buah Belimbing Manis (Averrhoa carambola terhadap Pertumbuhan Bakteri Streptococcus pneumoniae secara In Vitro

    Directory of Open Access Journals (Sweden)

    Rita Risandi


    Full Text Available AbstrakBuah belimbing manis (Averrhoa carambola merupakan salah satu tanaman Indonesia yang diyakini memiliki khasiat obat. Salah satu manfaat yang dapat diambil dari sari buah belimbing manis (Averrhoa carambola adalah dapat mengobati radang tenggorokan. Radang tenggorokan merupakan salah satu infeksi yang disebabkan oleh bakteri Streptococcus pneumoniae. Tujuan penelitian ini adalah menentukan daya hambat ekstrak buah belimbing manis (Averrhoa carambola terhadap pertumbuhan bakteri Streptococcus pneumoniae  secara in vitro. Metode studi ini ialah eksperimental dengan desain postest only control group design yang dilakukan di Laboratorium Biota Sumatera Universitas Andalas dan Laboratorium Mikrobiologi Fakultas Kedokteran Universitas Andalas dari Agustus sampai Oktober 2014. Hasil penelitian menunjukkan bahwa ekstrak buah belimbing manis (Averrhoa carambola dengan konsentrasi yaitu 5%, 10%, 15% dan 20% tidak memiliki daya hambat terhadap pertumbuhan bakteri Streptococcus pneumoniae.  Hal ini terbukti karena tidak terbentuk zona hambat pada agar darah dan tidak terdapat pengaruh lama kontak ekstrak buah belimbing manis (Averrhoa carambola  terhadap pertumbuhan bakteri Streptococcus pneumoniae secara in vitro. Ekstrak buah belimbing manis tidak memiliki efek antibakteri terhadap pertumbuhan bakteri Streptococcus pneumoniae.Kata kunci: ekstrak buah belimbing manis, Streptococcus pneumoniae, daya hambat Abstract             Star fruit (Averrhoa carambola is a Indonesian plant that is believed to have medicinal properties. One of the benefits that can be drawn from the juice of star fruit (Averrhoa carambola is the ability to treat strep throat. Strep throat is a bacterial infection caused by Streptococcus pneumoniae. The objective of this study was to determine the inhibitory extract of star fruit (Averrhoa carambola on the growth of the bacterium Streptococcus pneumoniae in vitro. This was an experimental  research  with design

  7. [Examination about utility of a Streptococcus pneumoniae capsular antigen swiftness search kit urine in a pneumonia patient]. (United States)

    Hashikita, Giichi; Yamaguti, Toshiyuki; Tachi, Yoshimi; Kishi, Etsuko; Kawamura, Toru; Takahashi, Shun; Arai, Yukie; Koyama, Sachie; Huruhata, Toshihumi; Itabashi, Akira; Oka, Yoko; Yamazaki, Tsutomu; Maesaki, Sigefumi


    We investigated the usefullness of Binax NOW urine antigen test, an immunochromatographic assay that binds any soluble Streptococcus pneumoniae antigen (C polysaccharide) for the diagnosis of penumoniae form September 2003 to March 2005. We used 372 samples form the patinets with pneumoniae diagnosed for blood or sputum cultuter or gram-stained sputum smear. Out of 24 culture positive specimens, Binax NOW urine antigen test, showed positive in 18 (75%) specimens. The sensitivity of sputum and blood culture was 71.7% and 83.3%, respectively. Binax NOW urine antigen test was seemed false positives in 55 samples, false negatives in 6 samples. The specificity of Binax NOW urine antigen test was evaluated 84.1%. Overall agreement among tests was 83.6%. When compared to culture, false negative urine antigen may be the result of colonizing S. pneumoniae in sputum or pneumonia caused by an agent other than S. pneumoniae. CRP values for cases were both urine antigen and culture were positive ranged from 40 mg/dl to 10 mg/dl while urine antigen and culture negative cases were predominantly less than 10 mg/dl. Positive blood and pleural fluid culture cases were consistently associated with strongly positive urine antigen tests. Non-agreement between urine antigen, culture, and microscopy may be the result of specimen quality, labile nature of S. pneumoniae and antimicrobial therapy.

  8. In vivo capsular switch in Streptococcus pneumoniae--analysis by whole genome sequencing.

    Directory of Open Access Journals (Sweden)

    Fen Z Hu

    Full Text Available Two multidrug resistant strains of Streptococcus pneumoniae - SV35-T23 (capsular type 23F and SV36-T3 (capsular type 3 were recovered from the nasopharynx of two adult patients during an outbreak of pneumococcal disease in a New York hospital in 1996. Both strains belonged to the pandemic lineage PMEN1 but they differed strikingly in virulence when tested in the mouse model of IP infection: as few as 1000 CFU of SV36 killed all mice within 24 hours after inoculation while SV35-T23 was avirulent.Whole genome sequencing (WGS of the two isolates was performed (i to test if these two isolates belonging to the same clonal type and recovered from an identical epidemiological scenario only differed in their capsular genes? and (ii to test if the vast difference in virulence between the strains was mostly - or exclusively - due to the type III capsule. WGS demonstrated extensive differences between the two isolates including over 2500 single nucleotide polymorphisms in core genes and also differences in 36 genetic determinants: 25 of which were unique to SV35-T23 and 11 unique to strain SV36-T3. Nineteen of these differences were capsular genes and 9 bacteriocin genes.Using genetic transformation in the laboratory, the capsular region of SV35-T23 was replaced by the type 3 capsular genes from SV36-T3 to generate the recombinant SV35-T3* which was as virulent as the parental strain SV36-T3* in the murine model and the type 3 capsule was the major virulence factor in the chinchilla model as well. On the other hand, a careful comparison of strains SV36-T3 and the laboratory constructed SV35-T3* in the chinchilla model suggested that some additional determinants present in SV36 but not in the laboratory recombinant may also contribute to the progression of middle ear disease. The nature of this determinants remains to be identified.

  9. CRH Affects the Phenotypic Expression of Sepsis-Associated Virulence Factors by Streptococcus pneumoniae Serotype 1 In vitro

    Directory of Open Access Journals (Sweden)

    Colette G. Ngo Ndjom


    Full Text Available Sepsis is a life-threatening health condition caused by infectious pathogens of the respiratory tract, and accounts for 28–50% of annual deaths in the US alone. Current treatment regimen advocates the use of corticosteroids as adjunct treatment with antibiotics, for their broad inhibitory effect on the activity and production of pro-inflammatory mediators. However, despite their use, corticosteroids have not proven to be able to reverse the death incidence among septic patients. We have previously demonstrated the potential for neuroendocrine factors to directly influence Streptococcus pneumoniae virulence, which may in turn mediate disease outcome leading to sepsis and septic shock. The current study investigated the role of Corticotropin-releasing hormone (CRH in mediating key markers of pneumococcal virulence as important phenotypic determinants of sepsis and septic shock risks. In vitro cultures of serotype 1 pneumococcal strain with CRH promoted growth rate, increased capsule thickness and penicillin resistance, as well as induced pneumolysin gene expression. These results thus provide significant insights of CRH–pathogen interactions useful in understanding the underlying mechanisms of neuroendocrine factor's role in the onset of community acquired pneumonias (CAP, sepsis and septic shock.

  10. Internamento devido a PAC por Streptococcus pneumoniae - Avaliação de factores de mortalidade Streptococcus pneumoniae - caused CAP in hospitalised patients: mortality predictors

    Directory of Open Access Journals (Sweden)

    Sandra Figueiredo


    Full Text Available A avaliação da gravidade perante qualquer caso de pneumonia adquirida na comunidade (PAC é de suma importância, pois dela decorrem decisões como a necessidade de internamento e o tratamento empírico inicial. Os autores apresentam um estudo retrospectivo, que incluiu doentes internados devido a pneumonia por Streptococcus pneumoniae durante o ano de 2006, no Hospital de São João. A confirmação etiológica de infecção foi feita por isolamentos no sangue, líquido pleural, secreções traqueobrônquicas, lavado brônquico, lavado broncoalveolar e pesquisa de antigenúria. Foram analisados os factores de risco e avaliados, com base nas normas PSI (Pneumonia Severity Index e da British Thoracic Society (BTS - CURB-65. A análise estatística foi efectuada utilizando teste T para amostras independentes e ANOVA, usando o programa de análise estatística SPSS 14.0. Foram incluídos 104 doentes com idade mediana de 63 anos, sendo 67,3% do sexo masculino. O estudo revelou existir uma associação com significado estatístico entre os resultados de PSI e CURB-65 e a evolução para a mortalidade. Apesar da melhoria dos meios diagnósticos e profilácticos, e da terapêutica antibiótica, a pneumonia pneumocócica permanece uma entidade de grande morbilidade e mortalidade. O valor preditivo das normas PSI e CURB-65 foi confirmado nesta população de doentes, documentando uma correlação entre o número de factores de risco e a evolução da doença.Probably the most important decision in the management of Community-Acquired Pneumonia (CAP is patient site of care. Patients with Streptococcus pneumoniae-caused CAP admitted to our hospital between 1st January and 31st December 2006 were retrospectively analysed. Samples of blood, sputum, bronchial and bronchoalveolar lavage and urine were collected for microbiological testing using standard culture techniques and urine antigen detection. Pneumonia Severity Index (PSI and British Thoracic Society

  11. Susceptibilidad a antimicrobianos en aislamientos de Streptococcus pneumoniae invasor en Colombia


    Aura Lucía Leal; Castañeda Elizabeth


    Se realizó un estudio para determinar los patrones de susceptibilidad a los antimicrobianos de los aislamientos de Streptococcus pneumoniae causante de enfermedad invasora diagnosticada en Colombia en niños menores de 5 años entre 1994 y 1996 y para establecer la distribución de los tipos capsulares de los aislamientos resistentes. Se analizaron 324 aislamientos recuperados durante la ejecución del Protocolo Nacional de Serotipificación de S. pneumoniae realizado en Santa Fe de Bogotá, Medell...

  12. An Increase in Streptococcus pneumoniae Serotype 12F

    Centers for Disease Control (CDC) Podcasts


    Dr. Cynthia Whitney, a CDC medical doctor and Epidemiologist, discusses serotype 12F pneumoniae.  Created: 2/8/2018 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 2/8/2018.

  13. Escherichia coli, Streptococcus pneumoniae, 4(1.2%) Haemophilus ...

    African Journals Online (AJOL)

    pneumoniae, P.aeruginosa, and. S.aureus may also cause acute conjunctivitis in neonates or children3 In sexually active teenagers and adults,. C.trachomatis and N.gonorrhoea have been implicated. In young children, H.influenzae can cause ...

  14. Antibiotic resistant profile of Streptococcus pneumoniae from the ...

    African Journals Online (AJOL)

    The isolates were subjected to antimicrobial susceptibility testing using the disc diffusion method. Results: S. pneumoniae was isolated from 37(42.04%) of the 88 samples. Isolates showed the highest resistance of 12 (32.43%) to erythromycin and lowest resistance of 4(10.81%) to ciprofloxacin. The resistance profiles for ...

  15. Genome-wide identification of Streptococcus pneumoniae genes essential for bacterial replication during experimental meningitis

    DEFF Research Database (Denmark)

    Molzen, T E; Burghout, P; Bootsma, H J


    Meningitis is the most serious of invasive infections caused by the Gram-positive bacterium Streptococcus pneumoniae. Vaccines protect only against a limited number of serotypes, and evolving bacterial resistance to antimicrobials impedes treatment. Further insight into the molecular pathogenesis...... as targets for future therapy and prevention of pneumococcal meningitis, since their mutants were attenuated in both models of infection as well as in competitive growth in human cerebrospinal fluid in vitro.......Meningitis is the most serious of invasive infections caused by the Gram-positive bacterium Streptococcus pneumoniae. Vaccines protect only against a limited number of serotypes, and evolving bacterial resistance to antimicrobials impedes treatment. Further insight into the molecular pathogenesis...... genes mutants of which had become attenuated or enriched, respectively, during infection. The results point to essential roles for capsular polysaccharides, nutrient uptake, and amino acid biosynthesis in bacterial replication during experimental meningitis. The GAF phenotype of a subset of identified...

  16. Demographic profile of healthy children with nasopharyngeal colonisation of Streptococcus pneumoniae: A research paper

    Directory of Open Access Journals (Sweden)

    Radhika Raman


    Full Text Available Background: Pneumonia is a preventable cause of mortality in children. Streptococcus pneumoniae colonising the nasopharynx of healthy children can cause invasive diseases and the serotype distribution of colonisation isolates should be an indicator of invasive disease, antibiotic resistance profiles, and potential vaccine coverage. Identifying factors influencing nasopharyngeal colonisation, the serotypes and antimicrobial resistance pattern can improve rational preventive strategies. Objectives: Identify risk factors associated with nasopharyngeal colonisation of S.pneumoniae in healthy children between 6 months to 5 years of age. Determine the serotype and antibiotic sensitivity of S. pneumoniae isolated from nasopharynx of healthy children. Methods: This prospective observational included 500 healthy children, 6months to 5 years of age. Demographic features of the study population, the serotypes and antimicrobial sensitivity pattern of S.Pneumoniae isolated from cultures of nasopharyngeal swabs were subjected to statistical analysis. Results: S. pneumoniae was isolated in 9% of 450 children. Increased nasopharyngeal carriage rate was associated with overcrowding 48.8% and poor ventilation 35.5%. 6B (n=16 was the most common serotype isolated. 69% were serogroups known to cause invasive disease All S. pneumoniae isolates were susceptible to vancomycin and linezolid. Antimicrobial susceptibility of PCV 7 serotypes were greater than non PCV 7 serotypes for almost all antimicrobials tested. Penicillin resistance was 11 % and MDR 51%

  17. Roles of the Essential Protein FtsA in Cell Growth and Division in Streptococcus pneumoniae

    Czech Academy of Sciences Publication Activity Database

    Mura, Andrea; Fadda, D.; Perez, A.J.; Danforth, M.L.; Musu, D.; Rico, A.I.; Krupka, M.; Denapaite, D.; Tsui, H-Ch.T.; Winkler, M.E.; Branny, Pavel; Vicente, M.; Margolin, W.; Massidda, O.


    Roč. 199, č. 3 (2017), č. článku UNSP e00608. ISSN 0021-9193 R&D Projects: GA ČR GAP302/12/0256; GA MŠk LH12055 Institutional support: RVO:61388971 Keywords : FtsA * Gram-positive cocci * Streptococcus pneumoniae Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 3.143, year: 2016

  18. A Multi-Scale Computational Study on the Mechanism of Streptococcus pneumoniae Nicotinamidase (SpNic)


    Ion, Bogdan; Kazim, Erum; Gauld, James


    Nicotinamidase (Nic) is a key zinc-dependent enzyme in NAD metabolism that catalyzes the hydrolysis of nicotinamide to give nicotinic acid. A multi-scale computational approach has been used to investigate the catalytic mechanism, substrate binding and roles of active site residues of Nic from Streptococcus pneumoniae (SpNic). In particular, density functional theory (DFT), molecular dynamics (MD) and ONIOM quantum mechanics/molecular mechanics (QM/MM) methods have been employed. The o...

  19. Quorum Sensing Regulation of Competence and Bacteriocins in Streptococcus pneumoniae and mutans (United States)

    Shanker, Erin; Federle, Michael J.


    The human pathogens Streptococcus pneumoniae and Streptococcus mutans have both evolved complex quorum sensing (QS) systems that regulate the production of bacteriocins and the entry into the competent state, a requirement for natural transformation. Natural transformation provides bacteria with a mechanism to repair damaged genes or as a source of new advantageous traits. In S. pneumoniae, the competence pathway is controlled by the two-component signal transduction pathway ComCDE, which directly regulates SigX, the alternative sigma factor required for the initiation into competence. Over the past two decades, effectors of cellular killing (i.e., fratricides) have been recognized as important targets of the pneumococcal competence QS pathway. Recently, direct interactions between the ComCDE and the paralogous BlpRH pathway, regulating bacteriocin production, were identified, further strengthening the interconnections between these two QS systems. Interestingly, a similar theme is being revealed in S. mutans, the primary etiological agent of dental caries. This review compares the relationship between the bacteriocin and the competence QS pathways in both S. pneumoniae and S. mutans, and hopes to provide clues to regulatory pathways across the genus Streptococcus as a potential tool to efficiently investigate putative competence pathways in nontransformable streptococci. PMID:28067778

  20. Antibiotic resistance of Streptococcus pneumoniae in children with acute otitis media treatment failure. (United States)

    Zielnik-Jurkiewicz, Beata; Bielicka, Anna


    The emergence of antibiotic-resistant bacteria is a major cause of treatment failure in children with acute otitis media (AOM). This study aimed to analyze the types of bacterial strains in fluid isolated from the middle ear of children with AOM who did not respond to oral antibiotic treatment. We also determined the antibiotic resistance of the most frequently isolated bacterial strain (Streptococcus pneumoniae) found in these children. This was a prospective study of 157 children with AOM aged from 6 months to 7 years admitted due to unsuccessful oral antibiotic treatment. All children underwent a myringotomy, and samples of the middle ear fluid were collected for bacteriological examination. Positive bacterial cultures were obtained in 104 patients (66.2%), with Streptococcus pneumoniae (39.69%), Haemophilus influenzae (16.03%) Staphylococcus aureus (16.03%), Staphylococcus haemolyticus (6.9%) and Streptococcus pyogenes (5.34%) found most frequently. The majority (65.4%) of S. pneumoniae strains were penicillin-intermediate-resistant or penicillin-resistant, and 67.2% strains of S. pneumoniae were multidrug-resistant. We identified S. pneumoniae as the most frequently isolated pathogen from the middle ear in children with AOM treatment failure and determined that the majority of strains were antibiotic-resistant. We propose that the microbiological identification of bacterial strains and their degree of antibiotic resistance should be performed prior to therapy in order to choose the most appropriate antibiotic therapy for children with AOM treatment failure. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  1. Streptococcus pneumoniae – caused CAP in hospitalised patients: mortality predictors

    Directory of Open Access Journals (Sweden)

    Sandra Figueiredo


    Full Text Available Probably the most important decision in the management of Community-Acquired Pneumonia (CAP is patient site of care. Patients with Streptococcus pneumoniae-caused CAP admitted to our hospital between 1st January and 31st December 2006 were retrospectively analysed. Samples of blood, sputum, bronchial and bronchoalveolar lavage and urine were collected for microbiological testing using standard culture techniques and urine antigen detection. Pneumonia Severity Index (PSI and British Thoracic Society (BTS CURB-65 scoring tools were evaluated. The statistical treatment was performed using the SPSS 14.0 program. We included 104 patients, 67.3% male, median age 63 years old, mortality 13.4%. There was a significant association between the PSI and CURB-65 score and mortality. Despite advances, CAP is still an important health problem with a high atten - dant morbi-mortality. This study confirms the value of PSI and CURB-65 in the prediction of severe pneumonia. Resumo: A avaliação da gravidade perante qualquer caso de pneumonia adquirida na comunidade (PAC é de suma importância, pois dela decorrem decisões como a necessidade de internamento e o tratamento empírico inicial. Os autores apresentam um estudo retrospectivo, que incluiu doentes internados devido a pneumonia por Streptococcus pneumoniae durante o ano de 2006, no Hospital de São João. A confirmação etiológica de infecção foi feita por isolamentos no sangue, líquido pleural, secreções traqueobrônquicas, lavado brônquico, lavado broncoalveolar e pesquisa de antigenúria. Foram analisados os factores de risco e avaliados, com base nas normas PSI (Pneumonia Severity Index e da British Thoracic Society (BTS - CURB-65. A análise estatística foi efectuada utilizando teste T para amostras independentes e ANOVA, usando o programa de análise estatística SPSS 14.0.Foram incluídos 104 doentes com idade mediana de 63 anos, sendo 67

  2. Utilización de la penicilina en la infección extrameníngea por Streptococcus pneumoniae


    Amauri Lázaro Noda Albelo; Lázaro Arturo Vidal Tallet; Joan Iavier Vidal Casal; Leanet Hernández Álvarez


    La resistencia del Streptococcus pneumoniae a los antibióticos betalactámicos es relativa, y puede ser superada si se incrementa la dosis de esta clase de medicamentos. La definición de susceptibilidad y resistencia del Streptococcus pneumoniae se creó originalmente para predecir respuesta al tratamiento de la infección del sistema nervioso central. La infección fuera del sistema nervioso central por la mayoría de las cepas de S. pneumoniae responde a las dosis habituales de antibióticos beta...

  3. A reação em cadeia da polimerase na detecção da resistência à penicilina em Streptococcus pneumoniae Polymerase chain reaction used to detect Streptococcus pneumoniae resistance to penicillin

    Directory of Open Access Journals (Sweden)

    Eduardo Walker Zettler


    Full Text Available INTRODUÇÃO: O Streptococcus pneumoniae é o mais freqüente agente etiológico de infecções respiratórias adquiridas na comunidade e sua resistência aos antimicrobianos tem aumentado nos últimos anos. A determinação da resistência é feita rotineiramente por método lento que depende do crescimento em cultura e determinação da concentração inibitória mínima (CIM. A reação em cadeia da polimerase (PCR detecta os genes responsáveis pela resistência do Streptococcus pneumoniae a penicilina em cerca de 8 horas. OBJETIVO: Comparar a PCR com o método da CIM no diagnóstico da resistência da Streptococcus pneumoniae a penicilina. MÉTODO: Foram estudadas 153 amostras de Streptococcus pneumoniae, isoladas de diferentes sítios anatômicos, usando-se para detecção de mutações nos genes que codificam as proteínas ligadoras de penicilina 1a, 2b e 2x, responsáveis pela resistência à penicilina. A ocorrência das mutações foi correlacionada com a CIM de penicilina, determinada pelo teste de difusão em ágar. RESULTADOS: A resistência global à penicilina do Streptococcus pneumoniae foi de 22,8% (16,3% de resistência intermediária e 6,5% de resistência alta. Em proporções estatisticamente significativas, as amostras sensíveis à penicilina não tinham mutações, as intermediárias apenas uma, geralmente na proteína ligadora de penicilina 2x, e as altamente resistentes tinham mutações nas três proteínas investigadas. CONCLUSÃO: A PCR é um método rápido para a detecção da resistência à penicilina do Streptococcus pneumoniae, que poderá vir a ser utilizado na prática clínica.BACKGROUND: Streptococcus pneumoniae is the most common etiologic agent of community-acquired respiratory infections. In recent years, S. pneumoniae resistance to antimicrobial agents has increased. Minimum inhibitory concentration (MIC is routinely used to determine resistance. Polymerase chain reaction (PCR detects the genes

  4. Prevalence and serotype distribution of nasopharyngeal carriage of Streptococcus pneumoniae in China: a meta-analysis. (United States)

    Wang, Lin; Fu, Jinjian; Liang, Zhuoxin; Chen, Jichang


    To explore the overall prevalence and serotype distribution of nasopharyngeal carriage of Streptococcus pneumoniae(S. pneumoniae) among healthy children. A search for pneumococcal nasopharyngeal carriage studies including children published up to July 31th, 2016 was conducted to describe carriage in China. The review also describes antibiotic resistance in and serotypes of S. pneumoniae and assesses the impact of vaccination on carriage in this region. Summary measures for overall prevalence, antibiotic resistance, and serotype distributions extracted from the analyzed data were determined with 95% confidence intervals (CIs) using random-effects models. Heterogeneity was assessed using I 2 test statistics. Thirty-seven studies were included in this review, and the majority of studies (64.9%) were located in the pre-introduction period of 7-valent pneumococcal conjugate vaccine (PCV7) in China. The pooled prevalence of S. pneumoniae nasopharyngeal carriage was 21.4% (95% CI: 18.3-24.4%). Carriage was highest in children attending kindergartens [24.5%, (19.7-29.3%)] and decreased with increasing age. Before the introduction of PCV7 into China, the prevalence of S. pneumoniae nasopharyngeal carriage was 25.8% (20.7-30.9%), the pooled carriage of S. pneumoniae sharply dropped into the 14.1% (11.3-16.9%) by PCV7 vaccination period (P China, the penicillin resistance rate in S. pneumoniae isolated from healthy children was 31.9% (21.2-42.6%); however, this rate sharply decreased after the introduction of PCV7 in China [21.6%, (7.4-35.9%)], and the difference between the rates during these two time periods was statistically significant (P value China. PCV7 immunization was found to be associated with reduction of nasopharyngeal colonization of S. pneumoniae. Conjugate vaccination coverage was slightly affected by the introduction of PCV7 into China because of low vaccination rate. The government should implement timely adjusted conjugate vaccination strategies based on

  5. A necrotic lung ball caused by co-infection with Candida and Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Yokoyama T


    Full Text Available Toshinobu Yokoyama, Jun Sasaki, Keita Matsumoto, Chie Koga, Yusuke Ito, Yoichiro Kaku, Morihiro Tajiri, Hiroki Natori, Masashi HirokawaDivision of Respirology, Neurology and Rheumatology, Department of Internal Medicine, Kurume University School of Medicine, Kurume, JapanIntroduction: A necrotic lung ball is a rare radiological feature that is sometimes seen in cases of pulmonary aspergillosis. This paper reports a rare occurrence of a necrotic lung ball in a young male caused by Candida and Streptococcus pneumoniae.Case report: A 28-year-old male with pulmonary candidiasis was found to have a lung ball on computed tomography (CT of the chest. The patient was treated with ß-lactams and itraconazole and then fluconazole, which improved his condition (as found on a following chest CT scan and serum ß-D-glucan level. The necrotic lung ball was suspected to have been caused by co-infection with Candida and S. pneumoniae.Conclusion: A necrotic lung ball can result from infection by Candida and/or S. pneumoniae, indicating that physicians should be aware that patients may still have a fungal infection of the lungs that could result in a lung ball, even when they do not have either Aspergillus antibodies or antigens.Keywords: lung ball, necrotic lung ball, Candida, Streptococcus pneumoniae

  6. Bactericidal effect of bovine lactoferrin and synthetic peptide lactoferrin chimera in Streptococcus pneumoniae and the decrease in luxS gene expression by lactoferrin

    NARCIS (Netherlands)

    León-Sicairos, N.; Angulo-Zamudio, U.A.; Vidal, J.E.; López-Torres, C.A.; Bolscher, J.G.M.; Nazmi, K.; Reyes-Cortes, R.; Reyes-López, M.; de la Garza, M.; Canizalez-Román, A.


    Streptococcus pneumoniae (pneumococcus) is responsible for nearly one million child deaths annually. Pneumococcus causes infections such as pneumonia, otitis media, meningitis, and sepsis. The human immune system includes antibacterial peptides and proteins such as lactoferrin (LF), but its activity

  7. Total synthesis of a Streptococcus pneumoniae serotype 12F CPS repeating unit hexasaccharide

    Directory of Open Access Journals (Sweden)

    Peter H. Seeberger


    Full Text Available The Gram-positive bacterium Streptococcus pneumoniae causes severe disease globally. Vaccines that prevent S. pneumoniae infections induce antibodies against epitopes within the bacterial capsular polysaccharide (CPS. A better immunological understanding of the epitopes that protect from bacterial infection requires defined oligosaccharides obtained by total synthesis. The key to the synthesis of the S. pneumoniae serotype 12F CPS hexasaccharide repeating unit that is not contained in currently used glycoconjugate vaccines is the assembly of the trisaccharide β-D-GalpNAc-(1→4-[α-D-Glcp-(1→3]-β-D-ManpNAcA, in which the branching points are equipped with orthogonal protecting groups. A linear approach relying on the sequential assembly of monosaccharide building blocks proved superior to a convergent [3 + 3] strategy that was not successful due to steric constraints. The synthetic hexasaccharide is the starting point for further immunological investigations.

  8. Acute suppurative parotitis caused by Streptococcus pneumoniae in an HIV-infected man. (United States)

    Guzman Vinasco, Luis; Bares, Sara; Sandkovsky, Uriel


    We report a case of a 32-year-old man who presented with progressive unilateral parotid gland enlargement and subsequently tested positive for HIV. A CT scan of the neck performed with contrast showed a phlegmon in the region of the right parotid tail measuring approximately 2.5×2.4 cm. Cultures of the aspirated fluid grew Streptococcus pneumoniae and the S. pneumoniae urinary antigen test was also positive. The patient underwent surgical debridement and received antimicrobial therapy with complete resolution of the parotitis. Parotitis caused by S. pneumoniae is rare, and HIV infection should be suspected in any case of invasive pneumococcal disease. 2015 BMJ Publishing Group Ltd.

  9. A type IV pilus mediates DNA binding during natural transformation in Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Raphaël Laurenceau

    Full Text Available Natural genetic transformation is widely distributed in bacteria and generally occurs during a genetically programmed differentiated state called competence. This process promotes genome plasticity and adaptability in Gram-negative and Gram-positive bacteria. Transformation requires the binding and internalization of exogenous DNA, the mechanisms of which are unclear. Here, we report the discovery of a transformation pilus at the surface of competent Streptococcus pneumoniae cells. This Type IV-like pilus, which is primarily composed of the ComGC pilin, is required for transformation. We provide evidence that it directly binds DNA and propose that the transformation pilus is the primary DNA receptor on the bacterial cell during transformation in S. pneumoniae. Being a central component of the transformation apparatus, the transformation pilus enables S. pneumoniae, a major Gram-positive human pathogen, to acquire resistance to antibiotics and to escape vaccines through the binding and incorporation of new genetic material.

  10. Novel role for the Streptococcus pneumoniae toxin pneumolysin in the assembly of biofilms. (United States)

    Shak, Joshua R; Ludewick, Herbert P; Howery, Kristen E; Sakai, Fuminori; Yi, Hong; Harvey, Richard M; Paton, James C; Klugman, Keith P; Vidal, Jorge E


    Streptococcus pneumoniae is an important commensal and pathogen responsible for almost a million deaths annually in children under five. The formation of biofilms by S. pneumoniae is important in nasopharyngeal colonization, pneumonia, and otitis media. Pneumolysin (Ply) is a toxin that contributes significantly to the virulence of S. pneumoniae and is an important candidate as a serotype-independent vaccine target. Having previously demonstrated that a luxS knockout mutant was unable to form early biofilms and expressed less ply mRNA than the wild type, we conducted a study to investigate the role of Ply in biofilm formation. We found that Ply was expressed in early phases of biofilm development and localized to cellular aggregates as early as 4 h postinoculation. S. pneumoniae ply knockout mutants in D39 and TIGR4 backgrounds produced significantly less biofilm biomass than wild-type strains at early time points, both on polystyrene and on human respiratory epithelial cells, cultured under static or continuous-flow conditions. Ply's role in biofilm formation appears to be independent of its hemolytic activity, as S. pneumoniae serotype 1 strains, which produce a nonhemolytic variant of Ply, were still able to form biofilms. Transmission electron microscopy of biofilms grown on A549 lung cells using immunogold demonstrated that Ply was located both on the surfaces of pneumococcal cells and in the extracellular biofilm matrix. Altogether, our studies demonstrate a novel role for pneumolysin in the assembly of S. pneumoniae biofilms that is likely important during both carriage and disease and therefore significant for pneumolysin-targeting vaccines under development. The bacterium Streptococcus pneumoniae (commonly known as the pneumococcus) is commonly carried in the human nasopharynx and can spread to other body sites to cause disease. In the nasopharynx, middle ear, and lungs, the pneumococcus forms multicellular surface-associated structures called biofilms

  11. Nonencapsulated Streptococcus pneumoniae as a cause of chronic adenoiditis

    Directory of Open Access Journals (Sweden)

    Cheshil Dixit


    We present the case of a child with chronic adenoiditis caused by a PspK+ NESp. We tested the pneumococcal isolate, designated C144.66, for antimicrobial resistance, the presence of the pspK gene and the expression of PspK. Sequence typing and genome sequencing were performed. C144.66 was found to be resistant to erythromycin and displayed intermediate resistance to penicillin and trimethoprim/sulfamethoxazole. C144.66 has the pspK gene in place of the capsule locus. Additionally, PspK expression was confirmed by flow cytometry. NESp are a growing concern as an emerging human pathogen, as current pneumococcal vaccines do not confer immunity against them. An inability to vaccinate against NESp may result in increased carriage and associated pathology.

  12. Changed Expression of Cytoskeleton Proteins During Lung Injury in a Mouse Model of Streptococcus pneumoniae Infection

    Directory of Open Access Journals (Sweden)

    Mario Ferrer-Navarro


    Full Text Available Infections by Streptococcus pneumoniae are a major cause of morbidity and mortality worldwide, often causing community-acquired pneumonia, otitis media and also bacteremia and meningitis. Studies on S. pneumoniae are mainly focused on its virulence or capacity to evade the host immune system, but little is known about the injury caused in lungs during a pneumococcal infection. Herein we investigated this issue comparing the proteome profile of lungs from S. pneumoniae-infected mice with control mice by means of difference gel electrophoresis (DIGE technology. In order to obtain reliable results three biological replicas were used, and four technical replicas were carried out in each biological replica. Proteomic comparison was performed at two time points: 24 and 48 h post infection. A total of 91 proteins were identified with different abundance. We found important changes in the protein profiles during pneumococcal infection mainly associated with regulation of vesicle-mediated transport, wound healing, and cytoskeleton organization. In conclusion, the results obtained show that the cytoskeleton of the host cell is modified in S. pneumoniae infection.

  13. Silica desiccant packets for storage and transport of Streptococcus pneumoniae and other clinically relevant species.

    Directory of Open Access Journals (Sweden)

    Casey L Pell

    Full Text Available Bacterial isolates are often transported between laboratories for research and diagnostic purposes. Silica desiccant packets (SDPs, which are inexpensive and do not require freezing, were evaluated for storage and recovery of bacterial isolates. Conditions such as inoculum size, swab type and temperature of storage were investigated using ten Streptococcus pneumoniae isolates. The optimized protocol was then tested using 49 additional S. pneumoniae isolates representing 40 serogroups. Overall, S. pneumoniae growth was considered satisfactory (>100 colony forming units for 98/109 (89.9% and 20/20 (100% swabs after 14 days at room temperature or 28 days at 4° C, respectively. Storage in SDPs did not impact on the ability of S. pneumoniae isolates to be subsequently serotyped. When the survival of nine other clinically relevant bacterial species was tested, seven were viable after 28 days at room temperature, the exceptions being Neisseria gonorrhoeae and Haemophilus influenzae. SDPs are suitable for transport and short-term storage of bacterial species including S. pneumoniae.

  14. Streptococcus pneumoniae-induced ototoxicity in organ of Corti explant cultures. (United States)

    Perny, Michael; Solyga, Magdalena; Grandgirard, Denis; Roccio, Marta; Leib, Stephen L; Senn, Pascal


    Hearing loss remains the most common long-term complication of pneumococcal meningitis (PM) reported in up to 30% of survivors. Streptococcus pneumoniae have been shown to possess different ototoxic properties. Here we present a novel ex vivo experimental setup to examine in detail the pattern of hair cell loss upon exposure to different S. pneumoniae strains, therefore recapitulating pathogen derived aspects of PM-induced hearing loss. Our results show a higher susceptibility towards S. pneumoniae-induced cochlear damage for outer hair cells (OHC) compared to inner hair cells (IHC), which is consistent with in vivo data. S. pneumoniae-induced hair cell loss was both time and dose-dependent. Moreover, we have found significant differences in the level of cell damage between tissue from the basal and the apical turns. This shows that the higher vulnerability of hair cells located at high frequency regions observed in vivo cannot be explained solely by the spatial organisation and bacterial infiltration from the basal portion of the cochlea. Using a wild type D39 strain and a mutant defective for the pneumolysin (PLY) gene, we also have shown that the toxin PLY is an important factor involved in ototoxic damages. The obtained results indicate that PLY can cause both IHC and OHC loss. Finally, we are reporting here for the first time a higher vulnerability of HC located at the basal and middle cochlear region to pneumolysin-induced damage. The detailed description of the susceptibility of hair cells to Streptococcus pneumoniae provided in this report can in the future determine the choice and the development of novel otoprotective therapies during pneumococcal meningitis. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  15. Fallos vacunales a vacunas conjugadas de Streptococcus pneumoniae y Haemophilus influenzae tipo b

    Directory of Open Access Journals (Sweden)

    Gonzalo Angulo


    Full Text Available Haemophilus influenzae type b and Streptococcus pneumoniae are the main cause agents of otitis, pneumonia, sepsis and meningitis, affecting mainly children under 5 years. Conjugate vaccines for encapsulated germs have dramatically decreased, the various diseases caused by these germs. Despite the decrease in morbidity and mortality, vaccine failures were observed. Children who experienced vaccine failures to Haemophilus influenzae type b had associated comorbidities more frequently than the general population (prematurity, HIV, Down syndrome, tumors, etc.. Nevertheless, most of these children have no medical history or immunological disorders. There is no consensus on whether all patients with vaccine failures should be assessed immunologically and how. There are recommendations to indicate a booster dose to patients with certain comorbidities and patients experiencing vaccine failure even in the absence of theses. Of the vaccine preparations available for Haemophilus influenzae type b association with acellular Bordetella pertussis proved to be less immunogenic and is currently being discouraged. Streptococcus pneumoniae serotypes 6B and 19F are less immunogenics and explain most of the vaccine failures in some series.

  16. Streptococcus pneumoniae Supragenome Hybridization Arrays for Profiling of Genetic Content and Gene Expression. (United States)

    Kadam, Anagha; Janto, Benjamin; Eutsey, Rory; Earl, Joshua P; Powell, Evan; Dahlgren, Margaret E; Hu, Fen Z; Ehrlich, Garth D; Hiller, N Luisa


    There is extensive genomic diversity among Streptococcus pneumoniae isolates. Approximately half of the comprehensive set of genes in the species (the supragenome or pangenome) is present in all the isolates (core set), and the remaining is unevenly distributed among strains (distributed set). The Streptococcus pneumoniae Supragenome Hybridization (SpSGH) array provides coverage for an extensive set of genes and polymorphisms encountered within this species, capturing this genomic diversity. Further, the capture is quantitative. In this manner, the SpSGH array allows for both genomic and transcriptomic analyses of diverse S. pneumoniae isolates on a single platform. In this unit, we present the SpSGH array, and describe in detail its design and implementation for both genomic and transcriptomic analyses. The methodology can be applied to construction and modification of SpSGH array platforms, as well to other bacterial species as long as multiple whole-genome sequences are available that collectively capture the vast majority of the species supragenome. Copyright © 2015 John Wiley & Sons, Inc.

  17. Streptococcus pneumoniae sepsis as the initial presentation of systemic lupus erythematosus

    Directory of Open Access Journals (Sweden)

    Erdem I


    Full Text Available Ilknur Erdem,1 Senay Elbasan Omar,1 Ridvan Kara Ali,1 Hayati Gunes,2 Aynur Eren Topkaya2 1Department of Infectious Diseases, 2Department of Medical Microbiology, Faculty of Medicine, Namik Kemal University, Tekirdag, Turkey Objective: Infections are among the most important causes of morbidity and mortality in patients with systemic lupus erythematosus (SLE but are rare initial presentation of the disease. Therefore, in this study, we describe a case of Streptococcus pneumoniae sepsis in a young woman with previously undiagnosed SLE. Case report: A 23-year-old female patient was admitted to our outpatient clinic complaining of high fever (40°C, chills, fatigue, generalized myalgia, and cough with brown sputum for 5 days. Blood cultures grew gram-positive coccus defined as S. pneumoniae using standard procedures. Antinuclear antibody was positive at a titer of 1/1,000, and anti-double-stranded DNA was positive at 984 IU/mL. She was diagnosed with SLE. Her respiratory symptoms and pleural effusion were considered to be due to pulmonary manifestation of SLE. Conclusion: The underlying immunosuppression caused by SLE could have predisposed the patient to invasive pneumococcal disease. It may also occur as a primary presenting feature, although a rare condition. Keywords: Streptococcus pneumoniae, sepsis, systemic lupus erythematosus

  18. C3b/iC3b deposition on Streptococcus pneumoniae is not affected by HIV infection.

    Directory of Open Access Journals (Sweden)

    Catherine Hyams


    Full Text Available Streptococcus pneumoniae is a common cause of infection in both HIV positive patients and those with complement deficiencies. We hypothesised that HIV positive individuals might exhibit reduced opsonisation of pneumococcus with complement due to reduced levels of S. pneumoniae specific IgG. We discovered no difference in C3 deposition on S. pneumoniae between HIV positive or negative individuals, and furthermore C3 deposition remained unchanged as HIV progressed towards AIDS. We found no correlation between C3 deposition on S. pneumoniae and CD4 cell count in HIV infected individuals. Hence we have demonstrated no failure of complement immunity in HIV positive patients.

  19. Recent epidemiology of Streptococcus pneumoniae in nasopharynxes of Korean children with acute otitis media. (United States)

    Han, Seung Beom; Kim, Jong-Hyun; Kang, Jin Han; Ma, Sang Hyuk; Kim, Chun Soo; Kim, Kyung-Hyo; Kim, Hwang Min; Choi, Young Youn


    This prospective study was performed to evaluate serotype distribution, multilocus sequence typing, and antibiotic susceptibility of Streptococcus pneumoniae identified in Korean children with acute otitis media (AOM) after the introduction of a 7-valent pneumococcal conjugate vaccine (PCV7). Nasopharyngeal aspirates were collected from children diagnosed with AOM in seven hospitals in Korea. The bacteria identified in these samples and the serotypes, sequence types (STs), and antibiotic susceptibilities of S. pneumoniae isolates were evaluated. A total of 390 children were enrolled, and bacteria were identified in 376 (96.4%) children. S. pneumoniae, Haemophilus influenzae and Moraxella catarrhalis were identified in 155 (39.7%), 127 (32.6%) and 86 (22.1%) children, respectively. Serotype 19A (22.4%) was the most common S. pneumoniae serotype, with serogroups 11 (14.7%) and 15 (13.5%) following. ST320 (23.5%) was the most common ST; ST166 (17.0%) and ST83 (8.5%) followed. The overall susceptibility rates of S. pneumoniae to oral penicillin V and amoxicillin/clavulanate were 2.6% and 53.2%, respectively. The susceptibility rate to cefditoren was 91.0%; however, the rates for other cephalosporins were less than 10.0%. Compared with other serogroups, S. pneumoniae serogroups 19, 11, and 15 showed significantly lower susceptibility rates to all the antibiotics tested. S. pneumoniae serotype 19A, serogroups 11 and 15 were the major nasopharyngeal-colonizing bacteria in Korean children with AOM after the introduction of PCV7. These relatively prevalent serotype/serogroups showed lower antibiotic susceptibility rates. Copyright © 2016. Published by Elsevier Ltd.

  20. Characterisation of Invasive Streptococcus pneumoniae Isolated from Cambodian Children between 2007 - 2012. (United States)

    Moore, Catrin E; Giess, Adam; Soeng, Sona; Sar, Poda; Kumar, Varun; Nhoung, Pheakdey; Bousfield, Rachel; Turner, Paul; Stoesser, Nicole; Day, Nicholas P J; Parry, Christopher M


    The 13-valent pneumococcal vaccine (PCV13) was introduced in Cambodia in January 2015. There are limited data concerning the common serotypes causing invasive pneumococcal disease (IPD). Knowledge of the circulating pneumococcal serotypes is important to monitor epidemiological changes before and after vaccine implementation. All episodes of IPD defined by the isolation of Streptococcus pneumoniae from blood, cerebrospinal fluid or other sterile site in Cambodian children admitted to the Angkor Hospital for Children in Siem Reap, Northwestern Cambodia, between 1st January 2007 and 1st July 2012 were retrospectively studied. Streptococcus pneumoniae isolates that could be retrieved underwent phenotypic typing and whole genome sequencing. There were 90 Cambodian children hospitalized with IPD with a median (IQR) age of 2.3 years (0.9-6.2). The case fatality was 15.6% (95% CI 8-23). Of 50 Streptococcus pneumoniae isolates available for further testing, 46% were penicillin non-susceptible and 8% were ceftriaxone non-susceptible, 78% were cotrimoxazole resistant, 30% were erythromycin resistant and 30% chloramphenicol resistant. There were no significant changes in resistance levels over the five-year period. The most common serotypes were 1 (11/50; 22%), 23F (8/50; 16%), 14 (6/50; 12%), 5 (5/50; 10%) and 19A (3/50; 6%). Coverage by PCV7, PCV10 and PCV13 was 44%, 76% and 92% respectively. We identified novel multilocus sequence types and resistotypes using whole genome sequencing. This study suggests IPD is an important disease in Cambodian children and can have a significant mortality. PCV13 coverage of the serotypes determined in studied strains was high and consistent with another recent study. The phenotypic resistance patterns observed were similar to other regional studies. The use of whole genome sequencing in the present study provides additional typing and resistance information together with the description of novel sequence types and resistotypes.

  1. Characterisation of Invasive Streptococcus pneumoniae Isolated from Cambodian Children between 2007 - 2012.

    Directory of Open Access Journals (Sweden)

    Catrin E Moore

    Full Text Available The 13-valent pneumococcal vaccine (PCV13 was introduced in Cambodia in January 2015. There are limited data concerning the common serotypes causing invasive pneumococcal disease (IPD. Knowledge of the circulating pneumococcal serotypes is important to monitor epidemiological changes before and after vaccine implementation.All episodes of IPD defined by the isolation of Streptococcus pneumoniae from blood, cerebrospinal fluid or other sterile site in Cambodian children admitted to the Angkor Hospital for Children in Siem Reap, Northwestern Cambodia, between 1st January 2007 and 1st July 2012 were retrospectively studied. Streptococcus pneumoniae isolates that could be retrieved underwent phenotypic typing and whole genome sequencing.There were 90 Cambodian children hospitalized with IPD with a median (IQR age of 2.3 years (0.9-6.2. The case fatality was 15.6% (95% CI 8-23. Of 50 Streptococcus pneumoniae isolates available for further testing, 46% were penicillin non-susceptible and 8% were ceftriaxone non-susceptible, 78% were cotrimoxazole resistant, 30% were erythromycin resistant and 30% chloramphenicol resistant. There were no significant changes in resistance levels over the five-year period. The most common serotypes were 1 (11/50; 22%, 23F (8/50; 16%, 14 (6/50; 12%, 5 (5/50; 10% and 19A (3/50; 6%. Coverage by PCV7, PCV10 and PCV13 was 44%, 76% and 92% respectively. We identified novel multilocus sequence types and resistotypes using whole genome sequencing.This study suggests IPD is an important disease in Cambodian children and can have a significant mortality. PCV13 coverage of the serotypes determined in studied strains was high and consistent with another recent study. The phenotypic resistance patterns observed were similar to other regional studies. The use of whole genome sequencing in the present study provides additional typing and resistance information together with the description of novel sequence types and resistotypes.

  2. Characterisation of Invasive Streptococcus pneumoniae Isolated from Cambodian Children between 2007 – 2012 (United States)

    Giess, Adam; Soeng, Sona; Sar, Poda; Kumar, Varun; Nhoung, Pheakdey; Bousfield, Rachel; Turner, Paul; Stoesser, Nicole; Day, Nicholas P. J.; Parry, Christopher M.


    Background The 13-valent pneumococcal vaccine (PCV13) was introduced in Cambodia in January 2015. There are limited data concerning the common serotypes causing invasive pneumococcal disease (IPD). Knowledge of the circulating pneumococcal serotypes is important to monitor epidemiological changes before and after vaccine implementation. Methods All episodes of IPD defined by the isolation of Streptococcus pneumoniae from blood, cerebrospinal fluid or other sterile site in Cambodian children admitted to the Angkor Hospital for Children in Siem Reap, Northwestern Cambodia, between 1st January 2007 and 1st July 2012 were retrospectively studied. Streptococcus pneumoniae isolates that could be retrieved underwent phenotypic typing and whole genome sequencing. Results There were 90 Cambodian children hospitalized with IPD with a median (IQR) age of 2.3 years (0.9–6.2). The case fatality was 15.6% (95% CI 8–23). Of 50 Streptococcus pneumoniae isolates available for further testing, 46% were penicillin non-susceptible and 8% were ceftriaxone non-susceptible, 78% were cotrimoxazole resistant, 30% were erythromycin resistant and 30% chloramphenicol resistant. There were no significant changes in resistance levels over the five-year period. The most common serotypes were 1 (11/50; 22%), 23F (8/50; 16%), 14 (6/50; 12%), 5 (5/50; 10%) and 19A (3/50; 6%). Coverage by PCV7, PCV10 and PCV13 was 44%, 76% and 92% respectively. We identified novel multilocus sequence types and resistotypes using whole genome sequencing. Conclusions This study suggests IPD is an important disease in Cambodian children and can have a significant mortality. PCV13 coverage of the serotypes determined in studied strains was high and consistent with another recent study. The phenotypic resistance patterns observed were similar to other regional studies. The use of whole genome sequencing in the present study provides additional typing and resistance information together with the description of novel

  3. Análise das cepas de Streptococcus pneumoniae causadores de pneumonia invasiva: sorotipos e sensibilidade aos antimicrobianos

    Directory of Open Access Journals (Sweden)

    Cristina R. M. Yoshioka


    Full Text Available OBJETIVOS: Identificar os sorotipos de pneumococo mais frequentemente isolados de crianças internadas com pneumonia invasiva, comparar os sorotipos com os incluídos em vacinas conjugadas e analisar sua sensibilidade aos antimicrobianos mais utilizados na faixa etária pediátrica. MÉTODOS: Estudo descritivo, retrospectivo das pneumonias pneumocócicas identificadas em crianças internadas no hospital universitário da Universidade de São Paulo, no período de janeiro de 2003 a outubro de 2008. Os critérios de inclusão foram: faixa etária de 29 dias até 15 anos incompletos com diagnóstico clínico e radiológico de pneumonia e com cultura de sangue e/ou líquido pleural com crescimento de Streptococcus pneumoniae. RESULTADOS: Foram incluídas no estudo 107 crianças. Os sorotipos mais frequentes foram: 14 (36,5%, 1 (16,7%, 5 (14,6%, 6B (6,3% e 3 (4,2%. A proporção de sorotipos contidos na vacina conjugada heptavalente seria de 53,1%, na vacina 10-valente de 86,5% e na 13-valente seria de 96,9%. De acordo com os padrões do Clinical and Laboratory Standards Institute 2008, 100 cepas (93,5% de pneumococos foram sensíveis à penicilina (concentração inibitória mínima, CIM 8 µg/mL. Verificamos alta taxa de sensibilidade para as cepas testadas para vancomicina, rifampicina, ceftriaxone, clindamicina, cloranfenicol e eritromicina. CONCLUSÕES: Nossos resultados confirmam um expressivo impacto potencial das vacinas conjugadas, principalmente pela 10-valente e 13-valente, sobre os casos de pneumonias invasivas. Os resultados de sensibilidade à penicilina evidenciam que a opção terapêutica de escolha para o tratamento das pneumonias invasivas continua sendo a penicilina.

  4. Streptococcus pneumonia YlxR at 1.35 Å shows a putative new fold


    Osipiuk, Jerzy; Górnicki, Piotr; Maj, Luke; Dementieva, Irina; Laskowski, Roman; Joachimiak, Andrzej


    The structure of the YlxR protein of unknown function from Streptococcus pneumonia was determined to 1.35 Å. YlxR is expressed from the nusA/infB operon in bacteria and belongs to a small protein family (COG2740) that shares a conserved sequence motif GRGA(Y/W). The family shows no significant amino-acid sequence similarity with other proteins. Three-wavelength diffraction MAD data were collected to 1.7 Å from orthorhombic crystals using synchrotron radiation and the structure was determined ...

  5. The Host Immune Response to Streptococcus pneumoniae: Bridging Innate and Adaptive Immunity (United States)


    P.J. (1989) Effect of Streptococcus pneumoniae on human respiratory epithelium in vitro. Infect. Immun. 57: 2006-2013. Stoop, J.N., van der Molen ...antibiotics. Clin. Microbiol. Rev. 3: 171-196. Knapp, S., Wieland, C.W., van ’t Veer, C., Takeuchi, O., Akira, S., Florquin, S., and van der Poll...R.G., Baan, C.C., van der Laan, L.J., Kuipers, E.J., Kusters, J.G., and Janssen, H.L. (2005) Regulatory T cells contribute to the impaired immune

  6. Structure of the Streptococcus pneumoniae Surface Protein and Adhesin PfbA


    Suits, Michael D.; Boraston, Alisdair B.


    PfbA (plasmin- and fibronectin-binding protein A) is an extracellular Streptococcus pneumoniae cell-wall attached surface protein that binds to fibronectin, plasmin, and plasminogen. Here we present a structural analysis of the surface exposed domains of PfbA using a combined approach of X-ray crystallography and small-angle X-ray scattering (SAXS). The crystal structure of the PfbA core domain, here called PfbAβ, determined to 2.28 Å resolution revealed an elongated 12-stranded parallel β-he...

  7. Identification of a patient with Streptococcus pneumoniae bacteremia and meningitis by the polymerase chain reaction (PCR). (United States)

    Isaacman, D J; Zhang, Y; Rydquist-White, J; Wadowsky, R M; Post, J C; Ehrlich, G D


    A polymerase chain reaction (PCR) assay based on the penicillin-binding protein gene PBP2B identified the presence of DNA specific for Streptococcus pneumoniae in the serum and CSF of a patient with culture-proven bacteremia and meningitis. Positive signals were seen to dilutions of 1:125 and 1:390,625 for the blood and CSF specimens, respectively. Potential advantages of PCR over conventional culture include exquisite sensitivity, faster results and the ability to identify the organisms by the presence of species-specific DNA even in patients pretreated with antibiotics.

  8. Evaluation of a PCR Assay for Detection of Streptococcus pneumoniae in Respiratory and Nonrespiratory Samples from Adults with Community-Acquired Pneumonia (United States)

    Murdoch, David R.; Anderson, Trevor P.; Beynon, Kirsten A.; Chua, Alvin; Fleming, Angela M.; Laing, Richard T. R.; Town, G. Ian; Mills, Graham D.; Chambers, Stephen T.; Jennings, Lance C.


    Streptococcus pneumoniae is the most common cause of community-acquired pneumonia, but it is undoubtedly underdiagnosed. We used a nested PCR assay (targeting the pneumolysin gene) to detect S. pneumoniae DNA in multiple sample types from 474 adults with community-acquired pneumonia and 183 control patients who did not have pneumonia. Plasma or buffy coat samples were PCR positive in only 6 of the 21 patients with positive blood cultures for S. pneumoniae and in 12 other patients (4 of whom had no other laboratory evidence of S. pneumoniae infection). Buffy coat samples from two control patients (neither having evidence of S. pneumoniae infection), but no control plasma samples, were PCR positive. Although pneumococcal antigen was detected in the urine from 120 of 420 (29%) patients, only 4 of 227 (2%) urine samples tested were PCR positive. Overall, 256 of 318 (81%) patients had PCR-positive sputum samples, including 58 of 59 samples from which S. pneumoniae was cultured. Throat swab samples from 229 of 417 (55%) patients were PCR positive and, in those who produced sputum, 96% also had positive PCR results from sputum. Throat swabs from 73 of 126 (58%) control patients were also PCR positive. We conclude that the pneumolysin PCR assay adds little to existing diagnostic tests for S. pneumoniae and is unable to distinguish colonization from infection when respiratory samples are tested. PMID:12517826

  9. Characterization of Streptococcus pneumoniae isolates from Austrian companion animals and horses. (United States)

    Ginders, Maximilian; Leschnik, Michael; Künzel, Frank; Kampner, Doris; Mikula, Claudia; Steindl, Georg; Eichhorn, Inga; Feßler, Andrea T; Schwarz, Stefan; Spergser, Joachim; Loncaric, Igor


    The aim of the present study was to investigate the genetic relatedness and the antimicrobial resistance profiles of a collection of Austrian Streptococcus pneumoniae isolates from companion animals and horses. A total of 12 non-repetitive isolates presumptively identified as S. pneumoniae were obtained during routinely diagnostic activities between March 2009 and January 2017. Isolates were confirmed as S. pneumoniae by bile solubility and optochin susceptibility testing, matrix-assisted laser desorption-ionization-time of flight (MALDI-TOF) mass spectrometry and sequence analysis of a part recA and the 16S rRNA genes. Isolates were further characterized by pneumolysin polymerase chain reaction (PCR) and genotyped by multilocus sequence typing (MLST). Antimicrobial susceptibility testing was performed and resistance genes were detected by specific PCR assays. All isolates were serotyped. Four sequence types (ST) (ST36, ST3546, ST6934 and ST6937) and four serotypes (3, 19A, 19F and 23F) were detected. Two isolates from twelve displayed a multidrug-resistance pheno- and genotype. This study represents the first comprehensive investigation on characteristics of S. pneumoniae isolates recovered from Austrian companion animals and horses. The obtained results indicate that common human sero- (23F) and sequence type (ST36) implicated in causing invasive pneumococcal disease (IPD) may circulate in dogs. Isolates obtained from other examined animals seem to be host-adapted.

  10. Epidemiology of Streptococcus pneumoniae and Staphylococcus aureus colonization in healthy Venezuelan children. (United States)

    Quintero, B; Araque, M; van der Gaast-de Jongh, C; Escalona, F; Correa, M; Morillo-Puente, S; Vielma, S; Hermans, P W M


    Streptococcus pneumoniae and Staphylococcus aureus cause significant morbidity and mortality worldwide. We investigated both the colonization and co-colonization characteristics for these pathogens among 250 healthy children from 2 to 5 years of age in Merida, Venezuela, in 2007. The prevalence of S. pneumoniae colonization, S. aureus colonization, and S. pneumoniae-S. aureus co-colonization was 28%, 56%, and 16%, respectively. Pneumococcal serotypes 6B (14%), 19F (12%), 23F (12%), 15 (9%), 6A (8%), 11 (8%), 23A (6%), and 34 (6%) were the most prevalent. Non-respiratory atopy was a risk factor for S. aureus colonization (p = 0.017). Vaccine serotypes were negatively associated with preceding respiratory infection (p = 0.02) and with S. aureus colonization (p = 0.03). We observed a high prevalence of pneumococcal resistance against trimethoprim-sulfamethoxazole (40%), erythromycin (38%), and penicillin (14%). Semi-quantitative measurement of pneumococcal colonization density showed that children with young siblings and low socioeconomic status were more densely colonized (p = 0.02 and p = 0.02, respectively). In contrast, trimethoprim-sulfamethoxazole- and multidrug-resistant-pneumococci colonized children sparsely (p = 0.03 and p = 0.01, respectively). Our data form an important basis to monitor the future impact of pneumococcal vaccination on bacterial colonization, as well as to recommend a rationalized and restrictive antimicrobial use in our community.

  11. Utilización de la penicilina en la infección extrameníngea por Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Amauri Lázaro Noda Albelo


    Full Text Available La resistencia del Streptococcus pneumoniae a los antibióticos betalactámicos es relativa, y puede ser superada si se incrementa la dosis de esta clase de medicamentos. La definición de susceptibilidad y resistencia del Streptococcus pneumoniae se creó originalmente para predecir respuesta al tratamiento de la infección del sistema nervioso central. La infección fuera del sistema nervioso central por la mayoría de las cepas de S. pneumoniae responde a las dosis habituales de antibióticos betalactámicos. Se realiza una revisión de los nuevos puntos de corte del Laboratory Standars Institute para sensibilidad a penicilina del patógeno, y se analiza su implicación en la terapéutica actual de la enfermedad extrameníngea por S. pneumoniae.

  12. Molecular Detection of Streptococcus pneumoniae on Dried Blood Spots from Febrile Nigerian Children Compared to Culture.

    Directory of Open Access Journals (Sweden)

    Pui-Ying Iroh Tam

    Full Text Available Nigeria has one of the highest burdens of pneumococcal disease in the world, but accurate surveillance is lacking. Molecular detection of infectious pathogens in dried blood spots (DBS is an ideal method for surveillance of infections in resource-limited settings because of its low cost, minimal blood volumes involved, and ease of storage at ambient temperature. Our study aim was to evaluate a Streptococcus pneumoniae real-time polymerase chain reaction (rt-PCR assay on DBS from febrile Nigerian children on Whatman 903 and FTA filter papers, compared to the gold standard of culture.Between September 2011 to May 2015, blood was collected from children 5 years of age or under who presented to six hospital study sites throughout northern and central Nigeria with febrile illness, and inoculated into blood culture bottles or spotted onto Whatman 903 or FTA filter paper. Culture and rt-PCR were performed on all samples.A total of 537 DBS specimens from 535 children were included in the study, of which 15 were culture-positive for S. pneumoniae. The rt-PCR assay detected S. pneumoniae in 12 DBS specimens (2.2%. One positive rt-PCR result was identified in a culture-negative specimen from a high-risk subject, and two positive rt-PCR results were negative on repeat testing. Six culture-confirmed cases of S. pneumoniae bacteremia were missed. Compared to culture, the overall sensitivities of Whatman 903 and FTA DBS for detection of S. pneumoniae were 57.1% (95% CI 18.4-90.1% and 62.5% (95% CI 24.5-91.5%, respectively. Nonspecific amplification was noted in an additional 22 DBS (4.1%. Among these, six were positive for a non-S. pneumoniae pathogen on culture.Rt-PCR was able to detect S. pneumoniae from clinical DBS specimens, including from a culture-negative specimen. Our findings show promise of this approach as a surveillance diagnostic, but also raise important cautionary questions. Several DBS specimens were detected as S. pneumoniae by rt-PCR despite

  13. Molecular Detection of Streptococcus pneumoniae on Dried Blood Spots from Febrile Nigerian Children Compared to Culture. (United States)

    Iroh Tam, Pui-Ying; Hernandez-Alvarado, Nelmary; Schleiss, Mark R; Hassan-Hanga, Fatimah; Onuchukwu, Chuma; Umoru, Dominic; Obaro, Stephen K


    Nigeria has one of the highest burdens of pneumococcal disease in the world, but accurate surveillance is lacking. Molecular detection of infectious pathogens in dried blood spots (DBS) is an ideal method for surveillance of infections in resource-limited settings because of its low cost, minimal blood volumes involved, and ease of storage at ambient temperature. Our study aim was to evaluate a Streptococcus pneumoniae real-time polymerase chain reaction (rt-PCR) assay on DBS from febrile Nigerian children on Whatman 903 and FTA filter papers, compared to the gold standard of culture. Between September 2011 to May 2015, blood was collected from children 5 years of age or under who presented to six hospital study sites throughout northern and central Nigeria with febrile illness, and inoculated into blood culture bottles or spotted onto Whatman 903 or FTA filter paper. Culture and rt-PCR were performed on all samples. A total of 537 DBS specimens from 535 children were included in the study, of which 15 were culture-positive for S. pneumoniae. The rt-PCR assay detected S. pneumoniae in 12 DBS specimens (2.2%). One positive rt-PCR result was identified in a culture-negative specimen from a high-risk subject, and two positive rt-PCR results were negative on repeat testing. Six culture-confirmed cases of S. pneumoniae bacteremia were missed. Compared to culture, the overall sensitivities of Whatman 903 and FTA DBS for detection of S. pneumoniae were 57.1% (95% CI 18.4-90.1%) and 62.5% (95% CI 24.5-91.5%), respectively. Nonspecific amplification was noted in an additional 22 DBS (4.1%). Among these, six were positive for a non-S. pneumoniae pathogen on culture. Rt-PCR was able to detect S. pneumoniae from clinical DBS specimens, including from a culture-negative specimen. Our findings show promise of this approach as a surveillance diagnostic, but also raise important cautionary questions. Several DBS specimens were detected as S. pneumoniae by rt-PCR despite growth of

  14. Crystallization and preliminary X-ray crystallographic studies of DnaJ from Streptococcus pneumoniae

    International Nuclear Information System (INIS)

    Zhao, Shasha; Jin, Li; Niu, Siqiang; Yang, Wei; Zhang, Shaocheng; Guo, Zhen; Zhang, Hongpeng; Huang, Ailong; Yin, Yibing; Wang, Deqiang


    DnaJ from Streptococcus pneumoniae (SpDnaJ) is involved in the infectious disease process and is being developed as a potential vaccine to prevent bacterial infection. Here the expression, purification, crystallization and preliminary crystallographic analysis of SpDnaJ are reported. DnaJ, cooperating with DnaK and GrpE, promotes the folding of unfolded hydrophobic polypeptides, dissociates protein complexes and translocates protein across membranes. Additionally, DnaJ from Streptococcus pneumoniae (SpDnaJ) is involved in the infectious disease process and is being developed as a potential vaccine to prevent bacterial infection. Here the expression, purification, crystallization and preliminary crystallographic analysis of SpDnaJ are reported. The crystals belong to space groups I222 or I2 1 2 1 2 1 and the diffraction resolution is 3.0 Å with unit-cell parameters a = 47.68, b = 104.45, c = 234.57 Å. The crystal most likely contains one molecule in the asymmetric unit, with a V M value of 3.24 Å 3 Da −1 and a solvent content of 62.1%

  15. Feasibility and Safety of Local Treatment with Recombinant Human Tissue Factor Pathway Inhibitor in a Rat Model of Streptococcus pneumoniae Pneumonia.

    Directory of Open Access Journals (Sweden)

    Florry E van den Boogaard

    Full Text Available Pulmonary coagulopathy is intrinsic to pulmonary injury including pneumonia. Anticoagulant strategies could benefit patients with pneumonia, but systemic administration of anticoagulant agents may lead to suboptimal local levels and may cause systemic hemorrhage. We hypothesized nebulization to provide a safer and more effective route for local administration of anticoagulants. Therefore, we aimed to examine feasibility and safety of nebulization of recombinant human tissue factor pathway inhibitor (rh-TFPI in a well-established rat model of Streptococcus (S. pneumoniae pneumonia. Thirty minutes before and every 6 hours after intratracheal instillation of S. pneumonia causing pneumonia, rats were subjected to local treatment with rh-TFPI or placebo, and sacrificed after 42 hours. Pneumonia was associated with local as well as systemic activation of coagulation. Nebulization of rh-TFPI resulted in high levels of rh-TFPI in bronchoalveolar lavage fluid, which was accompanied by an attenuation of pulmonary coagulation. Systemic rh-TFPI levels remained undetectable, and systemic TFPI activity and systemic coagulation were not affected. Histopathology revealed no bleeding in the lungs. We conclude that nebulization of rh-TFPI seems feasible and safe; local anticoagulant treatment with rh-TFPI attenuates pulmonary coagulation, while not affecting systemic coagulation in a rat model of S. pneumoniae pneumonia.

  16. Utilización de la penicilina en la infección extrameníngea por Streptococcus pneumoniae Use of penicillin in the extrameningeal infection from Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Amauri Lázaro Noda Albelo


    Full Text Available La resistencia del Streptococcus pneumoniae a los antibióticos betalactámicos es relativa, y puede ser superada si se incrementa la dosis de esta clase de medicamentos. La definición de susceptibilidad y resistencia del Streptococcus pneumoniae se creó originalmente para predecir respuesta al tratamiento de la infección del sistema nervioso central. La infección fuera del sistema nervioso central por la mayoría de las cepas de S. pneumoniae responde a las dosis habituales de antibióticos betalactámicos. Se realiza una revisión de los nuevos puntos de corte del Laboratory Standars Institute para sensibilidad a penicilina del patógeno, y se analiza su implicación en la terapéutica actual de la enfermedad extrameníngea por S. pneumoniae.The beta-lactamase resistance of Strepcoccus pneumoniae is relative and may to be overcome if the dose of this type of drugs is increased. The definition of oversensitivity and of resistance of above mentioned bacteria was originally created to predict the infection response of central nervous system (CNS to treatment. The infection outside of the CNS by most of strains of S. pneumoniae responds to habitual dose of betalactamic antibiotics. A review of the new cut points of Laboratory Standards Institute for the sensitivity to pathogen penicillin and its implication in current therapy of extrameningeal disease by S. pneumoniae is analyzed.

  17. Genotyping and serotyping of macrolide and multidrug resistant Streptococcus pneumoniae isolated from carrier children

    Directory of Open Access Journals (Sweden)

    S F Swedan


    Full Text Available Aims: Streptococcus pneumoniae, an opportunistic pathogen commonly carried asymptomatically in the nasopharynx of children, is associated with increasing rates of treatment failures due to a worldwide increase in drug resistance. We investigated the carriage of S. pneumoniae in children 5 years or younger, the identity of prevalent serotypes, the rates of resistance to macrolides and other antimicrobial agents and the genotypes responsible for macrolide resistance. Materials and Methods: Nasopharyngeal swabs were collected from 157 children under 5 years for cultural isolation of S. pneumoniae. Antibiogram of isolates  was determined using the disk diffusion test, and the minimal inhibitory concentration to macrolides was determined using the E-test. Isolate serotypes and macrolide resistance genes, erm(B and mef(E, were identified using multiplex polymerase chain reactions. Results: S. pneumoniae was recovered from 33.8% of children; 41.9% among males and 21.9% among females (P = 0.009. The highest carriage rate occurred among age groups 7-12 months and 49-60 months. Most frequent serotypes were 19F, 6A/B, 11A, 19A, 14 and 15B/C.  Resistance to macrolides was 60.4%. Resistance to oxacillin, trimethoprim/sulfamethoxazole and clindamycin was present among 90.6%, 54.7% and 32.1% of isolates, respectively. All isolates were susceptible to chloramphenicol, levofloxacin and vancomycin. Isolates resistant to one or more macrolide drugs were more likely to be multidrug resistant. Resistance to clindamycin or oxacillin coexisted with macrolide resistance. Among the erythromycin-resistant isolates, erm(B, mef(E and erm(B and mef(E genes were present at rates of 43.8%, 37.5% and 6.3%, respectively. Erm(B and mef(E were associated with very high level and moderate-to-high level resistance to macrolides, respectively. Conclusion: A significant proportion of children harboured macrolide and multidrug-resistant S. pneumoniae.

  18. Polyamine transporter potABCD is required for virulence of encapsulated but not nonencapsulated Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Haley R Pipkins

    Full Text Available Streptococcus pneumoniae is commonly found in the human nasopharynx and is the causative agent of multiple diseases. Since invasive pneumococcal infections are associated with encapsulated pneumococci, the capsular polysaccharide is the target of licensed pneumococcal vaccines. However, there is an increasing distribution of non-vaccine serotypes, as well as nonencapsulated S. pneumoniae (NESp. Both encapsulated and nonencapsulated pneumococci possess the polyamine oligo-transport operon (potABCD. Previous research has shown inactivation of the pot operon in encapsulated pneumococci alters protein expression and leads to a significant reduction in pneumococcal murine colonization, but the role of the pot operon in NESp is unknown. Here, we demonstrate deletion of potD from the NESp NCC1 strain MNZ67 does impact expression of the key proteins pneumolysin and PspK, but it does not inhibit murine colonization. Additionally, we show the absence of potD significantly increases biofilm production, both in vitro and in vivo. In a chinchilla model of otitis media (OM, the absence of potD does not significantly affect MNZ67 virulence, but it does significantly reduce the pathogenesis of the virulent encapsulated strain TIGR4 (serotype 4. Deletion of potD also significantly reduced persistence of TIGR4 in the lungs but increased persistence of PIP01 in the lungs. We conclude the pot operon is important for the regulation of protein expression and biofilm formation in both encapsulated and NCC1 nonencapsulated Streptococcus pneumoniae. However, in contrast to encapsulated pneumococcal strains, polyamine acquisition via the pot operon is not required for MNZ67 murine colonization, persistence in the lungs, or full virulence in a model of OM. Therefore, NESp virulence regulation needs to be further established to identify potential NESp therapeutic targets.

  19. Streptococcus pneumoniae from Palestinian nasopharyngeal carriers: serotype distribution and antimicrobial resistance.

    Directory of Open Access Journals (Sweden)

    Abedelmajeed Nasereddin

    Full Text Available Infections of Streptococcus pneumoniae in children can be prevented by vaccination; left untreated, they cause high morbidity and fatalities. This study aimed at determining the nasopharyngeal carrier rates, serotype distribution and antimicrobial resistance patterns of S. pneumoniae in healthy Palestinian children under age two prior to the full introduction of the pneumococcal 7-valent conjugate vaccine (PCV7, which was originally introduced into Palestine in a pilot trial in September, 2010. In a cross sectional study, nasopharyngeal specimens were collected from 397 healthy children from different Palestinian districts between the beginning of November 2012 to the end of January 2013. Samples were inoculated into blood agar and suspected colonies were examined by amplifying the pneumococcal-specific autolysin gene using a real-time PCR. Serotypes were identified by a PCR that incorporated different sets of specific primers. Antimicrobial susceptibility was measured by disk diffusion and MIC methods. The resulting carrier rate of Streptococcus pneumoniae was 55.7% (221/397. The main serotypes were PCV7 serotypes 19F (12.2%, 23F (9.0%, 6B (8.6% and 14 (4% and PCV13 serotypes 6A (13.6% and 19A (4.1%. Notably, serotype 6A, not included in the pilot trial (PCV7 vaccine, was the most prevalent. Resistance to more than two drugs was observed for bacteria from 34.1% of the children (72/211 while 22.3% (47/211 carried bacteria were susceptible to all tested antibiotics. All the isolates were sensitive to cefotaxime and vancomycin. Any or all of these might impinge on the type and efficacy of the pneumococcal conjugate vaccines and antibiotics to be used for prevention and treatment of pneumococcal disease in the country.

  20. Capsular Polysaccharide Expression in Commensal Streptococcus Species

    DEFF Research Database (Denmark)

    Skov Sørensen, Uffe B; Yao, Kaihu; Yang, Yonghong


    Expression of a capsular polysaccharide is considered a hallmark of most invasive species of bacteria, including Streptococcus pneumoniae, in which the capsule is among the principal virulence factors and is the basis for successful vaccines. Consequently, it was previously assumed that capsule....... pneumoniae evolved by import of cps fragments from commensal Streptococcus species, resulting in a mosaic of genes of different origins. The demonstrated antigenic identity of at least eight of the numerous capsular polysaccharide structures expressed by commensal streptococci with recognized serotypes of S...... of Streptococcus pneumoniae and is the basis for successful vaccines against infections caused by this important pathogen. Contrasting with previous assumptions, this study showed that expression of capsular polysaccharides by the same genetic mechanisms is a general property of closely related species...

  1. UlaR activates expression of the ula operon in Streptococcus pneumoniae in the presence of ascorbic acid

    NARCIS (Netherlands)

    Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P

    In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased

  2. Strain-specific impact of PsaR of Streptococcus pneumoniae on global gene expression and virulence.

    NARCIS (Netherlands)

    Hendriksen, W.T.; Bootsma, H.J.; Diepen, A. van; Estevao, S.; Kuipers, O.P.; Groot, R. de; Hermans, P.W.M.


    Previous studies have indicated that PsaR of Streptococcus pneumoniae is a manganese-dependent regulator, negatively affecting the expression of at least seven genes. Here, we extended these observations by transcriptome and proteome analysis of psaR mutants in strains D39 and TIGR4. The microarray

  3. The effect of immunization with pneumococcal conjugated vaccines on Streptococcus pneumoniae resistance patterns in acute otitis media

    Directory of Open Access Journals (Sweden)

    Tal Marom


    Full Text Available Following the introduction of 7- and 13-pneumococcal conjugate vaccines (PCVs in Israel, we demonstrated that within Streptococcus pneumoniae (Sp positive middle ear cultures, obtained from young children with severe acute otitis media (AOM episodes, there were more penicillin-susceptible and less multi-drug resistant Sp isolates in PCV immunized children.

  4. LocZ is a new cell division protein involved in proper septum placement in Streptococcus pneumoniae

    Czech Academy of Sciences Publication Activity Database

    Holečková, Nela; Doubravová, Linda; Massidda, Orietta; Molle, Virginie; Buriánková, Karolína; Benada, Oldřich; Kofroňová, Olga; Ulrych, Aleš; Branny, Pavel


    Roč. 6, č. 1 (2015), s. 1-13 ISSN 2150-7511 R&D Projects: GA ČR GAP207/12/1568; GA ČR GAP302/12/0256 Institutional support: RVO:61388971 Keywords : cell division * septum placement * Streptococcus pneumoniae Subject RIV: EE - Microbiology, Virology Impact factor: 6.975, year: 2015

  5. LuxS impacts on LytA-dependent autolysis and on competence in Streptococcus pneumoniae. (United States)

    Romao, Susana; Memmi, Guido; Oggioni, Marco R; Trombe, Marie-Claude


    The ubiquitous protein LuxS with S-ribosylhomocysteinase activity is involved in S-adenosyl methionine detoxification, C-1 unit recycling and the production of autoinducers that allow the cell to sense and respond to cell density. Independent reports describe the impact of LuxS deficiency on Streptococcus pneumoniae virulence in the mouse. In vitro, LuxS deficiency confers discrete phenotypes. A combined approach using genetic dissection and mixed-culture experiments allowed the involvement of LuxS in the developmental physiology of S. pneumoniae to be investigated. Functional LuxS was found to be related on the one hand to down-regulation of competence, and on the other hand to attenuation of autolysis in cultures entering stationary phase. The competence phenotype of luxS mutant bacteria was complemented by media conditioned by competence-defective ComAB0 bacteria, but not by BSA. The autolytic phenotype was complemented by BSA, but not by conditioned supernatants. It is suggested that the impact of LuxS on competence, but not on autolysis, involves cell-cell communication. The phenotype of luxS mutant strains reveals a hierarchy in the competence regulatory networks of S. pneumoniae.

  6. IL-22 Defect During Streptococcus pneumoniae Infection Triggers Exacerbation of Chronic Obstructive Pulmonary Disease

    Directory of Open Access Journals (Sweden)

    Muriel Pichavant


    Full Text Available Progression of chronic obstructive pulmonary disease (COPD is linked to episodes of exacerbations caused by bacterial infections due to Streptococcus pneumoniae. Our objective was to identify during COPD, factors of susceptibility to bacterial infections among cytokine network and their role in COPD exacerbations. S. pneumoniae was used to sub-lethally challenge mice chronically exposed to air or cigarette smoke (CS and to stimulate peripheral blood mononuclear cells (PBMC from non-smokers, smokers and COPD patients. The immune response and the cytokine production were evaluated. Delayed clearance of the bacteria and stronger lung inflammation observed in infected CS-exposed mice were associated with an altered production of IL-17 and IL-22 by innate immune cells. This defect was related to a reduced production of IL-1β and IL-23 by antigen presenting cells. Importantly, supplementation with recombinant IL-22 restored bacterial clearance in CS-exposed mice and limited lung alteration. In contrast with non-smokers, blood NK and NKT cells from COPD patients failed to increase IL-17 and IL-22 levels in response to S. pneumoniae, in association with a defect in IL-1β and IL-23 secretion. This study identified IL-17 and IL-22 as susceptibility factors in COPD exacerbation. Therefore targeting such cytokines could represent a potent strategy to control COPD exacerbation.

  7. S-carboxymethylcysteine inhibits adherence of Streptococcus pneumoniae to human alveolar epithelial cells. (United States)

    Sumitomo, Tomoko; Nakata, Masanobu; Yamaguchi, Masaya; Terao, Yutaka; Kawabata, Shigetada


    Streptococcus pneumoniae is a major pathogen of respiratory infections that utilizes platelet-activating factor receptor (PAFR) for firm adherence to host cells. The mucolytic agent S-carboxymethylcysteine (S-CMC) has been shown to exert inhibitory effects against infection by several respiratory pathogens including S. pneumoniae in vitro and in vivo. Moreover, clinical studies have implicated the benefits of S-CMC in preventing exacerbation of chronic obstructive pulmonary disease, which is considered to be related to respiratory infections. In this study, to assess whether the potency of S-CMC is attributable to inhibition of pneumococcal adherence to host cells, an alveolar epithelial cell line stimulated with interleukin-1α was used as a model of inflamed epithelial cells. Despite upregulation of PAFR by inflammatory activation, treatment with S-CMC efficiently inhibited pneumococcal adherence to host epithelial cells. In order to gain insight into the inhibitory mechanism, the effects of S-CMC on PAFR expression were also investigated. Following treatment with S-CMC, PAFR expression was reduced at both mRNA and post-transcriptional levels. Interestingly, S-CMC was also effective in inhibiting pneumococcal adherence to cells transfected with PAFR small interfering RNAs. These results indicate S-CMC as a probable inhibitor targeting numerous epithelial receptors that interact with S. pneumoniae.

  8. Differential recognition and hydrolysis of host carbohydrate antigens by Streptococcus pneumoniae family 98 glycoside hydrolases. (United States)

    Higgins, Melanie A; Whitworth, Garrett E; El Warry, Nahida; Randriantsoa, Mialy; Samain, Eric; Burke, Robert D; Vocadlo, David J; Boraston, Alisdair B


    The presence of a fucose utilization operon in the Streptococcus pneumoniae genome and its established importance in virulence indicates a reliance of this bacterium on the harvesting of host fucose-containing glycans. The identities of these glycans, however, and how they are harvested is presently unknown. The biochemical and high resolution x-ray crystallographic analysis of two family 98 glycoside hydrolases (GH98s) from distinctive forms of the fucose utilization operon that originate from different S. pneumoniae strains reveal that one enzyme, the predominant type among pneumococcal isolates, has a unique endo-beta-galactosidase activity on the LewisY antigen. Altered active site topography in the other species of GH98 enzyme tune its endo-beta-galactosidase activity to the blood group A and B antigens. Despite their different specificities, these enzymes, and by extension all family 98 glycoside hydrolases, use an inverting catalytic mechanism. Many bacterial and viral pathogens exploit host carbohydrate antigens for adherence as a precursor to colonization or infection. However, this is the first evidence of bacterial endoglycosidase enzymes that are known to play a role in virulence and are specific for distinct host carbohydrate antigens. The strain-specific distribution of two distinct types of GH98 enzymes further suggests that S. pneumoniae strains may specialize to exploit host-specific antigens that vary from host to host, a factor that may feature in whether a strain is capable of colonizing a host or establishing an invasive infection.

  9. Septicaemia models using Streptococcus pneumoniae and Listeria monocytogenes: understanding the role of complement properdin. (United States)

    Dupont, Aline; Mohamed, Fatima; Salehen, Nur'Ain; Glenn, Sarah; Francescut, Lorenza; Adib, Rozita; Byrne, Simon; Brewin, Hannah; Elliott, Irina; Richards, Luke; Dimitrova, Petya; Schwaeble, Wilhelm; Ivanovska, Nina; Kadioglu, Aras; Machado, Lee R; Andrew, Peter W; Stover, Cordula


    Streptococcus pneumoniae and Listeria monocytogenes, pathogens which can cause severe infectious disease in human, were used to infect properdin-deficient and wildtype mice. The aim was to deduce a role for properdin, positive regulator of the alternative pathway of complement activation, by comparing and contrasting the immune response of the two genotypes in vivo. We show that properdin-deficient and wildtype mice mounted antipneumococcal serotype-specific IgM antibodies, which were protective. Properdin-deficient mice, however, had increased survival in the model of streptococcal pneumonia and sepsis. Low activity of the classical pathway of complement and modulation of FcγR2b expression appear to be pathogenically involved. In listeriosis, however, properdin-deficient mice had reduced survival and a dendritic cell population that was impaired in maturation and activity. In vitro analyses of splenocytes and bone marrow-derived myeloid cells support the view that the opposing outcomes of properdin-deficient and wildtype mice in these two infection models is likely to be due to a skewing of macrophage activity to an M2 phenotype in the properdin-deficient mice. The phenotypes observed thus appear to reflect the extent to which M2- or M1-polarised macrophages are involved in the immune responses to S. pneumoniae and L. monocytogenes. We conclude that properdin controls the strength of immune responses by affecting humoral as well as cellular phenotypes during acute bacterial infection and ensuing inflammation.

  10. Dominance of multidrug resistant CC271 clones in macrolide-resistant streptococcus pneumoniae in Arizona

    Directory of Open Access Journals (Sweden)

    Bowers Jolene R


    Full Text Available Abstract Background Rates of resistance to macrolide antibiotics in Streptococcus pneumoniae are rising around the world due to the spread of mobile genetic elements harboring mef(E and erm(B genes and post-vaccine clonal expansion of strains that carry them. Results Characterization of 592 clinical isolates collected in Arizona over a 10 year period shows 23.6% are macrolide resistant. The largest portion of the macrolide-resistant population, 52%, is dual mef(E/erm(B-positive. All dual-positive isolates are multidrug-resistant clonal lineages of Taiwan19F-14, mostly multilocus sequence type 320, carrying the recently described transposon Tn2010. The remainder of the macrolide resistant S. pneumoniae collection includes 31% mef(E-positive, and 9% erm(B-positive strains. Conclusions The dual-positive, multidrug-resistant S. pneumoniae clones have likely expanded by switching to non-vaccine serotypes after the heptavalent pneumococcal conjugate vaccine release, and their success limits therapy options. This upsurge could have a considerable clinical impact in Arizona.

  11. Antibiotic susceptibility of Streptococcus pneumoniae colonizing the nasopharynx of Colombian children with pneumonia Susceptibilidad antimicrobiana de Streptococcus pneumoniae colonizante de nasofaringe en niños colombianos con neumonía

    Directory of Open Access Journals (Sweden)

    Aura Lucía Leal


    Full Text Available Streptococcus pneumoniae is one of the principal causal agents of acute respiratory infection (ARI in children, and its resistance to antibiotics has increased worldwide. This study examined the patterns of susceptibility to antibiotics of S. pneumoniae that had colonized the upper respiratory tract of 272 children hospitalized for pneumonia in two hospitals in Santafé de Bogotá. S. pneumoniae was isolated from 114 patients (42%. Diminished susceptibility to penicillin was noted in 19 isolates (17%, with 12 (11% having an intermediate level of sensitivity and 7 (6% showing outright resistance. Only 1 of the 19 isolates resistant to penicillin also showed resistance to ceftriaxone. There was diminished sensitivity to erythromycin in 3 isolates (3%, to chloramphenicol in 6 (5%, and to co-trimoxazole (trimethoprim + sulfamethoxazole in 46 (40%. Resistance to multiple drugs was found in 7 isolates (6%. The most commonly encountered penicillin-resistant serotype was 23F (68.4%. An association was observed between age, prior use of antibiotics, and colonization by S. pneumoniae with reduced penicillin sensitivity or multiple-drug resistance. This study confirmed the presence of antibiotic-resistant S. pneumoniae in Colombia and highlights the importance of the rational use of antibiotics and of the implementation of epidemiologic surveillance for this agent.Streptococcus pneumoniae es uno de los principales agentes causales de infección respiratoria aguda (IRA en niños y su resistencia a antibióticos se ha incrementado en todo el mundo. En este estudio se determinaron los patrones de susceptibilidad a antimicrobianos de S. pneumoniae colonizante de las vías respiratorias altas en 272 niños hospitalizados por neumonía en dos hospitales de Santafé de Bogotá. Se aisló S. pneumoniae en 114 pacientes (42%. Se observó susceptibilidad disminuida a la penicilina en 19 aislamientos (17%, con sensibilidad intermedia en 12 (11% y franca resistencia

  12. Susceptibilidad antimicrobiana de Streptococcus pneumoniae colonizante de nasofaringe en niños colombianos con neumonía Antibiotic susceptibility of Streptococcus pneumoniae colonizing the nasopharynx of Colombian children with pneumonia

    Directory of Open Access Journals (Sweden)

    Aura Lucía Leal


    Full Text Available Streptococcus pneumoniae es uno de los principales agentes causales de infección respiratoria aguda (IRA en niños y su resistencia a antibióticos se ha incrementado en todo el mundo. En este estudio se determinaron los patrones de susceptibilidad a antimicrobianos de S. pneumoniae colonizante de las vías respiratorias altas en 272 niños hospitalizados por neumonía en dos hospitales de Santafé de Bogotá. Se aisló S. pneumoniae en 114 pacientes (42%. Se observó susceptibilidad disminuida a la penicilina en 19 aislamientos (17%, con sensibilidad intermedia en 12 (11% y franca resistencia en 7 (6%. Solo 1 de los 19 aislamientos resistentes a penicilina mostró también resistencia a la ceftriaxona. Se observó sensibilidad disminuida a la eritromicina en 3 aislamientos (3%, al cloranfenicol en 6 (5% y al cotrimoxazol (trimetoprima + sulfametoxazol en 46 (40%. Se encontró multirresistencia en 7 aislamientos (6%. El serotipo con sensibilidad disminuida a la penicilina que se halló con mayor frecuencia fue el 23F (68,4%. Se observó una asociación entre la edad, el uso previo de antibióticos y la colonización con S. pneumoniae con susceptibilidad disminuida a la penicilina o multirresistencia. Este estudio confirma la presencia de resistencia antimicrobiana de S. pneumoniae en Colombia y resalta la importancia del uso racional de los antibióticos y de la implementación de la vigilancia epidemiológica sobre este agente.Streptococcus pneumoniae is one of the principal causal agents of acute respiratory infection (ARI in children, and its resistance to antibiotics has increased worldwide. This study examined the patterns of susceptibility to antibiotics of S. pneumoniae that had colonized the upper respiratory tract of 272 children hospitalized for pneumonia in two hospitals in Santafé de Bogotá. S. pneumoniae was isolated from 114 patients (42%. Diminished susceptibility to penicillin was noted in 19 isolations (17%, with 12 (11

  13. The enhanced pneumococcal LAMP assay: a clinical tool for the diagnosis of meningitis due to Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Dong Wook Kim

    Full Text Available BACKGROUND: Streptococcus pneumoniae is a leading cause of invasive bacterial disease in developed and developing countries. We studied the loop-mediated isothermal amplification (LAMP technique to assess its suitability for detecting S. pneumoniae nucleic acid in cerebrospinal fluid (CSF. METHODOLOGY/PRINCIPAL FINDINGS: We established an improved LAMP assay targeting the lytA gene (Streptococcus pneumoniae [Sp] LAMP. The analytical specificity of the primers was validated by using 32 reference strains (10 Streptococcus and seven non-Streptococcus species plus 25 clinical alpha-hemolytic streptococcal strains, including four S. pneumoniae strains and 21 other strains (3 S. oralis, 17 S. mitis, and one Streptococcus species harboring virulence factor-encoding genes (lytA or ply. Within 30 minutes, the assay could detect as few as 10 copies of both purified DNA and spiked CSF specimens with greater sensitivity than conventional polymerase chain reaction (PCR. The linear determination range for this assay is 10 to 1,000,000 microorganisms per reaction mixture using real-time turbidimetry. We evaluated the clinical sensitivity and specificity of the Sp LAMP assay using 106 randomly selected CSF specimens from children with suspected meningitis in Korea, China and Vietnam. For comparison, CSF specimens were also tested against conventional PCR and culture tests. The detection rate of the LAMP method was substantially higher than the rates of PCR and culture tests. In this small sample, relative to the LAMP assay, the clinical sensitivity of PCR and culture tests was 54.5% and 33.3%, respectively, while clinical specificity of the two tests was 100%. CONCLUSIONS/SIGNIFICANCE: Compared to PCR, Sp LAMP detected S. pneumoniae with higher analytical and clinical sensitivity. This specific and sensitive LAMP method offers significant advantages for screening patients on a population basis and for diagnosis in clinical settings.

  14. Components of Streptococcus pneumoniae suppress allergic airways disease and NKT cells by inducing regulatory T cells. (United States)

    Thorburn, Alison N; Foster, Paul S; Gibson, Peter G; Hansbro, Philip M


    Asthma is an allergic airways disease (AAD) caused by dysregulated immune responses and characterized by eosinophilic inflammation, mucus hypersecretion, and airway hyperresponsiveness (AHR). NKT cells have been shown to contribute to AHR in some mouse models. Conversely, regulatory T cells (Tregs) control aberrant immune responses and maintain homeostasis. Recent evidence suggests that Streptococcus pneumoniae induces Tregs that have potential to be harnessed therapeutically for asthma. In this study, mouse models of AAD were used to identify the S. pneumoniae components that have suppressive properties, and the mechanisms underlying suppression were investigated. We tested the suppressive capacity of type-3-polysaccharide (T3P), isolated cell walls, pneumolysoid (Ply) and CpG. When coadministered, T3P + Ply suppressed the development of: eosinophilic inflammation, Th2 cytokine release, mucus hypersecretion, and AHR. Importantly, T3P + Ply also attenuated features of AAD when administered during established disease. We show that NKT cells contributed to the development of AAD and also were suppressed by T3P + Ply treatment. Furthermore, adoptive transfer of NKT cells induced AHR, which also could be reversed by T3P + Ply. T3P + Ply-induced Tregs were essential for the suppression of NKT cells and AAD, which was demonstrated by Treg depletion. Collectively, our results show that the S. pneumoniae components T3P + Ply suppress AAD through the induction of Tregs that blocked the activity of NKT cells. These data suggest that S. pneumoniae components may have potential as a therapeutic strategy for the suppression of allergic asthma through the induction of Tregs and suppression of NKT cells.

  15. Trivalent pneumococcal protein recombinant vaccine protects against lethal Streptococcus pneumoniae pneumonia and correlates with phagocytosis by neutrophils during early pathogenesis. (United States)

    Xu, Qingfu; Surendran, Naveen; Verhoeven, David; Klapa, Jessica; Ochs, Martina; Pichichero, Michael E


    Due to the fact that current polysaccharide-based pneumococcal vaccines have limited serotype coverage, protein-based vaccine candidates have been sought for over a decade to replace or complement current vaccines. We previously reported that a trivalent Pneumococcal Protein recombinant Vaccine (PPrV), showed protection against pneumonia and sepsis in an infant murine model. Here we investigated immunological correlates of protection of PPrV in the same model. C57BL/6J infant mice were intramuscularly vaccinated at age 1-3 weeks with 3 doses of PPrV, containing pneumococcal histidine triad protein D (PhtD), pneumococcal choline binding protein A (PcpA), and detoxified pneumolysin mutant PlyD1. 3-4 weeks after last vaccination, serum and lung antibody levels to PPrV components were measured, and mice were intranasally challenged with a lethal dose of Streptococcus pneumoniae (Spn) serotype 6A. Lung Spn bacterial burden, number of neutrophils and alveolar macrophages, phagocytosed Spn by granulocytes, and levels of cytokines and chemokines were determined at 6, 12, 24, and 48h after challenge. PPrV vaccination conferred 83% protection against Spn challenge. Vaccinated mice had significantly elevated serum and lung antibody levels to three PPrV components. In the first stage of pathogenesis of Spn induced pneumonia (6-24h after challenge), vaccinated mice had lower Spn bacterial lung burdens and more phagocytosed Spn in the granulocytes. PPrV vaccination led to lower levels of pro-inflammatory cytokines IL-6, IL-1β, and TFN-α, and other cytokines and chemokines (IL-12, IL-17, IFN-γ, MIP-1b, MIP-2 and KC, and G-CSF), presumably due to a lower lung bacterial burden. Trivalent PPrV vaccination results in increased serum and lung antibody levels to the vaccine components, a reduction in Spn induced lethality, enhanced early clearance of Spn in lungs due to more rapid and thorough phagocytosis of Spn by neutrophils, and correspondingly a reduction in lung inflammation

  16. Meningitis caused by streptococci other than Streptococcus pneumoniae: a retrospective clinical study

    DEFF Research Database (Denmark)

    Møller, Kirsten; Harder, Eva; Wandall, Johan


    We reviewed the medical records of 26 patients (median age 62 years, range 5-76 years) admitted to our institution during 1978-98 with acute bacterial meningitis (ABM) caused by streptococci other than Streptococcus pneumoniae (comprising 1.9% of all patients with ABM). 19 cases were community......-acquired and 7 were nosocomial. 73% had comorbid or predisposing conditions and 73% had an identifiable extracerebral focus; only in 2 patients no comorbid disease, primary focus or predisposing condition was present. Five patients had cerebral abscesses, and 5 had endocarditis. Beta-haemolytic streptococci were...... grown in 14 cases (serotype A: 4, B: 5, C: 1, G: 4) and were predominant among patients with endocarditis, whereas alpha- or non-haemolytic strains grew in 12 cases (S. mitis: 4, S. constellatus: 2, E. faecalis: 2, S. bovis: 1, unspecified: 3) and were predominant in patients with a brain abscess...

  17. Construction of improved tools for protein localization studies in Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Mafalda X Henriques

    Full Text Available We have constructed a set of plasmids that allow efficient expression of both N- and C-terminal fusions of proteins of interest to fluorescent proteins mCherry, Citrine, CFP and GFP in the Gram-positive pathogen Streptococcus pneumoniae. In order to improve expression of the fluorescent fusions to levels that allow their detection by fluorescence microscopy, we have introduced a 10 amino acid tag, named i-tag, at the N-terminal end of the fluorescent proteins. This caused increased expression due to improved translation efficiency and did not interfere with the protein localization in pneumococcal bacteria. Localizing fluorescent derivatives of FtsZ, Wzd and Wze in dividing bacteria validated the developed tools. The availability of the new plasmids described in this work should greatly facilitate studies of protein localization in an important clinical pathogen.

  18. Mechanisms and impact of genetic recombination in the evolution of Streptococcus pneumoniae. (United States)

    Chaguza, Chrispin; Cornick, Jennifer E; Everett, Dean B


    Streptococcus pneumoniae (the pneumococcus) is a highly recombinogenic bacterium responsible for a high burden of human disease globally. Genetic recombination, a process in which exogenous DNA is acquired and incorporated into its genome, is a key evolutionary mechanism employed by the pneumococcus to rapidly adapt to selective pressures. The rate at which the pneumococcus acquires genetic variation through recombination is much higher than the rate at which the organism acquires variation through spontaneous mutations. This higher rate of variation allows the pneumococcus to circumvent the host innate and adaptive immune responses, escape clinical interventions, including antibiotic therapy and vaccine introduction. The rapid influx of whole genome sequence (WGS) data and the advent of novel analysis methods and powerful computational tools for population genetics and evolution studies has transformed our understanding of how genetic recombination drives pneumococcal adaptation and evolution. Here we discuss how genetic recombination has impacted upon the evolution of the pneumococcus.

  19. Antibiotic treatment and the diagnosis of Streptococcus pneumoniae in lower respiratory tract infections in adults

    DEFF Research Database (Denmark)

    Korsgaard, Jens; Møller, Jens Kjølseth; Kilian, Mogens


    OBJECTIVE: To analyze the possible influence of antibiotic treatment on the results of different diagnostic tests for the diagnosis of lower respiratory tract infections with Streptococcus pneumoniae. MATERIAL AND METHODS: A prospective cohort of 159 unselected adult immunocompetent patients...... admitted to Silkeborg County Hospital in Denmark with community-acquired lower respiratory tract infections underwent microbiological investigations with fiber-optic bronchoscopy with bronchoalveolar lavage, blood and sputum culture and urine antigen test for type-specific polysaccharide capsular antigens...... was positive in both systems, making a total of 22 patients with documented pneumococcal infection. As a positive culture test was dependent on the absence of antibiotic treatment, whereas a positive urine antigen test depended on antibiotic treatment within 48 hours, the two tests were complementary...


    Dinić, Marina M; Mladenović Antić, Snezana; Kocić, Branislava; Stanković Dordević, Dobrila; Vrbić, Miodrag; Bogdanović, Milena


    Streptococcus pneumoniae is one of the most common causes of respiratory infections. The aim was to study the susceptibility to antimicrobial agents of respiratory isolates ofStreptococcus pneumoniae obtained from hospitalized children. A total of 190 respiratory pneumococcal isolates obtained from children aged from 0 to 14 years were isolated and identified by using standard microbiological methods. Susceptibility to oxacillin, erythromycin, clindamycin, tetracycline, cotrimoxazole, ofloxacin and rifampicin was tested by disc diffusion method. Minimal inhibitory concentrations for amoxicillin and ceftriaxone were determined by means of E test. The macrolide-resistant phenotype was detected by double disc diffusion test. All tested isolates were susceptible to amoxicillin and ceftriaxone. The minimal amoxicillin concentration inhibiting the growth of 50% of isolates and of 90% of isolates was 0.50 microg/ml and 1.0 microg/ml, respectively and the minimal ceftriaxone concentration inhibiting the growth of 50% of isolates and of 90% of isolates was 0.25 microg/ml and 0.50 microg/ml, respectively. Susceptibility to erythromycin and clindamycin was observed in 21.6% and 29.47% of isolates, respectively. The resistence to macrolides-M phenotype was detected in 10.07% of isolates and constitutive macrolide-lincosamide-streptogramin phenotype (constitutive MLS phenotype) was found in 89.93% of isolates. All tested isolates were susceptible to ofloxacin and rifampicin. Amoxicillin could be the therapy of choice in pediatric practice. The macrolides should not be recommended for the empirical therapy of pneumococcal respiratory tract infection in our local area.

  1. The Small Molecule DAM Inhibitor, Pyrimidinedione, Disrupts Streptococcus pneumoniae Biofilm Growth In Vitro.

    Directory of Open Access Journals (Sweden)

    Mukesh Kumar Yadav

    Full Text Available Streptococcus pneumoniae persist in the human nasopharynx within organized biofilms. However, expansion to other tissues may cause severe infections such as pneumonia, otitis media, bacteremia, and meningitis, especially in children and the elderly. Bacteria within biofilms possess increased tolerance to antibiotics and are able to resist host defense systems. Bacteria within biofilms exhibit different physiology, metabolism, and gene expression profiles than planktonic cells. These differences underscore the need to identify alternative therapeutic targets and novel antimicrobial compounds that are effective against pneumococcal biofilms. In bacteria, DNA adenine methyltransferase (Dam alters pathogenic gene expression and catalyzes the methylation of adenine in the DNA duplex and of macromolecules during the activated methyl cycle (AMC. In pneumococci, AMC is involved in the biosynthesis of quorum sensing molecules that regulate competence and biofilm formation. In this study, we examine the effect of a small molecule Dam inhibitor, pyrimidinedione, on Streptococcus pneumoniae biofilm formation and evaluate the changes in global gene expression within biofilms via microarray analysis. The effects of pyrimidinedione on in vitro biofilms were studied using a static microtiter plate assay, and the architecture of the biofilms was viewed using confocal and scanning electron microscopy. The cytotoxicity of pyrimidinedione was tested on a human middle ear epithelium cell line by CCK-8. In situ oligonucleotide microarray was used to compare the global gene expression of Streptococcus pneumoniae D39 within biofilms grown in the presence and absence of pyrimidinedione. Real-time RT-PCR was used to study gene expression. Pyrimidinedione inhibits pneumococcal biofilm growth in vitro in a concentration-dependent manner, but it does not inhibit planktonic cell growth. Confocal microscopy analysis revealed the absence of organized biofilms, where cell

  2. Meningitis and pneumonia in Guatemalan children: the importance of Haemophilus influenzae type b and Streptococcus pneumoniae Meningitis y neumonía en niños guatemaltecos: importancia de Haemophilus influenzae tipo b y de Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Edwin J. Asturias


    Full Text Available OBJECTIVE: To determine the epidemiology of Haemophilus influenzae type b (Hib and Streptococcus pneumoniae invasive infections in hospitalized Guatemalan children. This is an important issue since Hib vaccine has not been incorporated into the routine immunization program in Guatemala and information from hospital records in 1995 indicated a low incidence of Hib and S. pneumoniae as causes of meningitis and invasive infections. METHODS: Children who were hospitalized in Guatemala City with clinical signs compatible with bacterial infections were evaluated for evidence of Hib or S. pneumoniae infection. Normally sterile body fluids were cultured, and antigen detection was performed on cerebrospinal fluid (CSF and pleural fluid. RESULTS: Of 1 203 children 1-59 months of age hospitalized over a 28-month period, 725 of them (60.3% had a primary diagnosis of pneumonia, 357 (29.7% of meningitis, 60 (5.0% of cellulitis, and 61 (5.1% of sepsis and other conditions. Hib was identified in 20.0% of children with meningitis and S. pneumoniae in 12.9%. The average annual incidence of Hib meningitis was 13.8 cases per 100 000 children under 5 years of age, and 32.4% of meningitides caused by Hib and 58.7% of S. pneumoniae meningitides occurred prior to 6 months of age. Case fatality rates were 14.1%, 37.0%, and 18.0%, respectively, for children with Hib, S. pneumoniae, and culture-negative and antigen-negative meningitis. Prior antibiotic therapy was common and was associated with significant reductions in CSF-culture-positive results for children with other evidence of Hib or S. pneumoniae meningitis. CONCLUSIONS: Improvements in case detection, culture methods, and latex agglutination for antigen detection in CSF resulted in identification of Hib and S. pneumoniae as important causes of severe disease in Guatemalan children. Using a cutoff of > 10 white blood cells per cubic millimeter in CSF would improve the sensitivity for detection of bacterial

  3. Time and dose-dependent risk of pneumococcal pneumonia following influenza: a model for within-host interaction between influenza and Streptococcus pneumoniae


    Shrestha, Sourya; Foxman, Betsy; Dawid, Suzanne; Aiello, Allison E.; Davis, Brian M.; Berus, Joshua; Rohani, Pejman


    A significant fraction of seasonal and in particular pandemic influenza deaths are attributed to secondary bacterial infections. In animal models, influenza virus predisposes hosts to severe infection with both Streptococcus pneumoniae and Staphylococcus aureus. Despite its importance, the mechanistic nature of the interaction between influenza and pneumococci, its dependence on the timing and sequence of infections as well as the clinical and epidemiological consequences remain unclear. We e...

  4. Identification of proteins in Streptococcus pneumoniae by reverse vaccinology and genetic diversity of these proteins in clinical isolates. (United States)

    Argondizzo, Ana Paula Corrêa; da Mota, Fabio Faria; Pestana, Cristiane Pinheiro; Reis, Joice Neves; de Miranda, Antonio Basílio; Galler, Ricardo; Medeiros, Marco Alberto


    Streptococcus pneumoniae is a major cause of morbidity and mortality worldwide. Virulence-associated proteins common and conserved among all capsular types now represent the best strategy to combat pneumococcal infections. Our aim was to identify conserved targets in pneumococci that showed positive prediction for lipoprotein and extracellular subcellular location using bioinformatics programs and verify the distribution and the degree of conservation of these targets in pneumococci. These targets can be considered potential vaccine candidate to be evaluated in the future. A set of 13 targets were analyzed and confirmed the presence in all pneumococci tested. These 13 genes were highly conserved showing around >96 % of amino acid and nucleotide identity, but they were also present and show high identity in the closely related species Streptococcus mitis, Streptococcus oralis, and Streptococcus pseudopneumoniae. S. oralis clusters away from S. pneumoniae, while S. pseudopneumoniae and S. mitis cluster closer. The divergence between the selected targets was too small to be observed consistently in phylogenetic groups between the analyzed genomes of S. pneumoniae. The proteins analyzed fulfill two of the initial criteria of a vaccine candidate: targets are present in a variety of different pneumococci strains including different serotypes and are conserved among the samples evaluated.

  5. Effect of Xylitol on Growth of Streptococcus pneumoniae in the Presence of Fructose and Sorbitol (United States)

    Tapiainen, Terhi; Kontiokari, Tero; Sammalkivi, Laura; Ikäheimo, Irma; Koskela, Markku; Uhari, Matti


    Xylitol is effective in preventing acute otitis media by inhibiting the growth of Streptococcus pneumoniae. To clarify this inhibition we used fructose, which is known to block similar growth inhibition observed in Streptococcus mutans. In addition, we evaluated the efficacy of sorbitol in inhibiting the growth of pneumococci, as sorbitol is widely used for indications similar to those for which xylitol is used. The addition of 5% xylitol to the growth medium resulted in marked growth inhibition, an effect which was totally eliminated in the presence of 1, 2.5, or 5% fructose but not in the presence of 1 or 5% glucose, 1% galactose, or 1% sucrose. This finding implies that xylitol-induced inhibition of pneumococcal growth is mediated via the fructose phosphotransferase system in a way similar to that in which mutans group streptococcal growth is inhibited. The addition of sorbitol at concentrations of 1, 2.5, or 5% to the growth medium did not affect the growth of pneumococci and neither inhibited nor enhanced the xylitol-induced growth impairment. Thus, it seems that xylitol is the only commercially used sugar substitute proven to have an antimicrobial effect on pneumococci. PMID:11120960

  6. Emerging, Non-PCV13 Serotypes 11A and 35B of Streptococcus pneumoniae Show High Potential for Biofilm Formation In Vitro.

    Directory of Open Access Journals (Sweden)

    Mirian Domenech

    Full Text Available Since the use of pneumococcal conjugate vaccines PCV7 and PCV13 in children became widespread, invasive pneumococcal disease (IPD has dramatically decreased. Nevertheless, there has been a rise in incidence of Streptococcus pneumoniae non-vaccine serotypes (NVT colonising the human nasopharynx. Nasopharyngeal colonisation, an essential step in the development of S. pneumoniae-induced IPD, is associated with biofilm formation. Although the capsule is the main pneumococcal virulence factor, the formation of pneumococcal biofilms might, in fact, be limited by the presence of capsular polysaccharide (CPS.We used clinical isolates of 16 emerging, non-PCV13 serotypes as well as isogenic transformants of the same serotypes. The biofilm formation capacity of isogenic transformants expressing CPSs from NVT was evaluated in vitro to ascertain whether this trait can be used to predict the emergence of NVT. Fourteen out of 16 NVT analysed were not good biofilm formers, presumably because of the presence of CPS. In contrast, serotypes 11A and 35B formed ≥45% of the biofilm produced by the non-encapsulated M11 strain.This study suggest that emerging, NVT serotypes 11A and 35B deserve a close surveillance.

  7. Susceptibilidad a antimicrobianos en aislamientos de Streptococcus pneumoniae invasor en Colombia Susceptibility to antimicrobial agents in isolates of invasive Streptococcus pneumoniae in Colombia

    Directory of Open Access Journals (Sweden)

    Aura Lucía Leal


    Full Text Available Se realizó un estudio para determinar los patrones de susceptibilidad a los antimicrobianos de los aislamientos de Streptococcus pneumoniae causante de enfermedad invasora diagnosticada en Colombia en niños menores de 5 años entre 1994 y 1996 y para establecer la distribución de los tipos capsulares de los aislamientos resistentes. Se analizaron 324 aislamientos recuperados durante la ejecución del Protocolo Nacional de Serotipificación de S. pneumoniae realizado en Santa Fe de Bogotá, Medellín y Cali, Colombia, entre julio de 1994 y marzo de 1996. Se observó que 119 de todos los aislamientos (36,7% presentaban susceptibilidad disminuida por lo menos a un antimicrobiano, que 39 (12% presentaban susceptibilidad disminuida a la penicilina y que de estos últimos aislamientos, 29 presentaban resistencia intermedia y 10 resistencia alta. Nueve aislamientos (2,8% presentaban resistencia a la ceftriaxona, 80 (24,7% a la combinación de trimetoprima y sulfametoxazol (TMS, 49 (15,1% al cloranfenicol y 31 (9,6% a la eritromicina. Se observó resistencia a dos antimicrobianos en 31 aislamientos (9,6% y multirresistencia en 22 (6,7%. Estos 22 aislamientos mostraron resistencia al TMS. Las asociaciones más frecuentes fueron penicilina, TMS y eritromicina en 5 casos; penicilina, cloranfenicol, TMS y eritromicina en 4; penicilina, ceftriaxona, cloranfenicol y TMS en 3; y penicilina, ceftriaxona, cloranfenicol, TMS y eritromicina en 3 casos. Los serotipos más frecuentes en los aislamientos resistentes a la penicilina fueron: 23F (53,8%, 14 (25,6%, 6B (7,7%, 9V (5,1%, 19F (5,1% y 34 (2,6%. Los serotipos más frecuentes en los aislamientos resistentes a antimicrobianos distintos de la penicilina fueron: 5 (37,5%, 23F (7,5%, 14 (18,8% y 6B (13,8%. Esta diferencia en la distribución de los serotipos fue estadísticamente significativa (P A study was done to determine the patterns of susceptibility to antimicrobial agents in isolates of Streptococcus

  8. Streptococcus pneumoniae Coinfection Is Correlated with the Severity of H1N1 Pandemic Influenza (United States)

    Cisterna, Daniel; Savji, Nazir; Bussetti, Ana Valeria; Kapoor, Vishal; Hui, Jeffrey; Tokarz, Rafal; Briese, Thomas; Baumeister, Elsa; Lipkin, W. Ian


    Background Initial reports in May 2009 of the novel influenza strain H1N1pdm estimated a case fatality rate (CFR) of 0.6%, similar to that of seasonal influenza. In July 2009, however, Argentina reported 3056 cases with 137 deaths, representing a CFR of 4.5%. Potential explanations for increased CFR included virus reassortment or genetic drift, or infection of a more vulnerable population. Virus genomic sequencing of 26 Argentinian samples representing both severe and mild disease indicated no evidence of reassortment, mutations associated with resistance to antiviral drugs, or genetic drift that might contribute to virulence. Furthermore, no evidence was found for increased frequency of risk factors for H1N1pdm disease. Methods/Principal Findings We examined nasopharyngeal swab samples (NPS) from 199 cases of H1N1pdm infection from Argentina with MassTag PCR, testing for 33 additional microbial agents. The study population consisted of 199 H1N1pdm-infected subjects sampled between 23 June and 4 July 2009. Thirty-nine had severe disease defined as death (n = 20) or hospitalization (n = 19); 160 had mild disease. At least one additional agent of potential pathogenic importance was identified in 152 samples (76%), including Streptococcus pneumoniae (n = 62); Haemophilus influenzae (n = 104); human respiratory syncytial virus A (n = 11) and B (n = 1); human rhinovirus A (n = 1) and B (n = 4); human coronaviruses 229E (n = 1) and OC43 (n = 2); Klebsiella pneumoniae (n = 2); Acinetobacter baumannii (n = 2); Serratia marcescens (n = 1); and Staphylococcus aureus (n = 35) and methicillin-resistant S. aureus (MRSA, n = 6). The presence of S. pneumoniae was strongly correlated with severe disease. S. pneumoniae was present in 56.4% of severe cases versus 25% of mild cases; more than one-third of H1N1pdm NPS with S. pneumoniae were from subjects with severe disease (22 of 62 S. pneumoniae-positive NPS, p = 0

  9. Multicentre in-vitro evaluation of the susceptibility of Streptococcus pneumoniae, Haemophilus influenzae and Moraxella catarrhalis to ciprofloxacin, clarithromycin, co-amoxiclav and sparfloxacin

    NARCIS (Netherlands)

    HoogkampKorstanje, JAA; DirksGo, SIS; Kabel, P; Manson, WL; Stobberingh, EE; Vreede, RW; Davies, BI

    Seven laboratories, including a reference laboratory, tested the susceptibility of Moraxella catarrhalis, Streptococcus pneumoniae and Haemophilus influenzae strains to ciprofloxacin, clarithromycin, co-amoxiclav and sparfloxacin with the Etest. A total of 976 strains were collected. The results

  10. The putative proteinase maturation protein A of Streptococcus pneumoniae is a conserved surface protein with potential to elicit protective immune responses

    NARCIS (Netherlands)

    K. Overweg (Karin); A. Kerr; M. Sluijter (Marcel); M.H. Jackson; T.J. Mitchell; A.P. de Jong; R. de Groot (Ronald); P.W.M. Hermans (Peter)


    textabstractSurface-exposed proteins often play an important role in the interaction between pathogenic bacteria and their host. We isolated a pool of hydrophobic, surface-associated proteins of Streptococcus pneumoniae. The opsonophagocytic activity of hyperimmune

  11. Overexpression, purification and crystallization of a choline-binding protein CbpI from Streptococcus pneumoniae

    International Nuclear Information System (INIS)

    Paterson, Neil G.; Riboldi-Tunicliffe, Alan; Mitchell, Timothy J.; Isaacs, Neil W.


    The choline-binding protein CbpI from S. pneumoniae has been purified and crystallized and diffraction data have been collected to 3.5 Å resolution. The choline-binding protein CbpI from Streptococcus pneumoniae is a 23.4 kDa protein with no known function. The protein has been successfully purified initially using Ni–NTA chromatography and to homogeneity using Q-Sepharose ion-exchange resin as an affinity column. CbpI was crystallized using PEG 3350 as a precipitant and X-ray crystallographic analysis showed that the crystals belonged to the tetragonal space group P4, with unit-cell parameters a = b = 83.31, c = 80.29 Å, α = β = γ = 90°. The crystal contains two molecules in the asymmetric unit with a solvent content of 55.7% (V M = 2.77 Å 3 Da −1 ) and shows a diffraction limit of 3.5 Å

  12. Frequent beneficial mutations during single-colony serial transfer of Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Kathleen E Stevens


    Full Text Available The appearance of new mutations within a population provides the raw material for evolution. The consistent decline in fitness observed in classical mutation accumulation studies has provided support for the long-held view that deleterious mutations are more common than beneficial mutations. Here we present results of a study using a mutation accumulation design with the bacterium Streptococcus pneumoniae in which the fitness of the derived populations increased. This rise in fitness was associated specifically with adaptation to survival during brief stationary phase periods between single-colony population bottlenecks. To understand better the population dynamics behind this unanticipated adaptation, we developed a maximum likelihood model describing the processes of mutation and stationary-phase selection in the context of frequent population bottlenecks. Using this model, we estimate that the rate of beneficial mutations may be as high as 4.8×10(-4 events per genome for each time interval corresponding to the pneumococcal generation time. This rate is several orders of magnitude higher than earlier estimates of beneficial mutation rates in bacteria but supports recent results obtained through the propagation of small populations of Escherichia coli. Our findings indicate that beneficial mutations may be relatively frequent in bacteria and suggest that in S. pneumoniae, which develops natural competence for transformation, a steady supply of such mutations may be available for sampling by recombination.

  13. Prophage spontaneous activation promotes DNA release enhancing biofilm formation in Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Margarida Carrolo

    Full Text Available Streptococcus pneumoniae (pneumococcus is able to form biofilms in vivo and previous studies propose that pneumococcal biofilms play a relevant role both in colonization and infection. Additionally, pneumococci recovered from human infections are characterized by a high prevalence of lysogenic bacteriophages (phages residing quiescently in their host chromosome. We investigated a possible link between lysogeny and biofilm formation. Considering that extracellular DNA (eDNA is a key factor in the biofilm matrix, we reasoned that prophage spontaneous activation with the consequent bacterial host lysis could provide a source of eDNA, enhancing pneumococcal biofilm development. Monitoring biofilm growth of lysogenic and non-lysogenic pneumococcal strains indicated that phage-infected bacteria are more proficient at forming biofilms, that is their biofilms are characterized by a higher biomass and cell viability. The presence of phage particles throughout the lysogenic strains biofilm development implicated prophage spontaneous induction in this effect. Analysis of lysogens deficient for phage lysin and the bacterial major autolysin revealed that the absence of either lytic activity impaired biofilm development and the addition of DNA restored the ability of mutant strains to form robust biofilms. These findings establish that limited phage-mediated host lysis of a fraction of the bacterial population, due to spontaneous phage induction, constitutes an important source of eDNA for the S. pneumoniae biofilm matrix and that this localized release of eDNA favors biofilm formation by the remaining bacterial population.

  14. Uptake of extracellular DNA: Competence induced pili in natural transformation of Streptococcus pneumoniae (United States)

    Muschiol, Sandra; Balaban, Murat; Normark, Staffan; Henriques-Normark, Birgitta


    Transport of DNA across bacterial membranes involves complex DNA uptake systems. In Gram-positive bacteria, the DNA uptake machinery shares fundamental similarities with type IV pili and type II secretion systems. Although dedicated pilus structures, such as type IV pili in Gram-negative bacteria, are necessary for efficient DNA uptake, the role of similar structures in Gram-positive bacteria is just beginning to emerge. Recently two essentially very different pilus structures composed of the same major pilin protein ComGC were proposed to be involved in transformation of the Gram-positive bacterium Streptococcus pneumoniae – one is a long, thin, type IV pilus-like fiber with DNA binding capacity and the other one is a pilus structure that was thicker, much shorter and not able to bind DNA. Here we discuss how competence induced pili, either by pilus retraction or by a transient pilus-related opening in the cell wall, may mediate DNA uptake in S. pneumoniae. PMID:25640084

  15. Influence of impaired lipoprotein biogenesis on surface and exoproteome of Streptococcus pneumoniae. (United States)

    Pribyl, Thomas; Moche, Martin; Dreisbach, Annette; Bijlsma, Jetta J E; Saleh, Malek; Abdullah, Mohammed R; Hecker, Michael; van Dijl, Jan Maarten; Becher, Dörte; Hammerschmidt, Sven


    Surface proteins are important for the fitness and virulence of the Gram-positive pathogen Streptococcus pneumoniae. They are crucial for interaction of the pathogen with its human host during infection. Therefore, the analysis of the pneumococcal surface proteome is an important task that requires powerful tools. In this study, two different methods, an optimized biotinylation approach and shaving with trypsin beads, were applied to study the pneumococcal surface proteome and to identify surface-exposed protein domains, respectively. The identification of nearly 95% of the predicted lipoproteins and 75% of the predicted sortase substrates reflects the high coverage of the two classical surface protein classes accomplished in this study. Furthermore, the biotinylation approach was applied to study the impact of an impaired lipoprotein maturation pathway on the cell envelope proteome and exoproteome. Loss of the lipoprotein diacylglyceryl transferase Lgt leads to striking changes in the lipoprotein distribution. Many lipoproteins disappear from the surface proteome and accumulate in the exoproteome. Further insights into lipoprotein processing in pneumococci are provided by immunoblot analyses of bacterial lysates and corresponding supernatant fractions. Taken together, the first comprehensive overview of the pneumococcal surface and exoproteome is presented, and a model for lipoprotein processing in S. pneumoniae is proposed.

  16. Purpura fulminans associated with Streptococcus pneumoniae septicemia in an asplenic pediatric patient. (United States)

    Konda, S; Zell, D; Milikowski, C; Alonso-Llamazares, J


    Purpura fulminans is a rapidly progressive syndrome of small-vessel thrombosis and hemorrhagic necrosis of the skin accompanied by disseminated intravascular coagulation. We describe a case of Streptococcus pneumoniae septicemia in an asplenic 5-year-old boy on oral tacrolimus, with a past medical history of multivisceral organ transplantation and subsequent development of purpura fulminans on his chest and distal extremities. The acute infectious form of purpura fulminans is usually caused by gram-negative bacteria. Cases secondary to gram-positive encapsulated bacteria usually occur when individuals are immuno-suppressed or have anatomic or functional asplenia. Our patient had both, which likely increased his susceptibility, and he responded well to antimicrobial therapy in addition to prophylactic coverage in the setting of his immunosuppression. We review the literature for similar cases due to S. pneumoniae in the pediatric population and discuss the etiology and treatment of purpura fulminans. Copyright © 2011 Elsevier España, S.L. and AEDV. All rights reserved.

  17. N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Muhammad Afzal


    Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

  18. Overexpression, purification and crystallization of a choline-binding protein CbpI from Streptococcus pneumoniae

    Energy Technology Data Exchange (ETDEWEB)

    Paterson, Neil G., E-mail:; Riboldi-Tunicliffe, Alan [Department of Chemistry and WestCHEM, Glasgow Biomedical Research Centre (GBRC), University of Glasgow, 120 University Place, Glasgow G12 8TA,Scotland (United Kingdom); Mitchell, Timothy J. [Division of Infection and Immunity (IBLS), Glasgow Biomedical Research Centre (GBRC), University of Glasgow, 120 University Place, Glasgow G12 8TA,Scotland (United Kingdom); Isaacs, Neil W. [Department of Chemistry and WestCHEM, Glasgow Biomedical Research Centre (GBRC), University of Glasgow, 120 University Place, Glasgow G12 8TA,Scotland (United Kingdom)


    The choline-binding protein CbpI from S. pneumoniae has been purified and crystallized and diffraction data have been collected to 3.5 Å resolution. The choline-binding protein CbpI from Streptococcus pneumoniae is a 23.4 kDa protein with no known function. The protein has been successfully purified initially using Ni–NTA chromatography and to homogeneity using Q-Sepharose ion-exchange resin as an affinity column. CbpI was crystallized using PEG 3350 as a precipitant and X-ray crystallographic analysis showed that the crystals belonged to the tetragonal space group P4, with unit-cell parameters a = b = 83.31, c = 80.29 Å, α = β = γ = 90°. The crystal contains two molecules in the asymmetric unit with a solvent content of 55.7% (V{sub M} = 2.77 Å{sup 3} Da{sup −1}) and shows a diffraction limit of 3.5 Å.

  19. Exposure to welding fumes and lower airway infection with Streptococcus pneumoniae. (United States)

    Suri, Reetika; Periselneris, Jimstan; Lanone, Sophie; Zeidler-Erdely, Patti C; Melton, Geoffrey; Palmer, Keith T; Andujar, Pascal; Antonini, James M; Cohignac, Vanessa; Erdely, Aaron; Jose, Ricardo J; Mudway, Ian; Brown, Jeremy; Grigg, Jonathan


    Welders are at increased risk of pneumococcal pneumonia. The mechanism for this association is not known. The capacity of pneumococci to adhere to and infect lower airway cells is mediated by host-expressed platelet-activating factor receptor (PAFR). We sought to assess the effect of mild steel welding fumes (MS-WF) on PAFR-dependent pneumococcal adhesion and infection to human airway cells in vitro and on pneumococcal airway infection in a mouse model. The oxidative potential of MS-WF was assessed by their capacity to reduce antioxidants in vitro. Pneumococcal adhesion and infection of A549, BEAS-2B, and primary human bronchial airway cells were assessed by means of quantitative bacterial culture and expressed as colony-forming units (CFU). After intranasal instillation of MS-WF, mice were infected with Streptococcus pneumoniae, and bronchoalveolar lavage fluid (BALF) and lung CFU values were determined. PAFR protein levels were assessed by using immunofluorescence and immunohistochemistry, and PAFR mRNA expression was assessed by using quantitative PCR. PAFR was blocked by CV-3988, and oxidative stress was attenuated by N-acetylcysteine. MS-WF exhibited high oxidative potential. In A549 and BEAS-2B cells MS-WF increased pneumococcal adhesion and infection and PAFR protein expression. Both CV-3988 and N-acetylcysteine reduced MS-WF-stimulated pneumococcal adhesion and infection of airway cells. MS-WF increased mouse lung PAFR mRNA expression and increased BALF and lung pneumococcal CFU values. In MS-WF-exposed mice CV-3988 reduced BALF CFU values. Hypersusceptibility of welders to pneumococcal pneumonia is in part mediated by the capacity of welding fumes to increase PAFR-dependent pneumococcal adhesion and infection of lower airway cells. Copyright © 2015 American Academy of Allergy, Asthma & Immunology. All rights reserved.

  20. Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer

    Directory of Open Access Journals (Sweden)

    Helen Hencida Thangamony


    Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.

  1. Multidrug Resistance in Non-PCV13 Serotypes of Streptococcus pneumoniae in Northern Japan, 2014. (United States)

    Kawaguchiya, Mitsuyo; Urushibara, Noriko; Kobayashi, Nobumichi


    Since the implementation of routine PCV13 immunization in Japan, nonvaccine serotypes (NVTs) have been increasing among clinical isolates of Streptococcus pneumoniae. In this study, susceptibility to 18 antibiotics was tested for all the 231 isolates with NVTs, which were collected from children Japan in 2014 (July-November). High resistance rates were observed for macrolides (>90.9%), tetracycline (91.3%), and clindamycin (75.3%), while penicillin (PEN) nonsusceptibility (PNSP; MIC ≥0.12 μg/ml) was detected in 42.9% of the pneumococci [39.4%; PEN-intermediate S. pneumoniae (PISP), 3.5%; PEN-resistant S. pneumoniae (PRSP)]. All serotype 15A isolates were PRSP (MIC, ≥2 μg/ml) or PISP, and PNSP was prevalent in also serotypes 23A (96.9%), 6C (41%), and 35B (33.3%). Overall, 42.0% of the isolates showed multidrug resistance (MDR). Sequence types (STs) determined for 20 PNSP isolates with NVTs were ST63 (15A), STs 242 or 5832 (6C), STs 338 or 5242 (23A), and ST558 (35B). All the PNSP isolates possessed tet(M), and erm(B) or mefA(A/E), and 70% of them were gPRSP having three altered genes pbp1a, pbp2x, and pbp2b. Among alterations in transpeptidase-coding region of penicillin-binding proteins (PBPs), two substitutions of T 371 S in the STMK motif and TSQF 574-577 NTGY in PBP1a were common to all PRSP isolates. The present study showed the spread of PNSP in NVTs 15A, 23A, 6C, and 35B, and the emergence of the MDR international clone Sweden 15A -ST63 in northern Japan.

  2. Transcriptional and metabolic effects of glucose on Streptococcus pneumoniae sugar metabolism

    Directory of Open Access Journals (Sweden)

    Laura ePaixão


    Full Text Available Streptococcus pneumoniae is a strictly fermentative human pathogen that relies on carbohydrate metabolism to generate energy for growth. The nasopharynx colonised by the bacterium is poor in free sugars, but mucosa lining glycans can provide a source of sugar. In blood and inflamed tissues glucose is the prevailing sugar. As a result during progression from colonisation to disease S. pneumoniae has to cope with a pronounced shift in carbohydrate nature and availability. Thus, we set out to assess the pneumococcal response to sugars found in glycans and the influence of glucose (Glc on this response at the transcriptional, physiological and metabolic levels. Galactose (Gal, N-acetylglucosamine (GlcNAc and mannose (Man affected the expression of 8 to 14% of the genes covering cellular functions including central carbon metabolism and virulence. The pattern of end-products as monitored by in vivo 13C-NMR is in good agreement with the fermentation profiles during growth, while the pools of phosphorylated metabolites are consistent with the type of fermentation observed (homolactic vs. mixed and regulation at the metabolic level. Furthermore, the accumulation of α-Gal6P and Man6P indicate metabolic bottlenecks in the metabolism of Gal and Man, respectively. Glc added to cells actively metabolizing other sugar(s was readily consumed and elicited a metabolic shift towards a homolactic profile. The transcriptional response to Glc was large (over 5% of the genome. In central carbon metabolism (most represented category, Glc exerted mostly negative regulation. The smallest response to Glc was observed on a sugar mix, suggesting that exposure to varied sugars improves the fitness of S. pneumoniae. The expression of virulence factors was negatively controlled by Glc in a sugar-dependent manner. Overall, our results shed new light on the link between carbohydrate metabolism, adaptation to host niches and virulence.

  3. Transcriptional and metabolic effects of glucose on Streptococcus pneumoniae sugar metabolism. (United States)

    Paixão, Laura; Caldas, José; Kloosterman, Tomas G; Kuipers, Oscar P; Vinga, Susana; Neves, Ana R


    Streptococcus pneumoniae is a strictly fermentative human pathogen that relies on carbohydrate metabolism to generate energy for growth. The nasopharynx colonized by the bacterium is poor in free sugars, but mucosa lining glycans can provide a source of sugar. In blood and inflamed tissues glucose is the prevailing sugar. As a result during progression from colonization to disease S. pneumoniae has to cope with a pronounced shift in carbohydrate nature and availability. Thus, we set out to assess the pneumococcal response to sugars found in glycans and the influence of glucose (Glc) on this response at the transcriptional, physiological, and metabolic levels. Galactose (Gal), N-acetylglucosamine (GlcNAc), and mannose (Man) affected the expression of 8 to 14% of the genes covering cellular functions including central carbon metabolism and virulence. The pattern of end-products as monitored by in vivo (13)C-NMR is in good agreement with the fermentation profiles during growth, while the pools of phosphorylated metabolites are consistent with the type of fermentation observed (homolactic vs. mixed) and regulation at the metabolic level. Furthermore, the accumulation of α-Gal6P and Man6P indicate metabolic bottlenecks in the metabolism of Gal and Man, respectively. Glc added to cells actively metabolizing other sugar(s) was readily consumed and elicited a metabolic shift toward a homolactic profile. The transcriptional response to Glc was large (over 5% of the genome). In central carbon metabolism (most represented category), Glc exerted mostly negative regulation. The smallest response to Glc was observed on a sugar mix, suggesting that exposure to varied sugars improves the fitness of S. pneumoniae. The expression of virulence factors was negatively controlled by Glc in a sugar-dependent manner. Overall, our results shed new light on the link between carbohydrate metabolism, adaptation to host niches and virulence.

  4. A Community-acquired Lung Abscess Attributable to Streptococcus pneumoniae which Extended Directly into the Chest Wall. (United States)

    Ko, Yuki; Tobino, Kazunori; Yasuda, Yuichiro; Sueyasu, Takuto; Nishizawa, Saori; Yoshimine, Kouhei; Munechika, Miyuki; Asaji, Mina; Yamaji, Yoshikazu; Tsuruno, Kosuke; Miyajima, Hiroyuki; Mukasa, Yosuke; Ebi, Noriyuki

    We herein report the case of 75-year-old Japanese female with a community-acquired lung abscess attributable to Streptococcus pneumoniae (S. penumoniae) which extended into the chest wall. The patient was admitted to our hospital with a painful mass on the left anterior chest wall. A contrast-enhanced chest computed tomography scan showed a lung abscess in the left upper lobe which extended into the chest wall. Surgical debridement of the chest wall abscess and percutaneous transthoracic tube drainage of the lung abscess were performed. A culture of the drainage specimen yielded S. pneumoniae. The patient showed a remarkable improvement after the initiation of intravenous antibiotic therapy.

  5. Antimicrobial activity of innate immune molecules against Streptococcus pneumoniae, Moraxella catarrhalis and nontypeable Haemophilus influenzae

    Directory of Open Access Journals (Sweden)

    Teufert Karen


    Full Text Available Abstract Background Despite its direct connection to the nasopharynx which harbors otitis media pathogens as part of its normal flora, the middle ear cavity is kept free of these bacteria by as yet unknown mechanisms. Respiratory mucosal epithelia, including those of the middle ear and eustachian tube, secrete antimicrobial effectors including lysozyme, lactoferrin and β defensins-1 and -2. To elucidate the role of these innate immune molecules in the normal defense and maintenance of sterility of respiratory mucosa such as that of the middle ear, we assessed their effect on the respiratory pathogens nontypeable Haemophilus influenzae (NTHi 12, Moraxella catarrhalis 035E, and Streptococcus pneumoniae 3, and 6B. Methods Two assay methods, the radial assay and the liquid broth assay, were employed for testing the antimicrobial activity of the molecules. This was done in order to minimize the possibility that the observed effects were artifacts of any single assay system employed. Also, transmission electron microscopy (TEM was employed to evaluate the effect of antimicrobial innate immune molecules on OM pathogens. For the statistical analysis of the data, Student's t-test was performed. Results Results of the radial diffusion assay showed that β defensin-2 was active against all four OM pathogens tested, while treatment with β defensin-1 appeared to only affect M. catarrhalis. The radial assay results also showed that lysozyme was quite effective against S. pneumoniae 3 and 6B and was partially bacteriostatic/bactericidal against M. catarrhalis. Lysozyme however, appeared not to affect the growth of NTHi. Thus, lysozyme seems to have a more pronounced impact on the growth of the Gram-positive S. pneumoniae as compared to that of Gram-negative pathogens. Lactoferrin on the other hand, enhanced the growth of the bacteria tested. The results of the radial assays were confirmed using liquid broth assays for antimicrobial activity, and showed that

  6. Nasopharyngeal carriage, antibiogram & serotype distribution of Streptococcus pneumoniae among healthy under five children

    Directory of Open Access Journals (Sweden)

    K.L. Ravi Kumar


    Full Text Available Background & objectives: Information related to nasopharyngeal carriage of Streptococcus pneumoniae among healthy children is scanty in India. This prospective study was undertaken to determine the presence of asymptomatic nasopharyngeal colonization, assess serogroups/types (SGT and drug resistance of S. pneumoniae in children below five years of age. Methods: A total of 109 male and 81 female children in the age group of three months to five years belonging to different socio-economic classes were enrolled. They were recruited across all age groups from those attending paediatric OPD of a tertiary care and research centre for immunization program. Fifty three isolates identified as pneumococci were tested for their antimicrobial susceptibility pattern by Kirby-Bauer′s disc diffusion and E-Test methods. Serotyping was performed by detection of the quelling reaction with specific antiserum. Result: The pneumococcal carriage rate in the study population was 27.9 per cent. The isolation rate was associated with age being higher (49.2% in smaller children (3-12 months and among male (62.2%. The most prevalent SGTs were 19 followed by 10, 14 and 7; 21 per cent of isolates belonging to serotype 10 (n=7 were 11 (n=4 were not covered in any of the conjugate vaccines currently available in Indian market. Resistance to co-trimoxazole, tetracycline, penicillin and erythromycin was observed in 91 per cent (n=48, 36 per cent (n=19, 17 per cent (n=9 and 9 per cent (n=5 isolates, respectively. All the penicillin resistant isolates were found to be intermediately resistant by E-Test. Multidrug resistance was observed in 19 per cent (n=10 isolates. Interpretation & conclusions: High level of antibiotic resistance was present in S. pneumoniae isolated from healthy children below age five. A pneumococcal conjugate vaccine with the prevailing SGTs would help to reduce the pool of antibiotic resistant pneumococci. Continued surveillance of serotypes and tracking

  7. Deletion analysis of Streptococcus pneumoniae late competence genes distinguishes virulence determinants that are dependent or independent of competence induction


    Zhu, Luchang; Lin, Jingjun; Kuang, Zhizhou; Vidal, Jorge E.; Lau, Gee W.


    The competence regulon of Streptococcus pneumoniae (pneumococcus) is crucial for genetic transformation. During competence development, the alternative sigma factor ComX is activated, which in turn, initiates transcription of 80 “late” competence genes. Interestingly, only 16 late genes are essential for genetic transformation. We hypothesized that these late genes that are dispensable for competence are beneficial to pneumococcal fitness during infection. These late genes were systematically...

  8. The response regulator YycF inhibits expression of the fatty acid biosynthesis repressor FabT in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Mohedano, Maria L.; Amblar, Mónica; La Fuente, De Alicia; Wells, Jerry M.; López, Paloma


    The YycFG (also known as WalRK, VicRK, MicAB, or TCS02) two-component system (TCS) is highly conserved among Gram-positive bacteria with a low G+C content. In Streptococcus pneumoniae the YycF response regulator has been reported to be essential due to its control of pcsB gene expression.

  9. Penicillin resistance and serotype distribution of Streptococcus pneumoniae in Ghanaian children less than six years of age

    DEFF Research Database (Denmark)

    Dayie, Nicholas T. K. D.; Arhin, Reuben E.; Newman, Mercy J.


    Background: The objective of this study was to determine the prevalence of nasopharyngeal carriage, serotype distribution, and penicillin resistance of Streptococcus pneumoniae in children 2 mu g/ml and were classified as fully penicillin resistant with 45% of the isolates having intermediate...... serotypes detected. The two penicillin resistant isolates (MIC 32 mu g/ml) were serotypes included in both PCV-13 and PPV-23. A nationwide monitoring system of penicillin susceptibility patterns and pneumococcal serotypes is recommended....

  10. Genetic diversity of penicillin-binding protein 2B and 2X genes from Streptococcus pneumoniae in South Africa.


    Smith, A M; Klugman, K P; Coffey, T J; Spratt, B G


    Streptococcus pneumoniae (the pneumococcus) is believed to have developed resistance to penicillin by the production of altered forms of penicillin-binding proteins (PBPs) that have decreased affinity for penicillin. Sixty-eight clinical isolates of serogroup 6 and 19 pneumococci (MICs, < 0.015 to 8 micrograms/ml) were randomly selected from hospitals across South Africa which are at substantial geographic distance from each other. The polymerase chain reaction was used to isolate the penicil...

  11. Post-infective transverse myelitis following Streptococcus pneumoniae meningitis with radiological features of acute disseminated encephalomyelitis: a case report

    Directory of Open Access Journals (Sweden)

    Williams Thomas


    Full Text Available Abstract Introduction Post-infectious autoimmune demyelination of the central nervous system is a rare neurological disorder typically associated with exanthematous viral infections. We report an unusual presentation of the condition and a previously undocumented association with Streptococcus pneumonia meningitis. Case presentation A 50-year-old Caucasian woman presented to our facility with an acute myelopathy three days after discharge following acute Streptococcus pneumoniae meningitis. Imaging studies of the spine ruled out an infective focus and no other lesions were seen within the cord. Diffuse, bilateral white matter lesions were seen within the cerebral hemispheres, and our patient was diagnosed as having a post-infective demyelination syndrome that met the diagnostic criteria for an acute transverse myelitis. Our patient clinically and radiologically improved following treatment with steroids. Conclusions The novel association of a Streptococcus pneumoniae infection with post-infectious autoimmune central nervous system demyelination should alert the reader to the potentially causative role of this common organism, and gives insights into the pathogenesis. The unusual dissociation between the clinical presentation and the location of the radiological lesions should also highlight the potential for the condition to mimic the presentation of others, and stimulates debate on the definitions of acute transverse myelitis and acute disseminated encephalomyelitis, and their potential overlap.

  12. Interaction of SIGNR1 expressed by marginal zone macrophages with marginal zone B cells is essential to early IgM responses against Streptococcus pneumoniae

    NARCIS (Netherlands)

    Koppel, Estella A.; Litjens, Manja; van den Berg, Venice C.; van Kooyk, Yvette; Geijtenbeek, Teunis B. H.


    The spleen plays a pivotal role in the immune defense against encapsulated bacteria such as Streptococcus pneumoniae. Murine splenic marginal zone macrophages express the C-type lectin SIGNR1, which is crucial for the capture of S. pneumoniae from blood. In this study, we demonstrate that SIGNR1 is

  13. The alpha-tocopherol form of vitamin E boosts elastase activity of human PMNs and their ability to kill Streptococcus pneumoniae (United States)

    Despite the availability of vaccines, Streptococcus pneumoniae remains a leading cause of life-threatening infections such as pneumonia, bacteremia and meningitis. Polymorphonuclear leukocytes (PMNs) are a key determinant of disease course, because optimal host defense requires an initial robust pul...

  14. Platelet Endothelial Cell Adhesion Molecule-1, a Putative Receptor for the Adhesion of Streptococcus pneumoniae to the Vascular Endothelium of the Blood-Brain Barrier

    NARCIS (Netherlands)

    Iovino, Federico; Molema, Grietje; Bijlsma, Jetta J. E.

    The Gram-positive bacterium Streptococcus pneumoniae is the main causative agent of bacterial meningitis. S. pneumoniae is thought to invade the central nervous system via the bloodstream by crossing the vascular endothelium of the blood-brain barrier. The exact mechanism by which pneumococci cross

  15. Competence in Streptococcus pneumoniae is regulated by the rate of ribosomal decoding errors. (United States)

    Stevens, Kathleen E; Chang, Diana; Zwack, Erin E; Sebert, Michael E


    Competence for genetic transformation in Streptococcus pneumoniae develops in response to accumulation of a secreted peptide pheromone and was one of the initial examples of bacterial quorum sensing. Activation of this signaling system induces not only expression of the proteins required for transformation but also the production of cellular chaperones and proteases. We have shown here that activity of this pathway is sensitively responsive to changes in the accuracy of protein synthesis that are triggered by either mutations in ribosomal proteins or exposure to antibiotics. Increasing the error rate during ribosomal decoding promoted competence, while reducing the error rate below the baseline level repressed the development of both spontaneous and antibiotic-induced competence. This pattern of regulation was promoted by the bacterial HtrA serine protease. Analysis of strains with the htrA (S234A) catalytic site mutation showed that the proteolytic activity of HtrA selectively repressed competence when translational fidelity was high but not when accuracy was low. These findings redefine the pneumococcal competence pathway as a response to errors during protein synthesis. This response has the capacity to address the immediate challenge of misfolded proteins through production of chaperones and proteases and may also be able to address, through genetic exchange, upstream coding errors that cause intrinsic protein folding defects. The competence pathway may thereby represent a strategy for dealing with lesions that impair proper protein coding and for maintaining the coding integrity of the genome. The signaling pathway that governs competence in the human respiratory tract pathogen Streptococcus pneumoniae regulates both genetic transformation and the production of cellular chaperones and proteases. The current study shows that this pathway is sensitively controlled in response to changes in the accuracy of protein synthesis. Increasing the error rate during

  16. Clinical presentation and prognostic factors of Streptococcus pneumoniae meningitis according to the focus of infection

    Directory of Open Access Journals (Sweden)

    Samuelsson Susanne


    Full Text Available Abstract Background We conducted a nationwide study in Denmark to identify clinical features and prognostic factors in patients with Streptococcus pneumoniae according to the focus of infection. Methods Based on a nationwide registration, clinical information's was prospectively collected from all reported cases of pneumococcal meningitis during a 2-year period (1999–2000. Clinical and laboratory findings at admission, clinical course and outcome of the disease including follow-up audiological examinations were collected retrospectively. The focus of infection was determined according to the clinical diagnosis made by the physicians and after review of the medical records. Results 187 consecutive cases with S. pneumoniae meningitis were included in the study. The most common focus was ear (30%, followed by lung (18%, sinus (8%, and other (2%. In 42% of cases a primary infection focus could not be determined. On admission, fever and an altered mental status were the most frequent findings (in 93% and 94% of cases, respectively, whereas back rigidity, headache and convulsion were found in 57%, 41% and 11% of cases, respectively. 21% of patients died during hospitalisation (adults: 27% vs. children: 2%, Fisher Exact Test, P P = 0.0005. Prognostic factors associated with fatal outcome in univariate logistic regression analysis were advanced age, presence of an underlying disease, history of headache, presence of a lung focus, absence of an otogenic focus, having a CT-scan prior to lumbar puncture, convulsions, requirement of assisted ventilation, and alterations in various CSF parameters (WBC P P = 0.005. Conclusion These results emphasize the prognostic importance of an early recognition of a predisposing focus to pneumococcal meningitis.

  17. The impact of pneumolysin on the macrophage response to Streptococcus pneumoniae is strain-dependent.

    Directory of Open Access Journals (Sweden)

    Richard M Harvey

    Full Text Available Streptococcus pneumoniae is the world's leading cause of pneumonia, bacteremia, meningitis and otitis media. A major pneumococcal virulence factor is the cholesterol-dependent cytolysin, which has the defining property of forming pores in cholesterol-containing membranes. In recent times a clinically significant and internationally successful serotype 1 ST306 clone has been found to express a non-cytolytic variant of Ply (Ply306. However, while the pneumococcus is a naturally transformable organism, strains of the ST306 clonal group have to date been virtually impossible to transform, severely restricting efforts to understand the role of non-cytolytic Ply in the success of this clone. In this study isogenic Ply mutants were constructed in the D39 background and for the first time in the ST306 background (A0229467 to enable direct comparisons between Ply variants for their impact on the immune response in a macrophage-like cell line. Strains that expressed cytolytic Ply were found to induce a significant increase in IL-1β release from macrophage-like cells compared to the non-cytolytic and Ply-deficient strains in a background-independent manner, confirming the requirement for pore formation in the Ply-dependent activation of the NLRP3 inflammasome. However, cytolytic activity in the D39 background was found to induce increased expression of the genes encoding GM-CSF (CSF2, p19 subunit of IL-23 (IL23A and IFNβ (IFNB1 compared to non-cytolytic and Ply-deficient D39 mutants, but had no effect in the A0229467 background. The impact of Ply on the immune response to the pneumococcus is highly dependent on the strain background, thus emphasising the importance of the interaction between specific virulence factors and other components of the genetic background of this organism.

  18. Natural Genetic Transformation Generates a Population of Merodiploids in Streptococcus pneumoniae (United States)

    Zomer, Aldert; Bootsma, Hester J.; Prudhomme, Marc; Granadel, Chantal; Hermans, Peter W. M.; Polard, Patrice; Martin, Bernard; Claverys, Jean-Pierre


    Partial duplication of genetic material is prevalent in eukaryotes and provides potential for evolution of new traits. Prokaryotes, which are generally haploid in nature, can evolve new genes by partial chromosome duplication, known as merodiploidy. Little is known about merodiploid formation during genetic exchange processes, although merodiploids have been serendipitously observed in early studies of bacterial transformation. Natural bacterial transformation involves internalization of exogenous donor DNA and its subsequent integration into the recipient genome by homology. It contributes to the remarkable plasticity of the human pathogen Streptococcus pneumoniae through intra and interspecies genetic exchange. We report that lethal cassette transformation produced merodiploids possessing both intact and cassette-inactivated copies of the essential target gene, bordered by repeats (R) corresponding to incomplete copies of IS861. We show that merodiploidy is transiently stimulated by transformation, and only requires uptake of a ∼3-kb DNA fragment partly repeated in the chromosome. We propose and validate a model for merodiploid formation, providing evidence that tandem-duplication (TD) formation involves unequal crossing-over resulting from alternative pairing and interchromatid integration of R. This unequal crossing-over produces a chromosome dimer, resolution of which generates a chromosome with the TD and an abortive chromosome lacking the duplicated region. We document occurrence of TDs ranging from ∼100 to ∼900 kb in size at various chromosomal locations, including by self-transformation (transformation with recipient chromosomal DNA). We show that self-transformation produces a population containing many different merodiploid cells. Merodiploidy provides opportunities for evolution of new genetic traits via alteration of duplicated genes, unrestricted by functional selective pressure. Transient stimulation of a varied population of merodiploids by

  19. Stress-triggered signaling affecting survival or suicide of Streptococcus pneumoniae. (United States)

    Cortes, Paulo R; Piñas, Germán E; Cian, Melina B; Yandar, Nubia; Echenique, Jose


    Streptococcus pneumoniae is a major human pathogen that can survive to stress conditions, such as the acidic environment of inflammatory foci, and tolerates lethal pH through a mechanism known as the acid tolerance response. We previously described that S. pneumoniae activates acidic-stress induced lysis in response to acidified environments, favoring the release of cell wall compounds, DNA and virulence factors. Here, we demonstrate that F(0)F(1)-ATPase is involved in the response to acidic stress. Chemical inhibitors (DCCD, optochin) of this proton pump repressed the ATR induction, but caused an increased ASIL. Confirming these findings, mutants of the subunit c of this enzyme showed the same phenotypes as inhibitors. Importantly, we demonstrated that F(0)F(1)-ATPase and ATR are necessary for the intracellular survival of the pneumococcus in macrophages. Alternatively, a screening of two-component system (TCS) mutants showed that ATR and survival in pneumocytes were controlled in contrasting ways by ComDE and CiaRH, which had been involved in the ASIL mechanism. Briefly, CiaRH was essential for ATR (ComE represses activation) whereas ComE was necessary for ASIL (CiaRH protects against induction). They did not regulate F0F1-ATPase expression, but control LytA expression on the pneumococcal surface. These results suggest that both TCSs and F(0)F(1)-ATPase control a stress response and decide between a survival or a suicide mechanism by independent pathways, either in vitro or in pneumocyte cultures. This biological model contributes to the current knowledge about bacterial response under stress conditions in host tissues, where pathogens need to survive in order to establish infections. Copyright © 2014 Elsevier GmbH. All rights reserved.

  20. Streptococcus pneumoniae serotype-2 childhood meningitis in Bangladesh: a newly recognized pneumococcal infection threat.

    Directory of Open Access Journals (Sweden)

    Samir K Saha

    Full Text Available BACKGROUND: Streptococcus pneumoniae is a leading cause of meningitis in countries where pneumococcal conjugate vaccines (PCV targeting commonly occurring serotypes are not routinely used. However, effectiveness of PCV would be jeopardized by emergence of invasive pneumococcal diseases (IPD caused by serotypes which are not included in PCV. Systematic hospital based surveillance in Bangladesh was established and progressively improved to determine the pathogens causing childhood sepsis and meningitis. This also provided the foundation for determining the spectrum of serotypes causing IPD. This article reports an unprecedented upsurge of serotype 2, an uncommon pneumococcal serotype, without any known intervention. METHODS AND FINDINGS: Cases with suspected IPD had blood or cerebrospinal fluid (CSF collected from the beginning of 2001 till 2009. Pneumococcal serotypes were determined by capsular swelling of isolates or PCR of culture-negative CSF specimens. Multicenter national surveillance, expanded from 2004, identified 45,437 patients with suspected bacteremia who were blood cultured and 10,618 suspected meningitis cases who had a lumber puncture. Pneumococcus accounted for 230 culture positive cases of meningitis in children <5 years. Serotype-2 was the leading cause of pneumococcal meningitis, accounting for 20.4% (45/221; 95% CI 15%-26% of cases. Ninety eight percent (45/46 of these serotype-2 strains were isolated from meningitis cases, yielding the highest serotype-specific odds ratio for meningitis (29.6; 95% CI 3.4-256.3. The serotype-2 strains had three closely related pulsed field gel electrophoresis types. CONCLUSIONS: S. pneumoniae serotype-2 was found to possess an unusually high potential for causing meningitis and was the leading serotype-specific cause of childhood meningitis in Bangladesh over the past decade. Persisting disease occurrence or progressive spread would represent a major potential infection threat since serotype-2

  1. A complex of equine lysozyme and oleic acid with bactericidal activity against Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Emily A Clementi

    Full Text Available HAMLET and ELOA are complexes consisting of oleic acid and two homologous, yet functionally different, proteins with cytotoxic activities against mammalian cells, with HAMLET showing higher tumor cells specificity, possibly due to the difference in propensity for oleic acid binding, as HAMLET binds 5-8 oleic acid molecules per protein molecule and ELOA binds 11-48 oleic acids. HAMLET has been shown to possess bactericidal activity against a number of bacterial species, particularly those with a respiratory tropism, with Streptococcus pneumoniae displaying the greatest degree of sensitivity. We show here that ELOA also displays bactericidal activity against pneumococci, which at lower concentrations shows mechanistic similarities to HAMLET's bactericidal activity. ELOA binds to S. pneumoniae and causes perturbations of the plasma membrane, including depolarization and subsequent rupture, and activates an influx of calcium into the cells. Selective inhibition of calcium channels and sodium/calcium exchange activity significantly diminished ELOA's bactericidal activity, similar to what we have observed with HAMLET. Finally, ELOA-induced death was also accompanied by DNA fragmentation into high molecular weight fragments - an apoptosis-like morphological phenotype that is seen during HAMLET-induced death. Thus, in contrast to different mechanisms of eukaryote cell death induced by ELOA and HAMLET, these complexes are characterized by rather similar activities towards bacteria. Although the majority of these events could be mimicked using oleic acid alone, the concentrations of oleic acid required were significantly higher than those present in the ELOA complex, and for some assays, the results were not identical between oleic acid alone and the ELOA complex. This indicates that the lipid, as a common denominator in both complexes, is an important component for the complexes' bactericidal activities, while the proteins are required both to solubilize

  2. Natural genetic transformation generates a population of merodiploids in Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Calum Johnston

    Full Text Available Partial duplication of genetic material is prevalent in eukaryotes and provides potential for evolution of new traits. Prokaryotes, which are generally haploid in nature, can evolve new genes by partial chromosome duplication, known as merodiploidy. Little is known about merodiploid formation during genetic exchange processes, although merodiploids have been serendipitously observed in early studies of bacterial transformation. Natural bacterial transformation involves internalization of exogenous donor DNA and its subsequent integration into the recipient genome by homology. It contributes to the remarkable plasticity of the human pathogen Streptococcus pneumoniae through intra and interspecies genetic exchange. We report that lethal cassette transformation produced merodiploids possessing both intact and cassette-inactivated copies of the essential target gene, bordered by repeats (R corresponding to incomplete copies of IS861. We show that merodiploidy is transiently stimulated by transformation, and only requires uptake of a ~3-kb DNA fragment partly repeated in the chromosome. We propose and validate a model for merodiploid formation, providing evidence that tandem-duplication (TD formation involves unequal crossing-over resulting from alternative pairing and interchromatid integration of R. This unequal crossing-over produces a chromosome dimer, resolution of which generates a chromosome with the TD and an abortive chromosome lacking the duplicated region. We document occurrence of TDs ranging from ~100 to ~900 kb in size at various chromosomal locations, including by self-transformation (transformation with recipient chromosomal DNA. We show that self-transformation produces a population containing many different merodiploid cells. Merodiploidy provides opportunities for evolution of new genetic traits via alteration of duplicated genes, unrestricted by functional selective pressure. Transient stimulation of a varied population of

  3. Validation of an immunodiagnostic assay for detection of 13 Streptococcus pneumoniae serotype-specific polysaccharides in human urine. (United States)

    Pride, Michael W; Huijts, Susanne M; Wu, Kangjian; Souza, Victor; Passador, Sherry; Tinder, Chunyan; Song, Esther; Elfassy, Arik; McNeil, Lisa; Menton, Ronald; French, Roger; Callahan, Janice; Webber, Chris; Gruber, William C; Bonten, Marc J M; Jansen, Kathrin U


    To improve the clinical diagnosis of pneumococcal infection in bacteremic and nonbacteremic community-acquired pneumonia (CAP), a Luminex technology-based multiplex urinary antigen detection (UAD) diagnostic assay was developed and validated. The UAD assay can simultaneously detect 13 different serotypes of Streptococcus pneumoniae by capturing serotype-specific S. pneumoniae polysaccharides (PnPSs) secreted in human urine. Assay specificity is achieved by capturing the polysaccharides with serotype-specific monoclonal antibodies (MAbs) on spectrally unique microspheres. Positivity for each serotype was based on positivity cutoff values calculated from a standard curve run on each assay plate together with positive- and negative-control urine samples. The assay is highly specific, since significant signals are detected only when each PnPS was paired with its homologous MAb-coated microspheres. Validation experiments demonstrated excellent accuracy and precision. The UAD assay and corresponding positivity cutoff values were clinically validated by assessing 776 urine specimens obtained from patients with X-ray-confirmed CAP. The UAD assay demonstrated 97% sensitivity and 100% specificity using samples obtained from patients with bacteremic, blood culture-positive CAP. Importantly, the UAD assay identified Streptococcus pneumoniae (13 serotypes) in a proportion of individuals with nonbacteremic CAP, a patient population for which the pneumococcal etiology of CAP was previously difficult to assess. Therefore, the UAD assay provides a specific, noninvasive, sensitive, and reproducible tool to support vaccine efficacy as well as epidemiological evaluation of pneumococcal disease, including CAP, in adults.

  4. The cGAS/STING Pathway Detects Streptococcus pneumoniae but Appears Dispensable for Antipneumococcal Defense in Mice and Humans. (United States)

    Ruiz-Moreno, Juan Sebastian; Hamann, Lutz; Jin, Lei; Sander, Leif E; Puzianowska-Kuznicka, Monika; Cambier, John; Witzenrath, Martin; Schumann, Ralf R; Suttorp, Norbert; Opitz, Bastian


    Streptococcus pneumoniae is a frequent colonizer of the upper respiratory tract and a leading cause of bacterial pneumonia. The innate immune system senses pneumococcal cell wall components, toxin, and nucleic acids, which leads to production of inflammatory mediators to initiate and control antibacterial defense. Here, we show that the cGAS (cyclic GMP-AMP [cGAMP] synthase)-STING pathway mediates detection of pneumococcal DNA in mouse macrophages to primarily stimulate type I interferon (IFN) responses. Cells of human individuals carrying HAQ TMEM173 , which encodes a common hypomorphic variant of STING, were largely or partly defective in inducing type I IFNs and proinflammatory cytokines upon infection. Subsequent analyses, however, revealed that STING was dispensable for restricting S. pneumoniae during acute pneumonia in mice. Moreover, explorative analyses did not find differences in the allele frequency of HAQ TMEM173 in nonvaccinated pneumococcal pneumonia patients and healthy controls or an association of HAQ TMEM173 carriage with disease severity. Together, our results indicate that the cGAS/STING pathway senses S. pneumoniae but plays no major role in antipneumococcal immunity in mice and humans. Copyright © 2018 American Society for Microbiology.

  5. Susceptibilidad a antimicrobianos en aislamientos de Streptococcus pneumoniae invasor en Colombia

    Directory of Open Access Journals (Sweden)

    Aura Lucía Leal


    Full Text Available Se realizó un estudio para determinar los patrones de susceptibilidad a los antimicrobianos de los aislamientos de Streptococcus pneumoniae causante de enfermedad invasora diagnosticada en Colombia en niños menores de 5 años entre 1994 y 1996 y para establecer la distribución de los tipos capsulares de los aislamientos resistentes. Se analizaron 324 aislamientos recuperados durante la ejecución del Protocolo Nacional de Serotipificación de S. pneumoniae realizado en Santa Fe de Bogotá, Medellín y Cali, Colombia, entre julio de 1994 y marzo de 1996. Se observó que 119 de todos los aislamientos (36,7% presentaban susceptibilidad disminuida por lo menos a un antimicrobiano, que 39 (12% presentaban susceptibilidad disminuida a la penicilina y que de estos últimos aislamientos, 29 presentaban resistencia intermedia y 10 resistencia alta. Nueve aislamientos (2,8% presentaban resistencia a la ceftriaxona, 80 (24,7% a la combinación de trimetoprima y sulfametoxazol (TMS, 49 (15,1% al cloranfenicol y 31 (9,6% a la eritromicina. Se observó resistencia a dos antimicrobianos en 31 aislamientos (9,6% y multirresistencia en 22 (6,7%. Estos 22 aislamientos mostraron resistencia al TMS. Las asociaciones más frecuentes fueron penicilina, TMS y eritromicina en 5 casos; penicilina, cloranfenicol, TMS y eritromicina en 4; penicilina, ceftriaxona, cloranfenicol y TMS en 3; y penicilina, ceftriaxona, cloranfenicol, TMS y eritromicina en 3 casos. Los serotipos más frecuentes en los aislamientos resistentes a la penicilina fueron: 23F (53,8%, 14 (25,6%, 6B (7,7%, 9V (5,1%, 19F (5,1% y 34 (2,6%. Los serotipos más frecuentes en los aislamientos resistentes a antimicrobianos distintos de la penicilina fueron: 5 (37,5%, 23F (7,5%, 14 (18,8% y 6B (13,8%. Esta diferencia en la distribución de los serotipos fue estadísticamente significativa (P < 0,0001. Los resultados de este estudio indican la necesidad de mantener una vigilancia activa de los patrones de

  6. Cysteine-mediated gene expression and characterization of the CmbR regulon in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Muhammad Afzal


    Full Text Available In this study, we investigated the transcriptomic response of Streptococcus pneumoniae D39 to cysteine. Transcriptome comparison of the D39 wild-type strain grown at a restricted concentration of cysteine (0.03 mM to one grown at a high concentration of cysteine (50 mM in chemically-define medium (CDM revealed elevated expression of various genes/operons, i.e. spd-0150, metQ, spd-0431, metEF, gshT, spd-0618, fhs, tcyB, metB-csd, metA, spd-1898, yvdE, and cysK, likely to be involved in the transport and utilization of cysteine and/or methionine. Microarray-based data were further confirmed by quantitative RT-PCR. Promoter lacZ-fusion studies and quantitative RT-PCR data showed that the transcriptional regulator CmbR acts as a transcriptional repressor of spd-0150, metEF, gshT, spd-0618, tcyB, metA, and yvdE, putatively involved in cysteine uptake and utilization. The operator site of CmbR in the promoter regions of CmbR-regulated genes is predicted and confirmed by mutating or deleting CmbR operator sites from the promoter regions of these genes.

  7. A multi-scale computational study on the mechanism of Streptococcus pneumoniae Nicotinamidase (SpNic). (United States)

    Ion, Bogdan F; Kazim, Erum; Gauld, James W


    Nicotinamidase (Nic) is a key zinc-dependent enzyme in NAD metabolism that catalyzes the hydrolysis of nicotinamide to give nicotinic acid. A multi-scale computational approach has been used to investigate the catalytic mechanism, substrate binding and roles of active site residues of Nic from Streptococcus pneumoniae (SpNic). In particular, density functional theory (DFT), molecular dynamics (MD) and ONIOM quantum mechanics/molecular mechanics (QM/MM) methods have been employed. The overall mechanism occurs in two stages: (i) formation of a thioester enzyme-intermediate (IC2) and (ii) hydrolysis of the thioester bond to give the products. The polar protein environment has a significant effect in stabilizing reaction intermediates and in particular transition states. As a result, both stages effectively occur in one step with Stage 1, formation of IC2, being rate limiting barrier with a cost of 53.5 kJ·mol-1 with respect to the reactant complex, RC. The effects of dispersion interactions on the overall mechanism were also considered but were generally calculated to have less significant effects with the overall mechanism being unchanged. In addition, the active site lysyl (Lys103) is concluded to likely play a role in stabilizing the thiolate of Cys136 during the reaction.

  8. Penicillin-Resistant trend of Streptococcus pneumoniae in Asia: A systematic review. (United States)

    Mamishi, Setareh; Moradkhani, Sepideh; Mahmoudi, Shima; Hosseinpour-Sadeghi, Reihaneh; Pourakbari, Babak


    The high prevalence of resistance to penicillin by Streptococcus pneumoniaeis considered as a great concern, particularly in Asian countries. The aim of this study was to investigate the changing trend of penicillin-resistant S. pneumoniae (PRSP) in Asia over a 20 years period. A review of the literature was conducted using the PubMed database, Google Scholar, Scopus, two Persian scientific search engines "Scientific Information Database" (, and "Mag Iran" ( through 1993 to 2013. Our study provides a unique chance to investigate the changing trend in PSSP in Asia over a 20 years period. Susceptibility rates among different centers in each country varied widely. In Malaysia, the PSSP rate decreased from 97.2% in 1995-1996 to 69% in 2000. In Singapore, PSSP levels decreased from 72.6% in 1997 to 30.5% in 2007-2008. In Iran, PSSP ranged from 0% to 100%. In Taiwan, the rate of PSSP was 60.3% in 1995 and countries such as Vietnam, Singapore, Philippines, Pakistan, Nepal, Kuwait, Korea and Indonesia.

  9. Streptococcus pneumonia YlxR at 1.35 A shows a putative new fold. (United States)

    Osipiuk, J; Górnicki, P; Maj, L; Dementieva, I; Laskowski, R; Joachimiak, A


    The structure of the YlxR protein of unknown function from Streptococcus pneumonia was determined to 1.35 A. YlxR is expressed from the nusA/infB operon in bacteria and belongs to a small protein family (COG2740) that shares a conserved sequence motif GRGA(Y/W). The family shows no significant amino-acid sequence similarity with other proteins. Three-wavelength diffraction MAD data were collected to 1.7 A from orthorhombic crystals using synchrotron radiation and the structure was determined using a semi-automated approach. The YlxR structure resembles a two-layer alpha/beta sandwich with the overall shape of a cylinder and shows no structural homology to proteins of known structure. Structural analysis revealed that the YlxR structure represents a new protein fold that belongs to the alpha-beta plait superfamily. The distribution of the electrostatic surface potential shows a large positively charged patch on one side of the protein, a feature often found in nucleic acid-binding proteins. Three sulfate ions bind to this positively charged surface. Analysis of potential binding sites uncovered several substantial clefts, with the largest spanning 3/4 of the protein. A similar distribution of binding sites and a large sharply bent cleft are observed in RNA-binding proteins that are unrelated in sequence and structure. It is proposed that YlxR is an RNA-binding protein.

  10. Transport of Streptococcus pneumoniae capsular polysaccharide in MHC Class II tubules.

    Directory of Open Access Journals (Sweden)

    Tom Li Stephen


    Full Text Available Bacterial capsular polysaccharides are virulence factors and are considered T cell-independent antigens. However, the capsular polysaccharide Sp1 from Streptococcus pneumoniae serotype 1 has been shown to activate CD4(+ T cells in a major histocompatibility complex (MHC class II-dependent manner. The mechanism of carbohydrate presentation to CD4(+ T cells is unknown. We show in live murine dendritic cells (DCs that Sp1 translocates from lysosomal compartments to the plasma membrane in MHCII-positive tubules. Sp1 cell surface presentation results in reduction of self-peptide presentation without alteration of the MHCII self peptide repertoire. In DM-deficient mice, retrograde transport of Sp1/MHCII complexes resulting in T cell-dependent immune responses to the polysaccharide in vitro and in vivo is significantly reduced. The results demonstrate the capacity of a bacterial capsular polysaccharide antigen to use DC tubules as a vehicle for its transport as an MHCII/saccharide complex to the cell surface for the induction of T cell activation. Furthermore, retrograde transport requires the functional role of DM in self peptide-carbohydrate exchange. These observations open new opportunities for the design of vaccines against microbial encapsulated pathogens.

  11. A Multi-Scale Computational Study on the Mechanism of Streptococcus pneumoniae Nicotinamidase (SpNic

    Directory of Open Access Journals (Sweden)

    Bogdan F. Ion


    Full Text Available Nicotinamidase (Nic is a key zinc-dependent enzyme in NAD metabolism that catalyzes the hydrolysis of nicotinamide to give nicotinic acid. A multi-scale computational approach has been used to investigate the catalytic mechanism, substrate binding and roles of active site residues of Nic from Streptococcus pneumoniae (SpNic. In particular, density functional theory (DFT, molecular dynamics (MD and ONIOM quantum mechanics/molecular mechanics (QM/MM methods have been employed. The overall mechanism occurs in two stages: (i formation of a thioester enzyme-intermediate (IC2 and (ii hydrolysis of the thioester bond to give the products. The polar protein environment has a significant effect in stabilizing reaction intermediates and in particular transition states. As a result, both stages effectively occur in one step with Stage 1, formation of IC2, being rate limiting barrier with a cost of 53.5 kJ•mol−1 with respect to the reactant complex, RC. The effects of dispersion interactions on the overall mechanism were also considered but were generally calculated to have less significant effects with the overall mechanism being unchanged. In addition, the active site lysyl (Lys103 is concluded to likely play a role in stabilizing the thiolate of Cys136 during the reaction.

  12. Autolytic Activity and Plasma Binding Study of Aap, a Novel Minor Autolysin of Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Ramina Mahboobi


    Full Text Available Pneumococcal autolysins are enzymes involved in cell wall turnover and cellular division physiologically. They have been found to be involved in the pneumococcus pathogenesis. The aim of this study was to identify the autolytic activity of Spr1754 as a novel protein of Streptococcus pneumoniae. Moreover, the binding of the recombinant protein to plasma proteins was also determined. The spr1754 gene was amplified by PCR and cloned into the pET21a(+ prokaryotic expression vector. The constructed pET21a(+/spr1754 recombinant plasmid was transformed into E. coli Origami (DE3 and induced using IPTG. The recombinant protein of Spr1754 was purified by Ni-NTA affinity chromatography and confirmed by SDS-PAGE and Western blot analysis using anti-His tag monoclonal antibody. Autolytic activity and the ability of the recombinant protein in binding to plasma proteins were performed using zymogram analysis and western blot, respectively. The spr1754 with expected size was cloned and overexpressed in Escherichia coli Origami (DE3, successfully. After purification of the Spr1754 recombinant protein, the autolytic activity was observed by zymography. Of the four plasma proteins used in this study, binding of lactoferrin to Spr1754 recombinant protein was shown. The Spr1754 recombinant protein has a bifunctional activity, i.e., as being autolysin and lactoferrin binding and designated as Aap (autolytic/ adhesion/ pneumococcus. Nevertheless, characterization of the Aap needs to be followed using gene inactivation and cell wall localization.

  13. Coordinated Bacteriocin Expression and Competence in Streptococcus pneumoniae Contributes to Genetic Adaptation through Neighbor Predation.

    Directory of Open Access Journals (Sweden)

    Wei-Yun Wholey


    Full Text Available Streptococcus pneumoniae (pneumococcus has remained a persistent cause of invasive and mucosal disease in humans despite the widespread use of antibiotics and vaccines. The resilience of this organism is due to its capacity for adaptation through the uptake and incorporation of new genetic material from the surrounding microbial community. DNA uptake and recombination is controlled by a tightly regulated quorum sensing system that is triggered by the extracellular accumulation of competence stimulating peptide (CSP. In this study, we demonstrate that CSP can stimulate the production of a diverse array of blp bacteriocins. This cross stimulation occurs through increased production and secretion of the bacteriocin pheromone, BlpC, and requires a functional competence regulatory system. We show that a highly conserved motif in the promoter of the operon encoding BlpC and its transporter mediates the upregulation by CSP. The accumulation of BlpC following CSP stimulation results in augmented activation of the entire blp locus. Using biofilm-grown organisms as a model for competition and genetic exchange on the mucosal surface, we demonstrate that DNA exchange is enhanced by bacteriocin secretion suggesting that co-stimulation of bacteriocins with competence provides an adaptive advantage. The blp and com regulatory pathways are believed to have diverged and specialized in a remote ancestor of pneumococcus. Despite this, the two systems have maintained a regulatory connection that promotes competition and adaptation by targeting for lysis a wide array of potential competitors while simultaneously providing the means for incorporation of their DNA.

  14. Live Attenuated Influenza Vaccine Enhances Colonization of Streptococcus pneumoniae and Staphylococcus aureus in Mice (United States)

    Mina, Michael J.; McCullers, Jonathan A.; Klugman, Keith P.


    ABSTRACT Community interactions at mucosal surfaces between viruses, like influenza virus, and respiratory bacterial pathogens are important contributors toward pathogenesis of bacterial disease. What has not been considered is the natural extension of these interactions to live attenuated immunizations, and in particular, live attenuated influenza vaccines (LAIVs). Using a mouse-adapted LAIV against influenza A (H3N2) virus carrying the same mutations as the human FluMist vaccine, we find that LAIV vaccination reverses normal bacterial clearance from the nasopharynx and significantly increases bacterial carriage densities of the clinically important bacterial pathogens Streptococcus pneumoniae (serotypes 19F and 7F) and Staphylococcus aureus (strains Newman and Wright) within the upper respiratory tract of mice. Vaccination with LAIV also resulted in 2- to 5-fold increases in mean durations of bacterial carriage. Furthermore, we show that the increases in carriage density and duration were nearly identical in all aspects to changes in bacterial colonizing dynamics following infection with wild-type (WT) influenza virus. Importantly, LAIV, unlike WT influenza viruses, had no effect on severe bacterial disease or mortality within the lower respiratory tract. Our findings are, to the best of our knowledge, the first to demonstrate that vaccination with a live attenuated viral vaccine can directly modulate colonizing dynamics of important and unrelated human bacterial pathogens, and does so in a manner highly analogous to that seen following wild-type virus infection. PMID:24549845

  15. Whole genome analysis of linezolid resistance in Streptococcus pneumoniae reveals resistance and compensatory mutations

    Directory of Open Access Journals (Sweden)

    Légaré Danielle


    Full Text Available Abstract Background Several mutations were present in the genome of Streptococcus pneumoniae linezolid-resistant strains but the role of several of these mutations had not been experimentally tested. To analyze the role of these mutations, we reconstituted resistance by serial whole genome transformation of a novel resistant isolate into two strains with sensitive background. We sequenced the parent mutant and two independent transformants exhibiting similar minimum inhibitory concentration to linezolid. Results Comparative genomic analyses revealed that transformants acquired G2576T transversions in every gene copy of 23S rRNA and that the number of altered copies correlated with the level of linezolid resistance and cross-resistance to florfenicol and chloramphenicol. One of the transformants also acquired a mutation present in the parent mutant leading to the overexpression of an ABC transporter (spr1021. The acquisition of these mutations conferred a fitness cost however, which was further enhanced by the acquisition of a mutation in a RNA methyltransferase implicated in resistance. Interestingly, the fitness of the transformants could be restored in part by the acquisition of altered copies of the L3 and L16 ribosomal proteins and by mutations leading to the overexpression of the spr1887 ABC transporter that were present in the original linezolid-resistant mutant. Conclusions Our results demonstrate the usefulness of whole genome approaches at detecting major determinants of resistance as well as compensatory mutations that alleviate the fitness cost associated with resistance.

  16. Identification of PblB mediating galactose-specific adhesion in a successful Streptococcus pneumoniae clone. (United States)

    Hsieh, Yu-Chia; Lin, Tzu-Lung; Lin, Che-Ming; Wang, Jin-Town


    The pneumococcal genome is variable and there are minimal data on the influence of the accessory genome on phenotype. Pneumococcal serotype 14 sequence type (ST) 46 had been the most prevalent clone causing pneumonia in children in Taiwan. A microarray was constructed using the genomic DNA of a clinical strain (NTUH-P15) of serotype 14 ST46. Using DNA hybridization, genomic variations in NTUH-P15 were compared to those of 3 control strains. Microarray analysis identified 7 genomic regions that had significant increases in hybridization signals in the NTUH-P15 strain compared to control strains. One of these regions encoded PblB, a phage-encoded virulence factor implicated (in Streptococcus mitis) in infective endocarditis. The isogenic pblB mutant decreased adherence to A549 human lung epithelial cell compared to wild-type NTUH-P15 strain (P = 0.01). Complementation with pblB restored the adherence. PblB is predicted to contain a galactose-binding domain-like region. Preincubation of NTUH-P15 with D-galactose resulted in decreases of adherence to A549 cell in a dose-dependent manner. Challenge of mice with NTUH-P15, isogenic pblB mutant and pblB complementation strains determined that PblB was required for bacterial persistence in the nasopharynx and lung. PblB, as an adhesin mediating the galactose-specific adhesion activity of pneumococci, promote pneumococcal clonal success.

  17. Impact of Sub-Inhibitory Concentrations of Amoxicillin on Streptococcus suis Capsule Gene Expression and Inflammatory Potential

    Directory of Open Access Journals (Sweden)

    Bruno Haas


    Full Text Available Streptococcus suis is an important swine pathogen and emerging zoonotic agent worldwide causing meningitis, endocarditis, arthritis and septicemia. Among the 29 serotypes identified to date, serotype 2 is mostly isolated from diseased pigs. Although several virulence mechanisms have been characterized in S. suis, the pathogenesis of S. suis infections remains only partially understood. This study focuses on the response of S. suis P1/7 to sub-inhibitory concentrations of amoxicillin. First, capsule expression was monitored by qRT-PCR when S. suis was cultivated in the presence of amoxicillin. Then, the pro-inflammatory potential of S. suis P1/7 culture supernatants or whole cells conditioned with amoxicillin was evaluated by monitoring the activation of the NF-κB pathway in monocytes and quantifying pro-inflammatory cytokines secreted by macrophages. It was found that amoxicillin decreased capsule expression in S. suis. Moreover, conditioning the bacterium with sub-inhibitory concentrations of amoxicillin caused an increased activation of the NF-κB pathway in monocytes following exposure to bacterial culture supernatants and to a lesser extent to whole bacterial cells. This was associated with an increased secretion of pro-inflammatory cytokines (CXCL8, IL-6, IL-1β by macrophages. This study identified a new mechanism by which S. suis may increase its inflammatory potential in the presence of sub-inhibitory concentrations of amoxicillin, a cell wall-active antibiotic, thus challenging its use for preventive treatments or as growth factor.

  18. Prevalência de sorotipos e resistência antimicrobiana de cepas invasivas do Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Mantese Orlando C.


    Full Text Available OBJETIVO: Avaliar o perfil de sorotipos e a susceptibilidade aos antimicrobianos de cepas de Streptococcus pneumoniae obtidas em espécimes clínicos de pacientes com doença invasiva, bem como suas implicações na formulação de vacinas pneumocócicas. MÉTODOS: Cepas de pneumococo isoladas no Laboratório de Análises Clínicas do Hospital de Clínicas da Universidade Federal de Uberlândia a partir de amostras clínicas de pacientes com doença invasiva foram identificadas e enviadas ao Instituto Adolfo Lutz em São Paulo para confirmação da identificação, sorotipagem e determinação da susceptibilidade aos antimicrobianos. RESULTADOS: De abril de 1999 a março de 2003, foram isoladas 148 cepas invasivas de pneumococo, sendo 84 (56,7% provenientes de pacientes do sexo masculino. A idade variou de um dia a 88,83 anos, com média de 21,33+25,82 anos e mediana de 4,42 anos. Os diagnósticos clínicos mais comuns foram pneumonia (91 casos; 61,4%, meningite (32 casos; 21,6% e bacteremia sem foco evidente (15 casos; 10,1%. As principais fontes de recuperação foram sangue (76 amostras; 51,3%, líquido pleural (39; 26,3% e liquor (30; 20,2%. No total, foram identificados 23 diferentes sorotipos entre 143 amostras testadas, sendo os mais comuns os seguintes: 14, 3, 1, 5, 6A, 6B e 18C. Dentre 30 (20,2% cepas oxacilina-resistentes, 23 (15,5% confirmaram a resistência à penicilina (12,8% com nível intermediário e 2,7%, com nível pleno, que esteve restrita aos sorotipos 14, 23F, 19A e 6B, predominando em indivíduos com até dois anos de idade (p = 0,0008. Foi detectada susceptibilidade diminuída ao cotrimoxazol (63,4%, à eritromicina (8,3%, à clindamicina (8,7% e à ofloxacina (0,8%. A resistência à cefotaxima foi detectada em três das 30 cepas testadas (2% das 148, todas elas com resistência confirmada à penicilina. Não foi observada resistência a cloranfenicol, rifampicina ou vancomicina. CONCLUSÕES: A resistência

  19. Development of new synthetic oligosaccharide vaccines : the immunogenicity of oligosaccharide-CRM197 neoconjugates and oligosaccharide/peptide hybrid gold nanoparticles based on the capsular polysaccharide structure of Streptococcus pneumoniae type 14

    NARCIS (Netherlands)

    Safari, D.


    Streptococcus pneumoniae is a leading cause of bacterial pneumonia, meningitis, and sepsis in children worldwide. Nowadays, the antibiotic resistance of S. pneumoniae bacteria has increased worldwide. This makes treatment of S. pneumoniae infections more difficult and stresses the importance of the

  20. Circulation of Streptococcus pneumoniae clone Colombia5 ST289 in nine Latin American countries Circulación de Streptococcus pneumoniae clon Colombia5 ST289 en nueve países de América Latina

    Directory of Open Access Journals (Sweden)

    Carolina Firacative


    Full Text Available OBJECTIVE: To determine genetic relatedness of clone Colombia5 ST289 with invasive Streptococcus pneumoniae serotype 5 isolates recovered in nine Latin American countries. METHODS: Forty-four invasive S. pneumoniae serotype 5 isolates recovered from children under 5 years of age in Bolivia, Chile, Dominican Republic, Ecuador, Nicaragua, Panama, Paraguay, Peru, and Venezuela were studied. Pulsed-field gel electrophoresis patterns of DNA treated with SmaI restriction enzyme were classified using Tenover's criteria and analyzed with the Fingerprinting II program to determine their genetic relatedness with the Colombian clone. RESULTS: All isolates had a genetic similarity of 78.5% or more with the Colombian clone. Thirteen electrophoretic subtypes derived of pattern A were identified, and five of them (A5, A6, A8, A13, A27 comprised 61.4% of the isolates. CONCLUSIONS: Clone Colombia5 ST289 is disseminated in Latin America. This is important because S. pneumoniae serotype 5 frequently causes invasive disease in the region and is associated with trimethoprim-sulfamethoxazole resistance.OBJETIVO: Determinar la relación genética del clon Colombia5 ST289 con los aislamientos invasores de Streptococcus pneumoniae serotipo 5 provenientes de nueve países latinoamericanos. MÉTODOS: Se estudiaron 45 aislamientos invasores de Streptococcus pneumoniae serotipo 5 procedentes de niños menores de 5 años de Bolivia, Chile, Ecuador, Nicaragua, Panamá, Paraguay, Perú, República Dominicana y Venezuela. Los patrones en electroforesis en gel de campo pulsante del ADN tratado con la enzima de restricción SmaI se clasificaron mediante el criterio de Tenover y se analizaron con el programa Fingerprinting II para determinar su relación genética con el clon colombiano. RESULTADOS: Todos los aislamientos tuvieron una similitud genética de 78,5% o mayor con el clon colombiano. Se identificaron 13 subtipos electroforéticos derivados del patrón A y cinco de ellos

  1. Streptococcus pneumoniae aislados durante 2002-2006: serotipos y resistencia antibiótica. Correlación con las vacunas existentes

    Directory of Open Access Journals (Sweden)

    José María Guevara-Duncan


    Full Text Available Objetivos: Identificar los serotipos de S. pneumoniae aislados, correlacionándolos con los incluidos en las vacunas existentes y su resistencia antimicrobiana. Diseño: Estudio descriptivo, observacional y longitudinal. Lugar: Instituto de Medicina Tropical Daniel A. Carrión, Facultad de Medicina, UNMSM. Material biológico: Cepas de Streptococcus pneumoniae. Intervenciones: Cuarenta Streptococcus pneumoniae de nuestro cepario, aislados entre el 2002 y 2006, fueron serotipificados en el Instituto de Salud Carlos III en Madrid -España; 15 fueron invasivos, 11 aislados de infecciones localizadas, 6 de portadores y 8 eran multiresistentes. Principales medidas de resultados: Protección de las vacunas existentes en nuestro medio a las infecciones causadas por Streptococcus pneumoniae. Resultados: Hubo 14 serotipos diferentes y los serogrupos más identificados fueron 23, 19 y 6. El 28,6% estaba contenido en la vacuna 7-valente, 42,9% en la 9-valente, 50% en la 11-valente y el 71,4% en la 23-valente; 57,5% fue resistente a la penicilina y 30% a eritromicina. El grupo de Streptococcus invasivo resultó más sensible a los antibióticos que los otros grupos. Los serotipos asociados a multirresistencia fueron 19F y 23F. Conclusiones: Ninguna de las vacunas protege a todas las infecciones causadas por Streptococcus pneumoniae, en nuestro medio.

  2. Interplay Between Capsule Expression and Uracil Metabolism in Streptococcus pneumoniae D39

    DEFF Research Database (Denmark)

    Carvalho, Sandra M.; Kloosterman, Tomas G.; Manzoor, Irfan


    . Importantly, Pcps expression is further decreased by mutating the first gene of the de novo synthesis of pyrimidines, carA. In contrast, the absence of uracil from the culture medium showed no effect on the spontaneous mutant strain. Co-cultivation of the wild-type and the mutant strain indicated...

  3. Nonencapsulated Streptococcus pneumoniae causes otitis media during single-species infection and during polymicrobial infection with nontypeable Haemophilus influenzae. (United States)

    Murrah, Kyle A; Pang, Bing; Richardson, Stephen; Perez, Antonia; Reimche, Jennifer; King, Lauren; Wren, John; Swords, W Edward


    Streptococcus pneumoniae strains lacking capsular polysaccharide have been increasingly reported in carriage and disease contexts. Since most cases of otitis media involve more than one bacterial species, we aimed to determine the capacity of a nonencapsulated S. pneumoniae clinical isolate to induce disease in the context of a single-species infection and as a polymicrobial infection with nontypeable Haemophilus influenzae. Using the chinchilla model of otitis media, we found that nonencapsulated S. pneumoniae colonizes the nasopharynx following intranasal inoculation, but does not readily ascend into the middle ear. However, when we inoculated nonencapsulated S. pneumoniae directly into the middle ear, the bacteria persisted for two weeks post-inoculation and induced symptoms consistent with chronic otitis media. During coinfection with nontypeable H. influenzae, both species persisted for one week and induced polymicrobial otitis media. We also observed that nontypeable H. influenzae conferred passive protection from killing by amoxicillin upon S. pneumoniae from within polymicrobial biofilms in vitro. Therefore, based on these results, we conclude that nonencapsulated pneumococci are a potential causative agent of chronic/recurrent otitis media, and can also cause mutualistic infection with other opportunists, which could complicate treatment outcomes. © FEMS 2014. All rights reserved. For permissions, please e-mail:

  4. Unusual Manifestation of Severe Conjugated Hyperbilirubinemia in an Infant with Streptococcus pneumoniae-associated Hemolytic Uremic Syndrome

    Directory of Open Access Journals (Sweden)

    Jung-Pin Chen


    Full Text Available Streptococcus pneumoniae is an uncommon etiologic organism in children with hemolytic uremic syndrome (HUS. Historically, severe S. pneumoniae-associated HUS usually has a poor clinical outcome. The clinical manifestations of marked jaundice and hepatic dysfunction in this form of HUS are extremely rare. We report a 10-month-old female infant with S. pneumoniae-associated HUS who had the unusual manifestation of severely elevated conjugated bilirubin and hepatic transaminases. Screening for viral hepatitis was negative, and evidence of biliary obstruction and hepatotoxic drug exposure was also absent. The patient was treated with antihypertensive agents for 2.5 months and required peritoneal dialysis for a period of 26 days. Hepatic function returned to normal on the 8th day of hospitalization. Renal function was mildly impaired at 1-year follow-up. Our report suggests that severe conjugated hyperbilirubinemia is a rare manifestation of S. pneumoniae-associated HUS in children. It is important for pediatricians that pneumococcal infection with severe hematologic and renal disorders should be investigated for evidence of S. pneumoniae-associated HUS. [J Formos Med Assoc 2007;106(2 Suppl:S17-S22

  5. Frequency of Streptococcus pneumonia and Haemophilus influenza in acute exacerbation of chronic obstructive airway disease and their sensitivity to levofloxacin

    International Nuclear Information System (INIS)

    Furqan, S.; Paracha, S.A.U.


    Objective: To determine the frequency of Streptococcus pneumoniae and Haemophilus influenzae in acute exacerbation of chronic obstructive pulmonary disease and their sensitivity to levofloxacin. Methods: The cross-sectional study was conducted at the Department of Medicine, AbbasiShaheed Hospital, Karachi, between July 2009 and January 2010. Patients already diagnosed with chronic obstructive pulmonary disease and admitted with symptoms of acute exacerbation were included in the study and their sputum samples were sent for microbiological evaluation. SPSS 16 was used for statistical analysis. Results: Of the total 105 patients in the study, 90 (85.17%) were males. Overall mean age at presentation was 62+-10.2 years. S. pneumoniae was isolated from sputum culture of 33 (31.4%) patients, while 13 (12.4%) patients showed growth of H. influenzae. Out of the 33 sputum specimens of S. pneumoniae, 32 (97.0%) were sensitive to levofloxacin, while 1 (3.0%) was resistant. All the 13 isolates of H. influenzae were sensitive to levofloxacin. Conclusion: S. pneumoniae and H. influenzae are still the most prevalent organisms isolated in acute exacerbation of chronic obstructive pulmonary disease in our population. Levofloxacin is still considered a highly sensitive antibiotic against these common micro-organisms in our population, but S. pneumoniae has started developing resistance against levofloxacin. Therefore, intermittent surveillance regarding development of resistance pattern of common micro-organisms against commonly prescribed antibiotics is required. (author)

  6. Standardisation and evaluation of a quantitative multiplex real-time PCR assay for the rapid identification of Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Feroze Ahmed Ganaie


    Full Text Available Rapid diagnosis of Streptococcus pneumoniae can play a significant role in decreasing morbidity and mortality of infection. The accurate diagnosis of pneumococcal disease is hampered by the difficulties in growing the isolates from clinical specimens and also by misidentification. Molecular methods have gained popularity as they offer improvement in the detection of causative pathogens with speed and ease. The present study aims at validating and standardising the use of 4 oligonucleotide primer-probe sets (pneumolysin [ply], autolysin [lytA], pneumococcal surface adhesion A [psaA] and Spn9802 [DNA fragment] in a single-reaction mixture for the detection and discrimination of S. pneumoniae. Here, we validate a quantitative multiplex real-time PCR (qmPCR assay with a panel consisting of 43 S. pneumoniae and 29 non-pneumococcal isolates, 20 culture positive, 26 culture negative and 30 spiked serum samples. A standard curve was obtained using S. pneumoniae ATCC 49619 strain and glyceraldehyde 3-phosphate dehydrogenase (GAPDH gene was used as an endogenous internal control. The experiment showed high sensitivity with lower limit of detection equivalent to 4 genome copies/µl. The efficiency of the reaction was 100% for ply, lytA, Spn9802 and 97% for psaA. The test showed sensitivity and specificity of 100% with culture isolates and serum specimens. This study demonstrates that qmPCR analysis of sera using 4 oligonucleotide primers appears to be an appropriate method for the genotypic identification of S. pneumoniae infection.

  7. TLR-mediated inflammatory responses to Streptococcus pneumoniae are highly dependent on surface expression of bacterial lipoproteins. (United States)

    Tomlinson, Gillian; Chimalapati, Suneeta; Pollard, Tracey; Lapp, Thabo; Cohen, Jonathan; Camberlein, Emilie; Stafford, Sian; Periselneris, Jimstan; Aldridge, Christine; Vollmer, Waldemar; Picard, Capucine; Casanova, Jean-Laurent; Noursadeghi, Mahdad; Brown, Jeremy


    Streptococcus pneumoniae infections induce inflammatory responses that contribute toward both disease pathogenesis and immunity, but the host-pathogen interactions that mediate these effects are poorly defined. We used the surface lipoprotein-deficient ∆lgt pneumococcal mutant strain to test the hypothesis that lipoproteins are key determinants of TLR-mediated immune responses to S. pneumoniae. We show using reporter assays that TLR2 signaling is dependent on pneumococcal lipoproteins, and that macrophage NF-κB activation and TNF-α release were reduced in response to the ∆lgt strain. Differences in TNF-α responses between Δlgt and wild-type bacteria were abrogated for macrophages from TLR2- but not TLR4-deficient mice. Transcriptional profiling of human macrophages revealed attenuated TLR2-associated responses to ∆lgt S. pneumoniae, comprising many NF-κB-regulated proinflammatory cytokine and chemokine genes. Importantly, non-TLR2-associated responses were preserved. Experiments using leukocytes from IL-1R-associated kinase-4-deficient patients and a mouse pneumonia model confirmed that proinflammatory responses were lipoprotein dependent. Our data suggest that leukocyte responses to bacterial lipoproteins are required for TLR2- and IL-1R-associated kinase-4-mediated inflammatory responses to S. pneumoniae. Copyright © 2014 The Authors.

  8. The Transcriptome of Streptococcus pneumoniae Induced by Local and Global Changes in Supercoiling

    Directory of Open Access Journals (Sweden)

    Adela G. de la Campa


    Full Text Available The bacterial chromosome is compacted in a manner optimal for DNA transactions to occur. The degree of compaction results from the level of DNA-supercoiling and the presence of nucleoid-binding proteins. DNA-supercoiling is homeostatically maintained by the opposing activities of relaxing DNA topoisomerases and negative supercoil-inducing DNA gyrase. DNA-supercoiling acts as a general cis regulator of transcription, which can be superimposed upon other types of more specific trans regulatory mechanism. Transcriptomic studies on the human pathogen Streptococcus pneumoniae, which has a relatively small genome (∼2 Mb and few nucleoid-binding proteins, have been performed under conditions of local and global changes in supercoiling. The response to local changes induced by fluoroquinolone antibiotics, which target DNA gyrase subunit A and/or topoisomerase IV, involves an increase in oxygen radicals which reduces cell viability, while the induction of global supercoiling changes by novobiocin (a DNA gyrase subunit B inhibitor, or by seconeolitsine (a topoisomerase I inhibitor, has revealed the existence of topological domains that specifically respond to such changes. The control of DNA-supercoiling in S. pneumoniae occurs mainly via the regulation of topoisomerase gene transcription: relaxation triggers the up-regulation of gyrase and the down-regulation of topoisomerases I and IV, while hypernegative supercoiling down-regulates the expression of topoisomerase I. Relaxation affects 13% of the genome, with the majority of the genes affected located in 15 domains. Hypernegative supercoiling affects 10% of the genome, with one quarter of the genes affected located in 12 domains. However, all the above domains overlap, suggesting that the chromosome is organized into topological domains with fixed locations. Based on its response to relaxation, the pneumococcal chromosome can be said to be organized into five types of domain: up-regulated, down

  9. Brain-derived neurotrophic factor reduces inflammation and hippocampal apoptosis in experimental Streptococcus pneumoniae meningitis. (United States)

    Xu, Danfeng; Lian, Di; Wu, Jing; Liu, Ying; Zhu, Mingjie; Sun, Jiaming; He, Dake; Li, Ling


    Streptococcus pneumoniae meningitis is a serious inflammatory disease of the central nervous system (CNS) and is associated with high morbidity and mortality rates. The inflammatory processes initiated by recognition of bacterial components contribute to apoptosis in the hippocampal dentate gyrus. Brain-derived neurotrophic factor (BDNF) has long been recommended for the treatment of CNS diseases due to its powerful neuro-survival properties, as well as its recently reported anti-inflammatory and anti-apoptotic effects in vitro and in vivo. In this study, we investigated the effects of BDNF-related signaling on the inflammatory response and hippocampal apoptosis in experimental models of pneumococcal meningitis. Pretreatment with exogenous BDNF or the tropomyosin-receptor kinase B (TrkB) inhibitor k252a was performed to assess the activation or inhibition of the BDNF/TrkB-signaling axis prior to intracisternal infection with live S. pneumoniae. At 24 h post-infection, rats were assessed for clinical severity and sacrificed to harvest the brains. Paraffin-embedded brain sections underwent hematoxylin and eosin staining to evaluate pathological severity, and cytokine and chemokine levels in the hippocampus and cortex were evaluated by enzyme-linked immunosorbent assay. Additionally, apoptotic neurons were detected in the hippocampal dentate gyrus by terminal deoxynucleotidyl transferase dUTP-nick-end labeling, key molecules associated with the related signaling pathway were analyzed by real-time polymerase chain reaction and western blot, and the DNA-binding activity of nuclear factor kappa B (NF-κB) was measured by electrophoretic mobility shift assay. Rats administered BDNF exhibited reduced clinical impairment, pathological severity, and hippocampal apoptosis. Furthermore, BDNF pretreatment suppressed the expression of inflammatory factors, including tumor necrosis factor α, interleukin (IL)-1β, and IL-6, and increased the expression of the anti

  10. [Antibiotic resistance analysis of Streptococcus pneumoniae isolates from the hospitalized children in Shanxi Children's Hospital from 2012 to 2014]. (United States)

    Ge, L L; Han, Z Y; Liu, A H; Zhu, L; Meng, J H


    Objective: To investigate the antibiotic resistance status of Streptococcus pneumoniae isolates from hospitalized children in Shanxi Children's Hospital. Method: E-test and Kirby-Bauer methods were applied to determine drug sensitivity of the isolates collected from the body fluid specimens of hospitalized children in Shanxi Children's Hospital from January 2012 to December 2014. The antimicrobial sensitivity and minimum inhibitory concentration (MIC) of Streptococcus pneumoniae to the conventional antibiotics were analyzed, in order to compare the annual trends of non-invasive isolates, while the differentiation of sensitivity from specimens. The comparison of rates was performed by Chi-squared test and Fisher's exact test. Result: A total of 671 isolates of streptococcus pneumoniae were obtained, which could be divided as non-invasive isolates(607), invasive isolates from non-cerebrospinal fluid(non-CSF)(40) and invasive isolates from cerebrospinal fluid(CSF)(24). The antimicrobial sensitivity(isolates(%)) of the 671 isolates were respectively vancomycin 671(100.0%), linezolid 671(100.0%), levofloxacin 665(99.1%), penicillin 595(88.7%), ceftriaxone 516(76.9%), cefotaxime 512(76.3%), sulfamethoxazole-trimethoprin(SMZ-TMP) 103(15.4%), clindamycin 28(4.2%), tetracycline 26(3.9%), erythromycin 12(1.8%). From 2012 to 2014, the susceptibility rates of non-invasive isolates to penicillin every year were 95.0%(96/101), 97.3%(110/113), 87.3%(343/393), respectively, and there was significant difference among the three years(χ(2)=13.266, P penicillin were 0.064, 2.000, 6.000 in 2012, which grew up to 1.000, 3.000, 16.000 in 2014. There was no significant difference in the susceptibility rate of non-invasive isolates to ceftriaxone and cefotaxime during these three years, (χ(2)=1.172, 1.198, both P >0.05). On the other hand, the values of MIC(50, )MIC(90) and the maximum value of MIC(mg/L) of ceftriaxone and cefotaxime both increased from 0.500, 2.000, 8.000 in 2012 to 0

  11. Co-Transcriptomes of Initial Interactions In Vitro between Streptococcus Pneumoniae and Human Pleural Mesothelial Cells.

    Directory of Open Access Journals (Sweden)

    Claire J Heath

    Full Text Available Streptococcus pneumoniae (Spn is a major causative organism of empyema, an inflammatory condition occurring in the pleural sac. In this study, we used human and Spn cDNA microarrays to characterize the transcriptional responses occurring during initial contact between Spn and a human pleural mesothelial cell line (PMC in vitro. Using stringent filtering criteria, 42 and 23 Spn genes were up-and down-regulated respectively. In particular, genes encoding factors potentially involved in metabolic processes and Spn adherence to eukaryotic cells were up-regulated e.g. glnQ, glnA, aliA, psaB, lytB and nox. After Spn initial contact, 870 human genes were differentially regulated and the largest numbers of significant gene expression changes were found in canonical pathways for eukaryotic initiation factor 2 signaling (60 genes out of 171, oxidative phosphorylation (32/103, mitochondrial dysfunction (37/164, eIF4 and p70S6K signaling (28/142, mTOR signaling (27/182, NRF2-mediated oxidative stress response (20/177, epithelial adherens junction remodeling (11/66 and ubiquitination (22/254. The cellular response appeared to be directed towards host cell survival and defense. Spn did not activate NF-kB or phosphorylate p38 MAPK or induce cytokine production from PMC. Moreover, Spn infection of TNF-α pre-stimulated PMC inhibited production of IL-6 and IL-8 secretion by >50% (p<0.01. In summary, this descriptive study provides datasets and a platform for examining further the molecular mechanisms underlying the pathogenesis of empyema.

  12. Distinct effects on diversifying selection by two mechanisms of immunity against Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Yuan Li

    Full Text Available Antigenic variation to evade host immunity has long been assumed to be a driving force of diversifying selection in pathogens. Colonization by Streptococcus pneumoniae, which is central to the organism's transmission and therefore evolution, is limited by two arms of the immune system: antibody- and T cell- mediated immunity. In particular, the effector activity of CD4(+ T(H17 cell mediated immunity has been shown to act in trans, clearing co-colonizing pneumococci that do not bear the relevant antigen. It is thus unclear whether T(H17 cell immunity allows benefit of antigenic variation and contributes to diversifying selection. Here we show that antigen-specific CD4(+ T(H17 cell immunity almost equally reduces colonization by both an antigen-positive strain and a co-colonized, antigen-negative strain in a mouse model of pneumococcal carriage, thus potentially minimizing the advantage of escape from this type of immunity. Using a proteomic screening approach, we identified a list of candidate human CD4(+ T(H17 cell antigens. Using this list and a previously published list of pneumococcal Antibody antigens, we bioinformatically assessed the signals of diversifying selection among the identified antigens compared to non-antigens. We found that Antibody antigen genes were significantly more likely to be under diversifying selection than the T(H17 cell antigen genes, which were indistinguishable from non-antigens. Within the Antibody antigens, epitopes recognized by human antibodies showed stronger evidence of diversifying selection. Taken together, the data suggest that T(H17 cell-mediated immunity, one form of T cell immunity that is important to limit carriage of antigen-positive pneumococcus, favors little diversifying selection in the targeted antigen. The results could provide new insight into pneumococcal vaccine design.

  13. Crystallization and preliminary X-ray diffraction analysis of phosphoglycerate kinase from Streptococcus pneumoniae

    International Nuclear Information System (INIS)

    Bernardo-García, Noelia; Bartual, Sergio G.; Fulde, Marcus; Bergmann, Simone; Hermoso, Juan A.


    Phosphoglycerate kinase, a two-domain enzyme involved in the glycolytic pathway, has been crystallized. Both the N-terminal domain and a ternary complex of the full-length enzyme with substrates were crystallized by the sitting-drop vapour-diffusion method. Inclusion of the substrates was critical in order to obtain crystals of the full-length protein. Phosphoglycerate kinase (PGK) is a widespread two-domain enzyme that plays a critical role in the glycolytic pathway. Several glycolytic enzymes from streptococci have been identified as surface-exposed proteins that are involved in streptococcal virulence by their ability to bind host proteins. This binding allows pneumococcal cells to disseminate through the epithelial and endothelial layers. Crystallization of PGK from Streptococcus pneumoniae yielded orthorhombic crystals (space group I222, unit-cell parameters a = 62.73, b = 75.38, c = 83.63 Å). However, the unit cell of these crystals was not compatible with the presence of full-length PGK. Various analytical methods showed that only the N-terminal domain of PGK was present in the I222 crystals. The ternary complex of PGK with adenylyl imidodiphosphate (AMP-PNP) and 3-phospho-d-glycerate (3PGA) produced monoclinic crystals (space group P2 1 , unit-cell parameters a = 40.35, b = 78.23, c = 59.03 Å, β = 96.34°). Molecular replacement showed that this new crystal form contained full-length PGK, thereby indicating the relevance of including substrates in order to avoid proteolysis during the crystallization process

  14. Identification of EloR (Spr1851) as a regulator of cell elongation in Streptococcus pneumoniae. (United States)

    Stamsås, Gro Anita; Straume, Daniel; Ruud Winther, Anja; Kjos, Morten; Frantzen, Cyril Alexander; Håvarstein, Leiv Sigve


    In a screen for mutations suppressing the lethal loss of PBP2b in Streptococcus pneumoniae we identified Spr1851 (named EloR), a cytoplasmic protein of unknown function whose inactivation removed the requirement for PBP2b as well as RodA. It follows from this that EloR and the two elongasome proteins must be part of the same functional network. This network also includes StkP, as this serine/threonine kinase phosphorylates EloR on threonine 89 (T89). We found that ΔeloR cells, and cells expressing the phosphoablative form of EloR (EloR T89A ), are significantly shorter than wild-type cells. Furthermore, the phosphomimetic form of EloR (EloR T89E ) is not tolerated unless the cell in addition acquires a truncated MreC or non-functional RodZ protein. By itself, truncation of MreC as well as inactivation of RodZ gives rise to less elongated cells, demonstrating that the stress exerted by the phosphomimetic form of EloR is relieved by suppressor mutations that reduce or abolish the activity of the elongasome. Of note, it was also found that loss of elongasome activity caused by truncation of MreC elicits increased StkP-mediated phosphorylation of EloR. Together, the results support a model in which phosphorylation of EloR stimulates cell elongation, while dephosphorylation has an inhibitory effect. © 2017 John Wiley & Sons Ltd.

  15. ABC transporter content diversity in Streptococcus pneumoniae impacts competence regulation and bacteriocin production. (United States)

    Wang, Charles Y; Patel, Nisha; Wholey, Wei-Yun; Dawid, Suzanne


    The opportunistic pathogen Streptococcus pneumoniae (pneumococcus) uses natural genetic competence to increase its adaptability through horizontal gene transfer. One method of acquiring DNA is through predation of neighboring strains with antimicrobial peptides called "bacteriocins." Competence and production of the major family of pneumococcal bacteriocins, pneumocins, are regulated by the quorum-sensing systems com and blp , respectively. In the classical paradigm, the ABC transporters ComAB and BlpAB each secretes its own system's signaling pheromone and in the case of BlpAB also secretes the pneumocins. While ComAB is found in all pneumococci, only 25% of strains encode an intact version of BlpAB [BlpAB(+)] while the rest do not [BlpAB(-)]. Contrary to the classical paradigm, it was previously shown that BlpAB(-) strains can activate blp through ComAB-mediated secretion of the blp pheromone during brief periods of competence. To better understand the full extent of com - blp crosstalk, we examined the contribution of each transporter to competence development and pneumocin secretion. We found that BlpAB(+) strains have a greater capacity for competence activation through BlpAB-mediated secretion of the com pheromone. Similarly, we show that ComAB and BlpAB are promiscuous and both can secrete pneumocins. Consequently, differences in pneumocin secretion between BlpAB(+) and BlpAB(-) strains derive from the regulation and kinetics of transporter expression rather than substrate specificity. We speculate that BlpAB(-) strains (opportunists) use pneumocins mainly in a narrowly tailored role for DNA acquisition and defense during competence while BlpAB(+) strains (aggressors) expand their use for the general inhibition of rival strains. Copyright © 2018 the Author(s). Published by PNAS.

  16. Streptococcus pneumoniae eradicates preformed Staphylococcus aureus biofilms through a mechanism requiring physical contact

    Directory of Open Access Journals (Sweden)

    Faidad Khan


    Full Text Available Staphylococcus aureus (Sau strains are a main cause of disease, including nosocomial infections which have been linked to the production of biofilms and the propagation of antibiotic resistance strains such as methicillin-resistant Staphylococcus aureus (MRSA. A previous study found that Streptococcus pneumoniae (Spn strains kill planktonic cultures of Sau strains. In this work, we have further evaluated in detail the eradication of Sau biofilms and investigated ultrastructural interactions of the biofilmicidal effect. Spn strain D39, which produces the competence stimulating peptide 1 (CSP1, reduced Sau biofilms within 8 h of inoculation, while TIGR4, producing CSP2, eradicated Sau biofilms and planktonic cells within 4 h. Differences were not attributed to pherotypes as other Spn strains producing different pheromones eradicated Sau within 4 h. Experiments using Transwell devices, which physically separated both species growing in the same well, demonstrated that direct contact between Spn and Sau was required to efficiently eradicate Sau biofilms and biofilm-released planktonic cells. Physical contact-mediated killing of Sau was not related to production of hydrogen peroxide as an isogenic TIGR4spxB mutant eradicated Sau bacteria within 4 h. Confocal micrographs confirmed eradication of Sau biofilms by TIGR4 and allowed us to visualize ultrastructural point of contacts between Sau and Spn. A time-course study further demonstrated spatial colocalization of Spn chains and Sau tetrads as early as 30 min post-inoculation (Pearson’s coefficient >0.72. Finally, precolonized biofilms produced by Sau strain Newman, or MRSA strain USA300, were eradicated by mid-log phase cultures of washed TIGR4 bacteria within 2 h post-inoculation. In conclusion, Spn strains rapidly eradicate pre-colonized Sau aureus biofilms, including those formed by MRSA strains, by a mechanism(s requiring bacterium-bacterium contact, but independent from the production of

  17. Digital gene expression analysis in mice lung with coinfection of influenza and streptococcus pneumoniae. (United States)

    Luo, Jun; Zhou, Linlin; Wang, Hongren; Qin, Zhen; Xiang, Li; Zhu, Jie; Huang, Xiaojun; Yang, Yuan; Li, Wanyi; Wang, Baoning; Li, Mingyuan


    Influenza A virus (IAV) and Streptococcus pneumoniae (SP) are two major upper respiratory tract pathogens that can also cause infection in polarized bronchial epithelial cells to exacerbate disease in coinfected individuals which may result in significant morbidity. However, the underlying molecular mechanism is poorly understood. Here, we employed BALB/c ByJ mice inflected with SP, IAV, IAV followed by SP (IAV+SP) and PBS (Control) as models to survey the global gene expression using digital gene expression (DGE) profiling. We attempt to gain insights into the underlying genetic basis of this synergy at the expression level. Gene expression profiles were obtain using the Illimina/Hisseq sequencing technique, and further analyzed by enrichment analysis of Gene Ontology (GO) and Pathway function. The hematoxylin-eosin (HE) staining revealed different tissue changes in groups during which IAV+SP group showed the most severe cell apoptosis. Compared with Control, a total of 2731, 3221 and 3946 differentially expressed genes (DEGs) were detected in SP, IAV and IAV+SP respectively. Besides, sixty-two GO terms were identified by Gene Ontology functional enrichment analysis, such as cell killing, biological regulation, response to stimulus, signaling, biological adhesion, enzyme regulator activity, receptor regulator activity and translation regulator activity. Pathway significant enrichment analysis indicated the dysregulation of multiple pathways, including apoptosis pathway. Among these, five selected genes were further verified by quantitative reverse transcription-polymerase chain reaction (qRT-PCR). This study shows that infection with SP, IAV or IAV+SP induces apoptosis with different degrees which might provide insights into the molecular mechanisms to facilitate further research.

  18. Clonal relationships among penicillin-susceptible, multiresistant serotype 6B Streptococcus pneumoniae isolates recovered in Greece and France. (United States)

    Syrogiannopoulos, G A; Doit, C; Grivea, I N; Geslin, P; Bingen, E


    In January 1996 the emergence of penicillin-susceptible, multiresistant serotype 6B Streptococcus pneumoniae isolates resistant to chloramphenicol, tetracycline, erythromycin, clindamycin and trimethoprim-sulfamethoxazole was observed in young carriers in the city of Patras, located in the southwestern region of Greece. Later, a significant spread of pneumococci with this unusual phenotype was noted in carriers living in various other areas of the country. Using restriction fragment length polymorphism of the ribosomal RNA genes, clonal relationships were found between these Greek strains and serotype 6B penicillin-susceptible, multiresistant pneumococci isolated in France between January 1992 and September 1996. The French and Greek isolates appear to have a common ancestry.

  19. Strain-specific impact of PsaR of Streptococcus pneumoniae on global gene expression and virulence


    Hendriksen, Wouter T.; Bootsma, Hester J.; van Diepen, Angela; Estevao, Silvia; Kuipers, Oscar P.; de Groot, Ronald; Hermans, Peter W. M.


    Previous studies have indicated that PsaR of Streptococcus pneumoniae is a manganese-dependent regulator, negatively affecting the expression of at least seven genes. Here, we extended these observations by transcriptome and proteome analysis of psaR mutants in strains D39 and TIGR4. The microarray analysis identified three shared PsaR targets: the psa operon, pcpA and prtA. In addition, we found 31 genes to be regulated by PsaR in D39 only, most strikingly a cellobiose-specific phosphotrains...

  20. Crystallization and preliminary crystallographic analysis of the transpeptidase domain of penicillin-binding protein 2B from Streptococcus pneumoniae

    International Nuclear Information System (INIS)

    Yamada, Mototsugu; Watanabe, Takashi; Baba, Nobuyoshi; Miyara, Takako; Saito, Jun; Takeuchi, Yasuo


    The selenomethionyl-substituted transpeptidase domain of penicillin-binding protein (PBP) 2B from S. pneumoniae was isolated from a limited proteolysis digest of the soluble form of recombinant PBP 2B and then crystallized. MAD data were collected to 2.4 Å resolution. Penicillin-binding protein (PBP) 2B from Streptococcus pneumoniae catalyzes the cross-linking of peptidoglycan precursors that occurs during bacterial cell-wall biosynthesis. A selenomethionyl (SeMet) substituted PBP 2B transpeptidase domain was isolated from a limited proteolysis digest of a soluble form of recombinant PBP 2B and then crystallized. The crystals belonged to space group P4 3 2 1 2, with unit-cell parameters a = b = 86.39, c = 143.27 Å. Diffraction data were collected to 2.4 Å resolution using the BL32B2 beamline at SPring-8. The asymmetric unit contains one protein molecule and 63.7% solvent

  1. Effect of decreased BCAA synthesis through disruption of ilvC gene on the virulence of Streptococcus pneumoniae. (United States)

    Kim, Gyu-Lee; Lee, Seungyeop; Luong, Truc Thanh; Nguyen, Cuong Thach; Park, Sang-Sang; Pyo, Suhkneung; Rhee, Dong-Kwon


    Streptococcus pneumoniae (pneumococcus) is responsible for significant morbidity and mortality worldwide. It causes a variety of life-threatening infections such as pneumonia, bacteremia, and meningitis. In bacterial physiology, the metabolic pathway of branched-chain amino acids (BCAAs) plays an important role in virulence. Nonetheless, the function of IlvC, one of the enzymes involved in the biosynthesis of BCAAs, in S. pneumoniae remains unclear. Here, we demonstrated that downregulation of BCAA biosynthesis by ilvC ablation can diminish BCAA concentration and expression of pneumolysin (Ply) and LytA, and subsequently attenuate virulence. Infection with an ilvC mutant showed significantly reduced mortality and colonization in comparison with strain D39 (serotype 2, wild type), suggesting that ilvC can potentiate S. pneumoniae virulence due to adequate BCAA synthesis. Taken together, these results suggest that the function of ilvC in BCAA synthesis is essential for virulence factor and could play an important role in the pathogenesis of respiratory infections.

  2. Individual risk factors associated with nasopharyngeal colonization with Streptococcus pneumoniae and Haemophilus influenzae: a Japanese birth cohort study. (United States)

    Otsuka, Taketo; Chang, Bin; Shirai, Takatoshi; Iwaya, Atsushi; Wada, Akihito; Yamanaka, Noboru; Okazaki, Minoru


    The first step in a bacterial disease is the establishment of nasopharyngeal carriage. We conducted a birth cohort study to identify factors associated with colonization in healthy children and evaluate the serotype distributions and resistances of Streptococcus pneumoniae/Haemophilus influenzae. Nasopharyngeal cultures were obtained from 349 subjects at 5 time points coinciding with health checkups (4, 7, 10, 18 and 36 months). A total of 551 S. pneumoniae (penicillin resistance rate: 46.3%) and 301 H. influenzae (ampicillin resistance rate: 44.5%) isolates were obtained from 1654 samples. In this study, 47.5% and 60.9% of S. pneumoniae isolates were included in the serotypes of 7- and 13-valent pneumococcal conjugate vaccines, respectively. Analyzing by Cox proportional hazards models, cohabiting older sibling(s) attending day-care (hazard ratios: 2.064-3.518, P rates. This data indicated that introduction of appropriate antimicrobial usage in areas of overuse of antimicrobials could contribute to lower colonization of S. pneumoniae/H. influenzae, resulting in a decrease in the absolute number of resistant isolates. Strategies to control transmission at day-care centers or from older sibling(s) as well as appropriate use of antimicrobials are essential for reducing colonization and the absolute number of resistant isolates.

  3. Streptococcus pneumoniae-Induced Oxidative Stress in Lung Epithelial Cells Depends on Pneumococcal Autolysis and Is Reversible by Resveratrol. (United States)

    Zahlten, Janine; Kim, Ye-Ji; Doehn, Jan-Moritz; Pribyl, Thomas; Hocke, Andreas C; García, Pedro; Hammerschmidt, Sven; Suttorp, Norbert; Hippenstiel, Stefan; Hübner, Ralf-Harto


    Streptococcus pneumoniae is the most common cause of community-acquired pneumonia worldwide. During pneumococcal pneumonia, the human airway epithelium is exposed to large amounts of H2O2 as a product of host and pathogen oxidative metabolism. Airway cells are known to be highly vulnerable to oxidant damage, but the pathophysiology of oxidative stress induced by S. pneumoniae and the role of nuclear factor erythroid 2-related factor 2 (Nrf2)-mediated antioxidant systems of the host are not well characterized. For gluthation/gluthathion disulfide analysis BEAS-2B cells, primary broncho-epithelial cells (pBEC), explanted human lung tissue and mouse lungs were infected with different S. pneumoniae strains (D39, A66, R6x, H2O2/pneumolysin/LytA- deficient mutants of R6x). Cell death was proven by LDH assay and cell viability by IL-8 ELISA. The translocation of Nrf2 and the expression of catalase were shown via Western blot. The binding of Nrf2 at the catalase promoter was analyzed by ChIP. We observed a significant induction of oxidative stress induced by S. pneumoniae in vivo, ex vivo, and in vitro. Upon stimulation, the oxidant-responsive transcription factor Nrf2 was activated, and catalase was upregulated via Nrf2. The pneumococci-induced oxidative stress was independent of S. pneumoniae-derived H2O2 and pneumolysin but depended on the pneumococcal autolysin LytA. The Nrf2 inducer resveratrol, as opposed to catalase, reversed oxidative stress in lung epithelial cells. These observations indicate a H2O2-independent induction of oxidative stress in lung epithelial cells via the release of bacterial factors of S. pneumoniae. Resveratrol might be an option for prevention of acute lung injury and inflammatory responses observed in pneumococcal pneumonia. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail:

  4. A novel computational method identifies intra- and inter-species recombination events in Staphylococcus aureus and Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Lisa Sanguinetti

    Full Text Available Advances in high-throughput DNA sequencing technologies have determined an explosion in the number of sequenced bacterial genomes. Comparative sequence analysis frequently reveals evidences of homologous recombination occurring with different mechanisms and rates in different species, but the large-scale use of computational methods to identify recombination events is hampered by their high computational costs. Here, we propose a new method to identify recombination events in large datasets of whole genome sequences. Using a filtering procedure of the gene conservation profiles of a test genome against a panel of strains, this algorithm identifies sets of contiguous genes acquired by homologous recombination. The locations of the recombination breakpoints are determined using a statistical test that is able to account for the differences in the natural rate of evolution between different genes. The algorithm was tested on a dataset of 75 genomes of Staphylococcus aureus and 50 genomes comprising different streptococcal species, and was able to detect intra-species recombination events in S. aureus and in Streptococcus pneumoniae. Furthermore, we found evidences of an inter-species exchange of genetic material between S. pneumoniae and Streptococcus mitis, a closely related commensal species that colonizes the same ecological niche. The method has been implemented in an R package, Reco, which is freely available from supplementary material, and provides a rapid screening tool to investigate recombination on a genome-wide scale from sequence data.

  5. Purification, crystallization and preliminary X-ray analysis of 3-hydroxy-3-methylglutaryl-coenzyme A reductase of Streptococcus pneumoniae

    International Nuclear Information System (INIS)

    Zhang, Liping; Feng, Lingling; Zhou, Li; Gui, Jie; Wan, Jian; Hu, Xiaopeng


    3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) reductase of Streptococcus pneumoniae has been cloned, overexpressed and purified to homogeneity using Ni–NTA affinity chromatography. Crystals were obtained using the hanging-drop vapour-diffusion method. Class II 3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) reductases are potential targets for novel antibiotic development. In order to obtain a precise structural model for use in virtual screening and inhibitor design, HMG-CoA reductase of Streptococcus pneumoniae was cloned, overexpressed and purified to homogeneity using Ni–NTA affinity chromatography. Crystals were obtained using the hanging-drop vapour-diffusion method. A complete data set was collected from a single frozen crystal on a home X-ray source. The crystal diffracted to 2.3 Å resolution and belonged to the orthorhombic space group C222 1 , with unit-cell parameters a = 773.4836, b = 90.3055, c = 160.5592 Å, α = β = γ = 90°. Assuming the presence of two molecules in the asymmetric unit, the solvent content was estimated to be 54.1% (V M = 2.68 Å 3 Da −1 )

  6. Validation of the Infectious Diseases Society of America/American Thoracic Society criteria to predict severe community-acquired pneumonia caused by Streptococcus pneumoniae. (United States)

    Kontou, Paschalina; Kuti, Joseph L; Nicolau, David P


    Severe community-acquired pneumonia (CAP) is usually defined as pneumonia that requires intensive care unit (ICU) admission; the primary pathogen responsible for ICU admission is Streptococcus pneumoniae. In this study, the 2007 Infectious Diseases Society of America/American Thoracic Society (IDSA/ATS) consensus criteria for ICU admission were compared with other severity scores in predicting ICU admission and mortality. We retrospectively studied 158 patients with pneumococcal CAP (1999-2003). Clinical and laboratory features at the emergency department were recorded and used to calculate the 2007 IDSA/ATS rule, the 2001 ATS rule, 2 modified 2007 IDSA/ATS rules, the Pneumonia Severity Index (PSI), and the CURB (confusion, urea, respiratory rate, blood pressure) score. The sensitivity, specificity, positive predictive value, and negative predictive value (NPV) were assessed for the various indices. We also determined the criteria that were independently predictive of ICU admission and of mortality in our population. The 2007 IDSA/ATS criteria performed as well as the 2001 ATS rule in predicting ICU admission both demonstrated high sensitivity (90%) and NPV (97%). For the prediction of mortality, the best tool proved to be the PSI score (sensitivity, 95%; NPV, 99%). The variables associated with ICU admission in this patient population included tachypnea, confusion, Pao(2)/Fio(2) ratio of 250 or lower, and hypotension requiring fluid resuscitation. Mechanical ventilation and PSI class V were independently associated with mortality. This study confirms the usefulness of the new criteria in predicting severe CAP. The 2001 ATS criteria seem an attractive alternative because they are simple and as effective as the 2007 IDSA/ATS criteria.

  7. Susceptibilidad antimicrobiana de Streptococcus pneumoniae colonizante de nasofaringe en niños colombianos con neumonía

    Directory of Open Access Journals (Sweden)

    Aura Lucía Leal


    Full Text Available Streptococcus pneumoniae es uno de los principales agentes causales de infección respiratoria aguda (IRA en niños y su resistencia a antibióticos se ha incrementado en todo el mundo. En este estudio se determinaron los patrones de susceptibilidad a antimicrobianos de S. pneumoniae colonizante de las vías respiratorias altas en 272 niños hospitalizados por neumonía en dos hospitales de Santafé de Bogotá. Se aisló S. pneumoniae en 114 pacientes (42%. Se observó susceptibilidad disminuida a la penicilina en 19 aislamientos (17%, con sensibilidad intermedia en 12 (11% y franca resistencia en 7 (6%. Solo 1 de los 19 aislamientos resistentes a penicilina mostró también resistencia a la ceftriaxona. Se observó sensibilidad disminuida a la eritromicina en 3 aislamientos (3%, al cloranfenicol en 6 (5% y al cotrimoxazol (trimetoprima + sulfametoxazol en 46 (40%. Se encontró multirresistencia en 7 aislamientos (6%. El serotipo con sensibilidad disminuida a la penicilina que se halló con mayor frecuencia fue el 23F (68,4%. Se observó una asociación entre la edad, el uso previo de antibióticos y la colonización con S. pneumoniae con susceptibilidad disminuida a la penicilina o multirresistencia. Este estudio confirma la presencia de resistencia antimicrobiana de S. pneumoniae en Colombia y resalta la importancia del uso racional de los antibióticos y de la implementación de la vigilancia epidemiológica sobre este agente.

  8. The accuracy of using the lytA-gene to distinguish Streptococcus pneumoniae from related species

    DEFF Research Database (Denmark)

    Greve, Thomas; Møller, Jens Kjølseth


    with primers and probes. The remaining 11 S. pneumoniae strains could be placed in a different cluster, which also contained the five S. mitis and two S. pseudopneumoniae strains. All strains had no match with primers and probes. The S. pneumoniae strains in the second cluster were all characterised by being....... The real-time PCR targeting the lytA-gene thus constitutes a sensitive and specific assay that distinguishes S. pneumoniae from its close relatives in the Mitis group....

  9. The alpha-tocopherol form of vitamin E reverses age-associated susceptibility to Streptococcus pneumoniae lung infection by modulating pulmonary neutrophil recruitment (United States)

    Streptococcus pneumonia infections are an important cause of morbidity and mortality in older patients. Uncontrolled neutrophil-driven pulmonary inflammation exacerbates this disease. To test whether the alpha-tocopherol (alpha-Toc) form of vitamin E, a regulator of immunity, can modulate neutrophil...

  10. Nasopharyngeal carriage of Streptococcus pneumoniae and other bacteria in the 7th year after implementation of the pneumococcal conjugate vaccine in the Netherlands

    NARCIS (Netherlands)

    Bosch, Astrid A T M; van Houten, Marlies A.; Bruin, Jacob P.; Wijmenga-Monsuur, Alienke J.; Trzciński, Krzysztof; Bogaert, Debby; Rots, Nynke Y.; Sanders, Elisabeth A M


    After introduction of the 7-valent pneumococcal conjugate vaccine (PCV7) in the infant national immunization program (NIP) in the Netherlands in 2006, Streptococcus pneumoniae strains of the non-vaccine serotype 19A emerged and became the dominant serotype in carriage in children and their parents.


    NARCIS (Netherlands)



    A 2.5-kb DNA fragment including the structural gene coding for the penicillin-binding protein 2x (PBP 2x) of Streptococcus pneumoniae has been cloned into the vector pJDC9 and expressed in Escherichia coli. Mapping of RNA polymerase binding sites by electron microscopy indicated that the pbpX

  12. Serotipos prevalentes de Streptococcus pneumoniae colonizadores de nasofaringe, en niños del Distrito Federal Prevalence of Streptococcus pneumoniae serotypes on nasopharyngeal colonization in children of Mexico City

    Directory of Open Access Journals (Sweden)

    Fortino Solórzano-Santos


    Full Text Available OBJETIVO: Determinar frecuencia, serotipos y susceptibilidad a ocho antimicrobianos en Streptococcus pneumoniae aislados de la nasofaringe de una muestra representativa de niños menores de cinco años de edad residentes en el Distrito Federal. MATERIAL Y MÉTODOS: Estudio transversal, hecho de febrero de 2002 a enero de 2003. Se incluyeron niños de 2 meses a 5 años. A los seleccionados se les tomó una muestra de exudado faríngeo con hisopo de alginato de calcio. Bajo técnicas ya establecidas se realizó identificación, tipificación y susceptibilidad a ocho antimicrobianos de los aislamientos de S. pneumoniae. Se utilizó estadística descriptiva, prueba de Ji cuadrada y razón de momios (IC 95% para los factores de riesgo. RESULTADOS: Se estudiaron 573 niños. En 122/573 (21.4% niños se aisló S. pneumoniae. Los serotipos más frecuentes fueron el 23F, 35, 19F, 11A y 15A; 46% de los serotipos encontrados no son cubiertos con la vacuna heptavalente. Se encontró 12% de susceptibilidad reducida a la penicilina, con 3% de cepas con alta resistencia; la resistencia a eritromicina fue >30% y para trimetoprim-sulfametoxazol (TMP/SMX >40%. No hubo cepas resistentes a vancomicina, cefotaxima, amoxicilina-clavulanato, cloranfenicol o ampicilina. CONCLUSIONES: El porcentaje de serotipos de S. pneumoniae en portadores nasofaríngeos no cubiertos por la vacuna heptavalente es alto, y la resistencia a macrólidos y TMP/SMX es elevada, lo que debe alertar al grupo médico.OBJECTIVE: To determine the frequency, serotypes and susceptibility profiles to eight antimicrobials in Streptococcus pneumoniae nasopharyngeal isolates from a representative sample of children under 5 years of age, residents of Mexico City. PATIENTS AND METHODS: A cross-sectional survey was conducted in 573 children aged 2 months to 5 years. A nasopharyngeal sample was taken. S. pneumoniae identification, capsular serotyping and antimicrobial susceptibility to eight antimicrobials

  13. Repeated extragenic sequences in prokaryotic genomes: a proposal for the origin and dynamics of the RUP element in Streptococcus pneumoniae. (United States)

    Oggioni, M R; Claverys, J P


    A survey of all Streptococcus pneumoniae GenBank/EMBL DNA sequence entries and of the public domain sequence (representing more than 90% of the genome) of an S. pneumoniae type 4 strain allowed identification of 108 copies of a 107-bp-long highly repeated intergenic element called RUP (for repeat unit of pneumococcus). Several features of the element, revealed in this study, led to the proposal that RUP is an insertion sequence (IS)-derivative that could still be mobile. Among these features are: (1) a highly significant homology between the terminal inverted repeats (IRs) of RUPs and of IS630-Spn1, a new putative IS of S. pneumoniae; and (2) insertion at a TA dinucleotide, a characteristic target of several members of the IS630 family. Trans-mobilization of RUP is therefore proposed to be mediated by the transposase of IS630-Spn1. To account for the observation that RUPs are distributed among four subtypes which exhibit different degrees of sequence homogeneity, a scenario is invoked based on successive stages of RUP mobility and non-mobility, depending on whether an active transposase is present or absent. In the latter situation, an active transposase could be reintroduced into the species through natural transformation. Examination of sequences flanking RUP revealed a preferential association with ISs. It also provided evidence that RUPs promote sequence rearrangements, thereby contributing to genome flexibility. The possibility that RUP preferentially targets transforming DNA of foreign origin and subsequently favours disruption/rearrangement of exogenous sequences is discussed.

  14. Meningitis caused by Neisseria Meningitidis, Hemophilus Influenzae Type B and Streptococcus Pneumoniae during 2005–2012 in Turkey (United States)

    Ceyhan, Mehmet; Gürler, Nezahat; Ozsurekci, Yasemin; Keser, Melike; Aycan, Ahmet Emre; Gurbuz, Venhar; Salman, Nuran; Camcioglu, Yildiz; Dinleyici, Ener Cagri; Ozkan, Sengul; Sensoy, Gulnar; Belet, Nursen; Alhan, Emre; Hacimustafaoglu, Mustafa; Celebi, Solmaz; Uzun, Hakan; Faik Oner, Ahmet; Kurugol, Zafer; Ali Tas, Mehmet; Aygun, Denizmen; Oncel, Eda Karadag; Celik, Melda; Yasa, Olcay; Akin, Fatih; Coşkun, Yavuz


    Successful vaccination policies for protection from bacterial meningitis are dependent on determination of the etiology of bacterial meningitis. Cerebrospinal fluid (CSF) samples were obtained prospectively from children from 1 month to ≤ 18 years of age hospitalized with suspected meningitis, in order to determine the etiology of meningitis in Turkey. DNA evidence of Neisseria meningitidis (N. meningitidis), Streptococcus pneumoniae (S. pneumoniae), and Hemophilus influenzae type b (Hib) was detected using multiplex polymerase chain reaction (PCR). In total, 1452 CSF samples were evaluated and bacterial etiology was determined in 645 (44.4%) cases between 2005 and 2012; N. meningitidis was detected in 333 (51.6%), S. pneumoniae in 195 (30.2%), and Hib in 117 (18.1%) of the PCR positive samples. Of the 333 N. meningitidis positive samples 127 (38.1%) were identified as serogroup W-135, 87 (26.1%) serogroup B, 28 (8.4%) serogroup A and 3 (0.9%) serogroup Y; 88 (26.4%) were non-groupable. As vaccines against the most frequent bacterial isolates in this study are available and licensed, these results highlight the need for broad based protection against meningococcal disease in Turkey. PMID:25483487

  15. Cloning, recombinant production, crystallization and preliminary X-ray diffraction analysis of a family 101 glycoside hydrolase from Streptococcus pneumoniae

    International Nuclear Information System (INIS)

    Gregg, Katie J.; Boraston, Alisdair B.


    The catalytic module of a family 101 glycoside hydrolase from S. pneumoniae was cloned, recombinantly produced and crystallized. Streptococcus pneumoniae is a serious human pathogen that is responsible for a wide range of diseases including pneumonia, meningitis, septicaemia and otitis media. The full virulence of this bacterium is reliant on carbohydrate processing and metabolism, as revealed by biochemical and genetic studies. One carbohydrate-processing enzyme is a family 101 glycoside hydrolase (SpGH101) that is responsible for catalyzing the liberation of galactosyl β1,3-N-acetyl-d-galactosamine (Galβ1,3GalNAc) α-linked to serine or threonine residues of mucin-type glycoproteins. The 124 kDa catalytic module of this enzyme (SpGH101CM) was cloned and overproduced in Escherichia coli and purified. Crystals were obtained in space group P2 1 and diffracted to 2.0 Å resolution, with unit-cell parameters a = 81.86, b = 88.91, c = 88.77 Å, β = 112.46°. SpGH101CM also qualitatively displayed good activity towards the synthetic substrate p-nitrophenyl-2-acetamido-2-deoxy-3-O-(β-d-galactopyranosyl) -α-d-galactopyranoside, which is consistent with the classification of this enzyme as an endo-α-N-acetylgalactosaminidase

  16. Antimicrobial resistance and serotyping of Streptococcus pneumoniae isolated from pediatric patients in Belo Horizonte, MG, Brazil Resistência antimicrobiana e sorotipagem de Streptococcus pneumoniae isolado de pacientes pediátricos em Belo Horizonte, MG

    Directory of Open Access Journals (Sweden)

    Ana Paula Gomes de Oliveira Magalhães


    Full Text Available Thirty one Streptococcus pneumoniae invasive strains were isolated from a pediatric population in Belo Horizonte from June, 1999 to May, 2001. Penicillin, trimethoprim-sulfamethoxazole, tetracycline and chloramphenicol resistance rates for the isolates were 41.9, 58.1, 25.8 and 3.2%, respectively. Intermediate penicillin resistant (MICs between 0.1 and 1.0 µg/ml and resistant (MICs > 2.0 µg/ml isolates occured at rates of 38.7 and 3.2%, respectively. Resistance to erythromycin, ofloxacin, rifampin or vancomicyn was not detected. Ten S. pneumoniae serotypes (14, 5, 10 A, 6B, 15B, 18C, 6 A, 18 A, 19 A and 19 F were identified. Serotype 14 (12 out of 31 was predominant among the isolates. Penicillin and trimethoprim-sulfamethoxazole resistance was more common in 14 and 6B serotypes.Trinta e três linhagens invasivas do S. pneumoniae foram isoladas a partir de pacientes pediátricos em Belo Horizonte, MG, Brasil, de junho de 1999 a maio de 2001. As taxas de resistência à penicilina, ao trimetoprim-sultametoxazol, tetraciclina e cloranfenicol foram respectivamente, 41, 9; 58,1 e 3,2%. A resistência intermediária à penicilina (MICs entre 0,1 e 1,0 µg/ml e resistência total (MICs>2.0 µg/ml ocorreram, respectivamente, nas porcentagens de 38,7 e 3,2%. Não foi detectada resistência à eritromicina, ofloxacin, rifampina e vancomicina. Foram identificados 9 sorotipos do S. pneumoniae (14, 5, 10 , 6B, 15B, 18C, 6 A, 18 19 A e 19F entre os isolados. O sorotipo 14 (12 de 31 foi predominate entre os isolados. A resistência à penicilina e ao trimetoprim-sulfametoxazol estava sempre associada aos sorotipos 14 e 6B.

  17. Dalbavancin Activity When Tested against Streptococcus pneumoniae Isolated in Medical Centers on Six Continents (2011 to 2014). (United States)

    Jones, Ronald N; Schuchert, Jason E; Mendes, Rodrigo E


    Dalbavancin, a novel lipoglycopeptide, was approved for use in 2014 by regulatory agencies in the United States and Europe for the treatment of skin and skin structure infections. The activity of dalbavancin was also widely assessed by determination of its activity against Streptococcus pneumoniae clinical isolates collected from patients on six continents monitored during two time intervals (2011 to 2013 and 2014). A total of 18,186 pneumococcal isolates were obtained from 49 nations and submitted to a monitoring laboratory as part of the SENTRY Antimicrobial Surveillance Program for reference susceptibility testing. The potency of dalbavancin against S. pneumoniae was consistent across the years that it was monitored, with the MIC50 and MIC90 being 0.015 and 0.03 μg/ml, respectively, and all isolates were inhibited by ≤0.12 μg/ml. The activity of dalbavancin was not adversely influenced by nonsusceptibility to β-lactams (ceftriaxone or penicillin), macrolides, clindamycin, fluoroquinolones, or tetracyclines or multidrug resistance (MDR). Regional variations in dalbavancin activity were not detected, but S. pneumoniae strains isolated in the Asia-Pacific region were more likely to be nonsusceptible to penicillin and ceftriaxone as well as to be MDR than strains isolated in North or South America and Europe. Direct comparisons of potency illustrated that dalbavancin (MIC50 and MIC90, 0.015 and 0.03 μg/ml, respectively) was 16-fold or more active than vancomycin (MIC50, 0.25 μg/ml), linezolid (MIC50, 1 μg/ml), levofloxacin (MIC50, 1 μg/ml), ceftriaxone (MIC90, 1 μg/ml), and penicillin (MIC90, 2 μg/ml). In conclusion, dalbavancin had potent and consistent activity against this contemporary (2011 to 2014) collection of S. pneumoniae isolates. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  18. Streptococcus pneumoniae bacteraemia due to parotitis in a patient with systemic sclerosis and secondary Sjögren's syndrome. (United States)

    Yii, Irene Yuen Lin; Tan, Jamie Bee Xian; Fong, Warren Weng Seng


    Invasive pneumococcal disease is an uncommon and notifiable disease in Singapore. It is often associated with significant morbidity and mortality. We report a rare case of invasive pneumococcal bacteraemia due to parotitis in a patient with systemic sclerosis and secondary Sjögren's syndrome. We also present a retrospective review of Streptococcus pneumoniae bacteraemia cases in Singapore General Hospital from January 2011 to April 2016. A 59-year-old Malay lady with a history of systemic sclerosis with secondary Sjögren's syndrome presented with fever and left parotid gland swelling. Clinical examination revealed poor salivary pooling and left parotid swelling without fluctuance. Ultrasound of the left parotid gland confirmed acute parotitis without evidence of abscess or sialolithiasis. Blood cultures were positive for S. pneumoniae . She was diagnosed to have invasive pneumococcal bacteraemia secondary to acute parotitis, and treated with intravenous benzylpenicillin with clearance of bacteraemia after 3 days. Upon discharge, her antibiotics were changed to intravenous ceftriaxone to facilitate outpatient parenteral antibiotic therapy for another 2 weeks. She responded favourably to antibiotics at follow-up, with no complications from the bacteraemia. A review of the microbiological records of the Singapore General Hospital revealed 116 cases of pneumococcal bacteraemia, most (80.3 %) of which were due to pneumonia. None were due to parotitis. S. pneumoniae parotitis and subsequent bacteraemia is rare. Prompt recognition of the disease and appropriate use of antibiotics are important. This case highlights that close communication between healthcare workers (microbiologist, rheumatologist and infectious disease specialist) is essential in ensuring good clinical outcomes in patients with a potentially fatal disease.

  19. Methylation of 23S rRNA nucleotide G748 by RlmAII methyltransferase renders Streptococcus pneumoniae telithromycin susceptible. (United States)

    Takaya, Akiko; Sato, Yoshiharu; Shoji, Tatsuma; Yamamoto, Tomoko


    Several posttranscriptional modifications of bacterial rRNAs are important in determining antibiotic resistance or sensitivity. In all Gram-positive bacteria, dimethylation of nucleotide A2058, located in domain V of 23S rRNA, by the dimethyltransferase Erm(B) results in low susceptibility and resistance to telithromycin (TEL). However, this is insufficient to produce high-level resistance to TEL in Streptococcus pneumoniae. Inactivation of the methyltransferase RlmA(II), which methylates the N-1 position of nucleotide G748, located in hairpin 35 of domain II of 23S rRNA, results in increased resistance to TEL in erm(B)-carrying S. pneumoniae. Sixteen TEL-resistant mutants (MICs, 16 to 32 μg/ml) were obtained from a clinically isolated S. pneumoniae strain showing low TEL susceptibility (MIC, 2 μg/ml), with mutation resulting in constitutive dimethylation of A2058 because of nucleotide differences in the regulatory region of erm(B) mRNA. Primer extension analysis showed that the degree of methylation at G748 in all TEL-resistant mutants was significantly reduced by a mutation in the gene encoding RlmA(II) to create a stop codon or change an amino acid residue. Furthermore, RNA footprinting with dimethyl sulfate and a molecular modeling study suggested that methylation of G748 may contribute to the stable interaction of TEL with domain II of 23S rRNA, even after dimethylation of A2058 by Erm(B). This novel finding shows that methylation of G748 by RlmA(II) renders S. pneumoniae TEL susceptible.

  20. Pneumonia


    Coelho, Liana Sousa [UNESP; Tanni, Suzana Erico; Godoy, Irma de [UNESP


    Pneumonia is an infectious disease with great morbidity and mortality worldwide. According to the current guidelines recommendations the authors reviewed the treatment of community-acquired pneumonia (CAP) and hospital-acquired pneumonia (HAP). In this paper will be presented data about etiology, clinics and diagnostic tools. © Copyright Moreira Jr. Editora.

  1. Pneumonia


    Coelho, Liana Sousa [UNESP; Do Vale, Simone Alves [UNESP; Godoy, Irma de [UNESP; Tanni, Suzana Erico [UNESP


    Pneumonia is an infectious disease with great morbidity and mortality worldwide. According to the current guidelines recommendations the authors reviewed the treatment of community-acquired pneumonia (CAP) and health care-associated pneumonia (HCAP). In this paper will be also presented data about etiology, clinics and diagnostic tools. © Copyright Moreira Jr. Editora.

  2. Meningitis neonatal e infección puerperal por Streptococcus pneumoniae: Presentación de un caso

    Directory of Open Access Journals (Sweden)

    Cecilia Ortiz Rodríguez


    Full Text Available Las infecciones neonatales causadas por Streptococcus pneumoniae constituyen un fenómeno raro, poco reportado en la literatura médica; en el presente trabajo se describe el caso de una meningoencefalitis purulenta de aparición precoz, en un neonato nacido por parto eutócico, a termino y de buen peso. Se aisló el microorganismo en la sangre y en el líquido cefalorraquídeo del recién nacido, así como en los loquios de la madre. Las 3 antibiotipias fueron idénticas. La evolución del niño fue desfavorable, el cual falleció a las 81 horas de vida, en un cuadro de fallo multiorgánico. La necropsia corroboró el diagnóstico. La madre desarrolló una endometritis puerperal a los 4 días, con buena evolución.Neonatal infections caused by Streptococcus pneumoniae are a rare phenomenon that is barely reported in the medical literature. The present paper describes a case of early purulent meningoencephalitis occurred in an adequate birthweight neonate born to term eutocic delivery. The microorganism was isolated in the newborn's blood and cerebrospinal fluid as well as in his mother's lochia. The three antibiotypes were identical. The newborn did not recover and died after 81 hours due to a multiple organ failure. Necropsy confirmed the diagnosis. The mother developed puerperal endometritis after 4 days but did recover.

  3. Cloning, expression, purification, crystallization and preliminary X-ray analysis of the pilus-associated sortase C from Streptococcus pneumoniae

    International Nuclear Information System (INIS)

    Neiers, F.; Madhurantakam, C.; Fälker, S.; Normark, S.; Henriques-Normark, B.; Achour, A.


    Crystallization conditions and preliminary X-ray diffraction analysis of the S. pneumoniae-derived pilus-associated protein sortase C are reported. The pilus-associated sortase C from Streptococcus pneumoniae (SrtC or Srt-2) acts as a polymerase for the pilus subunit proteins RrgA and RrgB. Here, the crystallization and preliminary X-ray diffraction analysis of three crystal forms of SrtC are reported. One crystal form belongs to space group P2 1 2 1 2 1 , with unit-cell parameters a = 48.9, b = 96.9, c = 98.9 Å, α = β = γ = 90°. The other two crystal forms belong to space group P222, with unit-cell parameters a = 48.8, b = 97.2, c = 99.2 Å, α = β = γ = 90° and a = 48.6, b = 96.5, c = 98.8 Å, α = β = γ = 90°, respectively. Preliminary analysis indicates the presence of two molecules in the asymmetric unit of the crystal for all three forms

  4. Deletion analysis of Streptococcus pneumoniae late competence genes distinguishes virulence determinants that are dependent or independent of competence induction. (United States)

    Zhu, Luchang; Lin, Jingjun; Kuang, Zhizhou; Vidal, Jorge E; Lau, Gee W


    The competence regulon of Streptococcus pneumoniae (pneumococcus) is crucial for genetic transformation. During competence development, the alternative sigma factor ComX is activated, which in turn, initiates transcription of 80 'late' competence genes. Interestingly, only 16 late genes are essential for genetic transformation. We hypothesized that these late genes that are dispensable for competence are beneficial to pneumococcal fitness during infection. These late genes were systematically deleted, and the resulting mutants were examined for their fitness during mouse models of bacteremia and acute pneumonia. Among these, 14 late genes were important for fitness in mice. Significantly, deletion of some late genes attenuated pneumococcal fitness to the same level in both wild-type and ComX-null genetic backgrounds, suggesting that the constitutive baseline expression of these genes was important for bacterial fitness. In contrast, some mutants were attenuated only in the wild-type genetic background but not in the ComX-null background, suggesting that specific expression of these genes during competence state contributed to pneumococcal fitness. Increased virulence during competence state was partially caused by the induction of allolytic enzymes that enhanced pneumolysin release. These results distinguish the role of basal expression versus competence induction in virulence functions encoded by ComX-regulated late competence genes. © 2015 John Wiley & Sons Ltd.

  5. The Response Regulator YycF Inhibits Expression of the Fatty Acid Biosynthesis Repressor FabT in Streptococcus pneumoniae (United States)

    Mohedano, Maria L.; Amblar, Mónica; de la Fuente, Alicia; Wells, Jerry M.; López, Paloma


    The YycFG (also known as WalRK, VicRK, MicAB, or TCS02) two-component system (TCS) is highly conserved among Gram-positive bacteria with a low G+C content. In Streptococcus pneumoniae the YycF response regulator has been reported to be essential due to its control of pcsB gene expression. Previously we showed that overexpression of yycF in S. pneumoniae TIGR4 altered the transcription of genes involved in cell wall metabolism and fatty acid biosynthesis, giving rise to anomalous cell division and increased chain length of membrane fatty acids. Here, we have overexpressed the yycFG system in TIGR4 wild-type strain and yycF in a TIGR4 mutant depleted of YycG, and analyzed their effects on expression of proteins involved in fatty acid biosynthesis during activation of the TCS. We demonstrate that transcription of the fab genes and levels of their products were only altered in the YycF overexpressing strain, indicating that the unphosphorylated form of YycF is involved in the regulation of fatty acid biosynthesis. In addition, DNA-binding assays and in vitro transcription experiments with purified YycF and the promoter region of the FabTH-acp operon support a direct inhibition of transcription of the FabT repressor by YycF, thus confirming the role of the unphosphorylated form in transcriptional regulation. PMID:27610104

  6. A Novel Function for the Streptococcus pneumoniae Aminopeptidase N: Inhibition of T Cell Effector Function through Regulation of TCR Signaling

    Directory of Open Access Journals (Sweden)

    Lance K. Blevins


    Full Text Available Streptococcus pneumoniae (Spn causes a variety of disease states including fatal bacterial pneumonia. Our previous finding that introduction of Spn into an animal with ongoing influenza virus infection resulted in a CD8+ T cell population with reduced effector function gave rise to the possibility of direct regulation by pneumococcal components. Here, we show that treatment of effector T cells with lysate derived from Spn resulted in inhibition of IFNγ and tumor necrosis factor α production as well as of cytolytic granule release. Spn aminopeptidase N (PepN was identified as the inhibitory bacterial component and surprisingly, this property was independent of the peptidase activity found in this family of proteins. Inhibitory activity was associated with reduced activation of ZAP-70, ERK1/2, c-Jun N-terminal kinase, and p38, demonstrating the ability of PepN to negatively regulate TCR signaling at multiple points in the cascade. These results reveal a novel immune regulatory function for a bacterial aminopeptidase.

  7. Replication of type 5 adenovirus promotes middle ear infection by Streptococcus pneumoniae in the chinchilla model of otitis media (United States)

    Murrah, Kyle A.; Turner, Roberta L.; Pang, Bing; Perez, Antonia C.; Reimche, Jennifer L.; King, Lauren B.; Wren, John; Gandhi, Uma; Swords, W. Edward; Ornelles, David A.


    Adenoviral infection is a major risk factor for otitis media. We hypothesized that adenovirus promotes bacterial ascension into the middle ear through the disruption of normal function in the Eustachian tubes due to inflammation-induced changes. An intranasal infection model of the chinchilla was used to test the ability of type 5 adenovirus to promote middle ear infection by Streptococcus pneumoniae. The hyperinflammatory adenovirus mutant dl327 and the nonreplicating adenovirus mutant H5wt300ΔpTP were used to test the role of inflammation and viral replication, respectively, in promotion of pneumococcal middle ear infection. Precedent infection with adenovirus resulted in a significantly greater incidence of middle ear disease by S. pneumoniae as compared to nonadenovirus infected animals. Infection with the adenovirus mutant dl327 induced a comparable degree of bacterial ascension into the middle ear as did infection with the wild-type virus. By contrast, infection with the nonreplicating adenovirus mutant H5wt300ΔpTP resulted in less extensive middle ear infection compared to the wild-type adenovirus. We conclude that viral replication is necessary for adenoviral-induced pneumococcal middle ear disease. PMID:25251686

  8. Crystallization and preliminary crystallographic analysis of the transpeptidase domain of penicillin-binding protein 2B from Streptococcus pneumoniae

    Energy Technology Data Exchange (ETDEWEB)

    Yamada, Mototsugu, E-mail:; Watanabe, Takashi; Baba, Nobuyoshi; Miyara, Takako; Saito, Jun; Takeuchi, Yasuo [Pharmaceutical Research Center, Meiji Seika Kaisha Ltd, 760 Morooka-cho, Kohoku-ku, Yokohama 222-8567 (Japan)


    The selenomethionyl-substituted transpeptidase domain of penicillin-binding protein (PBP) 2B from S. pneumoniae was isolated from a limited proteolysis digest of the soluble form of recombinant PBP 2B and then crystallized. MAD data were collected to 2.4 Å resolution. Penicillin-binding protein (PBP) 2B from Streptococcus pneumoniae catalyzes the cross-linking of peptidoglycan precursors that occurs during bacterial cell-wall biosynthesis. A selenomethionyl (SeMet) substituted PBP 2B transpeptidase domain was isolated from a limited proteolysis digest of a soluble form of recombinant PBP 2B and then crystallized. The crystals belonged to space group P4{sub 3}2{sub 1}2, with unit-cell parameters a = b = 86.39, c = 143.27 Å. Diffraction data were collected to 2.4 Å resolution using the BL32B2 beamline at SPring-8. The asymmetric unit contains one protein molecule and 63.7% solvent.

  9. Epidemiological study on the penicillin resistance of clinical Streptococcus pneumoniae isolates identified as the common sequence types. (United States)

    Gao, Wei; Shi, Wei; Chen, Chang-hui; Wen, De-nian; Tian, Jin; Yao, Kai-hu


    There were some limitation in the current interpretation about the penicillin resistance mechanism of clinical Streptococcus pneumoniae isolates at the strain level. To explore the possibilities of studying the mechanism based on the sequence types (ST) of this bacteria, 488 isolates collected in Beijing from 1997-2014 and 88 isolates collected in Youyang County, Chongqing and Zhongjiang County, Sichuan in 2015 were analyzed by penicillin minimum inhibitory concentration (MIC) distribution and annual distribution. The results showed that the penicillin MICs of the all isolates covering by the given ST in Beijing have a defined range, either penicillin MIC penicillin MICs in the first few years after it was identified. The penicillin MIC of isolates identified as common STs and collected in Youyang County, Chongqing and Sichuan Zhongjiang County, including the ST271, ST320 and ST81, was around 0.25~2 mg/L (≥0.25 mg/L). Our study revealed the epidemiological distribution of penicillin MICs of the given STs determined in clinical S. pneumoniae isolates, suggesting that it is reasonable to research the penicillin resistance mechanism based on the STs of this bacteria.

  10. Outcome of meningitis caused by Streptococcus pneumoniae and Haemophilus influenzae type b in children in The Gambia. (United States)

    Goetghebuer, T; West, T E; Wermenbol, V; Cadbury, A L; Milligan, P; Lloyd-Evans, N; Adegbola, R A; Mulholland, E K; Greenwood, B M; Weber, M W


    In developing countries, endemic childhood meningitis is a severe disease caused most commonly by Streptococcus pneumoniae or Haemophilus influenzae type b (Hib). Although many studies have shown that fatality rates associated with meningitis caused by these organisms are high in developing countries, little is known about the long-term outcome of survivors. The purpose of this study was to assess the importance of disabilities following pneumococcal and Hib meningitis in The Gambia. 257 children aged 0-12 years hospitalized between 1990 and 1995 with culture-proven S. pneumoniae (n = 134) or Hib (n = 123) meningitis were included retrospectively in the study. 48% of children with pneumococcal meningitis and 27% of children with Hib meningitis died whilst in hospital. Of the 160 survivors, 89 (55%) were followed up between September 1996 and October 1997. Of the children with pneumococcal meningitis that were traced, 58% had clinical sequelae; half of them had major disabilities preventing normal adaptation to social life. 38% of survivors of Hib meningitis had clinical sequelae, a quarter of whom had major disabilities. Major handicaps found were hearing loss, mental retardation, motor abnormalities and seizures. These data show that despite treatment with effective antibiotics, pneumococcal and Hib meningitis kill many Gambian children and leave many survivors with severe sequelae. Hib vaccination is now given routinely in The Gambia; an effective pneumococcal vaccine is needed.

  11. LocZ Is a New Cell Division Protein Involved in Proper Septum Placement in Streptococcus pneumoniae (United States)

    Holečková, Nela; Molle, Virginie; Buriánková, Karolína; Benada, Oldřich; Kofroňová, Olga; Ulrych, Aleš; Branny, Pavel


    ABSTRACT How bacteria control proper septum placement at midcell, to guarantee the generation of identical daughter cells, is still largely unknown. Although different systems involved in the selection of the division site have been described in selected species, these do not appear to be widely conserved. Here, we report that LocZ (Spr0334), a newly identified cell division protein, is involved in proper septum placement in Streptococcus pneumoniae. We show that locZ is not essential but that its deletion results in cell division defects and shape deformation, causing cells to divide asymmetrically and generate unequally sized, occasionally anucleated, daughter cells. LocZ has a unique localization profile. It arrives early at midcell, before FtsZ and FtsA, and leaves the septum early, apparently moving along with the equatorial rings that mark the future division sites. Consistently, cells lacking LocZ also show misplacement of the Z-ring, suggesting that it could act as a positive regulator to determine septum placement. LocZ was identified as a substrate of the Ser/Thr protein kinase StkP, which regulates cell division in S. pneumoniae. Interestingly, homologues of LocZ are found only in streptococci, lactococci, and enterococci, indicating that this close phylogenetically related group of bacteria evolved a specific solution to spatially regulate cell division. PMID:25550321

  12. Caracterización molecular de aislamientos invasores colombianos de Streptococcus pneumoniae serotipo 5 recuperados entre 1994 y 2004.

    Directory of Open Access Journals (Sweden)

    Carolina Firacative


    Full Text Available Introducción. Streptococcus pneumoniae serotipo 5 es causa importante de enfermedad invasora en Colombia, donde se ha demostrado la circulación del clon 19-Colombia(5 susceptible a penicilina pero resistente a tetraciclina y a cloranfenicol. Objetivo. Establecer las relaciones genéticas de aislamientos invasores colombianos de S. pneumoniae serotipo 5 recuperados entre 1994 y 2004 con el clon 19-Colombia(5. Materiales y métodos. Se estudiaron 83 aislamientos que tenían datos de susceptibilidad a penicilina, vancomicina, ceftriaxona, eritromicina, trimetoprim sulfametoxazol, cloranfenicol y tetraciclina, de los cuales 29 fueron obtenidos de niños menores de cinco años. El patrón de restricción del ADN se determinó por electroforesis en gel de campo pulsado, usando la enzima Sma I. La similitud genética entre los aislamientos y el clon se estableció según los criterios de Tenover y utilizando el programa Fingerprinting II. Resultados. Todos los aislamientos se relacionaron con el clon 19-Colombia5 y se agruparon en el patrón electroforético A con 17 subtipos. El patrón A se estableció en 32 aislamientos (38,6%, el A8 en 18 (21,7% y el A5 en 10 (12%, los 15 patrones restantes agruparon los otros 23 aislamientos. Los 34 aislamientos resistentes a tetraciclina y cloranfenicol mostraron relación con los patrones electroforéticos A (n = 32, A16 (n = 1 y A28 (n = 1, caracterizados, al igual que el clon, por presentar una banda de 340 Kb. Conclusión. Estos resultados muestran la circulación continua en el país de aislamientos de S. pneumoniae serotipo 5 genéticamente relacionados con el clon 19-Colombia(5.

  13. Monitoring changes in membrane polarity, membrane integrity, and intracellular ion concentrations in Streptococcus pneumoniae using fluorescent dyes. (United States)

    Clementi, Emily A; Marks, Laura R; Roche-Håkansson, Hazeline; Håkansson, Anders P


    Membrane depolarization and ion fluxes are events that have been studied extensively in biological systems due to their ability to profoundly impact cellular functions, including energetics and signal transductions. While both fluorescent and electrophysiological methods, including electrode usage and patch-clamping, have been well developed for measuring these events in eukaryotic cells, methodology for measuring similar events in microorganisms have proven more challenging to develop given their small size in combination with the more complex outer surface of bacteria shielding the membrane. During our studies of death-initiation in Streptococcus pneumoniae (pneumococcus), we wanted to elucidate the role of membrane events, including changes in polarity, integrity, and intracellular ion concentrations. Searching the literature, we found that very few studies exist. Other investigators had monitored radioisotope uptake or equilibrium to measure ion fluxes and membrane potential and a limited number of studies, mostly in Gram-negative organisms, had seen some success using carbocyanine or oxonol fluorescent dyes to measure membrane potential, or loading bacteria with cell-permeant acetoxymethyl (AM) ester versions of ion-sensitive fluorescent indicator dyes. We therefore established and optimized protocols for measuring membrane potential, rupture, and ion-transport in the Gram-positive organism S. pneumoniae. We developed protocols using the bis-oxonol dye DiBAC4(3) and the cell-impermeant dye propidium iodide to measure membrane depolarization and rupture, respectively, as well as methods to optimally load the pneumococci with the AM esters of the ratiometric dyes Fura-2, PBFI, and BCECF to detect changes in intracellular concentrations of Ca(2+), K(+), and H(+), respectively, using a fluorescence-detection plate reader. These protocols are the first of their kind for the pneumococcus and the majority of these dyes have not been used in any other bacterial

  14. [Macrolide-resistant Streptococcus pneumoniae on the islands of Gran Canaria and Lanzarote (Spain): molecular mechanisms and serogroup relationships]. (United States)

    Artiles, Fernando; Horcajada-Herrera, Iballa; Noguera-Catalán, Javier; Alamo-Antúnez, Isabel; Bordes-Benítez, Ana; Lafarga-Capuz, Bernardo


    Macrolide resistance in Streptococcus pneumoniae is coded by the ermB and mefA/E genes. The aim of this study was to determine the status of macrolide-resistance, the molecular mechanisms involved, the serogroup relationships, and the level of co-resistance in S. pneumoniae isolates from Gran Canaria and Lanzarote, in the Canary Islands, Spain. Macrolide resistance phenotypes were investigated in 261 S. pneumoniae clinical isolates over a two-year period (2004 and 2005). Genotypes were determined by PCR (detection of ermB and mefA/E genes). Overall macrolide resistance was 40.6% (106 isolates); 79.2% (84) of resistant isolates presented the MLSB phenotype (98.8% harbored the ermB gene), with a predominance of serogroup 19, and 20.8% (22) presented the M phenotype (77.3% displayed the mefA/E gene), all associated with serogroup 14. Worthy of note, the M phenotype was found in 8 invasive isolates from Lanzarote (80%) all from serogroup 14. The ermB and mefA/E genes were detected in 7 isolates belonging to serogroup 19. Absence of co-resistance was observed most frequently in serogroup 14 (66.7%). Co-resistance with penicillin G, tetracycline, and trimethoprim-sulfamethoxazole was associated with serogroup 19 (36.8%). Two isolates (0.8%) were resistant to telithromycin. The frequency of macrolide resistance mechanisms in the Canary Islands is different from that observed in the rest of Spain, particularly in Lanzarote, where 80% of isolates harbored the mefA/E gene and belonged to serogroup 14.

  15. Antagonism between penicillin and erythromycin against Streptococcus pneumoniae in vitro and in vivo

    DEFF Research Database (Denmark)

    Johansen, H K; Jensen, T G; Dessau, R B


    The combination of beta-lactam antibiotics and macrolides is often recommended for the initial empirical treatment of acute pneumonia in order to obtain activity against the most important pathogens. Theoretically, this combination may be inexpedient, as the bacteriostatic agent may antagonize th...

  16. Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P


    In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase

  17. A reação em cadeia da polimerase na detecção da resistência à penicilina em Streptococcus pneumoniae


    Zettler,Eduardo Walker; Scheibe,Rosane M.; Dias,Cícero A. G.; Santafé,Patrícia; Moreira,José da Silva; Santos,Diógenes S.; Fritscher,Carlos Cezar


    INTRODUÇÃO: O Streptococcus pneumoniae é o mais freqüente agente etiológico de infecções respiratórias adquiridas na comunidade e sua resistência aos antimicrobianos tem aumentado nos últimos anos. A determinação da resistência é feita rotineiramente por método lento que depende do crescimento em cultura e determinação da concentração inibitória mínima (CIM). A reação em cadeia da polimerase (PCR) detecta os genes responsáveis pela resistência do Streptococcus pneumoniae a penicilina em cerca...

  18. A Cross-sectional Survey Assessing Carriage of Streptococcus pneumoniae in a Healthy Population in Xinjiang Uygur Autonomous Region of China. (United States)

    Xie, Na; Chen, Zhao Yun; Chen, Tao; Zhu, Bing Qing; Xu, Li; Gao, Yuan; Zhang, Ai Yu; Zhao, Pan; Liu, Ji Wen; Shao, Zhu Jun


    The carriage rate and serotype distribution of Streptococcus pneumoniae (S. pneumoniae) in a healthy population in China remains unclear. In this study, we collected the oropharyngeal swabs from 513 individuals in Xinjiang, China. Real-time PCR targeting the lytA gene and 12 serotypes were assessed to identify S. pneumoniae carriage. The total carriage rate of S. pneumoniae was 70.4% (361/513). The most prevalent serotypes were 19B/F, 18B/C, 5, and 6A/B. The highest carriage rate of S. pneumoniae was noted in children aged 6-10 years (88.6%), which merits further attention. The co-colonization rate of two or more S. pneumoniae serotypes was 79.8% (264/331). This study aimed to investigate the baseline pneumococcal carriage rate among healthy individuals in China to improve our understanding of the epidemiology of S. pneumoniae. Copyright © 2018 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  19. The influence of Streptococcus pneumoniae nasopharyngeal colonization on the clinical outcome of the respiratory tract infections in preschool children. (United States)

    Petraitiene, Sigita; Alasevicius, Tomas; Staceviciene, Indre; Vaiciuniene, Daiva; Kacergius, Tomas; Usonis, Vytautas


    Streptococcus pneumoniae (SPn) is an important pathogen causing a variety of clinical manifestations. The effects of SPn nasopharyngeal colonization on respiratory tract infections are poorly studied. We evaluated the association of SPn colonization with features of respiratory tract infections. Children under the age of 6 years who visited a primary care physician because of respiratory tract infections were enrolled in the study. History was taken, children were clinically assessed by the physician, and nasopharyngeal swabs were obtained and cultured for SPn. Positive samples were serotyped. Associations of SPn colonization with clinical signs and symptoms, recovery duration, absence from day care centre, frequencies of specific diagnoses, and treatment with antimicrobials were evaluated. In total 900 children were enrolled. The prevalence of SPn colonization was 40.8 % (n = 367). There were minor differences between male and female subjects (199 of 492, 40.4 % vs 168 of 408, 41.2 %, p = 0.825). Children with and without siblings had similar colonization rates (145 of 334, 43.4 % vs 219 of 562, 39.0 %, p = 0.187). Clinical signs and symptoms were not associated with SPn colonization. Children colonized with SPn had longer recovery duration compared to non-colonized children (114 of 367, 31.1 % vs 98 of 533, 18.4 %, p vs 94 of 284, 33.1 %, p = 0.001). Pneumonia, sinusitis, and acute otitis media were more frequently diagnosed in children colonized with SPn. Children attending day care centres had significantly higher prevalence of SPn colonization (270 of 367, 44.4 % vs 338 of 533, 33.1 %, p = 0.001). Children with pneumonia, sinusitis and acute otitis media were more frequently treated with antimicrobials than children with other diagnoses. SPn nasopharyngeal colonization has a negative impact on the course of respiratory tract infection, likely because of SPn being the cause of the disease or a complicating factor. It is also associated

  20. Penicillin-resistant viridans streptococci have obtained altered penicillin-binding protein genes from penicillin-resistant strains of Streptococcus pneumoniae.


    Dowson, C G; Hutchison, A; Woodford, N; Johnson, A P; George, R C; Spratt, B G


    Penicillin-resistant strains of Streptococcus pneumoniae possess altered forms of penicillin-binding proteins (PBPs) with decreased affinity for penicillin. The PBP2B genes of these strains have a mosaic structure, consisting of regions that are very similar to those in penicillin-sensitive strains, alternating with regions that are highly diverged. Penicillin-resistant strains of viridans groups streptococci (e.g., S. sanguis and S. oralis) that produce altered PBPs have also been reported. ...

  1. Internamento devido a PAC por Streptococcus pneumoniae – Avaliação de factores de mortalidade

    Directory of Open Access Journals (Sweden)

    Sandra Figueiredo


    Full Text Available Resumo: A avaliação da gravidade perante qualquer caso de pneumonia adquirida na comunidade (PAC é de suma importância, pois dela decorrem decisões como a necessidade de internamento e o tratamento empírico inicial. Os autores apresentam um estudo retrospectivo, que incluiu doentes internados devido a pneumonia por Streptococcus pneumoniae durante o ano de 2006, no Hospital de São João. A confirmação etiológica de infecção foi feita por isolamentos no sangue, líquido pleural, secreções traqueobrônquicas, lavado brônquico, lavado broncoalveolar e pesquisa de antigenúria. Foram analisados os factores de risco e avaliados, com base nas normas PSI (Pneumonia Severity Index e da British Thoracic Society (BTS -CURB-65. A análise estatística foi efectuada utilizando teste T para amostras independentes e ANOVA, usando o programa de análise estatística SPSS 14.0.Foram incluídos 104 doentes com idade mediana de 63 anos, sendo 67,3% do sexo masculino. O estudo revelou existir uma associação com significado estatístico entre os resultados de PSI e CURB-65 e a evolução para a mortalidade.Apesar da melhoria dos meios diagnósticos e profilácticos, e da terapêutica antibiótica, a pneumonia pneumocócica permanece uma entidade de grande morbilidade e mortalidade. O valor preditivo das normas PSI e CURB-65 foi confirmado nesta população de doentes, documentando uma correlação entre o número de factores de risco e a evolução da doença.Rev Port Pneumol 2008; XIV (5: 601-615 Abstract: Probably the most important decision in the management of Community-Acquired Pneumonia (CAP is patient site of care. Patients with Streptococcus pneumoniae-caused CAP admitted to our hospital between 1st January and 31st December 2006 were retrospectively analysed. Samples of blood, sputum, bronchial and bronchoalveolar lavage and urine were collected for

  2. In vitro activity of fluoroquinolones (gatifloxacin, levofloxacin and trovafloxacin and seven other antibiotics against Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Nicodemo A.C.


    Full Text Available In recent years, the level of resistance of S. pneumoniae to beta-lactam and/or macrolides has increased around the world including some countries in South America. Because of this resistance, it is necessary to test the therapeutic alternatives for treating this pathogen, including the newer quinolones. This study was carried out in order to compare the in vitro activity of fluoroquinolones gatifloxacin, levofloxacin and trovafloxacin, to penicillin G, amoxicillin, amoxicillin-clavulanate, cufuroxime sodium, ceftriaxone, azithromycin and clarithromycin, against 300 strains of S. pneumoniae. Of the 300 samples tested, 18.6% were not susceptible to penicillin (56 strains and 7% (21 strains were resistant to the second generation cephalosporin. Among the macrolides, resistance ranged from 6.7% for clarithromycin to 29.6% for azithromycin. Susceptibility to the newer quinolones was 100% including the 56 strains not susceptible to penicillin. Among the 10 antibiotics evaluated, the fluoroquinolones gatifloxacin, levofloxacin, and trovafloxacin displayed high levels of in vitro activity against S. pneumoniae.

  3. Role of Streptococcus pneumoniae OM001 operon in capsular polysaccharide production, virulence and survival in human saliva. (United States)

    Ahmad, Zuleeza; Harvey, Richard M; Paton, James C; Standish, Alistair J; Morona, Renato


    Streptococcus pneumoniae is the leading cause of community-acquired pneumonia in all ages worldwide, and with ever-increasing antibiotic resistance, the understanding of its pathogenesis and spread is as important as ever. Recently, we reported the presence of a Low Molecular Weight Tyrosine Phosphatase (LMWPTP) Spd1837 in the pneumococcus. This protein is encoded in an operon, OM001 with two other genes, with previous work implicating this operon as important for pneumococcal virulence. Thus, we set out to investigate the role of the individual genes in the operon during pneumococcal pathogenesis. As LMWPTPs play a major role in capsular polysaccharide (CPS) biosynthesis in many bacteria, we tested the effect of mutating spd1837 and its adjacent genes, spd1836 and spd1838 on CPS levels. Our results suggest that individual deletion of the genes, including the LMWPTP, did not modulate CPS levels, in multiple conditions, and in different strain backgrounds. Following in vivo studies, Spd1836 was identified as a novel virulence factor during pneumococcal invasive disease, in both the lungs and blood, with this protein alone responsible for the effects of operon's role in virulence. We also showed that a deletion in spd1836, spd1838 or the overall OM001 operon reduced survival in human saliva during the conditions that mimic transmission compared to the wildtype strain. With studies suggesting that survival in human saliva may be important for transmission, this study identifies Spd1836 and Spd1838 as transmission factors, potentially facilitating the spread of the pneumococcus from person to person. Overall, this study hopes to further our understanding of the bacterial transmission that precedes disease and outbreaks.

  4. Redistribution of Streptococcus pneumoniae Serotypes After Nationwide 13-valent Pneumococcal Conjugate Vaccine Program in Children in Northern Taiwan. (United States)

    Cho, Ying-Chun; Chiu, Nan-Chang; Lu, Chun-Yi; Huang, Daniel Tsung-Ning; Huang, Fu-Yuan; Chang, Luan-Yin; Huang, Li-Min; Chi, Hsin


    After the introduction of 13-valent pneumococcal conjugate vaccine (PCV13) against Streptococcus pneumoniae, public health officials in Taiwan monitored a decline in circulating vaccine serotypes and the emergence of nonvaccine serotypes in children with invasive pneumococcal disease. A gradually expanded PCV13 national immunization program was launched in 2013 in Taiwan. Here, we evaluate the changes in the distribution of pneumococcal serotypes and antimicrobial nonsusceptibility in children during the evolution of vaccination policy. S. pneumoniae isolates from children with pneumococcal disease were collected and serotyped from 2010 to 2015 in northern Taiwan. PCVs were administered at the recipients' expense between 2010 and 2012, and then PCV13 was partially reimbursed by the government beginning in 2013. The distribution and diversity of serotypes were analyzed along with their antimicrobial susceptibilities. Among a total of 498 isolates, the proportion of invasive pneumococcal disease isolates declined (47.1%-10.6%) during the study period, and serotype diversity increased after 2011. Between 2010 and 2012, the dominant serotypes were 19A, 19F, 3, 6B and 14, and serotype 19A rose from 44.1% to 57.5%. Serotypes 19A, 15A, 19F and 15B were more prevalent from 2013 to 2015, and serotype 19A decreased from 42.1% to 4.5%. Serotypes 19F and 15A became the most commonly detected serotypes in 2015. Overall, PCV13 additional serotypes were reduced by 80% (P program is effective against pneumococcal disease in Taiwanese children, mainly by reducing PCV13 additional serotypes.

  5. Pneumonia (United States)

    ... may have received extra vaccinations and disease-preventing antibiotics to help prevent pneumonia and other infections caused by bacteria. ... patients are hospitalized, treatment might include intravenous (IV) antibiotics ... Can I Help Myself Feel Better? If your doctor has prescribed ...

  6. Colonização e resistência antimicrobiana de Streptococcus pneumoniae isolado em nasofaringe de crianças com rinofaringite aguda Nasopharyngeal colonization and antimicrobial resistance of Streptococcus pneumoniae isolated in children with acute rinofaringitis

    Directory of Open Access Journals (Sweden)

    Lêda Lúcia M. Ferreira


    ças com infecção respiratória alta podem ser usados na vigilância da resistência antimicrobiana numa determinada comunidade.OBJECTIVE: to determine the prevalence and risk factors for nasopharyngeal colonization by, and to evaluate antimicrobial susceptibility of Streptococcus pneumoniae strains in children with acute rhinopharyngitis. METHODS: we collected nasopharyngeal swab specimens from 400 children aged 3 months to 5 years and with clinical status of acute rhinopharyngitis from June 16, 1997 to May 20, 1998 at the outpatient clinics of two hospitals in the city of São Paulo. Nasopharyngeal specimens were collected pernasally using a calcium alginate swab and plated immediately after collection onto trypticose soy agar with 5% sheep blood and garamicin 5 mcg/ml. Penicillin susceptibility was determined by oxacillin 1 mcg disk screening test and the minimal inhibitory concentration by the E-test. RESULTS: Pneumococci were recovered from 139 children, indicating a colonization prevalence of 35%. The risk factors analyzed indicated that the colonization was more prevalent in children attending day-care centers, children with siblings younger than 5 years, and children with recent use of antimicrobial agents. The prevalence of penicillin non-susceptible strains was of 16 % (20 strains. All strains were intermediately resistant (0.1mcg/ ml < MIC < 1.0 mcg/ ml. Out of the penicillin intermediately resistant strains, 7 (37% showed intermediate resistance to cotrimoxazol and 2 (11% full resistance to trimethoprim-sulfamethoxazole. No strains were resistant to ceftriaxone, amoxicillin, clarithromicin, or chloramphenicol. CONCLUSIONS: our findings indicate that the prevalence of nasopharyngeal colonization by Streptococcus pneumoniae in children with upper respiratory infections was of 34.8%. Children attending day-care centers and children with younger siblings showed higher levels of colonization The results of prevalence of bacterial resistance were similar to those

  7. Antimicrobial resistance in Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis and group A beta-haemolytic streptococci in 2002-2003. Results of the multinational GRASP Surveillance Program

    DEFF Research Database (Denmark)

    Beekmann, Susan E; Heilmann, Kris P; Richter, Sandra S


    A multinational surveillance study, GRASP, was conducted between November 2002 and April 2003 with the aim of assessing rates of antimicrobial resistance among 2656 isolates of Streptococcus pneumoniae, 2486 isolates of group A beta-haemolytic streptococci, 1358 isolates of Haemophilus influenzae...... and 1047 of Moraxella catarrhalis from 20 countries in Europe, eastern Asia and southern Africa. Conspicuous differences between various countries were noted in the S. pneumoniae resistance rates observed for penicillin (0-79.2%) and erythromycin (4-66%), along with other antimicrobials. The percentage...... of MDR strains was above 25% in 8 of the 20 countries studied. Group A streptococcal macrolide resistance rates ranged from 0% to 35% by country, while rates of beta-lactamase production ranged from 0% to 39% for H. influenzae and 80-100% for M. catarrhalis. Antibiotic resistance in S. pneumoniae remains...

  8. Live Streptococcus pneumoniae, Haemophilus influenzae, and Neisseria meningitidis activate the inflammatory response trhough Toll-like receptors 2, 4, and 9 in species-specific patterns

    DEFF Research Database (Denmark)

    Mogensen, T.H.; Paludan, Søren Riis; Kilian, Mogens


    activation by live bacteria. Here, we demonstrate that live Streptococcus pneumoniae, Haemophilus influenzae type b, and Neisseria meningitidis, the three principal causes of bacterial meningitis, use distinct sets of TLRs to trigger the inflammatory response. Using human embryonic kidney 293 cell lines......, each overexpressing one type of TLR, we found that S. pneumoniae triggered activation of the transcription factor nuclear factor-kappaB and expression of interleukin-8, only in cells expressing TLR2 or -9. The same response was evoked by H. influenzae in cells expressing TLR2 or -4 and by N...... and confirmed the essential role of these TLRs and also identified differential functions of TLRs in activation of the inflammatory response. Collectively, we here demonstrate that S. pneumoniae, H. influenzae, and N. meningitidis each activate several TLRs in species-specific patterns and show that infection...

  9. Differences in genotype and virulence among four multidrug-resistant Streptococcus pneumoniae isolates belonging to the PMEN1 clone.

    Directory of Open Access Journals (Sweden)

    N Luisa Hiller

    Full Text Available We report on the comparative genomics and characterization of the virulence phenotypes of four S. pneumoniae strains that belong to the multidrug resistant clone PMEN1 (Spain(23F ST81. Strains SV35-T23 and SV36-T3 were recovered in 1996 from the nasopharynx of patients at an AIDS hospice in New York. Strain SV36-T3 expressed capsule type 3 which is unusual for this clone and represents the product of an in vivo capsular switch event. A third PMEN1 isolate - PN4595-T23 - was recovered in 1996 from the nasopharynx of a child attending day care in Portugal, and a fourth strain - ATCC700669 - was originally isolated from a patient with pneumococcal disease in Spain in 1984. We compared the genomes among four PMEN1 strains and 47 previously sequenced pneumococcal isolates for gene possession differences and allelic variations within core genes. In contrast to the 47 strains - representing a variety of clonal types - the four PMEN1 strains grouped closely together, demonstrating high genomic conservation within this lineage relative to the rest of the species. In the four PMEN1 strains allelic and gene possession differences were clustered into 18 genomic regions including the capsule, the blp bacteriocins, erythromycin resistance, the MM1-2008 prophage and multiple cell wall anchored proteins. In spite of their genomic similarity, the high resolution chinchilla model was able to detect variations in virulence properties of the PMEN1 strains highlighting how small genic or allelic variation can lead to significant changes in pathogenicity and making this set of strains ideal for the identification of novel virulence determinants.

  10. The LuxS/AI-2 Quorum-Sensing System of Streptococcus pneumoniae Is Required to Cause Disease, and to Regulate Virulence- and Metabolism-Related Genes in a Rat Model of Middle Ear Infection

    Directory of Open Access Journals (Sweden)

    Mukesh K. Yadav


    Full Text Available Objective:Streptococcus pneumoniae colonizes the nasopharynx of children, and from nasopharynx it could migrate to the middle ear and causes acute otitis media (AOM. During colonization and AOM, the pneumococcus forms biofilms. In vitro biofilm formation requires a functional LuxS/AI-2 quorum-sensing system. We investigated the role of LuxS/AI-2 signaling in pneumococcal middle ear infection, and identified the genes that are regulated by LuxS/AI-2 during pneumococcal biofilm formation.Methods:Streptococcus pneumoniae D39 wild-type and an isogenic D39ΔluxS strain were utilized to evaluate in vitro biofilm formation, and in vivo colonization and epithelial damage using a microtiter plate assay and a rat model of pneumococcal middle ear infection, respectively. Biofilm structures and colonization and epithelial damage were evaluated at the ultrastructural level by scanning electron microscopy and confocal microscopy. Microarrays were used to investigate the global genes that were regulated by LuxS/AI-2 during biofilm formation.Results: The biofilm biomass and density of D39ΔluxS were significantly (p < 0.05 lower than those of D39 wild-type. SEM and confocal microscopy revealed that D39ΔluxS formed thin biofilms in vitro compared with D39 wild-type. The in vivo model of middle ear infection showed that D39ΔluxS resulted in ~60% less (p < 0.05 bacterial colonization than the wild-type. SEM analysis of the rat middle ears revealed dense biofilm-like cell debris deposited on the cilia in wild-type D39-infected rats. However, little cell debris was deposited in the middle ears of the D39ΔluxS-inoculated rats, and the cilia were visible. cDNA-microarray analysis revealed 117 differentially expressed genes in D39ΔluxS compared with D39 wild-type. Among the 66 genes encoding putative proteins and previously characterized proteins, 60 were significantly downregulated, whereas 6 were upregulated. Functional annotation revealed that genes involved in

  11. Streptococcus pneumoniae and Haemophilus influenzae as etiological agents of conjunctivitis outbreaks in the region of Ribeirão Preto, SP, Brazil

    Directory of Open Access Journals (Sweden)

    Marta I. C. MEDEIROS


    Full Text Available In the study of conjunctivitis outbreaks occurring from September 1994 to September 1996 in the region of Ribeirão Preto, conjunctival exudates of 92 patients were cultivated in Instituto Adolfo Lutz Laboratory I, Ribeirão Preto. Most cases occurred in the age range 2-7 years. The etiological agents which were most frequently isolated from the analyzed cases were: Streptococcus pneumoniae and Haemophilus influenzae, in 40.22% and 21.74%, respectively. 51.35% of the S. pneumoniae isolated strains were not typable. The oxacillin-resistant S. pneumoniae strains were submitted to the minimum inhibitory concentration test (MIC and three of them presented intermediate resistance, whereas only one was highly resistant to penicillin.No estudo de surtos de conjuntivite ocorridos no período de setembro de 1994 a setembro de 1996, na região de Ribeirão Preto, foram semeadas no Instituto Adolfo Lutz Laboratório I, Ribeirão Preto, exsudatos conjuntivais de 92 pacientes, sendo que a maioria dos casos estava na faixa etária de 2-7 anos. Os agentes etiológicos mais freqüentemente isolados dos casos analisados foram: Streptococcus pneumoniae e Haemophilus influenzae em 40,22% e 21,74% respectivamente. 51,35% das cepas de S. pneumoniae isoladas foram não tipáveis. As cepas de S. pneumoniae oxacilina resistente foram submetidas ao teste de concentração inibitória mínima (CIM, sendo que três apresentaram resistência intermediária e apenas uma foi altamente resistente à penicilina.

  12. Conserved Streptococcus pneumoniae spirosomes suggest a single type of transformation pilus in competence.

    Directory of Open Access Journals (Sweden)

    Raphaël Laurenceau


    Full Text Available The success of S. pneumoniae as a major human pathogen is largely due to its remarkable genomic plasticity, allowing efficient escape from antimicrobials action and host immune response. Natural transformation, or the active uptake and chromosomal integration of exogenous DNA during the transitory differentiated state competence, is the main mechanism for horizontal gene transfer and genomic makeover in pneumococci. Although transforming DNA has been proposed to be captured by Type 4 pili (T4P in Gram-negative bacteria, and a competence-inducible comG operon encoding proteins homologous to T4P-biogenesis components is present in transformable Gram-positive bacteria, a prevailing hypothesis has been that S. pneumoniae assembles only short pseudopili to destabilize the cell wall for DNA entry. We recently identified a micrometer-sized T4P-like pilus on competent pneumococci, which likely serves as initial DNA receptor. A subsequent study, however, visualized a different structure--short, 'plaited' polymers--released in the medium of competent S. pneumoniae. Biochemical observation of concurrent pilin secretion led the authors to propose that the 'plaited' structures correspond to transformation pili acting as peptidoglycan drills that leave DNA entry pores upon secretion. Here we show that the 'plaited' filaments are not related to natural transformation as they are released by non-competent pneumococci, as well as by cells with disrupted pilus biogenesis components. Combining electron microscopy visualization with structural, biochemical and proteomic analyses, we further identify the 'plaited' polymers as spirosomes: macromolecular assemblies of the fermentative acetaldehyde-alcohol dehydrogenase enzyme AdhE that is well conserved in a broad range of Gram-positive and Gram-negative bacteria.

  13. Multidrug-resistant Streptococcus pneumoniae isolates from healthy Ghanaian preschool children

    DEFF Research Database (Denmark)

    Dayie, Nicholas Tete Kwaku Dzifa; Arhin, Reuben E.; Newman, Mercy J.


    in a previous study, to six antimicrobials was determined by disk diffusion test. Overall, 90.4% of isolates were intermediate penicillin resistant, 99.1% were trimethoprim resistant, 73.0% were tetracycline resistant, and 33.9% were sulfamethoxazole resistant. Low resistance was recorded for erythromycin (2...... of this study was to determine the antibiogram of S. pneumoniae recovered from Ghanaian children younger than six years of age and to what extent resistances were due to the spread of certain sero- and multilocus sequence typing (MLST) types. The susceptibility of 115 pneumococcal isolates, recovered...

  14. A modified Janus cassette (Sweet Janus to improve allelic replacement efficiency by high-stringency negative selection in Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Yuan Li

    Full Text Available The Janus cassette permits marker-free allelic replacement or knockout in streptomycin-resistant Streptococcus pneumoniae (pneumococcus through sequential positive and negative selection. Spontaneous revertants of Janus can lead to high level of false-positives during negative selection, which necessitate a time-consuming post-selection screening process. We hypothesized that an additional counter-selectable marker in Janus would decrease the revertant frequency and reduce false-positives, since simultaneous reversion of both counter-selectable makers is much less likely. Here we report a modified cassette, Sweet Janus (SJ, in which the sacB gene from Bacillus subtilis conferring sucrose sensitivity is added to Janus. By using streptomycin and sucrose simultaneously as selective agents, the frequency of SJ double revertants was about 105-fold lower than the frequency of Janus revertants. Accordingly, the frequency of false-positives in the SJ-mediated negative selection was about 100-fold lower than what was seen for Janus. Thus, SJ enhances negative selection stringency and can accelerate allelic replacement in pneumococcus, especially when transformation frequency is low due to strain background or suboptimal transformation conditions. Results also suggested the sacB gene alone can function as a counter-selectable marker in the Gram-positive pneumococcus, which will have the advantage of not requiring a streptomycin-resistant strain for allelic replacement.

  15. 99mTcN-gatifloxacin dithiocarbamate complex. A novel multi-drug-resistance Streptococcus pneumoniae (MRSP) infaction radiotracer

    International Nuclear Information System (INIS)

    Syed Qaiser Shah; Mohammad Rafiullah Khan


    Gatifloxacin (GTN) was derivatized to its dithiocarbamate derivative and its radiolabeling with technetium-99m ( 99m Tc) using the [ 99m Tc≡N] 2+ core was investigated. The appropriateness of the 99m TcN - gatifloxacin dithiocarbamate ( 99m TcN - GTND) complex as a potential multi-drug-resistance Streptococcus pneumoniae (MRSP) infection radiotracer was evaluated in terms of stability in saline, serum, in vitro binding with MRSP and biodistribution in artificially MRSP infected Male Wistar Rats (MWR). In saline the 99m TcN - GTND complex showed more than 90% labeling yield up to 4 h with a maximum yield of 98.25 ± 0.20%, after reconstitution. In serum the 99m TcN - GTND complex showed stability up to 16 h of incubation with the appearance of insignificant 15.95% undesirable side products. The 99m TcN - GTND complex demonstrated saturated in vitro binding with MRSP with a maximum value of 75.50 ± 1.00% (at 90 min). In MWR model of group A, almost six times higher uptake of the labeled GTND was monitored in the muscle of MWR infected with live MRSP as compared to the inflamed and normal muscles. Based on the higher labeling yield in saline, in vitro stability in serum, saturated in vitro binding with live MRSP and promising biodistribution in MWR model we recommend 99m TcN - gatifloxacin dithiocarbamate complex as a potential MRSP infection radiotracer. (author)

  16. PASTA repeats of the protein kinase StkP interconnect cell constriction and separation of Streptococcus pneumoniae. (United States)

    Zucchini, Laure; Mercy, Chryslène; Garcia, Pierre Simon; Cluzel, Caroline; Gueguen-Chaignon, Virginie; Galisson, Frédéric; Freton, Céline; Guiral, Sébastien; Brochier-Armanet, Céline; Gouet, Patrice; Grangeasse, Christophe


    Eukaryotic-like serine/threonine kinases (eSTKs) with extracellular PASTA repeats are key membrane regulators of bacterial cell division. How PASTA repeats govern eSTK activation and function remains elusive. Using evolution- and structural-guided approaches combined with cell imaging, we disentangle the role of each PASTA repeat of the eSTK StkP from Streptococcus pneumoniae. While the three membrane-proximal PASTA repeats behave as interchangeable modules required for the activation of StkP independently of cell wall binding, they also control the septal cell wall thickness. In contrast, the fourth and membrane-distal PASTA repeat directs StkP localization at the division septum and encompasses a specific motif that is critical for final cell separation through interaction with the cell wall hydrolase LytB. We propose a model in which the extracellular four-PASTA domain of StkP plays a dual function in interconnecting the phosphorylation of StkP endogenous targets along with septal cell wall remodelling to allow cell division of the pneumococcus.

  17. Residence of Streptococcus pneumoniae and Moraxella catarrhalis within polymicrobial biofilm promotes antibiotic resistance and bacterial persistence in vivo. (United States)

    Perez, Antonia C; Pang, Bing; King, Lauren B; Tan, Li; Murrah, Kyle A; Reimche, Jennifer L; Wren, John T; Richardson, Stephen H; Ghandi, Uma; Swords, W Edward


    Otitis media (OM) is an extremely common pediatric ailment caused by opportunists that reside within the nasopharynx. Inflammation within the upper airway can promote ascension of these opportunists into the middle ear chamber. OM can be chronic/recurrent in nature, and a wealth of data indicates that in these cases, the bacteria persist within biofilms. Epidemiological data demonstrate that most cases of OM are polymicrobial, which may have significant impact on antibiotic resistance. In this study, we used in vitro biofilm assays and rodent infection models to examine the impact of polymicrobial infection with Moraxella catarrhalis and Streptococcus pneumoniae (pneumococcus) on biofilm resistance to antibiotic treatment and persistence in vivo. Consistent with prior work, M. catarrhalis conferred beta-lactamase-dependent passive protection from beta-lactam killing to pneumococci within polymicrobial biofilms. Moreover, pneumococci increased resistance of M. catarrhalis to macrolide killing in polymicrobial biofilms. However, pneumococci increased colonization in vivo by M. catarrhalis in a quorum signal-dependent manner. We also found that co-infection with M. catarrhalis affects middle ear ascension of pneumococci in both mice and chinchillas. Therefore, we conclude that residence of M. catarrhalis and pneumococci within the same biofilm community significantly impacts resistance to antibiotic treatment and bacterial persistence in vivo. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  18. UlaR activates expression of the ula operon in Streptococcus pneumoniae in the presence of ascorbic acid. (United States)

    Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P


    In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased in the presence of ascorbic acid as compared with the effects of other sugar sources including glucose. The ula operon consists of nine genes, including a transcriptional regulator UlaR, and is transcribed as a single transcriptional unit. We demonstrate the role of the transcriptional regulator UlaR as a transcriptional activator of the ula operon in the presence of ascorbic acid and show that activation of the ula operon genes by UlaR is CcpA-independent. Furthermore, we predict a 16 bp regulatory site (5'-AACAGTCCGCTGTGTA-3') for UlaR in the promoter region of ulaA. Deletion of the half or full UlaR regulatory site in PulaA confirmed that the UlaR regulatory site present in PulaA is functional. © 2015 The Authors.

  19. Recurrent Streptococcus Pneumoniae Meningitis in a Child with Split Hand and Foot Malformation and Undiagnosed Mondini Dysplasia. (United States)

    Katarzyna, Mazur-Melewska; Jarosław, Szydłowski; Katarzyna, Jończyk-Potoczna; Wojciech, Służewski; Magdalena, Figlerowicz

    Recurrent bacterial meningitis is a life-threatening infection of the central nervous system that is mostly connected with anatomical abnormalities of the skull, chronic parameningeal infections and immunodeficiencies. It's rarely seen, but when it occurs an extensive investigation should be carried out to discover the responsible factor, so that further episodes can be prevented. We report on a child with split hand and foot (SHFM), confirmed incorrect karyotype 46, XY, t(7:12)(q21.2;q21.3) and a fourth episode of fulminant meningitis caused by penicillin-resistant Streptococcus pneumoniae . After a broad evaluation of factors predisposing to recurrent meningitis, the undiagnosed malformation of his inner and middle ears - Mondini dysplasia was found. We suggest examining all children with SHFM for hearing impairment before they develop recurrent meningitis. The time when the radiological procedure for searching for inner ear dysplasia should be performed could be a controversial issue: before or after the first episode of meningitis. From the epidemiological point of view, high-resolution computer tomography scanning of the temporal bones should be considered after the diagnosis of deafness in a child with SHFM related to 7q21 deletion.

  20. Alta prevalência de crianças portadoras de Streptococcus pneumoniae resistentes à penicilina em creches públicas High prevalence of children colonized with penicillin-resistant Streptococcus pneumoniae in public day-care centers

    Directory of Open Access Journals (Sweden)

    Patrícia A. G. Velasquez


    Full Text Available OBJETIVOS: Investigar a prevalência de Streptococcus pneumoniae (pneumococos na nasofaringe de crianças sadias atendidas em creches municipais da cidade de Umuarama (PR. Avaliar a susceptibilidade aos antimicrobianos dos pneumococos isolados. MÉTODOS: Secreção da nasofaringe de 212 crianças foi coletada no período de abril a outubro de 2008. Após semeadura dos espécimes em ágar sangue e incubação a 37 °C por 24-48 horas, as colônias suspeitas de pertencerem a S. pneumoniae foram identificadas pela α-hemólise, sensibilidade à optoquina e bile solubilidade. A susceptibilidade à penicilina foi investigada pelos testes de disco-difusão e de diluição. A susceptibilidade aos demais antimicrobianos indicados no tratamento das infecções pneumocócicas foi realizada por disco-difusão RESULTADOS: A prevalência de pneumococos na nasofaringe foi de 43,4% (92/212, sendo maior em crianças com idade entre 2 e 5 anos (p = 0,0005. Não houve diferença significativa entre os sexos. Resistência intermediária e resistência plena à penicilina foram encontradas respectivamente em 34,8 (32/92 e 22,8% (21/92 dos isolados. Sessenta e sete amostras (72,8% foram resistentes ao sulfametoxazol-trimetoprim, oito (8,7% à eritromicina e seis (6,5% à tetraciclina. Uma amostra apresentou resistência à clindamicina (1,1%, e outra ao cloranfenicol (1,1%. Todas as amostras foram sensíveis a levofloxacina, ofloxacina, rifampicina, telitromicina, linezolide e vancomicina. Nove amostras foram consideradas multirresistentes, por apresentarem resistência a três ou mais classes de antimicrobianos. CONCLUSÕES: O presente estudo registrou uma alta prevalência de crianças portadoras sadias de amostras de S. pneumoniae resistentes à penicilina que podem constituir importantes reservatórios desse patógeno na comunidade.OBJECTIVES: To investigate the prevalence of Streptococcus pneumoniae (pneumococci in the nasopharynx of healthy children enrolled

  1. Multiplex quantitative PCR for detection of lower respiratory tract infection and meningitis caused by Streptococcus pneumoniae, Haemophilus influenzae and Neisseria meningitidis. (United States)

    Abdeldaim, Guma M K; Strålin, Kristoffer; Korsgaard, Jens; Blomberg, Jonas; Welinder-Olsson, Christina; Herrmann, Björn


    Streptococcus pneumoniae and Haemophilus influenzae cause pneumonia and as Neisseria meningitidis they are important agents of meningitis. Although several PCR methods have been described for these bacteria the specificity is an underestimated problem. Here we present a quantitative multiplex real-time PCR (qmPCR) for detection of S. pneumoniae (9802 gene fragment), H. influenzae (omp P6 gene) and N. meningitidis (ctrA gene). The method was evaluated on bronchoalveolar lavage (BAL) samples from 156 adults with lower respiratory tract infection (LRTI) and 31 controls, and on 87 cerebrospinal fluid (CSF) samples from meningitis patients. The analytical sensitivity was not affected by using a combined mixture of reagents and a combined DNA standard (S. pneumoniae/H. influenzae/N. meningitidis) in single tubes. By blood- and BAL-culture and S. pneumoniae urinary antigen test, S. pneumoniae and H. influenzae were aetiological agents in 21 and 31 of the LTRI patients, respectively. These pathogens were identified by qmPCR in 52 and 72 of the cases, respectively, yielding sensitivities and specificities of 95% and 75% for S. pneumoniae, and 90% and 65% for H. influenzae, respectively. When using a cut-off of 10⁵ genome copies/mL for clinical positivity the sensitivities and specificities were 90% and 80% for S. pneumoniae, and 81% and 85% for H. influenzae, respectively. Of 44 culture negative but qmPCR positive for H. influenzae, 41 were confirmed by fucK PCR as H. influenzae. Of the 103 patients who had taken antibiotics prior to sampling, S. pneumoniae and H. influenzae were identified by culture in 6% and 20% of the cases, respectively, and by the qmPCR in 36% and 53% of the cases, respectively.In 87 CSF samples S. pneumoniae and N. meningitidis were identified by culture and/or 16 S rRNA in 14 and 10 samples and by qmPCR in 14 and 10 samples, respectively, giving a sensitivity of 100% and a specificity of 100% for both bacteria. The PCR provides increased

  2. Multiplex quantitative PCR for detection of lower respiratory tract infection and meningitis caused by Streptococcus pneumoniae, Haemophilus influenzae and Neisseria meningitidis

    Directory of Open Access Journals (Sweden)

    Welinder-Olsson Christina


    Full Text Available Abstract Background Streptococcus pneumoniae and Haemophilus influenzae cause pneumonia and as Neisseria meningitidis they are important agents of meningitis. Although several PCR methods have been described for these bacteria the specificity is an underestimated problem. Here we present a quantitative multiplex real-time PCR (qmPCR for detection of S. pneumoniae (9802 gene fragment, H. influenzae (omp P6 gene and N. meningitidis (ctrA gene. The method was evaluated on bronchoalveolar lavage (BAL samples from 156 adults with lower respiratory tract infection (LRTI and 31 controls, and on 87 cerebrospinal fluid (CSF samples from meningitis patients. Results The analytical sensitivity was not affected by using a combined mixture of reagents and a combined DNA standard (S. pneumoniae/H. influenzae/N. meningitidis in single tubes. By blood- and BAL-culture and S. pneumoniae urinary antigen test, S. pneumoniae and H. influenzae were aetiological agents in 21 and 31 of the LTRI patients, respectively. These pathogens were identified by qmPCR in 52 and 72 of the cases, respectively, yielding sensitivities and specificities of 95% and 75% for S. pneumoniae, and 90% and 65% for H. influenzae, respectively. When using a cut-off of 105 genome copies/mL for clinical positivity the sensitivities and specificities were 90% and 80% for S. pneumoniae, and 81% and 85% for H. influenzae, respectively. Of 44 culture negative but qmPCR positive for H. influenzae, 41 were confirmed by fucK PCR as H. influenzae. Of the 103 patients who had taken antibiotics prior to sampling, S. pneumoniae and H. influenzae were identified by culture in 6% and 20% of the cases, respectively, and by the qmPCR in 36% and 53% of the cases, respectively. In 87 CSF samples S. pneumoniae and N. meningitidis were identified by culture and/or 16 S rRNA in 14 and 10 samples and by qmPCR in 14 and 10 samples, respectively, giving a sensitivity of 100% and a specificity of 100% for both

  3. Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae. (United States)

    Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P


    In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase analysis, we demonstrate the role of the transcriptional regulator FcsR, present upstream of the fcs operon, as a transcriptional activator of the fcs operon. We also predict a 19-bp putative FcsR regulatory site (5'-ATTTGAACATTATTCAAGT-3') in the promoter region of the fcs operon. The functionality of this predicted FcsR regulatory site was further confirmed by promoter-truncation experiments, where deletion of half of the FscR regulatory site or full deletion led to the abolition of expression of the fcs operon. © 2015 S. Karger AG, Basel.

  4. Endocarditis in Greenland with special reference to endocarditis caused by Streptococcus pneumoniae

    DEFF Research Database (Denmark)

    Madsen, Rasmus Gaarde; Ladefoged, Karin; Kjaergaard, Jens Jørgen


    OBJECTIVES: The aim of this retrospective study was to determine the incidence and outcome of infectious endocarditis in Greenland with an emphasis on pneumococcal endocarditis. STUDY DESIGN: Retrospective, non-interventional study. METHODS: Review of files and medical history of all patients...... with infectious endocarditis from the Patient Registry in Greenland in the 11-year period 1995-2005. RESULTS: There were 25 cases of endocarditis, giving an incidence rate of 4.0/100,000 per year. Twenty-four percent of these cases were caused by Streptoccous pneumonia, which is significantly more frequent than...... in studies on Caucasian populations, where pneumococcal infection was seen in 1-3% of endocarditis cases. The overall mortality rate was 12%. Pneumococcal endocarditis (PE) had the clinical characteristics of fulminant disease with frequent heart failure, complications and need for surgery. Among cases...

  5. Dot Blot para determinar la identidad antigénica en vacunas conjugadas contra Streptococcus pneumoniae serotipo 19F

    Directory of Open Access Journals (Sweden)

    Osmir Cabrera-Blanco


    Full Text Available Las autoridades regulatorias recomiendan el uso de técnicas de Resonancia Magnética Nuclear o técnicas serológicas para la determinación de la identidad de los antígenos presentes en las vacunas conjugadas. Con la aparición de las vacunas conjugadas multivalentes, se ha hecho necesario recurrir a técnicas inmunoquímicas con la utilización de anticuerpos monoclonales para aumentar la sensibilidad en la determinación de la identidad de los antígenos en dichas vacunas conjugadas. El objetivo del presente trabajo fue establecer las condiciones óptimas de trabajo que permitieran utilizar la técnica del Dot Blot para determinar la identidad de los antígenos en vacunas conjugadas de Streptococcus pneumoniae serotipo 19F. Para ello se estudiaron los tiempos de incubación, la influencia del reactivo en la solución de bloqueo; también las concentraciones óptimas del anticuerpo monoclonal y de los ingredientes farmacéuticos activos, así como los volúmenes de aplicación óptimos para estos y vacunas. Se utilizó un anticuerpo monoclonal contra el polisacárido capsular del serotipo 19F de neumococo. Las muestras empleadas en este trabajo fueron lotes de ingredientes farmacéuticos activos de conjugados de polisacárido capsular 19F y lotes de un candidato vacunal cubano conjugado heptavalente contra neumococos. Los resultados mostraron que para la determinación de la identidad antigénica fueron suficientes 10 µL de muestras de los principios activos a una concentración de 125 µg/mL e igual volumen para las vacunas heptavalentes. Quedó demostrado que una concentración de 1 µg/mL para el anticuerpo monoclonal y tiempos de incubación de 30 min a 37 °C fueron suficientes para la determinación. Estos resultados permiten concluir que quedaron establecidas las condiciones óptimas de trabajo para determinar la identidad antigénica por Dot Blot del polisacárido capsular de S. pneumoniae serotipo 19F presente en las vacunas

  6. Serotype distribution of Streptococcus pneumoniae causing invasive disease in the Republic of Ireland.

    LENUS (Irish Health Repository)

    Vickers, I


    The 7-valent pneumococcal conjugate vaccine (PCV7) was included in the routine infant immunization schedule in Ireland in September 2008. We determined the serotype of 977 S. pneumoniae isolates causing invasive disease between 2000-2002 and 2007-2008, assessed for the presence of the recently described serotype 6C and determined the susceptibility of isolates during 2007-2008 to penicillin and cefotaxime. Serotype 14 was the most common serotype during both periods and 7·7% of isolates previously typed as serotype 6A were serotype 6C. During 2000-2002 and 2007-2008, PCV7 could potentially have prevented 85% and 74% of invasive pneumococcal disease in the target population (i.e. children aged <2 years), respectively. The level of penicillin non-susceptibility was 17% in 2007-2008. Ongoing surveillance of serotypes is required to determine the impact of PCV7 in the Irish population and to assess the potential of new vaccines with expanded valency.

  7. Induction of prophages by fluoroquinolones in Streptococcus pneumoniae: implications for emergence of resistance in genetically-related clones.

    Directory of Open Access Journals (Sweden)

    Elena López

    Full Text Available Antibiotic resistance in Streptococcus pneumoniae has increased worldwide by the spread of a few clones. Fluoroquinolone resistance occurs mainly by alteration of their intracellular targets, the type II DNA topoisomerases, which is acquired either by point mutation or by recombination. Increase in fluoroquinolone-resistance may depend on the balance between antibiotic consumption and the cost that resistance imposes to bacterial fitness. In addition, pneumococcal prophages could play an important role. Prophage induction by fluoroquinolones was confirmed in 4 clinical isolates by using Southern blot hybridization. Clinical isolates (105 fluoroquinolone-resistant and 160 fluoroquinolone-susceptible were tested for lysogeny by using a PCR assay and functional prophage carriage was studied by mitomycin C induction. Fluoroquinolone-resistant strains harbored fewer inducible prophages (17/43 than fluoroquinolone-susceptible strains (49/70 (P = 0.0018. In addition, isolates of clones associated with fluoroquinolone resistance [CC156 (3/25; CC63 (2/20, and CC81 (1/19], had lower frequency of functional prophages than isolates of clones with low incidence of fluoroquinolone resistance [CC30 (4/21, CC230 (5/20, CC62 (9/21, and CC180 (21/30]. Likewise, persistent strains from patients with chronic respiratory diseases subjected to fluoroquinolone treatment had a low frequency of inducible prophages (1/11. Development of ciprofloxacin resistance was tested with two isogenic strains, one lysogenic and the other non-lysogenic: emergence of resistance was only observed in the non-lysogenic strain. These results are compatible with the lysis of lysogenic isolates receiving fluoroquinolones before the development of resistance and explain the inverse relation between presence of inducible prophages and fluoroquinolone-resistance.

  8. Streptococcus pneumoniae Endohexosaminidase D, Structural and Mechanistic Insight into Substrate-Assisted Catalysis in Family 85 Glycoside Hydrolases

    International Nuclear Information System (INIS)

    Abbott, D.; Macauley, M.; Vocadlo, D.; Boraston, A.


    Endo-?-d-glucosaminidases from family 85 of glycoside hydrolases (GH85 endohexosaminidases) act to cleave the glycosidic linkage between the two N-acetylglucosamine units that make up the chitobiose core of N-glycans. Endohexosaminidase D (Endo-D), produced by Streptococcus pneumoniae, is believed to contribute to the virulence of this organism by playing a role in the deglycosylation of IgG antibodies. Endohexosaminidases have received significant attention for this reason and, moreover, because they are powerful tools for chemoenzymatic synthesis of proteins having defined glycoforms. Here we describe mechanistic and structural studies of the catalytic domain (SpGH85) of Endo-D that provide compelling support for GH85 enzymes using a catalytic mechanism involving substrate-assisted catalysis. Furthermore, the structure of SpGH85 in complex with the mechanism-based competitive inhibitor NAG-thiazoline (Kd = 28 ?m) provides a coherent rationale for previous mutagenesis studies of Endo-D and other related GH85 enzymes. We also find GH85, GH56, and GH18 enzymes have a similar configuration of catalytic residues. Notably, GH85 enzymes have an asparagine in place of the aspartate residue found in these other families of glycosidases. We propose that this residue, as the imidic acid tautomer, acts analogously to the key catalytic aspartate of GH56 and GH18 enzymes. This topographically conserved arrangement of the asparagine residue and a conserved glutamic acid, coupled with previous kinetic studies, suggests these enzymes may use an unusual proton shuttle to coordinate effective general acid and base catalysis to aid cleavage of the glycosidic bond. These results collectively provide a blueprint that may be used to facilitate protein engineering of these enzymes to improve their function as biocatalysts for synthesizing glycoproteins having defined glycoforms and also may serve as a guide for generating inhibitors of GH85 enzymes.

  9. Strain-specific virulence phenotypes of Streptococcus pneumoniae assessed using the Chinchilla laniger model of otitis media.

    Directory of Open Access Journals (Sweden)

    Michael L Forbes


    Full Text Available Streptococcus pneumoniae [Sp] infection is associated with local and systemic disease. Our current understanding of the differential contributions of genetic strain variation, serotype, and host response to disease phenotype is incomplete. Using the chinchilla model of otitis media [OM] we investigated the disease phenotype generated by the laboratory strain TIGR4 and each of thirteen clinical strains (BS68-75, BS290, BS291, BS293, BS436 and BS437; eleven of the thirteen strains have been genomically sequenced.For each strain 100 colony forming units were injected bilaterally into the tympanic bullae of 6 young adult chinchillas under general anesthesia. All animals were examined daily for local and systemic disease by a blinded observer. Pneumatic otoscopy was used to evaluate local disease, and behavioral assessments served as the measure of systemic disease. Virulence scoring was performed using a 4-point scale to assess four clinical parameters [severity and rapidity of local disease onset; and severity and rapidity of systemic disease onset] during a 10-day evaluation period. Highly significant variation was observed among the strains in their ability to cause disease and moribundity.As expected, there was a significant correlation between the rapidity of systemic disease onset and severity of systemic disease; however, there was little correlation between the severity of otoscopic changes and severity of systemic disease. Importantly, it was observed that different strains of the same serotype produced as broad an array of disease phenotypes as did strains of different serotypes. We attribute these phenotypic differences among the strains to the high degree of genomic plasticity that we have previously documented.

  10. What is the mechanism for persistent coexistence of drug-susceptible and drug-resistant strains of Streptococcus pneumoniae? (United States)

    Colijn, Caroline; Cohen, Ted; Fraser, Christophe; Hanage, William; Goldstein, Edward; Givon-Lavi, Noga; Dagan, Ron; Lipsitch, Marc


    The rise of antimicrobial resistance in many pathogens presents a major challenge to the treatment and control of infectious diseases. Furthermore, the observation that drug-resistant strains have risen to substantial prevalence but have not replaced drug-susceptible strains despite continuing (and even growing) selective pressure by antimicrobial use presents an important problem for those who study the dynamics of infectious diseases. While simple competition models predict the exclusion of one strain in favour of whichever is ‘fitter’, or has a higher reproduction number, we argue that in the case of Streptococcus pneumoniae there has been persistent coexistence of drug-sensitive and drug-resistant strains, with neither approaching 100 per cent prevalence. We have previously proposed that models seeking to understand the origins of coexistence should not incorporate implicit mechanisms that build in stable coexistence ‘for free’. Here, we construct a series of such ‘structurally neutral’ models that incorporate various features of bacterial spread and host heterogeneity that have been proposed as mechanisms that may promote coexistence. We ask to what extent coexistence is a typical outcome in each. We find that while coexistence is possible in each of the models we consider, it is relatively rare, with two exceptions: (i) allowing simultaneous dual transmission of sensitive and resistant strains lets coexistence become a typical outcome, as does (ii) modelling each strain as competing more strongly with itself than with the other strain, i.e. self-immunity greater than cross-immunity. We conclude that while treatment and contact heterogeneity can promote coexistence to some extent, the in-host interactions between strains, particularly the interplay between coinfection, multiple infection and immunity, play a crucial role in the long-term population dynamics of pathogens with drug resistance. PMID:19940002

  11. Generation of genic diversity among Streptococcus pneumoniae strains via horizontal gene transfer during a chronic polyclonal pediatric infection.

    Directory of Open Access Journals (Sweden)

    N Luisa Hiller


    Full Text Available Although there is tremendous interest in understanding the evolutionary roles of horizontal gene transfer (HGT processes that occur during chronic polyclonal infections, to date there have been few studies that directly address this topic. We have characterized multiple HGT events that most likely occurred during polyclonal infection among nasopharyngeal strains of Streptococcus pneumoniae recovered from a child suffering from chronic upper respiratory and middle-ear infections. Whole genome sequencing and comparative genomics were performed on six isolates collected during symptomatic episodes over a period of seven months. From these comparisons we determined that five of the isolates were genetically highly similar and likely represented a dominant lineage. We analyzed all genic and allelic differences among all six isolates and found that all differences tended to occur within contiguous genomic blocks, suggestive of strain evolution by homologous recombination. From these analyses we identified three strains (two of which were recovered on two different occasions that appear to have been derived sequentially, one from the next, each by multiple recombination events. We also identified a fourth strain that contains many of the genomic segments that differentiate the three highly related strains from one another, and have hypothesized that this fourth strain may have served as a donor multiple times in the evolution of the dominant strain line. The variations among the parent, daughter, and grand-daughter recombinant strains collectively cover greater than seven percent of the genome and are grouped into 23 chromosomal clusters. While capturing in vivo HGT, these data support the distributed genome hypothesis and suggest that a single competence event in pneumococci can result in the replacement of DNA at multiple non-adjacent loci.

  12. [Antibiotic susceptibility of Staphylococcus aureus and Streptococcus pneumoniae in healthy carrier individuals in primary care in Barcelona area]. (United States)

    Llor, Carles; Boada, Albert; Pons-Vigués, Mariona; Grenzner, Elisabet; Juvé, Rosa; Almeda, Jesús


    The information available on antibiotic resistance patterns are generally based on specimens from hospitalised individuals. This study was aimed at evaluating the antibiotic resistance rate of nasal carriage strains of Staphylococcus aureus and Streptococcus pneumoniae in healthy individuals, in accordance with age and gender, attended in Primary Care Centres (PCC). Cross-sectional study. Seven PCC in the Barcelona area. Healthy nasal carriers aged 4years or more who did not present with any sign of infectious disease, and had not taken any antibiotic or had been hospitalised in the previous 3months. A total of 3,969 nasal swabs valid for identification were collected between 2010 and 2011 and were sent to one central microbiological laboratory for isolation of both pathogens. Resistance to common antibiotics was determined on the basis of the current European Committee on Antimicrobial Susceptibility Testing guidelines on cut-off points. The prevalence of methicillin-resistant S.aureus was 1.3% (95%CI: 0.5-2.1%), with resistance rates of 87.1% to phenoxymethylpenicillin and 11.6% to azithromycin, with no significant differences with age and gender. A total of 2.4% (95CI%: 0.1-4.7%) of the pneumococcal strains were highly resistant to both phenoxymethylpenicillin and macrolides, whereas the highest resistance rates were to cefaclor (53.3%), followed by tetracycline (20%) and cefuroxime (12.1%). These pathogens have lower resistance rates in the community than in the hospital setting. Primary Care physicians must be more aware of the current antimicrobial resistance, in order to ensure prudent use of antibiotics. Copyright © 2017 Elsevier España, S.L.U. All rights reserved.

  13. Increased Nasopharyngeal Density and Concurrent Carriage of Streptococcus pneumoniae, Haemophilus influenzae, and Moraxella catarrhalis Are Associated with Pneumonia in Febrile Children. (United States)

    Chochua, Sopio; D'Acremont, Valérie; Hanke, Christiane; Alfa, David; Shak, Joshua; Kilowoko, Mary; Kyungu, Esther; Kaiser, Laurent; Genton, Blaise; Klugman, Keith P; Vidal, Jorge E


    We assessed nasopharyngeal (NP) carriage of five pathogens in febrile children with and without acute respiratory infection (ARI) of the upper (URTI) or lower tract, attending health facilities in Tanzania. NP swabs collected from children (N = 960) aged 2 months to 10 years, and with a temperature ≥38°C, were utilized to quantify bacterial density of S. pneumoniae (Sp), H. influenzae (Hi), M. catarrhalis (Mc), S. aureus (Sa), and N. meningitidis (Nm). We determined associations between presence of individual species, densities, or concurrent carriage of all species combination with respiratory diseases including clinical pneumonia, pneumonia with normal chest radiography (CXR) and endpoint pneumonia. Individual carriage, and NP density, of Sp, Hi, or Mc, but not Sa, or Nm, was significantly associated with febrile ARI and clinical pneumonia when compared to febrile non-ARI episodes. Density was also significantly increased in severe pneumonia when compared to mild URTI (Sp, p<0.002; Hi p<0.001; Mc, p = 0.014). Accordingly, concurrent carriage of Sp+, Hi+, and Mc+, in the absence of Sa- and Nm-, was significantly more prevalent in children with ARI (p = 0.03), or clinical pneumonia (p<0.001) than non-ARI, and in children with clinical pneumonia (p = 0.0007) than URTI. Furthermore, Sp+, Hi+, and Mc+ differentiated children with pneumonia with normal CXR, or endpoint pneumonia, from those with URTI, and non-ARI cases. Concurrent NP carriage of Sp, Hi, and Mc was a predictor of clinical pneumonia and identified children with pneumonia with normal CXR and endpoint pneumonia from those with febrile URTI, or non-ARI episodes.

  14. Increased Nasopharyngeal Density and Concurrent Carriage of Streptococcus pneumoniae, Haemophilus influenzae, and Moraxella catarrhalis Are Associated with Pneumonia in Febrile Children.

    Directory of Open Access Journals (Sweden)

    Sopio Chochua

    Full Text Available We assessed nasopharyngeal (NP carriage of five pathogens in febrile children with and without acute respiratory infection (ARI of the upper (URTI or lower tract, attending health facilities in Tanzania.NP swabs collected from children (N = 960 aged 2 months to 10 years, and with a temperature ≥38°C, were utilized to quantify bacterial density of S. pneumoniae (Sp, H. influenzae (Hi, M. catarrhalis (Mc, S. aureus (Sa, and N. meningitidis (Nm. We determined associations between presence of individual species, densities, or concurrent carriage of all species combination with respiratory diseases including clinical pneumonia, pneumonia with normal chest radiography (CXR and endpoint pneumonia.Individual carriage, and NP density, of Sp, Hi, or Mc, but not Sa, or Nm, was significantly associated with febrile ARI and clinical pneumonia when compared to febrile non-ARI episodes. Density was also significantly increased in severe pneumonia when compared to mild URTI (Sp, p<0.002; Hi p<0.001; Mc, p = 0.014. Accordingly, concurrent carriage of Sp+, Hi+, and Mc+, in the absence of Sa- and Nm-, was significantly more prevalent in children with ARI (p = 0.03, or clinical pneumonia (p<0.001 than non-ARI, and in children with clinical pneumonia (p = 0.0007 than URTI. Furthermore, Sp+, Hi+, and Mc+ differentiated children with pneumonia with normal CXR, or endpoint pneumonia, from those with URTI, and non-ARI cases.Concurrent NP carriage of Sp, Hi, and Mc was a predictor of clinical pneumonia and identified children with pneumonia with normal CXR and endpoint pneumonia from those with febrile URTI, or non-ARI episodes.

  15. A novel typing method for Streptococcus pneumoniae using selected surface proteins

    Directory of Open Access Journals (Sweden)

    Arnau eDomenech


    Full Text Available The diverse pneumococcal diseases are associated with different pneumococcal lineages, or clonal complexes. Nevertheless, intra-clonal genomic variability, which influences pathogenicity, has been reported for surface virulence factors. These factors constitute the communication interface between the pathogen and its host and their corresponding genes are subjected to strong selective pressures affecting functionality and immunogenicity. First, the presence and allelic dispersion of 97 outer protein families were screened in 19 complete pneumococcal genomes. Seventeen families were deemed variable and were then examined in 216 draft genomes. This procedure allowed the generation of binary vectors with 17 positions and the classification of strains into surfotypes. They represent the outer protein subsets with the highest inter-strain discriminative power. A total of 116 non-redundant surfotypes were identified. Those sharing a critical number of common protein features were hierarchically clustered into 18 surfogroups. Most clonal complexes with comparable epidemiological characteristics belonged to the same or similar surfogroups. However, the very large CC156 clonal complex was dispersed over several surfogroups. In order to establish a relationship between surfogroup and pathogenicity, the surfotypes of 95 clinical isolates with different serogroup/serotype combinations were analysed. We found a significant correlation between surfogroup and type of pathogenic behaviour (primary invasive, opportunistic invasive and non-invasive. We conclude that the virulent behaviour of S. pneumoniae is related to the activity of collections of, rather than individual, surface virulence factors. Since surfotypes evolve faster than MLSTs and directly reflect virulence potential, this novel typing protocol is appropriate for the identification of emerging clones.

  16. CD4+ T-cell Responses Among Adults and Young Children In Response to Streptococcus pneumoniae and Haemophilus influenzae Vaccine Candidate Protein Antigens


    Sharma, Sharad K.; Roumanes, David; Almudevar, Anthony; Mosmann, Tim R.; Pichichero, Michael E.


    We characterized cytokine profiles of CD4+ T-helper (h) cells in adults and young children to ascertain if responses occur to next-generation candidate vaccine antigens PspA, PcpA, PhtD, PhtE, Ply, LytB of Streptococcus pneumonia (Spn) and Protein D and OMP26 of non-typeable Haemophilus influenzae (NTHi). Adults had vaccine antigen-specific Th1 - and Th2 cells responsive to all antigens evaluated whereas young children had significant numbers of vaccine antigen-specific CD4+ T cells producing...

  17. Meningoencephalitis caused by Streptococcus pneumoniae: a diagnostic and therapeutic challenge. Diagnosis with diffusion-weighted MRI leading to treatment with corticosteroids

    International Nuclear Information System (INIS)

    Jorens, Philippe G.; Demey, Hendrik E.; Parizel, Paul M.; Smets, Katrien; Jadoul, Kris; Verbeek, M.M.; Wevers, R.A.; Cras, Patrick


    Streptococcus pneumoniae is a common cause of bacterial meningitis but only rarely causes other infections such as brain abscess, encephalitis, encephalomyelitis or meningoencephalitis. We report on three adult patients with meningoencephalitis caused by S. pneumoniae. In all three, CT and MRI revealed widespread brain lesions, suggesting extensive parenchymal injury. Diffusion-weighted MRI showed lesions with restricted diffusion, reflecting local areas of ischaemia with cytotoxic oedema secondary to an immunologically mediated necrotising vasculitis and thrombosis. High levels of markers of neuronal, glial and myelin damage were found in the cerebrospinal fluid. According to the literature, brain parenchyma lesions in adults with pneumococcal meningoencephalitis are often associated with death or severe neurological deficit. Our patients were treated with pulse doses of glucocorticoids: this resulted in dramatic clinical improvement and an excellent final neurological recovery. (orig.)

  18. Purification, crystallization and preliminary X-ray diffraction analysis of RafE, a sugar-binding lipoprotein from Streptococcus pneumoniae

    International Nuclear Information System (INIS)

    Paterson, Neil G.; Riboldi-Tunnicliffe, Alan; Mitchell, Timothy J.; Isaacs, Neil W.


    The mature form of RafE has been expressed, purified and crystallized. X-ray diffraction data have been collected to 3.65 and 2.90 Å resolution from native and selenomethionine-derivative crystals, respectively. Streptococcus pneumoniae contains a large number of sugar-transport systems and the system responsible for raffinose uptake has recently been identified. The substrate-binding protein component of this system shares strong sequence homology with the multiple sugar metabolism substrate-binding protein MsmE from S. mutans and contains a lipoprotein-attachment site at cysteine residue 23. A truncated form (residues 24–419) of RafE from S. pneumoniae was cloned and overexpressed in Escherichia coli. Native and selenomethionine-labelled protein have been crystallized in the hexagonal space group P6 1 22. Diffraction data have been successfully phased to 2.90 Å using Se SAD data and model building is in progress

  19. Meningoencephalitis caused by Streptococcus pneumoniae: a diagnostic and therapeutic challenge. Diagnosis with diffusion-weighted MRI leading to treatment with corticosteroids

    Energy Technology Data Exchange (ETDEWEB)

    Jorens, Philippe G.; Demey, Hendrik E. [University Hospital of Antwerp, UZA, Department of Intensive Care Medicine, Edegem (Belgium); Parizel, Paul M. [University of Antwerp, Department of Radiology, Edegem (Belgium); Smets, Katrien [University of Antwerp, Department of Neurology, Edegem (Belgium); General Hospital AZ Middelares, Department of Neurology, Sint-Niklaas (Belgium); Jadoul, Kris [General Hospital AZ Middelares, Department of Neurology, Sint-Niklaas (Belgium); Verbeek, M.M.; Wevers, R.A. [University Hospital of Nijmegen, Laboratory of Paediatrics and Neurology, Nijmegen (Netherlands); Cras, Patrick [University of Antwerp, Department of Neurology, Edegem (Belgium)


    Streptococcus pneumoniae is a common cause of bacterial meningitis but only rarely causes other infections such as brain abscess, encephalitis, encephalomyelitis or meningoencephalitis. We report on three adult patients with meningoencephalitis caused by S. pneumoniae. In all three, CT and MRI revealed widespread brain lesions, suggesting extensive parenchymal injury. Diffusion-weighted MRI showed lesions with restricted diffusion, reflecting local areas of ischaemia with cytotoxic oedema secondary to an immunologically mediated necrotising vasculitis and thrombosis. High levels of markers of neuronal, glial and myelin damage were found in the cerebrospinal fluid. According to the literature, brain parenchyma lesions in adults with pneumococcal meningoencephalitis are often associated with death or severe neurological deficit. Our patients were treated with pulse doses of glucocorticoids: this resulted in dramatic clinical improvement and an excellent final neurological recovery. (orig.)

  20. Purification, crystallization and preliminary X-ray diffraction analysis of RafE, a sugar-binding lipoprotein from Streptococcus pneumoniae

    Energy Technology Data Exchange (ETDEWEB)

    Paterson, Neil G., E-mail:; Riboldi-Tunnicliffe, Alan [Department of Chemistry and WestCHEM, Glasgow Biomedical Research Centre (GBRC), University of Glasgow, 120 University Place, Glasgow G12 8TA,Scotland (United Kingdom); Mitchell, Timothy J. [Division of Infection and Immunity (IBLS), Glasgow Biomedical Research Centre (GBRC), University of Glasgow, 120 University Place, Glasgow G12 8TA,Scotland (United Kingdom); Isaacs, Neil W. [Department of Chemistry and WestCHEM, Glasgow Biomedical Research Centre (GBRC), University of Glasgow, 120 University Place, Glasgow G12 8TA,Scotland (United Kingdom)


    The mature form of RafE has been expressed, purified and crystallized. X-ray diffraction data have been collected to 3.65 and 2.90 Å resolution from native and selenomethionine-derivative crystals, respectively. Streptococcus pneumoniae contains a large number of sugar-transport systems and the system responsible for raffinose uptake has recently been identified. The substrate-binding protein component of this system shares strong sequence homology with the multiple sugar metabolism substrate-binding protein MsmE from S. mutans and contains a lipoprotein-attachment site at cysteine residue 23. A truncated form (residues 24–419) of RafE from S. pneumoniae was cloned and overexpressed in Escherichia coli. Native and selenomethionine-labelled protein have been crystallized in the hexagonal space group P6{sub 1}22. Diffraction data have been successfully phased to 2.90 Å using Se SAD data and model building is in progress.

  1. Delineation of Streptococcus dysgalactiae, its subspecies, and its clinical and phylogenetic relationship to Streptococcus pyogenes

    DEFF Research Database (Denmark)

    Jensen, Anders; Kilian, Mogens


    The close phylogenetic relationship of the important pathogen Streptococcus pneumoniae and several species of commensal streptococci, particularly Streptococcus mitis and Streptococcus pseudopneumoniae, and the recently demonstrated sharing of genes and phenotypic traits previously considered...

  2. Identification of Streptococcus pneumoniae lytA, plyA and psaA genes in pleural fluid by multiplex real-time PCR. (United States)

    Sanz, Juan Carlos; Ríos, Esther; Rodríguez-Avial, Iciar; Ramos, Belén; Marín, Mercedes; Cercenado, Emilia


    The aim was to evaluate the utility of a multiplex real-time PCR to detect Streptococcus pneumoniae lytA, plyA and psaA genes in pleural fluid (PF). A collection of 81 PF samples was used. Sixty were considered positive for S. pneumoniae according to previous results (54 by an in-house lytA gene PCR and eight by universal rRNA PCR). The sensitivity for detection of the lytA, plyA and psaA genes by multiplex PCR was 100% (60/60), 98.3% (59/60) and 91.7% (55/60), respectively. The detection of all three genes was negative in 21 samples formerly confirmed as negative for S. pneumoniae (100% specificity) by the other procedures (9 by in-house lytA PCR and 12 by rRNA PCR). The use of this multiplex PCR may be a useful option to identify S. pneumoniae directly in PF samples. Copyright © 2017 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  3. Multiplex PCR to determine Streptococcus pneumoniae serotypes causing otitis media in the Republic of Ireland with further characterisation of antimicrobial susceptibilities and genotypes.

    LENUS (Irish Health Repository)

    Vickers, I


    The purpose of this study was to determine the serotypes, genotypes and antimicrobial susceptibilities of Streptococcus pneumoniae causing otitis media (OM) in children in Dublin, Ireland. S. pneumoniae isolates (n = 28) from spontaneously discharging OM were studied. Serotyping was performed using a previously undescribed multiplex polymerase chain reaction (PCR) scheme in combination with serological methods. Multilocus sequence typing (MLST) was performed using standard procedures. Antimicrobial susceptibility testing was performed using the Etest method. Fourteen different S. pneumoniae serotypes were identified. The five most common serotypes were 3, 19F, 19A, 14 and 6A, which accounted for 68% of all infections. The 7-valent pneumococcal conjugate vaccine (PCV7), 10-valent pneumococcal conjugate vaccine (PHiD-CV) and 13-valent pneumococcal conjugate vaccine (PCV13) provided potential coverages of 43%, 46% and 86%, respectively. Reduced susceptibility to penicillin was evident for 25% of isolates and was associated with serotypes 14, 19A, 19F and 9V. A total of 21 different sequence types (STs) were identified. Pneumococcal Molecular Epidemiology Network (PMEN) clones or their variants represented 54% (15\\/28) of all isolates. Continued monitoring and characterisation of S. pneumoniae causing OM in Ireland is warranted in order to guide future vaccine and treatment policies.

  4. Role of Nucleotide-Binding Oligomerization Domain-Containing (NOD 2 in Host Defense during Pneumococcal Pneumonia.

    Directory of Open Access Journals (Sweden)

    Tijmen J Hommes

    Full Text Available Streptococcus (S. pneumoniae is the most common causative pathogen in community-acquired pneumonia. Nucleotide-binding oligomerization domain-containing (NOD 2 is a pattern recognition receptor located in the cytosol of myeloid cells that is able to detect peptidoglycan fragments of S. pneumoniae. We here aimed to investigate the role of NOD2 in the host response during pneumococcal pneumonia. Phagocytosis of S. pneumoniae was studied in NOD2 deficient (Nod2-/- and wild-type (Wt alveolar macrophages and neutrophils in vitro. In subsequent in vivo experiments Nod2-/- and Wt mice were inoculated with serotype 2 S. pneumoniae (D39, an isogenic capsule locus deletion mutant (D39Δcps or serotype 3 S. pneumoniae (6303 via the airways, and bacterial growth and dissemination and the lung inflammatory response were evaluated. Nod2-/- alveolar macrophages and blood neutrophils displayed a reduced capacity to internalize pneumococci in vitro. During pneumonia caused by S. pneumoniae D39 Nod2-/- mice were indistinguishable from Wt mice with regard to bacterial loads in lungs and distant organs, lung pathology and neutrophil recruitment. While Nod2-/- and Wt mice also had similar bacterial loads after infection with the more virulent S. pneumoniae 6303 strain, Nod2-/- mice displayed a reduced bacterial clearance of the normally avirulent unencapsulated D39Δcps strain. These results suggest that NOD2 does not contribute to host defense during pneumococcal pneumonia and that the pneumococcal capsule impairs recognition of S. pneumoniae by NOD2.

  5. Serotype Distribution and Antimicrobial Sensitivity Profile of Streptococcus pneumoniae Carried in Healthy Toddlers before PCV13 Introduction in Niamey, Niger.

    Directory of Open Access Journals (Sweden)

    Sani Ousmane

    Full Text Available To mitigate the burden of pneumococcal infections in Niger, a 13-valent pneumococcal vaccine, PCV13, was introduced for routine child vaccination in July 2014. In order to provide pre-vaccine baseline data and allow appreciation of changes on carriage due to vaccination, we analyzed retrospectively pneumococcal isolates obtained from healthy, 0 to 2 year old children prior to the vaccine introduction.From June 5, 2007, to May 26, 2008, 1200 nasopharyngeal swabs were collected from healthy 0 to 2 year old children and analyzed by standard microbiological methods. Serotyping was done by SM-PCR and the data were analyzed with R version 2.15.0 (2012-03-30.Streptococcus pneumoniae was detected in 654/1200 children (54.5% among whom 339 (51.8% were males. The ages of the study subjects varied from few days to 26 months (mean = 7.1, median = 6, 95% CI [6.8-7.4]. Out of 654 frozen isolates, 377 (54.8% were able to be re-grown and analyzed. In total, 32 different serogroups/serotypes were detected of which, the most prevalent were 6/(6A/6B/6C/6D (15.6%, 23F (10.6%, 19F (9.3%, 14 (9%, 19A (5.6%, 23B (4.0%, 25F/38 (3.7%, 18/(18A/18B/18C/18F (2.9% and PCR non-typeable (16.4%. Eleven serogroups/serotypes accounting for 57.3% (216/377 were of PCV13 types. Of the 211/377 (56% isolates tested for drug sensitivity, 23/211 (10.9%, 24/211 (11.4%, 9/211(4.3% and 148/210 (70.5% were respectively resistance to oxacillin, chloramphenicol, erythromycin and tetracycline. Thirteen of the oxacillin resistant isolates were additionally multidrug-resistant. No resistance was however detected to gentamycin500μg and to fluoroquinolones (ø Norfloxacin5μg 3 months and presence in family of more than one sibling aged 3 months and presence in family of children aged < 6 years were significant factors for pneumococcal carriage. The present data should help understanding post vaccine introduction changes in pneumococcal carriage and infections for better action.

  6. Outbreaks of Streptococcus pneumoniae carriage in day care cohorts in Finland – implications for elimination of transmission

    Directory of Open Access Journals (Sweden)

    Auranen Kari


    Full Text Available Abstract Background Day care centre (DCC attendees play a central role in maintaining the circulation of Streptococcus pneumoniae (pneumococcus in the population. Exposure within families and within DCCs are the main risk factors for colonisation with pneumococcal serotypes in DCC attendees. Methods Transmission of serotype specific carriage was analysed with a continuous time event history model, based on longitudinal data from day care attendees and their family members. Rates of acquisition, conditional on exposure, were estimated in a Bayesian framework utilising latent processes of carriage. To ensure a correct level of exposure, non-participating day care attendees and their family members were included in the analysis. Posterior predictive simulations were used to quantify transmission patterns within day care cohorts, to estimate the basic reproduction number for pneumococcal carriage in a population of day care cohorts, and to assess the critical vaccine efficacy against carriage to eliminate pneumococcal transmission. Results The model, validated by posterior predictive sampling, was successful in capturing the strong temporal clustering of pneumococcal serotypes in the day care cohorts. In average 2.7 new outbreaks of pneumococcal carriage initiate in a day care cohort each month. While 39% of outbreaks were of size one, the mean outbreak size was 7.6 individuals and the mean length of an outbreak was 2.8 months. The role of families in creating and maintaining transmission was minimal, as only 10% of acquisitions in day care attendees were from family members. Considering a population of day care cohorts, a child-to-child basic reproduction number was estimated as 1.4 and the critical vaccine efficacy against acquisition of carriage as 0.3. Conclusion Pneumococcal transmission occurs in serotype specific outbreaks of carriage, driven by within-day-care transmission and between-serotype competition. An amplifying effect of the day

  7. Evaluación de un medio para la conservación de Streptococcus pneumoniae a partir de muestras nasofaríngeas

    Directory of Open Access Journals (Sweden)

    Nacxiry Fonseca


    Full Text Available La Organización Mundial de la Salud (OMS llegó a un consenso. en 1998, acerca de la metodologia general para el estudio de portadores de Streptococcus pneumoniae Esta metodología incluía un nuevo medio para el transporte y el almacenamiento de muestras nasofaringeas, compuesto portriptona, glucosa, glicerol y leche descremada, denominado STGG. Este medio fue evaluado oor nuestro laboratorio, en marzo de 1999. en un grupo de 15 niños menores de 5 años asistentes a una guarderia de Bogotá. Se les tomó una muestia nasofaringea que se colocó en el medio STGG y, posteriormente, se valoró el crecimiento de S. pneumoniae en cuatro momentos diferentes: 0, 5 , 10 y 30 días después de la toma de la muestra. La recuperación inicial de S. pneumoniae fue de 73% (11/15. En todas las 11 muestras de las que se obtuvo un crecimiento inicial, fue posible recuperar S. pneumoniae en los diferentes tiempos de observación, aún en las muestras con crecimiento en un solo cuadrante. En el tiempo 0 y a los 30 días, 7 de las 11 muestras presentaron un crecimiento de abundante a moderado. Con los datos obtenidos, se logró demostrar que el medio STGG es capaz de mantener, a largo plazo, la viabilidad de S. pneumoniae en muestras nasofaringeas de niños portadores de este microorganismo.

  8. Effect of experimental influenza A virus infection on isolation of Streptococcus pneumoniae and other aerobic bacteria from the oropharynges of allergic and nonallergic adult subjects. (United States)

    Wadowsky, R M; Mietzner, S M; Skoner, D P; Doyle, W J; Fireman, P


    Intranasal challenge with both influenza A virus and Streptococcus pneumoniae promotes otitis media with S. pneumoniae in chinchillas. We investigated whether influenza A virus infection promotes oropharyngeal colonization with S. pneumoniae and other middle ear pathogens by selectively inhibiting commensal bacteria. On study day 0, 12 allergic and 15 nonallergic adult subjects were intranasally inoculated with influenza A/Kawasaki (H1N1) virus. Every subject was infected with the virus as demonstrated by nasal shedding or seroconversion. Average upper respiratory symptom scores and nasal secretion weights from the entire subject group were elevated between days 2 and 6 (acute phase) and were not significantly different between allergic and nonallergic subjects. S. pneumoniae was not isolated from any subject prior to the virus challenge but was isolated in heavy density from 4 (15%) subjects on day 6 (P = 0.055). Staphylococcus aureus was isolated more frequently from the nonallergic subjects than from the allergic subjects on days 2 (80 versus 25%, respectively) 4, (67 versus 17%, respectively), and 6 (73 versus 25%, respectively) (P < 0.05). The isolation rates of other middle ear pathogens were not significantly different before virus challenge and during the acute and resolution phases (days 27 to 30) of the experimental infection for the entire subject group or either the allergic or nonallergic subgroup. Densities and isolation rates of commensal bacteria from the entire subject group were similar throughout the observational period. These results suggest that the virus infection promoted S. pneumoniae colonization of the oropharynx and that nonallergic persons may be more vulnerable to colonization with S. aureus than allergic persons. The altered colonization rates were not attributed to inhibition of commensal bacteria.

  9. Phosphorylation of the Streptococcus pneumoniae cell wall biosynthesis enzyme MurC by a eukaryotic-like Ser/Thr kinase. (United States)

    Falk, Shaun P; Weisblum, Bernard


    Streptococcus pneumoniae contains a single Ser/Thr kinase-phosphatase pair known as StkP-PhpP. Here, we report the interaction of StkP-PhpP with S. pneumoniae UDP-N-acetylmuramoyl:L-alanine ligase, MurC, an enzyme that synthesizes an essential intermediate of the cell wall peptidoglycan pathway. Combinatorial phage display using StkP as target selected the peptide sequence YEVCGSDTVGC as an interacting partner and subsequently confirmed by ELISA. The phage peptide sequence YEVCGSDTVGC aligns closely with the MurC motif spanning S. pneumoniae amino acid coordinates 31-37. We show that MurC is phosphorylated by StkP and that phosphoMurC is dephosphorylated by PhpP. These data suggest a link between StkP-PhpP with the coordinated regulation of cell wall biosynthesis via MurC. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  10. Prevalence of penicillin and erythromycin resistance among invasive Streptococcus pneumoniae isolates reported by laboratories in the southern and eastern Mediterranean region. (United States)

    Borg, M A; Tiemersma, E; Scicluna, E; van de Sande-Bruinsma, N; de Kraker, M; Monen, J; Grundmann, H


    Information about the epidemiology of resistance in Streptococcus pneumoniae within southern and eastern countries of the Mediterranean region is incomplete, as reports have been sporadic and difficult to compare. Over a 36-month period, from 2003 to 2005, the ARMed project collected 1298 susceptibility test results of invasive isolates of S. pneumoniae from blood and spinal fluid cultures routinely processed within 59 participating laboratories situated in Algeria, Cyprus, Egypt, Jordan, Lebanon, Malta, Morocco, Tunisia and Turkey. Overall, 26% (335) of isolates were reported as non-susceptible to penicillin, with the highest proportions being reported from Algeria (44%) and Lebanon (40%). During the same time period, the highest proportions of pneumococci that were not susceptible to erythromycin were reported from Malta (46%) and Tunisia (39%). Proportions of dual non-susceptibility in excess of 5% were found in laboratories in Algeria, Tunisia, Lebanon, Jordan and Turkey. ARMed data on the antimicrobial resistance epidemiology of S. pneumoniae in the southern and eastern Mediterranean region provided evidence of high rates of resistance, especially to penicillin. This evidence calls for a greater focus on the identification of relevant drivers of resistance and on the implemention of effective practices in order to address the problem of resistence.

  11. Rapid Assessment of Resistance to Antibiotic Inhibitors of Protein Synthesis in the Gram-Positive Pathogens, Enterococcus faecalis and Streptococcus pneumoniae, Based on Evaluation of the Lytic Response. (United States)

    Otero, Fátima; Tamayo, María; Santiso, Rebeca; Gosálvez, Jaime; Bou, Germán; Fernández, José Luis


    A novel assay for rapid determination of resistance to antibiotic inhibitors of protein synthesis was developed for the gram-positive pathogens, Enterococcus faecalis and Streptococcus pneumoniae. To this purpose, a lytic response was obtained by a brief incubation with lysozyme or a mixture of lysozyme, Triton X-100, and EDTA for E. faecalis (n = 82) and S. pneumoniae (n = 51), respectively. Lysis was quantified by visualizing the released nucleoids. Antibiotic-susceptible bacteria treated with Clinical and Laboratory Standards Institute (CLSI) breakpoint doses of erythromycin, azithromycin, or doxycycline that inhibited protein synthesis demonstrated a large reduction of lysed cells with respect to the control, that is, without antibiotics. However, cell lysis prevention was much lower in nonsusceptible strains, with unsuccessful inhibition of protein synthesis. ROC analysis showed that a reduction value of ≥35.6% and ≥40.4% discriminates susceptible and nonsusceptible strains for erythromycin and for doxycycline, respectively, in E. faecalis, whereas ≥20.0% is adequate for both macrolides and doxycycline in S. pneumoniae. Resistant stains were identified in 90-120 min with sensitivity and specificity between 91.7% and 100%. This is a proof of concept that evaluation of the lytic response may be a rapid and efficient test for determination of resistance to antibiotic inhibitors of protein synthesis.

  12. Nasopharyngeal colonization and invasive disease are enhanced by the cell wall hydrolases LytB and LytC of Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Elisa Ramos-Sevillano

    Full Text Available BACKGROUND: Streptococcus pneumoniae is a common colonizer of the human nasopharynx and one of the major pathogens causing invasive disease worldwide. Dissection of the molecular pathways responsible for colonization, invasion, and evasion of the immune system will provide new targets for antimicrobial or vaccine therapies for this common pathogen. METHODOLOGY/PRINCIPAL FINDINGS: We have constructed mutants lacking the pneumococcal cell wall hydrolases (CWHs LytB and LytC to investigate the role of these proteins in different phases of the pneumococcal pathogenesis. Our results show that LytB and LytC are involved in the attachment of S. pneumoniae to human nasopharyngeal cells both in vitro and in vivo. The interaction of both proteins with phagocytic cells demonstrated that LytB and LytC act in concert avoiding pneumococcal phagocytosis mediated by neutrophils and alveolar macrophages. Furthermore, C3b deposition was increased on the lytC mutant confirming that LytC is involved in complement evasion. As a result, the lytC mutant showed a reduced ability to successfully cause pneumococcal pneumonia and sepsis. Bacterial mutants lacking both LytB and LytC showed a dramatically impaired attachment to nasopharyngeal cells as well as a marked degree of attenuation in a mouse model of colonization. In addition, C3b deposition and phagocytosis was more efficient for the double lytB lytC mutant and its virulence was greatly impaired in both systemic and pulmonary models of infection. CONCLUSIONS/SIGNIFICANCE: This study confirms that the CWHs LytB and LytC of S. pneumoniae are essential virulence factors involved in the colonization of the nasopharynx and in the progress of invasive disease by avoiding host immunity.

  13. Population biology of Streptococcus pneumoniae in West Africa: multilocus sequence typing of serotypes that exhibit different predisposition to invasive disease and carriage.

    Directory of Open Access Journals (Sweden)

    Eric S Donkor

    Full Text Available Little is known about the population biology of Streptococcus pneumoniae in developing countries, although the majority of pneumococcal infections occur in this setting. The aim of the study was to apply MLST to investigate the population biology of S. pneumoniae in West Africa.Seventy three invasive and carriage S. pneumoniae isolates from three West African countries including The Gambia, Nigeria and Ghana were investigated. The isolates covered seven serotypes (1, 3, 5, 6A, 11, 14, 23F and were subjected to multilocus sequence typing and antibiotic susceptibility testing.Overall, 50 different sequence types (STs were identified, of which 38% (29 were novel. The most common ST was a novel clone-ST 4012 (6.5%, and some clones including STs 913, 925, 1737, 2160 and 3310 appeared to be specific to the study region. Two STs including ST 63 and ST 4012 were associated with multiple serotypes indicating a history of serotype switching. ST 63 was associated with serotypes 3 and 23F, while ST 4012 was associated with serotypes 6A and 23. eBURST analyses using the stringent 6/7 identical loci definition grouped the 50 STs into 5 clonal complexes and 65 singletons, expressing a high level of genetic diversity among the isolates. Compared to the other serotypes, serotypes 1 and 5 isolates appeared to be more clonal. Internationally recognized antibiotic resistant clones of S. pneumoniae were generally absent in the population investigated and the only multidrug resistant isolate identified (1/66 belong to the Pneumocococcal Epidemiology Network clone ST 63.The pneumococcal population in West Africa is quite divergent, and serotypes that are common in invasive disease (such as serotypes 1 and 5 are more likely to be clonal than serotypes that are common in carriage.

  14. Streptococcus pneumoniae Cell-Wall-Localized Phosphoenolpyruvate Protein Phosphotransferase Can Function as an Adhesin: Identification of Its Host Target Molecules and Evaluation of Its Potential as a Vaccine.

    Directory of Open Access Journals (Sweden)

    Yaffa Mizrachi Nebenzahl

    Full Text Available In Streptococcus pneumonia, phosphoenolpyruvate protein phosphotransferase (PtsA is an intracellular protein of the monosaccharide phosphotransferase systems. Biochemical and immunostaining methods were applied to show that PtsA also localizes to the bacterial cell-wall. Thus, it was suspected that PtsA has functions other than its main cytoplasmic enzymatic role. Indeed, recombinant PtsA and anti-rPtsA antiserum were shown to inhibit adhesion of S. pneumoniae to cultured human lung adenocarcinoma A549 cells. Screening of a combinatorial peptide library expressed in a filamentous phage with rPtsA identified epitopes that were capable of inhibiting S. pneumoniae adhesion to A549 cells. The insert peptides in the phages were sequenced, and homologous sequences were found in human BMPER, multimerin1, protocadherin19, integrinβ4, epsin1 and collagen type VIIα1 proteins, all of which can be found in A549 cells except the latter. Six peptides, synthesized according to the homologous sequences in the human proteins, specifically bound rPtsA in the micromolar range and significantly inhibited pneumococcal adhesion in vitro to lung- and tracheal-derived cell lines. In addition, the tested peptides inhibited lung colonization after intranasal inoculation of mice with S. pneumoniae. Immunization with rPtsA protected the mice against a sublethal intranasal and a lethal intravenous pneumococcal challenge. In addition, mouse anti rPtsA antiserum reduced bacterial virulence in the intravenous inoculation mouse model. These findings showed that the surface-localized PtsA functions as an adhesin, PtsA binding peptides derived from its putative target molecules can be considered for future development of therapeutics, and rPtsA should be regarded as a candidate for vaccine development.

  15. Carriage of Streptococcus pneumoniae and other respiratory bacterial pathogens in low and lower-middle income countries: a systematic review and meta-analysis.

    Directory of Open Access Journals (Sweden)

    Richard A Adegbola

    Full Text Available Infection with Streptococcus pneumoniae is a major cause of childhood morbidity and mortality worldwide, especially in low income countries where pneumococcal conjugate vaccines (PCVs are still underused. In countries where PCVs have been introduced, much of their efficacy has resulted from their impact on nasopharyngeal carriage in vaccinated children. Understanding the epidemiology of carriage for S. pneumoniae and other common respiratory bacteria in developing countries is crucial for implementing appropriate vaccination strategies and evaluating their impact.We have systematically reviewed published studies reporting nasopharyngeal or oropharyngeal carriage of S. pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, Staphylococcus aureus, and Neisseria meningitidis in children and adults in low and lower-middle income countries. Studies reporting pneumococcal carriage for healthy children <5 years of age were selected for a meta-analysis. The prevalences of carriage for S. pneumoniae, H. influenzae, and M. catarrhalis were generally higher in low income than in lower-middle income countries and were higher in young children than in adults. The prevalence of S. aureus was high in neonates. Meta-analysis of data from young children before the introduction of PCVs showed a pooled prevalence estimate of 64.8% (95% confidence interval, 49.8%-76.1% in low income countries and 47.8% (95% confidence interval, 44.7%-50.8% in lower-middle income countries. The most frequent serotypes were 6A, 6B, 19A, 19F, and 23F.In low and lower-middle income countries, pneumococcal carriage is frequent, especially in children, and the spectrum of serotypes is wide. However, because data are limited, additional studies are needed to adequately assess the impact of PCV introduction on carriage of respiratory bacteria in these countries.

  16. SpxB is a suicide gene of Streptococcus pneumoniae and confers a selective advantage in an in vivo competitive colonization model. (United States)

    Regev-Yochay, Gili; Trzcinski, Krzysztof; Thompson, Claudette M; Lipsitch, Marc; Malley, Richard


    The human bacterial pathogen Streptococcus pneumoniae dies spontaneously upon reaching stationary phase. The extent of S. pneumoniae death at stationary phase is unusual in bacteria and has been conventionally attributed to autolysis by the LytA amidase. In this study, we show that spontaneous pneumococcal death is due to hydrogen peroxide (H(2)O(2)), not LytA, and that the gene responsible for H(2)O(2) production (spxB) also confers a survival advantage in colonization. Survival of S. pneumoniae in stationary phase was significantly prolonged by eliminating H(2)O(2) in any of three ways: chemically by supplementing the media with catalase, metabolically by growing the bacteria under anaerobic conditions, or genetically by constructing DeltaspxB mutants that do not produce H(2)O(2). Likewise, addition of H(2)O(2) to exponentially growing S. pneumoniae resulted in a death rate similar to that of cells in stationary phase. While DeltalytA mutants did not lyse at stationary phase, they died at a rate similar to that of the wild-type strain. Furthermore, we show that the death process induced by H(2)O(2) has features of apoptosis, as evidenced by increased annexin V staining, decreased DNA content, and appearance as assessed by transmission electron microscopy. Finally, in an in vivo rat model of competitive colonization, the presence of spxB conferred a selective advantage over the DeltaspxB mutant, suggesting an explanation for the persistence of this gene. We conclude that a suicide gene of pneumococcus is spxB, which induces an apoptosis-like death in pneumococci and confers a selective advantage in nasopharyngeal cocolonization.


    Directory of Open Access Journals (Sweden)

    A. A. Baranov


    Full Text Available Data on the spread of Streptococcus pneumoniae serotypes in the RF are extremely limited. 3 pneumococcal conjugated vaccines are approved inRussia; however, neither has yet been employed in the framework of the national population immunization program. At the same time, it is the dataon the serotype range of pneumococcal infections that may be considered the prognostic efficacy criterion for the national vaccination programs.The objective of this research is identification of the circulating S. pneumoniae serotypes and spread of pneumococcal etiology infections in the structure of bacterial infections in the infants hospitalized to 5 inpatient hospital of Moscow in 2011–2012. The trial involved 864 patients in tote. Vast majority of patients (86% had acute purulent otitis media and sinusitis. Community-acquired pneumonia was diagnosed in 9% of patients, sepsis and bacteremia — in 3.6%; purulent meningitis — 1.2% of patients. It has been revealed that S. pneumoniae is the primary pathogen in the structure of nasopharyngeal carriage in the children under 5 years of age hospitalized with acute bacterial infections, and the primary bacterial causative agent of acute otitis media at this age. Nasopharyngeal pneumococcal carriage analysis revealed the prevalent serotypes — 19F, 14, 23F, 3, 6A and B; they were present in 3/4 of all cases; 19F was the most frequent (> 20%. Diversity of the S. pneumoniae serotypes detected in middle ear liquid was less significant — 17 serotypes (in comparison with 24 serotypes in nasopharynx. The 5 prevalent serotypes were 19F, 3, 14, 23F, 6B and 19A (> 75% in tote. Detection rate of serotypes 3 and 19A in middle ear liquid significantly exceeded the detection rate of these serotypes in case of nasopharyngeal carriage. The study of invasive infections revealed serotypes 14, 23F, 3 and 15C. These data may be used as a benchmark for future monitoring and evaluation of effect of PCV vaccines on epidemiology of

  18. Determination of Trimethoprim-Sulfamethoxazole Resistance in Streptococcus pneumoniae by Using the E Test with Mueller-Hinton Agar Supplemented with Sheep or Horse Blood May Be Unreliable (United States)

    Lovgren, M.; Dell’Acqua, L.; Palacio, R.; Echániz-Aviles, G.; Soto-Noguerón, A.; Castañeda, E.; Agudelo, C. I.; Heitmann, I.; Brandileone, M. C.; Zanella, R. C.; Rossi, A.; Pace, J.; Talbot, J. A.


    An international, multicenter study compared trimethoprim-sulfamethoxazole MICs for 743 Streptococcus pneumoniae isolates (107 to 244 isolates per country) by E test, using Mueller-Hinton agar supplemented with 5% defibrinated horse blood or 5% defibrinated sheep blood, with MICs determined by the National Committee for Clinical Laboratory Standards broth microdilution reference method. Agreement within 1 log2 dilution and minor error rates were 69.3 and 15.5%, respectively, on sheep blood-supplemented agar and 76.9 and 13.6%, respectively, with horse blood as the supplement. Significant interlaboratory variability was observed. E test may not be a reliable method for determining the resistance of pneumococci to trimethoprim-sulfamethoxazole. PMID:9854095

  19. Application of Quaternion in improving the quality of global sequence alignment scores for an ambiguous sequence target in Streptococcus pneumoniae DNA (United States)

    Lestari, D.; Bustamam, A.; Novianti, T.; Ardaneswari, G.


    DNA sequence can be defined as a succession of letters, representing the order of nucleotides within DNA, using a permutation of four DNA base codes including adenine (A), guanine (G), cytosine (C), and thymine (T). The precise code of the sequences is determined using DNA sequencing methods and technologies, which have been developed since the 1970s and currently become highly developed, advanced and highly throughput sequencing technologies. So far, DNA sequencing has greatly accelerated biological and medical research and discovery. However, in some cases DNA sequencing could produce any ambiguous and not clear enough sequencing results that make them quite difficult to be determined whether these codes are A, T, G, or C. To solve these problems, in this study we can introduce other representation of DNA codes namely Quaternion Q = (PA, PT, PG, PC), where PA, PT, PG, PC are the probability of A, T, G, C bases that could appear in Q and PA + PT + PG + PC = 1. Furthermore, using Quaternion representations we are able to construct the improved scoring matrix for global sequence alignment processes, by applying a dot product method. Moreover, this scoring matrix produces better and higher quality of the match and mismatch score between two DNA base codes. In implementation, we applied the Needleman-Wunsch global sequence alignment algorithm using Octave, to analyze our target sequence which contains some ambiguous sequence data. The subject sequences are the DNA sequences of Streptococcus pneumoniae families obtained from the Genebank, meanwhile the target DNA sequence are received from our collaborator database. As the results we found the Quaternion representations improve the quality of the sequence alignment score and we can conclude that DNA sequence target has maximum similarity with Streptococcus pneumoniae.

  20. Activación del polisacárido capsular de Streptococcus pneumoniae serotipo 23F para la obtención de vacunas conjugadas

    Directory of Open Access Journals (Sweden)

    Janoi Chang-Calderón


    Full Text Available En la actualidad, las vacunas conjugadas constituyen un gran hito en el desarrollo de fármacos que protegen contra las enfermedades infecciosas. Estas vacunas no solo disminuyen drásticamente la mortalidad y morbilidad de diferentes enfermedades causadas por bacterias en la población infantil; sino que también repercuten sobre la población no vacunada. Las vacunas conjugadas se basan en establecer una unión covalente entre un polisacárido y una proteína portadora para lo cual existen diferentes procedimientos químicos. Todos los procedimientos de conjugación requieren la presencia de grupos reactivos complementarios que muchas veces son generados en ambas macromoléculas. Este trabajo se enfoca en el estudio de la reacción de fragmentación y de la oxidación peryódica sobre el polisacárido capsular serotipo 23F de Streptococcus pneumoniae para su uso como antígeno vacunal. Se estableció la fragmentación del polisacárido mediante hidrólisis con ácido acético y trifluoroácetico. En el caso de la reacción de oxidación se encontró que la cantidad de moles de peryodato de sodio y la temperatura influyen de manera directamente proporcional sobre la generación de grupos carbonilos. Adicionalmente se demostró que el sustituyente glicerol-fosfatos presente en la estructura del serotipo 23F es relevante para conservar la antigenicidad. El procedimiento descrito permite obtener conjugados inmunogénicos a partir del polisacárido capsular de Streptococcus pneumoniae serotipo 23F en el modelo de conejos.

  1. Streptococcus pneumoniae carriage among healthy and sick pediatric patients before the generalized implementation of the 13-valent pneumococcal vaccine in Morocco from 2010 to 2011. (United States)

    Jroundi, Imane; Mahraoui, Chafik; Benmessaoud, Rachid; Moraleda, Cinta; Munoz Almagro, Carmen; Seffar, Meryem; Tligui, Houssain; Kettani, Selma C; Benjelloun, Badr S; Alonso, Pedro L; Bassat, Quique

    Nasopharyngeal carriage studies provide insights into the local prevalence of circulating pneumococcal serotypes. These data are critical to vaccination monitoring, as they allow for the prediction and assessment of impact. Very little data are available on the carriage of pneumococcal serotypes in Morocco. Here, we describe the prevalence of Streptococcus pneumoniae carriage and serotype distribution among 697 pediatric patients with ages ranging from 2 to 59 months who were admitted to a Moroccan hospital with severe pneumonia, as well as 195 healthy infants and young children who were recruited at a vaccination clinic. Carriage rates were 40.5% (79/195) for healthy children and 22.8% (159/697) for sick children. The most commonly observed circulating serotypes included 6A, 6B and 19F, all of which are included in the current 13-valent anti-pneumococcal conjugate vaccine that was recently introduced in Morocco. Monitoring of circulating serotypes remains necessary after vaccine introduction to assess whether serotype replacement is occurring. Copyright © 2016 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.

  2. Telithromycin resistance in Streptococcus pneumoniae is conferred by a deletion in the leader sequence of erm(B) that increases rRNA methylation

    DEFF Research Database (Denmark)

    Wolter, Nicole; Smith, Anthony M; Farrell, David J


    A telithromycin-resistant clinical isolate of Streptococcus pneumoniae (strain P1501016) has been found to contain a version of erm(B) that is altered by a 136-bp deletion in the leader sequence. By allele replacement mutagenesis, a second strain of S. pneumoniae (PC13) with a wild-type erm(B) gene...... was transformed to the telithromycin-resistant phenotype by introduction of the mutant erm(B) gene. Whereas the wild-type PC13 strain showed slight telithromycin resistance only after induction by erythromycin (telithromycin MIC increased from 0.06 to 0.5 microg/ml), the transformed PC13 strain is constitutively...... resistant (MIC of 16 mug/ml). Expression of erm(B) was quantified by real-time reverse transcription-PCR in the presence of erythromycin or telithromycin; erm(B) expression was significantly higher in the transformed PC13 strain than the wild-type strain. Furthermore, the transformed strain had...

  3. Epidemiology of culture-confirmed infections of Streptococcus pneumoniae (2012-2015) and nasopharyngeal carriage in children and households in Taiwan (2014-2015). (United States)

    Janapatla, Rajendra Prasad; Su, Lin-Hui; Chen, Hsin-Hang; Chang, Hsin-Ju; Tsai, Tian-Chi; Chen, Po-Yen; Chen, Chyi-Liang; Chiu, Cheng-Hsun


    An observational study was performed to investigate the carriage rate and serotypes of Streptococcus pneumoniae in the 13-valent pneumococcal conjugate vaccine (PCV13) era in Taiwan. From March 2014 to March 2015 a total of 500 healthy children and their households (631 adults) were enrolled from two large medical centres for nasopharyngeal carriage survey. Clinical isolates were prospectively collected from June 2012 to May 2015 at Chang Gung Memorial Hospital. We applied a multiplex polymerase chain reaction in addition to culture to detect S. pneumoniae. S. pneumoniae was isolated from 12.0 % of the children and 3.6 % of the households. In the children's cohort only 23.3 % of the isolates could be assigned to PCV13 serotypes; non-vaccine serotypes were predominant (76.6 %) and the most frequently detected non-vaccine serotypes were 15A/F and 15B/C (both 13.3 %), followed by 23A (6.7 %). In the household cohort, 21.7 % belonged to PCV13 serotypes, and 78.3 % to non-vaccine serotypes. Clinical analysis of culture-confirmed pneumococcal infection showed that infection caused by PCV13 serotypes decreased by 47 % from 83 % in 2012-2013 to 44 % in 2014-2015, while infection caused by non-PCV13 serotypes increased from 17 to 56 %. Among the carriage isolates a significantly higher percentage belonged to serogroup 15 compared to serogroup 19 (26.6 vs 6.66 %, 2014-2015; P=0.003). Therefore, clinical isolates belonging to serogroup 15 were more prevalent than those belonging to serogroup 19 (44.1 vs 32.3 %, 2014-2015; P=0.318). The isolation of non-vaccine serotypes and unknown serotypes after the introduction of PCV13 in children highlights the importance of continued surveillance for emerging serotypes.

  4. Effects of deletion of the Streptococcus pneumoniae lipoprotein diacylglyceryl transferase gene lgt on ABC transporter function and on growth in vivo.

    Directory of Open Access Journals (Sweden)

    Suneeta Chimalapati

    Full Text Available Lipoproteins are an important class of surface associated proteins that have diverse roles and frequently are involved in the virulence of bacterial pathogens. As prolipoproteins are attached to the cell membrane by a single enzyme, prolipoprotein diacylglyceryl transferase (Lgt, deletion of the corresponding gene potentially allows the characterisation of the overall importance of lipoproteins for specific bacterial functions. We have used a Δlgt mutant strain of Streptococcus pneumoniae to investigate the effects of loss of lipoprotein attachment on cation acquisition, growth in media containing specific carbon sources, and virulence in different infection models. Immunoblots of triton X-114 extracts, flow cytometry and immuno-fluorescence microscopy confirmed the Δlgt mutant had markedly reduced lipoprotein expression on the cell surface. The Δlgt mutant had reduced growth in cation depleted medium, increased sensitivity to oxidative stress, reduced zinc uptake, and reduced intracellular levels of several cations. Doubling time of the Δlgt mutant was also increased slightly when grown in medium with glucose, raffinose and maltotriose as sole carbon sources. These multiple defects in cation and sugar ABC transporter function for the Δlgt mutant were associated with only slightly delayed growth in complete medium. However the Δlgt mutant had significantly reduced growth in blood or bronchoalveolar lavage fluid and a marked impairment in virulence in mouse models of nasopharyngeal colonisation, sepsis and pneumonia. These data suggest that for S. pneumoniae loss of surface localisation of lipoproteins has widespread effects on ABC transporter functions that collectively prevent the Δlgt mutant from establishing invasive infection.

  5. Infección invasiva por Streptococcus pneumoniae: reporte de caso de un paciente con síndrome de Austrian

    Directory of Open Access Journals (Sweden)

    Daniel Echeverri


    Full Text Available Descrito inicialmente en 1957 por Robert Austrian, el síndrome que lleva su nombre se define como la tríada de neumonía, endocarditis y meningitis secundarias a una infección invasiva por Streptococcus pneumoniae. Desde entonces, y debido a su infrecuencia, se han reportado muy pocos casos en la literatura científica. A continuación se presenta el caso de un paciente de 61 años de edad con un cuadro inicial de meningitis bacteriana por S. pneumoniae, acompañado de neumonía bacteriana e insuficiencia mitral grave asociada a cuatro vegetaciones sobre la cara auricular de la valva posterior, con ruptura y prolapso de su festón central posterior. Se aisló S. pneumoniae, serotipo 18C, en líquido cefalorraquídeo y en dos hemocultivos. El paciente recibió antibióticos de amplio espectro y fue sometido a reemplazo valvular temprano con un resultado clínico satisfactorio. El principal factor pronóstico de esta condición lo determina el daño valvular subsecuente, sobre todo en pacientes con compromiso de la válvula aórtica, por lo que es necesario identificar tempranamente la extensión del compromiso valvular y definir oportunamente el tratamiento quirúrgico y antibiótico del paciente. En casos menos frecuentes, en los que solo hay compromiso de la válvula mitral, la evolución clínica es menos aguda y, por lo general, el tratamiento antibiótico dirigido y las medidas de soporte avanzado suelen ser suficientes para su control.

  6. Ablation of the Leptin receptor in Myeloid Cells Impairs Pulmonary Clearance of Streptococcus Pneumoniae and Alveolar Macrophage Bactericidal Function. (United States)

    Mancuso, Peter; Curtis, Jeffrey L; Freeman, Christine M; Peters-Golden, Marc; Weinberg, Jason B; Myers, Martin G


    Leptin is a pleiotropic hormone produced by white adipose tissue that regulates appetite and many physiologic functions including the immune response to infection. Genetic leptin deficiency in humans and mice impairs host defenses against respiratory tract infections. Since leptin deficiency is associated with obesity and other metabolic abnormalities, we generated mice that lack the leptin receptor (LepRb) in cells of the myeloid linage (LysM-LepRb-KO) to evaluate its impact in lean metabolically normal mice in a murine model of pneumococcal pneumonia. We observed higher lung and spleen bacterial burdens in LysM-LepRb-KO mice following an intratracheal challenge with S. pneumoniae. Although numbers of leukocytes recovered from bronchoalveolar lavage fluid did not differ between groups, we did observe higher levels of pulmonary IL-13 and TNFα in LysM-LepRb-KO mice 48 h post-infection. Phagocytosis and killing of ingested S. pneumoniae were also impaired in alveolar macrophages (AM)s from LysM-LepRb-KO mice in vitro, and was associated with reduced LTB4 and enhanced PGE2 synthesis in vitro. Pretreatment of AMs with LTB4 and the cyclooxygenase inhibitor, indomethacin, restored phagocytosis but not bacterial killing in vitro. These results, confirm our previous observations in leptin-deficient (ob/ob) and fasted mice, and demonstrate that decreased leptin action, as opposed to metabolic irregularities associated with obesity or starvation, are responsible for the defective host defense against pneumococcal pneumonia. They also provide novel targets for therapeutic intervention in humans with bacterial pneumonia.

  7. Distribución de serotipos de Streptococcus pneumoniae aislados de infecciones invasoras en el Hospital de Niños de Santa Fe Serotype distribution of Streptococcus pneumoniae isolated from invasive infections at the Hospital de Niños of Santa Fe.

    Directory of Open Access Journals (Sweden)

    C. Mayoral


    Full Text Available Con la introducción de vacunas conjugadas antineumocócicas se observó, en muchos países, disminución de aislamientos de Streptococcus pneumoniae del serotipo 14 y aumento de aislamientos correspondientes a serotipos no incluidos en esas vacunas. En 1993, el Hospital de Niños de Santa Fe comenzó la vigilancia de la distribución de serotipos de Streptococcus pneumoniae invasores. En este trabajo se estudió la correlación entre serotipo y a patología (neumonía/meningitis, b edad (menor o mayor de dos años, y c CIM de penicilina, para los serotipos aislados en el período 2003-2005. El serotipo predominante fue el 14, seguido del 1, 6B, 18C, 7F, 19F y 5. El serotipo 14 mostró asociación estadísticamente significativa con valores de CIM de penicilina entre 0,5 y 2 mg/l, no así con alguna patología, aunque se lo halló con mayor frecuencia en neumonías que en meningitis. Los serotipos 14 y 1 prevalecieron en niños menores y mayores de 2 años, respectivamente. La CIM de penicilina = 2 mg/l se observó más en neumonías que en meningitis. La frecuencia relativa de los diferentes serotipos hallados fue semejante a la observada en el período 1993-99; no obstante, los serotipos 18C, 4, 12F y 22F no se habían encontrado antes. La aparición de nuevos serotipos convierte en importante la vigilancia, dada la necesidad de formular vacunas que los incluyan y que efectivamente prevengan las infecciones neumocócicas más comunes.The serotype distribution of Streptococcus pneumoniae varies through time. The introduction of pneumococcal conjugate vaccines showed a decreased prevalence of pneumococcal invasive isolates belonging to serotype 14 and an increase of serotypes not therein included. In 1993, the Hospital de Niños of Santa Fe began surveillance of the serotype distribution of invasive S. pneumoniae disease. In the period 2003 - 2005, 76 isolates were analysed by studying the correlation between serotype and pathology, age and MIC

  8. NADH oxidase functions as an adhesin in Streptococcus pneumoniae and elicits a protective immune response in mice.

    Directory of Open Access Journals (Sweden)

    Lena Muchnik

    Full Text Available The initial event in disease caused by S. pneumoniae is adhesion of the bacterium to respiratory epithelial cells, mediated by surface expressed molecules including cell-wall proteins. NADH oxidase (NOX, which reduces free oxygen to water in the cytoplasm, was identified in a non-lectin enriched pneumococcal cell-wall fraction. Recombinant NOX (rNOX was screened with sera obtained longitudinally from children and demonstrated age-dependent immunogenicity. NOX ablation in S. pneumoniae significantly reduced bacterial adhesion to A549 epithelial cells in vitro and their virulence in the intranasal or intraperitoneal challenge models in mice, compared to the parental strain. Supplementation of Δnox WU2 with the nox gene restored its virulence. Saturation of A549 target cells with rNOX or neutralization of cell-wall residing NOX using anti-rNOX antiserum decreased adhesion to A549 cells. rNOX-binding phages inhibited bacterial adhesion. Moreover, peptides derived from the human proteins contactin 4, chondroitin 4 sulfotraferase and laminin5, homologous to the insert peptides in the neutralizing phages, inhibited bacterial adhesion to the A549 cells. Furthermore, rNOX immunization of mice elicited a protective immune response to intranasal or intraperitoneal S. pneumoniae challenge, whereas pneumococcal virulence was neutralized by anti-rNOX antiserum prior to intraperitoneal challenge. Our results suggest that in addition to its enzymatic activity, NOX contributes to S. pneumoniae virulence as a putative adhesin and thus peptides derived from its target molecules may be considered for the treatment of pneumococcal infections. Finally, rNOX elicited a protective immune response in both aerobic and anaerobic environments, which renders NOX a candidate for future pneumococcal vaccine.

  9. Caracterización molecular de aislamientos invasores colombianos de Streptococcus pneumoniae serotipo 5, recuperados entre 1994 y 2004

    Directory of Open Access Journals (Sweden)

    Sandra Carolina Firacative Ropero


    resistentes a tetraciclina y cloranfenicol, estuvieron relacionados con el patrón electroforético A (n=32 y los subtipos A16 (n=1 y A28 (n=1, caracterizados por presentar una banda de 340 Kb, al igual que el clon. Estos resultados muestran la prevalencia y circulación continua de aislamientos de S. pneumoniae serotipo 5, los cuales están genéticamente relacionados con el clon 19-Colombia.

  10. Characterization of the biomechanical properties of T4 pili expressed by Streptococcus pneumoniae--a comparison between helix-like and open coil-like pili. (United States)

    Castelain, Mickaël; Koutris, Efstratios; Andersson, Magnus; Wiklund, Krister; Björnham, Oscar; Schedin, Staffan; Axner, Ove


    Bacterial adhesion organelles, known as fimbria or pili, are expressed by gram-positive as well as gram-negative bacteria families. These appendages play a key role in the first steps of the invasion and infection processes, and they therefore provide bacteria with pathogenic abilities. To improve the knowledge of pili-mediated bacterial adhesion to host cells and how these pili behave under the presence of an external force, we first characterize, using force measuring optical tweezers, open coil-like T4 pili expressed by gram-positive Streptococcus pneumoniae with respect to their biomechanical properties. It is shown that their elongation behavior can be well described by the worm-like chain model and that they possess a large degree of flexibility. Their properties are then compared with those of helix-like pili expressed by gram-negative uropathogenic Escherichia coli (UPEC), which have different pili architecture. The differences suggest that these two types of pili have distinctly dissimilar mechanisms to adhere and sustain external forces. Helix-like pili expressed by UPEC bacteria adhere to host cells by single adhesins located at the distal end of the pili while their helix-like structures act as shock absorbers to dampen the irregularly shear forces induced by urine flow and to increase the cooperativity of the pili ensemble, whereas open coil-like pili expressed by S. pneumoniae adhere to cells by a multitude of adhesins distributed along the pili. It is hypothesized that these two types of pili represent different strategies of adhering to host cells in the presence of external forces. When exposed to significant forces, bacteria expressing helix-like pili remain attached by distributing the external force among a multitude of pili, whereas bacteria expressing open coil-like pili sustain large forces primarily by their multitude of binding adhesins which presumably detach sequentially.

  11. Serotype distribution of Streptococcus pneumoniae isolated from patients with invasive pneumococcal disease in Brazil before and after ten-pneumococcal conjugate vaccine implementation. (United States)

    dos Santos, Silvia R; Passadore, Lilian F; Takagi, Elizabeth H; Fujii, Cristiane M; Yoshioka, Cristina R M; Gilio, Alfredo E; Martinez, Marina B


    The ten-pneumococcal conjugate vaccine (PCV10) was introduced into the national immunization program for childhood vaccination schedules by the Brazilian Health Public Service in March 2010. The aim of this study was to compare Streptococcus pneumoniae serotype distribution, antibiotic resistance patterns, and potential coverage before (January 2006-June 2010) and after (July 2010-September 2012) PCV10 introduction. The incidence of invasive pneumococcal disease (IPD), patient demographics, and disease characteristics were recorded. This study was conducted at the University Hospital of Sao Paulo University in Brazil from January 2006 to September 2012. Serotyping was performed using multiplex PCR typing, and antimicrobial sensitivity by Clinical and Laboratory Standards Institute (CLSI). A total of 259 S. pneumoniae strains were isolated from patients with IPD. The ages of the patients ranged from 3 months to 95 years old. The strains were isolated from cerebrospinal fluid, pleural fluid, and blood. The incidence of IPD among patients at HU-USP changed after the introduction of PCV10. The overall incidence of IPD was 3.42 cases per 1000 admissions in the vaccine pre- implementation period and of 2.99 cases per 1000 admissions in the vaccine post-implementation period. The incidence of IPD among children<2 y.o. attended at HU-USP changed significantly after the introduction of PCV10, from 20.30 to 3.97 of incidence. The incidence of PCV10- serotypes decrease from 16.47 to 0.44 in the same age, before and after PC10 implementation, respectively. Moreover, it was possible to realize the sensitivity to penicillin among isolates increased significantly in the post-vaccine period. Data from this study suggest that PCV10 contributed to decrease with PID rate among children less than 2 y.o. The resistance rate among pneumococcal isolates also could be observed since serotypes with greater resistance to beta lactam antibiotics were not easily isolated after vaccination

  12. Transcriptional attenuation controls macrolide inducible efflux and resistance in Streptococcus pneumoniae and in other Gram-positive bacteria containing mef/mel(msr(D)) elements. (United States)

    Chancey, Scott T; Bai, Xianhe; Kumar, Nikhil; Drabek, Elliott F; Daugherty, Sean C; Colon, Thomas; Ott, Sandra; Sengamalay, Naomi; Sadzewicz, Lisa; Tallon, Luke J; Fraser, Claire M; Tettelin, Hervé; Stephens, David S


    Macrolide resistance, emerging in Streptococcus pneumoniae and other Gram-positive bacteria, is increasingly due to efflux pumps encoded by mef/mel(msr) operons found on discrete mobile genetic elements. The regulation of mef/mel(msr) in these elements is not well understood. We identified the mef(E)/mel transcriptional start, localized the mef(E)/mel promoter, and demonstrated attenuation of transcription as a mechanism of regulation of macrolide-inducible mef-mediated macrolide resistance in S. pneumoniae. The mef(E)/mel transcriptional start site was a guanine 327 bp upstream of mef(E). Consensus pneumococcal promoter -10 (5'-TATACT-3') and -35 (5'-TTGAAC-3') boxes separated by 17 bp were identified 7 bp upstream of the start site. Analysis of the predicted secondary structure of the 327 5' region identified four pairs of inverted repeats R1-R8 predicted to fold into stem-loops, a small leader peptide [MTASMRLR, (Mef(E)L)] required for macrolide induction and a Rho-independent transcription terminator. RNA-seq analyses provided confirmation of transcriptional attenuation. In addition, expression of mef(E)L was also influenced by mef(E)L-dependent mRNA stability. The regulatory region 5' of mef(E) was highly conserved in other mef/mel(msr)-containing elements including Tn1207.1 and the 5612IQ complex in pneumococci and Tn1207.3 in Group A streptococci, indicating a regulatory mechanism common to a wide variety of Gram-positive bacteria containing mef/mel(msr) elements.

  13. Prevalence of mef and ermB genes in invasive pediatric erythromycin-resistant Streptococcus pneumoniae isolates from Argentina Prevalencia de los genes mef y ermB en aislamientos invasivos de Streptococcus pneumoniae resistentes a eritromicina recuperados de pacientes pediátricos en Argentina

    Directory of Open Access Journals (Sweden)

    A. Corso


    Full Text Available During the period 1993-2001, a total of 1,499 pneumococci isolates were recovered through the Argentinean surveillance of Streptococcus pneumoniae causing invasive disease in children under 6 years of age, 3.5% of which were erythromycin resistant. Among the 50 erythromycin-resistant strains available, 58% (n=29 harbored mefA/E genes (15 mefA, 30%; and 14 mefE, 28%, 34% (n=17 ermB, and 6% (n=3 both mefA/E plus ermB genes, while one isolate was negative for all the acquired genes studied. The England14-9 (42%, Poland6B-20 (20% and Spain9v-3 (16% clones were responsible for the emergence of pneumococcal macrolide resistance in pediatric population from Argentina.En el marco del programa de vigilancia regional SIREVA, se analizaron 1499 aislamientos de Streptococcus pneumoniae causantes de enfermedad invasiva en menores de 6 años, recuperados entre 1993 y 2001. Se detectó un 3,5% de resistencia a eritromicina. De los 50 aislamientos resistentes a eritromicina que pudieron ser estudiados, el 58% (n=29 tenían los genes mefA/E (15 mefA, 30% y 14 mefE, 28%, el 34% (n=17 el gen ermB y el 6% (n=3 la combinación de genes mefA/E y ermB. Sólo un aislamiento fue negativo para todos los genes analizados. Los clones internacionales England14-9, Poland6B-20 y Spain9v-3 representaron el 78% del total de aislamientos resistentes (42, 20 y 16%, respectivamente y se consideraron los responsables de la emergencia de la resistencia a macrólidos entre los neumococos que afectan a la población pediátrica de Argentina.

  14. Vaccination for the control of childhood bacterial pneumonia - Haemophilus influenzae type b and pneumococcal vaccines

    Directory of Open Access Journals (Sweden)

    Diana C Otczyk


    Full Text Available Pneumonia in childhood is endemic in large parts of the world and in particular, in developing countries, as well as in many indigenous communities within developed nations. Haemophilus influenzae type b and Streptococcus pneumoniae conjugate vaccines are currently available against the leading bacterial causes of pneumonia.  The use of the vaccines in both industrialised and developing countries have shown a dramatic reduction in the burden of pneumonia and invasive disease in children.  However, the greatest threat facing pneumococcal conjugate vaccine effectiveness is serotype replacement.  The current vaccines provide serotype-specific, antibody–mediated protection against only a few of the 90+ capsule serotypes.  Therefore, there has been a focus in recent years to rapidly advance technologies that will result in broader disease coverage and more affordable vaccines that can be used in developing countries.  The next generation of pneumococcal vaccines have advanced to clinical trials.

  15. Development and Validation of a Multiplex PCR-Based Assay for the Upper Respiratory Tract Bacterial Pathogens Haemophilus influenzae, Streptococcus pneumoniae, and Moraxella catarrhalis. (United States)

    Post; White; Aul; Zavoral; Wadowsky; Zhang; Preston; Ehrlich


    Background: Conventional simplex polymerase chain reaction (PCR)-based assays are limited in that they only provide for the detection of a single infectious agent. Many clinical diseases, however, present in a nonspecific, or syndromic, fashion, thereby necessitating the simultaneous assessment of multiple pathogens. Panel-based molecular diagnostic testing can be accomplished by the development of multiplex PCR-based assays, which can detect, individually or severally, different pathogens that are associated with syndromic illness. As part of a larger program of panel development, an assay that can simultaneously detect Haemophilus influenzae, Streptococcus pneumoniae, and Moraxella catarrhalis was developed. These organisms were chosen as they are the most common bacterial pathogens associated with both the acute and chronic forms of otitis media; they are also responsible for a high percentage of sinus infections in both children and adults. In addition, H. influenzae and S. pneumoniae are commonly associated with septic meningitits. Methods and Results: Multiple individual PCR-based assays were developed for each of the three target organisms which were then evaluated for sensitivity and specificity. Utilizing the simplex assays that met our designated performance criteria, a matrix style approach was used to develop a duplex H. influenzae-S. pneumoniae assay. The duplex assay was then used as a single component in the development of a triplex assay, wherein the various M. catarrhalis primer-probe sets were tested for compatibility with the existing assay. A single-step PCR protocol, with species-specific primers for each of the three target organisms and a liquid hybridization-gel retardation amplimer detection system, was developed, which amplifies and then discriminates among each of the amplification products according to size. This assay is able to detect all three organisms in a specific manner, either individually or severally. Dilutional experiments

  16. Asymtomatic carriage of Neisseria meningitidis and Neisseria lactamica in relation to Streptococcus pneumoniae and Haemophilus influenzae colonization in healthy children: Apropos of 1400 children sampled

    International Nuclear Information System (INIS)

    Bakir, Mustafa; Yagci, Aysegul; Ulger, Nurver; Akbenlioglu, Cengiz; Ilki, Arzu; Soyletir, Guner


    Meningococcal disease is one of the most important causes of morbidity and mortality among children in many parts of the world. Main reservoir of carriage and site of meningococcal dissemination appears to be the upper respiratory tract. Colonization of Neisseria meningitidis and lactamica and factors affecting this carriage were determined in a group of healthy children aged 0-10 years. Meningococcus and N. lactamica carriage were detected in 17 (1.23%) and 245 (17.7%) of 1382 subjects, respectively. Number (%) of serogroups for meningococci was 1 (6), 5 (29), 0 (0), 1 (6), 1 (6), and 9 (53) for A, B, C, D, W135, and Y, respectively. Having more than three household members, elementary school attendance, pharyngeal carriage of Streptococcus pneumoniae and Haemophilus influenzae were associated with carriage of meningococci, whereas age less than 24-month was associated with carriage of N. lactamica. There was a reverse carriage rate between N. meningitidis and N. lactamica by age which may suggest a possible protective role of N. lactamica against meningococcal colonization among pre-school children

  17. Nasal immunization of mice with Lactobacillus casei expressing the Pneumococcal Surface Protein A: induction of antibodies, complement deposition and partial protection against Streptococcus pneumoniae challenge. (United States)

    Campos, Ivana B; Darrieux, Michelle; Ferreira, Daniela M; Miyaji, Eliane N; Silva, Débora A; Arêas, Ana Paula M; Aires, Karina A; Leite, Luciana C C; Ho, Paulo L; Oliveira, Maria Leonor S


    Strategies for the development of new vaccines against Streptococcus pneumoniae infections try to overcome problems such as serotype coverage and high costs, present in currently available vaccines. Formulations based on protein candidates that can induce protection in animal models have been pointed as good alternatives. Among them, the Pneumococcal Surface Protein A (PspA) plays an important role during systemic infection at least in part through the inhibition of complement deposition on the pneumococcal surface, a mechanism of evasion from the immune system. Antigen delivery systems based on live recombinant lactic acid bacteria (LAB) represents a promising strategy for mucosal vaccination, since they are generally regarded as safe bacteria able to elicit both systemic and mucosal immune responses. In this work, the N-terminal region of clade 1 PspA was constitutively expressed in Lactobacillus casei and the recombinant bacteria was tested as a mucosal vaccine in mice. Nasal immunization with L. casei-PspA 1 induced anti-PspA antibodies that were able to bind to pneumococcal strains carrying both clade 1 and clade 2 PspAs and to induce complement deposition on the surface of the bacteria. In addition, an increase in survival of immunized mice after a systemic challenge with a virulent pneumococcal strain was observed.

  18. The Three Major Spanish Clones of Penicillin-Resistant Streptococcus pneumoniae Are the Most Common Clones Recovered in Recent Cases of Meningitis in Spain (United States)

    Enright, Mark C.; Fenoll, Asunción; Griffiths, David; Spratt, Brian G.


    One hundred six isolates of Streptococcus pneumoniae recovered in Spain from patients with meningitis in 1997 and 1998 were characterized by multilocus sequence typing. A heterogeneous collection of genotypes was associated with meningitis in Spain: 65 different sequence types were resolved and, even at a genetic distance of 0.43, there were 37 distinct lineages. Thirty-eight percent of the isolates, including all isolates of serotypes 6B, 9V, 14, and 23F, were resistant to penicillin, and 24% of the isolates were members of the three major Spanish penicillin-resistant or multidrug-resistant clones of serotypes 6B, 9V, and 23F or serotype variants of these clones. These three clones (MICs, 1 to 2 μg of penicillin/ml) were the most common clones associated with pneumococcal meningitis in Spain during 1997 and 1998. Only two of the other clones associated with meningitis were penicillin resistant (MICs, 0.12 to 0.5 μg/ml). One of the two most prevalent penicillin-susceptible clones causing meningitis (serotype 3) has not been detected outside of Spain, whereas the other (serotype 18C) has been recovered from patients with meningitis in the United Kingdom, The Netherlands, and Denmark. The prevalence of meningitis caused by isolates of the three major Spanish penicillin-resistant or multiply antibiotic-resistant clones, which are now globally distributed, is disturbing and clearly establishes their ability to cause life-threatening disease. PMID:10488179

  19. Dominance of multidrug-resistant Denmark(14)-32 (ST230) clone among Streptococcus pneumoniae serotype 19A isolates causing pneumococcal disease in Bulgaria from 1992 to 2013. (United States)

    Setchanova, Lena Petrova; Alexandrova, Alexandra; Dacheva, Daniela; Mitov, Ivan; Kaneva, Radka; Mitev, Vanio


    A pneumococcal conjugate vaccine (PCV10) was introduced in Bulgarian national immunization program since April 2010. Clonal composition based on pulsed-field gel electrophoresis and multilocus sequence typing genotyping of 52 serotype 19A Streptococcus pneumoniae isolates was analyzed. These were invasive and respiratory isolates collected between 1992 and 2013 from both children (78.8% clone. The most frequent sequence type (ST) was ST230 (48.1%) and together with four other closely related STs (15.4%), belonging to ST1611, ST276, ST7466, and ST2013, which were single- and double-locus variants; they were included in the main CC230. The disappearance of highly drug-resistant ST663 clone and emergence of new clones as CC320 and CC199 was also observed among the rest 19A isolates. A comparison of clonal composition between invasive and noninvasive isolates did not show a great genetic diversity among both kinds of isolates. Continuous surveillance of serotype 19A population following the introduction of PCV10 is essential to evaluate the impact of the vaccine on the epidemiology of this serotype.

  20. Seasonal Variation of Escherichia coli, Staphylococcus aureus, and Streptococcus pneumoniae Bacteremia According to Acquisition and Patient Characteristics

    DEFF Research Database (Denmark)

    Gradel, Kim Oren; Nielsen, Stig Lønberg; Pedersen, Court


    subgroups by combining the following characteristics: species, acquisition, age group, gender, CCI level, and location of infection. Assuming a sinusoidal model, seasonal variation was assessed by the peak-to-trough (PTT) ratio with a 95% confidence interval (CI). RESULTS In total, we included 16,006 E...... variation was observed for S. aureus. S. pneumoniae showed high seasonal variation, which did not differ according to acquisition (overall PTT ratio, 3.42; 95% CI, 3.10-3.83). CONCLUSIONS Seasonal variation was mainly related to the species although the place of acquisition was important for E. coli. Infect....... coli, 6,924 S. aureus, and 4,884 S. pneumoniae bacteremia cases. For E. coli, the seasonal variation was highest for community-acquired cases (PTT ratio, 1.24; 95% CI, 1.17-1.32), was diminished for HCA (PTT ratio, 1.14; 95% CI, 1.04-1.25), and was missing for hospital-acquired cases. No seasonal...

  1. Virulence Factors of Streptococcus pneumoniae. Comparison between African and French Invasive Isolates and Implication for Future Vaccines.

    Directory of Open Access Journals (Sweden)

    Sophie Blumental

    Full Text Available Many surface proteins thought to promote Streptocococcus pneumoniae virulence have recently been discovered and are currently being considered as future vaccine targets. We assessed the prevalence of 16 virulence genes among 435 S. pneumoniae invasive isolates from France and the "African meningitis belt" region, with particular focus on serotype 1 (Sp1, to compare their geographical distribution, assess their association with site of infection and evaluate their potential interest as new vaccine candidates.Detection by PCR of pspA (+families, pspC (+pspC.4, pavA, lytA, phtA,B,D,E, nanA,B,C, rrgA (Pilus-1, sipA (Pilus-2, pcpA and psrp was performed on all isolates, as well as antibiotic resistance testing and MLVA typing (+MLST on 54 representative strains. Determination of ply alleles was performed by sequencing (Sp1 isolates.MLVA and virulence genes profiles segregated Sp1 isolates into 2 groups that followed continent distribution. The ply allele 5 and most of the genes that were variable (nanC, Pilus-2, psrp, pcpA, phtD were present in the French Sp1 isolates (PMEN clone Sweden(1-28, ST306 but absent from the African ones. Whereas all African Sp1 isolates clustered into a single MLST CC (CC217, MLVA distinguished two CCs that followed temporal evolution. Pilus-2 and psrp were more prevalent in bacteraemic pneumonia yielded isolates and phtB in meningitis-related isolates. Considering vaccine candidates, phtD was less prevalent than anticipated (50% and pcpA varied importantly between France and Africa (98% versus 34%. Pilus-1 was carried by 7-11% of isolates and associated with β-lactams resistance.Most virulence genes were carried by the European ST306 clone but were lacking on Sp1 isolates circulating in the African meningitis belt, where a more serious pattern of infection is observed. While virulence proteins are now considered as vaccine targets, the geographical differences in their prevalence could affect the efficacy expected from

  2. The Pneumococcal Serotype 15C Capsule Is Partially O-Acetylated and Allows for Limited Evasion of 23-Valent Pneumococcal Polysaccharide Vaccine-Elicited Anti-Serotype 15B Antibodies


    Spencer, Brady L.; Shenoy, Anukul T.; Orihuela, Carlos J.; Nahm, Moon H.


    As a species, Streptococcus pneumoniae (the pneumococcus) utilizes a diverse array of capsular polysaccharides to evade the host. In contrast to large variations in sugar composition and linkage formation, O-acetylation is a subtle capsular modification that nonetheless has a large impact on capsular shielding and recognition of the capsule by vaccine-elicited antibodies. Serotype 15B, which is included in the 23-valent pneumococcal polysaccharide vaccine (PPV23), carries the putative O-acety...

  3. Resistencia a antibióticos no betalactámicos de aislamientos invasores de Streptococcus pneumoniae en niños latinoamericanos: SIREVA II, 2000-2005 Resistance to non-beta-lactam antibiotics in the clinical isolates of Streptococcus pneumoniae of children in Latin America: SIREVA II, 2000-2005

    Directory of Open Access Journals (Sweden)

    Clara Inés Agudelo


    Full Text Available OBJETIVO:Determinar la evolución de la resistencia a la eritromicina, el cloranfenicol, el trimetoprim-sulfametozaxol (SXT y la vancomicina de aislamientos invasores de Streptococcus pneumoniae obtenidos de niños de 10 países de América Latina y del Caribe en seis años de vigilancia. MÉTODOS: Se analizaron 8 993 aislamientos de S. pneumoniae recuperados entre 2000 y 2005 de niños menores de 6 años con infecciones invasoras, procedentes de Argentina, Brasil, Chile, Colombia, Cuba, México, Paraguay, República Dominicana, Uruguay y Venezuela. La sensibilidad a los antibióticos se determinó mediante los métodos establecidos y estandarizados en el proyecto SIREVA. La resistencia a múltiples antibióticos se definió como la resistencia a tres o más familias de antibióticos, de los no betalactámicos analizados en este estudio o de los betalactámicos evaluados en un estudio previo en el que 37,8% de estos aislamientos presentaron sensibilidad disminuida a la penicilina. RESULTADOS: Se encontró algún grado de resistencia al SXT y la eritromicina (56,4% y 15,4% de los aislamientos estudiados, respectivamente y 4,6% presentó alta resistencia al cloranfenicol. Todos los aislamientos fueron sensibles a la vancomicina. Se observó la mayor frecuencia de resistencia al SXT en los aislamientos de neumonía y a la eritromicina en los casos de sepsis (61,6% y 25,5%, respectivamente; P OBJECTIVE: To examine the development of resistance to erythromycin, chloramphenicol, trimethoprim-sulfamethoxazole (TMP-SMZ, and vancomycin of the invasive isolates of Streptococcus pneumoniae obtained from children in 10 Latin American/Caribbean countries during six years of surveillance. METHODS: Analysis of 8 993 isolates of S. pneumoniae recovered in 2000-2005 from children with invasive infections, who were less than 6 years of age, and from Argentina, Brazil, Chile, Colombia, Cuba, Dominican Republic, Mexico, Paraguay, Uruguay, or Venezuela. Antibiotic

  4. Antimicrobial resistance patterns of colonizing Streptococcus pneumoniae among young child-mother pairs in the rural highlands of the Peruvian Andes (United States)

    Howard, Leigh; Edwards, Kathryn; Griffin, Marie; Gil, Ana; Minaya, Gina; Mercado, Erik; Ochoa, Theresa; Lanata, Claudio; Grijalva, Carlos G


    Abstract Background Despite widespread use of pneumococcal conjugate vaccines (PCVs), Streptococcus pneumoniae (pneumococcus) remains an important cause of pneumonia. Prior to widespread PCV use, we found a high prevalence of nasopharyngeal (NP) colonization with pneumococcus resistant to multiple antibiotic classes among young children in the rural highlands of Peru. We sought to confirm contemporary resistance profiles among young children, their mothers, and animal contacts in the post-PCV era. Methods We enrolled eligible members of Peruvian households whose children had participated in our previous study. Mothers were questioned about antibiotic use for themselves and their children age <3 years. NP samples were collected from children, mothers, and their animal contacts including cows, guinea pigs, and dogs, when available. Samples were cultured for pneumococcus using standard methods and routine disk antibiotic susceptibility testing was performed. Drinking water and milk samples were tested, when available, for the presence of β-lactam and tetracycline residues (IDEXX Β-Tetra testing kit; Westbrook, ME). Results Members of 47 households were enrolled, including 50 children and 47 mothers (3 sibling pairs). The median (IQR) age of children was 1.2 years (0.6-2.2) and number of household members was 5 (4-6). Sixteen of 50 (32%) children and 7/47 (15%) mothers had received antibiotics in the prior 6 months (Fig 1). Pneumococcus was detected in 31/50 (62%) children, 9/47 (19%) mothers, and 1/31 (3%) guinea pigs. Pneumococci were not detected in dogs (n = 29) or cows (n = 7). Resistance to multiple classes of antibiotics, including TMP-SMX, tetracyclines, and β-lactams, was common among children and adults (Fig 2). No antibiotic residues were detected in water (n = 41) or milk (n = 7) samples. Conclusion Pneumococcal colonization was common among young children, less prevalent among adults, and rare among animals. Resistance to macrolides and

  5. Crystallization and preliminary X-ray diffraction studies of choline-binding protein F from Streptococcus pneumoniae

    Energy Technology Data Exchange (ETDEWEB)

    Molina, Rafael [Grupo de Cristalografía Macromolecular y Biología Estructural, Instituto Química Física Rocasolano, CSIC, Serrano 119, 28006 Madrid (Spain); González, Ana; Moscoso, Miriam; García, Pedro [Departamento de Microbiología Molecular, Centro de Investigaciones Biológicas, CSIC, Ramiro de Maeztu 9, 28040 Madrid (Spain); Stelter, Meike; Kahn, Richard [Institut de Biologie Structurale J.-P. Ebel CEA CNRS UJF, Laboratoire de Cristallographie Macromoléculaire, 41 Rue Jules Horowitz, 38027 Grenoble CEDEX 1 (France); Hermoso, Juan A., E-mail: [Grupo de Cristalografía Macromolecular y Biología Estructural, Instituto Química Física Rocasolano, CSIC, Serrano 119, 28006 Madrid (Spain)


    The modular choline-binding protein F (CbpF) from S. pneumoniae has been crystallized by the hanging-drop vapour-diffusion method. A SAD data set from a gadolinium-complex derivative has been collected to 2.1 Å resolution. Choline-binding protein F (CbpF) is a modular protein that is bound to the pneumococcal cell wall through noncovalent interactions with choline moieties of the bacterial teichoic and lipoteichoic acids. Despite being one of the more abundant proteins on the surface, along with the murein hydrolases LytA, LytB, LytC and Pce, its function is still unknown. CbpF has been crystallized using the hanging-drop vapour-diffusion method at 291 K. Diffraction-quality orthorhombic crystals belong to space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 49.13, b = 114.94, c = 75.69 Å. A SAD data set from a Gd-HPDO3A-derivatized CbpF crystal was collected to 2.1 Å resolution at the gadolinium L{sub III} absorption edge using synchrotron radiation.

  6. Crystallization and preliminary X-ray diffraction studies of choline-binding protein F from Streptococcus pneumoniae

    International Nuclear Information System (INIS)

    Molina, Rafael; González, Ana; Moscoso, Miriam; García, Pedro; Stelter, Meike; Kahn, Richard; Hermoso, Juan A.


    The modular choline-binding protein F (CbpF) from S. pneumoniae has been crystallized by the hanging-drop vapour-diffusion method. A SAD data set from a gadolinium-complex derivative has been collected to 2.1 Å resolution. Choline-binding protein F (CbpF) is a modular protein that is bound to the pneumococcal cell wall through noncovalent interactions with choline moieties of the bacterial teichoic and lipoteichoic acids. Despite being one of the more abundant proteins on the surface, along with the murein hydrolases LytA, LytB, LytC and Pce, its function is still unknown. CbpF has been crystallized using the hanging-drop vapour-diffusion method at 291 K. Diffraction-quality orthorhombic crystals belong to space group P2 1 2 1 2, with unit-cell parameters a = 49.13, b = 114.94, c = 75.69 Å. A SAD data set from a Gd-HPDO3A-derivatized CbpF crystal was collected to 2.1 Å resolution at the gadolinium L III absorption edge using synchrotron radiation

  7. Síndrome hemolítico-urêmica relacionada à infecção invasiva pelo Streptococcus pneumoniae Hemolytic-uremic syndrome complicating invasive pneumococcal disease

    Directory of Open Access Journals (Sweden)

    Anna Leticia de O. Cestari


    Full Text Available OBJETIVO: A doença pneumocócica é importante problema de saúde pública e raramente há associação desta infecção com a síndrome hemolítico-urêmica (SHU grave. O objetivo deste artigo é relatar o caso de um paciente com esta associação. DESCRIÇÃO DO CASO: Criança do sexo masculino, com 17 meses de idade, admitida no hospital com insuficiência respiratória aguda e necessitando de suporte ventilatório. O exame radiológico mostrava extensa opacidade homogênea em hemitórax direito. A hemocultura foi positiva para Streptococcus pneumoniae. Nos exames de admissão, notaram-se: hemoglobina de 6,5g/dL, 38.000 plaquetas/mm³, uréia de 79mg/dL e creatinina de 1,64mg/dL. No primeiro dia, apresentou oligoanúria e hipervolemia, necessitando de hemodiafiltração. Evoluiu com disfunção de múltiplos órgãos e óbito no sétimo dia. A necrópsia mostrou áreas extensas de necrose cortical e tubular renal, com depósito de fibrina nas arteríolas. COMENTÁRIOS: A SHU associada ao pneumococo apresenta morbidade e mortalidade elevadas. Em crianças com doença pneumocócica invasiva e acometimento hematológico ou renal grave, deve-se estar atento a esta rara complicação. Merecem investigação os seguintes aspectos relacionados à doença: a função da detecção precoce de antígenos T ativados no diagnóstico e terapêutica, o papel do fator H na patogênese, o método ideal de substituição renal e a definição do prognóstico em longo prazo.OBJECTIVE: Pneumococcal diseases are a major public health problem. Severe hemolytic-uremic syndrome is an uncommon complication. The aim of this study is to report a child with this complication. CASE DESCRIPTION: A male child with 17 months old was admitted to the hospital, due to acute respiratory failure, needing ventilatory support. Roentgenogram demonstrated massive condensation of right lung and Streptococcus pneumonia was isolated from blood cultures. Laboratory tests showed

  8. The relBE2Spn toxin-antitoxin system of Streptococcus pneumoniae: role in antibiotic tolerance and functional conservation in clinical isolates.

    Directory of Open Access Journals (Sweden)

    Concha Nieto


    Full Text Available Type II (proteic chromosomal toxin-antitoxin systems (TAS are widespread in Bacteria and Archaea but their precise function is known only for a limited number of them. Out of the many TAS described, the relBE family is one of the most abundant, being present in the three first sequenced strains of Streptococcus pneumoniae (D39, TIGR4 and R6. To address the function of the pneumococcal relBE2Spn TAS in the bacterial physiology, we have compared the response of the R6-relBE2Spn wild type strain with that of an isogenic derivative, Delta relB2Spn under different stress conditions such as carbon and amino acid starvation and antibiotic exposure. Differences on viability between the wild type and mutant strains were found only when treatment directly impaired protein synthesis. As a criterion for the permanence of this locus in a variety of clinical strains, we checked whether the relBE2Spn locus was conserved in around 100 pneumococcal strains, including clinical isolates and strains with known genomes. All strains, although having various types of polymorphisms at the vicinity of the TA region, contained a functional relBE2Spn locus and the type of its structure correlated with the multilocus sequence type. Functionality of this TAS was maintained even in cases where severe rearrangements around the relBE2Spn region were found. We conclude that even though the relBE2Spn TAS is not essential for pneumococcus, it may provide additional advantages to the bacteria for colonization and/or infection.

  9. Familias de la proteína de superficie PspA de Streptococcus pneumoniae: Relación con serotipos y localización

    Directory of Open Access Journals (Sweden)

    Clara Mayoral


    Full Text Available PspA, proteína de superficie de Streptococcus pneumoniae es un factor de virulencia, fuertemente inmunogénica y común a todos los serotipos. Aunque el gen que codifica para esta proteína presenta una marcada heterogeneidad en la región correspondiente al N-terminal, la PspA contiene epitopes conservados de manera tal que la inmunización genera protección contra neumococos pertenecientes a diversos tipos capsulares y con distintas PspA. A pesar del marcado polimorfismo del gen pspA es posible agrupar las distintas variantes en 3 familias mayoritarias. Estas propiedades las convierten en candidatas ideales para elaborar vacunas. Debido a que la mayoría de los trabajos sobre identificación de familias fueron realizados sobre serotipos frecuentes en otros países, el objetivo fue identificar las familias de PspA de aislamientos de pacientes de nuestra región y relacionarlas con los serotipos prevalentes y patologías. Se estudiaron 70 aislamientos, provenientes de niños con infecciones invasoras. Se aplicó una PCR utilizando cebadores específicos de cada familia. El 60% fueron familia 1 y 34% familia 2. En un 6% no se identificó ninguna de las familias de PspA. Los serotipos 1 y 5 presentaron familia 1 únicamente; los serotipos 14, 6B, 19F y 18C mostraron genes de ambas familias. La familia 1 se observó en 60% de las neumonías y 50% de las meningitis. La familia 2 en 33% de neumonías y 50% de meningitis. Esta información podría ser un valioso aporte para la formulación de una vacuna regional efectiva utilizando PspA recombinante como inmunógeno.

  10. High Resolution Crystal Structures of Streptococcus pneumoniae Nicotinamidase with Trapped Intermediates Provide Insights into Catalytic Mechanism and Inhibition by Aldehydes∥,‡ (United States)

    French, Jarrod B.; Cen, Yana; Sauve, Anthony A.; Ealick, Steven E.


    Nicotinamidases are salvage enzymes that convert nicotinamide to nicotinic acid. These enzymes are essential for the recycling of nicotinamide into NAD+ in most prokaryotes, most single cell and multicellular eukaryotes, but not in mammals. The significance of these enzymes for nicotinamide salvage and for NAD+ homeostasis has increased interest in nicotinamidases as possible antibiotic targets. Nicotinamidases are also regulators of intracellular nicotinamide concentrations, thereby regulating signaling of downstream NAD+ consuming enzymes, such as the NAD+-dependent deacetylases (sirtuins). Here, we report several high resolution crystal structures of the nicotinamidase from Streptococcus pneumoniae (SpNic) in unliganded and ligand-bound forms. The structure of the C136S mutant in complex with nicotinamide provides details about substrate binding while a trapped nicotinoyl-thioester complexed with SpNic reveals the structure of the proposed thioester reaction intermediate. Examination of the active site of SpNic reveals several important features including a metal ion that coordinates the substrate and the catalytically relevant water molecule, and an oxyanion hole which both orients the substrate and offsets the negative charge that builds up during catalysis. Structures of this enzyme with bound nicotinaldehyde inhibitors elucidate the mechanism of inhibition and provide further details about the catalytic mechanism. In addition, we provide a biochemical analysis of the identity and role of the metal ion that orients the ligand in the active site and activates the water molecule responsible for hydrolysis of the substrate. These data provide structural evidence for several proposed reaction intermediates and allow for a more complete understanding of the catalytic mechanism of this enzyme. PMID:20853856

  11. High-resolution crystal structures of Streptococcus pneumoniae nicotinamidase with trapped intermediates provide insights into the catalytic mechanism and inhibition by aldehydes . (United States)

    French, Jarrod B; Cen, Yana; Sauve, Anthony A; Ealick, Steven E


    Nicotinamidases are salvage enzymes that convert nicotinamide to nicotinic acid. These enzymes are essential for the recycling of nicotinamide into NAD(+) in most prokaryotes and most single-cell and multicellular eukaryotes, but not in mammals. The significance of these enzymes for nicotinamide salvage and for NAD(+) homeostasis has stimulated interest in nicotinamidases as possible antibiotic targets. Nicotinamidases are also regulators of intracellular nicotinamide concentrations, thereby regulating signaling of downstream NAD(+)-consuming enzymes, such as the NAD(+)-dependent deacetylases (sirtuins). Here, we report several high-resolution crystal structures of the nicotinamidase from Streptococcus pneumoniae (SpNic) in unliganded and ligand-bound forms. The structure of the C136S mutant in complex with nicotinamide provides details about substrate binding, while a trapped nicotinoyl thioester in a complex with SpNic reveals the structure of the proposed thioester reaction intermediate. Examination of the active site of SpNic reveals several important features, including a metal ion that coordinates the substrate and the catalytically relevant water molecule and an oxyanion hole that both orients the substrate and offsets the negative charge that builds up during catalysis. Structures of this enzyme with bound nicotinaldehyde inhibitors elucidate the mechanism of inhibition and provide further details about the catalytic mechanism. In addition, we provide a biochemical analysis of the identity and role of the metal ion that orients the ligand in the active site and activates the water molecule responsible for hydrolysis of the substrate. These data provide structural evidence of several proposed reaction intermediates and allow for a more complete understanding of the catalytic mechanism of this enzyme.

  12. High-Resolution Crystal Structures of Streptococcus pneumoniae Nicotinamidase with Trapped Intermediates Provide Insights into the Catalytic Mechanism and Inhibition by Aldehydes

    Energy Technology Data Exchange (ETDEWEB)

    French, Jarrod B.; Cen, Yana; Sauve, Anthony A.; Ealick, Steven E. (Cornell); (Weill-Med)


    Nicotinamidases are salvage enzymes that convert nicotinamide to nicotinic acid. These enzymes are essential for the recycling of nicotinamide into NAD{sup +} in most prokaryotes and most single-cell and multicellular eukaryotes, but not in mammals. The significance of these enzymes for nicotinamide salvage and for NAD{sup +} homeostasis has stimulated interest in nicotinamidases as possible antibiotic targets. Nicotinamidases are also regulators of intracellular nicotinamide concentrations, thereby regulating signaling of downstream NAD{sup +}-consuming enzymes, such as the NAD{sup +}-dependent deacetylases (sirtuins). Here, we report several high-resolution crystal structures of the nicotinamidase from Streptococcus pneumoniae (SpNic) in unliganded and ligand-bound forms. The structure of the C136S mutant in complex with nicotinamide provides details about substrate binding, while a trapped nicotinoyl thioester in a complex with SpNic reveals the structure of the proposed thioester reaction intermediate. Examination of the active site of SpNic reveals several important features, including a metal ion that coordinates the substrate and the catalytically relevant water molecule and an oxyanion hole that both orients the substrate and offsets the negative charge that builds up during catalysis. Structures of this enzyme with bound nicotinaldehyde inhibitors elucidate the mechanism of inhibition and provide further details about the catalytic mechanism. In addition, we provide a biochemical analysis of the identity and role of the metal ion that orients the ligand in the active site and activates the water molecule responsible for hydrolysis of the substrate. These data provide structural evidence of several proposed reaction intermediates and allow for a more complete understanding of the catalytic mechanism of this enzyme.

  13. Cord blood Streptococcus pneumoniae-specific cellular immune responses predict early pneumococcal carriage in high-risk infants in Papua New Guinea. (United States)

    Francis, J P; Richmond, P C; Strickland, D; Prescott, S L; Pomat, W S; Michael, A; Nadal-Sims, M A; Edwards-Devitt, C J; Holt, P G; Lehmann, D; van den Biggelaar, A H J


    In areas where Streptococcus pneumoniae is highly endemic, infants experience very early pneumococcal colonization of the upper respiratory tract, with carriage often persisting into adulthood. We aimed to explore whether newborns in high-risk areas have pre-existing pneumococcal-specific cellular immune responses that may affect early pneumococcal acquisition. Cord blood mononuclear cells (CBMC) of 84 Papua New Guinean (PNG; high endemic) and 33 Australian (AUS; low endemic) newborns were stimulated in vitro with detoxified pneumolysin (dPly) or pneumococcal surface protein A (PspA; families 1 and 2) and compared for cytokine responses. Within the PNG cohort, associations between CBMC dPly and PspA-induced responses and pneumococcal colonization within the first month of life were studied. Significantly higher PspA-specific interferon (IFN)-γ, tumour necrosis factor (TNF)-α, interleukin (IL)-5, IL-6, IL-10 and IL-13 responses, and lower dPly-IL-6 responses were produced in CBMC cultures of PNG compared to AUS newborns. Higher CBMC PspA-IL-5 and PspA-IL-13 responses correlated with a higher proportion of cord CD4 T cells, and higher dPly-IL-6 responses with a higher frequency of cord antigen-presenting cells. In the PNG cohort, higher PspA-specific IL-5 and IL-6 CBMC responses were associated independently and significantly with increased risk of earlier pneumococcal colonization, while a significant protective effect was found for higher PspA-IL-10 CBMC responses. Pneumococcus-specific cellular immune responses differ between children born in pneumococcal high versus low endemic settings, which may contribute to the higher risk of infants in high endemic settings for early pneumococcal colonization, and hence disease. © 2016 British Society for Immunology.

  14. Physical structure and genetic expression of the sulfonamide-resistance plasmid pLS80 and its derivatives in Streptococcus pneumoniae and Bacillus subtilis

    Energy Technology Data Exchange (ETDEWEB)

    Lopez, P.; Espinosa, M.; Lacks, S.A.


    The 10-kb chromosomal fragment of Streptococcus pneumoniae cloned in pLS80 contains the sul-d allele of the pneumococcal gene for dihydropteroate synthase. As a single copy in the chromosome this allele confers resistance to sulfanilamide at 0.2 mg/ml; in the multicopy plasmid it confers resistance to 2.0 mg/ml. The sul-d mutation was mapped by restriction analysis to a 0.4-kb region. A spontaneous deletion beginning approx. 1.5 kb to the right of the sul-d mutation prevented gene function, possibly by removing a promoter. This region could be restored by chromosomal facilitation and be demonstrated in the plasmid by selection for sulfonamide resistance. Under selection for a vector marker, tetracycline resistance, only the deleted plasmid was detectable, apparently as a result of plasmid segregation and the advantageous growth rates of cells with smaller plasmids. When such cells were selected for sulfonamide resistance, the deleted region returned to the plasmid, presumably by equilibration between the chromosome and the plasmid pool, to give a low frequency (approx. 10/sup -3/) of cells resistant to sulfanilamide at 2.0 mg/ml. Models for the mechanisms of chromosomal facilitation and equilibration are proposed. Several derivatives of pLS80 could be transferred to Bacillus subtilis, where they conferred resistance to sulfanilamide at 2 mg/ml, thereby demonstrating cross-species expression of the pneumococcal gene. Transfer of the plasmids to B. subtilis gave rise to large deletions to the left of the sul-d marker, but these deletions did not interfere with the sul-d gene function. Restriction maps of pLS80 and its variously deleted derivatives are presented.

  15. Serum Antibody Response to Five Streptococcus pneumoniae Proteins during Acute Otitis Media in Otitis Prone and Non-Otitis Prone Children (United States)

    Kaur, Ravinder; Casey, Janet R.; Pichichero, Michael E.


    Background Streptococcus pneumoniae (Spn) is one of the common bacteria responsible for episodic acute otitis media (AOM; non-otitis prone), recurrent AOM (otitis-prone) and AOM treatment failure (AOMTF) in children. Objective From a population of 268 children we sought to compare the serum IgG antibody titers to five different Spn proteins (PhtD, LytB, PcpA, PhtE and Ply) that are vaccine candidates in children with episodic AOM (n=34), who were otitis prone (n=35), and who had AOMTF (n=25) caused by Spn. Methods Antibody was quantitated by ELISA. Results At their acute AOM visit, anti-PhtD, -LytB, -PhtE and −Ply IgG antibody titers in otitis-prone children were significantly lower compared to non-otitis prone children (p otitis-prone, AOMTF and non-otitis prone children had no significant change in geometric mean IgG antibody titers against the five proteins (except for PhtE in children with AOMTF), but detailed analysis showed that about one-third of the children in each cohort had a 2-fold rise in antibody to the studied antigens. While non-otitis prone children had significant increases (p otitis-prone children either failed to show rises or the rises were significantly less than the non-otitis prone children. Conclusion Otitis-prone and AOMTF children mount less of an IgG serum antibody response than non-otitis prone children to Spn proteins following AOM and nasopharyngeal colonization. PMID:21487325

  16. Epidemiology of Streptococcus pneumoniae causing acute otitis media among children in Southern Catalonia throughout 2007-2013: Incidence, serotype distribution and vaccine's effectiveness. (United States)

    Ochoa-Gondar, O; Figuerola-Massana, E; Vila-Corcoles, A; Aguirre, C A; de Diego, C; Satue, E; Gomez, F; Raga, X


    This study investigated incidence and serotype distribution of Streptococcus pneumoniae causing acute otitis media (AOM) in Catalonian children, evaluating vaccination effectiveness in the current era of extended valency pneumococcal conjugate vaccines (PCVs). Population-based surveillance study that included all AOM cases with isolation of pneumococcus (from otic fluids/otorrea) identified among children ≤14 years in the region of Tarragona (Southern Catalonia, Spain) from 01/01/2007 to 31/12/2013. Prevalence of infections caused by serotypes covered by the different PCVs formulations were calculated for the periods before and after 30/06/2010 (date of PCV7/PCV13 replacement). The indirect cohort method was used to estimate PCV7/13 effectiveness against vaccine-type infections. A total of 78 children with a pneumococcal AOM were identified across study period, which meant an incidence rate of 23 cases per 100,000 population-year. Thirty-six cases (46.2%) occurred within the late PCV7 era and 42 cases (53.8%) during the early PCV13 era. Overall, the most common serotypes were type 19A (21.7%), type 3 (13.3%) and type 15B (6.7%). Prevalence of cases caused by serotypes included in PCV7 did not substantially change between the first and the second study period (from 10.3% to 12.9%), whereas prevalence of cases caused by PCV13 serotypes showed a decreasing trend between both periods (from 65.5% to 48.4%). The aggregate PCV7/13 effectiveness against vaccine-type infections was 72% (95% confidence interval: -26 to 94). Pneumococcal conjugate vaccination appears an acceptable preventive option to prevent pneumococcal AOM in infants. However, its serotype coverage and clinical effectiveness are not optimal. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  17. A Novel Initiation Mechanism of Death in Streptococcus pneumoniae Induced by the Human Milk Protein-Lipid Complex HAMLET and Activated during Physiological Death* (United States)

    Clementi, Emily A.; Marks, Laura R.; Duffey, Michael E.; Hakansson, Anders P.


    To cause colonization or infection, most bacteria grow in biofilms where differentiation and death of subpopulations is critical for optimal survival of the whole population. However, little is known about initiation of bacterial death under physiological conditions. Membrane depolarization has been suggested, but never shown to be involved, due to the difficulty of performing such studies in bacteria and the paucity of information that exists regarding ion transport mechanisms in prokaryotes. In this study, we performed the first extensive investigation of ion transport and membrane depolarization in a bacterial system. We found that HAMLET, a human milk protein-lipid complex, kills Streptococcus pneumoniae (the pneumococcus) in a manner that shares features with activation of physiological death from starvation. Addition of HAMLET to pneumococci dissipated membrane polarity, but depolarization per se was not enough to trigger death. Rather, both HAMLET- and starvation-induced death of pneumococci specifically required a sodium-dependent calcium influx, as shown using calcium and sodium transport inhibitors. This mechanism was verified under low sodium conditions, and in the presence of ionomycin or monensin, which enhanced pneumococcal sensitivity to HAMLET- and starvation-induced death. Pneumococcal death was also inhibited by kinase inhibitors, and indicated the involvement of Ser/Thr kinases in these processes. The importance of this activation mechanism was made evident, as dysregulation and manipulation of physiological death was detrimental to biofilm formation, a hallmark of bacterial colonization. Overall, our findings provide novel information on the role of ion transport during bacterial death, with the potential to uncover future antimicrobial targets. PMID:22700972

  18. A novel initiation mechanism of death in Streptococcus pneumoniae induced by the human milk protein-lipid complex HAMLET and activated during physiological death. (United States)

    Clementi, Emily A; Marks, Laura R; Duffey, Michael E; Hakansson, Anders P


    To cause colonization or infection, most bacteria grow in biofilms where differentiation and death of subpopulations is critical for optimal survival of the whole population. However, little is known about initiation of bacterial death under physiological conditions. Membrane depolarization has been suggested, but never shown to be involved, due to the difficulty of performing such studies in bacteria and the paucity of information that exists regarding ion transport mechanisms in prokaryotes. In this study, we performed the first extensive investigation of ion transport and membrane depolarization in a bacterial system. We found that HAMLET, a human milk protein-lipid complex, kills Streptococcus pneumoniae (the pneumococcus) in a manner that shares features with activation of physiological death from starvation. Addition of HAMLET to pneumococci dissipated membrane polarity, but depolarization per se was not enough to trigger death. Rather, both HAMLET- and starvation-induced death of pneumococci specifically required a sodium-dependent calcium influx, as shown using calcium and sodium transport inhibitors. This mechanism was verified under low sodium conditions, and in the presence of ionomycin or monensin, which enhanced pneumococcal sensitivity to HAMLET- and starvation-induced death. Pneumococcal death was also inhibited by kinase inhibitors, and indicated the involvement of Ser/Thr kinases in these processes. The importance of this activation mechanism was made evident, as dysregulation and manipulation of physiological death was detrimental to biofilm formation, a hallmark of bacterial colonization. Overall, our findings provide novel information on the role of ion transport during bacterial death, with the potential to uncover future antimicrobial targets.

  19. Comparative supragenomic analyses among the pathogens Staphylococcus aureus, Streptococcus pneumoniae, and Haemophilus influenzae Using a modification of the finite supragenome model

    Directory of Open Access Journals (Sweden)

    Yu Susan


    Full Text Available Abstract Background Staphylococcus aureus is associated with a spectrum of symbiotic relationships with its human host from carriage to sepsis and is frequently associated with nosocomial and community-acquired infections, thus the differential gene content among strains is of interest. Results We sequenced three clinical strains and combined these data with 13 publically available human isolates and one bovine strain for comparative genomic analyses. All genomes were annotated using RAST, and then their gene similarities and differences were delineated. Gene clustering yielded 3,155 orthologous gene clusters, of which 2,266 were core, 755 were distributed, and 134 were unique. Individual genomes contained between 2,524 and 2,648 genes. Gene-content comparisons among all possible S. aureus strain pairs (n = 136 revealed a mean difference of 296 genes and a maximum difference of 476 genes. We developed a revised version of our finite supragenome model to estimate the size of the S. aureus supragenome (3,221 genes, with 2,245 core genes, and compared it with those of Haemophilus influenzae and Streptococcus pneumoniae. There was excellent agreement between RAST's annotations and our CDS clustering procedure providing for high fidelity metabolomic subsystem analyses to extend our comparative genomic characterization of these strains. Conclusions Using a multi-species comparative supragenomic analysis enabled by an improved version of our finite supragenome model we provide data and an interpretation explaining the relatively larger core genome of S. aureus compared to other opportunistic nasopharyngeal pathogens. In addition, we provide independent validation for the efficiency and effectiveness of our orthologous gene clustering algorithm.

  20. Streptococcus pneumoniae(Spn) Nasopharyngeal Carriage in Children Under 3 Years Old, Attending Day Care Centers in Argentina (United States)

    Gentile, Angela; Rearte, Analía; Von Spetch, Martha; Laban, Celia; Papucci, Santiago Lopez; Badano, Andrea; Ferrario, Claudia; Pereda, Rosana; Flores, Devora; Berry, Diana; Aguilera, Alejandra; Sponton, Norma; Sorhouet, Cecilia; Napoli, Daniela; Devoto, Susana; Vizzotti, Carla


    Abstract Background In 2012 the 13-valent conjugated pneumococcal vaccine (PCV-13) was introduced in the National Immunization Program. We performed an epidemiological study to describe SPN nasopharyngeal carriage prevalence. Methods Between June to September 2015 it was performed a cross-sectional study among children Salta (North West), Trelew (South), Rosario (Centre), Buenos Aires (Capital city) and Posadas (North East)). Samples were analyzed at references hospitals of each city and isolates were submitted to the INEI “Dr. Carlos G. Malbrán “, for confirming and serotyping. We considered completed schedule 3 doses of PCV13, administrated14 days prior to enrollment. Results We included 359 toddlers, 61,6% (IC95% 56,3–66,6) were SPN carriers. Median age was 24 months, without significative difference in carriage status. Multivariate analysis showed that independently of age, sex and socioeconomic level, variables associated with carriage were: · City: Taking Salta as reference (less carriage prevalence), Rosario and Posadas were statistically associated with higher prevalence rates: OR: 3,1 (IC95% 1,3–7,1) y OR: 2,8 (IC96% 1,2–6,3) respectively · Children attending to public day care centers had higher carriage rates than those attending private ones: OR: 1,9 (IC95% 1,06–3,4) · Children sharing bedroom with 3 or more persons, were associated to mayor risk or carriage: OR: 1,7 (IC95% 1,03–2,7) We found 46 serotypes in the 221 isolates. (2 couldn’t be serotyped), 90,9% (IC95% 86,3–94,3) were non PCV 13 serotypes (most frequent were 15B, 23B and 11A). Only 7 of 46 were PCV13 serotypes. (Graphic 1) Of the 20 toddlers with PCV13 serotypes, 16 were completely vaccinated Graphic 1: S pneumoniae serotype distribution. N = 221 Conclusion Nasopharyngeal carriage of SPN was high in children < 3 years old attending day care centers. Most isolates were Non PCV13 serotypes. The independent predictors for higher prevalence rates were: 1- Children living

  1. A Two-Component Regulatory System, CsrR-CsrS, Represses Expression of Three Streptococcus pyogenes Virulence Factors, Hyaluronic Acid Capsule, Streptolysin S, and Pyrogenic Exotoxin B


    Heath, Andrew; DiRita, Victor J.; Barg, Neil L.; Engleberg, N. Cary


    Certain Tn916 insertions in the chromosome of an M1-type, nonmucoid Streptococcus pyogenes isolate (MGAS166) were previously shown to result in stable mucoidy with increased expression of the capsular synthetic genes. The transposon insertions in these strains are directly upstream of an apparent operon encoding a two-component regulatory system, designated csrR-csrS. Compared with MGAS166, these mucoid mutants are more hemolytic and cause significantly more tissue damage in a murine model of...

  2. Vigilancia epidemiológica centinela de Haemophilus influenzae y Streptococcus pneumoniae en menores de 5 años en el Perú

    Directory of Open Access Journals (Sweden)


    Full Text Available Objetivo: Determinar la frecuencia, serotipos y perfil de resistencia antimicrobiana de Haemophilus influenzae (Hi y Streptococcus pneumoniae (Spn en casos de neumonía y meningitis en niños menores de 5 años en el Perú. Materiales y métodos: Entre octubre de 2000 y diciembre de 2001, se implementó la vigilancia centinela de Hi y Spn en dos hospitales de Lima y tres hospitales de otros departamentos (Cusco, Arequipa y Puno. La identificación de serotipos y el estudio de la resistencia antimicrobiana se realizaron en el Instituto Nacional de Salud de Lima, Perú. La susceptibilidad antimicrobiana por la concentración inhibitoria mínima (CIM se realizó por el método de microdilución en placa, siguiendo las pautas del Comité Nacional de Estándares de Laboratorios Clínicos (NCCLS. Resultados: Ingresaron 1 283 casos. Se aislaron 59 cepas (31 de Hi y 28 de Spn, de ellos, 2,3% de las neumonías y 42,5% de las meningitis tuvieron aislamiento bacteriológico. En 10/1210 (0,8% pacientes con neumonía se aisló Hi y Spn en 18/1210 (1,5%. En 21/73 (28,8% de los casos de meningitis se aislaron Hi y Spn en 10/73 (13,7%. Se identificaron los serotipos de Spn: 1, 5, 6A, 11, 14, 19, 19F y 20. Los cepas aislados de Hi fueron del serotipo B. Se identificaron cepas de Spn con resistencia alta a penicilina (3/13, cotrimoxazol (3/13, eritromicina (1/13, cloranfenicol (1/13 y ceftriaxona (1/13; y cepas de Hi altamente resistentes a cotrimoxazol (4/20 y ampicilina (1/20. Conclusiones: Las tasas de aislamiento de Spn y Hi en menores de 5 años fueron bastante bajas. Se hallaron serotipos ya encontrados en Latinoamérica, y se identificaron algunas cepas de Spn y Hi con resistencia a los antibióticos utilizados en los esquemas de tratamiento para neumonía y meningitis. Recomendamos continuar con este sistema de vigilancia, basado en hospitales centinela.

  3. Functional validation of putative toxin-antitoxin genes from the Gram-positive pathogen Streptococcus pneumoniae: phd-doc is the fourth bona-fide operon. (United States)

    Chan, Wai Ting; Yeo, Chew Chieng; Sadowy, Ewa; Espinosa, Manuel


    Bacterial toxin-antitoxin (TAs) loci usually consist of two genes organized as an operon, where their products are bound together and inert under normal conditions. However, under stressful circumstances the antitoxin, which is more labile, will be degraded more rapidly, thereby unleashing its cognate toxin to act on the cell. This, in turn, causes cell stasis or cell death, depending on the type of TAs and/or time of toxin exposure. Previously based on in silico analyses, we proposed that Streptococcus pneumoniae, a pathogenic Gram-positive bacterium, may harbor between 4 and 10 putative TA loci depending on the strains. Here we have chosen the pneumococcal strain Hungary(19A)-6 which contains all possible 10 TA loci. In addition to the three well-characterized operons, namely relBE2, yefM-yoeB, and pezAT, we show here the functionality of a fourth operon that encodes the pneumococcal equivalent of the phd-doc TA. Transcriptional fusions with gene encoding Green Fluorescent Protein showed that the promoter was slightly repressed by the Phd antitoxin, and exhibited almost background values when both Phd-Doc were expressed together. These findings demonstrate that phd-doc shows the negative self-regulatory features typical for an authentic TA. Further, we also show that the previously proposed TAs XreA-Ant and Bro-XreB, although they exhibit a genetic organization resembling those of typical TAs, did not appear to confer a functional behavior corresponding to bona fide TAs. In addition, we have also discovered new interesting bioinformatics results for the known pneumococcal TAs RelBE2 and PezAT. A global analysis of the four identified toxins-antitoxins in the pneumococcal genomes (PezAT, RelBE2, YefM-YoeB, and Phd-Doc) showed that RelBE2 and Phd-Doc are the most conserved ones. Further, there was good correlation among TA types, clonal complexes and sequence types in the 48 pneumococcal strains analyzed.

  4. Resistencia antibiótica de streptococcus pneumoniae en portadores nasofaríngeos sanos de siete regiones del Perú

    Directory of Open Access Journals (Sweden)

    Nancy Torres

    Full Text Available Objetivos. Determinar el patrón de susceptibilidad antibiótica de cepas de Streptococcus pneumoniae aisladas de portadores nasofaríngeos sanos menores de 2 años de siete regiones del Perú. Materiales y métodos. Entre el 2007 y 2009 se tomaron muestras de hisopado nasofaríngeo a 2123 niños sanos entre 2 y 24 meses de edad en los consultorios de crecimiento y desarrollo (CRED y vacunación de hospitales y centros de salud de Lima, Piura, Cusco, Abancay, Arequipa, Huancayo, e Iquitos. Se determinó la resistencia a diez antibióticos mediante la prueba de disco-difusión de las cepas de neumococo aisladas. Resultados. Se aislaron 572 cepas. Se encontró altas tasas de resistencia a cotrimoxazol (58%; penicilina (52,2% no-sensibles; tetraciclina (29,1%; azitromicina (28,9%, y eritromicina (26,3%. La resistencia a cloranfenicol fue baja (8,8%. Se encontró 29,5% de multirresistencia. La resistencia a la azitromicina y a la penicilina fue diferente en las siete regiones (p<0,05, hallándose el mayor porcentaje de cepas no-sensibles a penicilina en Arequipa (63,6%, mientras que el menor fue en Cusco (23,4%. Conclusiones. Los elevados niveles de resistencia encontrados para penicilina, cotrimoxazol y macrólidos en cepas de neumococo aisladas de portadores sanos en todas las regiones estudiadas, y su asociación con uso previo de antibióticos, representan un importante problema de salud pública en nuestro país. Esto resalta la necesidad de implementar, a nivel nacional, estrategias para disminuir el uso irracional de antibióticos, sobre todo en la población pediátrica. Es necesario complementar los datos de resistencia a penicilina con la determinación de la concentración mínima inhibitoria para hacer las recomendaciones terapéuticas respectivas

  5. Serotype distribution and antibiotic susceptibility of Streptococcus pneumoniae strains in the south of Tunisia: A five-year study (2012–2016 of pediatric and adult populations

    Directory of Open Access Journals (Sweden)

    Sonia Ktari


    Full Text Available Objectives: To analyze the serotype distribution of Streptococcus pneumoniae clinical isolates collected in the south of Tunisia over a 5-year period in different age groups and to assess their antimicrobial susceptibility patterns. Methods: A total of 305 non-duplicate S. pneumoniae isolates were collected between January 2012 and December 2016 at the university hospital in Sfax, Tunisia. All isolates were serotyped by multiplex PCR. The antibiotic susceptibility of all isolates was determined using the disk diffusion test or Etest assay. Results: Among the 305 pneumococcal isolates, 76 (24.9% were invasive and 229 (75.1% were non-invasive. The most common serotypes were 19F (20%, 14 (16.7%, 3 (9.2%, 23F (7.5%, 19A (5.9%, and 6B (5.9%. Potential immunization coverage rates for pneumococcal conjugate vaccines PCV7, PCV10, and PCV13 were 58%, 59.3%, and 78.7%, respectively. Three-quarters (75.3% of pneumococcal isolates were non-susceptible to penicillin. The resistance rate to erythromycin was 71.4%. Only two isolates were resistant to levofloxacin. Conclusions: 19F and 14 were the most prevalent serotypes in the south of Tunisia. The inclusion of a PCV in the immunization program could be useful for reducing the burden of pneumococcal diseases. The high resistance rate to penicillin and macrolides is alarming. Prudent use of antibiotics is crucial to prevent the selection of multidrug-resistant pneumococci. Keywords: Streptococcus pneumoniae, Antibiotic, Serotype, PCV, Tunisia

  6. Capsular typing of Streptococcus agalactiae (Lancefield group B streptococci) from fish using multiplex PCR and serotyping (United States)

    Streptococcus spp. including Streptococcus agalactiae (Lancefield group B streptococci) are considered emerging pathogens responsible for approximately $1 billion USD in annual losses to the global tilapia (Oreochromis sp.) aquaculture industry. This study evaluated a published multiplex PCR capsul...

  7. RlmCD-mediated U747 methylation promotes efficient G748 methylation by methyltransferase RlmAII in 23S rRNA in Streptococcus pneumoniae; interplay between two rRNA methylations responsible for telithromycin susceptibility. (United States)

    Shoji, Tatsuma; Takaya, Akiko; Sato, Yoshiharu; Kimura, Satoshi; Suzuki, Tsutomu; Yamamoto, Tomoko


    Adenine at position 752 in a loop of helix 35 from positions 745 to 752 in domain II of 23S rRNA is involved in binding to the ribosome of telithromycin (TEL), a member of ketolides. Methylation of guanine at position 748 by the intrinsic methyltransferase RlmA(II) enhances binding of telithromycin (TEL) to A752 in Streptococcus pneumoniae. We have found that another intrinsic methylation of the adjacent uridine at position 747 enhances G748 methylation by RlmA(II), rendering TEL susceptibility. U747 and another nucleotide, U1939, were methylated by the dual-specific methyltransferase RlmCD encoded by SP_1029 in S. pneumoniae. Inactivation of RlmCD reduced N1-methylated level of G748 by RlmA(II) in vivo, leading to TEL resistance when the nucleotide A2058, located in domain V of 23S rRNA, was dimethylated by the dimethyltransferase Erm(B). In vitro methylation of rRNA showed that RlmA(II) activity was significantly enhanced by RlmCD-mediated pre-methylation of 23S rRNA. These results suggest that RlmCD-mediated U747 methylation promotes efficient G748 methylation by RlmA(II), thereby facilitating TEL binding to the ribosome. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. Nucleotide sequence of the hexA gene for DNA mismatch repair in Streptococcus pneumoniae and homology of hexA to mutS of Escherichia coli and Salmonella typhimurium

    International Nuclear Information System (INIS)

    Priebe, S.D.; Hadi, S.M.; Greenberg, B.; Lacks, S.A.


    The Hex system of heteroduplex DNA base mismatch repair operates in Streptococcus pneumoniae after transformation and replication to correct donor and nascent DNA strands, respectively. A functionally similar system, called Mut, operates in Escherichia coli and Salmonella typhimurium. The nucleotide sequence of a 3.8-kilobase segment from the S. pneumoniae chromosome that includes the 2.7-kilobase hexA gene was determined. Chromosomal DNA used as donor to measure Hex phenotype was irradiated with UV light. An open reading frame that could encode a 17-kilodalton polypeptide (OrfC) was located just upstream of the gene encoding a polypeptide of 95 kilodaltons corresponding to HexA. Shine-Dalgarno sequences and putative promoters were identified upstream of each protein start site. Insertion mutations showed that only HexA functioned in mismatch repair and that the promoter for hexA transcription was located within the OrfC-coding region. The HexA polypeptide contains a consensus sequence for ATP- or GTP-binding sites in proteins. Comparison of the entire HexA protein sequence to that of MutS of S. typhimurium, showed the proteins to be homologous, inasmuch as 36% of their amino acid residues were identical. This homology indicates that the Hex and Mut systems of mismatch repair evolved from an ancestor common to the gram-positive streptococci and the gram-negative enterobacteria. It is the first direct evidence linking the two systems

  9. Impacto de la resistencia a antimicrobianos y de serotipos de Streptococcus pneumoniae en la mortalidad de niños menores de 5 años con enfermedad invasora

    Directory of Open Access Journals (Sweden)

    Ríos Ana María


    Full Text Available Las enfermedades invasoras ocasionadas por Streptococcus pneumoniae han sido por mucho tiempo una causa importante de mortalidad. Si bien se sabe que la resistencia de S. pneumoniae a la penicilina y otros antimicrobianos se ha incrementado con el tiempo, aún no se ha esclarecido el efecto de este cambio sobre la mortalidad. Se desconoce igualmente el impacto de la virulencia de los tipos capsulares del microorganismo en la mortalidad. El objetivo de este estudio de cohorte retrospectivo fue determinar los factores de riesgo de mortalidad por enfermedad neumocócica en niños menores de 5 años. Durante un estudio de serotipificación de S. pneumoniae patrocinado por el Sistema Regional de Vacunas de la OPS se revisaron con este fin las fichas epidemiológicas de 245 pacientes de esa edad en quienes se diagnosticó enfermedad invasora por S. pneumoniae entre 1994 y 1996 en Colombia. De los 245 pacientes, 29 (11% fallecieron. En el análisis univariado no se establecieron diferencias significativas entre los pacientes que murieron y aquellos que sobrevivieron en cuanto a edad, sexo, procesos patológicos subyacentes al ingresar, o concordancia del tratamiento antimicrobiano recibido. Las variables que se asociaron con la mortalidad fueron un diagnóstico de meningitis; infección por S. pneumoniae resistente a la penicilina, trimetoprima-sulfametoxazol (TMS o eritromicina; multirresistencia, y los tipos capsulares 6, 23F, 7F, 8 y 35 B. En el análisis por regresión logística siguieron mostrando asociación con la mortalidad los tipos capsulares 7F (razón de posibilidades u odds ratio [OR] = 7,13; P = 0,04 y 8 (OR = 13,8; P = 0,07, la polipnea (OR = 2,74; P = 0,03, el diagnóstico de meningitis (OR = 5,02; P = 0,0001 y la resistencia a TMS (OR = 2,62; P = 0,02. En los casos de neumonía, el factor que más se asoció con la mortalidad fue el tipo capsular, mientras que en los casos de meningitis, dicho factor fue la resistencia a

  10. Impacto de la resistencia a antimicrobianos y de serotipos de Streptococcus pneumoniae en la mortalidad de niños menores de 5 años con enfermedad invasora

    Directory of Open Access Journals (Sweden)

    Ana María Ríos


    Full Text Available Las enfermedades invasoras ocasionadas por Streptococcus pneumoniae han sido por mucho tiempo una causa importante de mortalidad. Si bien se sabe que la resistencia de S. pneumoniae a la penicilina y otros antimicrobianos se ha incrementado con el tiempo, aún no se ha esclarecido el efecto de este cambio sobre la mortalidad. Se desconoce igualmente el impacto de la virulencia de los tipos capsulares del microorganismo en la mortalidad. El objetivo de este estudio de cohorte retrospectivo fue determinar los factores de riesgo de mortalidad por enfermedad neumocócica en niños menores de 5 años. Durante un estudio de serotipificación de S. pneumoniae patrocinado por el Sistema Regional de Vacunas de la OPS se revisaron con este fin las fichas epidemiológicas de 245 pacientes de esa edad en quienes se diagnosticó enfermedad invasora por S. pneumoniae entre 1994 y 1996 en Colombia. De los 245 pacientes, 29 (11% fallecieron. En el análisis univariado no se establecieron diferencias significativas entre los pacientes que murieron y aquellos que sobrevivieron en cuanto a edad, sexo, procesos patológicos subyacentes al ingresar, o concordancia del tratamiento antimicrobiano recibido. Las variables que se asociaron con la mortalidad fueron un diagnóstico de meningitis; infección por S. pneumoniae resistente a la penicilina, trimetoprima-sulfametoxazol (TMS o eritromicina; multirresistencia, y los tipos capsulares 6, 23F, 7F, 8 y 35 B. En el análisis por regresión logística siguieron mostrando asociación con la mortalidad los tipos capsulares 7F (razón de posibilidades u odds ratio [OR] = 7,13; P = 0,04 y 8 (OR = 13,8; P = 0,07, la polipnea (OR = 2,74; P = 0,03, el diagnóstico de meningitis (OR = 5,02; P = 0,0001 y la resistencia a TMS (OR = 2,62; P = 0,02. En los casos de neumonía, el factor que más se asoció con la mortalidad fue el tipo capsular, mientras que en los casos de meningitis, dicho factor fue la resistencia a

  11. Understanding Pneumonia (United States)

    ... and Diseases > Lung Disease Lookup > Pneumonia Learn About Pneumonia Pneumonia is a common lung infection caused by ... vaccinated and practicing good health habits What Is Pneumonia? Pneumonia is an infection in one or both ...

  12. Antibacterial activity of Euphorbia hirta against Streptococcus ...

    African Journals Online (AJOL)

    This investigation was conducted to determine the in-vitro effect of aqueous, ethanol and methanol crude extracts of Euphorbia hirta at concentrations ranging from 10mg/ml – 100mg/ml against three pathogenic bacteria (Streptococcus pneumoniae, Klebsiella pneumoniae and Proteus vulgaris) using cup plate method.

  13. Klebsiella pneumoniae triggers a cytotoxic effect on airway epithelial cells

    Directory of Open Access Journals (Sweden)

    Llobet-Brossa Enrique


    Full Text Available Abstract Background Klebsiella pneumoniae is a capsulated Gram negative bacterial pathogen and a frequent cause of nosocomial infections. Despite its clinical relevance, little is known about the features of the interaction between K. pneumoniae and lung epithelial cells on a cellular level, neither about the role of capsule polysaccharide, one of its best characterised virulence factors, in this interaction. Results The interaction between Klebsiella pneumoniae and cultured airway epithelial cells was analysed. K. pneumoniae infection triggered cytotoxicity, evident by cell rounding and detachment from the substrate. This effect required the presence of live bacteria and of capsule polysaccharide, since it was observed with isolates expressing different amounts of capsule and/or different serotypes but not with non-capsulated bacteria. Cytotoxicity was analysed by lactate dehydrogenase and formazan measurements, ethidium bromide uptake and analysis of DNA integrity, obtaining consistent and complementary results. Moreover, cytotoxicity of non-capsulated strains was restored by addition of purified capsule during infection. While a non-capsulated strain was avirulent in a mouse infection model, capsulated K. pneumoniae isolates displayed different degrees of virulence. Conclusion Our observations allocate a novel role to K. pneumoniae capsule in promotion of cytotoxicity. Although this effect is likely to be associated with virulence, strains expressing different capsule levels were not equally virulent. This fact suggests the existence of other bacterial requirements for virulence, together with capsule polysaccharide.

  14. Pneumonia Atipikal


    Budastra I Nyoman; Siadi Purniti Putu; Subanada Ida Bagus


    Pneumonia atipikal adalah pneumonia yang disebabkan oleh mikroorganisme yang tidak dapat diidentifikasi dengan teknik diagnostik standar pneumonia pada umumnya dan tidak menunjukkan respon terhadap antibiotik b-laktam. Mikroorganisme patogen penyebab pneumonia atipikal pada umumnya adalah Mycoplasma pneumoniae, Chlamydia pneumoniae, dan Legionella pneumophila. Manifestasi klinik, pemeriksaan laboratorium dan radiologis pneumonia atipikal menunjukkan gambaran tidak spesifik. Man...

  15. Increased constituent ratios of Klebsiella sp., Acinetobacter sp., and Streptococcus sp. and a decrease in microflora diversity may be indicators of ventilator-associated pneumonia: a prospective study in the respiratory tracts of neonates.

    Directory of Open Access Journals (Sweden)

    Wei Lu

    Full Text Available Ventilator-associated pneumonia (VAP is a common complication and cause of death in neonates on mechanical ventilation. However, it is difficult to define the causes of VAP. To understand the causes of VAP, we undertook a prospective study based on the diversity of the microflora in VAP. The experimental group consisted of newborns who suffered from respiratory distress syndrome (RDS and VAP, while the control group suffered from RDS without VAP. Sputa were collected within 1, 3, and 5 days of ventilation and were divided into six groups. DNA was extracted from the samples, and the 16S rDNA was PCR amplified, separated using denaturing gradient gel electrophoresis (DGGE, cloned and sequenced. The resulting sequences were compared using BLAST. The DGGE pictures were measured, and the richness, Shannon-Wiener index, and cluster maps were analyzed. No differences were found regarding the constituent ratio of any genus between the Non-VAP and VAP group within 1 day after intubation. After 1 to 3 days, the constituent ratios of Klebsiella sp., Acinetobacter sp., and Streptococcus sp. in the VAP group were higher than those in the Non-VAP group, and the ratios of Serratia sp. and Achromobacter sp. were lower. After 3 to 5 days, the ratios of Klebsiella sp., Acinetobacter sp., Serratia sp., and Achromobacter sp. were lower than those in the Non-VAP group. The richness and Shannon-Wiener index of the Non-VAP group were higher than those of the VAP group from 1 to 3 days after intubation, while no differences were found within 1 day and from 3 to 5 days. We conclude that during the first three days of intubation, the microflora diversity in the lower respiratory tract was reduced due to VAP, and the greater constituent ratios of Klebsiella sp., Acinetobacter sp., and Streptococcus sp. in the sputum may be indicators of VAP.

  16. Capsule Endoscopy (United States)

    ... because experience with it is limited and traditional upper endoscopy is widely available. Why it's done Your doctor might recommend a capsule endoscopy procedure to: Find the cause of gastrointestinal bleeding. If you have unexplained bleeding in your digestive ...

  17. Surveillance of invasive diseases caused by Streptococcus pneumoniae in Italy: evolution of serotypes and antibiotic resistance in different age groups before and after implementation of PCV7

    Directory of Open Access Journals (Sweden)

    Fabio D’Ambrosio


    Full Text Available Background: PCV7 has been available in Italy since 2001, however only in 2005 national recommendations were issued and vaccination was implemented with different modalities by the Regions. Objectives: Aim of this study was to describe changes in serotype distribution and antibiotic susceptibility of S. pneumoniae from invasive pneumococcal diseases (IPD in the last decade. Study Design: S. pneumoniae isolates from IPD, collected through a national surveillance system, were serotyped and antibiotic susceptibility was determined by E-test. Data were analyzed according to age groups (5 years, >5-64 years, 65 years and to 3 time periods: prior, during and after PCV7 implementation (2001- 2003, 2006-2008 and 2009-2011. Results: The percentage of PCV7 serotypes (vaccine serotypes, VS decreased over the years not only in children (from 60% to 26% but also in the other age groups. Penicillin resistance was rather low in 2001-2003 (7-12%, but peaked in children in 2006-2008 (24%, and decreased in 2009-2011, while erythromycin resistance slightly decreased over the 3 periods. Conclusions: PCV7 use has largely impacted the epidemiology of S. pneumoniae in Italy, with a decrease in VS in all age groups.The impact of PCV 13, available in Italy since the end of 2010, requires future evaluations.

  18. Radiographic features of Mycoplasma pneumoniae pneumonia: differential diagnosis and performance timing

    International Nuclear Information System (INIS)

    Miyashita, Naoyuki; Sugiu, Tadaaki; Kawai, Yasuhiro; Oda, Keiko; Yamaguchi, Tetsuya; Ouchi, Kazunobu; Kobashi, Yoshihiro; Oka, Mikio


    The Japanese Respiratory Society guidelines propose a differential diagnosis for atypical pneumonia and bacterial pneumonia using a scoring system for the selection of appropriate antibiotic. In order to improve this scoring system, the guidelines are seeking new specific parameter. The purpose of this study was to clarify the pattern of abnormalities with Mycoplasma pneumoniae pneumonia on chest computed tomography (CT) and whether the radiographic findings could distinguish M. pneumoniae pneumonia from Streptococcus pneumoniae pneumonia. A retrospective review was performed of the CT findings of 64 cases and 68 cases where M. pneumoniae and S. pneumoniae, respectively, were the only pathogen identified by the panel of diagnostic tests used. Of the 64 patients with M. pneumoniae pneumonia, bronchial wall thickening was observed most frequently (81%), followed by centrilobular nodules (78%), ground-glass attenuation (78%), and consolidation (61%). Bronchial wall thickening and centrilobular nodules were observed more often in M. pneumoniae patients than in S. pneumoniae patients (p < 0.0001). The presence of bilateral bronchial wall thickening or centrilobular nodules was only seen in patients with M. pneumoniae pneumonia. Using the scoring system of the Japanese Respiratory Society guidelines and chest CT findings, 97% of M. pneumoniae patients were suspected to be M. pneumoniae pneumonia without serology. When comparing the CT findings between early stage and progressed stage in the same patients with severe pneumonia, the radiographic features of early stage M. pneumoniae pneumonia were not observed clearly in the progressed stage. The present results indicate that the diagnosis of M. pneumoniae pneumonia would appear to be reliable when found with a combination of bronchial wall thickening and centrilobular nodules in the CT findings. However, these CT findings are not observed in progressed severe M. pneumoniae pneumonia patients

  19. Impaired CD4+ and T-helper 17 cell memory response to Streptococcus pneumoniae is associated with elevated glucose and percent glycated hemoglobin A1c in Mexican Americans with type 2 diabetes mellitus. (United States)

    Martinez, Perla J; Mathews, Christine; Actor, Jeffrey K; Hwang, Shen-An; Brown, Eric L; De Santiago, Heather K; Fisher Hoch, Susan P; McCormick, Joseph B; Mirza, Shaper


    Individuals with type 2 diabetes are significantly more susceptible to pneumococcal infections than healthy individuals of the same age. Increased susceptibility is the result of impairments in both innate and adaptive immune systems. Given the central role of T-helper 17 (Th17) and T-regulatory (Treg) cells in pneumococcal infection and their altered phenotype in diabetes, this study was designed to analyze the Th17 and Treg cell responses to a whole heat-killed capsular type 2 strain of Streptococcus pneumoniae. Patients with diabetes demonstrated a lower frequency of total CD+T-cells, which showed a significant inverse association with elevated fasting blood glucose. Measurement of specific subsets indicated that those with diabetes had, low intracellular levels of interleukin (IL)-17, and lower pathogen-specific memory CD4+ and IL-17+ cell numbers. No significant difference was observed in the frequency of CD4+ and Th17 cells between those with and without diabetes. However, stratification of data by obesity indicated a significant increase in frequency of CD4+ and Th17 cells in obese individuals with diabetes compared with nonobese individual with diabetes. The memory CD+T-cell response was associated inversely with both fasting blood glucose and percent glycated hemoglobin A1c. This study demonstrated that those with type 2 diabetes have a diminished pathogen-specific memory CD4+ and Th17 response, and low percentages of CD+T-cells in response to S. pneumoniae stimulation. Copyright © 2014 Mosby, Inc. All rights reserved.

  20. MLVA Typing of Streptococcus pneumoniae Isolates with Emphasis on Serotypes 14, 9N and 9V: Comparison of Previously Described Panels and Proposal of a Novel 7 VNTR Loci-Based Simplified Scheme. (United States)

    Costa, Natália S; Pinto, Tatiana C A; Merquior, Vânia L C; Castro, Luciana F S; da Rocha, Filomena S P; Morais, Jaqueline M; Peralta, José M; Teixeira, Lúcia M


    Streptococcus pneumoniae remains as an important cause of community-acquired bacterial infections, and the nasopharynx of asymptomatic carriers is the major reservoir of this microorganism. Pneumococcal strains of serotype 14 and serogroup 9 are among the most frequently isolated from both asymptomatic carriers and patients with invasive disease living in Brazil. Internationally disseminated clones belonging to such serotypes have been associated with the emergence and spread of antimicrobial resistance in our setting, highlighting the need for epidemiological tracking of these isolates. In this scenario, Multiple Loci VNTR Analysis (MLVA) has emerged as an alternative tool for the molecular characterization of pneumococci, in addition to more traditional techniques such as Multi-Locus Sequence Typing (MLST) and Pulsed-Field Gel Electrophoresis (PFGE). In the present study, 18 VNTR loci, as well as other previously described reduced MLVA panels (7 VNTR loci), were evaluated as tools to characterize pneumococcal strains of serotypes 14, 9N and 9V belonging to international and regional clones isolated in Brazil. The 18 VNTR loci panel was highly congruent with MLST and PFGE, being also useful for indicating the genetic relationship with international clones and for discriminating among strains with indistinguishable STs and PFGE profiles. Analysis of the results also allowed deducing a novel shorter 7 VNTR loci panel, keeping a high discriminatory power for isolates of the serotypes investigated and a high congruence level with MLST and PFGE. The newly proposed simplified panel was then evaluated for typing pneumococcal strains of other commonly isolated serotypes. The results indicate that MLVA is a faster and easier to perform, reliable approach for the molecular characterization of S. pneumoniae isolates, with potential for cost-effective application, especially in resource-limited countries.

  1. Streptococcus iniae and Streptococcus agalactiae (United States)

    Streptococcus iniae and S. agalactiae are economically important Gram positive bacterial pathogens of cultured and wild fish with a worldwide distribution. Both bacteria are potential zoonotic pathogens and have been associated most often with infections in immunocompromised people. Streptococcus in...

  2. Colonización nasofaríngea y resistencia antimicrobiana de Streptococcus pneumoniae en niños de una guardería en Santa Fe de Bogotá.

    Directory of Open Access Journals (Sweden)

    lngrid J. Peñuela


    Full Text Available Streptococcus pneumoniae es el principal agente etiológico bacteriano de infección respiratoria aguda en niños. Esta bacteria coloniza la nasofaringe desde el momento del nacimiento, y el hombre se constituye, así, en el reseworio de la infección. La atención mundial se centra actualmente en la propagación de los aislamientos de S. pneumoniae resistentes a los antimicrobianos. El objetivo de este estudio fue el de establecer, mediante un seguimiento de seis meses, el porcentaje de colonización por Spneumoniae en un grupo de 20 niños menores de 2 años que asistían a una guardería, así como la distribución de los tipos capsulares de los aislamientos recuperados y los patrones de susceptibilidad antimicrobiana. Se obtuvieron 98 muestras nasofaríngeas con las que se estableció un porcentaje global de colonización por S. pneumoniae de 69%. Todos los niños fueron colonizados, por lo menos una vez durante el tiempo de estudio. Los serotipos más frecuentes fueron: 23F (41%, 19F (26%, 6A (10% y 10A (6% y la susceptibilidad disminuida a la penicilina (SDP se estableció en 53%. La resistencia global al trimetoprimsulfametoxazol (TMS fue de 68%, al cloranfenicol de 43% y a la eritromicina de 3%. Los porcentajes de resistencia presentaron variaciones durante los meses de estudio. El 42% de los aislamientos fue multirresistente y el patrón predominante fue la asociación penicilina, TMS y cloranfenicol. Los serotipos con SDP fueron 23F (72%, 19F (1 1%, 23A (8%, 6A (6% y 15 (3%. En la guardería en estudio, los datos obtenidos señalan el alto porcentaje de circulación de aislamientos con resistencia antimicrobiana, lo que constituye un factor de riesgo para su diseminación en la comunidad; también destacan la importancia de implementar un sistema de vigilancia con portadores, lo que permite monitorizar la susceptibilidad antimicrobiana de este patógeno.

  3. Streptococcus pneumoniae: evolución de los serotipos y los patrones de susceptibilidad antimicrobiana en aislamientos invasores en 11 años de vigilancia en colombia (1994 -2004.

    Directory of Open Access Journals (Sweden)

    Clara Inés Agudelo


    Full Text Available Introducción. Streptococcus pneumoniae es una las principales causas de morbilidad y mortalidad en niños y adultos en el mundo. Objetivo. Realizar un análisis de los datos de la vigilancia por el laboratorio de los aislamientos invasores de S. pneumoniae recuperados entre 1994 y 2004. Materiales y métodos. Se empleó la información de los aislamientos invasores de S. pneumoniae recibidos en el Grupo de Microbiología del Instituto Nacional de Salud durante la vigilancia de meningitis bacteriana aguda e infección respiratoria aguda entre 1994 y 2004. Los aislamientos contaban con datos epidemiológicos, serotipo, patrones de susceptibilidad antimicrobiana y algunos con tipificación molecular. Resultados. Se analizaron los datos de 2.022 aislamientos procedentes de 120 hospitales de diferentes regiones del país, recuperados principalmente de hemocultivos (50,7% y líquido cefalorraquídeo (42%. Los serotipos más importantes fueron el 14, 6B, 23F, 1, 5, 6A, 19F, 18C y 9V, los cuales corresponden al 83,6% en niños menores de 6 años, al 74,0% en el grupo de 6 a 14 años y al 61,4% en mayores de 14 años. El 29,8% de los aislamientos presentó susceptibilidad disminuida a la penicilina (SDP, 44,3% a trimetoprim-sulfametoxazol, 32,4% a tetraciclina, 8,2% a cloranfenicol, 3,8% a eritromicina; todos fueron sensibles a vancomicina y el 13% fue multirresistente. Se tipificaron 602 aislamientos con SDP, de los cuales 27 (4,5% se relacionaron con el clon 1-España23F, 38 (6,3% con el clon 2-España6B, 301 (50% con el 3- España9V y 75 (12,5% con el clon 26-Colombia23F, además, los 138 aislamientos con tipo capsular 5 se relacionaron con el clon 19-Colombia5. Conclusiones. Los resultados proporcionan información básica necesaria para el diseño e implementación de estrategias para la prevención de la enfermedad neumocócica en nuestro país.

  4. Polymeric immunoglobulin receptor-mediated invasion of Streptococcus pneumoniae into host cells requires a coordinate signaling of SRC family of protein-tyrosine kinases, ERK, and c-Jun N-terminal kinase. (United States)

    Agarwal, Vaibhav; Asmat, Tauseef M; Dierdorf, Nina I; Hauck, Christof R; Hammerschmidt, Sven


    Streptococcus pneumoniae are commensals of the human nasopharynx with the capacity to invade mucosal respiratory cells. PspC, a pneumococcal surface protein, interacts with the human polymeric immunoglobulin receptor (pIgR) to promote bacterial adherence to and invasion into epithelial cells. Internalization of pneumococci requires the coordinated action of actin cytoskeleton rearrangements and the retrograde machinery of pIgR. Here, we demonstrate the involvement of Src protein-tyrosine kinases (PTKs), focal adhesion kinase (FAK), extracellular signal-regulated kinase (ERK), and c-Jun N-terminal kinase (JNK) but not p38 mitogen-activated protein kinases (MAPK) in pneumococcal invasion via pIgR. Pharmacological inhibitors of PTKs and MAPKs and genetic interference with Src PTK and FAK functions caused a significant reduction of pIgR-mediated pneumococcal invasion but did not influence bacterial adhesion to host cells. Furthermore, pneumococcal ingestion by host cells induces activation of ERK1/2 and JNK. In agreement with activated JNK, its target molecule and DNA-binding protein c-Jun was phosphorylated. We also show that functionally active Src PTK is essential for activation of ERK1/2 upon pneumococcal infections. In conclusion, these data illustrate the importance of a coordinated signaling between Src PTKs, ERK1/2, and JNK during PspC-pIgR-mediated uptake of pneumococci by host epithelial cells.

  5. Important Mutations Contributing to High-Level Penicillin Resistance in Taiwan19F-14, Taiwan23F-15, and Spain23F-1 of Streptococcus pneumoniae Isolated from Taiwan. (United States)

    Liu, Esther Yip-Mei; Chang, Jen-Chang; Lin, Jung-Chung; Chang, Feng-Yee; Fung, Chang-Phone


    Penicillin-resistant Streptococcus pneumoniae is a serious concern worldwide. In this study, we analyzed the cause of β-lactam resistance in pandemic multidrug-resistant clones. A total of 41 penicillin-nonsusceptible clinical isolates were collected from 1996 to 2012. Sero- and molecular typing confirmed that these isolates were clonal types of Taiwan 19F -14, Taiwan 23F -15, and Spain 23F -1. Sero-switching was found in four isolates. All isolates were multidrug resistant. Sequencing analysis of the penicillin binding proteins (PBPs) was performed on PBP1a, 2b, and 2x, and a large number of mutations were identified in comparing to clinical penicillin-susceptible isolates and the recipient strain R6 used for homologous recombination. The T 451 A substitution was the key amino acid in PBP2b that contributed to penicillin resistance. T 338 A in PBP2x played a role in resistance and reached the highest level of resistance when combined with other mutations in PBP2x. High-level penicillin resistance could not be obtained without the combination of mutations in PBP1a with PBP2b and 2x. The amino acid substitutions in PBP1a, 2b, and 2x were the crucial factors for β-lactam resistance.


    Directory of Open Access Journals (Sweden)

    N. M. Alyab'eva


    Full Text Available Aim: to compare two methods of S. pneumoniae molecular typing: classic serological method and the multiplex polymerase chain reaction (M-PCR assay modified in accordance to the date on the serotypes circulating in Russian Federation. Patients and methods: 420 pneumococcal isolates mainly from non-sterile loci were analyzed. After microbiological identification pneumococci were serologically typed with the means of specific antiserum produced by Staten Serum Institute (Denmark in latex agglutination test and/or capsular swelling method. At the same time we performed series of the M-PCR, which consisted of 7 consecutive reactions at the most. Results: serotype was identified by the means of serological method in all 420 strains of S. pneumoniae; in total we determined 24 different serotypes. By the means of the M-PCR we succeeded in identification of 95% (399/420 examined strains, and 90% of them were typed during the first 3 reactions. All isolates failed to be typed by M-PCR (n =21 have serotypes not included into the composition of the M-PCR. The results of serological and molecular typing were identical in 99,2% (396/399 of the isolates; 3 strains showed contradictory results: serotype 19A was found on serological assay and serotype 19F — on PCR assay. Conclusions: the introduced modification of M-PCR allows correct identification of pneumococcal serotype more than in 90% of strains circulating in the Russian Federation, including all serotypes of pneumococcal polysaccharide conjugate vaccine.

  7. New Aspects of the Interplay between Penicillin Binding Proteins, murM, and the Two-Component System CiaRH of Penicillin-Resistant Streptococcus pneumoniae Serotype 19A Isolates from Hungary. (United States)

    Schweizer, Inga; Blättner, Sebastian; Maurer, Patrick; Peters, Katharina; Vollmer, Daniela; Vollmer, Waldemar; Hakenbeck, Regine; Denapaite, Dalia


    The Streptococcus pneumoniae clone Hungary 19A -6 expresses unusually high levels of β-lactam resistance, which is in part due to mutations in the MurM gene, encoding a transferase involved in the synthesis of branched peptidoglycan. Moreover, it contains the allele ciaH232 , encoding the histidine kinase CiaH (M. Müller, P. Marx, R. Hakenbeck, and R. Brückner, Microbiology 157:3104-3112, 2011, High-level penicillin resistance primarily requires the presence of low-affinity (mosaic) penicillin binding protein (PBP) genes, as, for example, in strain Hu17, a closely related member of the Hungary 19A -6 lineage. Interestingly, strain Hu15 is β-lactam sensitive due to the absence of mosaic PBPs. This unique situation prompted us to investigate the development of cefotaxime resistance in transformation experiments with genes known to play a role in this phenotype, pbp2x , pbp1a , murM , and ciaH , and penicillin-sensitive recipient strains R6 and Hu15. Characterization of phenotypes, peptidoglycan composition, and CiaR-mediated gene expression revealed several novel aspects of penicillin resistance. The murM gene of strain Hu17 ( murM Hu17 ), which is highly similar to murM of Streptococcus mitis , induced morphological changes which were partly reversed by ciaH232. murM Hu17 conferred cefotaxime resistance only in the presence of the pbp2x o f strain Hu17 ( pbp2x Hu17 ). The ciaH232 allele contributed to a remarkable increase in cefotaxime resistance in combination with pbp2x Hu17 and pbp1a of strain Hu17 ( pbp1a Hu17 ), accompanied by higher levels of expression of CiaR-regulated genes, documenting that ciaH232 responds to PBP1a Hu17 -mediated changes in cell wall synthesis. Most importantly, the proportion of branched peptides relative to the proportion of linear muropeptides increased in cells containing mosaic PBPs, suggesting an altered enzymatic activity of these proteins. Copyright © 2017 Schweizer et al.

  8. Pneumonia Nosokomial


    Keliat, E.N; Abidin, Alwinsyah; Lubis, Nursyamsiah


    Pada masa yang lalu pneumonia diklasifikasikan sebagai pneumonia tipikal yang disebabkan oleh Str. Pneumonia daan atipikal yang disebabkan kuman atipik seperti halnya M. pneumonia. Kemudian ternyata manifestasi dari patogen lain seperti H. influenza, S. aureus dan bakteri Gram negatif memberikan sindrom klinik yang identik dengan pneumonia oleh Str E.N Keliat

  9. Pharyngeal colonization and drug resistance profiles of Morraxella catarrrhalis, Streptococcus pneumoniae, Staphylococcus aureus, and Haemophilus influenzae among HIV infected children attending ART Clinic of Felegehiwot Referral Hospital, Ethiopia.

    Directory of Open Access Journals (Sweden)

    Wondemagegn Mulu

    Full Text Available Asymptomatic pharyngeal colonization by potential bacteria is the primary reservoir for bacterial species within a population and is considered a prerequisite for development of major childhood diseases such as sinusitis, otitis media, pneumonia, bacteremia, and meningitis. However, there is dearth of data on the colonization and drug resistance pattern of the main bacterial pathogens in the pharynx of HIV infected children in Ethiopia. Therefore, this study determined the pharyngeal colonization and drug resistance profile of bacterial pathogens in HIV infected children attending ART clinic of Felegehiwot Referral Hospital (FHRH, Amhara Region, Ethiopia.A hospital based cross-sectional study was conducted from May 2016 to June 2017 at the ART clinic of FHRH. A total of 300 HIV infected children were enrolled in the study. Data on socio-demographic characteristics of the study participants were collected with face-to-face interview and patient-card review using structured questionnaire. Bacterial species were identified using standard bacteriological techniques. Drug susceptibility testing was performed using disk diffusion technique. Chi-square test was done to determine associations among variables.The median age of the participants was 11 years. Overall, 153 (51% of children were colonized by respiratory bacteria in their pharynx. Colonization rate was higher in children from mothers who had attained college and above levels of education than others (P = 0.04. It was also higher in children without the sign of malnutrition than others (P = 0.004. The colonization rate of S.aureus, M.catarrhalis, S.pneumoniae and H.influenzae were 88 (29%, 37 (12.3%, 31 (10.3% and 6 (2%, respectively. S.aureus-M.catarrhalis concurrent colonization was found in 14 (4.7% of children. Age (P = 0.03, schooling (P = 0.045 and history of running nose (P = 0.043 were significantly associated with S.aureus colonization. Living in urban setting (P = 0.042 and children

  10. Biosorption of mercury by capsulated and slime layerforming Gram ...

    African Journals Online (AJOL)

    The biosorption of mercury by two locally isolated Gram-ve bacilli: Klebsiella pneumoniae ssp. pneumonia (capsulated) and slime layer forming Pseudomonas aeruginosa, was characterized. Mercury adsorption was found to be influenced by the pH value of the biosorption solution, initial metal concentration, amount of the ...

  11. Community-based outbreaks in vulnerable populations of invasive infections caused by Streptococcus pneumoniae serotypes 5 and 8 in Calgary, Canada.

    Directory of Open Access Journals (Sweden)

    Otto G Vanderkooi

    Full Text Available BACKGROUND: Outbreaks of invasive pneumococcal disease (IPD typically occur within institutions. Beginning in 2005, we detected an increase in serotype (ST 5 and ST8 IPD cases, predominantly in homeless persons living in an open community. METHODOLOGY/PRINCIPAL FINDINGS: CASPER (Calgary Area S. pneumoniae Epidemiology Research surveillance study of all IPD (sterile site isolates in our region (pop ~1,100,000. Interviews and chart reviews of all cases and all isolates phenotypically analyzed and selected isolated tested by multi-locus sequence typing (MLST. CONCLUSIONS/SIGNIFICANCE: During 2005-2007, 162 cases of ST5 IPD and 45 cases of ST8 IPD were identified. The isolates demonstrated phenotypic and genotypic clonality. The ST5 isolates were sequence type (ST 289 and demonstrated intermediate susceptibility to TMP-SMX. The ST8 isolates were predominantly ST1268, with a susceptible antimicrobial susceptibility profile. Individuals with ST5 IPD were more likely to be middle aged (OR 2.6, homeless (OR 4.4, using illicit drugs(OR 4.8, and asthmatic(OR 2.6. Those with ST8 were more likely to be male (OR 4.4, homeless (OR 2.6, aboriginal (OR7.3, and a current smoker (OR 2.5. Overlapping outbreaks of ST5 and ST8 IPD occurred in an open community in Calgary, Canada and homelessness was a predominant risk factor. Homelessness represents a unique community in which pneumococcal outbreaks can occur.

  12. Age-dependent prevalence of nasopharyngeal carriage of streptococcus pneumoniae before conjugate vaccine introduction: a prediction model based on a meta-analysis.

    Directory of Open Access Journals (Sweden)

    Olivier Le Polain de Waroux

    Full Text Available INTRODUCTION: Data on the prevalence of nasopharyngeal carriage of S.pneumoniae in all age groups are important to help predict the impact of introducing pneumococcal conjugate vaccines (PCV into routine infant immunization, given the important indirect effect of the vaccine. Yet most carriage studies are limited to children under five years of age. We here explore the association between carriage prevalence and serotype distribution in children aged ≥5 years and in adults compared to children. METHODS: We conducted a systematic review of studies providing carriage estimates across age groups in healthy populations not previously exposed to PCV, using MEDLINE and Embase. We used Bayesian linear meta-regression models to predict the overall carriage prevalence as well as the prevalence and distribution of vaccine and nonvaccine type (VT and NVT serotypes in older age groups as a function of that in <5 y olds. RESULTS: Twenty-nine studies compromising of 20,391 individuals were included in the analysis. In all studies nasopharyngeal carriage decreased with increasing age. We found a strong positive linear association between the carriage prevalence in pre-school childen (<5 y and both that in school aged children (5-17 y olds and in adults. The proportion of VT serotypes isolated from carriers was consistently lower in older age groups and on average about 73% that of children <5 y among 5-17 y olds and adults respectively. We provide a prediction model to infer the carriage prevalence and serotype distribution in 5-17 y olds and adults as a function of that in children <5 years of age. CONCLUSION: Such predictions are helpful for assessing the potential population-wide effects of vaccination programmes, e.g. via transmission models, and thus assist in the design of future pneumococcal conjugate vaccination strategies.

  13. Age-dependent prevalence of nasopharyngeal carriage of streptococcus pneumoniae before conjugate vaccine introduction: a prediction model based on a meta-analysis. (United States)

    Le Polain de Waroux, Olivier; Flasche, Stefan; Prieto-Merino, David; Edmunds, W John


    Data on the prevalence of nasopharyngeal carriage of S.pneumoniae in all age groups are important to help predict the impact of introducing pneumococcal conjugate vaccines (PCV) into routine infant immunization, given the important indirect effect of the vaccine. Yet most carriage studies are limited to children under five years of age. We here explore the association between carriage prevalence and serotype distribution in children aged ≥5 years and in adults compared to children. We conducted a systematic review of studies providing carriage estimates across age groups in healthy populations not previously exposed to PCV, using MEDLINE and Embase. We used Bayesian linear meta-regression models to predict the overall carriage prevalence as well as the prevalence and distribution of vaccine and nonvaccine type (VT and NVT) serotypes in older age groups as a function of that in linear association between the carriage prevalence in pre-school childen (<5 y) and both that in school aged children (5-17 y olds) and in adults. The proportion of VT serotypes isolated from carriers was consistently lower in older age groups and on average about 73% that of children <5 y among 5-17 y olds and adults respectively. We provide a prediction model to infer the carriage prevalence and serotype distribution in 5-17 y olds and adults as a function of that in children <5 years of age. Such predictions are helpful for assessing the potential population-wide effects of vaccination programmes, e.g. via transmission models, and thus assist in the design of future pneumococcal conjugate vaccination strategies.

  14. Evidencia in vitro de la utilidad de cloranfenicol y rifampicina para el tratamiento de infecciones sistémicas y meningitis causadas por Streptococcus pneumoniae aislados deniños menores de 5 años en Colombia.

    Directory of Open Access Journals (Sweden)

    Mariluz Hernández


    Full Text Available Actualmente, Streptococcus pneumoniae resistente a penicilina es un patógeno común en infecciones pediátricas, lo cual plantea dificultades en el tratamiento. La rifampicina y el cloranfenicol se han recomendado como antibióticos útiles y como alternativas en estos casos, pues son menos costosos y más accesibles a las comunidades de recursos limitados. Su uso, sin embargo, puede estar limitado por los niveles de resistencia encontrados en diferentes poblaciones. El objetivo del presente estudio fue determinar la concentración inhibitoria mínima (CIM y la concentración bactericida mínima (CBM a la rifampicina y al cloranfenicol en aislamientos de S. pneumoniae pertenecientes a un grupo recolectado entre 1994 a 1996 de niños menores de 5 años con infección sistémica y meningitis. Se estudiaron 107 aislamientos, 60 de ellos resistentes a penicilina y 47 sensibles, 53 de los cuales fueron aislamientos de LCR. La CIM y la CBM se realizaron de acuerdo con las recomendaciones de la NCCLS; se utilizó S. pneumoniae ATCC 49619 como control. Se consideraron como sensibles al cloranfenicol los aislamientos con CIM=4 ?g/ml y resistentes, con CIM=8 ?g/ml; sensibles a rifampicina con CIM=1 ?g/ml y resistentes con CIM=4 ?g/ml. La CBM se determinó con la menor concentración del antibiótico que inhibió el crecimiento del 99,9% del inóculo. Se encontró resistencia al cloranfenicol en 20,5% de los 107 aislamientos estudiados. En el grupo resistente a la penicilina, 28% fue resistente al cloranfenicol y 11% en el grupo sensible a la penicilina. La CBM para el cloranfenicol fue >4 ?g/ml en 28% de los aislamientos sensibles a la penicilina y en 60% de los resistentes. No se encontraron aislamientos resistentes a la rifampicina; sin embargo, 2 aislamientos mostraron CBM>1 ?g/ml y una CBM=16 ?g/ml. Los aislamientos de LCR presentaron la CIM y la CBM más altas que el grupo total de aislamientos. Los datos sugieren que en Colombia el cloranfenicol no

  15. Factors affecting capsule size and production by lactic acid bacteria used as dairy starter cultures. (United States)

    Hassan, A N; Frank, J F; Shalabi, S I


    The effects of sugar substrates on capsule size and production by some capsule-forming nonropy and ropy dairy starter cultures were studied. Test sugars (glucose, lactose, galactose, or sucrose) were used as a sole carbohydrate source and the presence of a capsule and its size were determined by using confocal scanning laser microscopy. Nonropy strains produced maximum capsule size when grown in milk. Strains that did not produce capsules in milk did not produce them in any other growth medium. Specific sugars required for capsule production were strain-dependent. Increasing lactose content of Elliker broth from 0.5 to 5% or adding whey protein or casein digest produced larger capsules. Whey protein concentrate stimulated production of larger capsules than did casamino acids or casitone. Some Streptococcus thermophilus strains produced capsules when grown on galactose only. Nonropy strains of Lactobacillus delbrueckii subsp. bulgaricus produced capsules on lactose, but not on glucose. A ropy strain of Lactobacillus delbrueckii subsp. bulgaricus produced a constant capsule size regardless of the growth medium. The ability of some strains of Streptococcus thermophilus to use galactose in capsule production could reduce browning of mozzarella cheese during baking by removing a source of reducing sugar. Media that do not support capsule production may improve cell harvesting.

  16. Effect of poly-hexamethylene biguanide hydrochloride (PHMB) treated non-sterile medical gloves upon the transmission of Streptococcus pyogenes, carbapenem-resistant E. coli, MRSA and Klebsiella pneumoniae from contact surfaces. (United States)

    Ali, S; Wilson, A P R


    Reduction of accidental contamination of the near-patient environment has potential to reduce acquisition of healthcare-associated infection(s). Although medical gloves should be removed when soiled or touching the environment, compliance is variable. The use of antimicrobial-impregnated medical gloves could reduce the horizontal-transfer of bacterial contamination between surfaces. Determine the activity of antimicrobial-impregnated gloves against common hospital pathogens: Streptococcus pyogenes, carbapenem-resistant E.coli (CREC), MRSA and ESBL-producing Klebsiella pneumoniae. Fingerpads (~1cm 2 ) of PHMB-treated and untreated gloves were inoculated with 10 μL (~10 4 colony-forming-units [cfu]) of test-bacteria prepared in heavy-soiling (0.5%BSA), blood or distilled-water (no-soiling) and sampled after 0.25, 1, 10 or 15 min contact-time. Donor surfaces (~1cm 2 computer-keys) contaminated with wet/dry inoculum were touched with the fingerpad of treated/untreated gloves and subsequently pressed onto recipient (uncontaminated) computer-keys. Approximately 4.50log 10 cfu of all bacteria persisted after 15 min on untreated gloves regardless of soil-type. In the absence of soiling, PHMB-treated gloves reduced surface-contamination by ~4.5log 10 cfu (>99.99%) within 10 min of contact-time but only ~2.5log 10 (>99.9%) and ~1.0log 10 reduction respectively when heavy-soiling or blood was present. Gloves became highly-contaminated (~4.52log 10 -4.91log 10 cfu) when handling recently-contaminated computer-keys. Untreated gloves contaminated "recipient" surfaces (~4.5log 10 cfu) while PHMB-treated gloves transferred fewer bacteria (2.4-3.6log 10 cfu). When surface contamination was dry, PHMB gloves transferred fewer bacteria (0.3-0.6log 10 cfu) to "recipient" surfaces than untreated gloves (1.0-1.9log 10 ; P gloves may be useful in preventing dissemination of organisms in the near-patient environment during routine care. However they are not a substitute for

  17. Pneumonia (image) (United States)

    Pneumonia is an inflammation of the lungs caused by an infection. Many different organisms can cause it, including bacteria, viruses, and fungi. Pneumonia is a common illness that affects millions of ...

  18. Extended Spectrum β-Lactamase (ESBL) in Klebsiella Pneumoniae ...

    African Journals Online (AJOL)

    Pseudomonas aeruginosa, Streptococcus Pneumoniae and Serratia spp. Two of the children died in spite of early use of appropriate antibiotics as determined by antibiotic susceptibility testing. Phenotypic and molecualr investigation showed extended-spectrum β-lactamase (ESBL) producing K. pneumoniae to be ...

  19. Rocking pneumonia


    Rijkers, Ger T.; Rodriguez Gomez, Maria


    Ever since Chuck Berry coined the term “rocking pneumonia” in his 1956 song “Roll over Beethoven”, pneumonia has been mentioned frequently in modern blues and rock songs. We analyzed the lyrics of these songs to examine how various elements of pneumonia have been represented in popular music, specifically the cause of pneumonia, the risk groups, comorbidity (such as the boogie woogie flu), the clinical symptoms, and treatment and outcome. Up to this day, songwriters suggest that pneumonia is ...

  20. Streptococcus suis

    DEFF Research Database (Denmark)

    Poggenborg, René; Gaïni, Shahin; Kjaeldgaard, Poul


    Meningitis and spondylodiscitis caused by Streptococcus suis is a rare disease which is contracted by occupational exposure to pigs. We report a 54-y-old pig-farm worker with S. suis meningitis and septicaemia complicated with thoracal and lumbar spine spondylodiscitis. The S. suis strain involved...

  1. Detection and quantification of Streptococcus pneumoniae from ...

    African Journals Online (AJOL)



    Oct 5, 2011 ... 4Department of Infectious Diseases, Labbafinejad Hospital, Shahid Beheshti University of Medical ... Culture showed 14, but real time PCR showed 15 specimens ..... Middle East and Asian countries (Rudan et al., 2008; Al-.

  2. Estado de portador nasofaríngeo de Streptococcus pneumoniae en madres e hijos de la población indígena Panare del estado Bolívar, Venezuela Pneumococcal carriage in mothers and children of the Panare Amerindians from the State of Bolivar, Venezuela

    Directory of Open Access Journals (Sweden)

    T Bello González


    Full Text Available En América del Norte, los grupos indígenas se han identificado como una población con un riesgo elevado de ser portadora de Streptococcus pneumoniae, así como de desarrollar enfermedad neumocócica invasora. Sin embargo, hay poca información con respecto a los indígenas de Latinoamérica. En el presente estudio se evaluó el estado de portador nasofaríngeo y la distribución de los serotipos de S. pneumoniae en madres e hijos de la población panare de Venezuela. Durante el mes de mayo de 2008 se obtuvieron 148 muestras nasofaríngeas de 64 madres y 84 niños menores de 5 años pertenecientes a 8 comunidades panare. Mediante procedimientos estándares se identificaron 65 cepas de S. pneumoniae. Dichas cepas fueron tipificadas por PCR múltiple, y sus patrones de sensibilidad a los antimicrobianos se determinaron por el método de difusión con discos. El 11% de las madres y el 69% de los niños eran portadores de S. pneumoniae. Los serotipos 6B (49%, 33F (21,5%, 6A (6%, 19A (3,1% y 23F (1,5% fueron los más frecuentes. El mismo serotipo se identificó en 3 de los 6 grupos madre-hijo/s colonizados. Todas las cepas fueron sensibles a la penicilina y el 13,7% fue resistente a los macrólidos. La elevada tasa de colonización en la población panare sugiere que los niños presentan un alto riesgo de desarrollar enfermedad invasora por S. pneumoniae; por lo tanto podrían beneficiarse de la vacunación. Cuatro serotipos de la vacuna conjugada (6B, 6A, 19A y 23F, que representaron el 58% de las cepas aisladas, estaban presentes en la población al momento del estudio. La resistencia a los antibióticos no se presenta como un problema dentro de esta población.In North America, the indigenous groups have been identified as a population with increased risk of pneumococcal colonization and pneumococcal invasive disease. However, little information is available from South American natives. In the present study we evaluated the nasopharyngeal

  3. Isolation of Streptococcus tigurinus - a novel member of Streptococcus mitis group from a case of periodontitis. (United States)

    Dhotre, Shree V; Mehetre, Gajanan T; Dharne, Mahesh S; Suryawanshi, Namdev M; Nagoba, Basavraj S


    Streptococcus tigurinus is a new member of the Streptococcus viridians group and is closely related to Streptococcus mitis, Streptococcus pneumoniae, Streptococcus pseudopneumoniae, Streptococcus oralis, and Streptococcus infantis. The type strain AZ_3a(T) of S. tigurinus was originally isolated from a patient with infective endocarditis. Accurate identification of S. tigurinus is facilitated only by newer molecular methods like 16S rRNA gene analysis. During the course of study on bacteraemia and infective endocarditis with reference to periodontitis and viridians group of streptococci, a strain of S. tigurinus isolated from subgingival plaque of a patient with periodontitis identified by 16S rRNA gene analysis, which was originally identified as Streptococcus pluranimalium by Vitek 2. Confirmation by 16S rRNA gene analysis showed 99.39% similarity (1476/1485 bp) with S. tigurinus AZ_3a(T) (AORU01000002). To the best of our knowledge, this is the first report of isolation of S. tigurinus from the oral cavity of a periodontitis patient. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  4. [Bacteremic pneumococcal pneumonia]. (United States)

    Pineda Solas, V; Pérez Benito, A; Domingo Puiggros, M; Larramona Carrera, H; Segura Porta, F; Fontanals Aymerich, D


    Streptococcus pneumonia is the most common bacterial cause of community-acquired pneumonia in children. The reference standard for etiological diagnosis is isolation of S. pneumoniae from blood Since the advent of conjugate vaccines, disease caused by this organism can now be prevented. Many studies have been performed of the global incidence of invasive pneumococcal infections and of pneumococcal meningitis but few studies investigated bacteremic pneumococcal pneumonia and its complications in children. To determine the incidence, patient characteristics, clinical signs, laboratory data, percentage and days of hospitalization, response to antibiotic treatment, antibiotic resistance, complications and causal serogroups of bacteremic pneumococcal pneumonia in our environment in order to estimate requirements for systematic vaccination programs. From January 1990 to May 2001, data on all pediatric cases of invasive pneumococcal infections diagnosed in our hospital were collected. Several characteristics of patients with bacteremic pneumococcal pneumonia were analyzed. Bacteremic pneumococcal pneumonia was diagnosed in patients with positive blood or pleural fluid cultures for S. pneumoniae and radiographically evident pulmonary infiltrate. The incidence of both types of pneumonia were determined according to population census data. All S. pneumonia strains were sent to the Pneumococci Reference Laboratory of the Instituto Carlos III in Madrid for serotyping. We estimated the serotype coverage of the pneumococcal 7-valent conjugate vaccine according to the serotypes included in this vaccine and their distribution. Forty cases of bacteremic pneumococcal pneumonia were diagnosed, yielding an incidence of 17,10 and 5 cases per 10(5) children aged less than 2, 4 and 15 years old respectively. The mean age was 50 months and 43% were aged less than 4 years. Peaks occurred in January, March, April and May. A total of 77.5% of the patients were admitted to hospital and the

  5. Pneumonia Pneumosistis


    I Wayan Gustawan; BNP Arhana; Putu Siadi Purniti; IB Subanada; K Dewi Kumara Wati


    Pneumonia pnemosistis merupakan penyebab kesakitan yang serius dan kematian pada kasus gangguan sistem imun. Pneumonia pnemosistis merupakan infeksi oportunistik tersering pada kasus yang terinfeksi HIV, leukemia dan anak yang menerima transplantasi organ. Organisme penyebab adalah Pneumocystis carinii. Manifestasi klinis berupa gangguan pernapasan disertai penyakit dasarnya. Diagnosis pasti ditegakkan dengan ditemukannya organisme dalam pemeriksaan mikroskopis. Pengobatan secara ...

  6. The Streptococcus sanguinis Competence Regulon Is Not Required for Infective Endocarditis Virulence in a Rabbit Model


    Callahan, Jill E.; Munro, Cindy L.; Kitten, Todd


    Streptococcus sanguinis is an important component of dental plaque and a leading cause of infective endocarditis. Genetic competence in S. sanguinis requires a quorum sensing system encoded by the early comCDE genes, as well as late genes controlled by the alternative sigma factor, ComX. Previous studies of Streptococcus pneumoniae and Streptococcus mutans have identified functions for the >100-gene com regulon in addition to DNA uptake, including virulence. We investigated this possibility i...

  7. Repertoire of intensive care unit pneumonia microbiota.

    Directory of Open Access Journals (Sweden)

    Sabri Bousbia

    Full Text Available Despite the considerable number of studies reported to date, the causative agents of pneumonia are not completely identified. We comprehensively applied modern and traditional laboratory diagnostic techniques to identify microbiota in patients who were admitted to or developed pneumonia in intensive care units (ICUs. During a three-year period, we tested the bronchoalveolar lavage (BAL of patients with ventilator-associated pneumonia, community-acquired pneumonia, non-ventilator ICU pneumonia and aspiration pneumonia, and compared the results with those from patients without pneumonia (controls. Samples were tested by amplification of 16S rDNA, 18S rDNA genes followed by cloning and sequencing and by PCR to target specific pathogens. We also included culture, amoeba co-culture, detection of antibodies to selected agents and urinary antigen tests. Based on molecular testing, we identified a wide repertoire of 160 bacterial species of which 73 have not been previously reported in pneumonia. Moreover, we found 37 putative new bacterial phylotypes with a 16S rDNA gene divergence ≥ 98% from known phylotypes. We also identified 24 fungal species of which 6 have not been previously reported in pneumonia and 7 viruses. Patients can present up to 16 different microorganisms in a single BAL (mean ± SD; 3.77 ± 2.93. Some pathogens considered to be typical for ICU pneumonia such as Pseudomonas aeruginosa and Streptococcus species can be detected as commonly in controls as in pneumonia patients which strikingly highlights the existence of a core pulmonary microbiota. Differences in the microbiota of different forms of pneumonia were documented.

  8. Aspiration pneumonia (United States)

    ... Images Pneumococci organism Bronchoscopy Lungs Respiratory system References Musher DM. Overview of pneumonia. In: Goldman L, Schafer ... University of Pennsylvania, Philadelphia, PA. Also reviewed by David Zieve, MD, MHA, Medical Director, Brenda Conaway, Editorial ...

  9. Pneumocystis Pneumonia (United States)

    ... among 16 patients after kidney transplantation. Journal of clinical microbiology 2008;46:966-71. Pifer LL, Hughes WT, ... diagnosis of Pneumocystis jirovecii pneumonia: a meta-analysis. Clinical microbiology and infection 2013;19:39-49. CDC. Pneumocystis ...

  10. Hydrocarbon pneumonia (United States)

    ... pneumonia is caused by drinking or breathing in gasoline , kerosene , furniture polish , paint thinner, or other oily ... Arterial blood gas monitoring Breathing support, including oxygen, inhalation treatment, breathing tube and ventilator (machine), in severe ...

  11. The novel species Streptococcus tigurinus and its association with oral infection. (United States)

    Zbinden, Andrea; Bostanci, Nagihan; Belibasakis, Georgios N


    Streptococcus tigurinus is a novel species of viridans streptococci, shown to cause severe invasive infections such as infective endocarditis, spondylodiscitis and meningitis. S. tigurinus belongs to the Streptococcus mitis group and is most closely related to Streptococcus mitis, Streptococcus oralis, Streptococcus pneumoniae, Streptococcus pseudopneumoniae and Streptococcus infantis. The presence of S. tigurinus in the human oral cavity has been documented, including in patients with periodontal disease. This review addresses the available scientific knowledge on S. tigurinus and its association with closely related streptococci, and discusses its putative involvement in common oral infections. While there is as yet no strong evidence on the involvement of S. tigurinus with oral infections, its presence in the oral cavity and its association with endocarditis warrants special attention for a link between oral and systemic infection.

  12. Peritonitis in a llama caused by Streptococcus equi subsp. zooepidemicus. (United States)

    Hewson, J; Cebra, C K


    A 7-month-old, male llama was diagnosed with peritonitis caused by Streptococcus equi subsp. zooepidemicus. Clinical findings, medical treatment, and case outcome are described. Hematogenous dissemination from suspected pneumonia is proposed as the route of infection in this case. Possible transmission of the organism through contact with horses is discussed. PMID:11424579

  13. Posterior capsule opacification. (United States)

    Wormstone, I Michael; Wang, Lixin; Liu, Christopher S C


    Posterior Capsule Opacification (PCO) is the most common complication of cataract surgery. At present the only means of treating cataract is by surgical intervention, and this initially restores high visual quality. Unfortunately, PCO develops in a significant proportion of patients to such an extent that a secondary loss of vision occurs. A modern cataract operation generates a capsular bag, which comprises a proportion of the anterior and the entire posterior capsule. The bag remains in situ, partitions the aqueous and vitreous humours, and in the majority of cases, houses an intraocular lens. The production of a capsular bag following surgery permits a free passage of light along the visual axis through the transparent intraocular lens and thin acellular posterior capsule. However, on the remaining anterior capsule, lens epithelial cells stubbornly reside despite enduring the rigours of surgical trauma. This resilient group of cells then begin to re-colonise the denuded regions of the anterior capsule, encroach onto the intraocular lens surface, occupy regions of the outer anterior capsule and most importantly of all begin to colonise the previously cell-free posterior capsule. Cells continue to divide, begin to cover the posterior capsule and can ultimately encroach on the visual axis resulting in changes to the matrix and cell organization that can give rise to light scatter. This review will describe the biological mechanisms driving PCO progression and discuss the influence of IOL design, surgical techniques and putative drug therapies in regulating the rate and severity of PCO.

  14. Polydopamine-coated capsules (United States)

    White, Scott R.; Sottos, Nancy R.; Kang, Sen; Baginska, Marta B.


    One aspect of the invention is a polymer material comprising a capsule coated with PDA. In certain embodiments, the capsule encapsulates a functional agent. The encapsulated functional agent may be an indicating agent, healing agent, protecting agent, pharmaceutical drug, food additive, or a combination thereof.

  15. Familias de la proteína de superficie PspA de Streptococcus pneumoniae: Relación con serotipos y localización Pneumococcal surface protein A (PspA families: Relation with serotypes and clinical site of infection

    Directory of Open Access Journals (Sweden)

    Clara Mayoral


    Full Text Available PspA, proteína de superficie de Streptococcus pneumoniae es un factor de virulencia, fuertemente inmunogénica y común a todos los serotipos. Aunque el gen que codifica para esta proteína presenta una marcada heterogeneidad en la región correspondiente al N-terminal, la PspA contiene epitopes conservados de manera tal que la inmunización genera protección contra neumococos pertenecientes a diversos tipos capsulares y con distintas PspA. A pesar del marcado polimorfismo del gen pspA es posible agrupar las distintas variantes en 3 familias mayoritarias. Estas propiedades las convierten en candidatas ideales para elaborar vacunas. Debido a que la mayoría de los trabajos sobre identificación de familias fueron realizados sobre serotipos frecuentes en otros países, el objetivo fue identificar las familias de PspA de aislamientos de pacientes de nuestra región y relacionarlas con los serotipos prevalentes y patologías. Se estudiaron 70 aislamientos, provenientes de niños con infecciones invasoras. Se aplicó una PCR utilizando cebadores específicos de cada familia. El 60% fueron familia 1 y 34% familia 2. En un 6% no se identificó ninguna de las familias de PspA. Los serotipos 1 y 5 presentaron familia 1 únicamente; los serotipos 14, 6B, 19F y 18C mostraron genes de ambas familias. La familia 1 se observó en 60% de las neumonías y 50% de las meningitis. La familia 2 en 33% de neumonías y 50% de meningitis. Esta información podría ser un valioso aporte para la formulación de una vacuna regional efectiva utilizando PspA recombinante como inmunógeno.PspA, a pneumococcal surface protein, is highly immunogenic and common to all serotypes. Although pspA gene shows a great heterogeneity at the N-terminal region, PspA protein has conserved epytopes which are able to elicit protective cross-reaction against various serotypes presenting different PspA. In spite of the high polimorfism of the PspA, three majority families can be identified

  16. Group B streptococcus - pregnancy (United States)

    ... Group B streptococcus - pregnancy To use the sharing features on this page, please enable JavaScript. Group B streptococcus (GBS) is a type of bacteria that some ...

  17. Moxifloxacin pharmacokinetic profile and efficacy evaluation in empiric treatment of community-acquired pneumonia

    DEFF Research Database (Denmark)

    Öbrink-Hansen, Kristina; Hardlei, Tore Forsingdal; Brock, Birgitte


    for each patient were evaluated against epidemiological cutoff MIC values for Streptococcus pneumoniae, Haemophilus influenzae, and Legionella pneumophila. PK-PD targets adopted were a Cmax/MIC of ≥12.2 for all pathogens, an fAUC0-24/MIC of >34 for S. pneumoniae, and an fAUC0-24/MIC of >75 for H...

  18. Protease-activated receptor-1 impairs host defense in murine pneumococcal pneumonia: a controlled laboratory study

    NARCIS (Netherlands)

    Schouten, Marcel; van't Veer, Cornelis; Roelofs, Joris J. T. H.; Levi, Marcel; van der Poll, Tom


    Streptococcus pneumoniae is the most common causative pathogen in community-acquired pneumonia. Protease-activated receptor-1 (PAR-1) is expressed by multiple cell types present in the lungs and can be activated by various proteases generated during acute inflammation. The cellular effect of PAR-1

  19. The Receptor for Advanced Glycation End Products Impairs Host Defense in Pneumococcal Pneumonia

    NARCIS (Netherlands)

    van Zoelen, Marieke A. D.; Schouten, Marcel; de Vos, Alex F.; Florquin, Sandrine; Meijers, Joost C. M.; Nawroth, Peter P.; Bierhaus, Angelika; van der Poll, Tom


    Streptococcus pneumoniae is the most common cause of community-acquired pneumonia. The receptor for advanced glycation end products (RAGE) is a multiligand receptor that is expressed ubiquitously in the lungs. Engagement of RAGE leads to activation of multiple intracellular signaling pathways,

  20. Pneumonia necrotizante


    Daniel Coutinho; Nuno Príncipe


    A pneumonia adquirida na comunidade (PAC) é causa frequente de re-curso a Serviços de Urgência (SU), sendo a principal causa de sépsis em cuidados intensivos de adultos, com significativa morbi-mortalidade.1Uma das suas complicações, a pneumonia necrotizante, sendo rara, é grave e caracterizada por liquefação e necrose com cavitação do tecido pulmonar em áreas de consolidação parenquimatosa


    Sisson, W R; Walker, I C


    The foregoing experiments show that in cats a definite lobar pneumonia may be caused by Bacillus mucosus capsulatus. Judging both from the clinical course and from the pathological findings, this form of pulmonary infection differs from the usual pneumococcus types of pneumonia and closely resembles the so called Friedländer's bacillus or Bacillus pneumonioe in man. In all instances in which a lobar pneumonia was found after the injection of the bacillus, a similar organism was recovered from the lung, and in no case was this associated with other organisms. The course of the disease in cats is very short, the animals developing early symptoms of profound toxemia. In 87 per cent of the animals showing a lobar pneumonia positive blood cultures were obtained. The pathological findings, judging from the early stages of the disease, are subject to considerable variation. In some instances the process may suggest a pseudolobar or confluent lobular distribution. In these cases the lung has a mottled, marble-like appearance. In the majority of cases, however, the process gave a more homogeneous appearance, suggesting a diffuse and uniform distribution. Foci of hemorrhage were not uncommon in both. Such areas cause the mottled appearance sometimes found. In all instances the consolidated lung presents a greater infiltration of tissue than is usually seen in other types of experimental pneumonia. Although the exudate as seen on the cut surface may be abundant and especially viscid in character, this is not present in most cases. The cut surface of the consolidated lung does not present a granular appearance. The histological findings are also subject to considerable variation. In most instances the infundibular and alveolar spaces are completely filled with an exudate made up chiefly of polymorphonuclear cells. Associated with these are the capsulated bacilli, large vacuolated mononuclear phagocytic cells, and red blood cells, and occasionally small amounts of fibrin. The

  2. Multiple colonization with S. pneumoniae before and after introduction of the seven-valent conjugated pneumococcal polysaccharide vaccine.

    Directory of Open Access Journals (Sweden)

    Silvio D Brugger


    Full Text Available Simultaneous carriage of more than one strain of Streptococcus pneumoniae promotes horizontal gene transfer events and may lead to capsule switch and acquisition of antibiotic resistance. We studied the epidemiology of cocolonization with S. pneumoniae before and after introduction of the seven-valent conjugated pneumococcal vaccine (PCV7.Nasopharyngeal swabs (n 1120 were collected from outpatients between 2004 and 2009 within an ongoing nationwide surveillance program. Cocolonization was detected directly from swabs by restriction fragment length polymorphism (RFLP analysis. Serotypes were identified by agglutination, multiplex PCR and microarray.Rate of multiple colonization remained stable up to three years after PCV7 introduction. Cocolonization was associated with serotypes of low carriage prevalence in the prevaccine era. Pneumococcal colonization density was higher in cocolonized samples and cocolonizing strains were present in a balanced ratio (median 1.38. Other characteristics of cocolonization were a higher frequency at young age, but no association with recurrent acute otitis media, recent antibiotic exposure, day care usage and PCV7 vaccination status.Pneumococcal cocolonization is dominated by serotypes of low carriage prevalence in the prevaccine era, which coexist in the nasopharynx. Emergence of such previously rare serotypes under vaccine selection pressure may promote cocolonization in the future.

  3. Estandarización en Colombia de una prueba ELISA para la evaluación de los niveles séricos de anticuerpos IgG contra diez serotipos de Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Lucía Carolina Leal-Esteban


    Conclusión. Esta prueba ELISA cuantifica de forma confiable los niveles de IgG sérica contra diez serotipos de S. pneumoniae y, de acuerdo con los resultados obtenidos en individuos sanos de nuestra población, en este trabajo se validan los parámetros internacionales para considerar adecuada la respuesta a la vacuna 23-valente contra este microorganismo.   DOI:

  4. CT features of legionella pneumonia, compared with streptococcal pneumonia. A collaborative study

    International Nuclear Information System (INIS)

    Tokuda, Hitoshi; Sakai, Fumikazu; Goto, Hajime


    Legionella pneumophila pneumonia (LPP) is of serious concern for chest physicians for its potential lethality and difficulty of diagnosis. In spite of widespread use of urine antigen detection method, it remains one of the most difficult-to-treat disease among community acquired pneumonia. We investigated CT images of 38 cases of LPP, comparing them with wide spread Streptococcus pneumoniae pneumonia (SPP). We find that sharply demarcated consolidation scattered in ground-glass opacity is the most striking and pathognomonic feature of LPP, which is rarely found in SPP. Bronchiolitis was not found in LPP, while it is a relatively common finding in SPP, which could be the second clue of differentiation of these two diseases. (author)

  5. Prevent Pneumonia

    Centers for Disease Control (CDC) Podcasts


    CDC’s Matthew Westercamp explains what pneumonia is, its symptoms, and how to prevent it.  Created: 8/6/2015 by National Center for Immunization and Respiratory Diseases (NCIRD), Division of Bacterial Diseases (DBD), Respiratory Diseases Branch (RDB).   Date Released: 8/6/2015.

  6. Health related quality of life in patients with community-acquired pneumococcal pneumonia in France


    Andrade, Luiz Flavio; Saba, Grèce; Ricard, Jean-Damien; Messika, Jonathan; Gaillat, Jacques; Bonnin, Pierre; Chidiac, Christian; Illes, Hajnal-Gabriela; Laurichesse, Henri; Detournay, Bruno; Petitpretz, Patrick; de Pouvourville, Gérard


    Background Community Acquired Pneumococcal Pneumonia is a lung infection that causes serious health problems and can lead to complications and death. The aim of this study was to observe and analyze health related quality of life after a hospital episode for patients with community acquired pneumococcal pneumonia in France. Methods A total of 524 individuals were enrolled prospectively in the study and were followed for 12 months after hospital discharge. Presence of streptococcus pneumoniae ...

  7. Etiology of community-acquired pneumonia in hospitalized patients in Jordan

    International Nuclear Information System (INIS)

    Al-Ali, Musa K.; Batchoun, R. G.; Al-Nour, Tariq M.


    To ascertain the causative organisms of community acquired pneumonia (Cap) in Jordanian patients requiring hospital admission. A prospective study of both adults and children admitted to Princess Basma and Princess Rahma Teaching Hospitals in Irbid, Jordan with a diagnosis of CAP over a 6-month period from April to October 2002. A total of 35 adult patients were admitted with a mean age of 47 years, and 63 children with a mean age of 3 years. A pathogen was isolated from 25 (71%) adults, and from 17 (27%) children, and sputum cultures gave the best diagnostic yield. In adults Streptococcus pneumoniae was the most common isolate (26%), followed by Chlamydia pneumoniae (23%), Haemophilus influenzae (17%), Mycoplasma pneumoniae (9%), and Legionella pneumophila and Klebsiella pneumoniae (6%) each. Seven of the 9 gram negative isolates were from patients with some co morbid illness. While in children, Chlamydia pneumoniae was the most common (14%), followed by Mycoplasma pneumoniae (6%), and Streptococcus pneumoniae, Haemophilus influenzae, and Pseudomonas aeruginosa (3%) each. Streptococcus pneumoniae and atypical microorganisms are the most common cause of CAP in previously healthy adults; while in those with associated co morbid illness, gram negative organisms are the likely cause. In children, the overall detection rate of causative organisms was low with atypical microorganisms being the most common. (author)

  8. Magnetically guided capsule endoscopy. (United States)

    Shamsudhin, Naveen; Zverev, Vladimir I; Keller, Henrik; Pane, Salvador; Egolf, Peter W; Nelson, Bradley J; Tishin, Alexander M


    Wireless capsule endoscopy (WCE) is a powerful tool for medical screening and diagnosis, where a small capsule is swallowed and moved by means of natural peristalsis and gravity through the human gastrointestinal (GI) tract. The camera-integrated capsule allows for visualization of the small intestine, a region which was previously inaccessible to classical flexible endoscopy. As a diagnostic tool, it allows to localize the sources of bleedings in the middle part of the gastrointestinal tract and to identify diseases, such as inflammatory bowel disease (Crohn's disease), polyposis syndrome, and tumors. The screening and diagnostic efficacy of the WCE, especially in the stomach region, is hampered by a variety of technical challenges like the lack of active capsular position and orientation control. Therapeutic functionality is absent in most commercial capsules, due to constraints in capsular volume and energy storage. The possibility of using body-exogenous magnetic fields to guide, orient, power, and operate the capsule and its mechanisms has led to increasing research in Magnetically Guided Capsule Endoscopy (MGCE). This work shortly reviews the history and state-of-art in WCE technology. It highlights the magnetic technologies for advancing diagnostic and therapeutic functionalities of WCE. Not restricting itself to the GI tract, the review further investigates the technological developments in magnetically guided microrobots that can navigate through the various air- and fluid-filled lumina and cavities in the body for minimally invasive medicine. © 2017 American Association of Physicists in Medicine.

  9. Inhibition of phage infection in capsule-producing Streptococcus ...

    African Journals Online (AJOL)



    Oct 4, 2007 ... prove the physical properties of low fat yogurt and some reduced fat cheeses .... tion of the procedure described by Terzaghi and Sandine (1975). Sugars were ... polysaccharides share structural saccharide constituents. (glucose ..... 11, the interface between the baseplate anf short tail fibers. J. Mol. Biol.

  10. Group B Streptococcus and Pregnancy (United States)

    ... B Strep and Pregnancy • What is group B streptococcus (GBS)? • What does it mean to be colonized ... planned cesarean birth? •Glossary What is group B streptococcus (GBS)? Group B streptococcus is one of the ...

  11. NIF capsule performance modeling

    Directory of Open Access Journals (Sweden)

    Weber S.


    Full Text Available Post-shot modeling of NIF capsule implosions was performed in order to validate our physical and numerical models. Cryogenic layered target implosions and experiments with surrogate targets produce an abundance of capsule performance data including implosion velocity, remaining ablator mass, times of peak x-ray and neutron emission, core image size, core symmetry, neutron yield, and x-ray spectra. We have attempted to match the integrated data set with capsule-only simulations by adjusting the drive and other physics parameters within expected uncertainties. The simulations include interface roughness, time-dependent symmetry, and a model of mix. We were able to match many of the measured performance parameters for a selection of shots.

  12. Impact of the factor V Leiden mutation on the outcome of pneumococcal pneumonia: a controlled laboratory study

    NARCIS (Netherlands)

    Schouten, Marcel; van 't Veer, Cornelis; Roelofs, Joris Jth; Levi, Marcel; van der Poll, Tom


    Introduction: Streptococcus (S.) pneumoniae is the most common cause of community-acquired pneumonia. The factor V Leiden (FVL) mutation results in resistance of activated FV to inactivation by activated protein C and thereby in a prothrombotic phenotype. Human heterozygous FVL carriers have been

  13. Recombinant human tissue factor pathway inhibitor exerts anticoagulant, anti-inflammatory and antimicrobial effects in murine pneumococcal pneumonia

    NARCIS (Netherlands)

    van den Boogaard, F. E.; Brands, X.; Schultz, M. J.; Levi, M. [=Marcel M.; Roelofs, J. J. T. H.; van 't Veer, C.; van der Poll, T.


    Background: Streptococcus (S.) pneumoniae is the most common causative pathogen in community-acquired pneumonia and a major cause of sepsis. Recombinant human tissue factor pathway inhibitor (rh-TFPI) attenuates sepsis-induced coagulation and has been evaluated in clinical trials involving patients

  14. When is pneumonia not pneumonia?


    Sasegbon, Ayodele


    A 34-year-old man was admitted to hospital via the accident and emergency department with severe right-sided abdominal pain and raised inflammatory markers. His pain settled with analgaesia and he was discharged with a course of oral co-amoxiclav. He was readmitted to the hospital 7���days later reporting cough and shortness of breath. His chest X-ray showed a raised right hemi-diaphragm, presumed consolidation and a right-sided effusion. As a result, he was treated for pneumonia. Despite ant...

  15. Características laboratoriais das ceratites e conjuntivites causadas por Streptococcus sp Laboratorial findings of Streptococcus keratitis and conjunctivitis

    Directory of Open Access Journals (Sweden)

    Helena Parente Solari


    Full Text Available OBJETIVOS: Analisar os resultados laboratoriais de conjuntivites e ceratites com cultura positiva para Streptococcus sp, avaliando a incidência das diferentes espécies e os dados dos antibiogramas. MÉTODOS: Estudo retrospectivo de revisão de prontuários de pacientes encaminhados ao laboratório de Doenças Externas do Departamento de Oftalmologia da UNIFESP com resultado de cultivo bacteriano positivo de córnea ou conjuntiva e com identificação de alguma cepa do gênero Streptococcus sp, no período de janeiro de 1995 a dezembro de 2001. Analisou-se idade do paciente, espécie de Streptococcus e os testes de sensibilidade aos seguintes antibióticos: cefalotina, amicacina, gentamicina, tobramicina, ciprofloxacina, lomefloxacina, ofloxacina, norfloxacina e vancomicina. RESULTADOS: As espécies mais encontradas foram Streptococcus pneumoniae e Streptococcus viridans. Com relação aos antibióticos, a sensibilidade foi maior à cefalotina, às quinolonas e à vancomicina. CONCLUSÕES: Considerando-se os antibióticos tópicos comercialmente disponíveis, as quinolonas apresentam melhor espectro de ação quando comparadas aos aminoglicosídios.PURPOSE: To evaluate laboratorial findings of Streptococcus keratitis and conjunctivitis, analyzing the different species and the results of bacterial susceptibility to an antibiotics. METHODS: Retrospective study of the records from the External Disease Laboratory of the Ophthalmology Department of the Federal University of São Paulo, with conjunctival or corneal positive bacterial culture for Streptococcus sp, between January 1995 and December 2001. The collected data were age, Streptococcus species and the bacterial susceptibility to the following antibiotics: cephalotin, amikacin, gentamicin, tobramicin, ciprofloxacin, lomefloxacin, ofloxacin, norfloxacin and vancomicin. RESULTS: The most frequent species were Streptococcus pneumoniae and Streptococcus viridans. Regarding bacterial

  16. Pneumonia (For Parents) (United States)

    ... Staying Safe Videos for Educators Search English Español Pneumonia KidsHealth / For Parents / Pneumonia What's in this article? ... the Doctor? Print en español Neumonía What Is Pneumonia? Pneumonia is an infection of the lungs . The ...

  17. Streptococcus sinensis may react with Lancefield group F antiserum. (United States)

    Woo, Patrick C Y; Teng, Jade L L; Leung, Kit-wah; Lau, Susanna K P; Tse, Herman; Wong, Beatrice H L; Yuen, Kwok-yung


    Lancefield group F streptococci have been found almost exclusively as members of the 'Streptococcus milleri' group, although they have been reported very occasionally in some other streptococcal species. Among 302 patients with bacteraemia caused by viridans streptococci over a 6-year period, three cases were caused by Streptococcus sinensis (type strain HKU4T, HKU5 and HKU6). All three patients had infective endocarditis complicating their underlying chronic rheumatic heart diseases. Gene sequencing showed no base differences between the 16S rRNA gene sequences of HKU5 and HKU6 and that of HKU4T. All three strains were Gram-positive, non-spore-forming cocci arranged in chains. All grew on sheep blood agar as alpha-haemolytic, grey colonies of 0.5-1 mm in diameter after 24 h incubation at 37 degrees C in ambient air. Lancefield grouping revealed that HKU5 and HKU6 were Lancefield group F, but HKU4T was non-groupable with Lancefield groups A, B, C, D, F or G antisera. HKU4T was identified by the Vitek system (GPI), API system (20 STREP) and ATB system (ID32 STREP) as 99 % Streptococcus intermedius, 51.3 % S. intermedius and 99.9 % Streptococcus anginosus, respectively. Using the same tests, HKU5 was identified as 87 % Streptococcus sanguinis/Streptococcus gordonii, 59 % Streptococcus salivarius and 99.6 % S. anginosus, respectively, and HKU6 as 87 % S. sanguinis/S. gordonii, 77 % Streptococcus pneumoniae and 98.3 % S. anginosus, respectively. The present data revealed that a proportion of Lancefield group F streptococci could be S. sinensis. Lancefield group F streptococci should not be automatically reported as 'S. milleri'.

  18. Mycoplasmal pneumonia in children

    Energy Technology Data Exchange (ETDEWEB)

    Schmidt, H.; Lengerke, H.J. v.


    Roentgenographic findings of bilateral interstitial pneumonia without segmental consolidation and with regional lymphadenitis, which occurs after infancy, are always suggestive of pneumonia from Mycoplasma pneumoniae, as this is one of the most frequent types of pneumonia in children. M. pneumonia can be presumed by the discrepancy between the extensive roentgenographic findings and the generally good condition of the patient. Before therapy is decided upon it is important to know what the etiology is.

  19. Early host response in the mammary gland after experimental Streptococcus uberis challenge in heifers

    NARCIS (Netherlands)

    Greeff, de A.; Zadoks, R.N.; Ruuls, L.; Toussaint, M.; Nguyen, T.K.; Downing, A.; Rebel, J.M.J.; Stockhofe-Zurwieden, N.; Smith, H.E.


    Streptococcus uberis is a highly prevalent causative agent of bovine mastitis, which leads to large economic losses in the dairy industry. The aim of this study was to examine the host response during acute inflammation after experimental challenge with capsulated Strep. uberis. Gene expression in

  20. Two distinct sensing pathways allow recognition of Klebsiella pneumoniae by Dictyostelium amoebae. (United States)

    Lima, Wanessa C; Balestrino, Damien; Forestier, Christiane; Cosson, Pierre


    Recognition of bacteria by metazoans is mediated by receptors that recognize different types of microorganisms and elicit specific cellular responses. The soil amoebae Dictyostelium discoideum feeds upon a variable mixture of environmental bacteria, and it is expected to recognize and adapt to various food sources. To date, however, no bacteria-sensing mechanisms have been described. In this study, we isolated a Dictyostelium mutant (fspA KO) unable to grow in the presence of non-capsulated Klebsiella pneumoniae bacteria, but growing as efficiently as wild-type cells in the presence of other bacteria, such as Bacillus subtilis. fspA KO cells were also unable to respond to K. pneumoniae and more specifically to bacterially secreted folate in a chemokinetic assay, while they responded readily to B. subtilis. Remarkably, both WT and fspA KO cells were able to grow in the presence of capsulated LM21 K. pneumoniae, and responded to purified capsule, indicating that capsule recognition may represent an alternative, FspA-independent mechanism for K. pneumoniae sensing. When LM21 capsule synthesis genes were deleted, growth and chemokinetic response were lost for fspA KO cells, but not for WT cells. Altogether, these results indicate that Dictyostelium amoebae use specific recognition mechanisms to respond to different K. pneumoniae elements. © 2013 John Wiley & Sons Ltd.