WorldWideScience

Sample records for stilbene crystal scintillation

  1. Characteristics evaluation of stilbene single crystal grown by vertical bridgman technique

    International Nuclear Information System (INIS)

    Jo, Kwang Ho

    2012-02-01

    As the nature of organic scintillator, stilbene single crystal's decay time is only a couple of nano seconds, which makes it suitable for fast neutron detection. However, the entire amount of stilbene single crystal being used relies on import currently. As the necessity of fast neutron detection equipment such as KSTAR and Sodium-cooled Fast Reactor system increases, the goal is to have our own domestic technology through the growth of stilbene single crystal. The emission wavelength of grown stilbene single crystal is confirmed, and the property of grown stilbene single crystal is assessed compared to commercial stilbene (Ukraine ISMA research center) through gamma ray and neutron tests. In this research, we have grown stilbenes through Bridgman technique, and obtained three stilbenes out of two amples. (Two ones of Φ 30 mm x 15 mm, and Φ 40 mm x 17 mm from the first ample, and size of Φ 25 mm x 13 mm from the other) The grown stilbene's emission wavelength and inherent property of stilbene are confirmed. As the result of gamma ray test, we have confirmed linearity of grown stilbene's scintillator, and the relative light yield ratio is proven 101% efficiency to reference stilbene. Neutron detection efficiency of the three stilbenes amounts to 80% of reference stilbene, and FOM of them is 108% efficiency to reference stilbene's one. Although Ukraine ISMA research center still holds a dominant position with world-class efficiency and performance of its stilbene, we expect to produce a better stilbene with our domestic technology development. Through this, fast neutron detection technique can be obtained, which opens up an opportunity to be used not only in neutron monitoring system in nuclear fusion reactor, but also in alternative measurement technique as the unit price of He-3 increases recently

  2. Relative light yield and temporal response of a stilbene-doped bibenzyl organic scintillator for neutron detection

    Energy Technology Data Exchange (ETDEWEB)

    Brown, J. A.; Goldblum, B. L., E-mail: bethany@nuc.berkeley.edu; Brickner, N. M.; Daub, B. H.; Kaufman, G. S.; Bibber, K. van; Vujic, J. [Department of Nuclear Engineering, University of California, Berkeley, California 94720 (United States); Bernstein, L. A.; Bleuel, D. L.; Caggiano, J. A.; Hatarik, R.; Phillips, T. W.; Zaitseva, N. P. [Lawrence Livermore National Laboratory, Livermore, California 94551 (United States); Wender, S. A. [Los Alamos National Laboratory, Los Alamos, New Mexico 87545 (United States)

    2014-05-21

    The neutron time-of-flight (nTOF) diagnostics used to characterize implosions at the National Ignition Facility (NIF) has necessitated the development of novel scintillators that exhibit a rapid temporal response and high light yield. One such material, a bibenzyl-stilbene mixed single-crystal organic scintillator grown in a 99.5:0.5 ratio in solution, has become the standard scintillator used for nTOF diagnostics at NIF. The prompt fluorescence lifetime and relative light yield as a function of proton energy were determined to calibrate this material as a neutron detector. The temporal evolution of the intensity of the prompt fluorescent response was modeled using first-order reaction kinetics and the prompt fluorescence decay constant was determined to be 2.46 ± 0.01 (fit) ± 0.13 (systematic) ns. The relative response of the bibenzyl-stilbene mixed crystal generated by recoiling protons was measured, and results were analyzed using Birks' relation to quantify the non-radiative quenching of excitation energy in the scintillator.

  3. Stilbene crystalline powder in polymer base as a new fast neutron detector

    International Nuclear Information System (INIS)

    Budakovsky, S.V.; Galunov, N.Z.; Grinyov, B.V.; Karavaeva, N.L.; Kyung Kim, Jong; Kim, Yong-Kyun; Pogorelova, N.V.; Tarasenko, O.A.

    2007-01-01

    A new organic scintillation material consisting of stilbene grains in a polymer glue base is presented. The crystalline grains of stilbene are obtained by mechanical grinding of stilbene single crystals. The resulting composite scintillators have been studied as detectors for fast neutrons

  4. Fast collimated neutron flux measurement using stilbene scintillator and flashy analog-to-digital converter in JT-60U

    International Nuclear Information System (INIS)

    Ishikawa, M.; Itoga, T.; Okuji, T.; Nakhostin, M.; Shinohara, K.; Hayashi, T.; Sukegawa, A.; Baba, M.; Nishitani, T.

    2006-01-01

    A line-integrated neutron emission profile is routinely measured using the radial neutron collimator system in JT-60U tokamak. Stilbene neuron detectors (SNDs), which combine a stilbene organic crystal scintillation detector (SD) with an analog neutron-gamma pulse shape discrimination (PSD) circuit, have been used to measure collimated neutron flux. Although the SND has many advantages as a neutron detector, the maximum count rate is limited up to ∼1x10 5 counts/s due to the analog PSD circuit. To overcome this issue, a digital signal processing system (DSPS) using a flash analog-to-digital converter (Acqiris DC252, 8 GHz, 10 bits) has been developed at Cyclotron and Radioisotope Center in Tohoku University. In this system anode signals from photomultiplier of the SD are directory stored and digitized. Then, the PSD between neutrons and gamma rays is performed using software. The DSPS has been installed in the vertical neutron collimator system in JT-60U and applied to deuterium experiments. It is confirmed that the PSD is sufficiently performed and collimated neutron flux is successfully measured with count rate up to ∼5x10 5 counts/s without the effect of pileup of detected pulses. The performance of the DSPS as a neutron detector, which supersedes the SND, is demonstrated

  5. Comparative study of neutron and gamma-ray pulse shape discrimination of anthracene, stilbene, and p-terphenyl

    International Nuclear Information System (INIS)

    Yanagida, Takayuki; Watanabe, Kenichi; Fujimoto, Yutaka

    2015-01-01

    Solid state organic scintillators, such as anthracene, stilbene, and p-terphenyl were investigated on their basic scintillation properties and neutron–gamma discrimination capabilities. Scintillation wavelengths under X-ray irradiation of anthracene, stilbene, and p-terphenyl were 445–525, 400–500, and 350–450 nm, respectively. Scintillation light yields of anthracene, stilbene, and p-terphenyl under 137 Cs gamma-ray irradiation were 20100, 16000, and 19400 ph/MeV, respectively. Neutron and gamma-ray events discrimination capabilities were examined and anthracene exhibited the best figure of merit among three organic scintillators

  6. Comparative study of neutron and gamma-ray pulse shape discrimination of anthracene, stilbene, and p-terphenyl

    Energy Technology Data Exchange (ETDEWEB)

    Yanagida, Takayuki, E-mail: yanagida@lsse.kyutech.ac.jp [Kyushu Institute of Technology, 2-4 Hibikino, Wakamatsu, Kitakyushu, Fukuoka 808-0196 (Japan); Watanabe, Kenichi [Nagoya University, Furocho, Chikusa, Nagoya 464-8603 (Japan); Fujimoto, Yutaka [Kyushu Institute of Technology, 2-4 Hibikino, Wakamatsu, Kitakyushu, Fukuoka 808-0196 (Japan)

    2015-06-01

    Solid state organic scintillators, such as anthracene, stilbene, and p-terphenyl were investigated on their basic scintillation properties and neutron–gamma discrimination capabilities. Scintillation wavelengths under X-ray irradiation of anthracene, stilbene, and p-terphenyl were 445–525, 400–500, and 350–450 nm, respectively. Scintillation light yields of anthracene, stilbene, and p-terphenyl under {sup 137}Cs gamma-ray irradiation were 20100, 16000, and 19400 ph/MeV, respectively. Neutron and gamma-ray events discrimination capabilities were examined and anthracene exhibited the best figure of merit among three organic scintillators.

  7. Prototype Stilbene Neutron Collar

    Energy Technology Data Exchange (ETDEWEB)

    Prasad, M. K. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Shumaker, D. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Snyderman, N. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Verbeke, J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Wong, J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2016-10-26

    A neutron collar using stilbene organic scintillator cells for fast neutron counting is described for the assay of fresh low enriched uranium (LEU) fuel assemblies. The prototype stilbene collar has a form factor similar to standard He-3 based collars and uses an AmLi interrogation neutron source. This report describes the simulation of list mode neutron correlation data on various fuel assemblies including some with neutron absorbers (burnable Gd poisons). Calibration curves (doubles vs 235U linear mass density) are presented for both thermal and fast (with Cd lining) modes of operation. It is shown that the stilbene collar meets or exceeds the current capabilities of He-3 based neutron collars. A self-consistent assay methodology, uniquely suited to the stilbene collar, using triples is described which complements traditional assay based on doubles calibration curves.

  8. High-efficiency organic glass scintillators

    Science.gov (United States)

    Feng, Patrick L.; Carlson, Joseph S.

    2017-12-19

    A new family of neutron/gamma discriminating scintillators is disclosed that comprises stable organic glasses that may be melt-cast into transparent monoliths. These materials have been shown to provide light yields greater than solution-grown trans-stilbene crystals and efficient PSD capabilities when combined with 0.01 to 0.05% by weight of the total composition of a wavelength-shifting fluorophore. Photoluminescence measurements reveal fluorescence quantum yields that are 2 to 5 times greater than conventional plastic or liquid scintillator matrices, which accounts for the superior light yield of these glasses. The unique combination of high scintillation light-yields, efficient neutron/gamma PSD, and straightforward scale-up via melt-casting distinguishes the developed organic glasses from existing scintillators.

  9. Radiation Damage in Scintillating Crystals

    CERN Document Server

    Zhu Ren Yuan

    1998-01-01

    Crystal Calorimetry in future high energy physics experiments faces a new challenge to maintain its precision in a hostile radiation environment. This paper discusses the effects of radiation damage in scintillating crystals, and concludes that the predominant radiation damage effect in crystal scintillators is the radiation induced absorption, or color center formation, not the loss of the scintillation light yield. The importance of maintaining crystal's light response uniformity and the feasibility to build a precision crystal calorimeter under radiation are elaborated. The mechanism of the radiation damage in scintillating crystals is also discussed. While the damage in alkali halides is found to be caused by the oxygen or hydroxyl contamination, it is the structure defects, such as oxygen vacancies, cause damage in oxides. Material analysis methods used to reach these conclusions are presented in details.

  10. Measurement of scintillation decay curves by a single photon counting technique

    International Nuclear Information System (INIS)

    Noguchi, Tsutomu

    1978-01-01

    An improved apparatus suitable for the measurement of spectroscopic scintillation decay curves has been developed by combination of a single photon counting technique and a delayed coincidence method. The time resolution of the apparatus is improved up to 1.16 nsec (FWHM), which is obtained from the resolution function of the system for very weak Cherenkov light flashes. Systematic measurement of scintillation decay curves is made for liquid and crystal scintillators including PPO-toluene, PBD-xylene, PPO-POPOP-toluene, anthracene and stilbene. (auth.)

  11. Hybrid metal organic scintillator materials system and particle detector

    Science.gov (United States)

    Bauer, Christina A.; Allendorf, Mark D.; Doty, F. Patrick; Simmons, Blake A.

    2011-07-26

    We describe the preparation and characterization of two zinc hybrid luminescent structures based on the flexible and emissive linker molecule, trans-(4-R,4'-R') stilbene, where R and R' are mono- or poly-coordinating groups, which retain their luminescence within these solid materials. For example, reaction of trans-4,4'-stilbenedicarboxylic acid and zinc nitrate in the solvent dimethylformamide (DMF) yielded a dense 2-D network featuring zinc in both octahedral and tetrahedral coordination environments connected by trans-stilbene links. Similar reaction in diethylformamide (DEF) at higher temperatures resulted in a porous, 3-D framework structure consisting of two interpenetrating cubic lattices, each featuring basic to zinc carboxylate vertices joined by trans-stilbene, analogous to the isoreticular MOF (IRMOF) series. We demonstrate that the optical properties of both embodiments correlate directly with the local ligand environments observed in the crystal structures. We further demonstrate that these materials produce high luminescent response to proton radiation and high radiation tolerance relative to prior scintillators. These features can be used to create sophisticated scintillating detection sensors.

  12. Photonic crystal scintillators and methods of manufacture

    Science.gov (United States)

    Torres, Ricardo D.; Sexton, Lindsay T.; Fuentes, Roderick E.; Cortes-Concepcion, Jose

    2015-08-11

    Photonic crystal scintillators and their methods of manufacture are provided. Exemplary methods of manufacture include using a highly-ordered porous anodic alumina membrane as a pattern transfer mask for either the etching of underlying material or for the deposition of additional material onto the surface of a scintillator. Exemplary detectors utilizing such photonic crystal scintillators are also provided.

  13. Recent developments in plastic scintillators with pulse shape discrimination

    Science.gov (United States)

    Zaitseva, N. P.; Glenn, A. M.; Mabe, A. N.; Carman, M. L.; Hurlbut, C. R.; Inman, J. W.; Payne, S. A.

    2018-05-01

    The paper reports results of studies conducted to improve scintillation performance of plastic scintillators capable of neutron/gamma pulse-shape discrimination (PSD). Compositional modifications made with the polymer matrix improved physical stability, allowing for increased loads of the primary dye that, in combination with selected secondary dyes, provided enhanced PSD especially important for the lower energy ranges. Additional measurements were made with a newly-introduced PSD plastic EJ-276, that replaces the first commercially produced EJ-299. Comparative studies conducted with the new materials and EJ-309 liquids at large scale (up to 10 cm) show that current plastics may provide scintillation and PSD performance sufficient for the replacement of liquid scintillators. Comparison to stilbene single crystals compliments the information about the status of the solid-state materials recently developed for fast neutron detection applications.

  14. WORKSHOP: Scintillating crystals

    Energy Technology Data Exchange (ETDEWEB)

    Anon.

    1992-12-15

    Scintillating crystals are one of the big spinoff success stories of particle physics, and from 22-26 September an international workshop in Chamonix in the French Alps looked at the increasing role of these materials in pure and applied science and in industry.

  15. WORKSHOP: Scintillating crystals

    International Nuclear Information System (INIS)

    Anon.

    1992-01-01

    Scintillating crystals are one of the big spinoff success stories of particle physics, and from 22-26 September an international workshop in Chamonix in the French Alps looked at the increasing role of these materials in pure and applied science and in industry

  16. Scintillation response of organic and inorganic scintillators

    CERN Document Server

    Papadopoulos, L M

    1999-01-01

    A method to evaluate the scintillation response of organic and inorganic scintillators to different heavy ionizing particles is suggested. A function describing the rate of the energy consumed as fluorescence emission is derived, i.e., the differential response with respect to time. This function is then integrated for each ion and scintillator (anthracene, stilbene and CsI(Tl)) to determine scintillation response. The resulting scintillation responses are compared to the previously reported measured responses. Agreement to within 2.5% is observed when these data are normalized to each other. In addition, conclusions regarding the quenching parameter kB dependence on the type of the particle and the computed values of kB for certain ions are included. (author)

  17. Progress in PbWO4 scintillating crystal

    International Nuclear Information System (INIS)

    Fyodorov, A.; Korzhik, M.; Missevitch, O.; Pavlenko, V.; Kachanov, V.; Singovsky, A.; Annenkov, A.N.; Ligun, V.A.; Peigneux, J.P.; Vialle, J.P.

    1994-12-01

    Lead tungstate PbWO 4 (PWO) has recently been shown to be a promising scintillating material for precise electromagnetic calorimetry. Modifications of PWO technology were made to improve the uniformity of the crystal properties. A model of the scintillation mechanism for PWO was developed and served to guide the improvement. The complex spectroscopic analysis of the crystal after improvement is presented, as well as the new crystal properties achieved. (K.A.). 14 refs., 14 figs., 4 tabs

  18. New scintillating media based on liquid crystals for particle detectors

    International Nuclear Information System (INIS)

    Barnik, M.I.; Yudin, S.G.; Vasil'chenko, V.G.; Golovkin, S.V.; Medvedkov, A.M.; Solovjev, A.S.

    2000-01-01

    The study results of optical, photoluminiscent and scintillation properties of a liquid crystal 4-pentyl-4'-cyanobiphenyl are presented. The scintillation light output of this liquid crystal is about 35% of crystal anthracene, its main decay time constants are 4 and 14 ns, and the maximum of light emission spectrum is about 400 nm. The light output of a dissolution of green emitting light scintillation dopant R6 in the liquid crystal is about 120% of crystal anthracene. The light output of the frozen dissolution measured at -112 deg. C is about 2.5 times higher as observed at +20 deg. C. In the uniaxially oriented liquid crystal, the predominant intensity direction of emitted light is pointed perpendicular to the liquid crystal director and an appreciable part of the emitted light is elliptically polarized. The possibility to use scintillation properties of liquid crystals is considered both for the improvement of existing particle detector characteristics and for the creation of new gated particle detectors

  19. New scintillating media based on liquid crystals for particle detectors

    CERN Document Server

    Barnik, M I; Vasilchenko, V G; Golovkin, S V; Medvedkov, A M; Soloviev, A S

    2000-01-01

    The study results of optical, photoluminiscent and scintillation properties of a liquid crystal 4-pentyl-4'-cyanobiphenyl are presented. The scintillation light output of this liquid crystal is about 35% of crystal anthracene, its main decay time constants are 4 and 14 ns, and the maximum of light emission spectrum is about 400 nm. The light output of a dissolution of green emitting light scintillation dopant R6 in the liquid crystal is about 120% of crystal anthracene. The light output of the frozen dissolution measured at -112 deg. C is about 2.5 times higher as observed at +20 deg. C. In the uniaxially oriented liquid crystal, the predominant intensity direction of emitted light is pointed perpendicular to the liquid crystal director and an appreciable part of the emitted light is elliptically polarized. The possibility to use scintillation properties of liquid crystals is considered both for the improvement of existing particle detector characteristics and for the creation of new gated particle detectors.

  20. Scintillation properties of CdF2 crystal

    International Nuclear Information System (INIS)

    Yanagida, Takayuki; Fujimoto, Yutaka; Koshimizu, Masanori; Fukuda, Kentaro

    2015-01-01

    CdF 2 single crystal was prepared by Tokuyama Corp. with the μ-PD method to investigate Auger free luminescence of this material. From optical transmittance spectrum, bandgap wavelength was around 280 nm. In X-ray induced radioluminescence spectrum, emission lines appeared around 350 nm and 420 nm. Excitation wavelength was investigated and excitation peak was around 250 nm. Photoluminescence and scintillation decay times were evaluated and decay time was few ns. Temperature dependence of X-ray induced radioluminescence was compared with conventional BaF 2 scintillator and scintillation of CdF 2 decreased when the temperature increased. Consequently, scintillation of CdF 2 is possibly emission at color centers or exciton related one. - Highlights: • CdF 2 crystal scinitillator was synthesized. • Emission wavelengths of CdF 2 appeared around 350 and 420 nm. • Scintillation decay time of CdF 2 was quite fast, 1.75 ns. • Excitation bands were investigated by using Synchrotron facility, UVSOR

  1. Barium iodide and strontium iodide crystals andd scintillators implementing the same

    Science.gov (United States)

    Payne, Stephen A; Cherepy, Nerine J; Hull, Giulia E; Drobshoff, Alexander D; Burger, Arnold

    2013-11-12

    In one embodiment, a material comprises a crystal comprising strontium iodide providing at least 50,000 photons per MeV. A scintillator radiation detector according to another embodiment includes a scintillator optic comprising europium-doped strontium iodide providing at least 50,000 photons per MeV. A scintillator radiation detector in yet another embodiment includes a scintillator optic comprising SrI.sub.2 and BaI.sub.2, wherein a ratio of SrI.sub.2 to BaI.sub.2 is in a range of between 0:1 A method for manufacturing a crystal suitable for use in a scintillator includes mixing strontium iodide-containing crystals with a source of Eu.sup.2+, heating the mixture above a melting point of the strontium iodide-containing crystals, and cooling the heated mixture near the seed crystal for growing a crystal. Additional materials, systems, and methods are presented.

  2. Event localization in bulk scintillator crystals using coded apertures

    Energy Technology Data Exchange (ETDEWEB)

    Ziock, K.P. [Oak Ridge National Laboratory, Oak Ridge, TN (United States); Department of Physics and Astronomy, University of Tennessee, Knoxville, TN (United States); Braverman, J.B. [Department of Physics and Astronomy, University of Tennessee, Knoxville, TN (United States); Fabris, L.; Harrison, M.J.; Hornback, D.; Newby, J. [Oak Ridge National Laboratory, Oak Ridge, TN (United States)

    2015-06-01

    The localization of radiation interactions in bulk scintillators is generally limited by the size of the light distribution at the readout surface of the crystal/light-pipe system. By finding the centroid of the light spot, which is typically of order centimeters across, practical single-event localization is limited to ~2 mm/cm of crystal thickness. Similar resolution can also be achieved for the depth of interaction by measuring the size of the light spot. Through the use of near-field coded-aperture techniques applied to the scintillation light, light transport simulations show that for 3-cm-thick crystals, more than a five-fold improvement (millimeter spatial resolution) can be achieved both laterally and in event depth. At the core of the technique is the requirement to resolve the shadow from an optical mask placed in the scintillation light path between the crystal and the readout. In this paper, experimental results are presented that demonstrate the overall concept using a 1D shadow mask, a thin-scintillator crystal and a light pipe of varying thickness to emulate a 2.2-cm-thick crystal. Spatial resolutions of ~1 mm in both depth and transverse to the readout face are obtained over most of the crystal depth.

  3. Event localization in bulk scintillator crystals using coded apertures

    International Nuclear Information System (INIS)

    Ziock, K.P.; Braverman, J.B.; Fabris, L.; Harrison, M.J.; Hornback, D.; Newby, J.

    2015-01-01

    The localization of radiation interactions in bulk scintillators is generally limited by the size of the light distribution at the readout surface of the crystal/light-pipe system. By finding the centroid of the light spot, which is typically of order centimeters across, practical single-event localization is limited to ~2 mm/cm of crystal thickness. Similar resolution can also be achieved for the depth of interaction by measuring the size of the light spot. Through the use of near-field coded-aperture techniques applied to the scintillation light, light transport simulations show that for 3-cm-thick crystals, more than a five-fold improvement (millimeter spatial resolution) can be achieved both laterally and in event depth. At the core of the technique is the requirement to resolve the shadow from an optical mask placed in the scintillation light path between the crystal and the readout. In this paper, experimental results are presented that demonstrate the overall concept using a 1D shadow mask, a thin-scintillator crystal and a light pipe of varying thickness to emulate a 2.2-cm-thick crystal. Spatial resolutions of ~1 mm in both depth and transverse to the readout face are obtained over most of the crystal depth

  4. Scintillation properties of CdF{sub 2} crystal

    Energy Technology Data Exchange (ETDEWEB)

    Yanagida, Takayuki, E-mail: yanagida@lsse.kyutech.ac.jp [Kyushu Institute of Technology, 2-4 Hibikino, Wakamatsu, Kitakyushu, Fukuoka 808-0196 (Japan); Fujimoto, Yutaka; Koshimizu, Masanori [Department of Applied Chemistry, Graduate School of Engineering, Tohoku University, 6-6-07 Aoba, Aramaki, Aoba-ku, Sendai 980-8579 (Japan); Fukuda, Kentaro [Tokuyama Corp., 1-1 Mikage-cho, Shunan-shi, Yamaguchi 745-8648 Japan (Japan)

    2015-01-15

    CdF{sub 2} single crystal was prepared by Tokuyama Corp. with the μ-PD method to investigate Auger free luminescence of this material. From optical transmittance spectrum, bandgap wavelength was around 280 nm. In X-ray induced radioluminescence spectrum, emission lines appeared around 350 nm and 420 nm. Excitation wavelength was investigated and excitation peak was around 250 nm. Photoluminescence and scintillation decay times were evaluated and decay time was few ns. Temperature dependence of X-ray induced radioluminescence was compared with conventional BaF{sub 2} scintillator and scintillation of CdF{sub 2} decreased when the temperature increased. Consequently, scintillation of CdF{sub 2} is possibly emission at color centers or exciton related one. - Highlights: • CdF{sub 2} crystal scinitillator was synthesized. • Emission wavelengths of CdF{sub 2} appeared around 350 and 420 nm. • Scintillation decay time of CdF{sub 2} was quite fast, 1.75 ns. • Excitation bands were investigated by using Synchrotron facility, UVSOR.

  5. New scintillating crystals for PET scanners

    CERN Document Server

    Lecoq, P

    2002-01-01

    Systematic R&D on basic mechanism in inorganic scintillators, initiated by the Crystal Clear Collaboration at CERN 10 years ago, has contributed not to a small amount, to the development of new materials for a new generation of medical imaging devices with increased resolution and sensitivity. The first important requirement for a scintillator to be used in medical imaging devices is the stopping power for the given energy range of X and gamma rays to be considered, and more precisely the conversion efficiency. A high light yield is also mandatory to improve the energy resolution, which is essentially limited by the photostatistics and the electronic noise at these energies. A short scintillation decay time allows to reduce the dead time and therefore to increase the limiting counting rate. When all these requirements are fulfilled the sensitivity and image contrast are increased for a given patient dose, or the dose can be reduced. Examples of new materials under development by the Crystal Clear Collabor...

  6. Modifications of micro-pulling-down method for the growth of selected Li-containing crystals for neutron scintillator and VUV scintillation crystals

    Science.gov (United States)

    Pejchal, J.; Fujimoto, Y.; Chani, V.; Yanagida, T.; Yokota, Y.; Yoshikawa, A.; Nikl, M.; Beitlerova, A.

    2012-12-01

    To develop new and efficient neutron scintillator, Ti-doped LiAlO2 single crystal was grown by micro-pulling-down method. The X-ray excited radioluminescence spectra and neutron light yield were measured. Positive effect of Mg codoping on the overall scintillation efficiency was found. The BaLu2F8 single crystal was grown by micro-pulling-down method using low temperature gradient at growth interface and applying quenching immediately after growth process.

  7. Suppression background device in neutron detection by a scintillation detector

    International Nuclear Information System (INIS)

    Degtyarev, A.P.; Kozyr', Yu.E.; Prokopets, G.A.

    1980-01-01

    A pulse shape discriminator for suppression of cosmic and gamma background as well as for suppression of intrinsic noises of a photomultiplier is described. Identification of signals of background and neutrons is performed by means of comparison of relative intensity of fast and slow components of scintillator luminescence. Basic discriminator flowsheet which contains integrating and differential RC circuits and time-to-amplitude converter is given. The discriminator provides minimum energy of detected neutrons equal to 500 keV when using a FEhU-36 neutron detector with a stilbene crystal [ru

  8. A comparison of two methods of pulse-shape discrimination for alpha-gamma separation with trans-stilbene

    International Nuclear Information System (INIS)

    Shani, G.; Cojocaru, M.

    1977-01-01

    A method for measurement of low level alpha particles in high level gamma background is investigated. Because of its pulse-shape-discrimination properties and being a solid scintillator, trans-stilbene seems to be the proper scintillator, for this purpose. The investigation was done by measuring the effect of different gamma background level (from very low to very high) on constant alpha count rate. Two different pulse-shape-discrimination systems were used and compared. The Ortec system measures the pulse fall time and supplies a corresponding pulse height and the Elscint system checks whether the pulse is what is expected to be the gamma pulse, or is a longer pulse. Both systems yielded good results and were found to be adequate for alpha-gamma separation with trans-stilbene. (Auth.)

  9. LiCaAlF sub 6 :Ce crystal: a new scintillator

    CERN Document Server

    Gektin, A V; Neicheva, S; Gavrilyuk, V; Bensalah, A; Fukuda, T; Shimamura, K

    2002-01-01

    Scintillation properties of LiCaAlF sub 6 :Ce crystal, well known as the effective UV laser material, is reported. Ce sup 3 sup + emission at 286-305 nm with a single exponential decay time of 35 ns provides a scintillation pulse. Radiation damage in pure and Ce-doped crystals is studied. In contrast to the majority of fluoride crystals, cerium is responsible for the ultradeep traps formation revealing thermostimulated luminescence. Overlapping of color center absorption and Ce sup 3 sup + ion emission bands limits the scintillation efficiency of LiCaAlF sub 6 :Ce at high radiation doses.

  10. Development and melt growth of novel scintillating halide crystals

    Science.gov (United States)

    Yoshikawa, Akira; Yokota, Yuui; Shoji, Yasuhiro; Kral, Robert; Kamada, Kei; Kurosawa, Shunsuke; Ohashi, Yuji; Arakawa, Mototaka; Chani, Valery I.; Kochurikhin, Vladimir V.; Yamaji, Akihiro; Andrey, Medvedev; Nikl, Martin

    2017-12-01

    Melt growth of scintillating halide crystals is reviewed. The vertical Bridgman growth technique is still considered as very popular method that enables production of relatively large and commercially attractive crystals. On the other hand, the micro-pulling-down method is preferable when fabrication of small samples, sufficient for preliminary characterization of their optical and/or scintillation performance, is required. Moreover, bulk crystal growth is also available using the micro-pulling-down furnace. The examples of growths of various halide crystals by industrially friendly melt growth techniques including Czochralski and edge-defined film-fed growth methods are also discussed. Finally, traveling molten zone growth that in some degree corresponds to horizontal zone melting is briefly overviewed.

  11. Optimization of light collection from crystal scintillators for cryogenic experiments

    International Nuclear Information System (INIS)

    Mokina, V.M.; Danevich, F.A.; Kobychev, V.V.; Kraus, H.; Mikhailik, V.B.; Nagornaya, L.L.

    2012-01-01

    Cryogenic scintillation bolometers are a promising technique to search for dark matter and neutrinoless double decay. Improvement of light collection and energy resolution are important requirements in such experiments. Energy resolutions and relative pulse amplitudes of scintillation detectors using ZnWO 4 scintillation crystals of different shapes (cylinder 20x20 mm and hexagonal prism with diagonal 20 mm and height 20 mm), reflector materials and shapes, optical contact and surface properties (polished and diffused) were measured. The crystal scintillator of hexagonal shape shows the better energy resolution and pulse amplitude. The best energy resolution (FWHM = 9.3 % for 662 keV γ quanta of 137 Cs) was obtained with a hexagonal scintillator with all surfaces diffuse, in optical contact with a PMT and surrounded by a reflector (3M) of size 26x25 mm. In the geometry w ithout optical contact r epresenting the conditions of light collection for a cryogenic scintillating bolometer the best energy resolution and relative pulse amplitude was obtained for a hexagonal shape scintillator with diffuse side and polished face surfaces, surrounded by a reflector with a gap between the scintillator and the reflector

  12. Characterisation of a LSO scintillation crystal for space applications

    Energy Technology Data Exchange (ETDEWEB)

    Elftmann, Robert; Grunau, Jan; Kulkarni, Shrinivasrao; Martin, Cesar; Wimmer-Schweingruber, Robert F. [IEAP, Christian-Albrechts-Universitaet Kiel (Germany)

    2013-07-01

    Inorganic scintillation crystals coupled with semiconductor detectors are often used in space applications as gamma ray detectors or high energy particle calorimeters. Currently BGO (Bi{sub 4}Ge{sub 3}O{sub 12}) is widely used for this purpose because of its high stopping power, the non hygroscopy and its ruggedness, which is favorable in space applications. Cerium doped LSO (Lu{sub 2}SiO{sub 5}) offers the same benefits with higher light output capabilites and a shorter decay time. In this work a cerium doped LSO scintillation crystal coupled with a photo diode is investigated. The light yield and resolution studies for two different radioactive sources, {sup 207}Bi and {sup 60}Co, are presented. To increase the light collection and consequently the energy resolution, scintillation crystals are wrapped in highly reflective material. The increase in light collection depending on the amount of layers for the LSO crystal along with investigations of quenching effects with alpha particles and the background spectrum, which arises from radioactive cerium isotopes, are also included in this work.

  13. A HPMT based set-up to characterize scintillating crystals

    International Nuclear Information System (INIS)

    D'Ambrosio, C.; Ercoli, C.; Jaaskelainen, S.; Lecoeur, G.; Leutz, H.; Loos, R.; Piedigrossi, D.; Puertolas, D.; Rosso, E.; Schomaker, R.

    1999-01-01

    We have developed a fully automatic measurement set-up, capable of measuring light yields arising from scintillating crystals in a linear range of about four orders of magnitude. The photodetector is a hybrid photomultiplier tube specially developed to optimize linear range and photon detection. Crystal and photodetector are temperature controlled by a closed water circuit, as this is essential when measuring low light yield scintillating crystals with a marked temperature dependence of their light yield. Gamma sources can be placed either on top or on the side of the crystal. In this latter case, the source can be automatically moved by a computer-controlled step motor to provide a uniformity profile of the light yield along the crystal. Tagged and not-tagged operation modes are possible. The whole set-up is computer-controlled in an effort to provide fast and reliable measurements, to characterize many crystals per day. This is important for the quality control of the lead tungstate crystals that will be applied in the electromagnetic calorimeter of the CMS-detector at the LHC at CERN. (author)

  14. A HPMT based set-up to characterize scintillating crystals

    Energy Technology Data Exchange (ETDEWEB)

    D' Ambrosio, C.; Ercoli, C.; Jaaskelainen, S.; Lecoeur, G.; Leutz, H.; Loos, R.; Piedigrossi, D.; Puertolas, D.; Rosso, E.; Schomaker, R

    1999-09-21

    We have developed a fully automatic measurement set-up, capable of measuring light yields arising from scintillating crystals in a linear range of about four orders of magnitude. The photodetector is a hybrid photomultiplier tube specially developed to optimize linear range and photon detection. Crystal and photodetector are temperature controlled by a closed water circuit, as this is essential when measuring low light yield scintillating crystals with a marked temperature dependence of their light yield. Gamma sources can be placed either on top or on the side of the crystal. In this latter case, the source can be automatically moved by a computer-controlled step motor to provide a uniformity profile of the light yield along the crystal. Tagged and not-tagged operation modes are possible. The whole set-up is computer-controlled in an effort to provide fast and reliable measurements, to characterize many crystals per day. This is important for the quality control of the lead tungstate crystals that will be applied in the electromagnetic calorimeter of the CMS-detector at the LHC at CERN. (author)

  15. Scintillation activity in an unirradiated single crystal of 3-hydroxyxanthine

    International Nuclear Information System (INIS)

    Cooke, D.W.; Jahan, M.S.; Alexander, C. Jr.

    1976-01-01

    A method of growing single crystals (approximately 4mm long) of 3-hydroxyxanthine is described. Observed scintillations occurring in an unirradiated single crystal of this potent oncogen as the temperature is lowered from 300 to 90 K are shown. It was found that these scintillations occur upon heating or cooling and do not diminish in activity as the number of heating and cooling cycles increase. It was found that a short duration u.v. exposure would terminate the scintillation activity and various attempts (such as annealing and pressure changes) to rejuvenate them were unsuccessful. With these observations in mind speculation is made concerning the mechanisms associated with the production of purine N-oxide derivatives. (U.K.)

  16. Digital silicon photomultiplier readout of a new fast and bright scintillation crystal (Ce:GFAG)

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Yong-Seok [Department of Bio-convergence Engineering, Korea University, Seoul (Korea, Republic of); Leem, Hyun-Tae [Molecular Imaging Research & Education (MiRe) Laboratory, Department of Electronic Engineering, Sogang University, Seoul (Korea, Republic of); Yamamoto, Seiichi [Department of Medical Technology, Nagoya University Graduate School of Medicine, Nagoya (Japan); Choi, Yong, E-mail: ychoi@sogang.ac.kr [Molecular Imaging Research & Education (MiRe) Laboratory, Department of Electronic Engineering, Sogang University, Seoul (Korea, Republic of); Kamada, Kei [New Industry Creation Hatchery Center (NICHe), Tohoku University, Sendai (Japan); C& A corporation, Sendai (Japan); Yoshikawa, Akira [New Industry Creation Hatchery Center (NICHe), Tohoku University, Sendai (Japan); C& A corporation, Sendai (Japan); Institute for Material Research, Tohoku University, Sendai (Japan); Park, Sang-Geon [Department of Electrical & Electronics, Silla University, Pusan (Korea, Republic of); Yeom, Jung-Yeol, E-mail: jungyeol@korea.ac.kr [Department of Bio-convergence Engineering, Korea University, Seoul (Korea, Republic of); School of Biomedical Engineering, Korea University, Seoul (Korea, Republic of)

    2016-10-01

    A new Gadolinium Fine Aluminum Gallate (Ce:GFAG) scintillation crystal with both high energy resolution and fast timing properties has successfully been grown. Compared to Gd{sub 3}Al{sub 2}Ga{sub 3}O{sub 12} (Ce:GAGG), this new inorganic scintillation crystal has a high luminosity similar to and a faster decay time. In this paper, we report on the timing and energy performance results of the new GFAG scintillation crystal read out with digital silicon photomultipliers (dSiPM) for positron emission tomography (PET) application. The best coincidence resolving time (FWHM) of polished 3×3×5 mm{sup 3} crystals was 223±6 ps for GFAG crystals compared to 396±28 ps for GAGG crystals and 131±3 ps for LYSO crystals respectively. An energy resolution (511 keV peak of Na-22) of 10.9±0.2% was attained with GFAG coupled to dSiPM after correcting for saturation effect, compared to 9.5±0.3% for Ce:GAGG crystals and 11.9±0.4% for LYSO crystals respectively. It is expected that this new scintillator may be competitive in terms of overall properties such as energy resolution, timing resolution and growing (raw material) cost, compared to existing scintillators for positron emission tomography (PET).

  17. An organic scintillator neutron spectrometer suitable for in-phantom studies

    International Nuclear Information System (INIS)

    Harrison, K.G.

    1981-07-01

    A transportable organic scintillator spectrometry system based on a 1 cm high x 1 cm dia. cylindrical stilbene scintillator with a 30 cm light-pipe has been developed for neutron spectrometry inside anthropomorphic phantoms in order to improve knowledge of dose and dose-equivalent distributions in the body. Electronic pulse-shape discrimination is used to discriminate between neutron and gamma-ray events in the scintillator. The spectrometer is shown to give excellent results in the range of neutron energies from 1.5 to 7 MeV when used with an unfolding program based on differentiation of the pulse-height distribution. Below 1 MeV problems are experienced with pulse-shape discrimination, and below 2 MeV there are found to be some shortcomings in the differentiation method for this size of scintillator. Above about 9 MeV more sophisticated unfolding methods are shown to be desirable. Problems of stability of the system, difficulties in the measurement and calculation of the response functions, and disadvantages of using stilbene are discussed. (author)

  18. Luminescence and scintillation properties of YAG:Ce single crystal and optical ceramics

    CERN Document Server

    Mihóková, E; Mareš, J A; Beitlerová, A; Vedda, A; Nejezchleb, K; Blažek, K; D’Ambrosio, C

    2007-01-01

    We use various techniques to study optical and scintillation properties of Ce-doped yttrium aluminum garnet, Y3Al5O12 (YAG:Ce), in the form of a high-quality industrial single crystal. This was compared to optical ceramics prepared from YAG:Ce nanopowders. We present experimental data in the areas of optical absorption, radioluminescence, scintillation decay, photoelectron yield, thermally stimulated luminescence and radiation-induced absorption. The results point to an interesting feature—the absence of antisite (YAl, i.e. Y at the Al site) defects in optical ceramics. The scintillation decay of the ceramics is faster than that of the single crystal, but its photoelectron yield (measured with 1 μs integration time) is about 30–40% lower. Apart from the photoelectron yield value the YAG:Ce optical ceramic is fully comparable to a high quality industrial YAG:Ce single crystal and can become a competitive scintillator material.

  19. Photonic Crystals: Enhancing the Light Output of Scintillation Based Detectors

    CERN Document Server

    Knapitsch, Arno Richard

    A scintillator is a material which emits light when excited by ionizing radiation. Such materials are used in a diverse range of applications; From high energy particle physics experiments, X-ray security, to nuclear cameras or positron emission tomography. Future high-energy physics (HEP) experiments as well as next generation medical imaging applications are more and more pushing towards better scintillation characteristics. One of the problems in heavy scintillating materials is related to their high index of refraction. As a consequence, most of the scintillation light produced in the bulk material is trapped inside the crystal due to total internal reflection. The same problem also occurs with light emitting diodes (LEDs) and has for a long time been considered as a limiting factor for their overall efficiency. Recent developments in the area of nanophotonics were showing now that those limitations can be overcome by introducing a photonic crystal (PhC) slab at the outcoupling surface of the substrate. P...

  20. Experimental evidence of infrared scintillation in crystals

    CERN Document Server

    Belogurov, S; Carugno, Giovanni; Conti, E; Iannuzzi, D; Meneguzzo, Anna Teresa

    2000-01-01

    We present experimental results on infrared emission induced by protons in some solid-state samples. Infrared scintillation occurs in many crystals, with different yield values and time-response behaviours. A rough measurement of the emission wavelength of CsI(Tl) is also reported.

  1. Growth and scintillation properties of gadolinium and yttrium orthovanadate crystals

    International Nuclear Information System (INIS)

    Voloshina, O.V.; Baumer, V.N.; Bondar, V.G.; Kurtsev, D.A.; Gorbacheva, T.E.; Zenya, I.M.; Zhukov, A.V.; Sidletskiy, O.Ts.

    2012-01-01

    Aiming to explore the possibility of using the undoped rare-earth orthovanadates as scintillation materials, we developed the procedure for growth of gadolinium (GdVO 4 ) and yttrium (YVO 4 ) orthovanadate single crystals by Czochralski method, and determined the optimal conditions of their after-growth annealing. Optical, luminescent, and scintillation properties of YVO 4 and GdVO 4 were discussed versus known literature data. Scintillation characteristics of GdVO 4 were determined for the first time.

  2. Quality inspection of anisotropic scintillating crystals through measurement of interferometric fringe pattern parameters

    CERN Document Server

    Cocozzella, N; Majni, G; Paone, N; Rinaldi, D T

    2001-01-01

    Scintillating crystals are widely used as detectors in radiographic systems, computerized axial tomography devices and in calorimeters employed in high-energy physics. This paper results from a project motivated by the development of the CMS calorimeter at CERN, which will make use of a large number of scintillating crystals. In order to prevent crystals from breaking because of internal residual stress, a quality control system based on optic inspection of interference fringe patterns was developed. The principle of measurement procedures was theoretically modelled, and then a dedicated polariscope was designed and built, in order to observe the crystals under induced stresses or to evaluate the residual internal stresses. The results are innovative and open a new perspective for scintillating crystals quality control: the photoelastic constant normal to the optic axis of the lead tungstate crystals (PbWO sub 4) was measured, and the inspection procedure developed is applicable to mass production, not only t...

  3. Optimization of the scintillation parameters of the lead tungstate crystals for their application in high precision electromagnetic calorimetry

    International Nuclear Information System (INIS)

    Drobychev, G.

    2000-01-01

    In the frame of this dissertation work scintillation properties of the lead tungstate crystals PWO) and possibilities of their use were studied foreseeing their application for electromagnetic calorimetry in extreme radiation environment conditions of new colliders. The results of this work can be summarized in the following way. 1. A model of the scintillations origin in the lead tungstate crystals which includes processes influencing on the crystals radiation hardness and presence of slow components in scintillations was developed. 2. An analysis of the influences of the PWO scintillation properties changes on the parameters of the electromagnetic calorimeter was done. 3. Methods of the light collection from the large scintillation elements of complex shape made of the birefringent scintillation crystal with high refraction index and low light yield in case of signal registration by a photodetector with sensitive surface small in compare with the output face of scintillator were Studied. 4. Physical principles of the methodology of the scintillation crystals certification during their mass production foreseeing their installation into a calorimeter electromagnetic were developed. Correlations between the results of measurements of the PWO crystals parameters by different methods were found. (author)

  4. Crystal growth and characterization of calcium metaborate scintillators

    Czech Academy of Sciences Publication Activity Database

    Fujimoto, Y.; Yanagida, T.; Kawaguchi, N.; Fukuda, K.; Totsuka, D.; Watanabe, K.; Yamazaki, A.; Chani, V.; Nikl, Martin; Yoshikawa, A.

    2013-01-01

    Roč. 703, MAR (2013), s. 7-10 ISSN 0168-9002 Institutional support: RVO:68378271 Keywords : Czochralski method * single crystal * scintillator * calcium metaborate * luminescence Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.316, year: 2013

  5. Dual-readout calorimetry with scintillating crystals

    International Nuclear Information System (INIS)

    Pinci, D

    2009-01-01

    The dual-readout approach, which allows an event-by-event measurement of the electromagnetic shower fraction, was originally demonstrated with the DREAM sampling calorimeter. This approach can be extended to homogeneous detectors like crystals if Cherenkov and scintillation light can be separated. In this paper we present several methods we developed for distinguishing the two components in PWO and BGO based calorimeters and the results obtained.

  6. Luminescence and scintillation properties of Ce-doped Cs2ZnCl4 crystals

    Science.gov (United States)

    Sugawara, K.; Koshimizu, M.; Yanagida, T.; Fujimoto, Y.; Haruki, R.; Nishikido, F.; Kishimoto, S.; Asai, K.

    2015-03-01

    In this study, we have synthesized scintillation materials based on Ce-doped Cs2ZnCl4 crystals. The light yield was enhanced by up to 20% by doping Cs2ZnCl4 with Ce3+ ions. In the scintillation time profiles, fast components exhibited decay time constants on the order of nanoseconds, which was ascribed to Auger-free luminescence (AFL). The light yield of the AFL component decreased at 10 mol% Ce3+ concentration, which is mainly attributed to the reabsorption of AFL photons inside the crystals by Ce3+ ions, as seen in the scintillation spectra. Long components had decay time constants of approximately 30 ns. In addition, at 10 mol% Ce3+ concentration, a prominent band appeared at approximately 500 nm in the scintillation spectrum, which was not observed in the photoluminescence spectra. The long components in the scintillation time profiles and the 500 nm band in the scintillation spectra were tentatively attributed to self-trapped excitons perturbed by Ce3+ ions.

  7. A new hybrid photomultiplier tube as detector for scintillating crystals

    International Nuclear Information System (INIS)

    De Notaristefani, F.; Vittori, F.; Puertolas, D.

    2002-01-01

    In this work, we have attentively studied the performance of a new hybrid photomultiplier tube (HPMT) as detector for photons from scintillating crystals. The HPMT is equipped with a YAP window in order to improve light collection and increase measured light response from scintillating crystals. Several measurements have been performed on BGO, LSO, CsI(Tl) and NaI(Tl) planar crystals having three different surface treatments as well as on YAP : Ce and CsI(Tl) matrices. Such crystals have been coupled to two HPMTs, one equipped with a YAP window (Y-HPMT) and the other with a conventional quartz window (Q-HPMT). Measurements on crystals coupled to the Y-HPMT have shown a consistent improvement of the light response, thanks to the presence of the YAP window. Indeed, the light response measured with the Y-HPMT was on average equal to 1.5, 2.1 and 2.6 times that obtained with the Q-HPMT for planar crystals with white painted (diffusive), fine ground and polished rear surfaces, respectively. With regards to crystal matrices, we measured a light response increase of about 1.2 times

  8. Response of CsI:Pb Scintillator Crystal to Neutron Radiation

    Science.gov (United States)

    Costa Pereira, Maria da Conceição; Filho, Tufic Madi; Berretta, José Roberto; Náhuel Cárdenas, José Patrício; Iglesias Rodrigues, Antonio Carlos

    2018-01-01

    The helium-3 world crisis requires a development of new methods of neutron detection to replace commonly used 3He proportional counters. In the past decades, great effort was made to developed efficient and fast scintillators to detect radiation. The inorganic scintillator may be an alternative. Inorganic scintillators with much higher density should be selected for optimal neutron detection efficiency taking into consideration the relevant reactions leading to light emission. These detectors should, then, be carefully characterized both experimentally and by means of advanced simulation code. Ideally, the detector should have the capability to separate neutron and gamma induced events either by amplitude or through pulse shape differences. As neutron sources also generate gamma radiation, which can interfere with the measurement, it is necessary that the detector be able to discriminate the presence of such radiation. Considerable progress has been achieved to develop new inorganic scintillators, in particular increasing the light output and decreasing the decay time by optimized doping. Crystals may be found to suit neutron detection. In this report, we will present the results of the study of lead doped cesium iodide crystals (CsI:Pb) grown in our laboratory, using the vertical Bridgman technique. The concentration of the lead doping element (Pb) was studied in the range 5x10-4 M to 10-2 M . The crystals grown were subjected to annealing (heat treatment). In this procedure, vacuum of 10-6 mbar and continuous temperature of 350°C, for 24 hours, were employed. In response to neutron radiation, an AmBe source with energy range of 1 MeV to 12 MeV was used. The activity of the AmBe source was 1Ci Am. The fluency was 2.6 x 106 neutrons/second. The operating voltage of the photomultiplier tube was 1700 V; the accumulation time in the counting process was 600 s and 1800 s. The scintillator crystals used were cut with dimensions of 20 mm diameter and 10 mm height.

  9. Effects of Photonic Crystals on the Light Output of Heavy Inorganic Scintillators

    CERN Document Server

    Knapitsch, Arno; Fabjan, Christian W; Leclercq, Jean-Louis; Letartre, Xavier; Mazurczyk, Radoslaw; Lecoq, Paul

    2013-01-01

    Photonic crystals (PhCs) are optical materials which can affect the propagation of light in multiple ways. In recent years PhCs contributed to major technological developments in the field of semiconductor lasers, light emitting diodes and photovoltaic applications. In our case we are investigating the capabilities of photonic crystal slabs with the aim to improve the performance of heavy inorganic scintillators. To study the combination of scintillators and PhCs we use a Monte-Carlo program to simulate the light propagation inside a scintillator and a rigorous coupled wave analysis (RCWA) framework to analyse the optical PhC properties. The simulations show light output improvements of a wide range of scintillating materials due to light scattering effects of the PhC slabs. First samples have been produced on top of 1.2 × 2.6 × 5 mm LSO (cerium-doped Lutetium Oxyorthosilicate, Lu_2SiO_5:Ce^3+) scintillators using electron beam lithography and reactive ion etching (RIE). Our samples show a 30-60% light outp...

  10. A region segmentation based algorithm for building a crystal position lookup table in a scintillation detector

    International Nuclear Information System (INIS)

    Wang Haipeng; Fan Xin; Yun Mingkai; Liu Shuangquan; Cao Xuexiang; Chai Pei; Shan Baoci

    2015-01-01

    In a scintillation detector, scintillation crystals are typically made into a 2-dimensional modular array. The location of incident gamma-ray needs be calibrated due to spatial response nonlinearity. Generally, position histograms-the characteristic flood response of scintillation detectors-are used for position calibration. In this paper, a position calibration method based on a crystal position lookup table which maps the inaccurate location calculated by Anger logic to the exact hitting crystal position has been proposed. Firstly, the position histogram is preprocessed, such as noise reduction and image enhancement. Then the processed position histogram is segmented into disconnected regions, and crystal marking points are labeled by finding the centroids of regions. Finally, crystal boundaries are determined and the crystal position lookup table is generated. The scheme is evaluated by the whole-body positron emission tomography (PET) scanner and breast dedicated single photon emission computed tomography scanner developed by the Institute of High Energy Physics, Chinese Academy of Sciences. The results demonstrate that the algorithm is accurate, efficient, robust and applicable to any configurations of scintillation detector. (authors)

  11. Ultra-fast scintillation properties of β-Ga2O3 single crystals grown by Floating Zone method

    Science.gov (United States)

    He, Nuotian; Tang, Huili; Liu, Bo; Zhu, Zhichao; Li, Qiu; Guo, Chao; Gu, Mu; Xu, Jun; Liu, Jinliang; Xu, Mengxuan; Chen, Liang; Ouyang, Xiaoping

    2018-04-01

    In this investigation, β-Ga2O3 single crystals were grown by the Floating Zone method. At room temperature, the X-ray excited emission spectrum includes ultraviolet and blue emission bands. The scintillation light output is comparable to the commercial BGO scintillator. The scintillation decay times are composed of the dominant ultra-fast component of 0.368 ns and a small amount of slightly slow components of 8.2 and 182 ns. Such fast component is superior to most commercial inorganic scintillators. In contrast to most semiconductor crystals prepared by solution method such as ZnO, β-Ga2O3 single crystals can be grown by traditional melt-growth method. Thus we can easily obtain large bulk crystals and mass production.

  12. High efficiency scintillation detectors

    International Nuclear Information System (INIS)

    Noakes, J.E.

    1976-01-01

    A scintillation counter consisting of a scintillation detector, usually a crystal scintillator optically coupled to a photomultiplier tube which converts photons to electrical pulses is described. The photomultiplier pulses are measured to provide information on impinging radiation. In inorganic crystal scintillation detectors to achieve maximum density, optical transparency and uniform activation, it has been necessary heretofore to prepare the scintillator as a single crystal. Crystal pieces fail to give a single composite response. Means are provided herein for obtaining such a response with crystal pieces, such means comprising the combination of crystal pieces and liquid or solid organic scintillator matrices having a cyclic molecular structure favorable to fluorescence. 8 claims, 6 drawing figures

  13. Optical and scintillation properties of bulk ZnO crystal

    Energy Technology Data Exchange (ETDEWEB)

    Yanagida, Takayuki [Kyushu Institute of Technology, 2-4 Hibikino, Wakamatsu, Kitakyushu 808-0196 (Japan); Fujimoto, Yutaka; Kurosawa, Shunsuke [Institute for Materials Research, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai 980-8577 (Japan); Yamanoi, Kohei; Sarukura, Nobuhiko [Institute of Laser Engineering, Osaka University, Suita, Osaka 565-0871 (Japan); Kano, Masataka; Wakamiya, Akira [Daishinku Corporation, 1389 Shinzaike, Hiraoka-cho, Kakogawa, Hyogo 675-0194 (Japan)

    2012-12-15

    Single crystal bulk ZnO scintillator grown by the hydrothermal method was tested on its scintillation performances. In X-ray induced radio luminescence spectrum, it exhibited two intense emission peaks at 400 and 550 nm. The former was ascribed to the free and bound exciton related luminescence and the latter to oxygen vacancy related one, respectively. X-ray induced scintillation decay time of the exciton related emission measured by the pulse X-ray streak camera system resulted {proportional_to} 4 ns. Finally, the light yield under {sup 241}Am 5.5 MeV {alpha}-ray was examined and it resulted {proportional_to} 500 ph/5.5 MeV-{alpha}.(copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  14. A scintillating fibre detector for the Crystal Barrel experiment at ELSA

    International Nuclear Information System (INIS)

    Suft, G.; Anton, G.; Bogendoerfer, R.; Ehmanns, A.; Foesel, A.; Hoessl, J.; Kalinowsky, H.; Kueppersbusch, C.; Walther, D.

    2005-01-01

    A scintillating fibre detector with high spatial granularity was built for the Crystal Barrel experiment at ELSA (CB-ELSA) in Bonn. It consists of 513 scintillating fibres with 2mm in diameter, arranged in three layers with cylindrical geometry inside the Crystal Barrel detector surrounding the target cell. Two layers are wound in opposite directions, the third is parallel to the incident beam direction, resulting in an unambiguous hit reconstruction and a position resolution better than 1.6mm for charged particles. The read-out is done with 16-channel multi-anode photomultipliers. The detector was designed to cover the full angular acceptance of the Crystal Barrel detector with an angular range of 12 deg. ≤θ = 168 deg. and 0 deg. ≤φ≤360 deg. in the lab frame

  15. Scintillation properties of pure and Ca-doped ZnWO4 crystals

    International Nuclear Information System (INIS)

    Danevich, F.A.; Shkulkova, O.G.; Henry, S.; Kraus, H.; McGowan, R.; Mikhailik, V.B.; Telfer, J.

    2008-01-01

    Following the investigations of the structure and scintillation properties of Ca-doped zinc tungstate powder [phys. stat. sol. (a) 204, 730 (2007)] a single-crystal of ZnWO 4 -Ca (0.5 mol%) was grown and characterised. The relative light output, energy resolution and decay characteristics were measured for pure and Ca-doped ZnWO 4 scintillators. An increase in the light yield of ∝40% compared with the undoped crystal, and an energy resolution 9.6% ( 137 Cs) were obtained for Ca-doped ZnWO 4 . The observed improvement is attributed to the reduction of self-absorption (bleaching) of the crystal. The cause of bleaching as well as the possible contribution of scattering is discussed. (copyright 2008 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  16. Scintillation response of CsI: Tl crystal under neutron, gamma, alpha particles and beta excitations

    Energy Technology Data Exchange (ETDEWEB)

    Pereira, Maria da Conceicao Costa; Madi Filho, Tufic; Lopes, Valdir Maciel; Berretta, Jose Roberto; Cardenas, Jose Patricio Nahuel, E-mail: macoper@ipen.br [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)

    2015-07-01

    Among the converters of X and gamma radiation in light photons, known as scintillators, the one which is the most efficient emits photons with a wavelength near 400 nm. Particularly, among them, the cesium iodine doped with thallium (CsI:Tl) crystal is that which matches better between the light emission spectrum (peak at 540 nm) and the quantum sensitivity curve of the photodiodes and CCD (Charge Coupled Device). This explains the renewed interest in using this crystal as scintillator. Although the CsI:Tl crystal is commercially available, its local development would give the possibility to obtain it in different geometric configurations and coupling. Moreover, there is a special interest in studying new conditions that will alter the properties of this crystal in order to achieve a optimal level of its functional characteristics. Having an efficient national scintillator with low cost is a strategic opportunity to study the response of a detector applied to different types of radiation. The crystal of cesium iodide activated with thallium (CsI:Tl) has a high gamma detection efficiency per unit volume. In this paper, the CsI:Tl crystal, grown by the vertical Bridgman technique in evacuated silica ampoules and with the purpose of use as radiation detectors, is described. To evaluate the scintillator, measures of the thallium distribution in the crystal volume were taken, with overall efficiency score. The scintillator response was studied through gamma radiation from sources of {sup 137}Cs, {sup 60}Co, {sup 22}Na, {sup 54}Mn, {sup 131}I and {sup 99m}Tc; the beta radiation from source of {sup 90}Sr/{sup 90}Y, alpha particles from {sup 241}Am source and the scintillator response to neutrons from Am/Be source. The energetic resolution for {sup 137}Cs gamma rays (662 keV) was 10%. The results showed the validity of using the CsI:Tl crystal developed in our laboratory, in many applications in the area of radiation detectors. (author)

  17. Precision machining and polishing of scintillating crystals for large calorimeters and hodoscopes

    International Nuclear Information System (INIS)

    Wuest, C.R.; Fuchs, B.A.

    1993-05-01

    New machining and polishing techniques have been developed for large barium fluoride scintillating crystals that provide crystalline surfaces without sub-surface damage or deformation as verified by Atomic Force Microscopy (AFM) and Rutherford Back-scattering (RBS) analyses. Surface roughness of about 10--20 angstroms and sub-micron mechanical tolerances have been demonstrated on large crystal samples. Mass production techniques have also been developed for machining and polishing up to five 50 cm long crystals at one time. We present this technology along with surface studies of barium fluoride crystals polished with this technique. This technology is applicable for a number of new crystal detectors proposed at Colliders including the Barium Fluoride Electromagnetic Calorimeter at SSC, the Crystal Clear Collaboration's cerium fluoride calorimeter at LHC, and the KTeV and PHENIX scintillating hodoscopes at Fermilab, and RHIC, respectively. Lawrence Livermore National Laboratory (LLNL) has an active program of study on barium fluoride scintillating crystals for the Barium Fluoride Electromagnetic Calorimeter Collaboration and cerium fluoride and lead fluoride for the Crystal Clear Collaboration. This program has resulted in a number of significant improvements in the mechanical processing, polishing and coating of fluoride crystals. Techniques have been developed using diamond-loaded pitch lapping that can produce 15 angstrom RMS surface finishes over large areas. Also, special polishing fixtures have been designed based on mounting technology developed for the 1.1 m diameter optics used in LLNL's Nova Laser. These fixtures allow as many as five 25--50 cm long crystals to be polished and lapped at the same time with tolerances satisfying the stringent requirements of crystal calorimeters. We also discuss results on coating barium fluoride with UV reflective layers of magnesium fluoride and aluminum

  18. Scintillation quenching in BGO crystal of the Solar Orbiter HET

    Energy Technology Data Exchange (ETDEWEB)

    Grunau, J.; Kulkarni, Shrinivasrao; Martin, C.; Boettcher, Stephan; Seimetz, L.; Schuster, B.; Kulemzin, A.; Wimmer-Schweingruber, Robert F. [IEAP, Christian-Albrechts-Universitaet zu Kiel (Germany)

    2013-07-01

    The High-Energy Telescope (HET) on ESA's Solar Orbiter mission will measure electrons from 300 keV up to about 30 MeV, protons from 10 to 100 MeV and heavy ions from approximately 20 to 200 MeV/nuc. These measurement capabilities are reached by a combination of solid-state tracking detectors and a scintillator calorimeter. This setup can perform particle identification via the dE/dx vs total E technique. The scintillator approach provides a good resolution over the complete energy range but the total energy deposition has to be corrected for the scintillation quenching. The quenching lowers light output depending on the type and energy of the incident particle. We measured the crystal response for different heavy ions and energies and compared them to simulated values. Simulations were carried out using the GEANT4 toolkit provided by CERN. From comparison of simulated and measured data we were able to calculate quenching factors for the BGO crystals for ions up to iron. The results are of great interest for later data analysis with the HET telescope.

  19. How Photonic Crystals Can Improve the Timing Resolution of Scintillators

    CERN Document Server

    Lecoq, P; Knapitsch, A

    2013-01-01

    Photonic crystals (PhCs) and quantum optics phenomena open interesting perspectives to enhance the light extraction from scintillating me dia with high refractive indices as demonstrated by our previous work. By doing so, they also in fl uence the timing resolution of scintillators by improving the photostatistics. The present cont ribution will demonstrate that they are actually doing much more. Indeed, photonic crystals, if properly designed, allow the extr action of fast light propagation modes in the crystal with higher efficiency, therefore contributing to increasing the density of photons in the early phase of the light pulse. This is of particular interest to tag events at future high-energy physics colliders, such as CLIC, with a bunch-crossing rate of 2 GHz, as well as for a new generation of time-of-flight positron emission tomographs (TOFPET) aiming at a coincidence timing resolution of 100 ps FWHM. At this level of precision, good control of the light propagation modes is crucial if we consid...

  20. Crystal scintillators for use in check-light source for thermoluminescent systems

    Science.gov (United States)

    Nagpal, J. S.; Sabharwal, S. C.; Chougaonkar, M. P.; Godbole, S. V.

    1999-08-01

    Beta ( 63Ni, Emax 0.063 MeV) excited radioluminescence of indigenously grown crystal scintillators CsI(Tl), Bi 4Ge 3O 12 and CdWO 4 has been studied for its use in check-light source needed for thermoluminescence systems. Temperature coefficient of the light output over 298-323 K and the beta-induced TL of the scintillators over 298-553 K are reported.

  1. Performance study of Philips digital silicon photomultiplier coupled to scintillating crystals

    CERN Document Server

    Liu, Z.; Auffray, E.; Lecoq, P.; Paganoni, M.

    2016-01-01

    Silicon photomultipliers (SiPMs) and scintillators are often arranged in the shape of arrays in Positron Emission Tomography (PET) systems. Digital SiPMs provide signal readout in single photon avalanche diode (SPAD) level. From the photon count rate measurement of each SPAD cell of digital SiPM, we found that the output scintillating photons distribute in an area larger than the scintillator physical coupling area. Taking advantage of the possibility to enable/disable individual cells of the digital SiPM, a group of Lutetium-yttrium oxyorthosilicate (LYSO) crystals with different dimensions coupled to a digital SiPM was used to study the influence of using different SiPM active area on the number of photons detected, energy resolution and coincidence time resolution (CTR). For the same crystal coupled to the digital SiPM, the larger the active area of digital SiPM, the higher the number of photons detected. The larger active area of the digital SiPM also results in a better energy resolution after saturation...

  2. Rare-Earth Tantalates and Niobates Single Crystals: Promising Scintillators and Laser Materials

    Directory of Open Access Journals (Sweden)

    Renqin Dou

    2018-01-01

    Full Text Available Rare-earth tantalates, with high density and monoclinic structure, and niobates with monoclinic structure have been paid great attention as potential optical materials. In the last decade, we focused on the crystal growth technology of rare-earth tantalates and niobates and studied their luminescence and physical properties. A series of rare-earth tantalates and niobates crystals have been grown by the Czochralski method successfully. In this work, we summarize the research results on the crystal growth, scintillation, and laser properties of them, including the absorption and emission spectra, spectral parameters, energy levels structure, and so on. Most of the tantalates and niobates exhibit excellent luminescent properties, rich physical properties, and good chemical stability, indicating that they are potential outstanding scintillators and laser materials.

  3. Photonic crystals: A novel approach to enhance the light output of scintillation based detectors

    CERN Document Server

    Knapitsch, A; Leclercq, J L; Letartre, X; Auffray, E; Fabjan, C W

    2011-01-01

    Future high-energy physics (HEP) experiments as well as next generation medical imaging applications are more and more pushing towards better scintillation characteristics. One of the problems in heavy scintillating materials is related to their high electronic density, resulting in a large index of refraction. As a consequence, most of the scintillation light produced in the bulk material is trapped inside the crystal due to total internal reflection. The same problem also occurs with light emitting diodes (LEDs) and has for a long time been considered as a limiting factor for their overall efficiency. Recent studies have shown that those limits can be overcome by means of light scattering effects of photonic crystals (PhCs). In our simulations we could show light yield improvements between 90\\% and 110\\% when applying PhC structures to different scintillator materials. To evaluate the results, a PhC modified scintillator was produced in cooperation with the NIL (Nanotechnology Institute of Lyon). By using s...

  4. Performance study of Philips digital silicon photomultiplier coupled to scintillating crystals

    International Nuclear Information System (INIS)

    Liu, Z.; Pizzichemi, M.; Paganoni, M.; Auffray, E.; Lecoq, P.

    2016-01-01

    Silicon photomultipliers (SiPMs) and scintillators are often arranged in the shape of arrays in Positron Emission Tomography (PET) systems. Digital SiPMs provide signal readout in single photon avalanche diode (SPAD) level. From the photon count rate measurement of each SPAD cell of digital SiPM, we found that the output scintillating photons distribute in an area larger than the scintillator physical coupling area. Taking advantage of the possibility to enable/disable individual cells of the digital SiPM, a group of Lutetium-yttrium oxyorthosilicate (LYSO) crystals with different dimensions coupled to a digital SiPM was used to study the influence of using different SiPM active area on the number of photons detected, energy resolution and coincidence time resolution (CTR). For the same crystal coupled to the digital SiPM, the larger the active area of digital SiPM, the higher the number of photons detected. The larger active area of the digital SiPM also results in a better energy resolution after saturation correction. The best energy resolution full width half maximum (FWHM) obtained for the 2×2×5mm 3 , 2×2×10 mm 3 , 2×2×15mm 3 , 2×2×20mm 3 LYSO crystals was 10.7%, 11.6%, 12.1%, 12.5%, respectively. For crystals with different cross sections coupled to the digital SiPM, we found that the larger the cross section of coupling area, the more photons were detected and thus a better energy resolution was obtained. The CTR of crystals fully wrapped with Teflon or without wrapping was measured by positioning two identical crystals facing each other. A larger area of digital SiPM improves the CTR and the CTR reaches the plateau when the active area is larger than 2.2×2.2mm 2 with both two configurations of wrapping. The best CTR value for the 2×2×5mm 3 , 2×2×10mm 3 , 2×2×15mm 3 , 2×2×20mm 3 LYSO crystals was 128.9 ps, 148.4 ps, 171.6 ps, 177.9 ps, respectively. The measurements performed lead us to conclude that optimising the coupling between crystal

  5. Barium iodide and strontium iodide crystals and scintillators implementing the same

    Science.gov (United States)

    Payne, Stephen A.; Cherepy, Nerine; Pedrini, Christian; Burger, Arnold

    2016-09-13

    In one embodiment, a crystal includes at least one metal halide; and an activator dopant comprising ytterbium. In another general embodiment, a scintillator optic includes: at least one metal halide doped with a plurality of activators, the plurality of activators comprising: a first activator comprising europium, and a second activator comprising ytterbium. In yet another general embodiment, a method for manufacturing a crystal suitable for use in a scintillator includes mixing one or more salts with a source of at least one dopant activator comprising ytterbium; heating the mixture above a melting point of the salt(s); and cooling the heated mixture to a temperature below the melting point of the salts. Additional materials, systems, and methods are presented.

  6. Crystal growth and characterization of calcium metaborate scintillators

    Science.gov (United States)

    Fujimoto, Y.; Yanagida, T.; Kawaguchi, N.; Fukuda, K.; Totsuka, D.; Watanabe, K.; Yamazaki, A.; Chani, V.; Nikl, M.; Yoshikawa, A.

    2013-03-01

    Calcium metaborate CaB2O4 single crystals were grown by the Czochralski (CZ) method with the radio-frequency (RF) heating system. In these crystals, a plane cleavage was observed along the growth direction. The crystals had an 80% transparency, and no absorption bands were detected in the 190-900 nm wavelength range. The 241Am 5.5 MeV α-ray-excited radioluminescence spectrum of CaB2O4 demonstrated a broad intrinsic luminescence peak at 300-400 nm, which originated from the lattice defects or an exciton-based emission. According to the pulse height spectrum, when irradiated by neutrons from a 252Cf source, the scintillation light yielded approximately 3200 photons per neutron (ph/n).

  7. Digital pile-up rejection for plutonium experiments with solution-grown stilbene

    Energy Technology Data Exchange (ETDEWEB)

    Bourne, M.M., E-mail: mmbourne@umich.edu; Clarke, S.D., E-mail: clarkesd@umich.edu; Paff, M., E-mail: mpaff@umich.edu; DiFulvio, A., E-mail: difulvio@umich.edu; Norsworthy, M., E-mail: marknors@umich.edu; Pozzi, S.A., E-mail: pozzisa@umich.edu

    2017-01-11

    A solution-grown stilbene detector was used in several experiments with plutonium samples including plutonium oxide, mixed oxide, and plutonium metal samples. Neutrons from different reactions and plutonium isotopes are accompanied by numerous gamma rays especially by the 59-keV gamma ray of {sup 241}Am. Identifying neutrons correctly is important for nuclear nonproliferation applications and makes neutron/gamma discrimination and pile-up rejection necessary. Each experimental dataset is presented with and without pile-up filtering using a previously developed algorithm. The experiments were simulated using MCNPX-PoliMi, a Monte Carlo code designed to accurately model scintillation detector response. Collision output from MCNPX-PoliMi was processed using the specialized MPPost post-processing code to convert neutron energy depositions event-by-event into light pulses. The model was compared to experimental data after pulse-shape discrimination identified waveforms as gamma ray or neutron interactions. We show that the use of the digital pile-up rejection algorithm allows for accurate neutron counting with stilbene to within 2% even when not using lead shielding.

  8. Scintillation properties of a La,Lu-admix gadolinium pyrosilicate crystal

    Czech Academy of Sciences Publication Activity Database

    Kurosawa, S.; Shishido, T.; Suzuki, A.; Sugawara, T.; Nomura, A.; Yubuta, K.; Shoji, Y.; Yokota, Y.; Pejchal, Jan; Ohashi, Y.; Kamada, K.; Yoshikawa, A.

    2015-01-01

    Roč. 784, Jun (2015), s. 115-118 ISSN 0168-9002 Institutional support: RVO:68378271 Keywords : scintillator * pyrosilicate crystal * Ce-doped (La, Lu, Gd) Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.200, year: 2015

  9. Crystal scintillators for use in check-light source for thermoluminescent systems

    Energy Technology Data Exchange (ETDEWEB)

    Nagpal, J.S.; Sabharwal, S.C.; Chougaonkar, M.P.; Godbole, S.V

    1999-08-11

    Beta ({sup 63}Ni, E{sub max} 0.063 MeV) excited radioluminescence of indigenously grown crystal scintillators CsI(Tl), Bi{sub 4}Ge{sub 3}O{sub 12} and CdWO{sub 4} has been studied for its use in check-light source needed for thermoluminescence systems. Temperature coefficient of the light output over 298-323 K and the beta-induced TL of the scintillators over 298-553 K are reported. (author)

  10. Luminescence and scintillation properties of Rb2HfCl6 crystals

    International Nuclear Information System (INIS)

    Saeki, Keiichiro; Wakai, Yuki; Fujimoto, Yutaka; Koshimizu, Masanori; Asai, Keisuke; Yanagida, Takayuki; Nakauchi, Daisuke

    2016-01-01

    We developed a scintillator based on a Rb 2 HfCl 6 crystal as a ternary halide crystal with intrinsic luminescence. In the photoluminescence spectra, two emission bands are observed at 383 and 434 nm. The 434 nm emission band for Rb 2 HfCl 6 may be attributed to [HfCl 6 ] 2- complex ion or [ZrCl 6 ] 2- impurity, since the Rb 2 HfCl 6 contained Zr as impurity at 0.62 mol %. The radioluminescence band is observed at 420 nm and can be attributed to the same origin as the photoluminescence band at 434 nm. The scintillation decay-time constants were 0.84 and 5.4 μs. The light yield was estimated to be 24,100 photons/MeV. (author)

  11. Crystal growth and scintillation properties of Lu substituted CeBr.sub.3./sub. single crystals

    Czech Academy of Sciences Publication Activity Database

    Ito, T.; Yokota, Y.; Kurosawa, S.; Král, Robert; Kamada, K.; Pejchal, Jan; Ohashi, Y.; Yoshikawa, A.

    2016-01-01

    Roč. 452, Oct (2016), s. 65-68 ISSN 0022-0248. [American Conference on Crystal Growth and Epitaxy /20./ (ACCGE) / 17th Biennial Workshop on Organometallic Vapor Phase Epitaxy (OMVPE) / 2nd 2D Electronic Materials Symposium. Big Sky, MT, 02.08.2015-07.08.2015] Institutional support: RVO:68378271 Keywords : radiation * halides * scintillator materials * crystal growth Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.751, year: 2016

  12. Inorganic scintillators for detector systems physical principles and crystal engineering

    CERN Document Server

    Lecoq, Paul; Korzhik, Mikhail

    2017-01-01

    This second edition features new chapters highlighting advances in our understanding of the behavior and properties of scintillators, and the discovery of new families of materials with light yield and excellent energy resolution very close to the theoretical limit. The book focuses on the discovery of next-generation scintillation materials and on a deeper understanding of fundamental processes. Such novel materials with high light yield as well as significant advances in crystal engineering offer exciting new perspectives. Most promising is the application of scintillators for precise time tagging of events, at the level of 100 ps or higher, heralding a new era in medical applications and particle physics. Since the discovery of the Higgs Boson with a clear signature in the lead tungstate scintillating blocks of the CMS Electromagnetic Calorimeter detector, the current trend in particle physics is toward very high luminosity colliders, in which timing performance will ultimately be essential to mitigating...

  13. Scintillation camera

    International Nuclear Information System (INIS)

    Zioni, J.; Klein, Y.; Inbar, D.

    1975-01-01

    The scintillation camera is to make pictures of the density distribution of radiation fields created by the injection or administration radioactive medicaments into the body of the patient. It contains a scintillation crystal, several photomultipliers and computer circuits to obtain an analytical function at the exits of the photomultiplier which is dependent on the position of the scintillations at the time in the crystal. The scintillation crystal is flat and spatially corresponds to the production site of radiation. The photomultipliers form a pattern whose basic form consists of at least three photomultipliers. They are assigned to at least two crossing parallel series groups where a vertical running reference axis in the crystal plane belongs to each series group. The computer circuits are each assigned to a reference axis. Each series of a series group assigned to one of the reference axes in the computer circuit has an adder to produce a scintillation dependent series signal. Furthermore, the projection of the scintillation on this reference axis is calculated. A series signal is used for this which originates from a series chosen from two neighbouring photomultiplier series of this group. The scintillation must have appeared between these chosen series. They are termed as basic series. The photomultiplier can be arranged hexagonally or rectangularly. (GG/LH) [de

  14. Final LDRD report : advanced plastic scintillators for neutron detection.

    Energy Technology Data Exchange (ETDEWEB)

    Vance, Andrew L.; Mascarenhas, Nicholas; O' Bryan, Greg; Mrowka, Stanley

    2010-09-01

    This report summarizes the results of a one-year, feasibility-scale LDRD project that was conducted with the goal of developing new plastic scintillators capable of pulse shape discrimination (PSD) for neutron detection. Copolymers composed of matrix materials such as poly(methyl methacrylate) (PMMA) and blocks containing trans-stilbene (tSB) as the scintillator component were prepared and tested for gamma/neutron response. Block copolymer synthesis utilizing tSBMA proved unsuccessful so random copolymers containing up to 30% tSB were prepared. These copolymers were found to function as scintillators upon exposure to gamma radiation; however, they did not exhibit PSD when exposed to a neutron source. This project, while falling short of its ultimate goal, demonstrated the possible utility of single-component, undoped plastics as scintillators for applications that do not require PSD.

  15. Testing the radiation hardness of lead tungstate scintillating crystals

    CERN Document Server

    Shao, M; Li Chuan; Chen, H; Xu, Z Z; Wang, Z M

    2000-01-01

    Large Hadron Collider operation will produce a high radiation background. PbWO/sub 4/ crystals are selected as scintillators for the CMS electromagnetic calorimeter. To reach the precise requirement for energy measurements, a strict requirement for the radiation hardness is needed. In this paper, we present a method for evaluating the radiation hardness and its measurement. Results for several full size (23 cm length) lead tungstate crystals under Co/sup 60/ gamma - ray irradiation are given, investigating the light yield loss and its longitudinal uniformity. (8 refs).

  16. Quality inspection of anisotropic scintillating lead tungstate (PbWO4) crystals through measurement of interferometric fringe pattern parameters

    International Nuclear Information System (INIS)

    Cocozzella, N.; Lebeau, M.; Majni, G.; Paone, N.; Rinaldi, D.

    2001-01-01

    Scintillating crystals are widely used as detectors in radiographic systems, computerized axial tomography devices and in calorimeters employed in high-energy physics. This paper results from a project motivated by the development of the CMS calorimeter at CERN, which will make use of a large number of scintillating crystals. In order to prevent crystals from breaking because of internal residual stress, a quality control system based on optic inspection of interference fringe patterns was developed. The principle of measurement procedures was theoretically modelled, and then a dedicated polariscope was designed and built, in order to observe the crystals under induced stresses or to evaluate the residual internal stresses. The results are innovative and open a new perspective for scintillating crystals quality control: the photoelastic constant normal to the optic axis of the lead tungstate crystals (PbWO 4 ) was measured, and the inspection procedure developed is applicable to mass production, not only to optimize the crystal processing, but also to establish a quality inspection procedure

  17. Quality inspection of anisotropic scintillating lead tungstate (PbWO 4) crystals through measurement of interferometric fringe pattern parameters

    Science.gov (United States)

    Cocozzella, N.; Lebeau, M.; Majni, G.; Paone, N.; Rinaldi, D.

    2001-08-01

    Scintillating crystals are widely used as detectors in radiographic systems, computerized axial tomography devices and in calorimeters employed in high-energy physics. This paper results from a project motivated by the development of the CMS calorimeter at CERN, which will make use of a large number of scintillating crystals. In order to prevent crystals from breaking because of internal residual stress, a quality control system based on optic inspection of interference fringe patterns was developed. The principle of measurement procedures was theoretically modelled, and then a dedicated polariscope was designed and built, in order to observe the crystals under induced stresses or to evaluate the residual internal stresses. The results are innovative and open a new perspective for scintillating crystals quality control: the photoelastic constant normal to the optic axis of the lead tungstate crystals (PbWO 4) was measured, and the inspection procedure developed is applicable to mass production, not only to optimize the crystal processing, but also to establish a quality inspection procedure.

  18. Scintillation of lead tungstate crystal studied with single-electron beam from KUFEL

    Energy Technology Data Exchange (ETDEWEB)

    Rizwan, Mohamad, E-mail: rizwan@nucl.kyushu-u.ac.jp; Uozumi, Yusuke; Matsuo, Kazuki [Department of Applied Quantum Physics and Nuclear Engineering, Kyushu University, Fukuoka (Japan); Ohgaki, Hideaki; Kii, Toshiteru; Zen, Heishun [Institute of Advanced Energy, Kyoto University, Gokasho, Uji, Kyoto (Japan); Tsamalaidze, Zviadi; Evtoukhovitch, Petr; Valentin, Samoilov [Joint Institute for Nuclear Research, JINR, Joliot-Curie Str.6, Dubna (Russian Federation)

    2015-04-29

    Lead tungstate (PWO) crystal has a very fast response, high atomic density and high radiation hardness. Therefore, they are suitable to be used for high-energy nuclear data measurements under high-background circumstances. Although a good electron-ion separation with a pulse shape analysis technique is essential, scintillation pulse shapes have not been observed with electron beams of a wide energy range. A single-electron beam technique has been developed at Kyoto University Free Electron Laser (KUFEL), and electron beams of 4-38 MeV are available. During the experiments, single electron beams bombarded a PWO crystal. By using oscilloscope we observed scintillation pulses of a PWO crystal coupled with a photomultiplier tube. Measured spectra were compared with the simulation code of EGS5 to analyze scattering effects. As the result, the pulse amplitudes show good linearity and the pulse shapes are almost constant in the observed energy range.

  19. Optimization of detection system based on inorganic scintillation crystal coupled with a long lightguide

    CERN Document Server

    Globus, M; Ratner, M

    2002-01-01

    Operation characteristics of a scintillation crystal, linked with the photomultiplier by a long transparent lightguide, are considered (such detection systems are used for monitoring the seawater pollution, scintillation measurements in magnetic field, etc.). This system is optimized with respect to the refractive index of the liquid, coupling the crystal with the lightguide, and the roughness degree of the crystal surface. It is shown that the energy resolution of the system can be significantly improved by using the coupling liquid with a refractive index somewhat less than that of the lightguide (a difference of about 0.2 is optimal). Light output and especially energy resolution becomes better with an increase of the roughness degree of the reflecting surface.

  20. The development of a single-crystal fiber-array scintillator area detector

    International Nuclear Information System (INIS)

    Loong, Chun; Vitt, Richard; Sayir, Ali; Sayir, Haluk

    2001-01-01

    The scientific output of a neutron instrument is directly proportional to the effectiveness of its detector system-coverage of scattering area, pixel resolution, counting efficiency, signal-to-noise ratio, life time and cost. The current neutron scintillator detectors employ mainly 6 Li-doped glass and ZnS, both of which present well-know limitations such as low light output, high gamma sensitivity in the case of 6 Li-glass and optical opacity in the case of ZnS. We aim to develop a position-sensitive, flight-time differentiable, efficient and cost-effective neutron detector system based on single-crystal scintillator fiber-arrays. The laser-heated melt modulation fiber growth technology developed at NASA provides the means to grow high-purity single-crystal fibers or rods of variable diameters (200 μm to 5 mm) and essentially unlimited length. Arrays of such fibers can be tailored to meet the requirements of pixel size, geometric configuration, and coverage area for a detector system. We report a plan in the growth and characterization of scintillators based on lithium silicates and boron aluminates using Ce as activator. (author)

  1. Isomerization Intermediates In Solution Phase Photochemistry Of Stilbenes

    Science.gov (United States)

    Doany, F. E.; Hochstrasser, R. M.; Greene, B. I.

    1985-04-01

    Picosecond and subpicosecond spectroscopic studies have revealed evidence for an isomerization intermediate between cis and trans in the photoinduced isomerism of both stilbene and biindanyledene ("stiff" stilbene). In stiff stilbene, a transient absorption at 351 nm displays time evolution and viscosity dependence consistent with absorption by a twisted intermediate ("phantom" state) with a lOps lifetime. An analagous bottleneck state with a life-time of 4ps is also consistent with the ground state recovery dynamics of t-stilbene following excitation of c-stilbene when monitored with 0.1ps resolution.

  2. Optimization of the scintillation parameters of the lead tungstate crystals for their application in high precision electromagnetic calorimetry; Optimisation des parametres de scintillation des cristaux de tungstate de plomb pour leur application dans la calorimetrie electromagnetique de haute precision

    Energy Technology Data Exchange (ETDEWEB)

    Drobychev, G

    2000-04-12

    In the frame of this dissertation work scintillation properties of the lead tungstate crystals (PWO) and possibilities of their use were studied foreseeing their application for electromagnetic calorimetry in extreme radiation environment conditions of new colliders. The results of this work can be summarized in the following way. 1. A model of the scintillations origin in the lead tungstate crystals which includes processes influencing on the crystals radiation hardness and presence of slow components in scintillations was developed. 2. An analysis of the influences of the PWO scintillation properties changes on the parameters of the electromagnetic calorimeter was done. 3. Methods of the light collection from the large scintillation elements of complex shape made of the birefringent scintillation crystal with high refraction index and low light yield in case of signal registration by a photodetector with sensitive surface small in compare with the output face of scintillator were Studied. 4. Physical principles of the methodology of the scintillation crystals certification during their mass production foreseeing their installation into a calorimeter electromagnetic were developed. Correlations between the results of measurements of the PWO crystals parameters by different methods were found. (author)

  3. On the ionization scintillation calorimeter based on KMgF3 crystal

    International Nuclear Information System (INIS)

    Buzulutskov, A.F.

    1990-01-01

    The development of the ionization scintillation calorimeter, using KMgF 3 crystals and high efficiency photocathodes, is proposed. Some characteristics of such calorimeter are compared with those of the high pressure gas one. 6 refs.; 2 figs.; 2 tabs

  4. arXiv Strong reduction of the effective radiation length in an oriented PWO scintillator crystal

    CERN Document Server

    Bandiera, L.; Romagnoni, M.; Argiolas, N.; Bagli, E.; Ballerini, G.; Berra, A.; Brizzolani, C.; Camattari, R.; De Salvador, D.; Haurylavets, V.; Mascagna, V.; Mazzolari, A.; Prest, M.; Soldani, M.; Sytov, A.; Vallazza, E.

    We measured a considerable increase of the emitted radiation by 120 GeV/c electrons in an axially oriented lead tungstate scintillator crystal, if compared to the case in which the sample was not aligned with the beam direction. This enhancement resulted from the interaction of particles with the strong crystalline electromagnetic field. The data collected at the external lines of CERN SPS were critically compared to Monte Carlo simulations based on the Baier Katkov quasiclassical method, highlighting a reduction of the scintillator radiation length by a factor of five in case of beam alignment with the [001] crystal axes. The observed effect opens the way to the realization of compact electromagnetic calorimeters/detectors based on oriented scintillator crystals in which the amount of material can be strongly reduced with respect to the state of the art. These devices could have relevant applications in fixed-target experiments as well as in satellite-borne gamma-telescopes.

  5. Collection of scintillation light from small BGO crystals

    International Nuclear Information System (INIS)

    Cherry, S.R.; Shao, Y.; Tornai, M.P.; Siegel, S.; Ricci, A.R.; Phelps, M.E.

    1995-01-01

    The authors propose to develop a high resolution positron emission tomography (PET) detector designed for animal imaging. The detector consists of a 2-D array of small bismuth germanate (BGO) crystals coupled via optical fibers to a multi-channel photomultiplier tube (MC-PMT). Though this approach offers several advantages over the conventional BGO block design, it does require that a sufficient number of scintillation photons be transported from the crystal, down the fiber and into the PMT. In this study the authors use simulations and experimental data to determine how to maximize the signal reaching the PMT. This involves investigating factors such as crystal geometry, crystal surface treatment, the use of reflectors, choice of optical fiber, coupling of crystals to the optical fiber and optical fiber properties. Their results indicate that using 2 x 2 x 10 mm BGO crystals coupled to 30 cm of clad optical fiber, roughly 50 photoelectrons are produced at the PMT photocathode for a 511 keV interaction. This is sufficient to clearly visualize the photopeak and provide adequate timing resolution for PET. Based on these encouraging results, a prototype detector will now be constructed

  6. Gamma-ray detection with an UV-enhanced photodiode and scintillation crystals emitting at short wavelengths

    International Nuclear Information System (INIS)

    Johansen, G.A.

    1997-01-01

    A low-noise ion implanted photodiode with high spectral response in the deep blue/UV region has been tested as read-out device for scintillation crystals with matching emission spectra (YAP(Ce), GSO(Ce), BGO and CsI(Tl)). This gamma-ray detector concept is attractive in many industrial applications where compactness, reliability and ambient temperature operation are important. The results show that the amount of detected scintillation light energy falls rapidly off as the wavelength of the scintillation light decreases. It is concluded that the dynamic spectral response of the photodiode, due to increasing carrier collection times, is considerably less than the DC response at short wavelengths. The diode is not useful in pulse mode operation with scintillation crystals emitting at wavelengths below about 400 nm. For read-out of CsI(Tl) with 661.6 keV gamma-radiation, however, the photodiode concept shows better energy resolution (7.1%) than other detectors. (orig.)

  7. Growth and fabrication of large size sodium iodide crystal scintillator

    International Nuclear Information System (INIS)

    Sabharwal, S.C.; Karandikar, S.C.; Mirza, T.; Ghosh, B.; Deshpande, R.Y.

    1979-01-01

    The growth of 80 - 135 mm dia. Sodium iodide crystals activated with thallium is described in the present report. The growth is effected in a glazed porcelain crucible in a protective ambient of dry nitrogen. The technical details of the equipment developed have been fully described. The results of measurements on the rate of growth of crystal and the optimization of different growth parameters are reported. The dependence of various factors upon the performance characteristics of the scintillator detectors made using these crystals is also discussed. The energy resolution obtained for a typical detector of dimensions 76 mm dia x 76 mm ht. is 10 percent. (auth.)

  8. Crystal growth and scintillation properties of Pr-doped SrI2 single crystals

    Science.gov (United States)

    Yokota, Yuui; Ito, Tomoki; Yoshino, Masao; Yamaji, Akihiro; Ohashi, Yuji; Kurosawa, Shunsuke; Kamada, Kei; Yoshikawa, Akira

    2018-04-01

    Pr-doped SrI2 (Pr:SrI2) single crystals with various Pr concentrations were grown by the halide-micro-pulling-down (H-μ-PD) method, and the scintillation properties were investigated. Pr1%:SrI2 single crystal with high transparency could be grown by the H-μ-PD method while Pr2, 3 and 5%:SrI2 single crystals included some cracks and opaque parts. In the photoluminescence spectrum of the Pr1%:SrI2 single crystal, an emission peak originated from the Pr3+ ion was observed around 435 nm while the radioluminescence spectra showed an emission peak around 535 nm for the undoped SrI2 and Pr:SrI2 single crystals. Light yields of Pr1, 2, 3 and 5%:SrI2 single crystals under γ-ray irradiation were 7700, 8700, 7200 and 6700 photons/MeV, respectively. Decay times of Pr1 and 2%:SrI2 single crystals under γ-ray irradiation were 55.9 and 35.0 ns of the fast decay component, and 435 and 408 ns of the slow decay component, respectively.

  9. Crystal growth and scintillation properties of multi-component oxide single crystals: Ce:GGAG and Ce:La-GPS

    Energy Technology Data Exchange (ETDEWEB)

    Yoshikawa, A., E-mail: yoshikawa@imr.tohoku.ac.jp [Institute for Materials Research (IMR), Tohoku University, Sendai 980-8577 (Japan); New Industry Creation Hatchery Center (NICHe), Tohoku University, Sendai 980-8579 (Japan); C& A Corporation, 6-6-40 Aramaki Aza Aoba, Aoba-ku, Sendai 980-8579 (Japan); Kamada, K. [New Industry Creation Hatchery Center (NICHe), Tohoku University, Sendai 980-8579 (Japan); C& A Corporation, 6-6-40 Aramaki Aza Aoba, Aoba-ku, Sendai 980-8579 (Japan); Kurosawa, S. [Institute for Materials Research (IMR), Tohoku University, Sendai 980-8577 (Japan); New Industry Creation Hatchery Center (NICHe), Tohoku University, Sendai 980-8579 (Japan); Shoji, Y. [Institute for Materials Research (IMR), Tohoku University, Sendai 980-8577 (Japan); C& A Corporation, 6-6-40 Aramaki Aza Aoba, Aoba-ku, Sendai 980-8579 (Japan); Yokota, Y. [New Industry Creation Hatchery Center (NICHe), Tohoku University, Sendai 980-8579 (Japan); Chani, V.I. [Institute for Materials Research (IMR), Tohoku University, Sendai 980-8577 (Japan); Nikl, M. [Institute of Physics, AS CR, Cukrovarnická 10, 162 53 Prague (Czech Republic)

    2016-01-15

    Crystal growth by micro-pulling-down, Czochralski, and floating zone methods and scintillation properties of Ce:Gd{sub 3}(Ga,Al){sub 5}O{sub 12} (Ce:GGAG) multi-component oxide garnets, and Ce:Gd{sub 2}Si{sub 2}O{sub 7} (Ce:GPS) or Ce:(La,Gd){sub 2}Si{sub 2}O{sub 7} (Ce:La-GPS) pyro-silicates are reviewed. GGAG crystals demonstrated practically linear dependences of some of the parameters including lattice constant, emission wavelength, and band gap on Ga content. However, emission intensity, light yield and energy resolution showed maxima for intermediate compositions. GGAG crystals had the highest light yield of 56,000 photon/MeV for Ga content of 2.7 atoms per garnet formula unit. Similarly the light yield and energy resolution of La-GPS showed the highest values of 40,000 photon/MeV and 4.4%@662 keV, respectively, for La-GPS containing 10% of La. Moreover, La-GPS demonstrated stable scintillation performance up to 200 °C.

  10. Scintillation characteristics of Tm3+ in Ca3(BO3)2 crystals

    International Nuclear Information System (INIS)

    Fujimoto, Yutaka; Yanagida, Takayuki; Yokota, Yuui; Kawaguchi, Noriaki; Fukuda, Kentaro; Totsuka, Daisuke; Watanabe, Kenichi; Yamazaki, Atsushi; Yoshikawa, Akira

    2011-01-01

    Basic optical properties and radiation responses of undoped, Tm 3+ 1.0% and 2.0% activated Ca 3 (BO 3 ) 2 (CBO) crystalline scintillator prepared by the micro-pulling down (μ-PD) method are reported. Tm 3+ : CBO crystals showed three weak absorption bands around 190, 260 and 350 nm, owing to the Tm 3+ 4f–4f transition. Strong blue luminescence peaks at 360 and 460 nm which are ascribed to the 1 D 2 – 3 H 6 and 1 D 2 – 3 F 4 transitions of Tm 3+ respectively were observed under 241 Am 5.5 MeV α-ray excitation. The scintillation light yield of 2.0% Tm 3+ -doped CBO crystal was evaluated to be about 250 ph/n from the 252 Cf excited pulse height spectrum.

  11. Photon statistics in scintillation crystals

    Science.gov (United States)

    Bora, Vaibhav Joga Singh

    Scintillation based gamma-ray detectors are widely used in medical imaging, high-energy physics, astronomy and national security. Scintillation gamma-ray detectors are eld-tested, relatively inexpensive, and have good detection eciency. Semi-conductor detectors are gaining popularity because of their superior capability to resolve gamma-ray energies. However, they are relatively hard to manufacture and therefore, at this time, not available in as large formats and much more expensive than scintillation gamma-ray detectors. Scintillation gamma-ray detectors consist of: a scintillator, a material that emits optical (scintillation) photons when it interacts with ionization radiation, and an optical detector that detects the emitted scintillation photons and converts them into an electrical signal. Compared to semiconductor gamma-ray detectors, scintillation gamma-ray detectors have relatively poor capability to resolve gamma-ray energies. This is in large part attributed to the "statistical limit" on the number of scintillation photons. The origin of this statistical limit is the assumption that scintillation photons are either Poisson distributed or super-Poisson distributed. This statistical limit is often dened by the Fano factor. The Fano factor of an integer-valued random process is dened as the ratio of its variance to its mean. Therefore, a Poisson process has a Fano factor of one. The classical theory of light limits the Fano factor of the number of photons to a value greater than or equal to one (Poisson case). However, the quantum theory of light allows for Fano factors to be less than one. We used two methods to look at the correlations between two detectors looking at same scintillation pulse to estimate the Fano factor of the scintillation photons. The relationship between the Fano factor and the correlation between the integral of the two signals detected was analytically derived, and the Fano factor was estimated using the measurements for SrI2:Eu, YAP

  12. Neutron spectrometry with organic scintillation detector

    International Nuclear Information System (INIS)

    Butragueno Casado, J. L.

    1972-01-01

    This work describes a fast neutron spectrometer using a stilbene crystal as head detector with pulse shape discrimination (P.S.D.) to reject gamma background. Tre experimental procedure involves the P.S.D., the measurements to calibrate the spectrometer and the corrections for several factors, mainly the non-linear response of the stilbene. Results of the measurements with the reaction D 2 (d,n)He 3 , and with an Am-Be neutron source are presented. It is also presented the measurement of the spectrum of the fast reactor CCRAl-1. (Author) 17 refs

  13. Analysis of thermal treatment effects upon optico-luminescent and scintillation characteristics of oxide and chalcogenide crystals

    International Nuclear Information System (INIS)

    Ryzhikov, Vladimir D.; Grinyov, Boris V.; Pirogov, Evgeniy N.; Galkin, Sergey N.; Nagornaya, Lyudmila L.; Bondar, Vladimir G.; Babiychuk, Inna P.; Krivoshein, Vadim I.; Silin, Vitaliy I.; Lalayants, Alexandr I.; Voronkin, Evgeniy F.; Katrunov, Konstantin A.; Onishchenko, Gennadiy M.; Vostretsov, Yuriy Ya.; Malyi, Pavel Yu.; Lisetskaya, Elena K.; Lisetskii, Longin N.

    2005-01-01

    This work has been aimed at analyzing the effects of various thermal treatment factors upon optical-luminescent, scintillation and other functional characteristics of complex oxide and chalcogenide crystals. The crystals considered in this work are scintillators with intrinsic (PWO, CWO, BGO), activator (GSO:Ce) or complex-defect ZnSe(Te) type of luminescence. Important factors of thermal treatment are not only the temperature and its variation with time, but also the chemical composition of the annealing medium, its oxidation-reduction properties

  14. Scintillation properties of a La, Lu-admix gadolinium pyrosilicate crystal

    Energy Technology Data Exchange (ETDEWEB)

    Kurosawa, Shunsuke, E-mail: kurosawa@imr.tohoku.ac.jp [Institute for Materials Research (IMR), Tohoku University 2-1-1 Katahira, Aoba-ku, Sendai, Miyagi 980-8577 (Japan); New Industry Creation Hatchery Center (NICHe) 6-6-10 Aoba, Aramaki, Aoba-ku, Sendai, Miyagi 980-8579 (Japan); Shishido, Toetsu; Suzuki, Akira; Sugawara, Takamasa; Nomura, Akiko; Yubuta, Kunio [Institute for Materials Research (IMR), Tohoku University 2-1-1 Katahira, Aoba-ku, Sendai, Miyagi 980-8577 (Japan); Shoji, Yasuhiro [Institute for Materials Research (IMR), Tohoku University 2-1-1 Katahira, Aoba-ku, Sendai, Miyagi 980-8577 (Japan); C& A Corporation, 6-6-40 Aoba, Aramaki, Aoba-ku, Sendai, Miyagi 980-8577 (Japan); Yokota, Yuui [New Industry Creation Hatchery Center (NICHe) 6-6-10 Aoba, Aramaki, Aoba-ku, Sendai, Miyagi 980-8579 (Japan); Pejchal, Jan [New Industry Creation Hatchery Center (NICHe) 6-6-10 Aoba, Aramaki, Aoba-ku, Sendai, Miyagi 980-8579 (Japan); Institute of Physics, AS CR, Cukrovarnická 10, 162 53 Prague (Czech Republic); Ohashi, Yuji [Institute for Materials Research (IMR), Tohoku University 2-1-1 Katahira, Aoba-ku, Sendai, Miyagi 980-8577 (Japan); Kamada, Kei [New Industry Creation Hatchery Center (NICHe) 6-6-10 Aoba, Aramaki, Aoba-ku, Sendai, Miyagi 980-8579 (Japan); C& A Corporation, 6-6-40 Aoba, Aramaki, Aoba-ku, Sendai, Miyagi 980-8577 (Japan); Yoshikawa, Akira [Institute for Materials Research (IMR), Tohoku University 2-1-1 Katahira, Aoba-ku, Sendai, Miyagi 980-8577 (Japan); New Industry Creation Hatchery Center (NICHe) 6-6-10 Aoba, Aramaki, Aoba-ku, Sendai, Miyagi 980-8579 (Japan); C& A Corporation, 6-6-40 Aoba, Aramaki, Aoba-ku, Sendai, Miyagi 980-8577 (Japan)

    2015-06-01

    In order to obtain new scintillator with higher effective atomic number, a pyrosilicate crystal with a composition (Ce{sub 0.01}, Gd{sub 0.54}, La{sub 0.25}, Lu{sub 0.20}){sub 2}Si{sub 2}O{sub 7} (Ce:LaLu-GPS) was grown by the floating zone method. Emission wavelengths of this material were at 370 and 390 nm. Gamma-ray-excited pulse height and scintillation decay measurement showed that Ce:LaLu-GPS had a light output of 34,000±2000 photons/MeV, an FWHM energy resolution of 6.9±0.2%, and the decay time components of 59±1 ns (13%) and 570±20 ns (87%)

  15. Development of phonon and photon detectors for rare events searches using scintillating crystals

    Energy Technology Data Exchange (ETDEWEB)

    Ahrens, Felix; Enss, Christian; Fleischmann, Andreas; Gastaldo, Loredana; Hassel, Clemens; Hendricks, Sebastian; Kempf, Sebastian [Kirchhoff-Institut fuer Physik, Universit at Heidelberg (Germany); Kim, Yong-Hamb [Korea Research Institute of Standards and Science, Daejeon (Korea, Republic of); Loidl, Martin; Navick, Xavier-Francois; Rodrigues, Matias [Commissariat a l' energie atomique, Saclay (France)

    2016-07-01

    The use of scintillating crystals in cryogenic experiments searching for neutrinoless double beta decay and for direct interaction of dark matter particles allows for an efficient background reduction due to particle discrimination. We develop phonon and photon detectors based on metallic magnetic calorimeters (MMCs) to perform simultaneous measurements of heat and light generated by the interaction of a particle in a scintillating crystal. As designed we expect for the phonon sensor an energy resolution of ΔE{sub FWHM}<100 eV and a signal rise time τ<200 μs whereas for the photon detector we expect ΔE{sub FWHM}<5 eV and τ<50 μs. We discuss the design and the fabrication of these detectors and present recent results.

  16. Grooved windows for scintillation crystals and light pipes of high refractive index

    International Nuclear Information System (INIS)

    Swinehart, C.F.

    1975-01-01

    Scintillation crystals are disclosed which have improved resolution and pulse height. An improved crystal has shallow grooves or spot depressions cut in the window, usually an end surface. Typical grooves are about 1.5 mm wide and about .1 mm deep. The grooves may be either horizontal, generally parallel grooves in spaced apart relationship, or concentric rings in radially spaced apart relationship. A light pipe of high refractive index, such as a crystal of pure sodium iodide, may also be improved with shallow grooves or spot depressions cut in an end surface

  17. X-ray detection capability of a Cs2ZnCl4 single-crystal scintillator

    International Nuclear Information System (INIS)

    Yahaba, Natsuna; Koshimizu, Masanori; Sun, Yan; Asai, Keisuke; Yanagida, Takayuki; Fujimoto, Yutaka; Haruki, Rie; Nishikido, Fumihiko; Kishimoto, Shunji

    2014-01-01

    The X-ray detection capability of a scintillation detector equipped with a Cs 2 ZnCl 4 single crystal was evaluated. The scintillation decay kinetics can be expressed as the sum of two exponential decay components. The fast decay component had a decay time constant of 1.8 ns, and its relative intensity was 95%. The total light output was 630 photons/MeV, and a subnanosecond timing resolution of 0.66 ns was obtained. The detection efficiency of 67.4 keV X-rays was 80% for a detector equipped with a 2.2-mm-thick Cs 2 ZnCl 4 crystal. Thus, excellent timing resolution and high detection efficiency were achieved simultaneously. (author)

  18. Preparation and characterisation of radiation hard PbWO4 crystal scintillator

    International Nuclear Information System (INIS)

    Sabharwal, S.C.; Desai, D.G.; Sangeeta; Karandikar, S.C.; Chauhan, A.K.; Sangiri, A.K.; Keshwani, K.S.; Ahuja, M.N.

    1996-01-01

    The selective loss of one of the crystal constituents is found to be responsible for the yellowish coloration of PbWO 4 crystals. However, using the already pulled crystals as the starting charge for the subsequent growth, colorless crystals can be grown. The crystals exhibiting excellent transmission characteristics have been grown employing a low temperature gradient, a moderate rotation rate of 15 rpm and a pull speed of 1 mm/h. The colored crystals show some radiation damage on gamma irradiation, while the colorless ones remain unaffected even for irradiation doses as high as 10 Mrad. Both the types of crystals show the presence of weak thermoluminescence (TL) emission when high irradiation doses (similar 10 Mrad) are given. Only one TL glow peak is obtained in both the cases but the peak temperatures are different. The emission centers responsible for the TL emission are found to be the ones which give rise to the scintillation emission in the crystal. (orig.)

  19. Scintillators and other particle optical detectors

    International Nuclear Information System (INIS)

    Chipaux, R.

    2011-01-01

    The author reports and comments his researcher career in the field of particle optical detectors. He addresses the cases of organic scintillators (scintillating fibers, liquid scintillators), inorganic scintillators (crystals for electromagnetic calorimetry, crystals for solar neutrino spectroscopy), and Cherenkov Effect detectors. He also reports his works on Cd Te detectors and their modelling

  20. Nd-doped Lu3Al5O12 single-crystal scintillator for X-ray imaging

    International Nuclear Information System (INIS)

    Sugiyama, Makoto; Fujimoto, Yutaka; Yanagida, Takayuki; Totsuka, Daisuke; Chani, Valery; Yokota, Yuui; Yoshikawa, Akira

    2013-01-01

    The optical and scintillation properties of Nd-doped Lu 3 Al 5 O 12 (Nd:LuAG) crystals grown by the Czochralski (Cz) method were examined under X-ray excitation. Their applicability for X-ray imaging was also inspected. The radioluminescence spectrum induced by X-rays showed a broad host emission and sharp Nd 3+ 4f–4f emission peaks in the UV to visible wavelengths. The light output current of the Nd:LuAG was 85% of that of a standard CdWO 4 X-ray scintillator. The afterglow value measured 20 ms after X-ray irradiation was 1.5%. An X-ray radiographic image was successfully obtained using the Nd:LuAG scintillator coupled with the charge coupled device (CCD) photodetector. -- Highlights: ► The Nd:LuAG single crystal was produced to perform X-ray imaging test. ► The sample exhibited the 85% light output current of the standard CdWO 4 . ► The afterglow intensity of the sample was very high compared with the CdWO 4 . ► The X-ray radiographic image was obtained from the Nd:LuAG single crystal

  1. Optical and scintillating properties of Ce:Li(Y,Lu)F4 single crystals

    International Nuclear Information System (INIS)

    Yokota, Yuui; Kurosawa, Shunsuke; Chani, Valery; Kamada, Kei; Yoshikawa, Akira

    2014-01-01

    We have investigated the optical and scintillating properties of Lu co-doped Ce:LiYF 4 single crystals with various Lu content. In the transmittance and absorption spectra, the absorption peaks at 243 nm get systematically red shifted in contrast to the peaks at 197 and 200 nm which get blue shifted with the increase in Lu content. At the same time, emission peaks at 306 nm and 200 nm under 295 nm excitation also get red shifted. The decay time of Ce:Li(Y,Lu)F 4 crystals under 295 nm excitation is found to be faster than that of Ce:LiYF 4 and Ce:LiLuF 4 crystals. The alpha-peak positions in the pulse-height spectra and decay times of crystals under alpha-ray irradiation are found to vary with the Lu content. - Highlights: • Optical and scintillation properties of Ce:Li(Y 1-x Lu x )F 4 crystals were inspected. • Increase of Lu content resulted change of the position of four absorption peaks. • Admixing of Y and Lu decreased the light yield and increased the decay time. • The Ce:LiLuF 4 crystal indicated the largest light yield in the pulse-height spectra. • Li[(Y 0.8 Lu 0.2 ) 0.98 Ce 0.02 ]F 4 indicated larger light yield than Ce:LiYF 4 crystal

  2. Two new stilbene trimers from Cynodon dactylon.

    Science.gov (United States)

    Li, Bi-Jun; Liu, Yao; Gu, Ai-Tong; Zhang, Qing; Chen, Lei; Wang, Shu-Mei; Wang, Feng

    2017-11-01

    Many naturally occurring oligostilbenes have drawn considerable attention because of their intricate structures and diverse bioactivities. Two new stilbene trimers, cystibenetrimerol A (1) and cystibenetrimerol B (2) were isolated from the dried grass of Cynodon dactylon (L.) Pers. The planar structures and stereo configurations of them were elucidated by spectroscopic and spectrometric methods. The isolation and structures elucidation of two new stilbene trimers suggested the ordinary grass belonging to the family Poaceae may be a rich source of stilbene oligomers.

  3. Detector construction for a scintillation camera

    International Nuclear Information System (INIS)

    Ashe, J.B.

    1977-01-01

    An improved transducer construction for a scintillation camera in which a light conducting element is equipped with a layer of moisture impervious material is described. A scintillation crystal is thereafter positioned in optical communication with the moisture impervious layer and the remaining surfaces of the scintillation crystal are encompassed by a moisture shield. Affixing the moisture impervious layer to the light conducting element prior to attachment of the scintillation crystal reduces the requirement for mechanical strength in the moisture impervious layer and thereby allows a layer of reduced thickness to be utilized. Preferably, photodetectors are also positioned in optical communication with the light conducting element prior to positioning the scintillation crystal in contact with the impervious layer. 13 claims, 4 figures

  4. Scintillation properties of semiconducting {sup 6}LiInSe{sub 2} crystals to ionizing radiation

    Energy Technology Data Exchange (ETDEWEB)

    Wiggins, Brenden [Y-12 National Security Complex, Oak Ridge, TN (United States); Vanderbilt University, Nashville, TN (United States); Groza, Michael; Tupitsyn, Eugene [Fisk University, Nashville, TN (United States); Lukosi, Eric [University of Tennessee, Knoxville, TN (United States); Stassun, Keivan; Burger, Arnold [Vanderbilt University, Nashville, TN (United States); Fisk University, Nashville, TN (United States); Stowe, Ashley [Y-12 National Security Complex, Oak Ridge, TN (United States); Vanderbilt University, Nashville, TN (United States); University of Tennessee, Knoxville, TN (United States)

    2015-11-21

    {sup 6}LiInSe{sub 2} has gained attention recently as a semiconducting thermal neutron detector. As presented herein, the chalcogenide compound semiconductor also detects incident neutrons via scintillation, making {sup 6}LiInSe{sub 2} the only lithium containing semiconductor to respond to neutrons via both detection mechanisms. Both yellow and red crystals, which appear in the literature, were investigated. Only the yellow crystal responded favorably to ionizing radiation, similar to the semiconducting operation utilizing electrodes. The obtained light yield for yellow crystals is 4400 photons/MeV, referenced to Bi{sub 4}Ge{sub 3}O{sub 12} (BGO).The estimated thermal neutron light yield was 21,000 photons/thermal neutron. The two measured decay time components were found to be 31±1 ns (49%) and 143±9 ns (51%).This crystal provides efficient, robust detection of neutrons via scintillation with respectable light yield and rapid response, enabling its use for a broad array of neutron detection applications.

  5. Scintillation properties of μPD-grown Y{sub 4}Al{sub 2}O{sub 9}:Pr (YAM:Pr) crystals

    Energy Technology Data Exchange (ETDEWEB)

    Drozdowski, Winicjusz, E-mail: wind@fizyka.umk.pl [Institute of Physics, Faculty of Physics, Astronomy and Informatics, Nicolaus Copernicus University, Grudziadzka 5, 87-100 Torun (Poland); Brylew, Kamil [Institute of Physics, Faculty of Physics, Astronomy and Informatics, Nicolaus Copernicus University, Grudziadzka 5, 87-100 Torun (Poland); Malinowski, Michał [Institute of Microelectronics and Optoelectronics, Koszykowa 75, 00-662 Warsaw (Poland); Turczyński, Sebastian [Institute of Electronic Materials Technology, Wolczynska 133, 01-919 Warsaw (Poland)

    2015-05-25

    Highlights: • YAM:Pr crystals do scintillate and as such deserve further interest. • Fast d–f luminescence of Pr{sup 3+} ions appears in X-ray excited spectra. • Two components (24 and 790 ns) constitute scintillation time profiles. - Abstract: Y{sub 4}Al{sub 2}O{sub 9}:Pr (YAM:Pr) crystals have been grown by the micro-pulling-down method and their scintillation properties have been investigated. YAM:0.1%Pr displays a light yield of about 2000 ph/MeV and its scintillation time profile contains a prompt component with a decay time of 23.5 ns and a contribution of 20%. Radioluminescence spectra show both fast d–f and slow f–f praseodymium emissions. Low temperature glow curves are complex, consisting of discrete peaks and broad bands related to quasi-continuous trap distributions. Overall scintillation performance of YAM:Pr deteriorates with increasing praseodymium concentration.

  6. Scintillation and optical properties of Ce{sup 3+}-doped CaGdAl{sub 3}O{sub 7} single crystals

    Energy Technology Data Exchange (ETDEWEB)

    Mori, Masaki, E-mail: masaki.mori.mz4@ms.naist.jp [Graduate School of Materials Science, Nara Institute of Science and Technology (NAIST), 8916-5 Takayama-cho, Ikoma-shi, Nara 630-0192 (Japan); Nakauchi, Daisuke; Okada, Go [Graduate School of Materials Science, Nara Institute of Science and Technology (NAIST), 8916-5 Takayama-cho, Ikoma-shi, Nara 630-0192 (Japan); Fujimoto, Yutaka [Department of Applied Chemistry, Graduate School of Engineering, Tohoku University, 6-6-07 Aoba, Aramaki, Aoba-ku, Sendai, 980-8579 (Japan); Kawaguchi, Noriaki [Graduate School of Materials Science, Nara Institute of Science and Technology (NAIST), 8916-5 Takayama-cho, Ikoma-shi, Nara 630-0192 (Japan); Koshimizu, Masanori [Department of Applied Chemistry, Graduate School of Engineering, Tohoku University, 6-6-07 Aoba, Aramaki, Aoba-ku, Sendai, 980-8579 (Japan); Yanagida, Takayuki [Graduate School of Materials Science, Nara Institute of Science and Technology (NAIST), 8916-5 Takayama-cho, Ikoma-shi, Nara 630-0192 (Japan)

    2017-06-15

    The single crystals of 0, 0.6, 1, 1.6 and 2 mol% Ce doped CaGdAl{sub 3}O{sub 7} (Ce:CGAM) were grown by the Floating Zone method, and investigated on photoluminescence (PL) and scintillation properties. In the PL spectra, a broad emission appeared over 380–500 nm under 280 and 360 nm excitations with the quantum yield of 33.8–38.8%. Under a vacuum ultraviolet excitation (90 nm) using a synchrotron source, non-doped CGAM single crystal showed broad emissions over 250–650 nm. The PL decay time profiles followed a monotonic exponential decay with a decay time constant of around 33 ns. The scintillation spectra were similar to those of PL. All of the samples exhibited a clear photoabsorption peak and Compton edge in the pulse height spectra measured under {sup 137}Cs γ-ray irradiation, and the absolute scintillation light yield (LY) was highest for the 2% Ce-doped sample with the value of 3300±300 ph/MeV. The scintillation decay profiles were approximated by a third order exponential decay function, and the extracted decay time of Ce{sup 3+} emission component was around 36–44 ns. Among all the samples, 2%Ce:CGAM single crystal sample showed the best afterglow level as a scintillator under X-ray irradiation. - Highlights: •Ce{sup 3+}-doped CaGdAl{sub 3}O{sub 7} single crystals were synthesized by the FZ method. •Optical and scintillation properties of Ce{sup 3+}-doped CaGdAl{sub 3}O{sub 7} were investigated. •Photoabsorption peak in a pulse height spectrum was clearly observed under γ-rays.

  7. Scintillating crystals: the best things come in small packages

    CERN Multimedia

    Anaïs Schaeffer

    2011-01-01

    The European project ENDO TOFPET-US, which involves a team from the PH Department, was officially launched last month. Its main objective is to design a high-performance medical imaging device for use in pancreatic cancer research. 13 partners (including three hospitals and three companies) are involved in the initiative, which has obtained funding of 5.5 million euros from the European Union's FP7 programme and will last for four years.   CERN researchers participating in the ENDO TOFPET-US project. The scintillating crystals developed at CERN have a wide variety of applications, ranging from the LHC to use in hospitals. Now experts in the field, members of the PH Department are currently working on the development of a new type of crystal in the framework of the European project ENDO TOFPET-US. These new-generation crystals, which will be used in endoscopic probes for studying the biological processes associated with pancreatic cancer, are among the finest grown for medical imaging in the world...

  8. Influence of Mo impurity on the spectroscopic and scintillation properties of PbWO4 crystals

    International Nuclear Information System (INIS)

    Boehm, M.; Hofstaetter, A.; Luh, M.; Meyer, B.K.; Scharmann, A.; Drobychev, G.Yu.; Grenoble-1 Univ., 74 - Annecy; Peigneux, J.P.

    1997-12-01

    The influence of molybdenum doping on the spectroscopic and scintillation properties of lead tungstate crystals has been investigated. From the results the slow scintillation component as well as the afterglow are found to be due to the Mo impurity. In addition the blue luminescence from excited (WO 4 ) 2- -complex seems to be increasingly suppressed as the doping concentration goes on. Possible mechanisms for the effects have been discussed. (author)

  9. Optimization of decay kinetics of YAG:Ce single crystal scintillators for S(T)EM electron detectors

    Czech Academy of Sciences Publication Activity Database

    Schauer, Petr

    2011-01-01

    Roč. 269, č. 21 (2011), s. 2572-2577 ISSN 0168-583X R&D Projects: GA ČR GAP102/10/1410 Institutional research plan: CEZ:AV0Z20650511 Keywords : scintillation detector * electron microscope * cathodoluminescence * YAG:Ce single crystal scintillator * decay time * afterglow * kinetic model * SEM * STEM Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering Impact factor: 1.211, year: 2011

  10. Photoisomerization of Stilbene: The Detailed XMCQDPT2 Treatment.

    Science.gov (United States)

    Ioffe, I N; Granovsky, A A

    2013-11-12

    We report the detailed XMCQDPT2/cc-pVTZ study of trans-cis photoisomerization in one of the core systems of both experimental and computational photochemistry-the stilbene molecule. For the first time, the potential energy surface (PES) of the S1 state has been directly optimized and scanned using a multistate multiconfiguration second-order perturbation theory. We characterize the trans-stilbene, pyramidalized (phantom), and DHP-cis-stilbene geometric domains of the S1 state and describe their stationary points including the transition states between them, as well as S1/S0 intersections. Also reported are the minima and the activation barriers in the ground state. Our calculations correctly predict the kinetic isotope effect due to H/D exchange at ethylenic hydrogens, the dynamic behavior of excited cis-stilbene, and trans-cis branching ratio after relaxation to S0 through a rather unsymmetric conical intersection. In general, the XMCQDPT2 results confirm the qualitative adequacy of the TDDFT (especially SF-TDDFT) picture of the excited stilbene but also reveal quantitative discrepancies that deserve further exploration.

  11. Growth and scintillation properties of 3 in. diameter Ce doped Gd.sub.3./sub.Ga.sub.3./sub.Al.sub.2./sub.O.sub.12./sub. scintillation single crystal

    Czech Academy of Sciences Publication Activity Database

    Kamada, K.; Shoji, Y.; Kochurikhin, V.V.; Okumura, S.; Yamamoto, S.; Nagura, A.; Yeom, J.Y.; Kurosawa, S.; Yokota, Y.; Ohashi, Y.; Nikl, Martin; Yoshikawa, A.

    2016-01-01

    Roč. 452, Oct (2016), s. 81-84 ISSN 0022-0248. [American Conference on Crystal Growth and Epitaxy /20./ (ACCGE) / 17th Biennial Workshop on Organometallic Vapor Phase Epitaxy (OMVPE) / 2nd 2D Electronic Materials Symposium. Big Sky, MT, 02.08.2015-07.08.2015] R&D Projects: GA MŠk(CZ) LH14266; GA ČR GJ15-18300Y EU Projects: European Commission(XE) 644260 - INTELUM Institutional support: RVO:68378271 Keywords : single crystal growth * oxides * scintillator materials * scintillators Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.751, year: 2016

  12. Crystal Growth and Scintillation Properties of Eu2+ doped Cs4CaI6 and Cs4SrI6

    Science.gov (United States)

    Stand, L.; Zhuravleva, M.; Chakoumakos, B.; Johnson, J.; Loyd, M.; Wu, Y.; Koschan, M.; Melcher, C. L.

    2018-03-01

    In this work we present the crystal growth and scintillation properties of two new ternarymetal halide scintillators activated with divalent europium, Cs4CaI6 and Cs4SrI6. Single crystals of each compound were grown in evacuated quartz ampoules via the vertical Bridgman technique using a two-zone transparent furnace. Single crystal X-ray diffraction experiments showed that both crystals have a trigonal (R-3c) structure, with a density of 3.99 g/cm3 and 4.03 g/cm3. The radioluminescence and photoluminescence measurements showed typical luminescence properties due to the 5d-4f radiative transitions in Eu2+. At this early stage of development Cs4SrI6:Eu and Cs4CaI6:Eu have shown very promising scintillation properties, with light yields and energy resolutions of 62,300 ph/MeV and 3.3%, and 51,800 photons/MeV and 3.6% at 662 keV, respectively.

  13. Scintillation characteristics of LiB3O5 and β-BaB2O4 single crystals

    International Nuclear Information System (INIS)

    Nazarenko, B.P.; Pedash, V.Yu.; Shekhovtsov, A.N.; Tarasov, V.A.; Zelenskaya, O.V.

    2006-01-01

    LiB 3 O 5 and β-BaB 2 O 4 single crystals have been grown by the top seeded solution growth technique. The optical characteristics and scintillation parameters of the grown single crystals have been tested and discussed

  14. LaBr3:Ce crystal: The latest advance for scintillation cameras

    International Nuclear Information System (INIS)

    Pani, R.; Pellegrini, R.; Cinti, M.N.; Bennati, P.; Betti, M.; Vittorini, F.; Mattioli, M.; Trotta, G.; Orsolini Cencelli, V.; Scafe, R.; Montani, L.; Navarria, F.; Bollini, D.; Baldazzi, G.; Moschini, G.; Rossi, P.; De Notaristefani, F.

    2007-01-01

    Recent availability of LaBr 3 :Ce crystal is attracting researchers for the development of new advanced SPECT e PET systems. The crystal shows excellent energy resolution values good radiation absorption properties and speed. At present, LaBr 3 :Ce crystal is available with continuous shape covering 5x5 cm 2 area with a thickness up to 1 in. With the aim of analysing the imaging performances of LaBr 3 :Ce for Single Photon Emission Tomography (SPET), we tested three continuous crystals with the same detection area of 5x5 cm 2 and various thicknesses ranging between 4 and 10 mm. Three small scintillation cameras were assembled by coupling LaBr3:Ce crystal to Hamamatsu H8500 Flat panel PMT. The results show very good imaging performances for single photon emission application with superior energy and spatial resolution up 7.5% and 0.9 mm, respectively, and a detection efficiency up to 95% at 140 keV photon energy

  15. Crystal growth and scintillation properties of Ce-doped sodium calcium lutetium complex fluoride

    Czech Academy of Sciences Publication Activity Database

    Wakahara, S.; Furuya, Y.; Yanagida, T.; Yokota, Y.; Pejchal, Jan; Sugiyama, M.; Kawaguchi, N.; Totsuka, D.; Yoshikawa, A.

    2012-01-01

    Roč. 34, č. 4 (2012), s. 729-732 ISSN 0925-3467 Institutional research plan: CEZ:AV0Z10100521 Keywords : scintillator * micro-pulling-down method * single crystal * gamma-ray stopping power Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.918, year: 2012

  16. Optical and scintillation properties of Sr7%:Ce15%:GdF.sub.3./sub. single crystal

    Czech Academy of Sciences Publication Activity Database

    Fukabori, A.; Kamada, K.; Yanagida, T.; Chani, V.; Aoki, K.; Yokota, Y.; Maeo, S.; Nikl, Martin; Yoshikawa, A.

    2011-01-01

    Roč. 318, č. 1 (2011), s. 1175-1178 ISSN 0022-0248. [International Conference on Crystal Growth (ICCG16) /16./ and International Conference on Vapor Growth and Epitaxy (ICVGE14) /14./. Beijing, 08.08.2010-13.08.2010] Institutional research plan: CEZ:AV0Z10100521 Keywords : radiation * inorganic compounds * scintillator materials * scintillators Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.726, year: 2011

  17. Scintillation and optical properties of Pb-doped YCa{sub 4}O(BO{sub 3}){sub 3} crystals

    Energy Technology Data Exchange (ETDEWEB)

    Fujimoto, Yutaka, E-mail: fuji-you@tagen.tohoku.ac.jp [IMRAM, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai 980-8577 (Japan); JSPS, 8 Ichibanmachi, Chiyoda-ku, Tokyo 102-8472 (Japan); Yanagida, Takayuki; Yokota, Yuui [IMRAM, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai 980-8577 (Japan); Kawaguchi, Noriaki [Tokuyama Corporation, 3 Shibuya Shibuya-ku, Tokyo 150-8383 (Japan); Fukuda, Kentaro [IMRAM, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai 980-8577 (Japan); Tokuyama Corporation, 3 Shibuya Shibuya-ku, Tokyo 150-8383 (Japan); Totsuka, Daisuke [Nihon Kessho Kogaku Co., Ltd., 810-5 Nobe-cho Tatebayashi Gunma (Japan); Watanabe, Kenichi; Yamazaki, Atsushi [Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8603 (Japan); Chani, Valery [IMRAM, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai 980-8577 (Japan); Yoshikawa, Akira [IMRAM, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai 980-8577 (Japan); NICHe, Tohoku University, 6-6-10 Aoba, Aramaki, Aoba-ku, Sendai 980-8579 (Japan)

    2011-10-01

    This communication reports optical properties and radiation responses of Pb{sup 2+} 0.5 and 1.0 mol%-doped YCa{sub 4}O(BO{sub 3}){sub 3} (YCOB) single crystals grown by the micro-pulling-down ({mu}-PD) method for neutron scintillator applications. The crystals had no impurity phases according to the results of X-ray powder diffraction. These Pb{sup 2+}-doped crystals demonstrated blue-light luminescence at 330 nm because of Pb{sup 2+1}S{sub 0}-{sup 3}P{sub 0,1} transition in the photoluminescence spectra. The main emission decay component was determined to be about 250-260 ns under 260 nm excitation wavelength. When irradiated by a {sup 252}Cf source, the relative light yield of 0.5% Pb{sup 2+}-doped crystal was about 300 ph/n that was determined using the light yield of a reference Li-glass scintillator.

  18. Mesoporous stilbene-based lanthanide metal organic frameworks: synthesis, photoluminescence and radioluminescence characteristics.

    Science.gov (United States)

    Mathis Ii, Stephan R; Golafale, Saki T; Bacsa, John; Steiner, Alexander; Ingram, Conrad W; Doty, F Patrick; Auden, Elizabeth; Hattar, Khalid

    2017-01-03

    Ultra large pore isostructural metal organic frameworks (MOFs) which exhibit both photoluminescence and scintillation properties, were synthesized from trans-4,4'-stilbenedicarboxylic acid (H 2 L) and trivalent lanthanide (Ln) metal salts under solvothermal conditions (Ln = Er 3+ (1) and Tm 3+ (2)). This new class of mesoporous materials is a non-interpenetrating network that features ultra-large diamond shaped pores of dimensions with approximate cross-sectional dimensions of 28 Å × 12 Å. The fully deprotonated ligand, L, is isolated and rigidified as it serves as the organic linker component of the MOF structure. Its low density unit cells possess asymmetric units with two crystallographically independent Ln 3+ ions in seven coordinate arrangements. A distinct feature of the structure is the bis-bidentate carboxylate groups. They serve as a ligand that coordinates two Ln(iii) ions while each L connects four Ln(iii) ions yielding an exceptionally large diamond-shaped rectangular network. The structure exhibits ligand-based photoluminescence with increased lifetime compared to free stilbene molecules on exposure to UV radiation, and also exhibits strong scintillation characteristics, comprising of both prompt and delayed radioluminescence features, on exposure to ionizing radiation.

  19. Recent R&D trends in inorganic single crystal scintillator materials for radiation detection

    Czech Academy of Sciences Publication Activity Database

    Nikl, Martin; Yoshikawa, A.

    2015-01-01

    Roč. 3, č. 4 (2015), s. 463-481 ISSN 2195-1071 R&D Projects: GA MŠk(CZ) LH14266; GA ČR GAP204/12/0805 Institutional support: RVO:68378271 Keywords : scintillator * single crystal * luminescence Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 5.359, year: 2015

  20. Carborane-stilbene dyads: the influence of substituents and cluster isomers on photoluminescence properties.

    Science.gov (United States)

    Ferrer-Ugalde, A; Cabrera-González, J; Juárez-Pérez, E J; Teixidor, F; Pérez-Inestrosa, E; Montenegro, J M; Sillanpää, R; Haukka, M; Núñez, R

    2017-02-14

    Two novel styrene-containing meta-carborane derivatives substituted at the second carbon cluster atom (C c ) with either a methyl (Me) or a phenyl (Ph) group are introduced herein along with a new set of stilbene-containing ortho- (o-) and meta- (m-) carborane dyads. The latter set of compounds have been prepared from styrene-containing carborane derivatives via a Heck coupling reaction. High regioselectivity has been achieved for these compounds by using a combination of palladium complexes [Pd 2 (dba) 3 ]/[Pd(t-Bu 3 P) 2 ] as a catalytic system, yielding exclusively E isomers. All compounds have been fully characterised and the crystal structures of seven of them were analysed by X-ray diffraction. The absorption spectra of these compounds are similar to those of their respective fluorophore groups (styrene or stilbene), showing a very small influence of the substituent (Me or Ph) linked to the second C c atom or the cluster isomer (o- or m-). On the other hand, fluorescence spectroscopy revealed high emission intensities for Me-o-carborane derivatives, whereas their Ph-o-carborane analogues evidenced an almost total lack of fluorescence, confirming the significant role of the substituent bound to the adjacent C c in o-carboranes. In contrast, all the m-carborane derivatives display similar photoluminescence (PL) behavior regardless of the substituent attached to the second C c , demonstrating its small influence on emission properties. Additionally, m-carborane derivatives are significantly more fluorescent than their o-counterparts, reaching quantum yield values as high as 30.2%. Regarding solid state emission, only stilbene-containing Ph-o-carborane derivatives, which showed very low fluorescence in solution, exhibited notable PL emission in films attributed to aggregation-induced emission. DFT calculations were performed to successfully complement the photoluminescence studies, supporting the experimentally observed photophysical behavior of the styrene and

  1. Development of an application specific scintimammography detector based on a crystal scintillator array and a PSPMT

    CERN Document Server

    Majewski, S; Goode, A; Kross, B J; Steinbach, D; Weisenberger, A; Williams, M; Wojci, R

    1998-01-01

    We report the results of studies conducted with small field of view scintimammography camera based on a position-sensitive photomultiplier tube (5'' Hamamatsu R3292) and several pixelized crystal scintillator arrays made of YAP, CsI(Na) and NaI(Tl) scintillators. Laboratory tests and pre-clinical phantom studies were conducted to compare and optimize the performances of the prototypes with special emphasis on spatial resolution (approx 2-3mm) and sufficient energy resolution for scatter rejection.

  2. Calculated Absolute Detection Efficiencies of Cylindrical Nal (Tl) Scintillation Crystals for Aqueous Spherical Sources

    Energy Technology Data Exchange (ETDEWEB)

    Strindehag, O; Tollander, B

    1968-08-15

    Calculated values of the absolute total detection efficiencies of cylindrical scintillation crystals viewing spherical sources of various sizes are presented. The calculation is carried out for 2 x 2 inch and 3 x 3 inch Nal(Tl) crystals and for sources which have the radii 1/4, 1/2, 3/4 and 1 times the crystal radius. Source-detector distances of 5-20 cm and gamma energies in the range 0.1 - 5 MeV are considered. The correction factor for absorption in the sample container wall and in the detector housing is derived and calculated for a practical case.

  3. Linear energy transfer effects on time profiles of scintillation of Ce-doped LiCaAlF6 crystals

    International Nuclear Information System (INIS)

    Yanagida, Takayuki; Koshimizu, Masanori; Kurashima, Satoshi; Iwamatsu, Kazuhiro; Kimura, Atsushi; Taguchi, Mitsumasa; Fujimoto, Yutaka; Asai, Keisuke

    2015-01-01

    We measured temporal profiles of the scintillation of Ce-doped LiCaAlF 6 scintillator crystals at different linear energy transfers (LETs). Based on the comparison of high-LET temporal profiles with those at low LET, a fast component was observed only at low LET. The disappearance of the fast component at high LET is tentatively ascribed to the quenching of excited states at crystal defects owing to the interaction between excited states via the Auger process. In addition, the rise and the initial decay behavior were dependent on the LET. This LET-dependent behavior is explained by an acceleration process and a deceleration process in energy transfer at high LET. The LET-dependent temporal profiles provide the basis for a discrimination technique of gamma-ray and neutron detection events using these scintillators based on the nuclear reaction, 6 Li(n,α)t.

  4. Eu-activated fluorochlorozirconate glass-ceramic scintillators

    International Nuclear Information System (INIS)

    Johnson, J. A.; Schweizer, S.; Henke, B.; Chen, G.; Woodford, J.; Newman, P. J.; MacFarlane, D. R.

    2006-01-01

    Rare-earth-doped fluorochlorozirconate (FCZ) glass-ceramic materials have been developed as scintillators and their properties investigated as a function of dopant level. The paper presents the relative scintillation efficiency in comparison to single-crystal cadmium tungstate, the scintillation intensity as a function of x-ray intensity and x-ray energy, and the spatial resolution (modulation transfer function). Images obtained with the FCZ glass-ceramic scintillator and with cadmium tungstate are also presented. Comparison shows that the image quality obtained using the glass ceramic is close to that from cadmium tungstate. Therefore, the glass-ceramic scintillator could be used as an alternative material for image formation resulting from scintillation. Other inorganic scintillators such as single crystals or polycrystalline films have limitations in resolution or size, but the transparent glass-ceramic can be scaled to any shape or size with excellent resolution

  5. QUANTUM-MECHANICAL MODELING OF SPATIAL AND BAND STRUCTURE OF Y3AL5O12 SCINTILLATION CRYSTAL

    Directory of Open Access Journals (Sweden)

    I. I. Vrubel

    2016-05-01

    Full Text Available Spatial and electronic structures of a unit cell of yttrium-aluminum garnet have been studied. Quantum-mechanical model have been presented. Semi-empirical methods PM6 and PM7 have been used for geometry optimization of the crystal unit cell. Band structure has been calculated within density functional theory with the use of PBE exchange-correlation functional. Histograms of metal-oxygen distances for equilibrium geometry have been constructed. Comparison of the used methods has been carried out and recommendation about their applicability for such problems was given. The single-particle wave functions and energies have been calculated. The bandgap was estimated. The band structure was plotted. It was shown that the method gives reliable results for spatial and band structure of Y3Al5O12 scintillation crystal. The results of this work can be used for improvement of characteristics of garnet scintillation crystals.

  6. Shock-resistant scintillation detector

    International Nuclear Information System (INIS)

    Novak, W.P.

    1979-01-01

    A unique scintillation detector unit is disclosed which employs a special light transfer and reflector means that encases and protects the scintillator crystal against high g forces. The light transfer means comprises a flexible silicon rubber optical material bonded between the crystal and the optical window and having an axial thickness sufficient to allow the scintillator to move axially inside the container under high g forces without destroying the bonds. The reflector means comprises a soft elastic silicone rubber sleeve having a multiplicity of closely arranged tapered protrusions radiating toward and engaging the periphery of the scintillator crystal to cushion shocks effectively and having a reflective material, such as aluminum oxide powder, in the spaces between the protrusions. The reflector means provides improved shock absorption because of the uniform support and cushioning action of the protrusions and also provides the detector with high efficiency. The silicon rubber composition is specially compounded to include a large amount of aluminum oxide which enables the rubber to function effectively as a light reflector

  7. Effects of Na co-doping on optical and scintillation properties of Eu:LiCaAlF.sub.6./sub. scintillator single crystals

    Czech Academy of Sciences Publication Activity Database

    Tanaka, Ch.; Yokota, Y.; Kurosawa, S.; Yamaji, A.; Ohashi, Y.; Kamada, K.; Nikl, Martin; Yoshikawa, A.

    2017-01-01

    Roč. 468, Jun (2017), s. 399-402 ISSN 0022-0248 R&D Projects: GA MŠk(CZ) LH14266 Institutional support: RVO:68378271 Keywords : doping * single crystal growth * lithium compounds * scintillator materials Subject RIV: BM - Solid Matter Physics ; Magnetism OBOR OECD: Condensed matter physics (including formerly solid state physics, supercond.) Impact factor: 1.751, year: 2016

  8. Water deficit increases stilbene metabolism in Cabernet Sauvignon berries.

    Science.gov (United States)

    Deluc, Laurent G; Decendit, Alain; Papastamoulis, Yorgos; Mérillon, Jean-Michel; Cushman, John C; Cramer, Grant R

    2011-01-12

    The impact of water deficit on stilbene biosynthesis in wine grape (Vitis vinifera) berries was investigated. Water deficit increased the accumulation of trans-piceid (the glycosylated form of resveratrol) by 5-fold in Cabernet Sauvignon berries but not in Chardonnay. Similarly, water deficit significantly increased the transcript abundance of genes involved in the biosynthesis of stilbene precursors in Cabernet Sauvignon. Increased expression of stilbene synthase, but not that of resveratrol-O-glycosyltransferase, resulted in increased trans-piceid concentrations. In contrast, the transcript abundance of the same genes declined in Chardonnay in response to water deficit. Twelve single nucleotide polymorphisms (SNPs) were identified in the promoters of stilbene synthase genes of Cabernet Sauvignon, Chardonnay, and Pinot Noir. These polymorphisms resulted in eight changes within the predicted cis regulatory elements in Cabernet Sauvignon and Chardonnay. These results suggest that cultivar-specific molecular mechanisms might exist that control resveratrol biosynthesis in grapes.

  9. Multi element high resolution scintillator structure

    International Nuclear Information System (INIS)

    Cusano, D.A.

    1980-01-01

    A gamma camera scintillator structure, suitable for detecting high energy gamma photons which, in a single scintillator camera, would require a comparatively thick scintillator crystal, so resulting in unacceptable dispersion of light photons, comprises a collimator array of a high Z material with elongated, parallel wall channels with the scintillator material being disposed in one end of the channels so as to form an integrated collimator/scintillator structure. The collimator channel walls are preferably coated with light reflective material and further light reflective surfaces being translucent to gamma photons, may be provided in each channel. The scintillators may be single crystals or preferably comprise a phosphor dispersed in a thermosetting translucent matrix as disclosed in GB2012800A. The light detectors of the assembled camera may be photomultiplier tubes charge coupled devices or charge injection devices. (author)

  10. Fast neutron spectrometer with pulse shape discrimination

    International Nuclear Information System (INIS)

    Verbitsky, S.S.

    1978-01-01

    A fast neutron spectrometer with a stilbene single crystal designed to operate at high pulsed count rate has been described. Making use of identification and rejection of events, accompanied by pile-up, allowed to increase permissible count rates by an order of magnitude. The results of energy dependence of signal amplitude and shape relative anisotropy in stilbene in the range 4-10 and 2-8 MeV respectively have been presented. Taking into account anisotropy of the detector-scintillation properties allowed to improve particle discrimination. (Auth.)

  11. Precision machining and polishing of scintillating crystals for large calorimeters and hodoscopes

    International Nuclear Information System (INIS)

    Wuest, C.R.; Fuchs, B.A.; Holdener, F.R.; Heck, J.L. Jr.

    1994-04-01

    New machining and polishing techniques have been developed for large scintillating crystal arrays such as the Barium Fluoride Electromagnetic Calorimeter for the GEM Detector at SSCL, the Crystal Clear Collaboration's cerium fluoride or lead tungstenate calorimeter at the proposed LHC and CERN, the PHENIX Detector at RHIC (barium fluoride), and the cesium iodide Calorimeter for the BaBar Detector at PEP-2 B Factory at SLAC. The machining and polishing methods to be presented in this paper provide crystalline surfaces without sub-surface damage or deformation as verified by Rutherford Back-scattering (RBS) analysis. Surface roughness of about 10--20 angstroms and sub-micron mechanical tolerances have been demonstrated on large barium fluoride crystal samples. Mass production techniques have also been developed for machining the proper angled surfaces and polishing up to five 50 cm long crystals at one time. These techniques utilize kinematic mount technology developed at LLNL to allow precision machining and polishing of complex surfaces. They will present this technology along with detailed surface studies of barium fluoride and cerium fluoride crystals polished with this technique

  12. Linear energy transfer effects on time profiles of scintillation of Ce-doped LiCaAlF{sub 6} crystals

    Energy Technology Data Exchange (ETDEWEB)

    Yanagida, Takayuki [Graduate School of Materials Science, Nara Institute of Science and Technology, 8916-5 Takayama-Cho, Ikoma, Nara 630-0192 (Japan); Koshimizu, Masanori [Department of Applied Chemistry, Graduate School of Engineering, Tohoku University, 6-6-07 Aoba, Aramaki, Aoba-ku, Sendai 980-8579 (Japan); Kurashima, Satoshi [Takasaki Advanced Radiation Research Institute, Japan Atomic Energy Agency, 1233 Watanuki, Takasaki, Gunma 370-1292 (Japan); Iwamatsu, Kazuhiro [Graduate School of Engineering, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8656 (Japan); Kimura, Atsushi; Taguchi, Mitsumasa [Quantum Beam Science Directorate, Japan Atomic Energy Agency, 1233 Watanuki, Takasaki, Gunma 370-1292 (Japan); Fujimoto, Yutaka; Asai, Keisuke [Department of Applied Chemistry, Graduate School of Engineering, Tohoku University, 6-6-07 Aoba, Aramaki, Aoba-ku, Sendai 980-8579 (Japan)

    2015-12-15

    We measured temporal profiles of the scintillation of Ce-doped LiCaAlF{sub 6} scintillator crystals at different linear energy transfers (LETs). Based on the comparison of high-LET temporal profiles with those at low LET, a fast component was observed only at low LET. The disappearance of the fast component at high LET is tentatively ascribed to the quenching of excited states at crystal defects owing to the interaction between excited states via the Auger process. In addition, the rise and the initial decay behavior were dependent on the LET. This LET-dependent behavior is explained by an acceleration process and a deceleration process in energy transfer at high LET. The LET-dependent temporal profiles provide the basis for a discrimination technique of gamma-ray and neutron detection events using these scintillators based on the nuclear reaction, {sup 6}Li(n,α)t.

  13. Growth and luminescent properties of Yb3+--doped oxide single crystals for scintillator application

    International Nuclear Information System (INIS)

    Yoshikawa, A.; Ogino, H.; Shim, J.B.; Nikl, M.; Solovieva, N.; Fukuda, T.

    2004-01-01

    Rod-shaped (Lu 1-x Yb x ) 3 Al 5 O 12 with x=0.05, 0.15, 0.30 and (Y 1-x Yb x )AlO 3 with x=0.05, 0.10, 0.30 single crystals were grown by the micro-pulling-down method. Edge-defined film-fed growth method was used to prepare (Y 0.9 Yb 0.1 )VO 4 crystal, while Ca 8 (La 1.98 Yb 0.02 )(PO 4 ) 6 O 2 crystal was grown by the Czochralski method. Luminescence of these crystals was studied with main attention paid to the charge transfer emission of Yb 3+ . Temperature tuned decay times in the time scale of units--tens of nanosecond was measured as a feature possibly interesting for an application in scintillation detectors in positron emission tomography

  14. Monte Carlo and Lambertian light guide models of the light output from scintillation crystals at megavoltage energies

    International Nuclear Information System (INIS)

    Evans, Philip M.; Mosleh-Shirazi, M. Amin; Harris, Emma J.; Seco, Joao

    2006-01-01

    A new model of the light output from single-crystal scintillators in megavoltage energy x-ray beams has been developed, based on the concept of a Lambertian light guide model (LLG). This was evaluated in comparison with a Monte Carlo (MC) model of optical photon transport, previously developed and reported in the literature, which was used as a gold standard. The LLG model was developed to enable optimization of scintillator detector design. In both models the dose deposition and light propagation were decoupled, the scintillators were cuboids, split into a series of cells as a function of depth, with Lambertian side and entrance faces, and a specular exit face. The signal in a sensor placed 1 and 1000 mm beyond the exit face was calculated. Cesium iodide (CSI) crystals of 1.5 and 3 mm square cross section and 1, 5, and 10 mm depth were modeled. Both models were also used to determine detector signal and optical gain factor as a function of CsI scintillator thickness, from 2 to 10 mm. Results showed a variation in light output with position of dose deposition of a factor of up to approximately 5, for long, thin scintillators (such as 10x1.5x1.5 mm 3 ). For short, fat scintillators (such as 1x3x3 mm 3 ) the light output was more uniform with depth. MC and LLG generally agreed to within 5%. Results for a sensor distance of 1 mm showed an increase in light output the closer the light originates to the exit face, while a distance of 1000 mm showed a decrease in light output the closer the light originates to the exit face. For a sensor distance of 1 mm, the ratio of signal for a 10 mm scintillator to that for a 2 mm scintillator was 1.98, whereas for the 1000 mm distance the ratio was 3.00. The ratio of quantum efficiency (QE) between 10 and 2 mm thicknesses was 4.62. We conclude that these models may be used for detector optimization, with the light guide model suitable for parametric study

  15. Progress in the development of LuAlO3 based scintillators

    CERN Document Server

    Belsky, A; Lecoq, P; Dujardin, C; Garnier, N; Canibano, H; Pédrini, C; Petrosian, A

    2000-01-01

    LuAlO3:Ce3+ (LuAP) and LuxY1-xAlO3:Ce3+ (LuYAP) crystals are the promote scintillation materials for Positron Emission Tomography. Actual study of these scintillators develops in the tree directions: (i) growth of large size LuAP crystals with stable properties, (ii) relationship between composition of LuYAP crystals and scintillation properties, and (iii) scintillation mechanisms in lutetium compounds. After improving of growth conditions a large size samples (length greater than 40 mm) have been prepared. Crystals show a good correlation between growth parameters, light yield and transmission spectra. We performed a series of samples with calibrated size (2x2x10 mm3) and compare the light yield with a standard BGO and LSO samples. Mixed crystals with composition of 0.6 less than x less than 0.8 show a significant increase of light yield. We suggest that the short order clusterisation in mixed crystals may by playing an important role in governing the scintillation efficiency. In order to clarify the scintil...

  16. Design and simulation of a novel method for determining depth-of-interaction in a PET scintillation crystal array using a single-ended readout by a multi-anode PMT

    International Nuclear Information System (INIS)

    Ito, Mikiko; Sim, Kwang-Souk; Lee, Jae Sung; Park, Min-Jae; Hong, Seong Jong

    2010-01-01

    PET detectors with depth-of-interaction (DOI) encoding capability allow high spatial resolution and high sensitivity to be achieved simultaneously. To obtain DOI information from a mono-layer array of scintillation crystals using a single-ended readout, the authors devised a method based on light spreading within a crystal array and performed Monte Carlo simulations with individual scintillation photon tracking to prove the concept. A scintillation crystal array model was constructed using a grid method. Conventional grids are constructed using comb-shaped reflector strips with rectangular teeth to isolate scintillation crystals optically. However, the authors propose the use of triangularly shaped teeth, such that scintillation photons spread only in the x-direction in the upper halves of crystals and in the y-direction in lower halves. DOI positions can be estimated by considering the extent of two-dimensional light dispersion, which can be determined from the multiple anode outputs of a position-sensitive PMT placed under the crystal array. In the main simulation, a crystal block consisting of a 29 x 29 array of 1.5 mm x 1.5 mm x 20 mm crystals and a multi-anode PMT with 16 x 16 pixels were used. The effects of crystal size and non-uniform PMT output gain were also explored by simulation. The DOI resolution estimated for 1.5 x 1.5 x 20 mm 3 crystals was 2.16 mm on average. Although the flood map was depth dependent, each crystal was well identified at all depths when a corner of the crystal array was irradiated with 511 keV gamma rays (peak-to-valley ratio ∼9:1). DOI resolution was better than 3 mm up to a crystal length of 28 mm with a 1.5 x 1.5 mm 2 or 2.0 x 2.0 mm 2 crystal surface area. The devised light-sharing method allowed excellent DOI resolutions to be obtained without the use of dual-ended readout or multiple crystal arrays.

  17. Effects of packaging SrI{sub 2}(Eu) scintillator crystals

    Energy Technology Data Exchange (ETDEWEB)

    Sturm, Benjamin W., E-mail: sturm1@llnl.gov [Lawrence Livermore National Laboratory, Livermore, CA 94550 (United States); Cherepy, Nerine J.; Drury, Owen B.; Thelin, Peter A.; Fisher, Scott E.; Payne, Stephen A. [Lawrence Livermore National Laboratory, Livermore, CA 94550 (United States); Burger, Arnold [Fisk University, Nashville, TN 37201 (United States); Boatner, Lynn A.; Ramey, Joanne O. [Oak Ridge National Laboratory, Oak Ridge, TN 37830 (United States); Shah, Kanai S.; Hawrami, Rastgo [Radiation Monitoring Devices, Watertown, MA 02472 (United States)

    2011-10-01

    Recent renewed emphasis placed on gamma-ray detectors for national security purposes has motivated researchers to identify and develop new scintillator materials capable of high energy resolution and growable to large sizes. We have discovered that SrI{sub 2}(Eu) has many desirable properties for gamma-ray detection and spectroscopy, including high light yield of {approx}90,000 photons/MeV and excellent light yield proportionality. We have measured <2.7% FWHM at 662 keV with small detectors (<1 cm{sup 3}) in direct contact with a photomultiplier tube, and {approx}3% resolution at 662 keV is obtained for 1 in.{sup 3} crystals. Due to the hygroscopic nature of SrI{sub 2}(Eu), similar to NaI(Tl), proper packaging is required for field use. This work describes a systematic study performed to determine the key factors in the packaging process to optimize performance. These factors include proper polishing of the surface, the geometry of the crystal, reflector materials and windows. A technique based on use of a collimated {sup 137}Cs source was developed to examine light collection uniformity. Employing this technique, we found that when the crystal is packaged properly, the variation in the pulse height at 662 keV from events near the bottom of the crystal compared to those near the top of the crystal could be reduced to <1%. This paper describes the design and engineering of our detector package in order to improve energy resolution of 1 in.{sup 3}-scale SrI{sub 2}(Eu) crystals.

  18. Development of surgical gamma probes with TlBr semiconductors and CsI(Tl) scintillators crystals

    International Nuclear Information System (INIS)

    Costa, Fabio Eduardo da

    2006-01-01

    Radio guided surgery, using probes with radiation detectors, has been prominence in the medical area in the last decade. This technique consists in injecting a radioactive substance to concentrate in tumour and assist the localization during the surgical procedure. The radio guided surgeries allowing the identification of lymph node has revolutioned the behavior of tumour in initial stadium when are being spread by lymphatic way. The conditions imposed to the surgery due the proximity between some lymph nodes, demands of the probes, a small diameters and capacity of individual identification of these lymph nodes radiolabelled by a specific tracer. The international market supplies these probes with CdTe semiconductors and scintillators, but there is some time lack a promptly technical assistance in the Brazilian market. This work developed probes with national technology, using CsI(Tl) scintillators crystals and, in substitution to CdTe crystals semiconductors, the TlBr crystal, that is a new semiconductor detector in a world-wide development, with advantages in relation to the CdTe. Both crystals have been grown in IPEN. All the necessary electronics, specially, the preamplifier, that was also a restrictive factor for development of these types of probe in the country, have been developed with components found in the national market. Systematic measures of spatial resolution, spatial selectivity, maximum sensitivity and quality of the shielding have been carried the probes development. The results have shown that the probes, one with the CsI(Tl) crystal and another with TlBr semiconductor presented the requested performance in the international literature for radio guided probes. (author)

  19. Preharvest methyl jasmonate and postharvest UVC treatments: increasing stilbenes in wine.

    Science.gov (United States)

    Fernández-Marín, María Isabel; Puertas, Belén; Guerrero, Raúl F; García-Parrilla, María Carmen; Cantos-Villar, Emma

    2014-03-01

    Stilbene-enriched wine is considered to be an interesting new food product with added value due to its potential health-promoting properties. Stilbene concentration in grape is highly variable and rather scarce. However, it can be increased by stress treatments. For this reason, numerous pre- and postharvest grape treatments, and some combinations of them, have been tested to maximize stilbene content in grapes. In the present manuscript, Syrah grapes were treated with (i) methyl jasmonate (MEJA), (ii) ultraviolet light (UVC), and (iii) methyl jasmonate and ultraviolet light (MEJA-UVC) and compared with untreated grapes. Afterward, winemaking was developed. Wine achieved by combination of both treatments (MEJA-UVC) contained significantly higher stilbene concentration (trans-resveratrol and piceatannol) than its respective control (2.5-fold). Wine quality was improved in color-related parameters (color intensity, L*, a*, b*, ΔE*, anthocyanins, and tannin). Moreover, MEJA-UVC wines obtained the highest score in sensorial analysis. To the best of our knowledge, this is the first time that pre- and postharvest treatments are combined to increase stilbenes in wine. The effect of treatment combination (methyl jasmonate and UVC light) on grape and wine was evaluated. Our results highlight the positive effect of the treatments in stilbene content, color parameters, and sensorial analysis. Moreover, added-value by-products were achieved. © 2014 Institute of Food Technologists®

  20. Growth and scintillation properties of Ce{sup 3+}-doped (Y{sub 1-x}Gd{sub x})AlO{sub 3} crystals

    Energy Technology Data Exchange (ETDEWEB)

    Fujimoto, Yutaka; Wakahara, Shingo; Suzuki, Shotaro; Kurosawa, Shunsuke [Institute of Materials Research, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai, Miyagi 980-8577 (Japan); Yanagida, Takayuki [New Industry Creation Hatchery Center, Tohoku University, 6-6-10 Aramaki, Aoba-ku, Sendai 980-8579 (Japan); Yoshikawa, Akira [Institute of Materials Research, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai, Miyagi 980-8577 (Japan); New Industry Creation Hatchery Center, Tohoku University, 6-6-10 Aramaki, Aoba-ku, Sendai 980-8579 (Japan)

    2012-12-15

    The optical and scintillation properties of 0.5% fixed Ce-doped (Y{sub 1-x}Gd{sub x})AlO{sub 3} single crystals have been investigated at three different levels of Gd doping: x = 0.2, 0.4 and 0.6. Single crystal of the Ce{sup 3+}-doped (Y{sub 0.8}Gd{sub 0.2})AlO{sub 3}, (Y{sub 0.6}Gd{sub 0.4})AlO{sub 3} and (Y{sub 0.4}Gd{sub 0.6})AlO{sub 3} were successfully grown by {mu}-PD technique in nitrogen atmosphere. From X-ray diffraction analysis, no impurity phase was detected for the grown Ce-doped crystals. Ce-doped (Y{sub 0.6}Gd{sub 0.4})AlO{sub 3} crystal demonstrated highest fluorescence quantum efficiency ({proportional_to} 25%) with improvement of excitation efficiency due to the Gd-doping. When irradiated by the alpha-rays from a {sup 241}Am source, all the Ce-doped crystals showed luminescence band that corresponding to 5d (t{sub 2g})-4f transition of Ce{sup 3+}. The scintillation decay time was characterized by two components; the fast component (5-15 ns) is ascribed to 5d-4f transition of Ce{sup 3+}, while the slow one (100-200 ns) may be related to energy transfer between Ce{sup 3+} and Gd{sup 3+} ion. According to the result of {sup 137}Cs gamma-ray irradiated pulse height spectra compared with BGO scintillator, the relative scintillation light output was found to be about 12200 {+-} 1220 (Gd 20%) and 16000 {+-} 1600 (Gd 40%) ph/MeV. (copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  1. Estimation of Fano factor in inorganic scintillators

    Energy Technology Data Exchange (ETDEWEB)

    Bora, Vaibhav, E-mail: bora.vaibhav@gmail.com [Center for Gamma-Ray Imaging, Department of Medical Imaging, University of Arizona and College of Optical Sciences, University of Arizona, Tucson, AZ 85724 (United States); Barrett, Harrison H., E-mail: barrett@radiology.arizona.edu [Center for Gamma-Ray Imaging, Department of Medical Imaging, University of Arizona and College of Optical Sciences, University of Arizona, Tucson, AZ 85724 (United States); Fastje, David, E-mail: dfastje@gmail.com [Center for Gamma-Ray Imaging, Department of Medical Imaging, University of Arizona and College of Optical Sciences, University of Arizona, Tucson, AZ 85724 (United States); Clarkson, Eric, E-mail: clarkson@radiology.arizona.edu [Center for Gamma-Ray Imaging, Department of Medical Imaging, University of Arizona and College of Optical Sciences, University of Arizona, Tucson, AZ 85724 (United States); Furenlid, Lars, E-mail: furen@radiology.arizona.edu [Center for Gamma-Ray Imaging, Department of Medical Imaging, University of Arizona and College of Optical Sciences, University of Arizona, Tucson, AZ 85724 (United States); Bousselham, Abdelkader, E-mail: abousselham@qf.org.qa [Qatar Foundation, QEERI, P.O. Box 5825, Doha (Qatar); Shah, Kanai S., E-mail: kanaishah@yahoo.com [Radiation Monitoring Devices, Inc., Watertown, MA 02472 (United States); Glodo, Jarek, E-mail: jglodo@rmdinc.com [Radiation Monitoring Devices, Inc., Watertown, MA 02472 (United States)

    2016-01-01

    The Fano factor of an integer-valued random variable is defined as the ratio of its variance to its mean. Correlation between the outputs of two photomultiplier tubes on opposite faces of a scintillation crystal was used to estimate the Fano factor of photoelectrons and scintillation photons. Correlations between the integrals of the detector outputs were used to estimate the photoelectron and photon Fano factor for YAP:Ce, SrI{sub 2}:Eu and CsI:Na scintillator crystals. At 662 keV, SrI{sub 2}:Eu was found to be sub-Poisson, while CsI:Na and YAP:Ce were found to be super-Poisson. An experiment setup inspired from the Hanbury Brown and Twiss experiment was used to measure the correlations as a function of time between the outputs of two photomultiplier tubes looking at the same scintillation event. A model of the scintillation and the detection processes was used to generate simulated detector outputs as a function of time for different values of Fano factor. The simulated outputs from the model for different Fano factors was compared to the experimentally measured detector outputs to estimate the Fano factor of the scintillation photons for YAP:Ce, LaBr{sub 3}:Ce scintillator crystals. At 662 keV, LaBr{sub 3}:Ce was found to be sub-Poisson, while YAP:Ce was found to be close to Poisson.

  2. Study on the property of the avalanche photodiode as the readout component for scintillation crystals

    International Nuclear Information System (INIS)

    He Jingtang; Chen Duanbao; Zhu Guoyi; Mao Yufang; Dong Xiaoli; Li Zuhao

    1996-01-01

    The new avalanche photodiode (APD) and a CsI(Tl) crystal formed a scintillation detector. The energy spectrum of γ rays was measured by this detector. The measured results were compared with that measured by photomultiplier. Our plan is to use APD as PbWO 4 readout component for forward luminosity electromagnetic calorimeter at τ-C factory

  3. Progress in the development of LuAlO$_{3}$ based scintillators

    CERN Document Server

    Belsky, A; Lecoq, P; Dujardin, C; Garnier, N; Canibano, H; Pédrini, C; Petrosian, A

    2000-01-01

    LuAlO/sub 3/:Ce/sup 3+/ (LuAP) and Lu/sub x/Y/sub 1/-xAlO/sub 3/:Ce /sup 3+/ (LuYAP) crystals are used as scintillation materials for positron emission tomography. The actual study of these scintillators develops in three directions: (i) growth of large size LuAP crystals with stable properties, (ii) the relationship between the composition of LuYAP crystals and scintillation properties, and (iii) scintillation mechanisms in lutetium compounds. After improving of growth conditions a large size samples (length >40 mm) have been prepared. Crystals show a good correlation between growth parameters, light yield and transmission spectra. We studied a series of samples with calibrated size (2*2*10 mm3) and compare the light yield with standard BGO and LSO samples. Mixed crystals with composition of 0.6crystals may play an important role in governing the scintillation efficiency. In order to clarify the s...

  4. Cerium-doped single crystal and transparent ceramic lutetium aluminum garnet scintillators

    International Nuclear Information System (INIS)

    Cherepy, Nerine J.; Kuntz, Joshua D.; Tillotson, Thomas M.; Speaks, Derrick T.; Payne, Stephen A.; Chai, B.H.T.; Porter-Chapman, Yetta; Derenzo, Stephen E.

    2007-01-01

    For rapid, unambiguous isotope identification, scintillator detectors providing high-resolution gamma ray spectra are required. We have fabricated Lutetium Aluminum Garnet (LuAG) using transparent ceramic processing, and report a 2-mm thick ceramic exhibiting 75% transmission and light yield comparable to single-crystal LuAG:Ce. The LuAG:Ce luminescence peaks at 550 nm, providing an excellent match for Silicon Photodiode readout. LuAG is dense (6.67 g/cm 3 ) and impervious to water, exhibits good proportionality and a fast decay (∼40 ns), and we measure light yields in excess of 20,000 photons/MeV

  5. Neutron spectrometry with organic scintillation detector; Espectrometria de nuetrones con cristales de centelleo organicos

    Energy Technology Data Exchange (ETDEWEB)

    Butragueno Casdo, J L

    1972-07-01

    This work describes a fast neutron spectrometer using a stilbene crystal as head detector with pulse shape discrimination (P.S.D.) to reject gamma background. Tre experimental procedure involves the P.S.D., the measurements to calibrate the spectrometer and the corrections for several factors, mainly the non-linear response of the stilbene. Results of the measurements with the reaction D{sup 2}(d,n)He{sup 3}, and with an Am-Be neutron source are presented. It is also presented the measurement of the spectrum of the fast reactor CCRAl-1. (Author) 17 refs.

  6. Development of scintillation materials for PET scanners

    CERN Document Server

    Korzhik, Mikhail; Annenkov, Alexander N; Borissevitch, Andrei; Dossovitski, Alexei; Missevitch, Oleg; Lecoq, Paul

    2007-01-01

    The growing demand on PET methodology for a variety of applications ranging from clinical use to fundamental studies triggers research and development of PET scanners providing better spatial resolution and sensitivity. These efforts are primarily focused on the development of advanced PET detector solutions and on the developments of new scintillation materials as well. However Lu containing scintillation materials introduced in the last century such as LSO, LYSO, LuAP, LuYAP crystals still remain the best PET species in spite of the recent developments of bright, fast but relatively low density lanthanum bromide scintillators. At the same time Lu based materials have several drawbacks which are high temperature of crystallization and relatively high cost compared to alkali-halide scintillation materials. Here we describe recent results in the development of new scintillation materials for PET application.

  7. Screening Analyses of Pinosylvin Stilbenes, Resin Acids and Lignans in Norwegian Conifers

    OpenAIRE

    Anne Fiksdahl; Karin Oyaas; Ingebjorg Leirset; Hanne Hovelstad

    2006-01-01

    The content and distribution of stilbenes and resin acids in Scots pine (Pinus sylvestris) and spruce (Picea abies), sampled in central Norway, have been examined. The contents of pinosylvin stilbenes in pine heartwood/living knots were 0.2-2/2-8 % (w/w). No stilbenes could be detected in spruce (Picea abies). The resin acid contents of pine sapwood/heartwood and knots were 1-4 and 5-10 % (w/w), respectively. Minor amounts of resin acids (

  8. The Use of Stilbene Scaffold in Medicinal Chemistry and Multi- Target Drug Design.

    Science.gov (United States)

    Giacomini, Elisa; Rupiani, Sebastiano; Guidotti, Laura; Recanatini, Maurizio; Roberti, Marinella

    2016-01-01

    The stilbene scaffold is a basic element for a number of biologically active natural and synthetic compounds, and it is considered as a privileged structure. Stilbenes exemplified by resveratrol, combretastatin A-4 and pterostilbene are of significant interest for drug research and development because of their potential in therapeutic and preventive application. Resveratrol, present in grapes and other food products, plays a role in the prevention of several human pathological processes and has been suggested as an anticancer agent. Moreover, recent evidence has revealed its potential effect on the aging process, diabetes and neurological dysfunction. Combretastatin A-4, from the bark of South African bush willow Combretum caffrum, also shows significant antitumor activity. Pterostilbene is closely related to resveratrol, sharing the same unique therapeutic potential as anti-inflammatory, antineoplastic and antioxidant agent. Therefore, research and development of stilbene-based medicinal chemistry have become rapidly evolving and increasingly active topics covering almost the whole range of therapeutic fields. In the present review, we provide an overview of the role of stilbenes in medicinal chemistry. In this context, we highlight the chemical methodologies adopted for the synthesis of stilbene derivatives, and outline the successful design of novel stilbene based hybrids in the field of cancer, Alzheimer's and other relevant diseases. This information may be useful in further design of stilbene-based molecules as new leads for the development of novel agents with clinical potential or as effective chemical probes to dissect biological processes.

  9. Scintillation and optical properties of Sn-doped Ga2O3 single crystals

    Science.gov (United States)

    Usui, Yuki; Nakauchi, Daisuke; Kawano, Naoki; Okada, Go; Kawaguchi, Noriaki; Yanagida, Takayuki

    2018-06-01

    Sn-doped Ga2O3 single crystals were synthesized by the Floating Zone (FZ) method. In photoluminescence (PL) under the excitation wavelength of 280 nm, we observed two types of luminescence: (1) defect luminescence due to recombination of the donor/acceptor pairs which appears at 430 nm and (2) the nsnp-ns2 transitions of Sn2+ which appear at 530 nm. The PL and scintillation decay time curves of the Sn-doped samples were approximated by a sum of exponential decay functions. The faster two components were ascribed to the defect luminescence, and the slowest component was owing to the nsnp-ns2 transitions. In the pulse height spectrum measurements under 241Am α-rays irradiation, all the Sn-doped Ga2O3 samples were confirmed to show a full energy absorption peak but the undoped one. Among the present samples, the 1% Sn-doped sample exhibited the highest scintillation light yield (1,500 ± 150 ph/5.5 MeV-α).

  10. A new technique for infrared scintillation measurements

    Energy Technology Data Exchange (ETDEWEB)

    Chiossi, F., E-mail: federico.chiossi@studenti.unipd.it [Dip. di Fisica e Astronomia and INFN, University of Padua, Via F. Marzolo 8, I-35131 Padova (Italy); Brylew, K. [Institute of Physics, Faculty of Physics, Astronomy and Informatics, Nicolaus Copernicus University, Grudziadzka 5, 87-100 Torun (Poland); Borghesani, A.F. [CNISM Unit and Dip. di Fisica e Astronomia, University of Padua, Via F. Marzolo 8, I-35131 Padova (Italy); Braggio, C.; Carugno, G. [Dip. di Fisica e Astronomia and INFN, University of Padua, Via F. Marzolo 8, I-35131 Padova (Italy); Drozdowski, W. [Institute of Physics, Faculty of Physics, Astronomy and Informatics, Nicolaus Copernicus University, Grudziadzka 5, 87-100 Torun (Poland); Guarise, M. [Dip. di Fisica e Astronomia and INFN, University of Padua, Via F. Marzolo 8, I-35131 Padova (Italy)

    2017-05-21

    We propose a new technique to measure the infrared scintillation light yield of rare earth doped crystals by comparing it to near UV–visible scintillation of a calibrated Pr:(Lu{sub 0.75}Y{sub 0.25}){sub 3}Al{sub 5}O{sub 12} sample. As an example, we apply this technique to provide the light yield in visible and infrared range up to 1700 nm of this crystal.

  11. A new technique for infrared scintillation measurements

    International Nuclear Information System (INIS)

    Chiossi, F.; Brylew, K.; Borghesani, A.F.; Braggio, C.; Carugno, G.; Drozdowski, W.; Guarise, M.

    2017-01-01

    We propose a new technique to measure the infrared scintillation light yield of rare earth doped crystals by comparing it to near UV–visible scintillation of a calibrated Pr:(Lu_0_._7_5Y_0_._2_5)_3Al_5O_1_2 sample. As an example, we apply this technique to provide the light yield in visible and infrared range up to 1700 nm of this crystal.

  12. Stilbene dimer radical cations in the radiolyses of stilbenes and 1,2,3,4-tetraphenylcyclobutanes

    International Nuclear Information System (INIS)

    Tojo, Sachiko; Morishima, Kazuhiro; Ishida, Akito; Majima, Tetsuro; Takamuku, Setsuo

    1995-01-01

    The reaction of the stilbene radical cation formed by pulse radiolysis or γ-radiolyses is explained based on neutralization as well as the formation of a π-type stilbene dimer radical cation (π-St 2 +· ), converting to the σ-type St 2 +· (σ-St 2 +· ). The r-1, c-2, t-3, t-4-tetraphenylcyclobutane radical cation generated in a rigid matrix at 77 K which converted to σ-St 2 +· upon warming. Both r-1, c-2, t-3, t-4- and r-1, t-2, c-3, t-4-tetraphenylcyclobutane radical cations underwent photochemical cycloreversion to π-St 2 +· upon irradiation at wavelengths longer than 390 nm at 77 K, and converted to σ-St 2 +· upon warming. It is suggested that π-St 2 +· has overlapping arrangements of π-electrons, while σ-St 2 +· has radical and cation centers on the 1- and 4-positions of the C 4 linkage. (author)

  13. Effect of Aspect Ratio on the Light Output of Scintillators

    CERN Document Server

    Pauwels, Kristof; Gundacker, S.; Knapitsch, A.; Lecoq, P.

    2012-01-01

    The influence of the geometry of the scintillators is presented in this paper. We focus on the effect of narrowing down the section of crystals that have a given length. The light output of a set of crystals with very similar scintillating properties but different geometries measured with several coupling/wrapping configurations is provided. We observe that crystals shaped in thin rods have a lower light output as compared to bulk or sliced crystals. The effect of unpolishing the crystal faces is also investigated, and it is shown that highest light outputs are not necessarily obtained with crystals having all faces polished. Simulation results based on a realistic model of the crystal that implements light scattering on the crystal edges are in agreement with the experimental data. Fine-tuning of this model would allow us to further explore the details of light propagation in scintillators and would be highly valuable to fast timing detection and highly granular detectors.

  14. Scintillation properties of polycrystalline LaxY1-xO3 ceramic

    Science.gov (United States)

    Sahi, Sunil; Chen, Wei; Kenarangui, Rasool

    2015-03-01

    Scintillators are the material that absorbs the high-energy photons and emits visible photons. Scintillators are commonly used in radiation detector for security, medical imaging, industrial applications and high energy physics research. Two main types of scintillators are inorganic single crystals and organic (plastic or liquid) scintillators. Inorganic single crystals are expensive and difficult to grow in desire shape and size. Also, some efficient inorganic scintillator such as NaI and CsI are not environmental friendly. But on the other hand, organic scintillators have low density and hence poor energy resolution which limits their use in gamma spectroscopy. Polycrystalline ceramic can be a cost effective alternative to expensive inorganic single crystal scintillators. Here we have fabricated La0.2Y1.8O3 ceramic scintillator and studied their luminescence and scintillation properties. Ceramic scintillators were fabricated by vacuum sintering of La0.2Y1.8O3 nanoparticles at temperature below the melting point. La0.2Y1.8O3 ceramic were characterized structurally using XRD and TEM. Photoluminescence and radioluminescence studies were done using UV and X-ray as an excitation source. We have used gamma isotopes with different energy to studies the scintillation properties of La0.2Y1.8O3 scintillator. Preliminary studies of La0.2Y1.8O3 scintillator shows promising result with energy resolution comparable to that of NaI and CsI.

  15. Compensation Methods for Non-uniform and Incomplete Data Sampling in High Resolution PET with Multiple Scintillation Crystal Layers

    International Nuclear Information System (INIS)

    Lee, Jae Sung; Kim, Soo Mee; Lee, Dong Soo; Hong, Jong Hong; Sim, Kwang Souk; Rhee, June Tak

    2008-01-01

    To establish the methods for sinogram formation and correction in order to appropriately apply the filtered backprojection (FBP) reconstruction algorithm to the data acquired using PET scanner with multiple scintillation crystal layers. Formation for raw PET data storage and conversion methods from listmode data to histogram and sinogram were optimized. To solve the various problems occurred while the raw histogram was converted into sinogram, optimal sampling strategy and sampling efficiency correction method were investigated. Gap compensation methods that is unique in this system were also investigated. All the sinogram data were reconstructed using 2D filtered backprojection algorithm and compared to estimate the improvements by the correction algorithms. Optimal radial sampling interval and number of angular samples in terms of the sampling theorem and sampling efficiency correction algorithm were pitch/2 and 120, respectively. By applying the sampling efficiency correction and gap compensation, artifacts and background noise on the reconstructed image could be reduced. Conversion method from the histogram to sinogram was investigated for the FBP reconstruction of data acquired using multiple scintillation crystal layers. This method will be useful for the fast 2D reconstruction of multiple crystal layer PET data

  16. Characterizations of Pr-doped Yb3Al5O12 single crystals for scintillator applications

    Science.gov (United States)

    Yoshida, Yasuki; Shinozaki, Kenji; Igashira, Takuya; Kawano, Naoki; Okada, Go; Kawaguchi, Noriaki; Yanagida, Takayuki

    2018-04-01

    Yb3Al5O12 (YbAG) single crystals doped with different concentrations of Pr were synthesized by the Floating Zone (FZ) method. Then, we evaluated their basic optical and scintillation properties. All the samples showed photoluminescence (PL) with two emission bands appeared approximately 300-500 nm and 550-600 nm due to the charge transfer luminescence of Yb3+ and intrinsic luminescence of the garnet structure, respectively. A PL decay profile of each sample was approximated by a sum of two exponential decay functions, and the obtained decay times were 1 ns and 3-4 ns. In the scintillation spectra, we observed emission peaks in the ranges from 300 to 400 nm and from 450 to 550 nm for all the samples. The origins of these emissions were attributed to charge transfer luminescence of Yb3+ and intrinsic luminescence of the garnet structure, respectively. The scintillation decay times became longer with increasing the Pr concentrations. Among the present samples, the 0.1% Pr-doped sample showed the lowest scintillation afterglow level. In addition, pulse height spectrum of 5.5 MeV α-rays was demonstrated using the Pr-doped YbAG, and we confirmed that all the samples showed a full energy deposited peak. Above all, the 0.1% Pr-doped sample showed the highest light yield with a value of 14 ph/MeV under α-rays excitation.

  17. Radiation Damage Mechanism in PbWO4 Crystal and Radiation Hardness Quality Control of PWO Scintillators for CMS

    CERN Document Server

    Baccaro, Stefania; Borgia, Bruno; Cavallari, Francesca; Cecilia, Angelica; Dafinei, Ioan; Diemoz, Marcella; Lecoq, Paul; Longo, Egidio; Montecchi, Marco; Organtini, Giovanni; Salvatori, S

    1997-01-01

    The optical damage induced by UV light in PbWO4 crystals is found to be similar to that induced by g radiation. Due to the peculiarities of optical absorption in PbWO4, the damage induced by UV light is a bulk process. This fact has important consequences for the approach to be adopted both for the use of the crystal as scintillator and for the qualification methods foreseen in the Regional Centres of the ECAL CMS Collaboration.

  18. Crystal growth and evaluation of scintillation properties of Eu and alkali-metal co-doped LiSrAlF{sub 6} single crystals for thermal neutron detector

    Energy Technology Data Exchange (ETDEWEB)

    Wakahara, Shingo; Yokota, Yuui; Yamaji, Akihiro; Fujimoto, Yutaka; Sugiyama, Makoto; Kurosawa, Shunsuke [Institute for Materials Research, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai, Miyagi 980-8577 (Japan); Yanagida, Takayuki [New Industry Creation Hatchery Center (NICHe), 6-6-10 Aoba, Aramaki, Aoba-ku, Sendai, Miyagi 980-8579 (Japan); Pejchal, Jan [Institute for Materials Research, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai, Miyagi 980-8577 (Japan); Institute of Physics AS CR, Cukrovarnicka 10, Prague 16253 (Czech Republic); Kawaguchi, Noriaki [Institute for Materials Research, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai, Miyagi 980-8577 (Japan); Tokuyama, Co. Ltd., Shibuya 3-chome, Shibuya-ku, Tokyo 150-8383 (Japan); Fukuda, Kentaro [Tokuyama, Co. Ltd., Shibuya 3-chome, Shibuya-ku, Tokyo 150-8383 (Japan); Yoshikawa, Akira [Institute for Materials Research, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai, Miyagi 980-8577 (Japan); New Industry Creation Hatchery Center (NICHe), 6-6-10 Aoba, Aramaki, Aoba-ku, Sendai, Miyagi 980-8579 (Japan)

    2012-12-15

    In recent work, Na co-doping have found to improve the light output of Eu doped LiCaAlF{sub 6} (Eu:LiCAF) for thermal neutron scintillator. We grew Eu 2% and alkali metal 1% co-doped LiSAF crystals by Micro-Pulling down method to understand the effect of alkali metal co-doping on scintillation properties and mechanism compared with LiCAF. In photo- and {alpha}-ray induced radio-luminescence spectra of the all grown crystals, the emissions from d-f transition of Eu{sup 2+} were observed. Without relation to excitation source, decay times of co-doped LiSAF were longer than Eu only doped one. The light yield of Na, K and Cs co-doped LiSAF under {sup 252}Cf neutron excitation were improved. Especially, K co-doped Eu:LiSAF reached 33200 ph/n, which outperformed Eu only doped one by approximately 20% (copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  19. Characterisation of stilbenes in California almonds (Prunus dulcis) by UHPLC-MS.

    Science.gov (United States)

    Xie, Liyang; Bolling, Bradley W

    2014-04-01

    Stilbene polyphenols are present in some fruits and nuts, but their abundance in many foods, such as almonds, is unknown. Therefore, we characterised stilbenes from Nonpareil, Butte and Carmel almond (Prunus dulcis) varieties from California. UHPLC-MS conditions were optimised to resolve cis- and trans-resveratrol, d4-resveratrol, dienestrol, hexestrol, oxyresveratrol, piceatannol, pterostilbene, and resveratrol-3-β-glucoside (polydatin). Stilbenes were isolated from ethanolic almond extracts by solid-phase extraction and identified with UHPLC-MS by comparison of retention times, mass spectra, in-source CID spectra, and enzymatic hydrolysis to authentic standards. Polydatin was identified in almond extracts, with 7.19-8.52 μg/100 g almond. Piceatannol+oxyresveratrol was tentatively identified in almond blanch water, at 0.19-2.55 μg/100 g almond. Polydatin was concentrated in almond skins, which contained 95.6-97.5% of the total almond content. Therefore, almonds contain the stilbene class of polyphenols in addition to the previously identified proanthocyanidin, hydrolysable tannin, flavonoid, and phenolic acid classes. Copyright © 2013 Elsevier Ltd. All rights reserved.

  20. submitter Light Extraction From Scintillating Crystals Enhanced by Photonic Crystal Structures Patterned by Focused Ion Beam

    CERN Document Server

    Modrzynski, Pawel; Knapitsch, Arno; Kunicki, Piotr; Lecoq, Paul; Moczala, Magdalena; Papakonstantinou, Ioannis; Auffray, Etiennette

    2016-01-01

    “Photonic Crystals (PhC)” have been used in a variety of fields as a structure for improving the light extraction efficiency from materials with high index of refraction. In previous work we already showed the light extraction improvement of several PhC covered LYSO crystals in computer simulations and practical measurements. In this work, new samples are made using different materials and techniques which allows further efficiency improvements. For rapid prototyping of PhC patterns on scintillators we tested a new method using “Focused Ion Beam (FIB)” patterning. The FIB machine is a device similar to a “Scanning Electron Microscope (SEM)”, but it uses ions (mainly gallium) instead of electrons for the imaging of the samples' surface. The additional feature of FIB devices is the option of surface patterning in nano-scale which was exploited for our samples. Three samples using FIB patterning have been produced. One of them is a direct patterning of the extraction face of a 0.8×0.8×10 $mm^3$ LYS...

  1. Search of new scintillation materials for nuclear medicine application

    CERN Document Server

    Korzhik, M

    2001-01-01

    Oxide crystals have a great potential to develop new advanced scintillation materials which are dense, fast, and bright. This combination of parameters, when combined to affordable price, gives a prospect for materials to be applied in nuclear medicine devices. Some of them have been developed for the last two decades along the line of rear-earth (RE) garnet (RE//3Al//5O//1//2) oxiorthosilicate (RE//2SiO//5) and perovskite (REAlO//3) crystals doped with Ce ions. Among recently developed oxide materials the lead tungstate scintillator (PWO) becomes the most used scintillation materials in high energy physics experiments due to its application in CMS and ALICE experiments at LHC. In this paper we discuss scintillation properties of some new heavy compounds doped with Ce as well as light yield improvement of PWO crystals to apply them in low energy physics and nuclear medicine. 18 Refs.

  2. Luminescence and scintillation properties of rare-earth-doped LuF.sub.3./sub. scintillation crystals

    Czech Academy of Sciences Publication Activity Database

    Pejchal, Jan; Fukuda, K.; Kurosawa, S.; Yokota, Y.; Yoshikawa, A.

    2015-01-01

    Roč. 41, Mar SI (2015), s. 58-62 ISSN 0925-3467 Institutional support: RVO:68378271 Keywords : lutetium fluoride * scintillator * scintillator * VUV luminescence Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.183, year: 2015

  3. Photoluminescence in Carborane-Stilbene Triads: A Structural, Spectroscopic, and Computational Study.

    Science.gov (United States)

    Cabrera-González, Justo; Viñas, Clara; Haukka, Matti; Bhattacharyya, Santanu; Gierschner, Johannes; Núñez, Rosario

    2016-09-12

    A set of triads in which o- and m-carborane clusters are bonded to two stilbene units through Ccluster -CH2 bonds was synthesized, and their structures were confirmed by X-ray diffraction. A study on the influence of the o- and m- isomers on the absorption and photoluminescence properties of the stilbene units in solution revealed no charge-transfer contributions in the lowest excited state, as confirmed by (TD)DFT calculations. The presence of one or two B-I groups in m-carborane derivatives does not affect the emission properties of the stilbenes in solution, probably due to the rather large distance between the iodo substituents and the fluorophore. Nevertheless, a significant redshift of the photoluminescence (PL) emission maximum in the solid state (thin films and powder samples) compared to solution was observed; this can be traced back to PL sensitization, most probably due to more densely packed stilbene moieties. Remarkably, the PL absolute quantum yields of powder samples are significantly higher than those in solution, and this was attributed to the restricted environment and the aforementioned sensitization. Thus, the bonding of the carborane clusters to two stilbene units preserves their PL behavior in solution, but produces significant changes in the solid state. Furthermore, iodinated species can be considered to be promising precursors for theranostic agents in which both imaging and therapeutic functions could possibly be combined. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Properties of high pressure nitrogen-argon and nitrogen-xenon gas scintillators

    International Nuclear Information System (INIS)

    Tornow, W.; Huck, H.; Koeber, H.J.; Mertens, G.

    1976-01-01

    Investigations of scintillation light output and energy resolution have been made at pressures up to 90 atm in gaseous mixtures of nitrogen with both argon and xenon by stopping of 210 Po-alpha particles. In the absence of a wavelength shifter, the N 2 -Ar mixtures gave a maximum pulse height at a ratio of nitrogen to argon partial pressures rsub(N 2 /Ar) approximately =0.2. However, when using the wavelength shifter diphenyl stilbene (DPS), the measured light output was much larger at lower values of rsub(N 2 /Ar), whereas for rsub(N 2 /Ar)>0.2 pulse height and energy resolution of the studied N 2 -Ar mixtures were roughly indentical with and without DPS. The N 2 -Xe gas mixtures exhibited a similar dependence of pulse height and energy resolution to that of the N 2 -Ar mixtures employing DPS, but the pulse height was larger by a factor of about 7. A 40 atm 50% N 2 -50% Xe gas scintillator showed an energy resolution ΔE/E=0.25, while an 80 atm 75% N 2 -25% Xe scintillator gave ΔE/E=0.6. The pulse height from the 80 atm N 2 -Xe scintillator was smaller by a factor of about 240 than the pulse height from a 20 atm pure Xe gas scintillator, but larger by a factor of about 20 than the pulse height from a 75 atm pure N 2 gas scintillator. The N 2 -Xe mixtures showed a remarkable increase of light output as the temperature of the gas was descreased. (Auth.)

  5. Measurements of angular and energy distributions of gamma-rays resulting from neutron interactions in shielding barriers

    International Nuclear Information System (INIS)

    Makarious, A.S.; Maayouf, R.M.A.; Megahid, R.

    1978-01-01

    Measurements of both angular and energy distributions of secondary gamma resulting from interactions of neutrons emerging from one of the ET-RR-1 reactor beam holes, in barriers from iron, lead and water are reported. The measurements were carried out, both with a bare neutron beam and with the beam being transmitted through a B4C. Filter, using a stilbene crystal gamma spectrometer. The spectrometer applies discrimination between neutrons and gammas according to the difference in decay times of the scintillations produced by them in stilbene. The described angular distributions resulted from measurements made at different angles of neutron incidence and with three different thicknesses of each sample

  6. 76 FR 30967 - Certain Stilbenic Optical Brightening Agents From China and Taiwan

    Science.gov (United States)

    2011-05-27

    ... Stilbenic Optical Brightening Agents From China and Taiwan Determinations On the basis of the record \\1... is a reasonable indication that an industry in the United States is materially injured by reason of imports from China and Taiwan of certain stilbenic optical brightening agents, provided for in subheadings...

  7. Scintillation properties of YAlO3 doped with Lu and Nd perovskite single crystals

    Science.gov (United States)

    Akatsuka, Masaki; Usui, Yuki; Nakauchi, Daisuke; Kato, Takumi; Kawano, Naoki; Okada, Go; Kawaguchi, Noriaki; Yanagida, Takayuki

    2018-05-01

    YAlO3 (YAP) single crystals doped with Lu and Nd were grown by the Floating Zone (FZ) method to evaluate their scintillation properties particularly emissions in the near-infrared (NIR) range. The Nd concentration was fixed to 0 or 1 mol% while the Lu concentration was varied from 0 to 30%. When X-ray was irradiated, the scintillation of Nd-doped samples was observed predominantly at 1064 nm due to 4F3/2 → 4I11/2 transition of Nd3+. In contrast, a weak emission around 700 nm appeared in the samples doped with only Lu, and the emission origin was attributed to defect centers. In the Nd3+-doped samples, the decay time was 94-157 μs due to the 4f-4f transitions of Nd3+ whereas the Lu-doped samples showed signal with the decay time of 1.45-1.54 ms. The emission origin of the latter signal was attributed to the perovskite lattice defect.

  8. FLUKA studies of hadron-irradiated scintillating crystals for calorimetry at the High-Luminosity LHC

    CERN Document Server

    Quittnat, Milena Eleonore

    2015-01-01

    Calorimetry at the High-Luminosity LHC (HL-LHC) will be performed in a harsh radiation environment with high hadron fluences. The upgraded CMS electromagnetic calorimeter design and suitable scintillating materials are a focus of current research. In this paper, first results using the Monte Carlo simulation program FLUKA are compared to measurements performed with proton-irradiated LYSO, YSO and cerium fluoride crystals. Based on these results, an extrapolation to the behavior of an electromagnetic sampling calorimeter, using one of the inorganic scintillators above as an active medium, is performed for the upgraded CMS experiment at the HL-LHC. Characteristic parameters such as the induced ambient dose, fluence spectra for different particle types and the residual nuclei are studied, and the suitability of these materials for a future calorimeter is surveyed. Particular attention is given to the creation of isotopes in an LYSO-tungsten calorimeter that might contribute a prohibitive background to the measu...

  9. Numerical modeling of Czochralski growth of Li2MoO4 crystals for heat-scintillation cryogenic bolometers

    Science.gov (United States)

    Stelian, Carmen; Velázquez, Matias; Veber, Philippe; Ahmine, Abdelmounaim; Sand, Jean-Baptiste; Buşe, Gabriel; Cabane, Hugues; Duffar, Thierry

    2018-06-01

    Lithium molybdate Li2MoO4 (LMO) crystals of mass ranging between 350 and 500 g are excellent candidates to build heat-scintillation cryogenic bolometers likely to be used for the detection of rare events in astroparticle physics. In this work, numerical modeling is applied in order to investigate the Czochralski growth of Li2MoO4 crystals in an inductive furnace. The numerical model was validated by comparing the numerical predictions of the crystal-melt interface shape to experimental visualization of the growth interface. Modeling was performed for two different Czochralski furnaces that use inductive heating. The simulation of the first furnace, which was used to grow Li2MoO4 crystals of 3-4 cm in diameter, reveals non-optimal heat transfer conditions for obtaining good quality crystals. The second furnace, which will be used to grow crystals of 5 cm in diameter, was numerically optimized in order to reduce the temperature gradients in the crystal and to avoid fast crystallization of the bath at the later stages of the growth process.

  10. Measurement of ultimate tensile strength and Young modulus in LYSO scintillating crystals

    Energy Technology Data Exchange (ETDEWEB)

    Scalise, Lorenzo, E-mail: l.scalise@univpm.it [Dipartimento di Meccanica, Universita Politecnica delle Marche, Via Brecce Bianche, 60131 Ancona (Italy); Rinaldi, Daniele [Dipartimento di Fisica e Ingegneria dei Materiali e del Territorio, Universita Politecnica delle Marche, Via Brecce Bianche, 60131 Ancona (Italy); Istituto Nazionale di Fisica Nucleare, Section of Perugia (Italy); Davi, Fabrizio [Dipartimento di Architettura Costruzioni e Strutture, Universita Politecnica delle Marche, Via Brecce Bianche, 60131 Ancona (Italy); Paone, Nicola [Dipartimento di Meccanica, Universita Politecnica delle Marche, Via Brecce Bianche, 60131 Ancona (Italy)

    2011-10-21

    Scintillating crystals are employed in high energy physics, in medical imaging, diagnostic and security. Two mechanical properties of lutetium-yttrium oxyorthosilicate cerium-doped Lu{sub 2(1-x)}Y{sub 2x}SiO{sub 5}:Ce with x=0.1 (LYSO) crystals have been measured: the ultimate tensile stress ({sigma}{sub UTS}) and the Young elastic modulus (E). Measurements are made by means of a 4-points loading device and the experimental results account for an elastic-brittle stress-strain relation, which depends heavily on the specimen preparation and the material defects. {sigma}{sub UTS} along the [0 1 0] tensile direction ranges within 68.14 and 115.61 MPa, which, in the lowest case, is more than twice with respect to those measured for PbWO{sub 4} (PWO), exhibiting a marked difference between the annealed and the not-annealed samples. The mean elastic modulus (E), along the same direction, is E=1.80x10{sup 11} ({+-}2.15x10{sup 10}) N/m{sup 2}, with lower dispersion respect to UTS data. This type of analysis and study can be included into quality control procedures of crystals, based on samples taken out of production; such procedures can be established for industrial processing of crystals aimed to the high energy physics (calorimeters) and medical imaging (PET, etc.) applications.

  11. Methods for a systematic, comprehensive search for fast, heavy scintillator materials

    International Nuclear Information System (INIS)

    Derenzo, S.E.; Moses, W.W.; Weber, M.J.; West, A.C.

    1994-01-01

    Over the years a number of scintillator materials have been developed for a wide variety of nuclear detection applications in industry, high energy physics, and medical instrumentation. To expand the list of useful scintillators, the authors are pursuing the following systematic, comprehensive search: (1) select materials with good gamma-ray interaction properties from the 200,000 data set NIST crystal diffraction file, (2) synthesize samples (doped and undoped) in powdered or single crystal form, (3) test the samples using sub-nanosecond pulsed x-rays to measure important scintillation properties such as rise times, decay times, emission wavelengths, and light output, (4) prepare large, high quality crystals of the most promising candidates, and (5) test the crystals as gamma-ray detectors in representative configurations. An important parallel effort is the computation of electronic energy levels of activators and the band structure of intrinsic and host crystals to aid in the materials selection process. In this paper the authors interested mainly in scintillator materials for detecting 511 keV gamma rays in positron emission tomography

  12. On improvement of scintillation characteristics of Gd2SiO5:Ce crystals by thermal treatment

    International Nuclear Information System (INIS)

    Bondar, Valery G.; Grinyov, Boris V.; Katrunov, Konstantin A.; Lisetski, Longin N.; Nagornaya, Lyudmila L.; Ryzhikov, Vladimir D.; Spasov, Vladimir G.; Starzhinskiy, Nikolai; Tamulaitis, Gintautas

    2005-01-01

    Effects of thermal treatment of Gd 2 SiO 5 :Ce crystals at T∼0.7T m under low pressure on their optical and scintillation properties were studied. It is shown that thermal treatment in the atmosphere with the chemical potential of ∼40 J mol -1 decreases the absorption in the UV region and substantially improves the crystal transparency in the region of intrinsic emission peaked at 427 nm.Narrowing of the emission band due to suppression of the long-wave component in the range of 520-560 nm, light output increase by 7-10%, decrease of the emission decay time, and improvement of thermal stability of the luminescence yield were also observed. Transformations of the ensemble of structural defects in cerium-activated gadolinium oxyorthosilicate crystals are under discussion

  13. Single crystal and optical ceramic multicomponent garnet scintillators: A comparative study

    International Nuclear Information System (INIS)

    Wu, Yuntao; Luo, Zhaohua; Jiang, Haochuan; Meng, Fang; Koschan, Merry; Melcher, Charles L.

    2015-01-01

    Multicomponent garnet materials can be made in optical ceramic as well as single crystal form due to their cubic crystal structure. In this work, high-quality Gd 3 Ga 3 Al 2 O 12 :0.2 at% Ce (GGAG:Ce) single crystal and (Gd,Lu) 3 Ga 3 Al 2 O 12 :1 at% Ce (GLuGAG:Ce) optical ceramics were fabricated by the Czochralski method and a combination of hot isostatic pressing (HIPing) and annealing treatment, respectively. Under optical and X-ray excitation, the GLuGAG:Ce optical ceramic exhibits a broad Ce 3+ transition emission centered at 550 nm, while the emission peak of the GGAG:Ce single crystal is centered at 540 nm. A self-absorption effect in GLuGAG:Ce optical ceramic results in this red-shift of the Ce 3+ emission peak compared to that in the GGAG:Ce single crystal. The light yield under 662 keV γ-ray excitation was 45,000±2500 photons/MeV and 48,200±2410 photons/MeV for the GGAG:Ce single crystal and GLuGAG:Ce optical ceramic, respectively. An energy resolution of 7.1% for 662 keV γ-rays was achieved in the GLuGAG:Ce optical ceramic with a Hamamatsu R6231 PMT, which is superior to the value of 7.6% for a GGAG:Ce single crystal. Scintillation decay time measurements under 137 Cs irradiation show two exponential decay components of 58 ns (47%) and 504 ns (53%) for the GGAG:Ce single crystal, and 84 ns (76%) and 148 ns (24%) for the GLuGAG:Ce optical ceramic. The afterglow level after X-ray cutoff in the GLuGAG:Ce optical ceramic is at least one order of magnitude lower than in the GGAG:Ce single crystal. - Highlights: • GGAG:Ce single crystal and GLuGAG:Ce optical ceramics were fabricated. • The light yield of both ceramic and crystal G(Lu)GAG:Ce reached the level of 45,000 photons/MeV. • GLuGAG:Ce optical ceramic showed a better energy resolution of 7.1% for 662 keV. • GLuGAG:Ce ceramics exhibited lower afterglow level than that of GGAG:Ce single crystals. • The possible optimization strategies for multicomponent aluminate garnets are discussed

  14. Growth of LiF/LiBaF.sub.3./sub. eutectic scintillator crystals and their optical properties

    Czech Academy of Sciences Publication Activity Database

    Kurosawa, S.; Yamaji, A.; Pejchal, Jan; Yokota, Y.; Ohashi, Y.; Kamada, K.; Yoshikawa, A.

    2017-01-01

    Roč. 52, č. 10 (2017), s. 5531-5536 ISSN 0022-2461 Grant - others:AV ČR(CZ) JSPS-17-18 Program:Bilaterální spolupráce Institutional support: RVO:68378271 Keywords : scintillators * eutectics * crystal growth Subject RIV: BM - Solid Matter Physics ; Magnetism OBOR OECD: Condensed matter physics (including formerly solid state physics, supercond.) Impact factor: 2.599, year: 2016

  15. Influence of the reactor irradiation on the radiation-optical features of the PbWO4:La scintillation crystals

    International Nuclear Information System (INIS)

    Ashurov, M.Kh.; Ismoilov, Sh.Kh.; Khatamov, K.; Gasanov, Eh.M.; Rustamov, I.R.

    2001-01-01

    Within an International LHC project the lead tungstates (PbWO 4 ) scintillation crystals radiation stability activated by La ions was carried out. In the 400-700 nm length range the transmission spectra were measured on the different parts of the standard PbWO 4 :La crystals. The spectra were measured before and after irradiation by both fast neutrons and γ-radiation. On the base of obtained data the contribution of γ-quanta and neutrons in the radiation-induced losses value of optical radiation in the active media of the electromagnetic colorimeter was estimated

  16. Energy resolution of scintillation detectors

    Energy Technology Data Exchange (ETDEWEB)

    Moszyński, M., E-mail: M.Moszynski@ncbj.gov.pl; Syntfeld-Każuch, A.; Swiderski, L.; Grodzicka, M.; Iwanowska, J.; Sibczyński, P.; Szczęśniak, T.

    2016-01-01

    According to current knowledge, the non-proportionality of the light yield of scintillators appears to be a fundamental limitation of energy resolution. A good energy resolution is of great importance for most applications of scintillation detectors. Thus, its limitations are discussed below; which arise from the non-proportional response of scintillators to gamma rays and electrons, being of crucial importance to the intrinsic energy resolution of crystals. The important influence of Landau fluctuations and the scattering of secondary electrons (δ-rays) on intrinsic resolution is pointed out here. The study on undoped NaI and CsI at liquid nitrogen temperature with a light readout by avalanche photodiodes strongly suggests that the non-proportionality of many crystals is not their intrinsic property and may be improved by selective co-doping. Finally, several observations that have been collected in the last 15 years on the influence of the slow components of light pulses on energy resolution suggest that more complex processes are taking place in the scintillators. This was observed with CsI(Tl), CsI(Na), ZnSe(Te), and undoped NaI at liquid nitrogen temperature and, finally, for NaI(Tl) at temperatures reduced below 0 °C. A common conclusion of these observations is that the highest energy resolution, and particularly intrinsic resolution measured with the scintillators, characterized by two or more components of the light pulse decay, is obtainable when the spectrometry equipment integrates the whole light of the components. In contrast, the slow components observed in many other crystals degrade the intrinsic resolution. In the limiting case, afterglow could also be considered as a very slow component that spoils the energy resolution. The aim of this work is to summarize all of the above observations by looking for their origin.

  17. Simulation of light collection in calcium tungstate scintillation detectors

    Directory of Open Access Journals (Sweden)

    F. A. Danevich

    2015-12-01

    Full Text Available Due to high operational properties, the oxide scintillators are perspective for cryogenic scintillation experiments with aim of study rare nuclear processes. In order to optimize light yield and the energy resolution we performed calculations of the efficiency of light collection for different geometries of scintillation detector with CaWO4 crystal by Monte-Carlo method using Litrani, Geant4 and Zemax packages. The calculations were compared with experimental data in the same configurations, depending on the crystal shape, surface treatment, material and shape of the reflector and presence of optical contact. The best results were obtained with crystals shaped as the right prism with triangle base, with completely diffused surfaces, using mirror reflector shaped as a truncated cone. Simulations by using Litrani have shown the best agreement with experimental results.

  18. Synthesis, Biological Evaluation, and Molecular Modeling Studies of New Oxadiazole-Stilbene Hybrids against Phytopathogenic Fungi

    Science.gov (United States)

    Jian, Weilin; He, Daohang; Song, Shaoyun

    2016-08-01

    Natural stilbenes (especially resveratrol) play important roles in plant protection by acting as both constitutive and inducible defenses. However, their exogenous applications on crops as fungicidal agents are challenged by their oxidative degradation and limited availability. In this study, a new class of resveratrol-inspired oxadiazole-stilbene hybrids was synthesized via Wittig-Horner reaction. Bioassay results indicated that some of the compounds exhibited potent fungicidal activity against Botrytis cinerea in vitro. Among these stilbene hybrids, compounds 11 showed promising inhibitory activity with the EC50 value of 144.6 μg/mL, which was superior to that of resveratrol (315.6 μg/mL). Remarkably, the considerably abnormal mycelial morphology was observed in the presence of compound 11. The inhibitory profile was further proposed by homology modeling and molecular docking studies, which showed the possible interaction of resveratrol and oxadiazole-stilbene hybrids with the cytochrome P450-dependent sterol 14α-demethylase from B. cinerea (BcCYP51) for the first time. Taken together, these results would provide new insights into the fungicidal mechanism of stilbenes, as well as an important clue for biology-oriented synthesis of stilbene hybrids with improved bioactivity against plant pathogenic fungi in crop protection.

  19. Process for obtaining oxygen doped zinc telluride monocrystals and scintillator crystals obtained by this process

    International Nuclear Information System (INIS)

    Schneider, Maurice; Moreau, Roland; D'Haenen, J.-P.; Merenda, Pierre.

    1976-01-01

    A process is described for obtaining oxygen doped zinc telluride monocrystals, for use as scintillator crystals for ionising radiation detectors. The following operations are carried out in succession: one or several zinc telluride crystals are introduced into a silica ampoule together with a ternary mixture of zinc tellurium and oxygen, as an oxide or hydroxide of these elements; the ampoule is pumped down to a high vacuum and sealed; the sealed ampoule containing the mixture and monocrystals is placed in a kiln and brought to a uniform temperature sufficient to make the mixture three-phased, depending on its composition; the zinc telluride crystalline compound remains solid; the ampoule is then tempered to bring it quickly back to ambient temperature [fr

  20. Prospects for first-principle calculations of scintillator properties

    International Nuclear Information System (INIS)

    Derenzo, Stephen E.; Weber, Marvin J.

    1999-01-01

    Several scintillation processes can be modeled from first principles using quantum chemistry cluster calculations and recently available high-performance computers. These processes include the formation of excitons and trapping centers, the diffusion of ionization energy (electrons and holes) through a host crystal, and the efficient capture of these carriers by an activator atom to form a luminous, non-quenched excited state. As examples of such calculations, results are presented for (1) hole transport in the known scintillator host crystal CsI, (2) hole trapping in the non-scintillator PbF 2 , (3) hole transport in the experimentally unexplored PbF 4 , and (4) the electronic nature of excited states of CsI : Tl and CsI : Na

  1. Merocyanines: polyene-polymethine transition in donor-acceptor-substituted stilbenes and polyenes

    International Nuclear Information System (INIS)

    Rettig, Wolfgang; Dekhtyar, Marina

    2003-01-01

    Three series of donor-acceptor-substituted conjugated compounds, namely, stilbenes, the open-chain polyenes of equivalent length, and the species of intermediate structure (polyenes terminated with only one phenyl ring) have been studied by the AM1 and HMO methods to elucidate and compare the structural prerequisites of the ideal polymethinic state ('cyanine limit'). The transition from polyenic to polymethinic properties has been traced in terms of bond-length (bond-order) alternation using the variation of terminal donor and acceptor substituents. Stilbenes manifest themselves as notably 'retarded' polyenes since a larger electronic asymmetry is necessary for them to reach the same degree of polymethinic character. The ground and the excited state have been shown to differ much more strongly for stilbenes than for polyenes with respect to the position of the bond equalization point on the scale of donor-acceptor difference. For the compounds containing one phenyl ring, the features revealed are intermediate between stilbenes and polyenes. The large S 0 -S 1 discrepancy in terms of bond alternation is a general property of aromatic ring-terminated chains (stilbenes) and is related to the influence of the aromatic character which can be quantified in this way. In this context, the most relevant definition for the cyanine limit (based on the bond invariance upon excitation) was selected from the existing definitions. The major trends revealed in the polyenic/polymethinic behaviour of the molecules can be interpreted on a topological basis within HMO or even simpler models with some additional influence due to the interelectronic repulsion which is taken into account in the AM1 treatment

  2. Crystal growth and scintillation properties of Er-doped Lu3Al5O12 single crystals

    International Nuclear Information System (INIS)

    Sugiyama, Makoto; Fujimoto, Yutaka; Yanagida, Takayuki; Totsuka, Daisuke; Kurosawa, Shunsuke; Futami, Yoshisuke; Yokota, Yuui; Chani, Valery; Yoshikawa, Akira

    2012-01-01

    Er-doped Lu 3 Al 5 O 12 (Er:LuAG) single crystalline scintillators with different Er concentrations of 0.1, 0.5, 1, and 3% were grown by the micro-pulling-down (μ-PD) method. The grown crystals were composed of single-phase material, as demonstrated by powder X-ray diffraction (XRD). The radioluminescence spectra measured under 241 Am α-ray excitation indicated host emission at approximately 350 nm and Er 3+ 4f-4f emissions. According to the pulse height spectra recorded under γ-ray irradiation, the 0.5% Er:LuAG exhibited the highest peak channel among the samples. The γ-ray excited decay time profiles were well fitted by the two-component exponential approximation (0.8 μs and 6-10 μs).

  3. GAGG:ce single crystalline films: New perspective scintillators for electron detection in SEM

    International Nuclear Information System (INIS)

    Bok, Jan; Lalinský, Ondřej; Hanuš, Martin; Onderišinová, Zuzana; Kelar, Jakub; Kučera, Miroslav

    2016-01-01

    Single crystal scintillators are frequently used for electron detection in scanning electron microscopy (SEM). We report gadolinium aluminum gallium garnet (GAGG:Ce) single crystalline films as a new perspective scintillators for the SEM. For the first time, the epitaxial garnet films were used in a practical application: the GAGG:Ce scintillator was incorporated into a SEM scintillation electron detector and it showed improved image quality. In order to prove the GAGG:Ce quality accurately, the scintillation properties were examined using electron beam excitation and compared with frequently used scintillators in the SEM. The results demonstrate excellent emission efficiency of the GAGG:Ce single crystalline films together with their very fast scintillation decay useful for demanding SEM applications. - Highlights: • First practical application of epitaxial garnet films demonstrated in SEM. • Improved image quality of SEM equipped with GAGG:Ce single crystalline thin film scintillator. • Scintillation properties of GAGG:Ce films compared with standard bulk crystal scintillators.

  4. Development of scintillation materials for medical imaging and other applications

    International Nuclear Information System (INIS)

    Melcher, C. L.

    2013-01-01

    Scintillation materials that produce pulses of visible light in response to the absorption of energetic photons, neutrons, and charged particles, are widely used in various applications that require the detection of radiation. The discovery and development of new scintillators has accelerated in recent years, due in large part to their importance in medical imaging as well as in security and high energy physics applications. Better understanding of fundamental scintillation mechanisms as well as the roles played by defects and impurities have aided the development of new high performance scintillators for both gamma-ray and neutron detection. Although single crystals continue to dominate gamma-ray based imaging techniques, composite materials and transparent optical ceramics potentially offer advantages in terms of both synthesis processes and scintillation performance. A number of promising scintillator candidates have been identified during the last few years, and several are currently being actively developed for commercial production. Purification and control of raw materials and cost effective crystal growth processes can present significant challenges to the development of practical new scintillation materials.

  5. Characterization of scintillating CaWO{sub 4} crystals for the CRESST experiment using two-photon excitation

    Energy Technology Data Exchange (ETDEWEB)

    Hampf, Raphael; Dandl, Thomas; Muenster, Andrea; Oberauer, Lothar; Roth, Sabine; Schoenert, Stefan; Ulrich, Andreas [Physik-Department and Excellence Cluster Universe, Technische Universitaet Muenchen, D-85747 Garching (Germany)

    2016-07-01

    In the CRESST experiment for direct dark matter search, phonon and photon signals from cryogenic CaWO{sub 4} crystals are used to search for WIMP-induced nuclear recoil events. We present a novel table-top setup in which the scintillation of CaWO{sub 4} is induced by 0.7 ns laser pulses of 355 nm wavelength. The excitation occurs via two-photon absorption in the bulk material. The scintillation light is observed by time resolved optical spectroscopy. By varying the focusing of the laser-beam the excitation density can be made high enough to study quenching effects due to exciton-exciton annihilation. This allows to perform experiments to test models for the quenching factors of different ionizing projectiles in CaWO{sub 4} which are used to identify these projectiles on an event by event basis.

  6. Basic study of single crystal fibers of Pr:Lu3Al5O12 scintillator for gamma-ray imaging applications

    International Nuclear Information System (INIS)

    Yanagida, Takayuki; Kamada, Kei; Kawaguchi, Noriaki; Fujimoto, Yutaka; Fukuda, Kentaro; Yokota, Yuui; Chani, Valery; Yoshikawa, Akira

    2011-01-01

    Single-crystalline fibers were grown from 0.25, 0.70, and 1.50 mol% Pr-doped Lu 3 Al 5 O 12 (LuAG) melts by the micro-pulling down (μ-PD) method with a diameter of 0.3-0.5 mm and a length of about 200 mm. They were cut to 10 mm long specimens, and their scintillation properties, including light yield and decay time profile, were examined. These results were compared with corresponding properties of the specimens (0.8x0.8x10 mm 3 ) cut from the bulk crystals produced by conventional Czochralski (CZ) growth. The μ-PD-grown fibers demonstrated relatively low light yield and had the same decay time constant when compared with those of the samples cut from the CZ-grown crystals. The fiber crystals were used to assemble scintillating arrays with dimensions of O 0.5x10 mm 2 x20 pixels and O 0.3x10 mm 2 x30 pixels coated by a BaSO 4 reflector. After optical coupling with a position sensitive photomultiplier tube, the fiber-based arrays demonstrated acceptable imaging capability with a spatial resolution of about 0.5 mm.

  7. Structural and kinetic analysis of the unnatural fusion protein 4-coumaroyl-CoA ligase::stilbene synthase

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Yechun; Yi, Hankuil; Wang, Melissa; Yu, Oliver; Jez, Joseph M. (WU); (Danforth)

    2012-10-24

    To increase the biochemical efficiency of biosynthetic systems, metabolic engineers have explored different approaches for organizing enzymes, including the generation of unnatural fusion proteins. Previous work aimed at improving the biosynthesis of resveratrol, a stilbene associated a range of health-promoting activities, in yeast used an unnatural engineered fusion protein of Arabidopsis thaliana (thale cress) 4-coumaroyl-CoA ligase (At4CL1) and Vitis vinifera (grape) stilbene synthase (VvSTS) to increase resveratrol levels 15-fold relative to yeast expressing the individual enzymes. Here we present the crystallographic and biochemical analysis of the 4CL::STS fusion protein. Determination of the X-ray crystal structure of 4CL::STS provides the first molecular view of an artificial didomain adenylation/ketosynthase fusion protein. Comparison of the steady-state kinetic properties of At4CL1, VvSTS, and 4CL::STS demonstrates that the fusion protein improves catalytic efficiency of either reaction less than 3-fold. Structural and kinetic analysis suggests that colocalization of the two enzyme active sites within 70 {angstrom} of each other provides the basis for enhanced in vivo synthesis of resveratrol.

  8. Safeguards Technology Development Program 1st Quarter FY 2018 Report

    Energy Technology Data Exchange (ETDEWEB)

    Prasad, Manoj K. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2018-01-10

    LLNL will evaluate the performance of a stilbene-based scintillation detector array for IAEA neutron multiplicity counting (NMC) applications. This effort will combine newly developed modeling methodologies and recently acquired high-efficiency stilbene detector units to quantitatively compare the prototype system performance with the conventional He-3 counters and liquid scintillator alternatives.

  9. First scintillating bolometer tests of a CLYMENE R&D on Li2MoO4 scintillators towards a large-scale double-beta decay experiment

    Science.gov (United States)

    Buşe, G.; Giuliani, A.; de Marcillac, P.; Marnieros, S.; Nones, C.; Novati, V.; Olivieri, E.; Poda, D. V.; Redon, T.; Sand, J.-B.; Veber, P.; Velázquez, M.; Zolotarova, A. S.

    2018-05-01

    A new R&D on lithium molybdate scintillators has begun within a project CLYMENE (Czochralski growth of Li2MoO4 crYstals for the scintillating boloMeters used in the rare EveNts sEarches). One of the main goals of the CLYMENE is a realization of a Li2MoO4 crystal growth line to be complementary to the one recently developed by LUMINEU in view of a mass production capacity for CUPID, a next-generation tonne-scale bolometric experiment to search for neutrinoless double-beta decay. In the present paper we report the investigation of performance and radiopurity of 158-g and 13.5-g scintillating bolometers based on a first large-mass (230 g) Li2MoO4 crystal scintillator developed within the CLYMENE project. In particular, a good energy resolution (2-7 keV FWHM in the energy range of 0.2-5 MeV), one of the highest light yield (0.97 keV/MeV) amongst Li2MoO4 scintillating bolometers, an efficient alpha particles discrimination (10 σ) and potentially low internal radioactive contamination (below 0.2-0.3 mBq/kg of U/Th, but 1.4 mBq/kg of 210Po) demonstrate prospects of the CLYMENE in the development of high quality and radiopure Li2MoO4 scintillators for CUPID.

  10. R&D on scintillation materials for novel ionizing radiation detectors for High Energy Physics, medical imaging and industrial applications

    CERN Multimedia

    Chipaux, R; Rinaldi, D; Boursier, Y M; Vasilyev, A; Tikhomirov, V; Morel, C; Choi, Y; Tamulaitis, G

    2002-01-01

    The Crystal Clear Collaboration (CCC) was approved by the Detector R&D Committee as RD18 in 1990 with the objective of developing new inorganic scintillators suitable for crystal electromagnetic calorimeters of LHC experiments. From 1990 to 1994, CCC made an intensive investigation for the quest of the most adequate ideal scintillator for the LHC; three main candidates were identified and extensively studied : CeF$_{3}$, PbWO$_{4}$ and heavy scintillating glasses. Lead tungstate was chosen by CMS and ALICE as the most cost effective crystal compliant to LHC conditions. Today 76648 PWO crystals are installed in CMS and 17920 in ALICE. After this success Crystal clear has continued its investigation on new scintillators and the understanding of scintillation mechanisms and light transfer properties in particular : The understanding of cerium ion as activator, The development of LuAP, LuYAP crystals for medical imaging applications, (CERN patent) Investigation of Ytterbium based scintillators for solar ne...

  11. Co-doping effects on luminescence and scintillation properties of Ce doped Lu3Al5O12 scintillator

    International Nuclear Information System (INIS)

    Kamada, Kei; Nikl, Martin; Kurosawa, Shunsuke; Beitlerova, Alena; Nagura, Aya; Shoji, Yasuhiro; Pejchal, Jan; Ohashi, Yuji; Yokota, Yuui; Yoshikawa, Akira

    2015-01-01

    The Mg, Ca, Sr and Ba 200 ppm co-doped Ce:Lu 3 Al 5 O 12 single crystals were prepared by micro pulling down method. Absorption and luminescence spectra were measured together with several other scintillation characteristics, namely the scintillation decay and light yield to reveal the effect of the co-doping. The scintillation decays were accelerated by both Mg and Ca co-dopants. The Mg co-doped samples showed the fastest decay and the highest light yield among the co-doped samples

  12. Inorganic-organic rubbery scintillators

    CERN Document Server

    Gektin, A V; Pogorelova, N; Neicheva, S; Sysoeva, E; Gavrilyuk, V

    2002-01-01

    Spectral-kinetic luminescence properties of films, containing homogeneously dispersed scintillation particles of CsI, CsI:Tl, CsI:Na, and NaI:Tl in optically transparent organosiloxane matrix, are presented. Material is flexible and rubbery and in consequence the detectors of convenient shapes can be produced. It is found that luminescence spectra of the received films are identical whereas decay times are much shorter compared to the same ones of the corresponding single crystals. Layers with pure CsI demonstrate only the fast UV emission (307 nm, 10 ns) without blue microsecond afterglow typical for crystals. The films containing NaI:Tl are non-hygroscopic and preserve scintillation properties for a long time in humid atmosphere unlike single crystals. Organosiloxane layers with CsI:Tl particles provide high light output with good energy resolution for sup 5 sup 5 Fe, sup 1 sup 0 sup 9 Cd, sup 2 sup 4 sup 1 Am sources, and are capable of detecting both X-rays and alpha-, beta-particles.

  13. Scintillation properties of selected oxide monocrystals activated with Ce and Pr

    Science.gov (United States)

    Wojtowicz, Andrzej J.; Drozdowski, Winicjusz; Wisniewski, Dariusz; Lefaucheur, Jean-Luc; Galazka, Zbigniew; Gou, Zhenhui; Lukasiewicz, Tadeusz; Kisielewski, Jaroslaw

    2006-01-01

    In the last 10-15 years there has been a significant effort toward development of new, more efficient and faster materials for detection of ionizing radiation. A growing demand for better scintillator crystals for detection of 511 keV gamma particles has been due mostly to recent advances in modern imaging systems employing positron emitting radionuclides for medical diagnostics in neurology, oncology and cardiology. While older imaging systems were almost exclusively based on BGO and NaI:Tl crystals the new systems, e.g., ECAT Accel, developed by Siemens/CTI, are based on recently discovered and developed LSO (Lu 2SiO 5:Ce, Ce-activated lutetium oxyorthosilicate) crystals. Interestingly, despite very good properties of LSO, there still is a strong drive toward development of new scintillator crystals that would show even better performance and characteristics. In this presentation we shall review spectroscopic and scintillator characterization of new complex oxide crystals, namely LSO, LYSO, YAG, LuAP (LuAlO 3, lutetium aluminate perovskite) and LuYAP activated with Ce and Pr. The LSO:Ce crystals have been grown by CTI Inc (USA), LYSO:Ce, LuAP:Ce and LuYAP:Ce crystals have been grown by Photonic Materials Ltd., Scotland (PML is the only company providing large LuAP:Ce crystals on a commercial scale), while YAG:Pr and LuAP:Pr crystals have been grown by Institute of Electronic Materials Technology (Poland). All these crystals have been characterized at Institute of Physics, N. Copernicus University (Poland). We will review and compare results of measurements of radioluminescence, VUV spectroscopy, scintillation light yields, scintillation time profiles and low temperature thermoluminescence performed on these crystals. We will demonstrate that all experiments clearly indicate that there is a significant room for improvement of LuAP, LuYAP and YAG. While both Ce-activated LSO and LYSO perform very well, we also note that LuYAP:Ce, LuAP:Ce and YAG:Pr offer some

  14. The measurement of temperature effect of light output of scintillators

    International Nuclear Information System (INIS)

    Ji Changsong; Zhou Zaiping; Zhang Longfang

    1999-01-01

    The author describes a experiment equipment used for measurement of temperature effect of light output of scintillators; gives some measurement results of temperature effect of light output for NaI(Tl), CsI(Tl), plastic scintillator, ZnS(Ag), anthracene crystal glass scintillator; analyzes the error factors affecting the measurement results. The total uncertainty of the temperature effect measurement for NaI(Tl) and plastic scintillator is 11%

  15. Effects of Na and K co-doping on growth and scintillation properties of Eu:SrI.sub.2./sub. crystals\

    Czech Academy of Sciences Publication Activity Database

    Ito, T.; Yokota, Y.; Kurosawa, S.; Král, Robert; Pejchal, Jan; Ohashi, Y.; Kamada, K.; Nikl, Martin; Yoshikawa, A.

    2016-01-01

    Roč. 90, Jul (2016), 157-161 ISSN 1350-4487 R&D Projects: GA MŠk(CZ) LH14266 Institutional support: RVO:68378271 Keywords : Eu:SrI 2 * scintillator * single crystal * alkali metal * light yield * non-proportionality Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.442, year: 2016

  16. Cosmic ray effect on the X-ray Trigger Telescope of UFFO/Lomonosov using YSO scintillation crystal array in space

    DEFF Research Database (Denmark)

    Kim, M. B.; Jeong, S.; Jeong, H. M.

    2017-01-01

    UFFO Burst Alert and Trigger telescope (UBAT) is the X-ray trigger telescope of UFFO/Lomonosov to localize X-ray source with coded mask method and X-ray detector. Its X-ray detector is made up of 36 8×8 pixels Yttrium OxyorthoSilicate (Y2SiO5:Ce, YSO) scintillation crystal arrays and 36 64-channe...

  17. Comparative study of optical and scintillation properties of YVO4, (Lu0.5Y0.5)VO4, and LuVO4 single crystals

    International Nuclear Information System (INIS)

    Fujimoto, Yutaka; Yanagida, Takayuki; Yokota, Yuui; Chani, Valery; Kochurikhin, Vladimir V.; Yoshikawa, Akira

    2011-01-01

    Optical and scintillation properties of YVO 4 , (Lu 0.5 Y 0.5 )VO 4 , and LuVO 4 single crystals grown by the Czochralski (CZ) method with RF heating system are compared. All vanadate crystals show high transmittance (∼80%) in the 400-900 nm wavelength range. In both photo- and radio-luminescence spectra, intense peak around 400-500 nm, which was ascribed to the transition from triplet state of VO 4 3- , was clearly observed. The main decay time component was about 38 μs (YVO 4 ), 18 μs ((Lu 0.5 Y 0.5 )VO 4 ), and 17 μs (LuVO 4 ) under 340 nm excitation. The scintillation light yields of YVO 4 , (Lu 0.5 Y 0.5 )VO 4 , and LuVO 4 crystals (obtained from the 137 Cs excited pulse height spectra) were evaluated to be about 11,200, 10,700, and 10,300 ph/MeV, respectively.

  18. New heavy scintillating materials for precise heterogeneous EM-calorimeters

    International Nuclear Information System (INIS)

    Britvich, G.I.; Britvich, I.G.; Vasil'chenko, V.G.; Lishin, V.A.; Obraztsov, V.F.; Polyakov, V.A.; Solovjev, A.S.; Ryzhikov, V.D.

    2001-01-01

    This investigation shows some optical and scintillation properties of new scintillating media, based on heavy composite materials and an inorganic crystal CsI:Br, intended for the creation of precise heterogeneous EM-calorimeters with the energy resolution σ/E congruent with 4-5% E-radical. The possibility to use cheap heavy scintillating plates based on optical ceramics as active media in heterogeneous EM-calorimeters is considered

  19. Scintillation crystal mounting apparatus

    International Nuclear Information System (INIS)

    Engdahl, L.W.; Deans, A.J.

    1982-01-01

    An improved detector head for a gamma camera is disclosed. The detector head includes a housing and a detector assembly mounted within the housing. Components of the detector assembly include a crystal sub-assembly, a phototube array, and a light pipe between the phototube array and crystal sub-assembly. The invention provides a unique structure for maintaining the phototubes in optical relationship with the light pipe and preventing the application of forces that would cause the camera's crystal to crack

  20. Perspectives on the future development of new scintillators

    International Nuclear Information System (INIS)

    Melcher, C.L.

    2005-01-01

    The search for new scintillators has become increasingly sophisticated and increasingly successful in recent years, driven to a large degree by the rapidly growing needs of medical imaging and high energy physics. Better understanding of the various scintillation mechanisms has led to innovative new materials for both gamma-ray and neutron detection, and the concept of scintillator design and engineering has emerged, whereby materials are optimized according to the scintillation properties needed by specific applications. Numerous promising candidates have been identified during the last few years, and several are currently being actively developed for commercial production. Economical crystal growth often represents a significant challenge in the practical application of new scintillation materials

  1. Ultrasound-Assisted Extraction of Stilbenes from Grape Canes.

    Science.gov (United States)

    Piñeiro, Zulema; Marrufo-Curtido, Almudena; Serrano, Maria Jose; Palma, Miguel

    2016-06-16

    An analytical ultrasound-assisted extraction (UAE) method has been optimized and validated for the rapid extraction of stilbenes from grape canes. The influence of sample pre-treatment (oven or freeze-drying) and several extraction variables (solvent, sample-solvent ratio and extraction time between others) on the extraction process were analyzed. The new method allowed the main stilbenes in grape canes to be extracted in just 10 min, with an extraction temperature of 75 °C and 60% ethanol in water as the extraction solvent. Validation of the extraction method was based on analytical properties. The resulting RSDs (n = 5) for interday/intraday precision were less than 10%. Furthermore, the method was successfully applied in the analysis of 20 different grape cane samples. The result showed that grape cane byproducts are potentially sources of bioactive compounds of interest for pharmaceutical and food industries.

  2. SiPM optical crosstalk amplification due to scintillator crystal: effects on timing performance

    International Nuclear Information System (INIS)

    Gola, Alberto; Ferri, Alessandro; Tarolli, Alessandro; Zorzi, Nicola; Piemonte, Claudio

    2014-01-01

    For a given photon detection efficiency (PDE), the primary, Poisson distributed, dark count rate of the detector (DCR 0 ) is one of the most limiting factors affecting the timing resolution of a silicon photomultiplier (SiPM) in the scintillation light readout. If the effects of DCR 0  are removed through a suitable baseline compensation algorithm or by cooling, it is possible to clearly observe another phenomenon that limits the PDE, and thus the timing resolution of the detector. It is caused by the optical crosstalk of the SiPM, which is significantly increased by the presence of the scintillator. In this paper, we describe this phenomenon, which is also easily observed from the reverse I–V curve of the device, and we relate it to the measured coincidence resolving time in 511 keV γ-ray measurements. We discuss its consequences on the SiPM design and, in particular, we observe that there is an optimal cell size, dependent on both SiPM and crystal parameters, that maximizes the PDE in presence of optical crosstalk. Finally, we report on a crosstalk simulator developed to study the phenomenon and we compare the simulation results obtained for different SiPM technologies, featuring different approaches to the reduction of the crosstalk. (paper)

  3. Cerium doped lanthanum halides: fast scintillators for medical imaging

    International Nuclear Information System (INIS)

    Selles, O.

    2006-12-01

    This work is dedicated to two recently discovered scintillating crystals: cerium doped lanthanum halides (LaCl 3 :Ce 3+ and LaBr 3 :Ce 3+ ).These scintillators exhibit interesting properties for gamma detection, more particularly in the field of medical imaging: a short decay time, a high light yield and an excellent energy resolution. The strong hygroscopicity of these materials requires adapting the usual experimental methods for determining physico-chemical properties. Once determined, these can be used for the development of the industrial manufacturing process of the crystals. A proper comprehension of the scintillation mechanism and of the effect of defects within the material lead to new possible ways for optimizing the scintillator performance. Therefore, different techniques are used (EPR, radioluminescence, laser excitation, thermally stimulated luminescence). Alongside Ce 3+ ions, self-trapped excitons are involved in the scintillation mechanism. Their nature and their role are detailed. The knowledge of the different processes involved in the scintillation mechanism leads to the prediction of the effect of temperature and doping level on the performance of the scintillator. A mechanism is proposed to explain the thermally stimulated luminescence processes that cause slow components in the light emission and a loss of light yield. Eventually the study of afterglow reveals a charge transfer to deep traps involved in the high temperature thermally stimulated luminescence. (author)

  4. Characteristics of Un doped and Europium-doped SrI2 Scintillator Detectors

    International Nuclear Information System (INIS)

    Sturm, Benjamin; Cherepy, Nerine; Drury, Owen; Thelin, P.; Fisher, S.E.; O'Neal, S.P.; Payne, Stephen A.; Burger, Arnold; Boatner, Lynn A.; Ramey, Joanne Oxendine; Shah, Kanai; Hawrami, Rastgo

    2012-01-01

    High energy resolution gamma-ray detectors that can be formed into relatively large sizes while operating at room temperature offer many advantages for national security applications. We are working toward that goal through the development of SrI 2 (Eu) scintillator detectors, which routinely provide ;10 cm 3 . In this study, we have tested pure, undoped SrI 2 to gain a better understanding of the scintillation properties and spectroscopic performance achievable without activation. An undoped crystal grown from 99.999% pure SrI 2 pellets was tested for its spectroscopic performance, its light yield, and uniformity of scintillation light collection as a function of gamma-ray interaction position relative to the crystal growth direction. Undoped SrI 2 was found to provide energy resolution of 5.3% at 662 keV, and the light collection nonuniformity varied by only 0.72% over the length of the crystal. Measurements of both a 3% Eu-doped and the undoped SrI 2 crystal were carried out in the SLYNCI facility and indicate differences in their light yield non-proportionality. The surprisingly good scintillation properties of the pure SrI 2 crystal suggests that with high-purity feedstock, further reduction of the Eu concentration can be made to grow larger crystals while not adversely impacting the spectroscopic performance.

  5. MgO reflectance data for Monte Carlo simulation of LaBr{sub 3}:Ce scintillation crystals

    Energy Technology Data Exchange (ETDEWEB)

    Scafè, Raffaele, E-mail: raffaele.scafe@uniroma1.it [Dept. of Molecular Medicine, Sapienza University of Rome, Viale Regina Elena 324, I-00161 Rome (Italy); Pani, Roberto; Pellegrini, Rosanna; Cinti, Maria Nerina [Dept. of Molecular Medicine, Sapienza University of Rome, Viale Regina Elena 324, I-00161 Rome (Italy); Bennati, Paolo [INFN-Roma I, Italian National Institute of Nuclear Physics, Piazzale Aldo Moro 5, I-00185 Rome (Italy); Lo Meo, Sergio [National Institution for Insurance against Accidents at Work, Via Fontana Candida 1, I-00040, Monte Porzio Catone (Italy)

    2013-02-11

    Present paper is aimed to estimate the spectral reflectance of MgO as a function of layer thickness around LaBr{sub 3}:5%Ce crystals. A reference emission spectrum of scintillator was calculated averaging 15 experimental trends from literature. A survey on MgO reflectance provided experimental data in the wavelength region of interest without thickness information, while trends with dimensional facts were found in the adjacent wavelength region. An algorithm was developed for interpolating spectral data in the wavelength region of interest for given thickness. A comparison between reflectors for LaBr{sub 3}:Ce is summarized in Appendix A. Results are presented in form of weighted average values as well as numerical trends suitable, in particular, as input for Monte Carlo simulations of encapsulated crystals.

  6. Piceatannol and Other Wine Stilbenes: A Pool of Inhibitors against α-Synuclein Aggregation and Cytotoxicity

    Directory of Open Access Journals (Sweden)

    Hamza Temsamani

    2016-06-01

    Full Text Available The aggregation of α-synuclein is one on the key pathogenic events in Parkinson’s disease. In the present study, we investigated the inhibitory capacities of stilbenes against α-synuclein aggregation and toxicity. Thioflavin T fluorescence, transmission electronic microscopy, and SDS-PAGE analysis were performed to investigate the inhibitory effects of three stilbenes against α-synuclein aggregation: piceatannol, ampelopsin A, and isohopeaphenol. Lipid vesicle permeabilization assays were performed to screen stilbenes for protection against membrane damage induced by aggregated α-synuclein. The viability of PC12 cells was examined using an MTT assay to assess the preventive effects of stilbenes against α-synuclein-induced toxicity. Piceatannol inhibited the formation of α synuclein fibrils and was able to destabilize preformed filaments. It seems to induce the formation of small soluble complexes protecting membranes against α-synuclein-induced damage. Finally, piceatannol protected cells against α-synuclein-induced toxicity. The oligomers tested (ampelopsin A and hopeaphenol were less active.

  7. Scintillator structure

    International Nuclear Information System (INIS)

    Cusano, D.A.; Prener, J.S.

    1979-01-01

    A scintillator structure comprises at least one layer of transparent fused quartz with a phosphor coating on one or both sides adjacent to at least one transparent layer of epoxy resin which directs light from the phosphor to a detector. The phosphor layer may be formed from a powder optionally with a binder, a single crystal or a melt, or by evaporation or sintering. A plurality of multiple layers may be used or the structure tilted for greater absorption. The structure may be surrounded by another such structure optionally operating in cascade with the first. Many phosphors are specified. A scintillator structure comprises phosphor particles dispersed in epoxy resin or copoly imide-silicone and cast in a multi-compartment box with long sides transparent to X-rays and dividers opaque to X-rays. (UK)

  8. Chloride, bromide and iodide scintillators with europium

    Science.gov (United States)

    Zhuravleva, Mariya; Yang, Kan

    2016-09-27

    A halide scintillator material is disclosed where the halide may comprise chloride, bromide or iodide. The material is single-crystalline and has a composition of the general formula ABX.sub.3 where A is an alkali, B is an alkali earth and X is a halide which general composition was investigated. In particular, crystals of the formula ACa.sub.1-yEu.sub.yI.sub.3 where A=K, Rb and Cs were formed as well as crystals of the formula CsA.sub.1-yEu.sub.yX.sub.3 (where A=Ca, Sr, Ba, or a combination thereof and X=Cl, Br or I or a combination thereof) with divalent Europium doping where 0.ltoreq.y.ltoreq.1, and more particularly Eu doping has been studied at one to ten mol %. The disclosed scintillator materials are suitable for making scintillation detectors used in applications such as medical imaging and homeland security.

  9. Efficiency and yield spectra of inorganic scintillates

    International Nuclear Information System (INIS)

    Rodnyi, P.A.

    1998-01-01

    Recent developments in the field of energy loss in inorganic scintillators are reviewed. The main parameters, which control the fundamental limit of the scintillator energy efficiency, are determined. It is shown that together with simple cascade processes one should take into account the production of plasmons to estimate the energy efficiency of scintillators or other phosphors excited by an ionizing radiation. Core-to-valence luminescence related to 5pCs→3pCl transitions is investigated in some chlorides: CsCl, KCl, RbCl, NaCl, KCaCl 3 , RbCaCl 3 . The yield spectra of the crystals in the VUV and X-ray regions are also studied. It is shown that the 4pRb-core states are involved in the process of creation of holes in the 5pCs-core band in Rb-based crystals. The formation of holes in the potassium core band acts as a competing process and suppresses the radiative core-to-valence transitions

  10. Crystal growth and luminescence properties of Yb.sub.2./sub.Si.sub.2./sub.O.sub.7./sub. infra-red emission scintillator

    Czech Academy of Sciences Publication Activity Database

    Horiai, T.; Kurosawa, S.; Murakami, R.; Pejchal, Jan; Yamaji, A.; Shoji, Y.; Chani, V.I.; Ohashi, Y.; Kamada, K.; Yokota, Y.; Yoshikawa, A.

    2016-01-01

    Roč. 58, Aug (2016), s. 14-17 ISSN 0925-3467 R&D Projects: GA MŠk(CZ) LH14266 Institutional support: RVO:68378271 Keywords : scintillator * pyrosilicate * charge transfer * infra-red * single crystal Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.238, year: 2016

  11. Modular scintillation camera

    International Nuclear Information System (INIS)

    Barrett, H. H.

    1985-01-01

    Improved optical coupling modules to be used in coded-aperture-type radiographic imaging systems. In a first system, a rotating slit coded-aperture is employed between the radioactive object and the module. The module consists of one pair of side-by-side photomultipliers receiving light rays from a scintillation crystal exposed to the object via the coded-aperture. The light rays are guided to the photomultipliers by a mask having a central transverse transparent window, or by a cylindrical lens, the mask or lens being mounted in a light-conveying quartz block assembly providing internal reflections at opposite faces of the assembly. This generates output signals from the photomultipliers which can be utilized to compute one-dimensional coordinate values for restoring the image of the radioactive object on a display screen. In another form of optical coupling module, usable with other types of coded-apertures, four square photomultipliers form a substantially square block and receive light rays from scintillations from a scintillation crystal exposed to the radioactive object via the coded-aperture. The light rays are guided to the photomultipliers by a square mask or a centrally transparent square lens configuration mounted in a light-conveying assembly formed by internally reflecting quartz blocks, the optical rays being directed to the respective photomultipliers so as to generate resultant output signals which can be utilized to compute image coordinate values for two-dimensional representation of the radioactive object being examined

  12. An ideal scintillator – ZnO:Sc for sub-nanosecond pulsed radiation detection

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Kan, E-mail: zhangkan8414@163.com [Northwest Institute of Nuclear Technology, Xi’an 710024 (China); Ouyang, Xiaoping [Northwest Institute of Nuclear Technology, Xi’an 710024 (China); Xi’an Jiaotong University, Xi’an 710049 (China); Song, Zhaohui; Han, Hetong [Northwest Institute of Nuclear Technology, Xi’an 710024 (China); Zuo, Yanbin [China Nonferrous Metal Guilin Research Institute of Geology for Mineral Resource, Guilin 541004 (China); Guan, Xingyin [Northwest Institute of Nuclear Technology, Xi’an 710024 (China); Xi’an Jiaotong University, Xi’an 710049 (China); Tan, Xinjian; Zhang, Zichuan; Liu, Junhong [Northwest Institute of Nuclear Technology, Xi’an 710024 (China)

    2014-08-21

    ZnO-based scintillators are particularly well suited for use as ultrafast pulsed radiation detectors which have shown broad application prospects in various fields such as the inertial confinement fusion (ICF) diagnosis, the nuclear reaction mechanism, etc. Using the hydro-thermal method, a ZnO single-crystal doped with Scandium (ZnO:Sc) sample was prepared. As a new ZnO-based scintillator, the scintillation characteristics of ZnO:Sc have not been reported previously. In this paper, optical and scintillation characteristics of ZnO:Sc single-crystal were studied. Also a scintillation detector based on ZnO:Sc was designed. Excited by the alpha-particle, the rise time of ZnO:Sc detectors was from 162.5 to 170.7 ps, and the fall time was from 300.4 to 328.8 ps.

  13. An ideal scintillator – ZnO:Sc for sub-nanosecond pulsed radiation detection

    International Nuclear Information System (INIS)

    Zhang, Kan; Ouyang, Xiaoping; Song, Zhaohui; Han, Hetong; Zuo, Yanbin; Guan, Xingyin; Tan, Xinjian; Zhang, Zichuan; Liu, Junhong

    2014-01-01

    ZnO-based scintillators are particularly well suited for use as ultrafast pulsed radiation detectors which have shown broad application prospects in various fields such as the inertial confinement fusion (ICF) diagnosis, the nuclear reaction mechanism, etc. Using the hydro-thermal method, a ZnO single-crystal doped with Scandium (ZnO:Sc) sample was prepared. As a new ZnO-based scintillator, the scintillation characteristics of ZnO:Sc have not been reported previously. In this paper, optical and scintillation characteristics of ZnO:Sc single-crystal were studied. Also a scintillation detector based on ZnO:Sc was designed. Excited by the alpha-particle, the rise time of ZnO:Sc detectors was from 162.5 to 170.7 ps, and the fall time was from 300.4 to 328.8 ps

  14. Ultrasound-Assisted Extraction of Stilbenes from Grape Canes

    Directory of Open Access Journals (Sweden)

    Zulema Piñeiro

    2016-06-01

    Full Text Available An analytical ultrasound-assisted extraction (UAE method has been optimized and validated for the rapid extraction of stilbenes from grape canes. The influence of sample pre-treatment (oven or freeze-drying and several extraction variables (solvent, sample-solvent ratio and extraction time between others on the extraction process were analyzed. The new method allowed the main stilbenes in grape canes to be extracted in just 10 min, with an extraction temperature of 75 °C and 60% ethanol in water as the extraction solvent. Validation of the extraction method was based on analytical properties. The resulting RSDs (n = 5 for interday/intraday precision were less than 10%. Furthermore, the method was successfully applied in the analysis of 20 different grape cane samples. The result showed that grape cane byproducts are potentially sources of bioactive compounds of interest for pharmaceutical and food industries.

  15. Studies of scintillation light nonproportionality of ZnSe(Te), CsI(Tl) and YAP(Ce) crystals using heavy ions

    CERN Document Server

    Klamra, W; Kapusta, M; Kérek, A; Moszynski, M; Norlin, L O; Novák, D; Possnert, G

    2002-01-01

    The scintillation light yield for ZnSe(Te), CsI(Tl) and YAP(Ce) crystals have been studied with alpha particles, sup 1 sup 2 C and sup 8 sup 1 Br in the energy region 2.8-42.2 MeV. A nonproportional behavior was observed, mostly pronounced for alpha particles on YAP(Ce). The results are understood in terms of delta-rays effect.

  16. New Tl{sub 2}LaBr{sub 5}: Ce{sup 3+} crystal scintillator for γ-rays detection

    Energy Technology Data Exchange (ETDEWEB)

    Kim, H.J., E-mail: hongjoo@knu.ac.kr [Department of Physics, Kyungpook National University, Daegu 41566 (Korea, Republic of); Rooh, Gul [Department of Physics, Abdul Wali Khan University, Mardan 23200 (Pakistan); Khan, Arshad [Department of Physics, Kyungpook National University, Daegu 41566 (Korea, Republic of); Kim, Sunghwan [Department of Radiological Science, Cheongju University, Cheongju 41566 (Korea, Republic of)

    2017-03-21

    In this study we present our preliminary report on the scintillation properties of new Ce-doped Tl{sub 2}LaBr{sub 5} single crystal. Two zones vertical Bridgman technique is used for the growth of this compound. Pure and Ce-doped samples showed maximum emission peaks at 435 nm and 415 nm, respectively. Best light yield of 43,000±4300 ph/MeV with 6.3% (FWHM) energy resolution is obtained for 5% Ce-doped sample under γ-ray excitation. Single exponential decay time constant of 25 ns is observed for 5% Ce doped sample. Effective Z-number is found to be 67, therefore efficient detection of X- and γ-ray will be possible. Preliminary results revealed that this compound will be an ideal candidate for the medical imaging techniques. Further investigations are under way for the determination of optimized conditions of this compound. - Highlights: • Scintillation characterization of Tl{sub 2}LaBr{sub 5}: Ce{sup 3+} crystals are presented. • This material is grown by two zone vertical Bridgman technique. • It has high Z{sub eff} therefore, detection efficiency of γ-rays will be higher. • Energy resolution of 6.3% and light yield of 43,000±4300 ph/MeV are obtained. • Single exponential decay of 25 ns is observed under γ-ray excitation.

  17. Low temperature scintillation in ZnSe crystals

    Czech Academy of Sciences Publication Activity Database

    Dafinei, I.; Fasoli, M.; Ferroni, F.; Mihóková, Eva; Orio, F.; Pirro, S.; Vedda, A.

    2010-01-01

    Roč. 57, č. 3 (2010), 1470-1474 ISSN 0018-9499 Institutional research plan: CEZ:AV0Z10100521 Keywords : bolometers * double beta decay * scintillation detectors * ZnSe Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.519, year: 2010

  18. The γ rays sensitivity measurement of CeF3 scintillator detector

    International Nuclear Information System (INIS)

    Hu Mengchun; Zhou Dianzhong; Li Rurong; Wang Zhentong; Yang Hongqiong; Zhang Jianhua; Hu Qingyuan; Peng Taiping

    2003-01-01

    The CeF 3 is an abio-scintillator developed in recent years, which are insensitive to neutron and sensitive to gamma rays and respond quickness. The relationship of CeF 3 scintillation detector gamma rays sensitivity with the change of crystal thickness was measured. The CeF 3 scintillation detector is composed by high liner current photomultiplier tube of CHφT3, CHφT5 and CeF 3 scintillator. The detector gamma rays sensitivity of purple photocell and common photocell with CeF 3 scintillator were measured too

  19. Improved Growth Methods for LaBr3 Scintillation Radiation Detectors

    International Nuclear Information System (INIS)

    McGregor, Douglas S.

    2011-01-01

    The objective is to develop advanced materials for deployment as high-resolution gamma ray detectors. Both LaBr3 and CeBr3 are advanced scintillation materials, and will be studied in this research. Prototype devices, in collaboration Sandia National Laboratories, will be demonstrated along with recommendations for mass production and deployment. It is anticipated that improved methods of crystal growth will yield larger single crystals of LaBr3 for deployable room-temperature operated gamma radiation spectrometers. The growth methods will be characterized. The LaBr3 and CeBr3 scintillation crystals will be characterized for light yield, spectral resolution, and for hardness.

  20. Scintillator studies for the HPD-PET concept

    CERN Document Server

    Braem, D; Ciocia, F; De Leo, R; Joram, C; Lagamba, L; Nappi, E; Séguinot, Jacques; Vilardi, I; Weilhammer, P

    2007-01-01

    The spatial, energy, and time resolutions of 10 cm long polished YAP:Ce and LYSO:Ce crystals have been measured. The work is part of the novel HPD-PET concept, based on a full three-dimensional, free of parallax errors, reconstruction of the γ-ray interaction point in 10–15 cm long scintillators. The effective light attenuation length, a key parameter of the HPD-PET concept, and the resolutions have been measured for various wrappings and coatings of the crystal lateral surfaces. Even if the final HPD-PET prototype could use scintillators and/or wrappings different from those tested, the results here presented prove the feasibility of the concept and provide hints on its potential capabilities.

  1. Effect of stilbene resveratrol on haematological indices of rats

    Czech Academy of Sciences Publication Activity Database

    Doubek, J.; Volný, T.; Lojek, Antonín; Knotková, Z.; Kotrbáček, V.; Scheer, P.; Holešovská, Z.

    2005-01-01

    Roč. 74, č. 2 (2005), s. 205-208 ISSN 0001-7213 Institutional research plan: CEZ:AV0Z50040507 Keywords : antioxidative capacity * stilbene-resveratrol Subject RIV: BO - Biophysics Impact factor: 0.353, year: 2005

  2. Luminescent properties of Cr-doped (Gd.sub.x./sub., Y.sub.1-x./sub.).sub.3./sub.Al.sub.5./sub.O.sub.12./sub. infra-red scintillator crystals

    Czech Academy of Sciences Publication Activity Database

    Suzuki, A.; Kurosawa, S.; Yamaji, A.; Shoji, Y.; Pejchal, Jan; Kamada, K.; Yokota, Y.; Yoshikawa, A.

    2014-01-01

    Roč. 36, č. 12 (2014), s. 1938-1941 ISSN 0925-3467. [International Symposium on Laser, Scintillator and Non Linear Optical Materials (ISLNOM) /6./. Shanghai, 20.10.2013-23.10.2013] Institutional support: RVO:68378271 Keywords : infra-red scintillator * patient dosimetry * Cr-doped oxide garnet * bulk crystal Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.981, year: 2014

  3. CMS lead tungstate crystals

    CERN Multimedia

    Laurent Guiraud

    2000-01-01

    These crystals are made from lead tungstate, a crystal that is as clear as glass yet with nearly four times the density. They have been produced in Russia to be used as scintillators in the electromagnetic calorimeter on the CMS experiment, part of the LHC project at CERN. When an electron, positron or photon passes through the calorimeter it will cause a cascade of particles that will then be absorbed by these scintillating crystals, allowing the particle's energy to be measured.

  4. Comparison of the methods for determination of scintillation light yield

    CERN Document Server

    Sysoeva, E; Zelenskaya, O

    2002-01-01

    One of the most important characteristics of scintillators is the light yield. It depends not only on the properties of scintillators, but also on the conditions of measurements. Even for widely used crystals, such as alkali halide scintillators NaI(Tl) and CsI(Tl), light yield data, obtained by various authors, are different. Therefore, it is very important to choose the convenient method of the light yield measurements. In the present work, methods for the determination of the physical light yield, based on measurements of pulse amplitude, single-electron pulses and intrinsic photomultiplier resolution are discussed. These methods have been used for the measurements of light yield of alkali halide crystals and oxide scintillators. Repeatability and reproducibility of results were determined. All these methods are rather complicated in use, not for measurements, but for further data processing. Besides that, they demand a precise determination of photoreceiver's parameters, as well as determination of light ...

  5. Growth and radioluminescence of metal elements doped LiCaAlF.sub.6./sub. single crystals for neutron scintillator

    Czech Academy of Sciences Publication Activity Database

    Tanaka, Ch.; Yokota, Y.; Kurosawa, S.; Yamaji, A.; Jarý, Vítězslav; Babin, Vladimir; Pejchal, Jan; Ohashi, Y.; Kamada, K.; Nikl, Martin; Yoshikawa, A.

    2016-01-01

    Roč. 90, Jul (2016), s. 170-173 ISSN 1350-4487. [International Conference on Luminescent Detectors and Transformers of Ionizing Radiation (LUMDETR). Tartu (Estonsko), 20.09.2015-25.09.2015] R&D Projects: GA MŠk(CZ) LH14266 Institutional support: RVO:68378271 Keywords : neutron scintillator * LiCaAlF 6 * Pb2+ * single crystal Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.442, year: 2016

  6. Scintillation properties of Er-doped Y3Al5O12 single crystals

    International Nuclear Information System (INIS)

    Yamaji, Akihiro; Ogino, Hiraku; Fujimoto, Yutaka; Suzuki, Akira; Yanagida, Takayuki; Yokota, Yuui; Kurosawa, Shunsuke; Yoshikawa, Akira

    2013-01-01

    Er-doped Y 3 Al 5 O 12 single crystals with different Er concentrations of 0.1, 1.0, 10, 30, and 50% were grown by the micro-pulling down method. There were several absorption lines due to the Er 3+ 4f-4f transitions in the transmittance spectra and these lines correspond to the transitions from the ground state of 4 I 15/2 to the excited states. The photo- and radio-luminescence spectra showed Er 3+ 4f-4f emissions. Relative light yield under 5.5 MeV alpha-ray irradiation of Er 0.1%:Y 3 Al 5 O 12 was estimated to be 63% of that of Bi 4 Ge 3 O 12 . -- Highlights: •Er doped Y 3 Al 5 O 12 single crystal scintillators were grown with different Er concentrations. •Optical properties associated with 4f-4f transition were evaluated. •Radio luminescence spectra measurements were performed under 5.5 MeV alpha-ray irradiation. •The highest light yield was estimated to be 63% of that of Bi 4 Ge 3 O 12 under 5.5 MeV alpha-ray irradiation

  7. Pulse shaper for scintillation detectors with NaI(Tl) or CsI(Tl) crystals

    International Nuclear Information System (INIS)

    Novisov, B.S.; Maksimenko, A.S.; Baryshev, A.V.; Zhukov, A.V.

    1978-01-01

    The basic circuit of a signal shaper for scintillation detectors with NaI(Tl) and CsI(Tl) crystals is described. To increase amplitude resolution, it is suggested to integrate not the whole charge at the photomultiplier output, but a part of the charge during the initial 100 ns of the current pulse; the remaining part of the current signal is compensated directly at the photomultiplier anode by means of an electric circuit. The principal elements of the spectrometric signal shaper include an input transistor amplifier, a compensation circuit, a key element, a shaper amplifier of time pulses, a shaper of signal duration for controlling the key element, and an output spectrometric amplifier. This device, being used, one can shape pulses at durations of 100 ns and more. The shaper restoration time does not exceed 50 ns. When the shaper operates with NaI(Tl) crystals and at counting rate of 10 6 pulse/s, the amplitude resolution with and without the compensation circuit is 17% and 21% respectively

  8. Crystal growth and scintillation properties of Er-doped Lu{sub 3}Al{sub 5}O{sub 12} single crystals

    Energy Technology Data Exchange (ETDEWEB)

    Sugiyama, Makoto, E-mail: makoto.sugiyama@imr.tohoku.ac.jp [Institute for Materials Research, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai, Miyagi 980-8577 (Japan); Fujimoto, Yutaka [Institute for Materials Research, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai, Miyagi 980-8577 (Japan); Yanagida, Takayuki [New Industry Creation Hatchery Center (NICHe), Tohoku University, 6-6-10 Aoba, Aramaki, Aoba-ku, Sendai, Miyagi 980-8579 (Japan); Totsuka, Daisuke [Institute for Materials Research, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai, Miyagi 980-8577 (Japan); Nihon Kessho Kogaku Co. Ltd., 810-5 Nobe-cho Tatebayashi Gunma (Japan); Kurosawa, Shunsuke; Futami, Yoshisuke; Yokota, Yuui; Chani, Valery [Institute for Materials Research, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai, Miyagi 980-8577 (Japan); Yoshikawa, Akira [Institute for Materials Research, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai, Miyagi 980-8577 (Japan); New Industry Creation Hatchery Center (NICHe), Tohoku University, 6-6-10 Aoba, Aramaki, Aoba-ku, Sendai, Miyagi 980-8579 (Japan)

    2012-02-01

    Er-doped Lu{sub 3}Al{sub 5}O{sub 12} (Er:LuAG) single crystalline scintillators with different Er concentrations of 0.1, 0.5, 1, and 3% were grown by the micro-pulling-down ({mu}-PD) method. The grown crystals were composed of single-phase material, as demonstrated by powder X-ray diffraction (XRD). The radioluminescence spectra measured under {sup 241}Am {alpha}-ray excitation indicated host emission at approximately 350 nm and Er{sup 3+} 4f-4f emissions. According to the pulse height spectra recorded under {gamma}-ray irradiation, the 0.5% Er:LuAG exhibited the highest peak channel among the samples. The {gamma}-ray excited decay time profiles were well fitted by the two-component exponential approximation (0.8 {mu}s and 6-10 {mu}s).

  9. Radon gamma-ray spectrometry with YAP:Ce scintillator

    CERN Document Server

    Plastino, W; De Notaristefani, F

    2002-01-01

    The detection properties of a YAP:Ce scintillator (YAlO sub 3 :Ce crystal) optically coupled to a Hamamatsu H5784 photomultiplier with standard bialkali photocathode have been analyzed. In particular, the application to radon and radon-daughters gamma-ray spectrometry was investigated. The crystal response has been studied under severe extreme conditions to simulate environments of geophysical interest, particularly those found in geothermal and volcanic areas. Tests in water up to a temperature of 100 deg.C and in acids solutions such as HCl (37%), H sub 2 SO sub 4 (48%) and HNO sub 3 (65%) have been performed. The measurements with standard radon sources provided by the National Institute for Metrology of Ionizing Radiations (ENEA) have emphasized the non-hygroscopic properties of the scintillator and a small dependence of the light yield on temperature and HNO sub 3. The data collected in this first step of our research have pointed out that the YAP:Ce scintillator can allow high response stability for rad...

  10. Chloride, bromide and iodide scintillators with europium doping

    Science.gov (United States)

    Zhuravleva, Mariya; Yang, Kan

    2014-08-26

    A halide scintillator material is disclosed where the halide may comprise chloride, bromide or iodide. The material is single-crystalline and has a composition of the general formula ABX.sub.3 where A is an alkali, B is an alkali earth and X is a halide which general composition was investigated. In particular, crystals of the formula ACa.sub.1-yEu.sub.yI.sub.3 where A=K, Rb and Cs were formed as well as crystals of the formula CsA.sub.1-yEu.sub.yX.sub.3 (where A=Ca, Sr, Ba, or a combination thereof and X=Cl, Br or I or a combination thereof) with divalent Europium doping where 0.ltoreq.y.ltoreq.1, and more particularly Eu doping has been studied at one to ten mol %. The disclosed scintillator materials are suitable for making scintillation detectors used in applications such as medical imaging and homeland security.

  11. Time of gamma radiation transport in NaI(Tl) scintillators

    International Nuclear Information System (INIS)

    Matarrita, A.S.

    1976-01-01

    The distribution of time intervals in function of the energy, ocurred between the incidence of a gamma radiation in the face of a scintillation crystal and the arrival of the correspondent scintillation at photocathode, is calculated. The mean square fluctuation these time interval, relating to resolution of the detector system is determined. The calculations are done for NaI (Tl) cylindrical crystals with the radiation source placed in the symmetry axis, in two situations: para axial incidence and oblique incidence, indicating a good agreement with experimental data. (M.C.K.) [pt

  12. Pulsed electric field treatment enhanced stilbene content in Graciano, Tempranillo and Grenache grape varieties.

    Science.gov (United States)

    López-Alfaro, Isabel; González-Arenzana, Lucía; López, Noelia; Santamaría, Pilar; López, Rosa; Garde-Cerdán, Teresa

    2013-12-15

    The purpose of this paper was to study the effect of pulsed electric fields (PEF) on the stilbene content of three grape varieties. For this purpose, four different PEF treatments were applied using a continuous system over three varieties, Graciano, Tempranillo and Grenache, destemmed and crushed. In addition, the influence of PEF on their physicochemical composition was studied. PEF treatments did not affect the pH or total acidity of Graciano, however, musts from Tempranillo and Grenache had higher pH values and lower total acidity. In the three varieties, all treatments resulted in an increase of potassium content, deeper colour intensity and total polyphenol index and lower tonality, more pronounced in the treatments with higher time and energy. The stilbene content of the must significantly increased with respect to the control. This increase depended on the variety and the treatment applied. Tempranillo increased up 200% the total stilbene concentration, Grenache 60% and Graciano 50%. For the three varieties, the treatment with the highest time and energy was the most effective on the total stilbene extraction. These results indicate that PEF could be a suitable technology for obtaining musts with deeper colour and higher phenolic content, including resveratrol and piceid. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Photoinduced gelation by stilbene oxalyl amide compounds.

    Science.gov (United States)

    Miljanić, Snezana; Frkanec, Leo; Meić, Zlatko; Zinić, Mladen

    2005-03-29

    Oxalyl amide derivatives bearing 4-dodecyloxy-stilbene as a cis-trans photoisomerizing unit were synthesized. The trans derivative acted as a versatile gelator of various organic solvents, whereas the corresponding cis derivative showed a poor gelation ability or none at all. In diluted solution (c = 2.0 x10(-5) mol dm(-3), ethanol), the cis isomer was photochemically converted into the trans isomer within 4 min. Depending on the radiation wavelength, the trans isomer was stable or liable to photodecomposition. When exposed to irradiation, a concentrated solution of the cis isomer (c = 2.0 x 10(-2) mol dm(-3), ethanol) turned into a gel. The FT-Raman, FT-IR, and 1H NMR spectra demonstrated that the gelation process occurred because of a rapid cis --> trans photoisomerization followed by a self-assembly of the trans molecules. Apart from the formation of hydrogen bonding between the oxalyl amide parts of the molecules, confirmed by FT-IR spectroscopy, it was assumed that the pi-pi stacking between the trans-stilbene units of the molecule and a lipophilic interaction between long alkyl chains were the interactions responsible for gelation.

  14. Characterization of a ZnSe scintillating bolometer prototype for neutrinoless double beta decay search

    Directory of Open Access Journals (Sweden)

    Tenconi M.

    2014-01-01

    Full Text Available As proposed in the LUCIFER project, ZnSe crystals are attractive materials to realize scintillating bolometers aiming at the search for neutrinoless double beta decay of the promising isotope 82Se. However, the optimization of the ZnSe-based detectors is rather complex and requires a wide-range investigation of the crystal features: optical properties, crystalline quality, scintillation yields and bolometric behaviour. Samples tested up to now show problems in the reproducibility of crucial aspects of the detector performance. In this work, we present the results obtained with a scintillating bolometer operated aboveground at about 25 mK. The detector energy absorber was a single 1 cm3 ZnSe crystal. The good energy resolution of the heat channel (about 14 keV at 1460 keV and the excellent alpha/beta discrimination capability are very encouraging for a successful realization of the LUCIFER program. The bolometric measurements were completed by optical tests on the crystal (optical transmission and luminescence measurements down to 10 K and investigation of the crystalline structure. The work here described provides a set of parameters and procedures useful for a complete pre-characterization of ZnSe crystals in view of the realization of highly performing scintillating bolometers.

  15. Scintillation Response of CaF2 to H and He over a Continuous Energy Range

    International Nuclear Information System (INIS)

    Zhang, Yanwen; Xiang, Xia; Weber, William J.

    2008-01-01

    Recent demands for new radiation detector materials with improved γ-ray detection performance at room temperature have prompted research efforts on both accelerated material discovery and efficient techniques that can be used to identify material properties relevant to detector performance. New material discovery has been limited due to the difficulties of large crystal growth to completely absorb γ-energies; whereas high-quality thin films or small crystals of candidate materials can be readily produced by various modern growth techniques. In this work, an ion-scintillator technique is demonstrated that can be applied to study scintillation properties of thin films and small crystals. The scintillation response of a benchmark scintillator, europium-doped calcium fluoride (CaF2:Eu), to energetic proton and helium ions is studied using the ion-scintillator approach based on a time of flight (TOF) telescope. Excellent energy resolution and fast response of the TOF telescope allow quantitative measurement of light yield, nonlinearity and energy resolution over an energy range from a few tens to a few thousands of keV

  16. LET dependence of scintillation yields in liquid argon

    Energy Technology Data Exchange (ETDEWEB)

    Doke, Tadayoshi; Hitachi, Akira; Kikuchi, Jun; Crawford, H J; Lindstrom, P J; Masuda, Kimiaki; Shibamura, Eido; Takahashi, Tan

    1988-06-01

    Scintillation yields (scintillation intensity per unit absorbed energy) in liquid argon for ionizing particles are reviewed as a function of LET for the particles. The maximum scintillation yield, which is obtained for relativistic heavy ions from Ne to La, is about 1.2 times larger than that for gamma rays in NaI(Tl) crystal. In the low LET region, the scintillation yields for relativistic electrons, protons and He ions are 10-20% lower than the maximum yield. This tendency can be explained by taking into account the existence of the electrons which have escaped from their parent ions. In the high LET region, a quenching effect due to high ionization density is observed for alpha particles, fission fragments and relativistic Au ions.

  17. Lithium indium diselenide: A new scintillator for neutron imaging

    Energy Technology Data Exchange (ETDEWEB)

    Lukosi, Eric, E-mail: elukosi@utk.edu [University of Tennessee, Knoxville, TN (United States); Herrera, Elan; Hamm, Daniel; Lee, Kyung-Min [University of Tennessee, Knoxville, TN (United States); Wiggins, Brenden [Y-12 National Security Complex, Oak Ridge, TN (United States); Trtik, Pavel [Paul Scherrer Institut, Villigen CH-5232 (Switzerland); Penumadu, Dayakar; Young, Stephen [University of Tennessee, Knoxville, TN (United States); Santodonato, Louis; Bilheux, Hassina [Oak Ridge National Laboratory, Oak Ridge, TN (United States); Burger, Arnold; Matei, Liviu [Fisk University, Nashville, TN (United States); Stowe, Ashley C. [University of Tennessee, Knoxville, TN (United States); Y-12 National Security Complex, Oak Ridge, TN (United States)

    2016-09-11

    Lithium indium diselenide, {sup 6}LiInSe{sub 2} or LISe, is a newly developed neutron detection material that shows both semiconducting and scintillating properties. This paper reports on the performance of scintillating LISe crystals for its potential use as a converter screen for cold neutron imaging. The spatial resolution of LISe, determined using a 10% threshold of the Modulation Transfer Function (MTF), was found to not scale linearly with thickness. Crystals having a thickness of 450 µm or larger resulted in an average spatial resolution of 67 µm, and the thinner crystals exhibited an increase in spatial resolution down to the Nyquist frequency of the CCD. The highest measured spatial resolution of 198 µm thick LISe (27 µm) outperforms a commercial 50 µm thick ZnS(Cu):{sup 6}LiF scintillation screen by more than a factor of three. For the LISe dimensions considered in this study, it was found that the light yield of LISe did not scale with its thickness. However, absorption measurements indicate that the {sup 6}Li concentration is uniform and the neutron absorption efficiency of LISe as a function of thickness follows general nuclear theory. This suggests that the differences in apparent brightness observed for the LISe samples investigated may be due to a combination of secondary charged particle escape, scintillation light transport in the bulk and across the LISe-air interface, and variations in the activation of the scintillation mechanism. Finally, it was found that the presence of {sup 115}In and its long-lived {sup 116}In activation product did not result in ghosting (memory of past neutron exposure), demonstrating potential of LISe for imaging transient systems.

  18. Thallium bromide photodetectors for scintillation detection

    CERN Document Server

    Hitomi, K; Shoji, T; Hiratate, Y; Ishibashi, H; Ishii, M

    2000-01-01

    A wide bandgap compound semiconductor, TlBr, has been investigated as a blue sensitive photodetector material for scintillation detection. The TlBr photodetectors have been fabricated from the TlBr crystals grown by the TMZ method using materials purified by many pass zone refining. The performance of the photodetectors has been evaluated by measuring their leakage current, quantum efficiency, spatial uniformity, direct X-ray detection and scintillation detection characteristics. The photodetectors have shown high quantum efficiency for the blue wavelength region and high spatial uniformity for their optical response. In addition, good direct X-ray detection characteristics with an energy resolution of 4.5 keV FWHM for 22 keV X-rays from a sup 1 sup 0 sup 9 Cd radioactive source have been obtained. Detection of blue scintillation from GSO and LSO scintillators irradiated with a sup 2 sup 2 Na radioactive source has been done successfully by using the photodetectors at room temperature. A clear full-energy pea...

  19. Scintillation camera for establishing the coordinates of a radiation stimuli produced by a radiation field

    International Nuclear Information System (INIS)

    Zioni, J.; Klein, Y.; Inbar, D.

    1977-01-01

    A scintillation camera has a planar scintillating crystal that produces light events whose spatial distribution corresponds to the spatial distribution of the radiation stimuli causing such events, and a plurality of photomultipliers having photocathodes for receiving light from the crystal through a planar face thereof. Computing circuitry coupled to the photomultipliers computes the projection of a light event in the crystal on a reference axis by forming an analytical function of the outputs of the photomultipliers according to the spatial location of the light event in the crystal

  20. Fission-neutrons source with fast neutron-emission timing

    Energy Technology Data Exchange (ETDEWEB)

    Rusev, G., E-mail: rusev@lanl.gov; Baramsai, B.; Bond, E.M.; Jandel, M.

    2016-05-01

    A neutron source with fast timing has been built to help with detector-response measurements. The source is based on the neutron emission from the spontaneous fission of {sup 252}Cf. The time is provided by registering the fission fragments in a layer of a thin scintillation film with a signal rise time of 1 ns. The scintillation light output is measured by two silicon photomultipliers with rise time of 0.5 ns. Overall time resolution of the source is 0.3 ns. Design of the source and test measurements using it are described. An example application of the source for determining the neutron/gamma pulse-shape discrimination by a stilbene crystal is given.

  1. Survey meter using novel inorganic scintillators

    International Nuclear Information System (INIS)

    Yoshikawa, Akira; Fukuda, Kentaro; Kawaguchi, Noriaki; Kamada, Kei; Fujimoto, Yutaka; Yokota, Yuui; Kurosawa, Shunsuke; Yanagida, Takayuki

    2012-01-01

    Single crystal scintillator materials are widely used for detection of high-energy photons and particles. There is continuous demand for new scintillator materials with higher performance because of increasing number of medical, industrial, security and other applications. This article presents the recent development of three novel inorganic scintillators; Pr-doped Lu 3 Al 5 O 12 (Pr:LuAG), Ce doped Gd 3 (Al, Ga) 5 O 12 (Ce:GAGG) and Ce or Eu-doped 6 LiCaAlF 6 (Ce:LiCAF, Eu:LiCAF). Pr:LuAG shows very interesting scintillation properties including very fast decay time, high light yield and excellent energy resolution. Taking the advantage of these properties, positron emission mammography (PEM) equipped with Pr:LuAG were developed. Ce:GAGG shows very high light yield, which is much higher than that of Ce:LYSO. Survey meter using Ce:GAGG is developed using this scintillator. Ce:LiCAF and Eu:LiCAF were developed for neutron detection. The advantage and disadvantage are discussed comparing with halide scintillators. Eu-doped LiCAF indicated five times higher light yield than that of existing Li-glass. It is expected to be used as the alternative of 3 He. (author)

  2. Basic study of single crystal fibers of Pr:Lu{sub 3}Al{sub 5}O{sub 12} scintillator for gamma-ray imaging applications

    Energy Technology Data Exchange (ETDEWEB)

    Yanagida, Takayuki, E-mail: t_yanagi@tagen.tohoku.ac.jp [IMRAM, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai, Miyagi 980-8577 (Japan); Kamada, Kei [Materials Research Laboratory, Furukawa Co., Ltd., 1-25-13 Kannondai, Tukuba Ibaragi 305-0856 (Japan); Kawaguchi, Noriaki [IMRAM, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai, Miyagi 980-8577 (Japan); Tokuyama Corporation, Shibuya 3-chome, Shibuya-ku, Tokyo 150-8383 (Japan); Fujimoto, Yutaka [IMRAM, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai, Miyagi 980-8577 (Japan); Fukuda, Kentaro [IMRAM, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai, Miyagi 980-8577 (Japan); Tokuyama Corporation, Shibuya 3-chome, Shibuya-ku, Tokyo 150-8383 (Japan); Yokota, Yuui; Chani, Valery; Yoshikawa, Akira [IMRAM, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai, Miyagi 980-8577 (Japan)

    2011-10-01

    Single-crystalline fibers were grown from 0.25, 0.70, and 1.50 mol% Pr-doped Lu{sub 3}Al{sub 5}O{sub 12} (LuAG) melts by the micro-pulling down ({mu}-PD) method with a diameter of 0.3-0.5 mm and a length of about 200 mm. They were cut to 10 mm long specimens, and their scintillation properties, including light yield and decay time profile, were examined. These results were compared with corresponding properties of the specimens (0.8x0.8x10 mm{sup 3}) cut from the bulk crystals produced by conventional Czochralski (CZ) growth. The {mu}-PD-grown fibers demonstrated relatively low light yield and had the same decay time constant when compared with those of the samples cut from the CZ-grown crystals. The fiber crystals were used to assemble scintillating arrays with dimensions of O 0.5x10 mm{sup 2}x20 pixels and O 0.3x10 mm{sup 2}x30 pixels coated by a BaSO{sub 4} reflector. After optical coupling with a position sensitive photomultiplier tube, the fiber-based arrays demonstrated acceptable imaging capability with a spatial resolution of about 0.5 mm.

  3. Effect of stilbene and chalcone scaffolds incorporation in clofibric acid on PPARα agonistic activity.

    Science.gov (United States)

    Giampietro, Letizia; D'Angelo, Alessandra; Giancristofaro, Antonella; Ammazzalorso, Alessandra; De Filippis, Barbara; Di Matteo, Mauro; Fantacuzzi, Marialuigia; Linciano, Pasquale; Maccallini, Cristina; Amoroso, Rosa

    2014-01-01

    In an effort to develop safe and efficacious compounds for the treatment of metabolic disorders, new compounds based on a combination of clofibric acid, the active metabolite of clofibrate, and trans-stilbene, chalcone, and other lipophilic groups were synthesized. They were evaluated for PPARα transactivation activity; all branched derivatives showed an increase of the transcriptional activity of receptor compared to the linear ones. Noteworthy, stilbene and benzophenone branched derivatives activated the PPARα better than clofibric acid.

  4. Plastic scintillation dosimetry: Optimal selection of scintillating fibers and scintillators

    International Nuclear Information System (INIS)

    Archambault, Louis; Arsenault, Jean; Gingras, Luc; Sam Beddar, A.; Roy, Rene; Beaulieu, Luc

    2005-01-01

    Scintillation dosimetry is a promising avenue for evaluating dose patterns delivered by intensity-modulated radiation therapy plans or for the small fields involved in stereotactic radiosurgery. However, the increase in signal has been the goal for many authors. In this paper, a comparison is made between plastic scintillating fibers and plastic scintillator. The collection of scintillation light was measured experimentally for four commercial models of scintillating fibers (BCF-12, BCF-60, SCSF-78, SCSF-3HF) and two models of plastic scintillators (BC-400, BC-408). The emission spectra of all six scintillators were obtained by using an optical spectrum analyzer and they were compared with theoretical behavior. For scintillation in the blue region, the signal intensity of a singly clad scintillating fiber (BCF-12) was 120% of that of the plastic scintillator (BC-400). For the multiclad fiber (SCSF-78), the signal reached 144% of that of the plastic scintillator. The intensity of the green scintillating fibers was lower than that of the plastic scintillator: 47% for the singly clad fiber (BCF-60) and 77% for the multiclad fiber (SCSF-3HF). The collected light was studied as a function of the scintillator length and radius for a cylindrical probe. We found that symmetric detectors with nearly the same spatial resolution in each direction (2 mm in diameter by 3 mm in length) could be made with a signal equivalent to those of the more commonly used asymmetric scintillators. With augmentation of the signal-to-noise ratio in consideration, this paper presents a series of comparisons that should provide insight into selection of a scintillator type and volume for development of a medical dosimeter

  5. A comparison of BCF-12 organic scintillators and Al2O3:C crystals for real-time medical dosimetry

    DEFF Research Database (Denmark)

    Beierholm, Anders Ravnsborg; Andersen, Claus Erik; Lindvold, Lars

    2008-01-01

    Radioluminescence (RL) from aluminium oxide (Al2O3:C) crystals and organic scintillators such as the blue-emitting BCF-12 can be used for precise real-time dose rate measurements during radiation therapy of cancer patients. Attaching the dosimeters to thin light-guiding fiber cables enables in vivo...... use. The light signal is detected by a photomultiplier tube (PNIT). Unfortunately Cerenkov light and fluorescence are also generated in the fiber cable itself during irradiation, and this so-called stem effect can be significant compared with the dosimeter signal. In the case of Al2O3:C, this problem...... can be circumvented for pulsed beams due to the long life-time of the main luminescence center. In contrast, chromatic removal seems to be the most effective method for organic scintillators, but is found to yield some experimental complexities. In this paper, we report on dose rate measurements using...

  6. Investigating the effect of K-characteristic radiation on the performance of nuclear medicine scintillators by Monte Carlo methods

    International Nuclear Information System (INIS)

    Liaparinos, Panagiotis; Kandarakis, Ioannis; Cavouras, Dionisis; Delis, Harry; Panayiotakis, George

    2006-01-01

    The aim of this study was to evaluate the effect of K-characteristic radiation on the performance of scintillator crystals incorporated in nuclear medicine detectors (LSO, BGO, GSO). K-characteristic radiation is produced within materials of at least one high atomic number element (e.g. Lu, Gd, Bi). This radiation may either be reabsorbed or it may escape the scintillator. In both cases the light emission efficiency of the scintillator may be affected resulting in either spatial or energy resolution degradation. A computational program, based on Monte Carlo methods, was developed in order to simulate the transport of K-characteristic radiation within the most commonly used scintillator materials. Crystal thickness was allowed to vary from 0.5 up to 15 mm. A monoenergetic pencil beam, with energy varying from 0.60 to 0.511 MeV was considered to fall on the center of the crystal surface. The dominant γ-ray interactions (elastic and inelastic scattering and photoelectric absorption) were taken into account in the simulation. Results showed that, depending on crystal thickness, incident photon energy and scintillator's intrinsic properties (L or K-fluorescence yield, effective atomic number and density), the scintillator's emission efficiency may be significantly reduced and affect spatial or energy resolution

  7. Photoluminescence and radiation response properties of Ce3+-doped CsCaCl3 crystalline scintillator

    International Nuclear Information System (INIS)

    Fujimoto, Yutaka; Saeki, Keiichiro; Tanaka, Hironori; Yahaba, Takuma; Koshimizu, Masanori; Asai, Keisuke; Yanagida, Takayuki

    2016-01-01

    In this paper, we report on the photoluminescence and scintillation properties of a newly developed CsCaCl 3 :Ce (0.5 mol%) crystalline scintillator grown by the vertical Bridgman method. The fluorescence quantum efficiency for the Ce 3+ characteristic emission bands centered at around 350–400 nm was 76% under excitation at 330 nm light. The photoluminescence decay time of the Ce 3+ was approximately 32 ns. When x-ray excited the crystal, intense emission bands were observed at 350–400 nm, and could be attributed to the Ce 3+ emission. The scintillation light yield of the developed crystal was ∼7600 ph MeV −1 compared to a NaI:Tl commercial scintillator, and the principal scintillation decay time was approximately 340 ns plus two fast components of around 1.6 ns and 45 ns. (paper)

  8. Luminescence and scintillation timing characteristics of (Lu{sub x}Gd{sub 2−x})SiO{sub 5}:Ce single crystals

    Energy Technology Data Exchange (ETDEWEB)

    Yawai, Nattasuda; Chewpraditkul, Warut; Sakthong, Ongsa [Faculty of Science, King Mongkut' s University of Technology Thonburi, Bangkok10140 (Thailand); Chewpraditkul, Weerapong, E-mail: weerapong.che@kmutt.ac.th [Faculty of Science, King Mongkut' s University of Technology Thonburi, Bangkok10140 (Thailand); Wantong, Kriangkrai [Faculty of Science, King Mongkut' s University of Technology Thonburi, Bangkok10140 (Thailand); Szczesniak, Tomasz; Swiderski, Lukasz; Moszynski, Marek [National Centre for Nuclear Research, A. Soltana 7, PL 05-400 Otwock-Swierk (Poland); Sidletskiy, Oleg [Institute for Scintillation Materials NAS of Ukraine, 60 Nauky Avenue, 61001 Kharkiv (Ukraine)

    2017-02-01

    The luminescence and scintillation characteristics of cerium-doped lutetium-gadolinium orthosilicate (Lu{sub x}Gd{sub 2−x}SiO{sub 5}:Ce; x=0, 0.8, 1.8) single crystals were investigated. At 662 keV γ-rays, the light yield of 29,800±3000 ph MeV{sup −1} obtained for Lu{sub 1.8}Gd{sub 0.2}SiO{sub 5}:Ce is higher than that of 20,200±2000 and 11,800±1200 ph MeV{sup −1} obtained for Lu{sub 0.8}Gd{sub 1.2}SiO{sub 5}:Ce and Gd{sub 2}SiO{sub 5}:Ce, respectively. The fast component decay time of 32, 18 and 17 ns was measured in the scintillation decay of Gd{sub 2}SiO{sub 5}:Ce, Lu{sub 0.8}Gd{sub 1.2}SiO{sub 5}:Ce and Lu{sub 1.8}Gd{sub 0.2}SiO{sub 5}:Ce, respectively. The coincidence time spectra for 511 keV annihilation quanta were measured in reference to a fast BaF{sub 2} detector and time resolution was discussed in terms of a number of photoelectrons and decay time of the fast component. The mass attenuation coefficient for studied crystals at 60 and 662 keV γ-rays was also evaluated and discussed. - Highlights: • Scintillation timing characteristics of Lu{sub x}Gd{sub 2−x}SiO{sub 5}:Ce crystals are studied. • Lu{sub 1.8}Gd{sub 0.2}SiO{sub 5}:Ce exhibits excellent light yield and timing response. • Energy resolution of 6% @662 keV is obtained for Lu{sub 0.8}Gd{sub 1.2}SiO{sub 5}:Ce. • Coincidence time resolution of 368 ps is obtained for Lu{sub 1.8}Gd{sub 0.2}SiO{sub 5}:Ce.

  9. Further understanding of PbWO4 Scintillator characteristics and their optimisation. LUMEN activity in 1998

    CERN Document Server

    Baccaro, Stefania; Borgia, Bruno; Cecilia, Angelica; Dafinei, Ioan; Diemoz, Marcella; Fabeni, P; Festinesi, Armando; Longo, Egidio; Martini, M; Meinardi, F; Mihoková, E; Montecchi, Marco; Nikl, M; Pazzi, G P; Rosa, J; Sulc, Miroslav

    2000-01-01

    The aim of LUMEN collaboration was the investigation on single crystals of PbWO4 ( PWO): the results performed up to now provide the evidence of the possibility to optimise the optical properties of an intrinsic scintillator such as PWO. The control of essential requirements in the crystal preparation ( raw material purity, growing methods and post-growth annealing) as well as the introduction of selected dopants at suitable concentrations ( particularly trivalent and pentavalent ions) were found to be very successful in lowering the concentration of point defects in the lattice which strongly affect scintillation properties and radiation hardness. The systematic investigation effort to better understand the scintillation characteristics and to improve the quality of PWO crystals is due to their use for the CMS electromagnetic calorimeter.

  10. Quality control on pre-serial Bridgman production of PbWO{sub 4} scintillating crystals by means of photoelasticity

    Energy Technology Data Exchange (ETDEWEB)

    Rinaldi, D., E-mail: d.rinaldi@univpm.i [Dipartimento di Fisica e Ingegneria dei Materiali e del Territorio, Universita Politecnica delle Marche, via Brecce Bianche, 60131 Ancona (Italy); INFN section of Perugia (Italy); Ciriaco, A. [Dipartimento di Fisica e Ingegneria dei Materiali e del Territorio, Universita' Politecnica delle Marche, via Brecce Bianche, 60131 Ancona (Italy); Lebeau, M. [CERN PH department, 1211 Geneva 23 (Switzerland); Paone, N. [Dipartimento di Meccanica, Universita' Politecnica delle Marche, via Brecce Bianche, 60131 Ancona (Italy)

    2010-04-11

    Residual internal stresses in PbWO{sub 4} (PWO) scintillating crystals grown by Bridgman method have been systematically studied. Residual stresses induced during growth play an important role in production yield. Cracking probability during mechanical processing as well as stable mechanical properties in finished crystal are closely related to internal stress levels. A regular production of good-quality crystals requires a fast and easy feed-back on growth parameters. Samples from a pre-serial production were analyzed in order to give the producer a quality feed-back for process optimization. By means of photoelasticity, we measured residual stress distribution in several sections along the growth axis and for typical positions in every section. The stress analysis revealed defects occurring during the crystallization process, attributed to dislocations, lattice disorientation and poly-crystallinity. This work had been prompted by the need for quality monitoring of a pre-serial production of PWO for the CMS experiment at CERN's LHC. Mapping stress levels inside the ingot volume and proposing a synthetic parameter to be used as a quality indicator, the resulting analysis should contribute to parameter optimization and improve the growth performance. The proposed method may be useful in conventional crystal production.

  11. Encapsulated scintillation detector

    International Nuclear Information System (INIS)

    Toepke, I.L.

    1982-01-01

    A scintillation detector crystal is encapsulated in a hermetically sealed housing having a glass window. The window may be mounted in a ring by a compression seal formed during cooling of the ring and window after heating. The window may be chemically bonded to the ring with or without a compression seal. The ring is welded to the housing along thin weld flanges to reduce the amount of weld heat which must be applied. A thin section is provided to resist the flow of welding heat to the seal between the ring and the window thereby forming a thermal barrier. The thin section may be provided by a groove cut partially through the wall of the ring. A layer of PTFE between the tubular body and the crystal minimizes friction created by thermal expansion. Spring washers urge the crystal towards the window. (author)

  12. Predicting the timing properties of phosphor-coated scintillators using Monte Carlo light transport simulation

    International Nuclear Information System (INIS)

    Roncali, Emilie; Schmall, Jeffrey P; Viswanath, Varsha; Berg, Eric; Cherry, Simon R

    2014-01-01

    Current developments in positron emission tomography focus on improving timing performance for scanners with time-of-flight (TOF) capability, and incorporating depth-of-interaction (DOI) information. Recent studies have shown that incorporating DOI correction in TOF detectors can improve timing resolution, and that DOI also becomes more important in long axial field-of-view scanners. We have previously reported the development of DOI-encoding detectors using phosphor-coated scintillation crystals; here we study the timing properties of those crystals to assess the feasibility of providing some level of DOI information without significantly degrading the timing performance. We used Monte Carlo simulations to provide a detailed understanding of light transport in phosphor-coated crystals which cannot be fully characterized experimentally. Our simulations used a custom reflectance model based on 3D crystal surface measurements. Lutetium oxyorthosilicate crystals were simulated with a phosphor coating in contact with the scintillator surfaces and an external diffuse reflector (teflon). Light output, energy resolution, and pulse shape showed excellent agreement with experimental data obtained on 3 × 3 × 10 mm 3  crystals coupled to a photomultiplier tube. Scintillator intrinsic timing resolution was simulated with head-on and side-on configurations, confirming the trends observed experimentally. These results indicate that the model may be used to predict timing properties in phosphor-coated crystals and guide the coating for optimal DOI resolution/timing performance trade-off for a given crystal geometry. Simulation data suggested that a time stamp generated from early photoelectrons minimizes degradation of the timing resolution, thus making this method potentially more useful for TOF-DOI detectors than our initial experiments suggested. Finally, this approach could easily be extended to the study of timing properties in other scintillation crystals, with a

  13. Luminescence properties of undoped CsCaCl3 and CsSrCl3 crystalline scintillators

    International Nuclear Information System (INIS)

    Fujimoto, Yutaka; Saeki, Keiichiro; Koshimizu, Masanori; Asai, Keisuke; Yanagida, Takayuki

    2015-01-01

    Intrinsic luminescence properties of undoped CsCaCl 3 and CsSrCl 3 crystalline scintillators were studied. The crystal samples were grown by a vertical Bridgman method. Photoluminescence spectra of the crystals showed Auger-free luminescence (AFL) at 310 nm and self-trapped emission (STE) at 400 nm for CsCaCl 3 and 465 nm for CsSrCl 3 , when vacuum ultraviolet (VUV) light at 84 nm and 160 nm excited the crystals. X-ray excited radioluminescence spectra of the crystals showed some emission bands in the 280-600 nm wavelength range, which are owing to AFL, STE, and other origins such as lattice defects and impurities. Scintillation light yield was 400-300 ph/MeV, and the principal scintillation decay time about 2.5 ns and 12 ns for CsCaCl 3 and 1.8 ns and 13 ns for CsSrCl 3 . (author)

  14. Study and understanding of n/γ discrimination processes in organic plastic scintillators

    International Nuclear Information System (INIS)

    Hamel, Matthieu; Blanc, Pauline; Rocha, Licinio; Normand, Stephane; Pansu, Robert

    2013-01-01

    For 50 years, it was assumed that unlike liquid scintillators or organic crystals, plastic scintillators were not able to discriminate fast neutrons from gamma. In this work, we will demonstrate that triplet-triplet annihilations (which are responsible of n/γ discrimination) can occur even in plastic scintillators, following certain conditions. Thus, the presentation will deal with the chemical preparation, the characterization and the comparison of n/γ pulse shape discrimination of various plastic scintillators. To this aim, scale-up of the process allowed us to prepare a O 100 mm x*110 mm thick. (authors)

  15. Target molecular weights for red cell band 3 stilbene and mercurial binding sites

    International Nuclear Information System (INIS)

    Verkman, A.S.; Skorecki, K.L.; Jung, C.Y.; Ausiello, D.A.

    1986-01-01

    Radiation inactivation was used to measure the target sizes for binding of disulfonic stilbene anion transport inhibitor 4,4'-dibenzamido-2,2'-disulfonic stilbene (DBDS) and mercurial water transport inhibitor p-chloromercuribenzene sulfonate (pCMBS) to human erythrocytes. The measured target size for erythrocyte ghost acetylcholinesterase was 78 +/- 3 kDa. DBDS binding to ghost membranes was measured by a fluorescence enhancement technique. Radiation (0-26 Mrad) had no effect on total membrane protein and DBDS binding affinity, whereas DBDS binding stoichiometry decreased exponentially with radiation dose, giving a target size of 59 +/- 4 kDa. H2-4,4'-diisothiocyano-2,2'-disulfonic stilbene (H2-DIDS, 5 microM) blocked greater than 95% of DBDS binding at all radiation doses. pCMBS binding was measured from the time course of tryptophan fluorescence quenching in ghosts treated with the sulfhydryl reagent N-ethylmaleimide (NEM). Radiation did not affect the kinetics of tryptophan quenching, whereas the total amplitude of the fluorescence signal inactivated with radiation with a target size of 31 +/- 6 kDa. These results support the notion that DBDS and pCMBS bind to the transmembrane domain of erythrocyte band 3 in NEM-treated ghosts and demonstrate that radiation inactivation may probe a target significantly smaller than a covalently linked protein subunit. The small target size for the band 3 stilbene binding site may correspond to the intramembrane domain of the band 3 monomer (52 kDa), which is physically distinct from the cytoplasmic domain (42 kDa)

  16. Advantages of GSO Scintillator in Imaging and Law Level Gamma-ray Spectroscopy

    CERN Document Server

    Sharaf, J

    2002-01-01

    The single GSO crystal is an excellent scintillation material featuring a high light yield and short decay time for gamma-ray detection. Its performance characteristics were investigated and directly compared to those of BGO. For this purpose, the two scintillators are cut into small crystals of approximately 4*4*10 mm sup 3 and mounted on a PMT. Energy resolution, detection efficiency and counting precision have been measured for various photon energies. In addition to this spectroscopic characterization, the imaging performance of GSO was studied using a scanning rig. The modulation transfer function was calculated and the spatial resolution evaluated by measurements of the detector's point spread function. It is shown that there exists some source intensity for which the two scintillators yield identical precision for identical count time. Below this intensity, the GSO is superior to the BGO detector. The presented properties of GSO suggest potential applications of this scintillator in gamma-ray spectrosc...

  17. Temperature dependence of scintillation properties of SrMoO{sub 4}

    Energy Technology Data Exchange (ETDEWEB)

    Mikhailik, V.B., E-mail: vmikhai@hotmail.com [Diamond Light Source, Harwell Science Campus, Didcot OX11 0DE (United Kingdom); Elyashevskyi, Yu. [Department of Physics, University of Oxford, Keble Rd., Oxford OX1 3RH (United Kingdom); Scientific-technical and Educational Centre of Low Temperature Studies, I. Franko National University of Lviv, 50 Dragomanova Str., 79005 Lviv (Ukraine); Kraus, H. [Department of Physics, University of Oxford, Keble Rd., Oxford OX1 3RH (United Kingdom); Kim, H.J. [Department of Physics of Kyungpook National University, 1370 Sangyeok-dong, Buk-gu, Daegu 702-701 (Korea, Republic of); Kapustianyk, V.; Panasyuk, M. [Scientific-technical and Educational Centre of Low Temperature Studies, I. Franko National University of Lviv, 50 Dragomanova Str., 79005 Lviv (Ukraine)

    2015-08-21

    Studies of the X-ray luminescence and scintillation properties of a SrMoO{sub 4} crystal as function of temperature down to T=10 K have been carried out. The luminescence in SrMoO{sub 4} is quenched at room temperature, but below T<200 K the crystal exhibits a broad emission band with a maximum at a wavelength of 520 nm. The emission is attributed to the radiative decay of self-trapped excitons and defects acting as traps for the exactions at low temperatures. Such complex character of radiative decay is reflected in the kinetics which contains several components plus a contribution from delayed recombination at low temperatures. The temperature dependence of scintillation light output of SrMoO{sub 4} was studied. Comparing with a reference ZnWO{sub 4} crystal measured under the same experimental conditions it was found that the light output of SrMoO{sub 4} is 15±5%. It is suggested, therefore, that there is scope for optimisation of strontium molybdate for application as scintillator in cryogenic rare event searches.

  18. Crystal growth and luminescence properties of Yb-doped Gd.sub.3./sub.Al.sub.2./sub.Ga.sub.3./sub.O.sub.12./sub. infra-red scintillator

    Czech Academy of Sciences Publication Activity Database

    Suzuki, A.; Kurosawa, S.; Nagata, S.; Yamamura, T.; Pejchal, Jan; Yamaji, A.; Yokota, Y.; Shirasaki, K.; Homma, Y.; Aoki, D.; Shikama, T.; Yoshikawa, A.

    2014-01-01

    Roč. 36, č. 9 (2014), s. 1484-1487 ISSN 0925-3467 Institutional support: RVO:68378271 Keywords : infra-red scintillator * radiation therapy * Yb:GAGG * bulk crystal Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.981, year: 2014

  19. Radiation-resistant composite scintillators based on GSO and GPS grains

    Energy Technology Data Exchange (ETDEWEB)

    Boyarintsev, A.Yu. [Institute for Scintillation Materials, National Academy of Sciences of Ukraine, 60 Nauki Avenue, 61001 Kharkiv (Ukraine); Galunov, N.Z. [Institute for Scintillation Materials, National Academy of Sciences of Ukraine, 60 Nauki Avenue, 61001 Kharkiv (Ukraine); V.N. Karasin Kharkov National University, 4 Svobody Sq., 61022 Kharkiv (Ukraine); Gerasymov, Ia.V.; Karavaeva, N.L. [Institute for Scintillation Materials, National Academy of Sciences of Ukraine, 60 Nauki Avenue, 61001 Kharkiv (Ukraine); Krech, A.V., E-mail: AntonKrech@gmail.com [Institute for Scintillation Materials, National Academy of Sciences of Ukraine, 60 Nauki Avenue, 61001 Kharkiv (Ukraine); Levchuk, L.G.; Popov, V.F. [National Science Center, Kharkov Institute of Physics and Technology, 1 Akademicheskaya Str., 61108 Kharkiv (Ukraine); Sidletskiy, O.Ts. [Institute for Scintillation Materials, National Academy of Sciences of Ukraine, 60 Nauki Avenue, 61001 Kharkiv (Ukraine); Sorokin, P.V. [National Science Center, Kharkov Institute of Physics and Technology, 1 Akademicheskaya Str., 61108 Kharkiv (Ukraine); Tarasenko, O.A. [Institute for Scintillation Materials, National Academy of Sciences of Ukraine, 60 Nauki Avenue, 61001 Kharkiv (Ukraine)

    2017-01-01

    The effect of irradiation on the scintillation light output, optical transmittance, and luminescent spectra of composite scintillators based on grains of single crystals Gd{sub 2}SiO{sub 5}:Ce (GSO) and Gd{sub 2}Si{sub 2}O{sub 7}:Ce (GPS) is studied. The dielectric gel Sylgard-184 is the base and the binder for the grains inside the composite scintillator. The paper presents and analyzes the results obtained for the scintillators exposed by 10 MeV electrons from the linear electron accelerator at room temperature. The exposure doses D≤250 Mrad. The dose rate is 0.2 or 1500 Mrad/h. The study has shown that the composite scintillators based on the grains of GSO and GPS are radiation-resistant over the range of the irradiation.

  20. Role of excitons in the energy resolution of scintillators used for medical imaging

    Energy Technology Data Exchange (ETDEWEB)

    Singh, Jai [School of Engineering and IT, B-purple-12, Faculty of EHS, Charles Darwin University, Darwin NT 0909 (Australia)

    2010-11-01

    Theoretical investigations suggest that the nonproportionality in a scintillator is caused by the high excitation density created within the track of an X-ray or {gamma} ray photon entering in a scintillating crystal. In this paper an analytical expression for the scintillator yield is derived. For the case of BaF{sub 2} scintillator the role of excitons created within the {gamma}-ray track in the scintillator yield is studied. By comparing the results of two theories an analytical expression is also derived for an energy parameter which could otherwise only be determined by fitting the theoretical yield to the experimental data.

  1. Role of excitons in the energy resolution of scintillators used for medical imaging

    International Nuclear Information System (INIS)

    Singh, Jai

    2010-01-01

    Theoretical investigations suggest that the nonproportionality in a scintillator is caused by the high excitation density created within the track of an X-ray or γ ray photon entering in a scintillating crystal. In this paper an analytical expression for the scintillator yield is derived. For the case of BaF 2 scintillator the role of excitons created within the γ-ray track in the scintillator yield is studied. By comparing the results of two theories an analytical expression is also derived for an energy parameter which could otherwise only be determined by fitting the theoretical yield to the experimental data.

  2. Evaluation of Ce3+ and alkali metal ions Co-doped LiSrAlF6 crystalline scintillators

    International Nuclear Information System (INIS)

    Wakahara, Shingo; Yanagida, Takayuki; Fujimoto, Yutaka; Yokota, Yuui; Pejchal, Jan; Kurosawa, Shunsuke; Suzuki, Shotaro; Kawaguchi, Noriaki; Fukuda, Kentaro; Yoshikawa, Akira

    2013-01-01

    High scintillation efficiency of Eu-doped LiSrAlF 6 (LiSAF) and LiCaAlF 6 (LiCAF) codoped with alkali metal ions has been reported in our recent studies. Thus in this paper, we demonstrated the scintillation properties of 1% Ce-doped LiSAF crystals with 1% alkali metal ions co-doping to increase the light yield and understand the scintillation mechanism. The crystals showed intense emission band corresponding to the 5d-4f transition of Ce 3+ , and their light yields under thermal neutron excitation were higher than that of the Ce only doped crystal. Especially, the light yield of Ce–Na co-doped crystal exceeded about two times that of Ce only doped one. -- Highlights: ► Ce-doped and alkali metal co-doped LiSAF crystals were grown by μ-PD method. ► Alkali metal co-doped crystals showed higher light yield than Ce only doped crystal. ► Decay time of alkali metal co-doped LiSAF were longer than that of Ce only doped one

  3. Temperature dependence of CsI(Tl) gamma-ray excited scintillation characteristics

    International Nuclear Information System (INIS)

    1993-01-01

    Gamma-ray excited emission spectrum, absolute scintillation yield, rise and decay time constants, and thermoluminescence emissions of CsI(Tl) were measured at -100 to +50 C, for crystals from 4 different vendors. The thermoluminescence glow curves were the only property that varied significantly from crystal to crystal; room temperature operation in current mode could be susceptible to temperature fluctuations. The CsI(Tl) emission spectrum has emission bands peaking around 400 and 560 nm; the former band disappears between -50 and -75 C. The RT absolute scintillation yield was calculated to be 65,500±4,100 photons/MeV. The two primary decay time constants increases about exponentially with inverse temperature. An ultra-fast decay component was confirmed. Applications are discussed

  4. Polyphenol Stilbenes from Fenugreek (Trigonella foenum-graecum L. Seeds Improve Insulin Sensitivity and Mitochondrial Function in 3T3-L1 Adipocytes

    Directory of Open Access Journals (Sweden)

    Gang Li

    2018-01-01

    Full Text Available Fenugreek (Trigonella foenum-graecum L. is a well-known annual plant that is widely distributed worldwide and has possessed obvious hypoglycemic and hypercholesterolemia characteristics. In our previous study, three polyphenol stilbenes were separated from fenugreek seeds. Here, we investigated the effect of polyphenol stilbenes on adipogenesis and insulin resistance in 3T3-L1 adipocytes. Oil Red O staining and triglyceride assays showed that polyphenol stilbenes differently reduced lipid accumulation by suppressing the expression of adipocyte-specific proteins. In addition, polyphenol stilbenes improved the uptake of 2-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-ylamino-2-deoxyglucose (2-NBDG by promoting the phosphorylation of protein kinase B (AKT and AMP-activated protein kinase (AMPK. In present studies, it was found that polyphenol stilbenes had the ability to scavenge reactive oxygen species (ROS. Results from adenosine triphosphate (ATP production and mitochondrial membrane potentials suggested that mitochondria play a critical role in insulin resistance and related signaling activation, such as AKT and AMPK. Rhaponticin, one of the stilbenes from fenugreek, had the strongest activity among the three compounds in vitro. Future studies will focus on mitochondrial biogenesis and function.

  5. Aerobic methylcyclohexane-promoted epoxidation of stilbene over gold nanoparticles supported on Gd-doped titania

    KAUST Repository

    Mendez, Violaine; Guillois, Kevin; Daniè le, Sté phane; Tuel, Alain; Caps, Valerie

    2010-01-01

    Aerobic partial oxidations of alkanes and alkenes are important processes of the petrochemical industry. The radical mechanisms involved can be catalyzed by soluble salts of transition metals (Co, Cu, Mn...). We show here that the model methylcyclohexane/stilbene co-oxidation reaction can be efficiently catalyzed at lower temperature by supported gold nanoparticles. The support has little influence on gold intrinsic activity but more on the apparent reaction rates which are a combination of catalytic activity and diffusion limitations. These are here minimized by using gadolinium-doped titania nanocrystallites as support for gold nanoparticles. This material is obtained by mild hydrolysis of a new Gd4TiO(OiPr)14 bimetallic oxoalkoxide. It leads to enhanced wettability of the < 3 nm gold particles in the tert-butyl hydroperoxide (TBHP)-initiated epoxidation of stilbene in methylcyclohexane; Au/TiO2:Gd3+ is in turn as active as the state-of-the-art hydrophobic Au/SiO2 catalyst. The rate-determining step of this reaction is identified as the gold-catalyzed homolytic decomposition of TBHP generating radicals and initiating the methylcyclohexane-mediated epoxidation of stilbene, yielding a methylcyclohexan-1-ol/trans-stilbene oxide mixture. Methylcyclohexan-1-ol can also be obtained in the absence of the alkene in the gold-catalyzed solvent-free autoxidation of methylcyclohexane, evidencing the catalytic potential of gold nanoparticles for low temperature C-H activation. © 2010 The Royal Society of Chemistry.

  6. GAGG:ce single crystalline films: New perspective scintillators for electron detection in SEM.

    Science.gov (United States)

    Bok, Jan; Lalinský, Ondřej; Hanuš, Martin; Onderišinová, Zuzana; Kelar, Jakub; Kučera, Miroslav

    2016-04-01

    Single crystal scintillators are frequently used for electron detection in scanning electron microscopy (SEM). We report gadolinium aluminum gallium garnet (GAGG:Ce) single crystalline films as a new perspective scintillators for the SEM. For the first time, the epitaxial garnet films were used in a practical application: the GAGG:Ce scintillator was incorporated into a SEM scintillation electron detector and it showed improved image quality. In order to prove the GAGG:Ce quality accurately, the scintillation properties were examined using electron beam excitation and compared with frequently used scintillators in the SEM. The results demonstrate excellent emission efficiency of the GAGG:Ce single crystalline films together with their very fast scintillation decay useful for demanding SEM applications. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Lanthanum halide scintillators: Properties and applications

    International Nuclear Information System (INIS)

    Iltis, Alain; Mayhugh, M.R.; Menge, P.; Rozsa, C.M.; Selles, O.; Solovyev, V.

    2006-01-01

    BrilLanCe[reg]-350 and BrilLanCe[reg]-380, Saint-Gobain Crystals' trade-names for LaCl 3 :Ce and LaBr 3 :Ce are being brought to market under exclusive license to Delft and Bern Universities. We are reporting the properties of crystals produced with commercially viable processes and find they match others' observations. These scintillators are bright (60,000 photons/MeV for LaBr 3 :Ce) and have very linear response, a combination that leads to very good energy resolution ( 3 :Ce). The materials also have fast scintillation decay times ( 3 :Ce). These excellent properties are retained at high temperature with only moderate light loss ( 138 and Ac 227 , the latter having been substantially reduced in recent processing. BrilLanCe[reg]-350 is now available in detectors up to 51 mm diameter while 38 mm diameter is available for BrilLanCe[reg]-380. Larger sizes are expected

  8. Large area avalanche photodiodes in scintillation and X-rays detection

    International Nuclear Information System (INIS)

    Moszynski, M.; Szawlowski, M.; Kapusta, M.; Balcerzyk, M.

    2002-01-01

    The presented paper summarizes our earlier studies on application of beveled-edge Large Area Avalanche Photodiodes (LAAPDs) in γ-rays scintillation detection. LAAPDs, due to their high quantum efficiency and low excess noise factor allow for better statistical accuracy of the signal as compared to photomultipliers. The device dark noise contribution significantly affects energy resolution only for γ-rays with energy below 50 keV. Notably better or comparable energy resolutions to those observed with a XP2020Q photomultiplier were obtained with the LAAPDs for a number of different scintillators. Particularly, the recorded energy resolutions of 4.3±0.2% and 4.8±0.14% measured with YAP and CsI(Tl) crystals, respectively, for the 662 keV γ-peak from a 137 Cs source belong to the best observed ever with these scintillation detectors. Results of the study of timing with fast scintillators coupled to the LAAPD showed subnanosecond time resolution of 570±30 ps for 60 Co γ-rays detected in LSO crystal. The response of LAAPD to X-rays and factors limiting energy resolution have been discussed too

  9. Development of radiation detection and measurement system - Development of scintillation radiation sensor

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Hee Dong; Kim, Wan [Kyungpook National University, Taegu (Korea); Kim, Do Sung [Taegu University, Taegu (Korea)

    2000-03-01

    We have been fabricated CsI(Tl) scintillation crystals and plastic scintillators for radiation-based measuring equipment. CsI (Tl) single crystals doped with thallium as an activator were grown using the Czochralski method. The crystal structure of grown CsI(Tl) was bcc, and it was confirmed that its lattice constant was 4,568 A. The spectral range of luminescence of CsI(Tl) was 350 {approx} 700 nm independent of thallium concentration, and the fast component of the luminescence was decreased with increasing thallium concentration. The energy resolution of CsI(Tl) scintillator doped with 0.1 mole% thallium was about 9% for 137 Cs {gamma}-rays. The relation formula of {gamma}-ray energy versus energy resolution was ln(FWHM%)=-0.705ln({epsilon})+6.75. The radiation damage of CsI(Tl) increased in proportion to thallium concentration and radiation damage of CsI(Tl) increased in proportion to thallium concentration and radiation dosage, and the irradiated crystals were colored reddish. The radiation induced absorption bands appeared around 355, 425, 520 and 555 nm, and their energy level were about 3.50, 2.88, 2.39 and 2.21 eV. Plastic scintillators were fabricated thermal polymerization method. Those were polymerizing at 120 deg. C, during 72 hours, and annealing at 75 deg. C, during 24 hours. When the concentration of 1st solute was 1.5 wt% and concentration of 2nd solute was 0.01 wt%, the characteristics of scintillation were very excellent. Also 3.0 wt% tetraphenyl lead were loaded to improve the detection efficiency of {gamma}-ray. The range of emission spectrum was 400 {approx} 450nm, and the central peak was 415 nm. The radiation damage was not appear under 1*10{sup 3}Gy, but the color of plastic scintillator was changed to brown, over 1*10{sup 4}Gy exposured. 84 refs., 39 figs. (Author)

  10. Investigation of high resolution compact gamma camera module based on a continuous scintillation crystal using a novel charge division readout method

    International Nuclear Information System (INIS)

    Dai Qiusheng; Zhao Cuilan; Qi Yujin; Zhang Hualin

    2010-01-01

    The objective of this study is to investigate a high performance and lower cost compact gamma camera module for a multi-head small animal SPECT system. A compact camera module was developed using a thin Lutetium Oxyorthosilicate (LSO) scintillation crystal slice coupled to a Hamamatsu H8500 position sensitive photomultiplier tube (PSPMT). A two-stage charge division readout board based on a novel subtractive resistive readout with a truncated center-of-gravity (TCOG) positioning method was developed for the camera. The performance of the camera was evaluated using a flood 99m Tc source with a four-quadrant bar-mask phantom. The preliminary experimental results show that the image shrinkage problem associated with the conventional resistive readout can be effectively overcome by the novel subtractive resistive readout with an appropriate fraction subtraction factor. The response output area (ROA) of the camera shown in the flood image was improved up to 34%, and an intrinsic spatial resolution better than 2 mm of detector was achieved. In conclusion, the utilization of a continuous scintillation crystal and a flat-panel PSPMT equipped with a novel subtractive resistive readout is a feasible approach for developing a high performance and lower cost compact gamma camera. (authors)

  11. Luminescence and light yield of (Gd2Y)(Ga3Al2)O12:Pr3+ single crystal scintillators

    Science.gov (United States)

    Lertloypanyachai, Prapon; Pathumrangsan, Nichakorn; Sreebunpeng, Krittiya; Pattanaboonmee, Nakarin; Chewpraditkul, Weerapong; Yoshikawa, Akira; Kamada, Kei; Nikl, Martin

    2017-06-01

    Praseodymium-doped (Gd2Y)(Ga3Al2)O12 (GYGAG: Pr) single crystals are grown by the micro-pulling down method with different Pr concentrations. The energy transfer process between Pr3+ and Gd3+ is investigated by photoluminescence excitation (PLE) and emission (PL) spectra measurements. Photoelectron yield measurements are carried out using photomultiplier. At 662 keV γ-rays, photoelectron yield of 2520 phe/MeV obtained for the GYGAG: Pr (0.01%) sample is larger than that of 1810 phe/MeV obtained for BGO crystal. Light yield degradation for the GYGAG: Pr scintillators is presumably due to the energy transfer from 5d state of Pr3+ to 4f state of Gd3+ together with the concentration quenching in the Gd3+-sublattice.

  12. Somatic mutations in stilbene estrogen-induced Syrian hamster kidney tumors identified by DNA fingerprinting

    Directory of Open Access Journals (Sweden)

    Roy Deodutta

    2004-01-01

    Full Text Available Abstract Kidney tumors from stilbene estrogen (diethylstilbestrol-treated Syrian hamsters were screened for somatic genetic alterations by Random Amplified Polymorphic DNA-polymerase chain-reaction (RAPD-PCR fingerprinting. Fingerprints from tumor tissue were generated by single arbitrary primers and compared with fingerprints for normal tissue from the same animal, as well as normal and tumor tissues from different animals. Sixty one of the arbitrary primers amplified 365 loci that contain approximately 476 kbp of the hamster genome. Among these amplified DNA fragments, 44 loci exhibited either qualitative or quantitative differences between the tumor tissues and normal kidney tissues. RAPD-PCR loci showing decreased and increased intensities in tumor tissue DNA relative to control DNA indicate that loci have undergone allelic losses and gains, respectively, in the stilbene estrogen-induced tumor cell genome. The presence or absence of the amplified DNA fragments indicate homozygous insertions or deletions in the kidney tumor DNA compared to the age-matched normal kidney tissue DNA. Seven of 44 mutated loci also were present in the kidney tissues adjacent to tumors (free of macroscopic tumors. The presence of mutated loci in uninvolved (non-tumor surrounding tissue adjacent to tumors from stilbene estrogen-treated hamsters suggests that these mutations occurred in the early stages of carcinogenesis. The cloning and sequencing of RAPD amplified loci revealed that one mutated locus had significant sequence similarity with the hamster Cyp1A1 gene. The results show the ability of RAPD-PCR to detect and isolate, in a single step, DNA sequences representing genetic alterations in stilbene estrogen-induced cancer cells, including losses of heterozygosity, and homozygous deletion and insertion mutations. RAPD-PCR provides an alternative molecular approach for studying cancer cytogenetics in stilbene estrogen-induced tumors in humans and experimental

  13. Properties of lead tungstate crystals for high-energy physics

    CERN Document Server

    Ippolitov, M S; Burachas, S; Ikonnikov, V; Kuriakin, A; Lebedev, V; Makov, I; Man'ko, V; Nikulin, S P; Nyanin, A; Saveliev, Yu; Tamulaitis, G; Tsvetkov, A A; Vasilev, A; Vinogradov, Yu I

    2004-01-01

    Technology for the mass production of high-quality PbWO//4 (PWO) scintillating crystals is described. Scintillators produced from PWO crystals are intented for the ALICE CERN heavy ion experiment. Light yield, emission and decay time spectra as well as optical transmission of about 3600 crystals (dimensions 22 multiplied by 22 multiplied by 180 mm**3) were measured. Beam-test results of the ALICE PHOS prototype obtained with such PWO crystals are presented.

  14. Luminescence rise time in self-activated PbWO{sub 4} and Ce-doped Gd{sub 3}Al{sub 2}Ga{sub 3}O{sub 12} scintillation crystals

    Energy Technology Data Exchange (ETDEWEB)

    Auffray, E. [CERN, Geneva (Switzerland); Augulis, R. [Center for Physical Sciences and Technology, Savanorių av. 231, Vilnius (Lithuania); Borisevich, A. [Research Institute for Nuclear Problems, Bobruiskaya str. 11, Minsk (Belarus); Gulbinas, V. [Center for Physical Sciences and Technology, Savanorių av. 231, Vilnius (Lithuania); Fedorov, A.; Korjik, M. [Research Institute for Nuclear Problems, Bobruiskaya str. 11, Minsk (Belarus); Lucchini, M.T. [CERN, Geneva (Switzerland); Mechinsky, V. [Research Institute for Nuclear Problems, Bobruiskaya str. 11, Minsk (Belarus); Nargelas, S. [Vilnius University, Universiteto str. 3, Vilnius (Lithuania); Songaila, E. [Center for Physical Sciences and Technology, Savanorių av. 231, Vilnius (Lithuania); Tamulaitis, G. [Vilnius University, Universiteto str. 3, Vilnius (Lithuania); Vaitkevičius, A., E-mail: augustas.vaitkevicius@ff.vu.lt [Vilnius University, Universiteto str. 3, Vilnius (Lithuania); Zazubovich, S. [Institute of Physics, University of Tartu, W. Ostwaldi Str. 1, Tartu (Estonia)

    2016-10-15

    The time resolution of scintillation detectors of ionizing radiation is one of the key parameters sought for in the current and future high-energy physics experiments. This study is encouraged by the necessity to find novel detection methods enabling a sub-10-ps time resolution in scintillation detectors and is focused on the exploitation of fast luminescence rise front. Time-resolved photoluminescence (PL) spectroscopy and thermally stimulated luminescence techniques have been used to study two promising scintillators: self-activated lead tungstate (PWO, PbWO{sub 4}) and Ce-doped gadolinium aluminum gallium garnet (GAGG, Gd{sub 3}Al{sub 2}Ga{sub 3}O{sub 12}). A sub-picosecond PL rise time is observed in PWO, while longer processes in the PL response in GAGG:Ce are detected and studied. The mechanisms responsible for the PL rise time in self-activated and doped scintillators are under discussion. - Highlights: • Photoluminescence rise time is studied in two scintillators: PWO and GAGG:Ce. • Sub-picosecond photoluminescence rise time in PWO is observed for the first time. • A multicomponent luminescence rise edge is observed in GAGG:Ce. • The mechanisms behind luminescence kinetics in the crystals are under discussion.

  15. Evaluation of New Inorganic Scintillators for Application in a Prototype Small Animal PET Scanner

    CERN Document Server

    Kuntner, C

    2003-01-01

    In the study of new pharmaceuticals as well as brain and genetic research, Positron Emission Tomography (PET) is a useful method. It has also recently entered the clinical domain in cardiology and particularly in oncology. Small animals such as mice, are often used to validate sophisticated models of human disease. High spatial resolution PET instrumentation is therefore necessary due to the reduced dimensions of the organs. Inorganic scintillators are employed in most of the diagnostic imaging devices. The ultimate performance of the PET scanner is tightly bound to the scintillation properties of the crystals. In the last years there has been an effort to develop new scintillating materials characterized by high light output, high detection efficiency and fast decay time. The most studied systems are mainly Ce3+-doped crystals such as LSO:Ce, YAP:Ce, LuAP:Ce, and recently also mixed Lux(RE3+)1-xAlO3:Ce crystals. These crystals are very attractive for medical application because of their high density (with th...

  16. Effects of Na and K co-doping on growth and scintillation properties of Eu:SrI_2 crystals

    International Nuclear Information System (INIS)

    Ito, Tomoki; Yokota, Yuui; Kurosawa, Shunsuke; Kral, Robert; Pejchal, Jan; Ohashi, Yuji; Kamada, Kei; Nikl, Martin; Yoshikawa, Akira

    2016-01-01

    We grew Na and K co-doped Eu:SrI_2 [Na,Eu:SrI_2 and K,Eu:SrI_2] crystals by a modified micro-pulling-down method to reveal the co-doping effects on the crystal growth and scintillation properties. The non-codoped, Na0.5%, Na1.0%, K0.5% and K1.0%,Eu:SrI_2 crystals indicated high transparency while the milky parts were generated in the Na5.0% and K5.0%,Eu:SrI_2 crystals. The light yields of Na,Eu:SrI_2 and K,Eu:SrI_2 crystals under γ-ray irradiation were decreased by the Na and K co-doping. On the other hand, there was a small change within 940–1020 ns in the decay times by the Na and K co-doping. In the light yield proportionality under γ-ray irradiation, the non-proportionality in the low energy region was improved by Na and K co-doping. - Highlights: • Na or K co-doped Eu:SrI_2crystals were grown by the modified μ-PD method. • The milky parts were generated in the Na5.0% and K5.0%,Eu:SrI_2crystals. • The light yield of Eu:SrI_2was decreased by the Na or K co-doping. • The decay times of Eu:SrI_2were almost constant by the Na or K co-doping. • The non-proportionalitywas improved in the low energy region by the K co-doping.

  17. Development of High-Resolution Scintillator Systems

    International Nuclear Information System (INIS)

    Larry A. Franks; Warnick J. Kernan

    2007-01-01

    Mercuric iodide (HgI2) is a well known material for the direct detection of gamma-rays; however, the largest volume achievable is limited by the thickness of the detector which needs to be a small fraction of the average trapping length for electrons. We report results of using HgI2 crystals to fabricate photocells used in the readout of scintillators. The optical spectral response and efficiency of these photocells were measured and will be reported. Nuclear response from an HgI2 photocell that was optically matched to a cerium-activated scintillator is presented and discussed. Further improvements can be expected by optimizing the transparent contact technology

  18. Study of the optical monitoring system of the scintillating crystal involved in the electromagnetic calorimeter of CMS experiment

    International Nuclear Information System (INIS)

    Geleoc, M.

    1998-01-01

    The prospect of the experimental discovery of the Higgs boson is one of the motivations to build the large hadron collider (LHC). Proton beams will collide and the emitted particles will be detected by ATLAS and CMS equipment. In each detector the electromagnetic calorimeter will allow the characterisation of the 2 photons coming from one of the disintegration channels of the Higgs boson. CMS collaboration has chosen an homogeneous calorimeter fitted with PbWO 4 crystals. Each crystal with its photodetector and its electronic device forms one detection channel. The resolution of the detection channels should not deteriorate all along the operating time. The optical monitoring system of the crystals logs then controls the response of each detection channel in order to allow an accurate calibration of the calorimeter. The optical properties, the resistance to irradiation of PbWO 4 crystals and the modelling of light collection are investigated in this work. The description of the different components of the optical monitoring system highlights the technical difficulties we had to challenge. An experimental testing bench has been set up to study the coupling between the scintillation signal and the signal that feeds the monitoring system, this coupling has been studied under irradiation in the conditions of CMS operating. (A.C.)

  19. Radiation damage in BaF2 crystals

    International Nuclear Information System (INIS)

    Woody, C.L.; Kierstead, J.A.; Levy, P.W.; Stoll, S.

    1991-01-01

    The effects of radiation damage and recovery have been studied in BaF 2 crystals exposed to 60 Co radiation. The change in optical transmission and scintillation light output have been measured as a function of dose up to 4.7 x 10 6 rad. Although some crystals exhibit a small change in transmission, a greater change in scintillation light output is observed. Several 25 cm long crystals whichhave been irradiated show large changes in both transmission and light output. Recovery from radiation damage has been studied as a function of time and exposure to UV light. A long lived radiation induced phosphorescence has been observed in all irradiated samples which is distinct from the standard fast and slow scintillation emissions. The emission spectrum of the phosphorescence has been measured and shown a peakat ∼330 nm, near the region of the slow scintillation component. Results are given on the dependence of the decay time of the phosphorescence with dose

  20. Role of activators and vacancies in the gamma-scintillation decay in CsI-Na

    International Nuclear Information System (INIS)

    Panova, A.N.; Grinev, B.V.; Sojfer, L.M.; Shakhova, K.V.; Kosinov, N.N.; Mitichkin, A.I.; Korsunova, S.P.; Lavrent'ev, F.F.

    2004-01-01

    We studied the influence of activator concentration (CNaI) and plastic deformation on the change in the contribution of the slow component to the decay of gamma-scintillation in CsI-Na crystals. The influence of CNaI on the change in the form of the luminescence excitation spectrum in the region of the absorption of activator centers (AC) and centers of vacancy nature (VNC) is investigated. The effect of CNaI on the change in the intercenter decay time of the mentioned centers is studied too. It is shown that AC and VNC participate in the photoluminescence and gamma-scintillations of CsI-Na crystals. In gamma-scintillations AC are responsible for the component τ i 370 ns, whereas the components τ 1 ' = 460 ns and τ 2 ∼ 2 μs are bound up with VNC. The decrease of τ γ from 770 to 560 ns with the growth of C from 2·10 -3 to 3·10 -2 mol. % NaI, and after plastic deformation of the crystals (ε = 5 %) along the axis from 570 to 470 ns is caused by the decrease in the number of VNC. Mechanisms of gamma-scintillations of CsI-Na crystals AC and VNC, as well as the decrease in the number of VNC are discussed. (authors)

  1. Scintillating glasses for total absorption dual readout calorimetry

    Energy Technology Data Exchange (ETDEWEB)

    Bonvicini, V. [INFN, Trieste; Driutti, A. [Udine U.; Cauz, D. [Udine U.; Pauletta, G. [Udine U.; Rubinov, P. [Fermilab; Santi, L. [Udine U.; Wenzel, H. [Fermilab

    2012-01-01

    Scintillating glasses are a potentially cheaper alternative to crystal - based calorimetry with common problems related to light collection, detection and processing. As such, their use and development are part of more extensive R&D aimed at investigating the potential of total absorption, combined with the readout (DR) technique, for hadron calorimetry. A recent series of measurements, using cosmic and particle beams from the Fermilab test beam facility and scintillating glass with the characteristics required for application of the DR technique, serve to illustrate the problems addressed and the progress achieved by this R&D. Alternative solutions for light collection (conventional and silicon photomultipliers) and signal processing are compared, the separate contributions of scintillation and Cherenkov processes to the signal are evaluated and results are compared to simulation.

  2. Quenching of scintillation in BaF2 for light charged particles

    International Nuclear Information System (INIS)

    Matulewicz, T.

    1992-01-01

    Detectors made of a barium fluoride (BaF 2 ) crystal have recently become popular in the spectroscopy of photons and light charged particles at intermediate energies. The quenching of the scintillation light of BaF 2 crystals is described in the framework of Birks law for light charged particles in the energy range of 20-100 A MeV. Based on the recently published data, the analysis yields a value of Birks constant equal to 1.8±0.3 mg MeV -1 cm -2 and a scintillation efficiency equal to 0.79±0.05 MeV ee MeV -1 . (R.P.) 10 refs.; 2 figs

  3. Growth of large detector crystals. CRADA final report

    International Nuclear Information System (INIS)

    Boatner, L.A.; Samuelson, S.

    1997-01-01

    In the course of a collaborative research effort between L.A. Boatner of Oak Ridge National Laboratory and Prof. Alex Lempicki of the Department of Chemistry of Boston University, a new highly efficient and very fast scintillator for the detection of gamma-rays was discovered. This new scintillator consists of a single crystal of lutetium orthophosphate (LuPO 4 ) to which a small percentage of trivalent cerium is added as an activator ion. The new lutetium orthophosphate-cerium scintillator was found to be superior in performance to bismuth germanium oxide--a material that is currently widely used as a gamma-ray detector in a variety of medical, scientific, and technical applications. Single crystals of LuPO 4 and related rare-earth orthophosphates had been grown for a number of years in the ORNL Solid State Division prior to the discovery of the efficient gamma-ray-scintillation response of LuPO 4 :Ce. The high-temperature-solvent (flux-growth) method used for the growth of these crystals was capable of producing crystals in sizes that were adequate for research purposes but that were inadequate for commercial-scale production and widespread application. The CRADA between ORNL and Deltronic Crystal Industries of Dover, NJ was undertaken for the purpose of investigating alternate approaches, such as top-seeded-solution growth, to the growth of LuPO 4 :Ce scintillator crystals in sizes significantly larger than those obtainable through the application of standard flux-growth methods and, therefore, suitable for commercial sales and applications

  4. Comparative study of optical and scintillation properties of YVO{sub 4}, (Lu{sub 0.5}Y{sub 0.5})VO{sub 4}, and LuVO{sub 4} single crystals

    Energy Technology Data Exchange (ETDEWEB)

    Fujimoto, Yutaka, E-mail: fuji-you@tagen.tohoku.ac.j [IMRAM, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai 980-8577 (Japan); Yanagida, Takayuki; Yokota, Yuui; Chani, Valery [IMRAM, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai 980-8577 (Japan); Kochurikhin, Vladimir V. [General Physics Institute, 38 Vavilov Street, 119991, Federation, Moscow (Russian Federation); Yoshikawa, Akira [IMRAM, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai 980-8577 (Japan); NICHe, Tohoku University, 6-6-10 Aoba, Aramaki, Aoba-ku, Sendai 980-8579 (Japan)

    2011-04-11

    Optical and scintillation properties of YVO{sub 4}, (Lu{sub 0.5}Y{sub 0.5})VO{sub 4}, and LuVO{sub 4} single crystals grown by the Czochralski (CZ) method with RF heating system are compared. All vanadate crystals show high transmittance ({approx}80%) in the 400-900 nm wavelength range. In both photo- and radio-luminescence spectra, intense peak around 400-500 nm, which was ascribed to the transition from triplet state of VO{sub 4}{sup 3-}, was clearly observed. The main decay time component was about 38 {mu}s (YVO{sub 4}), 18 {mu}s ((Lu{sub 0.5}Y{sub 0.5})VO{sub 4}), and 17 {mu}s (LuVO{sub 4}) under 340 nm excitation. The scintillation light yields of YVO{sub 4}, (Lu{sub 0.5}Y{sub 0.5})VO{sub 4}, and LuVO{sub 4} crystals (obtained from the {sup 137}Cs excited pulse height spectra) were evaluated to be about 11,200, 10,700, and 10,300 ph/MeV, respectively.

  5. Alpha-gamma pulse shape discrimination in CsI:Tl, CsI:Na and BaF sub 2 scintillators

    CERN Document Server

    Dinca, L E; Haas, J; Bom, V R; Eijk, C W E

    2002-01-01

    Some scintillating materials offer the possibility of measuring well separated alpha and gamma scintillation response using a single crystal. Eventually aiming at thermal neutron detection using sup 6 Li or sup 1 sup 0 B admixture, pulse shape discrimination measurements were made on three scintillators: CsI:Tl, CsI:Na and pure BaF sub 2 crystals. A very good alpha/gamma discrimination was obtained using sup 2 sup 2 Na, sup 2 sup 4 sup 1 Am (gamma) and sup 2 sup 4 sup 4 Cm (alpha) radioactive sources.

  6. An algorithm for automatic crystal identification in pixelated scintillation detectors using thin plate splines and Gaussian mixture models.

    Science.gov (United States)

    Schellenberg, Graham; Stortz, Greg; Goertzen, Andrew L

    2016-02-07

    A typical positron emission tomography detector is comprised of a scintillator crystal array coupled to a photodetector array or other position sensitive detector. Such detectors using light sharing to read out crystal elements require the creation of a crystal lookup table (CLUT) that maps the detector response to the crystal of interaction based on the x-y position of the event calculated through Anger-type logic. It is vital for system performance that these CLUTs be accurate so that the location of events can be accurately identified and so that crystal-specific corrections, such as energy windowing or time alignment, can be applied. While using manual segmentation of the flood image to create the CLUT is a simple and reliable approach, it is both tedious and time consuming for systems with large numbers of crystal elements. In this work we describe the development of an automated algorithm for CLUT generation that uses a Gaussian mixture model paired with thin plate splines (TPS) to iteratively fit a crystal layout template that includes the crystal numbering pattern. Starting from a region of stability, Gaussians are individually fit to data corresponding to crystal locations while simultaneously updating a TPS for predicting future Gaussian locations at the edge of a region of interest that grows as individual Gaussians converge to crystal locations. The algorithm was tested with flood image data collected from 16 detector modules, each consisting of a 409 crystal dual-layer offset LYSO crystal array readout by a 32 pixel SiPM array. For these detector flood images, depending on user defined input parameters, the algorithm runtime ranged between 17.5-82.5 s per detector on a single core of an Intel i7 processor. The method maintained an accuracy above 99.8% across all tests, with the majority of errors being localized to error prone corner regions. This method can be easily extended for use with other detector types through adjustment of the initial

  7. An algorithm for automatic crystal identification in pixelated scintillation detectors using thin plate splines and Gaussian mixture models

    International Nuclear Information System (INIS)

    Schellenberg, Graham; Goertzen, Andrew L; Stortz, Greg

    2016-01-01

    A typical positron emission tomography detector is comprised of a scintillator crystal array coupled to a photodetector array or other position sensitive detector. Such detectors using light sharing to read out crystal elements require the creation of a crystal lookup table (CLUT) that maps the detector response to the crystal of interaction based on the x–y position of the event calculated through Anger-type logic. It is vital for system performance that these CLUTs be accurate so that the location of events can be accurately identified and so that crystal-specific corrections, such as energy windowing or time alignment, can be applied. While using manual segmentation of the flood image to create the CLUT is a simple and reliable approach, it is both tedious and time consuming for systems with large numbers of crystal elements. In this work we describe the development of an automated algorithm for CLUT generation that uses a Gaussian mixture model paired with thin plate splines (TPS) to iteratively fit a crystal layout template that includes the crystal numbering pattern. Starting from a region of stability, Gaussians are individually fit to data corresponding to crystal locations while simultaneously updating a TPS for predicting future Gaussian locations at the edge of a region of interest that grows as individual Gaussians converge to crystal locations. The algorithm was tested with flood image data collected from 16 detector modules, each consisting of a 409 crystal dual-layer offset LYSO crystal array readout by a 32 pixel SiPM array. For these detector flood images, depending on user defined input parameters, the algorithm runtime ranged between 17.5–82.5 s per detector on a single core of an Intel i7 processor. The method maintained an accuracy above 99.8% across all tests, with the majority of errors being localized to error prone corner regions. This method can be easily extended for use with other detector types through adjustment of the initial

  8. An algorithm for automatic crystal identification in pixelated scintillation detectors using thin plate splines and Gaussian mixture models

    Science.gov (United States)

    Schellenberg, Graham; Stortz, Greg; Goertzen, Andrew L.

    2016-02-01

    A typical positron emission tomography detector is comprised of a scintillator crystal array coupled to a photodetector array or other position sensitive detector. Such detectors using light sharing to read out crystal elements require the creation of a crystal lookup table (CLUT) that maps the detector response to the crystal of interaction based on the x-y position of the event calculated through Anger-type logic. It is vital for system performance that these CLUTs be accurate so that the location of events can be accurately identified and so that crystal-specific corrections, such as energy windowing or time alignment, can be applied. While using manual segmentation of the flood image to create the CLUT is a simple and reliable approach, it is both tedious and time consuming for systems with large numbers of crystal elements. In this work we describe the development of an automated algorithm for CLUT generation that uses a Gaussian mixture model paired with thin plate splines (TPS) to iteratively fit a crystal layout template that includes the crystal numbering pattern. Starting from a region of stability, Gaussians are individually fit to data corresponding to crystal locations while simultaneously updating a TPS for predicting future Gaussian locations at the edge of a region of interest that grows as individual Gaussians converge to crystal locations. The algorithm was tested with flood image data collected from 16 detector modules, each consisting of a 409 crystal dual-layer offset LYSO crystal array readout by a 32 pixel SiPM array. For these detector flood images, depending on user defined input parameters, the algorithm runtime ranged between 17.5-82.5 s per detector on a single core of an Intel i7 processor. The method maintained an accuracy above 99.8% across all tests, with the majority of errors being localized to error prone corner regions. This method can be easily extended for use with other detector types through adjustment of the initial

  9. Bioactive and wood-associated stilbenes as multifunctional antimicrobial and health promoting agents - BIOSTIMUL

    Energy Technology Data Exchange (ETDEWEB)

    Wright, A. von (Univ. of Eastern Finland, Kuopio (Finland). Dept. of Biosciences.), Email: atte.vonWright@uef.fi

    2010-10-15

    Plant polyphenolics have a wide range of bioactivities. Coniferous trees are a rich source of stilbenes, such as pinosylvin in the genus Pinus. Pinosylvin is structurally very similar to resveratrol, a stilbene found in grapes and red berries, and which is reported to have beneficial health effects such as prevention of cardiovascular diseases, tumourigenesis, and according to recent findings, also type II diabetes. In our previous studies the bioactivities of pinosylvin (antimicrobial effects and cytotoxic activities against cancer cells) were very similar to those of resveratrol. In this project we elucidate the potential of pinosylvin and its derivatives in food applications as multifunctional antimicrobial agents with positive health effects (including prevention of type II diabetes) highlighting results. (orig.)

  10. Bioactive and wood-associated stilbenes as multifunctional antimicrobial and health promoting agents - BIOSTIMUL

    Energy Technology Data Exchange (ETDEWEB)

    Wright, A. von (Univ. of Kuopio, Dept. of Biosciences (Finland)), email: atte.vonWright@uku.fi

    2009-10-15

    Plant polyphenolics have a wide range of bioactivities. Coniferous trees are a rich source of stilbenes, such as pinosylvin in the genus Pinus. Pinosylvin is structurally very similar to resveratrol, a stilbene found in grapes and red berries, and which is reported to have beneficial health effects such as prevention of cardiovascular diseases, tumourigenesis, and according to recent findings, also type 2 diabetes. In our previous studies the bioactivities of pinosylvin (antimicrobial effects and cytotoxic activities against cancer cells) were very similar to those of resveratrol. In this project we elucidate the potential of pinosylvin and its derivatives in food applications as multifunctional antimicrobial agents with positive health effects (including prevention of type 2 diabetes) highlighting results. (orig.)

  11. Bioactive and wood-associated stilbenes as multifunctional antimicrobial and health promoting agents (BIOSTIMUL)

    Energy Technology Data Exchange (ETDEWEB)

    Wright, A. von (Kuopio Univ., Department of Biosciences (Finland))

    2008-07-01

    Plant polyphenolics have a wide range of bioactivities. Coniferous trees are a rich source of stilbenes, such as pinosylvin in the genus Pinus. Pinosylvin is structurally very similar to resveratrol, a stilbene found in grapes and red berries, and which is reported to have beneficial health effects such as prevention of cardiovascular diseases, tumourigenesis, and according to recent findings, also type II diabetes. In our previous studies the bioactivities of pinosylvin (antimicrobial effects and cytotoxic activities against cancer cells) were very similar to those of resveratrol. In this project we elucidate the potential of pinosylvin and as derivatives in food applications as multifunctional antimicrobial agents with positive health effects (including prevention of type II diabetes) highlighting results. (orig.)

  12. Scintillation efficiency and X-ray imaging with the RE-Doped LuAG thin films grown by liquid phase epitaxy

    International Nuclear Information System (INIS)

    Tous, Jan; Blazek, Karel; Kucera, Miroslav; Nikl, Martin; Mares, Jiri A.

    2012-01-01

    Very thin scintillator imaging plates have recently become of great interest. In high resolution X-ray radiography, very thin scintillator layers of about 5–20 μm are used to achieve 2D-spatial resolutions below 1 μm. Thin screens can be prepared by mechanical polishing from single crystals or by epitaxial growth on single-crystal substrates using the Liquid Phase Epitaxy technique (LPE). Other types of screens (e.g. deposited powder) do no reach required spatial resolutions. This work compares LPE-grown YAG and LuAG scintillator films doped with different rare earth ions (Cerium, Terbium and Europium). Two different fluxes were used in the LPE growth procedure. These LPE films are compared to YAG:Ce and LuAG:Ce screens made from bulk single crystals. Relative light yield was detected by a highly sensitive CCD camera. Scintillator screens were excited by a micro-focus X-ray source and the generated light was gathered by the CCD camera’s optical system. Scintillator 2D-homogeneity is examined in an X-ray imaging setup also using the CCD camera.

  13. Response function study of a scintillator detector of NaI(Tl)

    International Nuclear Information System (INIS)

    Villa, Marcelo Barros; Costa, Alessandro Martins da

    2014-01-01

    In measurements of gamma rays with Nai (Tl) scintillator, the detectors output data are pulse height spectra, that corresponding to distorted information about the radiation source due to various errors associated with the crystal scintillation process and electronics associated, instead of power spectra photons. Pulse height spectra are related to the real power spectra by means of scintillator detector response function NaI (Tl). In this work, the response function for a cylindrical crystal of Nal (Tl) of 7,62 x 7,62 cm (diameter x length) was studied, by Monte Carlo method, using the EGSnrc tool to model the transport of radiation, combined with experimental measurements. An inverse response matrix, even with the energy of the square root, which transforms the pulse height spectrum of photon energy spectrum was obtained. The results of this transformation of pulse height spectrum for photon energy spectrum is presented, showing that the methodology employed in this study is suitable

  14. Pulse-form discrimination in organic scintillation crystals; Discrimination d'apres la forme de l'impulsion dans les cristaux organiques de scintillation; Diskriminatsiya formy impul'sov v organicheskikh stsintillyatsionnykh kristallakh; Discriminacion de la forma de los impulsos en los cristales de compuestos organicos para contadores de centelleo

    Energy Technology Data Exchange (ETDEWEB)

    De Vries, L J; Udo, F [Instituut voor Kernphysisch Onderzoek, Amsterdam (Netherlands)

    1962-04-15

    Presented is a proton-electron discrimination circuit, based on the pulse-form differences between proton and electron-induced scintillation light pulses in stilbene. The circuit is stable and resolves proton from electron pulses down to a proton energy of 300 keV. The discrimination circuit, which contains only linear elements, is sensitive to pile-up-induced errors for only 0.1 {mu}s after the arrival of a pulse. The described circuit has now been used in a 1-30 MeV neutron spectrometer based on proton-recoil between two silbene crystals. A resolution of 10% at 14 MeV neutron energy was obtained with a detection efficiency of 1.3 x 10{sup -4}. A neutron monitor, also based on linear pulse-form discrimination, could be used to measure a neutron dose of 10% of the maximum permissible dose in the presence of a gamma flux of 4 times the maximum permissible dose. (author) [French] Le memoire decrit un circuit de discrimination proton/electron dont le principe repose sur les differences de forme entre les impulsions lumineuses dans du stilbene, produites par des protons, d'une part, et des electrons, d'autre part. Le circuit est stable et permet de separer les impulsions protoniques des impulsions electroniques, a partir d'une energie protonique de 300 keV. Ce circuit, qui ne contient que des elements lineaires, n'est sujet a des erreurs dues a l'accumulation que pendant 0,1 {mu}s apres l'arrivee de l'impulsion. Il a ete utilise dans un spectrometre neutronique de 1-30 MeV, fonde sur le recul des protons entre deux cristaux de stilbene. On a obtenu une resolution de 10% pour une energie neutronique de 14 MeV, avec une efficacite de detection de 1,3x10{sup -4}. Un detecteur de neutrons procedant egalement par discrimination d'apres la forme des impulsions, pourrait servir a mesurer une dose de neutrons representant 10% de la dose maximum admissible, en presence d'un flux gamma correspondant a une dose quatre fois superieure a la dose maximum admissible. (author

  15. Barium halide nanocrystals in fluorozirconate based glass ceramics for scintillation application

    Energy Technology Data Exchange (ETDEWEB)

    Selling, J.

    2007-07-01

    Europium (Eu)-activated barium halide nanocrystals in fluorozirconate based glass ceramics represent a promising class of Xray scintillators. The scintillation in these glass ceramics is mainly caused by the emission of divalent Eu incorporated in hexagonal BaCl{sub 2} nanocrystals which are formed in the glass matrix upon appropriate annealing. Experiments with cerium (Ce)-activated fluorozironate glass ceramics showed that Ce is an interesting alternative. In order to get a better understanding of the scintillation mechanism in Eu- or Ce-activated barium halide nanocrystals, an investigation of the processes in the corresponding bulk material is essential. The objective of this thesis is the investigation of undoped, Eu-, and Ce-doped barium halides by X-ray excited luminescence (XL), pulse height, and scintillation decay spectra. That will help to figure out which of these crystals has the most promising scintillation properties and would be the best nanoparticles for the glass ceramics. Furthermore, alternative dopants like samarium (Sm) and manganese (Mn) were also investigated. Besides the above-mentioned optical investigation electron paramagnetic resonance (EPR) and Moessbauer measurements were carried out in order to complete the picture of Eu-doped barium halides. The EPR data of Eu-doped BaI{sub 2} is anticipated to yield more information about the crystal field and crystal structure that will help to understand the charge carrier process during the scintillation process. The main focus of the Moessbauer investigations was set on the Eu-doped fluorochlorozirconate glass ceramics. The results of this investigation should help to improve the glass ceramics. The Eu{sup 2+}/Eu{sup 3+} ratio in the glass ceramics should be determined and optimize favor of the Eu{sup 2+}. We also want to distinguish between Eu{sup 2+} in the glass matrix and Eu{sup 2+} in the nanocrystals. For a better understanding of Moessbauer spectroscopy on Eu also measurements on Eu in a

  16. Barium halide nanocrystals in fluorozirconate based glass ceramics for scintillation application

    International Nuclear Information System (INIS)

    Selling, J.

    2007-01-01

    Europium (Eu)-activated barium halide nanocrystals in fluorozirconate based glass ceramics represent a promising class of Xray scintillators. The scintillation in these glass ceramics is mainly caused by the emission of divalent Eu incorporated in hexagonal BaCl 2 nanocrystals which are formed in the glass matrix upon appropriate annealing. Experiments with cerium (Ce)-activated fluorozironate glass ceramics showed that Ce is an interesting alternative. In order to get a better understanding of the scintillation mechanism in Eu- or Ce-activated barium halide nanocrystals, an investigation of the processes in the corresponding bulk material is essential. The objective of this thesis is the investigation of undoped, Eu-, and Ce-doped barium halides by X-ray excited luminescence (XL), pulse height, and scintillation decay spectra. That will help to figure out which of these crystals has the most promising scintillation properties and would be the best nanoparticles for the glass ceramics. Furthermore, alternative dopants like samarium (Sm) and manganese (Mn) were also investigated. Besides the above-mentioned optical investigation electron paramagnetic resonance (EPR) and Moessbauer measurements were carried out in order to complete the picture of Eu-doped barium halides. The EPR data of Eu-doped BaI 2 is anticipated to yield more information about the crystal field and crystal structure that will help to understand the charge carrier process during the scintillation process. The main focus of the Moessbauer investigations was set on the Eu-doped fluorochlorozirconate glass ceramics. The results of this investigation should help to improve the glass ceramics. The Eu 2+ /Eu 3+ ratio in the glass ceramics should be determined and optimize favor of the Eu 2+ . We also want to distinguish between Eu 2+ in the glass matrix and Eu 2+ in the nanocrystals. For a better understanding of Moessbauer spectroscopy on Eu also measurements on Eu in a CaF 2 host lattice were carried

  17. Cerium doped GSO scintillators and its application to position sensitive detectors

    International Nuclear Information System (INIS)

    Ishibashi, H.; Shimizu, K.; Susa, K.; Kubota, S.

    1989-01-01

    The dependence of the light output and the decay times of Ce doped Gd/sub 2/SiO/sub 5/ on Ce concentration is measured. By using the difference in decay times on Ce concentration for GSO(Ce), the combination of different concentration of GSO(Ce) scintillators is shown to be useful as position sensitive detectors. A Ce doped Gd/sub 2/SiO/sub 5/ (GSO(Ce)) single crystal is an excellent scintillator featuring, a large light output, a short decay time and a high absorption coefficient. Further investigation aimed at its implementation to scintillators has been carried out previously. An application of the GSO(Ce) scintillators to the gamma-ray detectors of positron emission computed tomography has also been shown. The authors have investigated the dependence of its scintillation properties on the Ce concentration and its application to position sensitive detectors

  18. Time walk correction for TOF-PET detectors based on a monolithic scintillation crystal coupled to a photosensor array

    International Nuclear Information System (INIS)

    Vinke, R.; Loehner, H.; Schaart, D.R.; Dam, H.T. van; Seifert, S.; Beekman, F.J.; Dendooven, P.

    2010-01-01

    When optimizing the timing performance of a time-of-flight positron emission tomography (TOF-PET) detector based on a monolithic scintillation crystal coupled to a photosensor array, time walk as a function of annihilation photon interaction location inside the crystal needs to be considered. In order to determine the 3D spatial coordinates of the annihilation photon interaction location, a maximum likelihood estimation algorithm was developed, based on a detector characterization by a scan of a 511 keV photon beam across the front and one of the side surfaces of the crystal. The time walk effect was investigated using a 20 mmx20 mmx12 mm LYSO crystal coupled to a fast 4x4 multi-anode photomultiplier tube (MAPMT). In the plane parallel to the photosensor array, a spatial resolution of 2.4 mm FWHM is obtained. In the direction perpendicular to the MAPMT (depth-of-interaction, DOI), the resolution ranges from 2.3 mm FWHM near the MAPMT to 4 mm FWHM at a distance of 10 mm. These resolutions are uncorrected for the ∼1mm beam diameter. A coincidence timing resolution of 358 ps FWHM is obtained in coincidence with a BaF 2 detector. A time walk depending on the 3D annihilation photon interaction location is observed. Throughout the crystal, the time walk spans a range of 100 ps. Calibration of the time walk vs. interaction location allows an event-by-event correction of the time walk.

  19. Digital Data Processing of Stilbene

    International Nuclear Information System (INIS)

    AMIRI, Moslem; MATEJ, Zdenek; MRAVEC, Filip; PRENOSIL, Vaclav; CVACHOVEC, Frantisek

    2013-06-01

    Stilbene is a proven spectrometric detector for mixed fields of neutrons and gamma rays. By digital processing of shape output pulses from the detector it is possible to obtain information about the energy of the interacting neutron / photon and distinguish which of these two particles interacts in the detector. Another numerical processing of digital data can finalize the energy spectrum of both components of the mixed field. The quality of the digitized data is highly dependent on the parameters of the hardware used for digitization and on the quality of software processing. Our results also show how the quality of the particle type identification depends on the sampling rate and as well as the method of processing of the sampled data. (authors)

  20. Scintillation and optical stimulated luminescence of Ce-doped CaF2

    International Nuclear Information System (INIS)

    Yanagida, Takayuki; Fujimoto, Yutaka; Watanabe, Kenichi; Fukuda, Kentaro; Kawaguchi, Noriaki; Miyamoto, Yuka; Nanto, Hidehito

    2014-01-01

    Scintillation and optical stimulated luminescence of Ce 0.1–20% doped CaF 2 crystals prepared by Tokuyama Corp. were investigated. In X-ray induced scintillation spectra, luminescence due to Ce 3+ 5d–4f transition appeared around 320 nm with typically 40 ns decay time. By 241 Am 5.5 MeV α-ray irradiation, 0.1% doped one showed the highest scintillation light yield and the light yield monotonically decreased with Ce concentrations. Optically stimulated luminescence after X-ray irradiation was observed around 320 nm under 550 or 830 nm stimulation in all samples. As a result, intensities of optically stimulated luminescence were proportional to Ce concentrations. Consequently, scintillation and optically stimulated luminescence resulted to have a complementary relation in Ce-doped CaF 2 system. - Highlights: • Optical, scintillation, and OSL properties of Ce 0.1–20% doped CaF 2 were studied. • Scintillation light yield exhibited inverse proportionality to Ce concentrations. • OSL intensities showed proportionality to Ce concentrations. • Complementary relation of scintillation and OSL was experimentally confirmed

  1. Large-scale production of PWO scintillation elements for CMS ECAL

    International Nuclear Information System (INIS)

    Annenkov, A.; Auffray, E.; Drobychev, G.; Korzhik, M.; Kostylev, V.; Kovalev, O.; Lecoq, P.; Ligoun, V.; Missevitch, O.; Zouevski, R.

    2005-01-01

    JSC Bogoroditsk Technical Chemical Plant, BTCP, has produced up to date more than 20,000 lead tungstate scintillation elements for the electromagnetic calorimeter of CMS Collaboration. Here we report on the status of the crystal production and results of the quality insurance program, which is performed by the Collaboration in cooperation with BTCP to keep crystal properties within specifications

  2. Growth and scintillation properties of praseodymium doped (Lu,Gd).sub.3./sub.(Ga,Al).sub.5./sub.O.sub.12./sub. single crystals

    Czech Academy of Sciences Publication Activity Database

    Kamada, K.; Nikl, Martin; Kurosawa, S.; Shoji, Y.; Pejchal, Jan; Ohashi, Y.; Yokota, Y.; Yoshikawa, A.

    2016-01-01

    Roč. 169, Jan (2016), s. 811-815 ISSN 0022-2313. [International Conference on Luminescence and Optical Spectroscopy of Condensed Matter /17./. Wroclaw, 13.07.2014-18.07.2014] R&D Projects: GA MŠk(CZ) LH14266 EU Projects: European Commission(XE) 316906 - LUMINET Institutional support: RVO:68378271 Keywords : single crystal growth * oxides * scintillators * praseodymium * garnet Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.686, year: 2016

  3. Crystal growth and scintillation properties of selected fluoride crystals for VUV scintillators

    Czech Academy of Sciences Publication Activity Database

    Pejchal, Jan; Fukuda, K.; Yamaji, A.; Yokota, Y.; Kurosawa, S.; Král, Robert; Nikl, Martin; Yoshikawa, A.

    2014-01-01

    Roč. 401, Sep (2014), s. 833-838 ISSN 0022-0248. [International Conference on Crystal Growth and Epitaxy /17./. Warsaw, 11.08.2013-16..08.2013] R&D Projects: GA MŠk LH12150 Institutional support: RVO:68378271 Keywords : vacuum-ultra-violet emission * micro-pulling-down method * barium -lutetium fluoride * erbium fluoride Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.698, year: 2014

  4. Modifications of micro-pulling-down method for the growth of selected Li-containing crystals for neutron scintillator and VUV scintillation crystals

    Czech Academy of Sciences Publication Activity Database

    Pejchal, Jan; Fujimoto, Y.; Chani, V.; Yanagida, T.; Yokota, Y.; Yoshikawa, A.; Nikl, Martin; Beitlerová, Alena

    2012-01-01

    Roč. 360, SI (2012), 127–130 ISSN 0022-0248 R&D Projects: GA MŠk(CZ) 1M06002 Grant - others:AVČR(CZ) M100100910 Institutional research plan: CEZ:AV0Z10100521 Keywords : Ti-doping * micro-pulling-down * barium lutetium fluoride * lithium aluminate * neutron scintillator Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.552, year: 2012

  5. Heat- and radiation-resistant scintillator for electron microscopes

    International Nuclear Information System (INIS)

    Kosov, A.V.; Petrov, S.A.; Puzyr', A.P.; Chetvergov, N.A.

    1987-01-01

    The use of a scintillator consisting of a single crystal of bismuth orthogermanate, which has high heat and radiation resistance, in REM-100, REM-200, and REM-100U electron microscopes is described. A study of the heat and radiation stabilities of single crystals of bismuth orthogermanate (Bi 4 Ge 3 O 12 ) has shown that they withstood multiple electron-beam heating redness (T ∼ 800 0 C) without changes in their properties

  6. Identification and quantification of stilbenes in some Tunisian red wines using UPLC-MS and HPLC-DAD

    Directory of Open Access Journals (Sweden)

    Kamel Arraki

    2017-06-01

    Full Text Available Seven Tunisian red wines mainly from the Mornag appellation were analyzed for resveratrol and analogues. The wines of each variety were evaporated, concentrated, and then subjected to fractionation and purification using XAD16 and DOWEX column chromatography. In addition to resveratrol, seven stilbenes were identified by UPLC-MS. The stilbenes derived were shown to be piceatannol, piceid, a-viniferin, e-viniferin, hopeaphenol and isohopeaphenol. From the point of view of the presence of resveratrol derivatives, one wine, Sidi Zahia, was the richest qualitatively.

  7. Impact of precursor purity on optical properties and radiation detection of CsI:Tl scintillators

    Energy Technology Data Exchange (ETDEWEB)

    Saengkaew, Phannee; Cheewajaroen, Kulthawat; Yenchai, Chadet; Thong-aram, Decho [Chulalongkorn University, Department of Nuclear Engineering, Faculty of Engineering, Bangkok (Thailand); Sanorpim, Sakuntam [Chulalongkorn University, Department of Physics, Faculty of Science, Bangkok (Thailand); Jitpukdee, Manit [Kasetsart University, Department of Applied Radiation and Isotope, Faculty of Science, Bangkok (Thailand); Yordsri, Visittapong; Thanachayanont, Chanchana [Ministry of Science and Technology, National Metal and Materials Technology Center, National Science and Technology Development Agency, Pathumthani (Thailand); Nuntawong, Noppadon [Ministry of Science and Technology, National Electronic and Computer Technology Center, National Science and Technology Development Agency, Pathumthani (Thailand)

    2016-08-15

    Cesium iodide doped with thallium (CsI:Tl) crystals was grown to develop the gamma-ray detectors by using low-cost raw materials. Effect of impurities on optical properties and radiation detection performance was investigated. By a modified homemade Bridgman-Stockbarger technique, CsI:Tl samples were grown in two levels of CsI and TlI reactant materials, i.e., having as a very high purity of 99.999 % and a high purity of 99.9 %. XRD measurements indicate CsI:Tl crystals having a good quality with a dominant (110) plane. Having a cubic structure, a lattice constant of CsI crystals of 0.4574 nm and a crystallite size of 43.539 nm were obtained. From the lower-purity raw materials, calcite was found in an orange crystal with a lattice constant of 0.4560 nm and a crystallite size of 43.089 nm. By PL measurements, the optical properties of the CsI:Tl crystals were analyzed. ∝540-nm-wavelength PL peak was observed from the colorless high-purity crystal, and ∝600-nm-wavelength PL peak was observed from the orange crystal. The brighter PL emission was obtained from the orange crystals suggesting impurities. CsI:Tl surface morphology by SEM exhibited a smooth surface with some parallel crystal facets. For electrical properties of high-quality CsI:Tl crystals, the electrical resistances were 230 ± 16 MΩ in cross-sectional direction and 714 ± 136 MΩ in vertical direction with respect to more homogeneous crystal quality in cross-sectional direction than that in vertical direction. TEM measurement was applied to evaluate the microstructure of colorless CsI:Tl crystal with different patterns of a cubic structure. Both CsI:Tl crystals show good efficiencies and good resolutions. Maintaining the same electronic conditions and amplifications, the colorless CsI:Tl scintillators represented a higher detection efficiency at 122 keV of Co-57 of 78.4 % and the energy resolution of 23.3 % compared to the detection efficiency of 75.9 % and the energy resolution of 34.6 % of the

  8. Influence of variable tungsten valency on optical transmittance and radiation hardness of lead tungstate (PWO) scintillation crystals

    CERN Document Server

    Burachas, S; Makov, I; Saveliev, Yu; Ippolitov, M S; Man'ko, V; Nikulin, S P; Nyanin, A; Vasilev, A; Apanasenko, A; Tamulaitis, G

    2003-01-01

    A new approach to interpret the radiation hardness of PbWO//4 (PWO) scintillators is developed by revealing importance of the inclusions of tungsten oxides WO//3//-//x with variable valency. It is demonstrated that the influence of the ionizing radiation on PWO is, in many aspects, similar to the effect of the high-temperature annealing in oxygenless ambient. In both cases, a valency change of the tungsten oxides is initiated and results in induced absorption and, consequently, in crystal coloration. In the PWO crystals doped with L//2O//3 (L = Y, La, Gd), the radiation hardness and the optical properties are mainly affected by inclusions of W//1//-//yL//yO//3//- //x (0 less than x less than 0.3) instead of inclusions of WO//3//- //x prevailing in the undoped samples. It is demonstrated that the radiation-induced bleaching and the photochromic effect of PWO are caused by phase transitions in the inclusions of tungsten oxide. Thermodynamic conditions for the phase transitions are discussed and the optimal oxid...

  9. Study of a generalized birks formula for the scintillation response of a CaMoO4 crystal

    Science.gov (United States)

    Lee, J. Y.; Kim, H. J.; Kang, Sang Jun; Lee, M. H.

    2017-12-01

    We have investigated the scintillation characteristics of CaMoO4 (CMO) crystals by using a gamma source and various internal alpha sources. A 137Cs source with 662-keV gamma-rays was used for the gamma-quanta light yield calibration. Internal radioactive contaminations provided alpha particles with different energies from 5.41 to 7.88 MeV. We developed a C++ program based on the ROOT package for the fitting of parameters in a generalized Birks semi-empirical formula by combining the experimental and the simulation data. Results for the fitted Birks parameters are k b1 = 3.3 × 10 -3 (g/MeVcm2) for the 1st parameter and k b2 = 7.9 × 10 -5 (g/MeVcm2)2 for the 2nd parameter. The χ2/n.d.f. (Number of Degree of Freedom) is calculated as 0.1/4. We were able to estimate the 238U and 234U contaminations in a CMO crystal by using the generalized Birks semi-empirical formula.

  10. New limits on 2β processes in 40Ca and 46Ca by using low radioactive CaF2(Eu) crystal scintillators

    International Nuclear Information System (INIS)

    Belli, P.; Bernabei, R.; Dai, C.J.

    2001-01-01

    The development of highly radiopure CaF 2 (Eu) crystal scintillators has been performed aiming at a substantial sensitivity enhancement of the 2β decay investigation and of the search for dark matter particles with spin-dependent (SD) interaction. The results of CaF 2 (Eu) background measurements and simulation are presented. New and highly improved T 1/2 limits on the 2β decay of 46 Ca and the double electron capture of 40 Ca are obtained

  11. Sapphire scintillation tests for cryogenic detectors in the Edelweiss dark matter search

    Energy Technology Data Exchange (ETDEWEB)

    Luca, M

    2007-07-15

    Identifying the matter in the universe is one of the main challenges of modern cosmology and astrophysics. An important part of this matter seems to be made of non-baryonic particles. Edelweiss is a direct dark matter search using cryogenic germanium bolometers in order to look for particles that interact very weakly with the ordinary matter, generically known as WIMPs (weakly interacting massive particles). An important challenge for Edelweiss is the radioactive background and one of the ways to identify it is to use a larger variety of target crystals. Sapphire is a light target which can be complementary to the germanium crystals already in use. Spectroscopic characterization studies have been performed using different sapphire samples in order to find the optimum doping concentration for good low temperature scintillation. Ti doped crystals with weak Ti concentrations have been used for systematic X ray excitation tests both at room temperature and down to 30 K. The tests have shown that the best Ti concentration for optimum room temperature scintillation is 100 ppm and 50 ppm at T = 45 K. All concentrations have been checked by optical absorption and fluorescence. After having shown that sapphire had interesting characteristics for building heat-scintillation detectors, we have tested if using a sapphire detector was feasible within a dark matter search. During the first commissioning tests of Edelweiss-II, we have proved the compatibility between a sapphire heat scintillation detector and the experimental setup. (author)

  12. Continuous flow photocyclization of stilbenes – scalable synthesis of functionalized phenanthrenes and helicenes

    Directory of Open Access Journals (Sweden)

    Quentin Lefebvre

    2013-09-01

    Full Text Available A continuous flow oxidative photocyclization of stilbene derivatives has been developed which allows the scalable synthesis of backbone functionalized phenanthrenes and helicenes of various sizes in good yields.

  13. Comparison of Spectral and Scintillation Properties of LuAP:Ce and LuAP:Ce,Sc Single Crystals

    Science.gov (United States)

    Petrosyan, Ashot G.; Derdzyan, Marina; Ovanesyan, Karine; Shirinyan, Grigori; Lecoq, Paul; Auffray, Etiennette; Kronberger, Matthias; Frisch, Benjamin; Pedrini, Christian; Dujardin, Christophe

    2009-10-01

    Scintillation properties of LuAP:Ce and LuAP:Ce,Sc crystal series were studied under excitation by gamma-rays from a 137Cs source. Both series demonstrated comparable optical quality in terms of underlying absorption at 260 nm, slope of the optical edge and transmission in the range of emission. The light yield of LuAP:Ce crystals measured in 0.2 cm times 0.2 cm times 0.8 cm pixels increases linearly with the Ce concentration reaching at 0.58 at. % 6448 plusmn 322 ph/MeV and 9911 plusmn 496 ph/MeV in the long and in the short directions respectively (the light yield ratio is 65%) and shows no sign of light saturation. The energy resolution is found to depend, among other factors, on the uniformity of Ce concentration within the pixels and is improved to 7.1 plusmn 0.4% (I = 0.2 cm), 9.5 plusmn 0.5% (I = 0.8 cm). Intentional co-doping with Sc + ions was tested and resulted in increase of the Ce distribution coefficient to about 0.3. This enabled to increase the concentration of Ce in LuAP:Ce,Sc crystals up to 0.7 at. %, while conserving high optical quality. In contrast to LuAP:Ce, the light yield in LuAP:Ce,Sc crystals does not increase with Ce concentration, the photo peak being gradually suppressed. The involved mechanisms are discussed basing on measurements of the unit cell volumes, Ce concentration uniformity, x-ray rocking spectra, absorption spectra of pure and variously doped LuAP crystals, and emission spectra under different excitations.

  14. Near threshold pulse shape discrimination techniques in scintillating CsI(Tl) crystals

    International Nuclear Information System (INIS)

    Wu, S.C.; Yue, Q.; Lai, W.P.; Li, H.B.; Li, J.; Lin, S.T.; Liu, Y.; Singh, V.; Wang, M.Z.; Wong, H.T.; Xin, B.; Zhou, Z.Y.

    2004-01-01

    There are recent interests with CsI(Tl) scintillating crystals for Dark Matter experiments. The key merit is the capability to differentiate nuclear recoil (nr) signatures from the background β/γ-events due to ambient radioactivity on the basis of their different pulse shapes. One of the major experimental challenges is to perform such pulse shape analysis in the statistics-limited domain where the light output is close to the detection threshold. Using data derived from measurements with low-energy γ's and nuclear recoils due to neutron elastic scatterings, it was verified that the pulse shapes between β/γ-events are different. Several methods of pulse shape discrimination (PSD) are studied, and their relative merits are compared. Full digitization of the pulse shapes is crucial to achieve good discrimination. Advanced software techniques with mean time, neural network and likelihood ratios give rise to satisfactory performance, and are superior to the conventional Double Charge method commonly applied at higher energies. PSD becomes effective starting at a light yield of about 20 photo-electrons. This corresponds to a detection threshold of about 5 keV electron-equivalence energy, or 40-50 keV recoil kinetic energy, in realistic experiments

  15. Effect of Dietary Stilbenes on 5-Lipoxygenase and Cyclooxygenases Activities In Vitro

    Czech Academy of Sciences Publication Activity Database

    Kutil, Zsófia; Kvasnicová, Marie; Temml, V.; Schuster, D.; Maršík, Petr; Cusimamani, E.F.; Lou, J.D.; Vaněk, Tomáš; Landa, Přemysl

    2015-01-01

    Roč. 18, č. 7 (2015), s. 1471-1477 ISSN 1094-2912 R&D Projects: GA MŠk LH12164 Institutional support: RVO:61389030 Keywords : Dietary stilbenes * Cyclooxygenase inhibition * Docking Subject RIV: EI - Biotechnology ; Bionics Impact factor: 1.586, year: 2015

  16. The design and performance of a large-volume spherical CsI(Tl) scintillation counter for gamma-ray spectroscopy

    CERN Document Server

    Meng, L J; Chirkin, V M; Potapov, V N; Ivanov, O P; Ignatov, S M

    2002-01-01

    This paper presents details of the design and performance of a prototype large-volume scintillation detector used for gamma-ray spectroscopy. In this detector, a spherical CsI(Tl) scintillation crystal having a diameter of 5.7 cm was polished and packed in dry MgO powder. The scintillation light from the crystal was viewed using a single 1x1 cm sup 2 silicon PIN diode. A low-noise preamplifier was also integrated within the detector housing. The measured noise level was equivalent to approx 800 electrons (FWHM). Such a configuration provided a very good light collection efficiency, which resulted in an average of 20 electrons being generated per keV of energy deposited in the crystal. One of the key features of the detector design is that it minimises spatial variations in the light collection efficiency throughout the detector. Compared with a standard 3 in. NaI scintillation counter, this feature leads to a much-improved energy resolution, particularly for photon energies above 1 MeV. The results presented ...

  17. Radioactive flow detectors: liquid or solid scintillators

    International Nuclear Information System (INIS)

    Reich, A.R.

    1983-01-01

    During the past five years, two schools of thought have emerged producing two different types of radio-HPLC detectors. Based on the naphthalene-in-the-vial principle, manufacturers have developed heterogeneous scintillation detectors. In these detectors the anthracene or naphthalene crystals are replaced by other scintillators. In order to avoid dead space and turbulence, a narrow diameter tube is used, either straight, or more popularly formed into a coil or a 'U' as the cell. To optimize light transmission to the photomultiplier tubes, mirrors are used. Due to limiting factors in this technique the counting efficiency for tritium is below the 10 percent level. The other school of radio-HPLC detectors based their design on classical liquid scintillation counting technology. In a homogeneous detector, the effluent from the HPLC system is mixed with a suitable liquid scintillator before entering the counting cell. The cell design is typically a flat glass or Teflon coil tightly sandwiched between two photomultiplier tubes, making good optical contact without the use of mirrors. Depending on the chromatographic effluent, 3 H efficiencies between 25 to 50 percent, and 14 C counting efficiencies up to 85 percent can be achieved

  18. Comparison of two types of scintillation probe for moisture density gauge

    International Nuclear Information System (INIS)

    Machaj, B.

    1974-01-01

    Investigations of pulse shape discrimination scintillation probe, and amplitude discrimination probe as a detector for moisutre density gauge have been carried out. It was found that sandwich scintillator consisting of NE-421 + NE-102A was the best for pulse shape discrimination probe for thermal neutrons and gamma radiation detection. Similarly LiJ(Eu) crystal was the best for amplitude discrimination probe. The amplitude discrimination probe with LiJ(Eu) comparing to pulse shape discrimination probe with sandwich scintillator, provides approximately two times higher thermal neutron detection efficiency and higher count rate stability. It is considered therefore more suitable as the detector for moisture density gauge. (author)

  19. ALICE photon spectrometer crystals

    CERN Multimedia

    Maximilien Brice

    2006-01-01

    Members of the mechanical assembly team insert the last few crystals into the first module of ALICE's photon spectrometer. These crystals are made from lead-tungstate, a crystal as clear as glass but with nearly four times the density. When a high-energy particle passes through one of these crystals it will scintillate, emitting a flash of light allowing the energy of photons, electrons and positrons to be measured.

  20. Measurement of the time resolution of small SiPM-based scintillation counters

    Science.gov (United States)

    Kravchenko, E. A.; Porosev, V. V.; Savinov, G. A.

    2017-12-01

    In this research, we evaluated the timing resolution of SiPM-based scintillation detector on a 1-GeV electron beam "extracted" from VEPP-4M. We tested small scintillation crystals of pure CsI, YAP, LYSO, and LFS-3 with HAMAMATSU S10362-33-025C and S13360-3050CS. The CsI scintillator together with HAMAMATSU S13360-3050CS demonstrated the best results. Nevertheless, the achieved time resolution of ~80 ps (RMS) relates mainly to the photodetector itself. It makes the silicon photomultiplier an attractive candidate to replace other devices in applications where sub-nanosecond accuracy is required.

  1. Polycrystalline scintillators for large area detectors in HEP experiments

    Science.gov (United States)

    Dosovitskiy, G.; Fedorov, A.; Karpyuk, P.; Kuznetsova, D.; Mikhlin, A.; Kozlov, D.; Dosovitskiy, A.; Korjik, M.

    2017-06-01

    After significant increase of the accelerator luminosity throughout the High Luminosity phase of LHC, charged hadrons and neutrons with fluences higher than 1014 p/cm2 per year in the largest pseudo-rapidity regions of the detectors will cause increased radiation damage of materials. Increasing activation of the experimental equipment will make periodical maintenance and replacement of detector components difficult. Therefore, the selected materials for new detectors should be tolerant to radiation damage. Y3Al5O12:Ce (YAG:Ce) crystal was found to be one of the most radiation hard scintillation materials. However, production of YAG:Ce in a single crystalline form is costly, because crystal growth is performed at temperature near 1900°C with a very low rate of transformation of a raw material into a crystal. We propose translucent YAG:Ce ceramics as an alternative cheaper solution. Ceramic samples were sintered up to density ~98% of the theoretical value and were translucent. The samples have demonstrated light yield of 2200 phot./MeV under 662 keV γ-quanta, which gives the expected response to minimum ionizing particle around 3000 phot. for 2 mm thick plate. Scintillation light yield, registered under surface layer excitation with α-particles, was 50-70% higher than for the reference single crystal YAG:Ce.

  2. Search for and selection of novel heavy scintillator crystals for calorimeter design for future high-energy colliders

    International Nuclear Information System (INIS)

    Ferrere, D.

    1993-01-01

    The discovery of some particles (Higgs, top,..) foreseen by theoretical models should be achieved at future colliders allowing to reach an energy scale of about 1 TeV. Efficient detectors must be designed to handle the very high luminosity of the LHC collider at CERN. In the intermediate mass region, M Z -2M Z , the diphoton decay mode of a Higgs boson produced inclusively or in association with W boson or a toponium gives good chance of observation. A very high resolution calorimeter with photon angle reconstruction and pion identification capability should detect a Higgs signal with high probability. So a homogeneous crystal calorimeter seems to be suitable. Because of the high luminosity and the high radiation level, a search for a new heavy scintillator has been undertaken. It must have a good radiation hardness (>0.5 MRad in a year) and a fast luminescence decay time (<30 ns). Among 50 crystals or glasses of specific chemical composition tested in transmission, luminescence, decay time, γ/neutrons radiation and light yield, cerium fluoride seems best suited for LHC. The necessity to have a good photon resolution in the intermediate Higgs mass region led us to optimise by Monte Carlo simulations the geometry of the calorimeter, the uniformisation of the light collection and crystal intercalibration parameters. (orig.)

  3. Scintillation properties of GSO

    International Nuclear Information System (INIS)

    Melcher, C.L.; Schweitzer, J.S.; Utsu, T.; Akiyama, S.

    1990-01-01

    The timing properties of Gd 2 SiO 5 :Ce (GSO) single crystal scintillators have previously been evaluated for positron emission tomography applications. The measured time resolution, however, was worse than expected from calculations based on photoelectron yield and a 60 nanosecond exponential decay constant, leading us to further investigate GSO's basic properties. With a time-correlated-single-photon technique, the authors have found two decay components, one of 56 ns and one of 600 ns, the latter containing 10--15% of the total scintillation output. This may explain the difference between the experimental and theoretical time resolutions and confirms a previous hypothesis of a long decay component. In addition, the authors have found that each component's decay constant strongly depends on the cerium concentration. The primary component varies from ∼ 20 ns to ∼ 190 ns and the secondary component varies from ∼ 70 ns to ∼ 1200 ns as the cerium concentration is varied from 5.0 mol% to 0.1 mol%

  4. Calorimeter detector consisting of a KMgF3 scintillator and parallel-plate avalanche chamber

    International Nuclear Information System (INIS)

    Buzulutskov, A.F.; Turchanovich, L.K.; Vasil'chenko, V.G.

    1989-01-01

    Scintillations of a KMgF 3 crystal have been detected in the parallel-plate avalanche chamber with a TEA gaseous photocathode, the scintillation signal is shown to be much higher than the direct ionization one. The characteristic properties of the calorimeters on the basis of such structure with electrical and optical readout are discussed. 10 refs.; 4 figs

  5. A series approximation model for optical light transport and output intensity field distribution in large aspect ratio cylindrical scintillation crystals

    Energy Technology Data Exchange (ETDEWEB)

    Tobias, Benjamin John [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2018-01-09

    A series approximation has been derived for the transport of optical photons within a cylindrically symmetric light pipe and applied to the task of evaluating both the origin and angular distribution of light reaching the output plane. This analytic expression finds particular utility in first-pass photonic design applications since it may be evaluated at a very modest computational cost and is readily parameterized for relevant design constraints. It has been applied toward quantitative exploration of various scintillation crystal preparations and their impact on both quantum efficiency and noise, reproducing sensible dependencies and providing physical justification for certain gamma ray camera design choices.

  6. Transparent Ceramic Scintillator Fabrication, Properties and Applications

    International Nuclear Information System (INIS)

    Cherepy, N.J.; Kuntz, J.D.; Roberts, J.J.; Hurst, T.A.; Drury, O.B.; Sanner, R.D.; Tillotson, T.M.; Payne, S.A.

    2008-01-01

    Transparent ceramics offer an alternative to single crystals for scintillator applications such as gamma ray spectroscopy and radiography. We have developed a versatile, scaleable fabrication method, using Flame Spray Pyrolysis (FSP) to produce feedstock which is readily converted into phase-pure transparent ceramics. We measure integral light yields in excess of 80,000 Ph/MeV with Cerium-doped Garnets, and excellent optical quality. Avalanche photodiode readout of Garnets provides resolution near 6%. For radiography applications, Lutetium Oxide offers a high performance metric and is formable by ceramics processing. Scatter in transparent ceramics due to secondary phases is the principal limitation to optical quality, and afterglow issues that affect the scintillation performance are presently being addressed

  7. Reflectivity quenching of ESR multilayer polymer film reflector in optically bonded scintillator arrays

    Science.gov (United States)

    Loignon-Houle, Francis; Pepin, Catherine M.; Charlebois, Serge A.; Lecomte, Roger

    2017-04-01

    The 3M-ESR multilayer polymer film is a widely used reflector in scintillation detector arrays. As specified in the datasheet and confirmed experimentally by measurements in air, it is highly reflective (> 98 %) over the entire visible spectrum (400-1000 nm) for all angles of incidence. Despite these outstanding characteristics, it was previously found that light crosstalk between pixels in a bonded LYSO scintillator array with ESR reflector can be as high as ∼30-35%. This unexplained light crosstalk motivated further investigation of ESR optical performance. Analytical simulation of a multilayer structure emulating the ESR reflector showed that the film becomes highly transparent to incident light at large angles when surrounded on both sides by materials of refractive index higher than air. Monte Carlo simulations indicate that a considerable fraction (∼25-35%) of scintillation photons are incident at these leaking angles in high aspect ratio LYSO scintillation crystals. The film transparency was investigated experimentally by measuring the scintillation light transmission through the ESR film sandwiched between a scintillation crystal and a photodetector with or without layers of silicone grease. Strong light leakage, up to nearly 30%, was measured through the reflector when coated on both sides with silicone, thus elucidating the major cause of light crosstalk in bonded arrays. The reflector transparency was confirmed experimentally for angles of incidence larger than 60 ° using a custom designed setup allowing illumination of the bonded ESR film at selected grazing angles. The unsuspected ESR film transparency can be beneficial for detector arrays exploiting light sharing schemes, but it is highly detrimental for scintillator arrays designed for individual pixel readout.

  8. X-ray and gamma-ray response of a 2 '' x 2 '' LaBr3 : Ce scintillation detector

    NARCIS (Netherlands)

    Quarati, F.; Bos, A. J. J.; Brandenburg, S.; Dathy, C.; Dorenbos, P.; Kraft, S.; Ostendorf, R. W.; Ouspenski, V.; Owens, Alan

    2007-01-01

    Advances in material growth techniques have recently made large volume LaBr3:Ce crystals commercially available. These scintillators are currently being assessed by ESA for use as remote sensing gamma-ray spectrometers on future planetary missions. In addition to their superior scintillation

  9. MODELING TIME DISPERSION DUE TO OPTICAL PATH LENGTH DIFFERENCES IN SCINTILLATION DETECTORS*

    Science.gov (United States)

    Moses, W.W.; Choong, W.-S.; Derenzo, S.E.

    2015-01-01

    We characterize the nature of the time dispersion in scintillation detectors caused by path length differences of the scintillation photons as they travel from their generation point to the photodetector. Using Monte Carlo simulation, we find that the initial portion of the distribution (which is the only portion that affects the timing resolution) can usually be modeled by an exponential decay. The peak amplitude and decay time depend both on the geometry of the crystal, the position within the crystal that the scintillation light originates from, and the surface finish. In a rectangular parallelpiped LSO crystal with 3 mm × 3 mm cross section and polished surfaces, the decay time ranges from 10 ps (for interactions 1 mm from the photodetector) up to 80 ps (for interactions 50 mm from the photodetector). Over that same range of distances, the peak amplitude ranges from 100% (defined as the peak amplitude for interactions 1 mm from the photodetector) down to 4% for interactions 50 mm from the photodetector. Higher values for the decay time are obtained for rough surfaces, but the exact value depends on the simulation details. Estimates for the decay time and peak amplitude can be made for different cross section sizes via simple scaling arguments. PMID:25729464

  10. Neutron and gamma-ray spectra measurement on the model of the KS-150 reactor radial shielding

    International Nuclear Information System (INIS)

    Holman, M.; Hogel, J.; Marik, J.; Kovarik, K.; Franc, L.; Vespalec, R.

    1977-01-01

    A shortened model of the peripheral region of the KS-150 reactor core consisting of two rows of fuel elements and a reflector was constructed from the peripheral fuel elements of the KS-150 reactor core in an experiment on the TR-0 reactor. The mockup of the thermal shield (10 cm of steel), the pressure vessel (15 cm of steel) and the inner wall of the water biological shielding (2 cm of steel) of the KS-150 reactor were erected outside the TR-0 vessel. Fast neutron and gamma spectra were measured with a stilbene crystal scintillation spectrometer. The resonance neutron spectra were measured with 197 Au, 63 Cu and 23 Na resonance activation detectors. Fast neutron spectra inside the reactor were measured with a 10 mm diameter by 10 mm thick stilbene crystal spectrometer, outside the reactor with a 10 mm diameter by 10 mm thick and a 20 mm diameter by 20 mm thick stilbene crystal spectrometer. Neutron spectra in the energy regions of 1 eV to 3 keV and 0.6 MeV to 0.8 MeV were obtained on the core periphery, on the reflector half-thickness and in front of and behind the reactor thermal shield. Gamma spectra were obtained in front of and behind the thermal shield. It was found that the attenuation of neutron fluxes by the reflector and the thermal shield increased with increasing energy while gamma radiation attenuation decreased with increasing energy. It was not possible to obtain the neutron spectrum in the 10 to 600 keV energy range because suitable detection instrumentation was not available. (J.P.)

  11. Comparison of the imaging performances for recently developed monolithic scintillators: CRY018 and CRY019 for dual isotope gamma ray imaging applications

    International Nuclear Information System (INIS)

    Polito, C.; Pani, R.; Trigila, C.; Cinti, M.N.; Fabbri, A.; Pellegrini, R.; Frantellizzi, V.; Vincentis, G. De; Pani, R.

    2017-01-01

    The growing interest for new scintillation crystals with outstanding imaging performances (i.e. resolution and efficiency) has suggested the study of recently discovered scintillators named CRY018 and CRY019 . The crystals under investigation are monolithic and have shown enhanced characteristics both for gamma ray spectrometry and for Nuclear Medicine imaging applications such as the dual isotope imaging. Moreover, the non-hygroscopic nature and the absence of afterglow make these scintillators even more attractive for the potential improvement in a wide range of applications. These scintillation crystals show a high energy resolution in the energy range involved in Nuclear Medicine, allowing the discrimination between very close energy values. Moreover, in order to prove their suitability of being powerful imaging systems, the imaging performances like the position linearity and the intrinsic spatial resolution have been evaluated obtaining satisfactory results thanks to the implementation of an optimized algorithm for the images reconstruction.

  12. Comparison of the imaging performances for recently developed monolithic scintillators: CRY018 and CRY019 for dual isotope gamma ray imaging applications

    Science.gov (United States)

    Polito, C.; Pani, R.; Trigila, C.; Cinti, M. N.; Fabbri, A.; Frantellizzi, V.; De Vincentis, G.; Pellegrini, R.; Pani, R.

    2017-01-01

    The growing interest for new scintillation crystals with outstanding imaging performances (i.e. resolution and efficiency) has suggested the study of recently discovered scintillators named CRY018 and CRY019. The crystals under investigation are monolithic and have shown enhanced characteristics both for gamma ray spectrometry and for Nuclear Medicine imaging applications such as the dual isotope imaging. Moreover, the non-hygroscopic nature and the absence of afterglow make these scintillators even more attractive for the potential improvement in a wide range of applications. These scintillation crystals show a high energy resolution in the energy range involved in Nuclear Medicine, allowing the discrimination between very close energy values. Moreover, in order to prove their suitability of being powerful imaging systems, the imaging performances like the position linearity and the intrinsic spatial resolution have been evaluated obtaining satisfactory results thanks to the implementation of an optimized algorithm for the images reconstruction.

  13. Holographic recording of surface relief gratings in stilbene azobenzene derivatives at 633 nm

    International Nuclear Information System (INIS)

    Ozols, A; Saharov, D; Kokars, V; Kampars, V; Maleckis, A; Mezinskis, G; Pludons, A

    2010-01-01

    Holographic recording in stilbene azobenzene derivatives by He-Ne 633 nm laser light has been experimentally studied. It was found that surface relief gratings (SRG) can be recorded by red light. Usually shorter wavelengths are used to induce the trans-cis photo-isomerization in organic materials. SRG with 2 μm period and an amplitude of 130 nm have been recorded with 0.88 W/cm 2 light in about 20 minutes in amorphous films of 3-(4-(bis(2-(trityloxy)ethyl)amino)phenyl)-2-(4-(2-bromo-4-nitrophenyl) diazenyl)phenyl)acrylonitrile spin-coated on glass substrates. Self-diffraction efficiency up to 17.4% and specific recording energy down to 114 J/(cm 2 %) were measured. The recorded SRG were stable as proved by subsequent AFM measurements. The photo-induced changes in absorption spectra did not reveal noticeable signs of trans-cis transformations. Rather, spectrally uniform bleaching of the films took place. We conclude that a photothermally stimulated photo-destruction of chromophores is responsible for the SRG recording. The recording of stable SRG in the stilbene azobenzene derivatives we studied is accompanied by the recording of relaxing volume-phase gratings due to the photo-orientation of chromophores by the linearly polarized recording light. It should also be noted that holographic recording efficiency in stilbene azobenzene derivatives exhibit an unusual non-monotonic sample storage-time dependence presumably caused by the peculiarities of structural relaxation of the films.

  14. ZnO Luminescence and scintillation studied via photoexcitation, X-ray excitation, and gamma-induced positron spectroscopy

    Science.gov (United States)

    Ji, J.; Colosimo, A. M.; Anwand, W.; Boatner, L. A.; Wagner, A.; Stepanov, P. S.; Trinh, T. T.; Liedke, M. O.; Krause-Rehberg, R.; Cowan, T. E.; Selim, F. A.

    2016-08-01

    The luminescence and scintillation properties of ZnO single crystals were studied by photoluminescence and X-ray-induced luminescence (XRIL) techniques. XRIL allowed a direct comparison to be made between the near-band emission (NBE) and trap emissions providing insight into the carrier recombination efficiency in the ZnO crystals. It also provided bulk luminescence measurements that were not affected by surface states. The origin of a green emission, the dominant trap emission in ZnO, was then investigated by gamma-induced positron spectroscopy (GIPS) - a unique defect spectroscopy method that enables positron lifetime measurements to be made for a sample without contributions from positron annihilation in the source materials. The measurements showed a single positron decay curve with a 175 ps lifetime component that was attributed to Zn vacancies passivated by hydrogen. Both oxygen vacancies and hydrogen-decorated Zn vacancies were suggested to contribute to the green emission. By combining scintillation measurements with XRIL, the fast scintillation in ZnO crystals was found to be strongly correlated with the ratio between the defect luminescence and NBE. This study reports the first application of GIPS to semiconductors, and it reveals the great benefits of the XRIL technique for the study of emission and scintillation properties of materials.

  15. Externally mounted radioactivity detector for MWD employing radial inline scintillator and photomultiplier tube

    International Nuclear Information System (INIS)

    Meisner, J.E.; Mumby, E.S.; Groeschel, V.E.

    1991-01-01

    Improved radioactivity well logging may be achieved by mounting a scintillator and photomultiplier tube in a single case interfacing with a hole extending through a drill collar at the lower end of a drill string so that measurements can be made while drilling. Radioactive sources (when required for well logging) are mounted in cavities which open to the exterior of the drill collar. Light from the scintillator is coupled directly to the aligned photomultiplier tube both of which are mounted in a case extending radially within the drill collar and sealingly engaging an electronics housing within the drill collar and the drill collar wall surrounding the hole. The scintillator is of greater diameter than the photomultiplier tube. A frustoconical light pipe connects the scintillator and the photomultiplier tube, channeling scintillation in the crystal to the photomultiplier to provide an amplified detection capability over that for a scintillator having the same diameter as the photomultiplier tube. (author)

  16. Varietal Distributions of Stilbenes in Grape Cane of Vitis vinifera L.

    Czech Academy of Sciences Publication Activity Database

    Soural, I.; Balík, J.; Vrchotová, Naděžda; Tříska, Jan

    2017-01-01

    Roč. 20, č. 1 (2017), s. 11-14 ISSN 1335-2563 R&D Projects: GA MŠk(CZ) LO1415; GA MŠk(CZ) LD14038 Institutional support: RVO:86652079 Keywords : Vitis vinifera L. * varieties * grape canes * stilbenes * distribution Subject RIV: EH - Ecology, Behaviour OBOR OECD: Environmental sciences (social aspects to be 5.7)

  17. 76 FR 19383 - Certain Stilbenic Optical Brightening Agents From China and Taiwan

    Science.gov (United States)

    2011-04-07

    ... Stilbenic Optical Brightening Agents From China and Taiwan AGENCY: United States International Trade... reasonable indication that an industry in the United States is materially injured or threatened with material injury, or the establishment of an industry in the United States is materially retarded, by reason of...

  18. HPLC Quantitative Analysis of Main Stilbenes and Flavones in Different Parts of Matteuccia struthiopteris

    Czech Academy of Sciences Publication Activity Database

    Li, S.; Zhang, D.; Yang, L.; Li, Y.; Zhu, X.; Kmoníčková, Eva; Zídek, Zdeněk

    -, č. 452610 (2013), s. 1-6 ISSN 2090-9063 R&D Projects: GA MŠk(CZ) ME10116 Institutional support: RVO:68378041 Keywords : flavones * alternative medicine * stilbenes Subject RIV: FR - Pharmacology ; Medidal Chemistry

  19. Comparative study of Tm-doped and Tm-Sc co-doped Lu3Al5O12 scintillator

    International Nuclear Information System (INIS)

    Sugiyama, Makoto; Yanagida, Takayuki; Fujimoto, Yutaka

    2014-01-01

    The crystals of Tm doped and Tm-Sc co-doped Lu 3 Al 5 O 12 (LuAG) grown by the floating zone (FZ) method were examined for their optical and scintillation properties. In transmittance spectra, strong absorption lines due to Tm 3+ 4f–4f transitions were observed. X-ray excited radioluminescence spectra were measured and broad and sharp emission peaks were detected. The former one was attributed to Sc 3+ and the latter one was due to Tm 3+ 4f–4f transitions. Scintillation yield enhancement due to Sc co-doping was observed by means of 137 Cs pulse height spectra. Scintillation decay times were several tens of μs under pulse X-ray excitation. - Highlights: • LuAG:Tm and LuAG:Tm, Sc single crystals have been grown by the FZ method. • Tm 3+ 4f–4f absorption has been observed in transmittance spectra. • Scintillation yield of Tm-doped LuAG has been enhanced by Sc co-doping

  20. Study of sampling rate influence on neutron-gamma discrimination with stilbene coupled to a silicon photomultiplier.

    Science.gov (United States)

    Zhang, Jinglong; Moore, Michael E; Wang, Zhonghai; Rong, Zhou; Yang, Chaowen; Hayward, Jason P

    2017-10-01

    Choosing a digitizer with an appropriate sampling rate is often a trade-off between performance and economy. The influence of sampling rates on the neutron-gamma Pulse Shape Discrimination (PSD) with a solid stilbene scintillator coupled to a Silicon Photomultiplier was investigated in this work. Sampling rates from 125MSPS to 2GSPS from a 10-bit digitizer were used to collect detector pulses produced by the interactions of a Cf-252 source. Due to the decreased signal-to-noise ratio (SNR), the PSD performance degraded with reduced sampling rates. The reason of PSD performance degradation was discussed. Then, an efficient combination of filtering and digital signal processing (DSP) was then applied to suppress the timing noise and electronic background noise. The results demonstrate an improved PSD performance especially at low sampling rates, down to 125MSPS. Using filtering and DSP, the ascribed Figure of Merit (FOM) at 125keV ee (± 10keV ee ) increased from 0.95 to 1.02 at 125MSPS. At 300keV ee and above, all the FOMs are better than 2.00. Our study suggests that 250MSPS is a good enough sampling rate for neutron-gamma discrimination in this system in order to be sensitive to neutrons at and above ~ 125keV ee . Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Study of the optical monitoring system of the scintillating crystal involved in the electromagnetic calorimeter of CMS experiment; Etude du systeme de suivi optique des cristaux scintillants du calorimetre electromagnetique de l`experience CMS

    Energy Technology Data Exchange (ETDEWEB)

    Geleoc, M

    1998-09-04

    The prospect of the experimental discovery of the Higgs boson is one of the motivations to build the large hadron collider (LHC). Proton beams will collide and the emitted particles will be detected by ATLAS and CMS equipment. In each detector the electromagnetic calorimeter will allow the characterisation of the 2 photons coming from one of the disintegration channels of the Higgs boson. CMS collaboration has chosen an homogeneous calorimeter fitted with PbWO{sub 4} crystals. Each crystal with its photodetector and its electronic device forms one detection channel. The resolution of the detection channels should not deteriorate all along the operating time. The optical monitoring system of the crystals logs then controls the response of each detection channel in order to allow an accurate calibration of the calorimeter. The optical properties, the resistance to irradiation of PbWO{sub 4} crystals and the modelling of light collection are investigated in this work. The description of the different components of the optical monitoring system highlights the technical difficulties we had to challenge. An experimental testing bench has been set up to study the coupling between the scintillation signal and the signal that feeds the monitoring system, this coupling has been studied under irradiation in the conditions of CMS operating. (A.C.) 94 refs.

  2. Solid state scintillators for gamma spectrometry

    International Nuclear Information System (INIS)

    La Mela, G.; Torrisi, M.

    1991-01-01

    Using different scintillator crystals, measurements of energy resolution and detection efficiency have been performed to detect gamma rays of energy ranging between 500 en 1550 KeV. This investigation is devoted to characterize the best systems to detect photons coming from positron annihilation processes, such as a PET apparatus where the medical image is the final aim of the investigation, and gamma emission from radioisotopes of biomedical interest

  3. Measurement of Gamma-ray Energy Spectrum According to Temperature Variation Using a Fiber-Optic Radiation Sensor Based on YSO:Ce Crystal

    Energy Technology Data Exchange (ETDEWEB)

    Jeon, H.; Yoo, W. J.; Shin, S. H.; Jang, J. S.; Kim, J. S.; Kwon, G.; Lee, D. E.; Jang, K. W.; Lee, B. [BK21 Plus Research Institute of Biomedical Engineering, Konkuk University, Chungju (Korea, Republic of)

    2015-05-15

    As an alternative to conventional radiation detectors, various fiber-optic radiation sensors (FORSs) have been investigated for gamma-ray monitoring because of their various desirable advantages, such as their small sensing volume, substantial flexibility, remote operation, ability to make real-time measurement, and immunity to high electromagnetic interference. In general, the basic principle of a radiation detection using scintillators is to measure the scintillating light signals generated from the interactions between the scintillators and the radiations. To measure gamma-ray, the inorganic scintillators used in the FORS should have some properties, such as high atomic material, high light yields, fast decay time, high density, and high stopping power. For these reasons, a cerium-doped lutetium yttrium orthosilicate (LYSO:Ce) crystal has been introduced as a promising scintillator in various radiation sensor applications. According to the recent studies, however, LYSO:Ce crystal is impossible to be applied in high-temperature conditions because it serves the fluctuations of its light yields with the temperature variation (i.e., thermosluminescence). In this study, to obtain gamma-ray energy spectra by measuring scintillating light signals emitted from the scintillators in high-temperature conditions, we first fabricated an FORS system using various inorganic scintillator crystals and then evaluated the light yields of each inorganic scintillator. As a promising scintillator for use in high-temperature conditions, a cerium-doped yttrium orthosilicate (YSO:Ce) crystal was selected and evaluated its thermal property according to the elevated temperature up to 300 .deg. C. We fabricated an FORS using inorganic scintillator and an optical fiber bundle. To select an adequate scintillator to apply in high-temperature conditions, the gamma-ray energy spectra were obtained by using four kinds of inorganic scintillators. From the experimental results, we selected YSO

  4. 77 FR 27079 - Certain Stilbenic Optical Brightening Agents From China and Taiwan

    Science.gov (United States)

    2012-05-08

    ... industry in the United States is materially injured by reason of imports from China and Taiwan of certain... Optical Brightening Agents From China and Taiwan Determinations On the basis of the record \\1\\ developed... that imports of certain stilbenic optical brightening agents from China and Taiwan were being sold at...

  5. Quantum mechanical cluster calculations of critical scintillation processes

    International Nuclear Information System (INIS)

    Derenzo, Stephen E.; Klintenberg, Mattias K.; Weber, Marvin J.

    2000-01-01

    This paper describes the use of commercial quantum chemistry codes to simulate several critical scintillation processes. The crystal is modeled as a cluster of typically 50 atoms embedded in an array of typically 5,000 point charges designed to reproduce the electrostatic field of the infinite crystal. The Schrodinger equation is solved for the ground, ionized, and excited states of the system to determine the energy and electron wave function. Computational methods for the following critical processes are described: (1) the formation and diffusion of relaxed holes, (2) the formation of excitons, (3) the trapping of electrons and holes by activator atoms, (4) the excitation of activator atoms, and (5) thermal quenching. Examples include hole diffusion in CsI, the exciton in CsI, the excited state of CsI:Tl, the energy barrier for the diffusion of relaxed holes in CaF2 and PbF2, and prompt hole trapping by activator atoms in CaF2:Eu and CdS:Te leading to an ultra-fast (<50ps) scintillation rise time.

  6. Crystal growth and characterization of europium doped lithium strontium iodide scintillator as an ionizing radiation detector

    Science.gov (United States)

    Uba, Samuel

    High performance detectors used in the detection of ionizing radiation is critical to nuclear nonproliferation applications and other radiation detectors applications. In this research we grew and tested Europium doped Lithium Strontium Iodide compound. A mixture of lithium iodide, strontium iodide and europium iodide was used as the starting materials for this research. Congruent melting and freezing temperature of the synthesized compound was determined by differential scanning calorimetry (DSC) using a Setaram Labsys Evo DSC-DTA instrument. The melting temperatures were recorded at 390.35°C, 407.59°C and freezing temperature was recorded at 322.84°C from a graph of heat flow plotted against temperature. The synthesized material was used as the charge for the vertical Bridgeman growth, and a 6.5 cm and 7.7cm length boule were grown in a multi-zone transparent Mullen furnace. A scintillating detector of thickness 2.53mm was fabricated by mechanical lapping in mineral oil, and scintillating response and timing were obtained to a cesium source using CS-137 isotope. An energy resolution (FWHM over peak position) of 12.1% was observed for the 662keV full absorption peak. Optical absorption in the UV-Vis wavelength range was recorded for the grown crystal using a U-2900 UV/VIS Spectrophotometer. Absorption peaks were recorded at 194nm, 273nm, and 344nm from the absorbance spectrum, various optical parameters such as absorption coefficient, extinction coefficient, refractive index, and optical loss were derived. The optical band gap energy was calculated using Tauc relation expression at 1.79eV.

  7. A novel method to calibrate DOI function of a PET detector with a dual-ended-scintillator readout

    International Nuclear Information System (INIS)

    Shao Yiping; Yao Rutao; Ma Tianyu

    2008-01-01

    The detection of depth-of-interaction (DOI) is a critical detector capability to improve the PET spatial resolution uniformity across the field-of-view and will significantly enhance, in particular, small bore system performance for brain, breast, and small animal imaging. One promising technique of DOI detection is to use dual-ended-scintillator readout that uses two photon sensors to detect scintillation light from both ends of a scintillator array and estimate DOI based on the ratio of signals (similar to Anger logic). This approach needs a careful DOI function calibration to establish accurate relationship between DOI and signal ratios, and to recalibrate if the detection condition is shifted due to the drift of sensor gain, bias variations, or degraded optical coupling, etc. However, the current calibration method that uses coincident events to locate interaction positions inside a single scintillator crystal has severe drawbacks, such as complicated setup, long and repetitive measurements, and being prone to errors from various possible misalignments among the source and detector components. This method is also not practically suitable to calibrate multiple DOI functions of a crystal array. To solve these problems, a new method has been developed that requires only a uniform flood source to irradiate a crystal array without the need to locate the interaction positions, and calculates DOI functions based solely on the uniform probability distribution of interactions over DOI positions without knowledge or assumption of detector responses. Simulation and experiment have been studied to validate the new method, and the results show that the new method, with a simple setup and one single measurement, can provide consistent and accurate DOI functions for the entire array of multiple scintillator crystals. This will enable an accurate, simple, and practical DOI function calibration for the PET detectors based on the design of dual-ended-scintillator readout. In

  8. Scintillation properties of quantum-dot doped styrene based plastic scintillators

    International Nuclear Information System (INIS)

    Park, J.M.; Kim, H.J.; Hwang, Y.S.; Kim, D.H.; Park, H.W.

    2014-01-01

    We fabricated quantum-dot doped plastic scintillators in order to control the emission wavelength. We studied the characterization of the quantum-dots (CdSe/ZnS) and PPO (2, 5-diphenyloxazole) doped styrene based plastic scintillators. PPO is usually used as a dopant to enhance the scintillation properties of organic scintillators with a maximum emission wavelength of 380 nm. In order to study the scintillation properties of the quantum-dots doped plastic scintillators, the samples were irradiated with X-ray, photon, and 45 MeV proton beams. We observed that only PPO doped plastic scintillators shows a luminescence peak around 380 nm. However, both the quantum-dots and PPO doped plastic scintillators shows luminescence peaks around 380 nm and 520 nm. Addition of quantum-dots had shifted the luminescence spectrum from 380 nm (PPO) toward the region of 520 nm (Quantum-dots). Emissions with wavelength controllable plastic scintillators can be matched to various kinds of photosensors such as photomultiplier tubes, photo-diodes, avalanche photo-diodes, and CCDs, etc. Also quantum-dots doped plastic scintillator, which is irradiated 45 MeV proton beams, shows that the light yield of quantum-dots doped plastic scintillator is increases as quantum-dots doping concentration increases at 520 nm. And also the plastic scintillators were irradiated with Cs-137 γ-ray for measuring fluorescence decay time. -- Highlights: • Quantum-dot doped plastic scintillator is grown by the thermal polymerization method. • Quantum-dot doped plastic scintillators can control the emission wavelength to match with photo-sensor. • Quantum-dots and PPO doped plastic scintillators emitted luminescence peaks around 380 nm and 520 nm. • We observed the energy transfer from PPO to quantum-dot in the quantum-dot doped plastic scintillator

  9. Scintillation properties of quantum-dot doped styrene based plastic scintillators

    Energy Technology Data Exchange (ETDEWEB)

    Park, J.M.; Kim, H.J., E-mail: hongjooknu@gmail.com; Hwang, Y.S.; Kim, D.H.; Park, H.W.

    2014-02-15

    We fabricated quantum-dot doped plastic scintillators in order to control the emission wavelength. We studied the characterization of the quantum-dots (CdSe/ZnS) and PPO (2, 5-diphenyloxazole) doped styrene based plastic scintillators. PPO is usually used as a dopant to enhance the scintillation properties of organic scintillators with a maximum emission wavelength of 380 nm. In order to study the scintillation properties of the quantum-dots doped plastic scintillators, the samples were irradiated with X-ray, photon, and 45 MeV proton beams. We observed that only PPO doped plastic scintillators shows a luminescence peak around 380 nm. However, both the quantum-dots and PPO doped plastic scintillators shows luminescence peaks around 380 nm and 520 nm. Addition of quantum-dots had shifted the luminescence spectrum from 380 nm (PPO) toward the region of 520 nm (Quantum-dots). Emissions with wavelength controllable plastic scintillators can be matched to various kinds of photosensors such as photomultiplier tubes, photo-diodes, avalanche photo-diodes, and CCDs, etc. Also quantum-dots doped plastic scintillator, which is irradiated 45 MeV proton beams, shows that the light yield of quantum-dots doped plastic scintillator is increases as quantum-dots doping concentration increases at 520 nm. And also the plastic scintillators were irradiated with Cs-137 γ-ray for measuring fluorescence decay time. -- Highlights: • Quantum-dot doped plastic scintillator is grown by the thermal polymerization method. • Quantum-dot doped plastic scintillators can control the emission wavelength to match with photo-sensor. • Quantum-dots and PPO doped plastic scintillators emitted luminescence peaks around 380 nm and 520 nm. • We observed the energy transfer from PPO to quantum-dot in the quantum-dot doped plastic scintillator.

  10. Comparison of the scintillation and luminescence properties of the (Lu1−xGdx)2SiO5:Ce single crystal scintillators

    International Nuclear Information System (INIS)

    Jarý, V; Mihóková, E; Mareš, J A; Beitlerová, A; Nikl, M; Kurtsev, D; Sidletskiy, O

    2014-01-01

    We provide a systematic comparison of the scintillation and luminescence properties, including emission mechanisms, of the highly efficient cerium-doped scintillators lutetium-(gadolinium) orthosilicates Lu 2 (SiO 4 )O (LSO), (Lu 1−x Gd x ) 2 (SiO) 4 O(LGSO) and Gd 2 (SiO 4 )O (GSO). Determined characteristics manifest an advantage of LGSO:Ce with respect to both LSO:Ce and GSO:Ce for scintillator applications around room temperature. This is thanks to combined fast decay (faster than both limit compositions) high light yield, similar to that of LSO:Ce (twice higher than GSO:Ce) and low afterglow, similar to that of GSO:Ce (almost two orders of magnitude lower than LSO:Ce). High temperature applications do not, however, seem to be a suitable option for LGSO:Ce due to evidenced thermal ionization of both Ce1 and Ce2 centres above room temperature. (paper)

  11. Scintillator structures

    International Nuclear Information System (INIS)

    Cusano, D.A.; Prener, J.S.

    1978-01-01

    Distributed phosphor scintillator structures providing superior optical coupling to photoelectrically responsive devices together with methods for fabricating said scintillator structures are disclosed. In accordance with one embodiment of the invention relating to scintillator structures, the phosphor is distributed in a 'layered' fashion with certain layers being optically transparent so that the visible wavelength output of the scintillator is better directed to detecting devices. In accordance with another embodiment of the invention relating to scintillator structures, the phosphor is distributed throughout a transparent matrix in a continuous fashion whereby emitted light is more readily transmitted to a photodetector. Methods for fabricating said distributed phosphor scintillator structures are also disclosed. (Auth.)

  12. Scintillation properties of Ce doped Gd.sub.2./sub.Lu.sub.1./sub.(Ga,Al).sub.5./sub.O.sub.12./sub. single crystal grown by the micro-pulling-down method

    Czech Academy of Sciences Publication Activity Database

    Kamada, K.; Yanagida, T.; Pejchal, Jan; Nikl, Martin; Endo, T.; Tsutumi, K.; Usuki, Y.; Fujimoto, Y.; Fukabori, A.; Yoshikawa, A.

    2012-01-01

    Roč. 352, č. 1 (2012), s. 35-38 ISSN 0022-0248 Grant - others:AV ČR(CZ) M100100910 Institutional research plan: CEZ:AV0Z10100521 Keywords : single crystal growth * oxides * scintillator materials Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.552, year: 2012

  13. Development of LuAG-based scintillator crystals - A review

    Czech Academy of Sciences Publication Activity Database

    Nikl, Martin; Yoshikawa, A.; Kamada, K.; Nejezchleb, K.; Stanek, C.R.; Mareš, Jiří A.; Blazek, K.

    2013-01-01

    Roč. 59, č. 2 (2013), s. 47-72 ISSN 0960-8974 R&D Projects: GA ČR GAP204/12/0805; GA AV ČR KAN300100802 Grant - others:GA AV(CZ) M100100910 Institutional support: RVO:68378271 Keywords : garnet * scintillator * Lu 3 Al 5 O 12 * Ce 3+ * Pr 3+ * Sc 3+ * Yb 3+ Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.476, year: 2013

  14. Improved organic scintillation detectors; Possibilites de perfectionnement des detecteurs organiques a scintillations; Usovershenstvovannye organicheskie stsintillyatsionnye detektory; Detectores organicos de centelleo perfeccionados

    Energy Technology Data Exchange (ETDEWEB)

    Birks, J B [University of Manchester, Manchester (United Kingdom)

    1962-04-15

    Equations have been derived for the practical scintillation efficiency (photo-electrons/MeV) of organic crystals and solutions in terms of molecular parameters and these have been applied to the more important scintillator systems, for photomultipliers with S11 (glass window) and S13 (quartz window) responses. The results suggest several improvements in current organic scintillation detector practice: the use of binary rather than ternary solutions; the use of quartz rather than glass windows; and the reconsideration of mixed crystal scintillators based on naphthalene. Improvements by factors of 2 or more in the figure of merit (practical efficiency/decay time) for fast-scintillation counting can be obtained. (author) [French] L'auteur a etabli des equations pour determiner le rendement de scintillation (photoelectrons/MeV) de cristaux et solutions organiques, en faisant intervenir des parametres moleculaires. Il a applique ces equations a des appareils a scintillations plus importantes pour determiner la reponse des photomultiplicateurs a fenetre en verre (S11) et a fenetre en quartz (S13). Les resultats obtenus ont fait apparaitre la possibilite d'ameliorer, a plusieurs egards, les detecteurs organiques a scintillations du type courant, par exemple en remplacant les solutions ternaires par des solutions binaires, les fenetres en verre par des fenetres en quartz, ou en reexaminant les possibilites offertes par les scintillateurs a cristaux mixtes a base de naphtalene. L'introduction de ces perfectionnements conduirait a une amelioration, du simple au double ou plus, du facteur de qualite (efficacite/temps de decroissance) des dispositifs de comptage a scintillations. (author) [Spanish] Se han establecido ecuaciones que permiten calcular el rendimiento practico de centelleo (fotoelectrones/MeV) de los cristales y soluciones organicos en funcion de parametros moleculares; estas ecuaciones han sido aplicadas a los sistemas de centelleo mas importantes, para

  15. Liquid scintillation solutions

    International Nuclear Information System (INIS)

    Long, E.C.

    1976-01-01

    The liquid scintillation solution described includes a mixture of: a liquid scintillation solvent, a primary scintillation solute, a secondary scintillation solute, a variety of appreciably different surfactants, and a dissolving and transparency agent. The dissolving and transparency agent is tetrahydrofuran, a cyclic ether. The scintillation solvent is toluene. The primary scintillation solute is PPO, and the secondary scintillation solute is dimethyl POPOP. The variety of appreciably different surfactants is composed of isooctylphenol-polyethoxyethanol and sodium dihexyl sulphosuccinate [fr

  16. Low temperature delayed recombination decay in complex oxide scintillating crystals

    Czech Academy of Sciences Publication Activity Database

    Mihóková, Eva; Jarý, Vítězslav; Schulman, L. S.; Nikl, Martin

    2014-01-01

    Roč. 61, č. 1 (2014), 257-261 ISSN 0018-9499 R&D Projects: GA MŠk LH12150; GA MŠk LH12185 Grant - others:AVČR(CZ) M100101212 Institutional support: RVO:68378271 Keywords : luminescence * oxides * scintillator * tunneling Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.283, year: 2014

  17. Advantages of CaF2 over ZnS in an α-particle scintillation detector

    International Nuclear Information System (INIS)

    Sabol, B.; Schery, S.D.

    1981-01-01

    Results are reported for using a europium-activated calcium fluoride (CaF 2 ) scintillation crystal as a α-particle detector in a two-filter monitor of atmospheric radon. CaF 2 detectors are cheaper and can cover a larger surface area than the higher-resolution solid-state detectors. Compared to ZnS scintillators, the energy resolution for CaF 2 is improved from 3.0 MeV to 1.1 MeV for 4.7 MeV α-particles; however the light output from CaF 2 is considerably lower. It is concluded that a thin CaF 2 crystal is a cost-effective method of improving energy and time resolutions for the two-filter monitor. (U.K.)

  18. Rare isotope beam energy measurements and scintillator developments for ReA3

    Science.gov (United States)

    Lin, Ling-Ying

    respect to the acceleration RF clock. The time-of-flight system can provide beam energy information with precision of single crystal YAG: Ce under He+ irradiation at low energies between 28 and 58 keV has been systematically studied. The scintillator was irradiated at the rare isotope ReAccelerator (ReA) facility. The scintillation emission is attributed to its rapid 5d-4f transition of Ce3+ ions. As the bombardment time increases, an exponential decay of the light output is observed due to the induced radiation damage of the crystal lattice. The decrease of the experimentally observed light yield as a function of particle fluence is found to be in fair agreement with the Birks model. Analysis indicates that the damage cross section of scintillation centers slightly decreases with the ion energy. The scintillator degrades slower under higher-energy irradiation. In order to investigate scintillation degradation over a wide range of irradiation energies and scintillator materials, the scintillation processes for KBr, YAG:Ce, CaF2:Eu and CsI:Tl crystals under H2 + irradiation in the energy range of 600-2150 keV/u have been investigated. The data indicates that YAG:Ce and CsI:Tl can maintain stable luminescence under continuous ion bombardment for at least a total fluence of 1.8x10 12 ions/mm2. On the other hand, the luminescence of CaF2:Eu shows a rapid initial decay but then maintains a nearly constant luminescence yield. The extraordinary scintillation response of KBr is initially enhanced under ion bombardment, approaches a maximum, and then eventually decays. The scintillation efficiency of the CsI:Tl scintillator is superior to the other materials. The low-energy H2+ bombardment (25 keV/u) on the YAG:Ce scintillator can lead to the significant degradation of the scintillation yields. Different scintillation degradation responses for the low- and high-energy bombardments can be attributed to the transmission loss of the emitted light inside the crystal caused by

  19. Conformationally constrained farnesoid X receptor (FXR) agonists: alternative replacements of the stilbene.

    Science.gov (United States)

    Akwabi-Ameyaw, Adwoa; Caravella, Justin A; Chen, Lihong; Creech, Katrina L; Deaton, David N; Madauss, Kevin P; Marr, Harry B; Miller, Aaron B; Navas, Frank; Parks, Derek J; Spearing, Paul K; Todd, Dan; Williams, Shawn P; Wisely, G Bruce

    2011-10-15

    To further explore the optimum placement of the acid moiety in conformationally constrained analogs of GW 4064 1a, a series of stilbene replacements were prepared. The benzothiophene 1f and the indole 1g display the optimal orientation of the carboxylate for enhanced FXR agonist potency. Copyright © 2011 Elsevier Ltd. All rights reserved.

  20. Various Extraction Methods for Obtaining Stilbenes from Grape Cane of Vitis vinifera L.

    Directory of Open Access Journals (Sweden)

    Ivo Soural

    2015-04-01

    Full Text Available Grape cane, leaves and grape marc are waste products from viticulture, which can be used to obtain secondary stilbene derivatives with high antioxidant value. The presented work compares several extraction methods: maceration at laboratory temperature, extraction at elevated temperature, fluidized-bed extraction, Soxhlet extraction, microwave-assisted extraction, and accelerated solvent extraction. To obtain trans-resveratrol, trans-ε-viniferin and r2-viniferin from grape cane of the V. vinifera variety Cabernet Moravia, various conditions were studied: different solvents, using powdered versus cut cane material, different extraction times, and one-step or multiple extractions. The largest concentrations found were 6030 ± 680 µg/g dry weight (d.w. for trans-resveratrol, 2260 ± 90 µg/g d.w. for trans-ε-viniferin, and 510 ± 40 µg/g d.w. for r2-viniferin. The highest amounts of stilbenes (8500 ± 1100 µg/g d.w. were obtained using accelerated solvent extraction in methanol.

  1. Scintillation light detectors with Neganov-Luke amplification

    Energy Technology Data Exchange (ETDEWEB)

    Isaila, C. [Physik Department E15, Technische Universitaet Muenchen, James Franck Strasse, 85748 Garching (Germany)]. E-mail: cisaila@ph.tum.de; Boslau, O. [Ketek GmbH, Gustav Heinemann Ring 125, 81739 Munich (Germany); Coppi, C. [Physik Department E15, Technische Universitaet Muenchen, James Franck Strasse, 85748 Garching (Germany); Feilitzsch, F. von [Physik Department E15, Technische Universitaet Muenchen, James Franck Strasse, 85748 Garching (Germany); Goldstrass, P. [Ketek GmbH, Gustav Heinemann Ring 125, 81739 Munich (Germany); Jagemann, T. [Eberhard Karls Universitaet Tuebingen, Auf der Morgenstelle 14, 72076 Tuebingen (Germany); Jochum, J. [Eberhard Karls Universitaet Tuebingen, Auf der Morgenstelle 14, 72076 Tuebingen (Germany); Kemmer, J. [Ketek GmbH, Gustav Heinemann Ring 125, 81739 Munich (Germany); Lachenmaier, T. [Physik Department E15, Technische Universitaet Muenchen, James Franck Strasse, 85748 Garching (Germany); Lanfranchi, J.-C. [Physik Department E15, Technische Universitaet Muenchen, James Franck Strasse, 85748 Garching (Germany); Pahlke, A. [Ketek GmbH, Gustav Heinemann Ring 125, 81739 Munich (Germany); Potzel, W. [Physik Department E15, Technische Universitaet Muenchen, James Franck Strasse, 85748 Garching (Germany); Rau, W. [Physik Department E15, Technische Universitaet Muenchen, James Franck Strasse, 85748 Garching (Germany); Stark, M. [Physik Department E15, Technische Universitaet Muenchen, James Franck Strasse, 85748 Garching (Germany); Wernicke, D. [Physik Department E15, Technische Universitaet Muenchen, James Franck Strasse, 85748 Garching (Germany); VeriCold Technologies GmbH, Bahnhofstrasse 21, 85737 Ismaning (Germany); Westphal, W. [Physik Department E15, Technische Universitaet Muenchen, James Franck Strasse, 85748 Garching (Germany)

    2006-04-15

    For an active suppression of the gamma and electron background in the Cryogenic Rare Event Search with Superconducting Thermometers (CRESST) dark matter experiment both phonons and scintillation light generated in a CaWO{sub 4} crystal are detected simultaneously. The phonon signal is read out by a transition edge sensor (TES) on the CaWO{sub 4} crystal. For light detection a silicon absorber equipped with a TES is employed. An efficient background discrimination requires very sensitive light detectors. The threshold can be improved by applying an electric field to the silicon crystal leading to an amplification of the thermal signal due to the Neganov-Luke effect. Measurements showing the improved sensitivity of the light detectors as well as future steps for reducing the observed extra noise will be presented.

  2. Scintillation light detectors with Neganov Luke amplification

    Science.gov (United States)

    Isaila, C.; Boslau, O.; Coppi, C.; Feilitzsch, F. v.; Goldstraß, P.; Jagemann, T.; Jochum, J.; Kemmer, J.; Lachenmaier, T.; Lanfranchi, J.-C.; Pahlke, A.; Potzel, W.; Rau, W.; Stark, M.; Wernicke, D.; Westphal, W.

    2006-04-01

    For an active suppression of the gamma and electron background in the Cryogenic Rare Event Search with Superconducting Thermometers (CRESST) dark matter experiment both phonons and scintillation light generated in a CaWO 4 crystal are detected simultaneously. The phonon signal is read out by a transition edge sensor (TES) on the CaWO 4 crystal. For light detection a silicon absorber equipped with a TES is employed. An efficient background discrimination requires very sensitive light detectors. The threshold can be improved by applying an electric field to the silicon crystal leading to an amplification of the thermal signal due to the Neganov-Luke effect. Measurements showing the improved sensitivity of the light detectors as well as future steps for reducing the observed extra noise will be presented.

  3. Scintillation light detectors with Neganov-Luke amplification

    International Nuclear Information System (INIS)

    Isaila, C.; Boslau, O.; Coppi, C.; Feilitzsch, F. von; Goldstrass, P.; Jagemann, T.; Jochum, J.; Kemmer, J.; Lachenmaier, T.; Lanfranchi, J.-C.; Pahlke, A.; Potzel, W.; Rau, W.; Stark, M.; Wernicke, D.; Westphal, W.

    2006-01-01

    For an active suppression of the gamma and electron background in the Cryogenic Rare Event Search with Superconducting Thermometers (CRESST) dark matter experiment both phonons and scintillation light generated in a CaWO 4 crystal are detected simultaneously. The phonon signal is read out by a transition edge sensor (TES) on the CaWO 4 crystal. For light detection a silicon absorber equipped with a TES is employed. An efficient background discrimination requires very sensitive light detectors. The threshold can be improved by applying an electric field to the silicon crystal leading to an amplification of the thermal signal due to the Neganov-Luke effect. Measurements showing the improved sensitivity of the light detectors as well as future steps for reducing the observed extra noise will be presented

  4. Monte Carlo simulation of electron thermalization in scintillator materials: Implications for scintillator nonproportionality

    Energy Technology Data Exchange (ETDEWEB)

    Prange, Micah P. [Physical and Computational Sciences Directorate, Pacific Northwest National Laboratory, Richland, Washington 99352, USA; Xie, YuLong [Energy and Environment Directorate, Pacific Northwest National Laboratory, Richland, Washington 99352, USA; Campbell, Luke W. [National Security Directorate, Pacific Northwest National Laboratory, Richland, Washington 99352, USA; Gao, Fei [Department of Nuclear Engineering and Radiological Sciences, University of Michigan, Ann Arbor, Michigan 48109, USA; Kerisit, Sebastien [Physical and Computational Sciences Directorate, Pacific Northwest National Laboratory, Richland, Washington 99352, USA

    2017-12-21

    The lack of reliable quantitative estimates of the length and time scales associated with hot electron thermalization after a gamma-ray induced energy cascade obscures the interplay of various microscopic processes controlling scintillator performance and hampers the search for improved detector materials. We apply a detailed microscopic kinetic Monte Carlo model of the creation and subsequent thermalization of hot electrons produced by gamma irradiation of six important scintillating crystals to determine the spatial extent of the cloud of excitations produced by gamma rays and the time required for the cloud to thermalize with the host lattice. The main ingredients of the model are ensembles of microscopic track structures produced upon gamma excitation (including the energy distribution of the excited carriers), numerical estimates of electron-phonon scattering rates, and a calculated particle dispersion to relate the speed and energy of excited carriers. All these ingredients are based on first-principles density functional theory calculations of the electronic and phonon band structures of the materials. Details of the Monte Carlo model are presented along with results for thermalization time and distance distributions. These results are discussed in light of previous work. It is found that among the studied materials, calculated thermalization distances are positively correlated with measured nonproportionality. In the important class of halide scintillators, the particle dispersion is found to be more influential than the largest phonon energy in determining the thermalization distance.

  5. Large area avalanche photodiodes in scintillation and X-rays detection

    CERN Document Server

    Moszynski, M; Kapusta, M; Balcerzyk, M

    2002-01-01

    The presented paper summarizes our earlier studies on application of beveled-edge Large Area Avalanche Photodiodes (LAAPDs) in gamma-rays scintillation detection. LAAPDs, due to their high quantum efficiency and low excess noise factor allow for better statistical accuracy of the signal as compared to photomultipliers. The device dark noise contribution significantly affects energy resolution only for gamma-rays with energy below 50 keV. Notably better or comparable energy resolutions to those observed with a XP2020Q photomultiplier were obtained with the LAAPDs for a number of different scintillators. Particularly, the recorded energy resolutions of 4.3+-0.2% and 4.8+-0.14% measured with YAP and CsI(Tl) crystals, respectively, for the 662 keV gamma-peak from a sup 1 sup 3 sup 7 Cs source belong to the best observed ever with these scintillation detectors. Results of the study of timing with fast scintillators coupled to the LAAPD showed subnanosecond time resolution of 570+-30 ps for sup 6 sup 0 Co gamma-ray...

  6. Crystal structure and thermal expansion of CsCaI3:Eu and CsSrBr3:Eu scintillators

    Science.gov (United States)

    Loyd, Matthew; Lindsey, Adam; Patel, Maulik; Koschan, Merry; Melcher, Charles L.; Zhuravleva, Mariya

    2018-01-01

    The distorted-perovskite scintillator materials CsCaI3:Eu and CsSrBr3:Eu prepared as single crystals have shown promising potential for use in radiation detection applications requiring a high light yield and excellent energy resolution. We present a study using high temperature powder X-ray diffraction experiments to examine a deleterious high temperature phase transition. High temperature phases were identified through sequential diffraction pattern Rietveld refinement in GSAS II. We report the linear coefficients of thermal expansion for both high and low temperature phases of each compound. Thermal expansion for both compositions is greatest in the [0 0 1] direction. As a result, Bridgman growth utilizing a seed oriented with the [0 0 1] along the growth direction should be used to mitigate thermal stress.

  7. Scintillation properties of acrylate based plastic scintillator by photoploymerization method

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Sung Hwan [Dept. of Radiological Science, Cheongju University, Cheongju (Korea, Republic of); Lee, Joo Il [Dept. of of Radiology, Daegu Health College, Daegu (Korea, Republic of)

    2016-12-15

    In this study, we prepared and characterized a acrylate based UV-curable plastic scintillator. It was used co-polymers TMPTA, DHPA and Ultima GoldTM LLT organic scintillator. The emission spectrum of the plastic scintillator was located in the range of 380⁓520 nm, peaking at 423 nm. And the scintillator is more than 50% transparent in the range of 400⁓ 800 nm. The emission spectrum is well match to the quantum efficiency of photo-multiplier tube and the fast decay time of the scintillation is 12 ns, approximately. This scintillation material provides the possibility of combining 3D printing technology, and then the applications of the plastic scintillator may be expected in human dosimetry etc.

  8. submitter Measurement of intrinsic rise times for various L(Y)SO and LuAG scintillators with a general study of prompt photons to achieve 10 ps in TOF-PET

    CERN Document Server

    Gundacker, Stefan; Pauwels, Kristof; Lecoq, Paul

    2016-01-01

    The coincidence time resolution (CTR) of scintillator based detectors commonly used in positron emission tomography is well known to be dependent on the scintillation decay time (${{\\tau}_{d}}$ ) and the number of photons detected (${{n}^{\\prime}}$ ), i.e. $CTR\\propto \\sqrt{{{\\tau}_{d}}/{{n}^{\\prime}}}$ . However, it is still an open question to what extent the scintillation rise time (${{\\tau}_{r}}$ ) and other fast or prompt photons, e.g. Cherenkov photons, at the beginning of the scintillation process influence the CTR. This paper presents measurements of the scintillation emission rate for different LSO type crystals, i.e. LSO:Ce, LYSO:Ce, LSO:Ce codoped Ca and LGSO:Ce. For the various LSO-type samples measured we find an average value of 70 ps for the scintillation rise time, although some crystals like LSO:Ce codoped Ca seem to have a much faster rise time in the order of 20 ps. Additional measurements for LuAG:Ce and LuAG:Pr show a rise time of 535 ps and 251 ps, respectively. For these crystals, promp...

  9. Factors influencing the production of stilbenes by the knotweed, Reynoutria × bohemica

    Czech Academy of Sciences Publication Activity Database

    Kovářová, Marcela; Bartůňková, Kristýna; Frantík, Tomáš; Koblihová, Helena; Prchalová, K.; Vosátka, Miroslav

    2010-01-01

    Roč. 10, č. 19 (2010), s. 1-16 ISSN 1471-2229 R&D Projects: GA MPO FT-TA3/008; GA MŠk 1M0571 Institutional research plan: CEZ:AV0Z60050516 Keywords : japanese knotweed * Reynoutria * stilbenes Subject RIV: EF - Botanics Impact factor: 4.085, year: 2010 http://www.biomedcentral.com/1471-2229/10/19

  10. Towards Bright and Fast Lu3Al5O12:Ce,Mg Optical Ceramics Scintillators

    CERN Document Server

    Liu, Shuping; Feng, Xiqi; Vedda, Anna; Fasoli, Mauro; Shi, Yun; Kou, Huamin; Beitlerova, Alena; Wu, Lexiang; D'Ambrosio, Carmelo; Pan, Yubai; Nikl, Martin

    2016-01-01

    The recent advent of Lu 3 Al 5 O 12 :Ce optical ceramics marks a turning point in scintillator material technology. Because of their lower preparation tem-perature, brightness, and robustness such materials can now compete with single crystals. Their further scintillation effi ciency optimization includes the thorough control of the defects responsible for optical and scintillation losses. The choice of sintering agent appears critical to achieve both high optical transparency and scintillation performance. In this work, the optical investi-gations coupled with X-ray absorption near-edge spectroscopy evidence the benefi cial role of MgO sintering agent. Mg 2+ co-dopants in ceramics drive the partial conversion of Ce 3+ to Ce 4+ . The Ce 4+ center, however, does not impair the scintillation performance due to its capability to positively infl uence the scintillation process. The importance of simultaneous application of such co-doping and annealing treatment is also demonstrated. With 0.3 at% Mg, our cer...

  11. Insights on the stilbenes in Raboso Piave grape (Vitis vinifera L.) as a consequence of postharvest vs on-vine dehydration.

    Science.gov (United States)

    Brillante, Luca; De Rosso, Mirko; Dalla Vedova, Antonio; Maoz, Itay; Flamini, Riccardo; Tomasi, Diego

    2018-03-01

    Grape withering is a process used to produce reinforced wines and raisins. Dehydration is usually carried out postharvest by keeping ripe grapes in special warehouses in controlled conditions of temperature, relative humidity (RH) and air flow. Alternatively, grape clusters can be left on the vines after the canes have been pruned. In general, dehydration increases stilbenes in grape, but there are few studies on the effects of on-vine withering. The stilbene profiles of Raboso Piave grape during postharvest and on-vine dehydration were studied here. High-resolution mass spectrometry (MS) was used to identify 19 stilbenes, including resveratrol monomers, dimers (viniferins), oligomers and glucoside derivatives. The two dehydration methods generally had different effects on the above nutraceuticals in grape. The samples kept in warehouses revealed significant increases in Z-ω-viniferin, E-ϵ-viniferin, δ-viniferin and another resveratrol dimer which were not observed in the plants. Trans-Resveratrol increased significantly only in samples dehydrated in the warehouse at 21 °C and 60-70% RH. The findings increase knowledge of stilbene composition in grapes subjected to withering on-vine. The choice of dehydration method affects the contents of these nutraceuticals in the grape and consequently in wines. Reasonably, it could also affect other secondary metabolites important for wine quality. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  12. Impact of geometry on light collection efficiency of scintillation detectors for cryogenic rare event searches

    International Nuclear Information System (INIS)

    Danevich, F.A.; Kobychev, V.V.; Kobychev, R.V.; Kraus, H.; Mikhailik, V.B.; Mokina, V.M.; Solsky, I.M.

    2014-01-01

    Simulations of photon propagation in scintillation detectors were performed with the aim to find the optimal scintillator geometry, surface treatment, and shape of external reflector in order to achieve maximum light collection efficiency for detector configurations that avoid direct optical coupling, a situation that is commonly found in cryogenic scintillating bolometers in experimental searches for double beta decay and dark matter. To evaluate the light collection efficiency of various geometrical configurations we used the ZEMAX ray-tracing software. It was found that scintillators in the shape of a triangular prism with an external mirror shaped as truncated cone gives the highest light collection efficiency. The results of the simulations were confirmed by carrying out measurements of the light collection efficiencies of CaWO 4 crystal scintillators. A comparison of simulated and measured values of light output shows good agreement

  13. Eu and Rb co-doped LiCaAlF6 scintillators for neutron detection

    International Nuclear Information System (INIS)

    Yamaji, Akihiro; Yanagida, Takayuki; Kawaguchi, Noriaki; Yokota, Yuui; Fujimoto, Yutaka; Kurosawa, Shunsuke; Pejchal, Jan; Watanabe, Kenichi; Yamazaki, Atsushi; Yoshikawa, Akira

    2013-01-01

    Eu and Rb co-doped LiCaAlF 6 (LiCAF) single crystals with different dopant concentrations were grown by the micro-pulling-down method for neutron detection. Their transmittance spectra showed strong absorption bands at 200–220 and 290–350 nm, and under 241 Am alpha-ray excitation, their radioluminescence spectra exhibited an intense emission peak at 373 nm that was attributed to the Eu 2+ 5d–4f transition. These results were consistent with those for the Rb-free Eu:LiCAF. The highest light yield among the grown crystals was 36,000 ph/n, which was 20% greater than that of the Rb-free crystal. In addition, the neutron-excited scintillation decay times were 650–750 ns slower than that of the Rb-free Eu:LiCAF. -- Highlights: •Eu and Rb co-doped LiCaAlF 6 crystals were grown by the micro-pulling down method. •Transmittance, photoluminescence and radioluminescence spectra were measured. •The light yields and scintillation decays were evaluated under 252 Cf neutron irradiation

  14. First-principles Electronic Structure Calculations for Scintillation Phosphor Nuclear Detector Materials

    Science.gov (United States)

    Canning, Andrew

    2013-03-01

    Inorganic scintillation phosphors (scintillators) are extensively employed as radiation detector materials in many fields of applied and fundamental research such as medical imaging, high energy physics, astrophysics, oil exploration and nuclear materials detection for homeland security and other applications. The ideal scintillator for gamma ray detection must have exceptional performance in terms of stopping power, luminosity, proportionality, speed, and cost. Recently, trivalent lanthanide dopants such as Ce and Eu have received greater attention for fast and bright scintillators as the optical 5d to 4f transition is relatively fast. However, crystal growth and production costs remain challenging for these new materials so there is still a need for new higher performing scintillators that meet the needs of the different application areas. First principles calculations can provide a useful insight into the chemical and electronic properties of such materials and hence can aid in the search for better new scintillators. In the past there has been little first-principles work done on scintillator materials in part because it means modeling f electrons in lanthanides as well as complex excited state and scattering processes. In this talk I will give an overview of the scintillation process and show how first-principles calculations can be applied to such systems to gain a better understanding of the physics involved. I will also present work on a high-throughput first principles approach to select new scintillator materials for fabrication as well as present more detailed calculations to study trapping process etc. that can limit their brightness. This work in collaboration with experimental groups has lead to the discovery of some new bright scintillators. Work supported by the U.S. Department of Homeland Security and carried out under U.S. Department of Energy Contract no. DE-AC02-05CH11231 at Lawrence Berkeley National Laboratory.

  15. Scintillation Counters

    Science.gov (United States)

    Bell, Zane W.

    Scintillators find wide use in radiation detection as the detecting medium for gamma/X-rays, and charged and neutral particles. Since the first notice in 1895 by Roentgen of the production of light by X-rays on a barium platinocyanide screen, and Thomas Edison's work over the following 2 years resulting in the discovery of calcium tungstate as a superior fluoroscopy screen, much research and experimentation have been undertaken to discover and elucidate the properties of new scintillators. Scintillators with high density and high atomic number are prized for the detection of gamma rays above 1 MeV; lower atomic number, lower-density materials find use for detecting beta particles and heavy charged particles; hydrogenous scintillators find use in fast-neutron detection; and boron-, lithium-, and gadolinium-containing scintillators are used for slow-neutron detection. This chapter provides the practitioner with an overview of the general characteristics of scintillators, including the variation of probability of interaction with density and atomic number, the characteristics of the light pulse, a list and characteristics of commonly available scintillators and their approximate cost, and recommendations regarding the choice of material for a few specific applications. This chapter does not pretend to present an exhaustive list of scintillators and applications.

  16. Luminescence and scintillation properties of XPO4:Nd3+ (X = Y, Lu, Sc, La) crystals

    Science.gov (United States)

    Makowski, Michał; Witkowski, Marcin E.; Drozdowski, Winicjusz; Wojtowicz, Andrzej J.; Wisniewski, Krzysztof; Boatner, Lynn A.

    2018-05-01

    Due to their very fast short-wavelength emission, neodymium-doped materials are a subject of current interest as potential scintillators. Although the initial reports regarding neodymium-doped orthophosphates (in crystalline form) and their scintillation properties appeared almost twenty years ago, they remain an interesting class of materials since there is no in-depth understanding of their fundamental scintillation mechanism. In the present research, we focus on the crystalline systems: XPO4:Nd3+, where X = Y, Lu, La, Sc. The pulse height, optical absorption, radioluminescence and photoluminescence spectra were investigated and are reported here for various temperatures from 10 to 350 K. Additionally, results of both low and high temperature thermoluminescence measurements are reported in this communication.

  17. CERN crystals used in medical imaging

    CERN Multimedia

    Maximilien Brice

    2004-01-01

    This crystal is a type of material known as a scintillator. When a high energy charged particle or photon passes through a scintillator it glows. These materials are widely used in particle physics for particle detection, but their uses are being realized in further fields, such as Positron Emission Tomography (PET), an area of medical imaging that monitors the regions of energy use in the body.

  18. Growth and scintillation properties of BaMgF4

    International Nuclear Information System (INIS)

    Yanagida, Takayuki; Kawaguchi, Noriaki; Fujimoto, Yutaka; Sugiyama, Makoto; Furuya, Yuki; Kamada, Kei; Yokota, Yuui; Yoshikawa, Akira; Chani, Valery

    2010-01-01

    By using the micro-pulling down (μ-PD) method, the barium magnesium fluoride (BaMgF 4 ) single crystalline scintillator was produced. The crystal was cut and mirror polished to the physical dimensions of 1x2x10 mm 3 for examination of scintillation properties. BaMgF 4 demonstrated ∼70% transmittance in wavelength range above 170 nm, and strong emission peaking around 205 nm was observed under X-ray excitation. The absolute light yield of BaMgF 4 was 1300±100 ph/MeV, and the decay time profile showed two components as 0.57±0.01 (70%) and 2.2±0.31 (30%) ns at room temperature.

  19. Gaseous photomultipliers for the readout of scintillators and detection Cherenkov radiation

    International Nuclear Information System (INIS)

    Peskov, V.; Borovik-Romanov, A.

    1993-11-01

    The latest achievements in the development of gaseous detectors for registering UV and visible photons are described. Possible modifications of their design for some particular applications such as the readout of crystal scintillators. noble liquids, fibers and for large area Cherenkov detectors are discussed

  20. Stilbenes from Deguelia rufescens var. urucu (Ducke) A. M. G. Azevedo leaves: effects on seed germination and plant growth

    Energy Technology Data Exchange (ETDEWEB)

    Lobo, Livia T.; Silva, Geilson A. da; Freitas, Manolo C.C. de; Silva, Milton N. da; Arruda, Alberto C.; Guilhon, Giselle M.S.P.; Santos, Lourivaldo S.; Santos, Alberdan S.; Arruda, Mara S.P., E-mail: mspa@ufpa.b [Universidade Federal do Para (UFPA), Belem, PA (Brazil). Inst. de Ciencias Exatas e Naturais. Programa de Pos-Graduacao em Quimica; Souza Filho, Antonio Pedro S. [Centro de Pesquisa Agroflorestal da Amazonia Oriental (CPATU), Belem, PA (Brazil)

    2010-07-01

    The Amazon biodiversity may provide plants whose chemical substances are capable of controlling weeds. In this study we report the isolation and identification of five stilbenes from the leaves of 'timbo vermelho' (Deguelia rufescens var. urucu): 4-methoxylonchocarpene (1); 3,5-dimethoxy-4'-hydroxy-3'-prenyl-trans-stilbene (2), lonchocarpene (3), 3,5-dimethoxy-4'-Oprenyl- trans-stilbene (4) and pterostilbene (5). Compounds 2 and 4 are new natural products although 2 has been previously cited as synthesis product. Potential allelopathic activity for 1, 2 and 4 was evaluated over seed germination and plant growth of Mimosa pudica weed. The observed effects on seed germination did not vary significantly (p > 0.05) when the analysis of phytotoxicity was performed with the substances alone, the maximum inhibition did not exceed 20%. The most intense inhibitions on radicle and hypocotyl development were found for compound 4 (p < 0.05). When tested in pairs, showed antagonism for seed germination and synergism for radicle and hypocotyl development. (author)

  1. A LSO scintillator array for a PET detector module with depth of interaction measurement

    International Nuclear Information System (INIS)

    Huber, J.S.; Moses, W.W.; Andreaco, M.S.; Petterson, O.

    2000-01-01

    We present construction methods and performance results for a production scintillator array of 64 optically isolated, 3 mm x 3 mm x 30 mm sized LSO crystals. This scintillator array has been developed for a PET detector module consisting of the 8x8 LSO array coupled on one end to a single photomultiplier tube (PMT) and on the opposite end to a 64 pixel array of silicon photodiodes (PD). The PMT provides an accurate timing pulse and initial energy discrimination, the PD identifies the crystal of interaction, the sum provides a total energy signal, and the PD/(PD+PMT) ratio determines the depth of interaction (DOI). Unlike the previous LSO array prototypes, we now glue Lumirror reflector material directly onto 4 sides of each crystal to obtain an easily manufactured, mechanically rugged array with our desired depth dependence. With 511 keV excitation, we obtain a total energy signal of 3600 electrons, pulse-height resolution of 25% fwhm, and 6-15 mm fwhm DOI resolution

  2. Non-uniformity measurements of PbWO4 crystals

    International Nuclear Information System (INIS)

    Depasse, P.; Ernenwein, J.P.; Ille, B.; Martin, F.; Rosset, C.; Zach, F.

    1998-11-01

    Two independent methods have been used to measure the longitudinal non-uniformity scintillation response of 3 different (23-cm long) PbWO 4 crystals. The first one is the classical 60 Co source method. The source is collimated along the crystal, each 1,5-cm, and the scintillation signal is measured with a photomultiplier (a hybrid photomultiplier in our case). The second one is the use of cosmic particles (Minimum Ionizing Particles). A cosmic bench allows reconstructing the track of the MIP's and thus the energy deposit with the help of a full GEANT simulation of the setup. Variations of E along the crystal artificially cut in 1,5-cm divisions, leads to determine the non-uniformity. The conclusion is that both methods agree quite well. Furthermore, a good estimation of crystal light yield can be obtained. (author)

  3. Scintillators

    International Nuclear Information System (INIS)

    Cusano, D.A.; Holub, F.F.; Prochazka, S.

    1979-01-01

    Scintillator bodies comprising phosphor materials and having high optical translucency with low light absorption, and methods of making the scintillator bodies, are described. Fabrication methods include (a) a hot-pressing process, (b) cold-pressing followed by sintering, (c) controlled cooling from a melt, and (d) hot-forging. The scintillator bodies that result are easily machined to desired shapes and sizes. Suitable phosphors include BaFCl:Eu, LaOBr:Tb, CsI:Tl, CaWO 4 and CdWO 4 . (U.K.)

  4. A fast, high light output scintillator for gamma ray and neutron detection. Fifth Semi-Annual Report

    International Nuclear Information System (INIS)

    Entine, Gerald; Kanai, S.; Shah, M.S.; Leonard Cirignano, M.S.; Jarek Glodo; Van Loef, Edgar V.

    2003-01-01

    In view of the attractive properties of RbGd2Br7:Ce for gamma-ray and thermal neutron detection, and the lack of larger volume crystals, the goal of the Phase I project was to perform a rigorous investigation of the crystal growth of this exciting material and explore its capabilities for gamma-ray and thermal neutron detection. The Phase I research was very successful. All technical objectives were met and in many cases exceeded expectations. We were able to produce large (>1 cm3) RbGd2Br7:Ce crystals with excellent scintillation properties and demonstrated the possibility to detect thermal neutrons. As far as we are aware, our Phase I experiment was the first to demonstrate thermal neutron detection with RbGd2Br7:Ce. Clearly, the feasibility of the proposed research was adequately proven. The Phase II research builds on the successful results obtained during Phase I. Phase II will initially focus on optimizing the RbGd2Br7:Ce growth process to produce high quality, larger volume RbGd2Br7:Ce crystals. We will continue to use the versatile Bridgman technique. During this process, crystal growth parameters will be adjusted for optimal growth conditions. Our goal is to produce high quality RbGd2Br7:Ce crystals of size 1 inch x 1 inch x 1 inch (∼16 cm3). We will work on packaging aspects that allow efficient light collection and prevent crystal degradation. We will study and measure emission spectra, light yield, scintillation decay, energy and time resolution. The effects of variation in Ce concentration on the scintillation properties of RbGd2Br7:Ce will be examined in detail. Comprehensive gamma-ray spectroscopic and imaging studies will be conducted. Also, optimization of RbGd2Br7:Ce for thermal neutron detection will be addressed. Our initial studies will determine the optimal geometry of the RbGd2Br7:Ce crystals for neutron detection. For thermal neutron detection experiments, we will produce large area, thin samples in order to minimize gamma-ray sensitivity

  5. Time resolution deterioration with increasing crystal length in a TOF-PET system

    CERN Document Server

    Gundacker, S; Auffray, E; Jarron, P; Meyer, T; Lecoq, P

    2014-01-01

    Highest time resolution in scintillator based detectors is becoming more and more important. In medical detector physics L(Y)SO scintillators are commonly used for time of flight positron emission tomography (TOF-PET). Coincidence time resolutions (CTRs) smaller than 100 ps FWHM are desirable in order to improve the image signal to noise ratio and thus give benefit to the patient by shorter scanning times. Also in high energy physics there is the demand to improve the timing capabilities of calorimeters down to 10 ps. To achieve these goals it is important to study the whole chain, i.e. the high energy particle interaction in the crystal, the scintillation process itself, the scintillation light transfer in the crystal, the photodetector and the electronics. Time resolution measurements for a PET like system are performed with the time-over-threshold method in a coincidence setup utilizing the ultra-fast amplifier-discriminator NINO. With 2×2×3 mm3 LSO:Ce codoped 0.4%Ca crystals coupled to commercially avai...

  6. Crystal Growth Technology

    Science.gov (United States)

    Scheel, Hans J.; Fukuda, Tsuguo

    2004-06-01

    This volume deals with the technologies of crystal fabrication, of crystal machining, and of epilayer production and is the first book on industrial and scientific aspects of crystal and layer production. The major industrial crystals are treated: Si, GaAs, GaP, InP, CdTe, sapphire, oxide and halide scintillator crystals, crystals for optical, piezoelectric and microwave applications and more. Contains 29 contributions from leading crystal technologists covering the following topics: General aspects of crystal growth technology Silicon Compound semiconductors Oxides and halides Crystal machining Epitaxy and layer deposition Scientific and technological problems of production and machining of industrial crystals are discussed by top experts, most of them from the major growth industries and crystal growth centers. In addition, it will be useful for the users of crystals, for teachers and graduate students in materials sciences, in electronic and other functional materials, chemical and metallurgical engineering, micro-and optoelectronics including nanotechnology, mechanical engineering and precision-machining, microtechnology, and in solid-state sciences.

  7. Scintillation scanner

    International Nuclear Information System (INIS)

    Mehrbrodt, A.W.; Mog, W.F.; Brunnett, C.J.

    1977-01-01

    A scintillation scanner having a visual image producing means coupled through a lost motion connection to the boom which supports the scintillation detector is described. The lost motion connection is adjustable to compensate for such delays as may occur between sensing and recording scintillations. 13 claims, 5 figures

  8. Certifying procedures for lead tungstate crystal parameters during mass production for the CMS ECAL

    CERN Document Server

    Auffray, Etiennette; Chipaux, Rémi; Drobychev, G Yu; Dromby, G; Fedorov, A A; Freire, M; Géléoc, M; Kondratev, O V; Korzhik, M V; Lecoq, P; Le Goff, J M; Letournel, P; Lopatic, A R; Missevitch, O V; Oriboni, A; Oskine, A V; Panov, B M; Peigneux, J P; Schneegans, M; Singovsky, A V; Zouevski, R F

    1998-01-01

    Certifying procedures and fully automated equipment for testing of Pb WO/sub 4/ (PWO) scintillators have been developed. The parameters to be verified are the optical transmission spectra in the longitudinal and transversal $9 directions; the light yield and its non-uniformity along the crystal; the scintillation kinetics; the radiation hardness and the dimensions. Both the precision of measurements and the output rate meet the stringent requirements of $9 the mass production stage of PWO scintillating elements for the CMS electromagnetic calorimeter at CERN (full characterization of several tens of crystals per day for five years). This is achieved by a) the implementation of a $9 `start- stop' technique with high count rate capability for scintillation decay measurement; b) the development of special compact fast scanning spectrophotometers; c) the application of a multi-axis movement system for crystal and $9 spectrometers; d) the use of a standard programmable 3D machine for precise dimension measurement....

  9. Defect Engineering by Codoping in KCaI3 :Eu2 + Single-Crystalline Scintillators

    Science.gov (United States)

    Wu, Yuntao; Li, Qi; Jones, Steven; Dun, Chaochao; Hu, Sheng; Zhuravleva, Mariya; Lindsey, Adam C.; Stand, Luis; Loyd, Matthew; Koschan, Merry; Auxier, John; Hall, Howard L.; Melcher, Charles L.

    2017-09-01

    Eu2 + -doped alkali or alkali earth iodide scintillators with energy resolutions ≤3 % at 662 keV promise the excellent discrimination ability for radioactive isotopes required for homeland-security and nuclear-nonproliferation applications. To extend their applications to x-ray imaging, such as computed tomography scans, the intense afterglow which delays the response time of such materials is an obstacle that needs to be overcome. However, a clear understanding of the origin of the afterglow and feasible solutions is still lacking. In this work, we present a combined experimental and theoretical investigation of the physical insights of codoping-based defect engineering which can reduce the afterglow effectively in KCaI3:Eu2 + single-crystal scintillators. We illustrate that Sc3 + codoping greatly suppresses the afterglow, whereas Y3 + , Gd3 + , or La3 + codoping enhances the afterglow. Meanwhile, a light yield of 57 000 photons / MeV and an energy resolution of 3.4% at 662 keV can be maintained with the appropriate concentration of Sc3 + codoping, which makes the material promising for medical-imaging applications. Through our thermoluminescence techniques and density-functional-theory calculations, we are able to identify the defect structures and understand the mechanism by which codoping affects the scintillation performance of KCaI3:Eu2 + crystals. The proposed defect-engineering strategy is further validated by achieving afterglow suppression in Mg2 + codoped KCaI3:Eu2 + single crystals.

  10. Liquid scintillation solution

    International Nuclear Information System (INIS)

    Long, E.C.

    1977-01-01

    A liquid scintillation solution is described which includes (1) a scintillation solvent (toluene and xylene), (2) a primary scintillation solute (PPO and Butyl PBD), (3) a secondary scintillation solute (POPOP and Dimethyl POPOP), (4) a plurality of substantially different surfactants and (5) a filter dissolving and/or transparentizing agent. 8 claims

  11. Various Extraction Methods for Obtaining Stilbenes from Grape Cane of Vitis vinifera L

    Czech Academy of Sciences Publication Activity Database

    Soural, I.; Vrchotová, Naděžda; Tříska, Jan; Balík, J.; Horník, Štěpán; Cuřínová, Petra; Sýkora, Jan

    2015-01-01

    Roč. 20, č. 4 (2015), s. 6093-6112 ISSN 1420-3049 R&D Projects: GA MŠk(CZ) LD14038 Institutional support: RVO:67179843 ; RVO:67985858 Keywords : Vitis vinifera L * grape cane * stilbenes * accelerated solvent extraction ( ASE ) * microwave-assisted extraction (MAE) * LC-MS Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 2.465, year: 2015

  12. Development of in-situ radon sensor using plastic scintillator

    International Nuclear Information System (INIS)

    Shitashima, Kiminori

    2009-01-01

    Underwater in-situ radon measurement is important scientific priority for oceanography, especially for survey and monitoring of submarine groundwater discharge (SDG). The high sensitivity and lightweight underwater in-situ radon sensor using NaI(Tl) doped plastic scintillator was developed for application to SDG research. Because NaI(Tl) doped plastic scintillator contacts seawater directly, the plastic scintillator can expect high sensitivity in comparison with NaI(Tl) crystal sealed in a container. In order to improve condensation efficiency of scintillation, the plastic scintillator was processed in funnel form and coated by light-resistant paint. This sensor consists of plastic scintillator, photomultiplier tube, preamplifier unit, high-voltage power supply, data logger and lithium-ion battery, and all parts are stored in a pressure housing (200φx300L). The newly developed underwater in-situ radon sensor was tested at hydrothermal area (underwater hot springs) that the hydrothermal fluid containing high concentration of radon is discharged into seawater. The sensor was operated by a diver, and sensitivity tests and mapping survey for estimation of radon diffusion were carried out. The signals of the radon sensor ranged from 20 to 65 mV, and these signals corresponded with radon concentration of 2 to 12 becquerels per liter. The sensor was able to detect radon to 20 m above the hydrothermal point (seafloor). Since the sensor is small and light-weight, measurement, monitoring and mapping can perform automatically by installing the sensor to an AUV (autonomous underwater vehicle). Furthermore, underwater in-situ radon sensor is expected an application to earthquake prediction and volcanic activity monitoring as well as oceanography and hydrology. (author)

  13. Silicon drift detectors coupled to CsI(Tl) scintillators for spaceborne gamma-ray detectors

    International Nuclear Information System (INIS)

    Marisaldi, M.; Fiorini, C.; Labanti, C.; Longoni, A.; Perotti, F.; Rossi, E.; Soltau, H.

    2006-01-01

    Silicon Drift Detectors (SDDs), thanks to their peculiar low noise characteristics, have proven to be excellent photodetectors for CsI(Tl) scintillation light detection. Two basic detector configurations have been developed: either a single SDD or a monolithic array of SDDs coupled to a single CsI(Tl) crystal. A 16 independent detectors prototype is under construction, designed to work in conjunction with the MEGA Compton telescope prototype under development at MPE, Garching, Germany. A single SDD coupled to a CsI(Tl) crystal has also been tested as a monolithic detector with an extended energy range between 1.5 keV and 1 MeV. The SDD is used as a direct X-ray detector for low energy photons interacting in silicon and as a scintillation light photodetector for photons interacting in the crystal. The type of interaction is identified by means of pulse shape discrimination technique. Detectors based on an array of SDDs coupled to a single CsI(Tl) crystal have also been built. The readout of these detectors is based on the Anger camera technique, and submillimeter spatial resolution can be achieved. The two detectors' approaches and their applications will be described

  14. Radiation hardness of undoped BGO crystals

    International Nuclear Information System (INIS)

    Sahu, S.K.; Peng, K.C.; Huang, H.C.; Wang, C.H.; Chang, Y.H.; Hou, W.S.; Ueno, K.; Chou, F.I.; Wei, Y.Y.

    1997-01-01

    We measured the radiation hardness of undoped BGO crystals from two different manufacturers. Such crystals are proposed to be used in a small-angle calorimeter of the BELLE detector of the KEK B-factory. Transparency and scintillation light output of the crystals were monitored to see the effect of radiation damage. The crystals show considerable radiation hardness up to 10.2 Mrad equivalent dose, which is much higher than the maximum expected dosage of 500 krad per year of running at BELLE. (orig.)

  15. Scintillating Organic–Inorganic Layered Perovskite-type Compounds and the Gamma-ray Detection Capabilities

    OpenAIRE

    Kawano, Naoki; Koshimizu, Masanori; Okada, Go; Fujimoto, Yutaka; Kawaguchi, Noriaki; Yanagida, Takayuki; Asai, Keisuke

    2017-01-01

    We investigated scintillation properties of organic–inorganic layered perovskite-type compounds under gamma-ray and X-ray irradiation. A crystal of the hybrid compounds with phenethyl amine (17 × 23 × 4 mm) was successfully fabricated by the poor-solvent diffusion method. The bulk sample showed superior scintillation properties with notably high light yield (14,000 photons per MeV) under gamma-rays and very fast decay time (11 ns). The light yield was about 1.4 time higher than that of common...

  16. FLARES: A flexible scintillation light apparatus for rare event searches

    Energy Technology Data Exchange (ETDEWEB)

    Sisti, M., E-mail: monica.sisti@mib.infn.it [Dipartimento di Fisica, Università di Milano-Bicocca and INFN – Sezione di Milano-Bicocca, Milano (Italy); Baldazzi, G. [Dipartimento di Fisica e Astronomia, Università di Bologna and INFN – Sezione di Bologna, Bologna (Italy); Bonvicini, V. [INFN – Sezione di Trieste, Trieste (Italy); Campana, R. [INAF/IASF and INFN – Sezione di Bologna, Bologna (Italy); Capelli, S. [Dipartimento di Fisica, Università di Milano-Bicocca and INFN – Sezione di Milano-Bicocca, Milano (Italy); Evangelista, Y.; Feroci, M. [INAF/IASF and INFN – Sezione di Roma2, Roma (Italy); Fuschino, F. [Dipartimento di Fisica e Astronomia, Università di Bologna and INFN – Sezione di Bologna, Bologna (Italy); INAF/IASF and INFN – Sezione di Bologna, Bologna (Italy); Gironi, L. [Dipartimento di Fisica, Università di Milano-Bicocca and INFN – Sezione di Milano-Bicocca, Milano (Italy); Labanti, C.; Marisaldi, M. [INAF/IASF and INFN – Sezione di Bologna, Bologna (Italy); Previtali, E. [Dipartimento di Fisica, Università di Milano-Bicocca and INFN – Sezione di Milano-Bicocca, Milano (Italy); Rignanese, L. [Dipartimento di Fisica e Astronomia, Università di Bologna and INFN – Sezione di Bologna, Bologna (Italy); Rachevsky, A. [INFN – Sezione di Trieste, Trieste (Italy); Vacchi, A. [INFN – Sezione di Trieste, Trieste (Italy); Dipartimento di Matematica e Informatica, Università di Udine, Udine (Italy); Zampa, G.; Zampa, N. [INFN – Sezione di Trieste, Trieste (Italy); Zuffa, M. [Dipartimento di Fisica e Astronomia, Università di Bologna and INFN – Sezione di Bologna, Bologna (Italy)

    2016-07-11

    FLARES is a project for an innovative detector technology to be applied to rare event searches, and in particular to neutrinoless double beta decay experiments. Its novelty is the enhancement and optimization of the collection of the scintillation light emitted by ultra-pure crystals through the use of arrays of high performance silicon photodetectors cooled to 120 K. This would provide scintillation detectors with 1% level energy resolution, with the advantages of a technology offering relatively simple low cost mass scalability and powerful background reduction handles, as requested by future neutrinoless double beta decay experimental programs. The performances of a first production of matrices of Silicon Drift Detectors are presented and discussed in this paper.

  17. FLARES: A flexible scintillation light apparatus for rare event searches

    International Nuclear Information System (INIS)

    Sisti, M.; Baldazzi, G.; Bonvicini, V.; Campana, R.; Capelli, S.; Evangelista, Y.; Feroci, M.; Fuschino, F.; Gironi, L.; Labanti, C.; Marisaldi, M.; Previtali, E.; Rignanese, L.; Rachevsky, A.; Vacchi, A.; Zampa, G.; Zampa, N.; Zuffa, M.

    2016-01-01

    FLARES is a project for an innovative detector technology to be applied to rare event searches, and in particular to neutrinoless double beta decay experiments. Its novelty is the enhancement and optimization of the collection of the scintillation light emitted by ultra-pure crystals through the use of arrays of high performance silicon photodetectors cooled to 120 K. This would provide scintillation detectors with 1% level energy resolution, with the advantages of a technology offering relatively simple low cost mass scalability and powerful background reduction handles, as requested by future neutrinoless double beta decay experimental programs. The performances of a first production of matrices of Silicon Drift Detectors are presented and discussed in this paper.

  18. Growth and scintillation properties of BaMgF{sub 4}

    Energy Technology Data Exchange (ETDEWEB)

    Yanagida, Takayuki, E-mail: t_yanagi@tagen.tohoku.ac.j [Institute of Multidisciplinary Research for Advanced Materials, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai 980-8577 (Japan); Kawaguchi, Noriaki [Tokuyama Corporation, Shibuya 3-chome, Shibuya-ku, Tokyo 150-8383 (Japan); Fujimoto, Yutaka; Sugiyama, Makoto; Furuya, Yuki; Kamada, Kei; Yokota, Yuui [Institute of Multidisciplinary Research for Advanced Materials, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai 980-8577 (Japan); Yoshikawa, Akira [Institute of Multidisciplinary Research for Advanced Materials, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai 980-8577 (Japan); New Industry Creation Hatchery Center (NICHe), Tohoku University, 6-6-10 Aoba, Aramaki, Aoba-ku, Sendai 980-8579 (Japan); Chani, Valery [Institute of Multidisciplinary Research for Advanced Materials, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai 980-8577 (Japan)

    2010-09-21

    By using the micro-pulling down ({mu}-PD) method, the barium magnesium fluoride (BaMgF{sub 4}) single crystalline scintillator was produced. The crystal was cut and mirror polished to the physical dimensions of 1x2x10 mm{sup 3} for examination of scintillation properties. BaMgF{sub 4} demonstrated {approx}70% transmittance in wavelength range above 170 nm, and strong emission peaking around 205 nm was observed under X-ray excitation. The absolute light yield of BaMgF{sub 4} was 1300{+-}100 ph/MeV, and the decay time profile showed two components as 0.57{+-}0.01 (70%) and 2.2{+-}0.31 (30%) ns at room temperature.

  19. Direct photon-counting scintillation detector readout using an SSPM

    International Nuclear Information System (INIS)

    Stapels, Christopher J.; Squillante, Michael R.; Lawrence, William G.; Augustine, Frank L.; Christian, James F.

    2007-01-01

    Gamma-ray detector technologies, capable of providing adequate energy information, use photomultiplier tubes (PMTs) or silicon avalanche photodiodes to detect the light pulse from a scintillation crystal. A new approach to detect the light from scintillation materials is to use an array of small photon counting detectors, or a 'detector-on-a-chip' based on a novel 'Solid-state Photomultiplier' (SSPM) concept. A CMOS SSPM coupled to a scintillation crystal uses an array of CMOS Geiger photodiode (GPD) pixels to collect light and produce a signal proportional to the energy of the radiation. Each pixel acts as a binary photon detector, but the summed output is an analog representation of the total photon intensity. We have successfully fabricated arrays of GPD pixels in a CMOS environment, which makes possible the production of miniaturized arrays integrated with the detector electronics in a small silicon chip. This detector technology allows for a substantial cost reduction while preserving the energy resolution needed for radiological measurements. In this work, we compare designs for the SSPM detector. One pixel design achieves maximum detection efficiency (DE) for 632-nm photons approaching 30% with a room temperature dark count rate (DCR) of less than 1 kHz for a 30-μm-diameter pixel. We characterize after pulsing and optical cross talk and discuss their effects on the performance of the SSPM. For 30-μm diameter, passively quenched CMOS GPD pixels, modeling suggests that a pixel spacing of approximately 90 μm optimizes the SSPM performance with respect to DE and cross talk

  20. Radiation damage studies on new liquid scintillators and liquid-core scintillating fibers

    International Nuclear Information System (INIS)

    Golovkin, S.V.

    1994-01-01

    The radiation resistant of some new liquid scintillation and capillaries filled with liquid scintillators has been presented. It was found that scintillation efficiency of the scintillator based on 1-methyl naphthalene with a new R39 only by 10% at the dose of 190 Mrad and the radiation resistance of thin liquid-core scintillating was decreased fibers exceeded 60 Mrad. 35 refs

  1. Cerium doped lanthanum halides: fast scintillators for medical imaging; Halogenures de lanthane dopes cerium des scintillateurs rapides pour l'imagerie medicale

    Energy Technology Data Exchange (ETDEWEB)

    Selles, O

    2006-12-15

    This work is dedicated to two recently discovered scintillating crystals: cerium doped lanthanum halides (LaCl{sub 3}:Ce{sup 3+} and LaBr{sub 3}:Ce{sup 3+}).These scintillators exhibit interesting properties for gamma detection, more particularly in the field of medical imaging: a short decay time, a high light yield and an excellent energy resolution. The strong hygroscopicity of these materials requires adapting the usual experimental methods for determining physico-chemical properties. Once determined, these can be used for the development of the industrial manufacturing process of the crystals. A proper comprehension of the scintillation mechanism and of the effect of defects within the material lead to new possible ways for optimizing the scintillator performance. Therefore, different techniques are used (EPR, radioluminescence, laser excitation, thermally stimulated luminescence). Alongside Ce{sup 3+} ions, self-trapped excitons are involved in the scintillation mechanism. Their nature and their role are detailed. The knowledge of the different processes involved in the scintillation mechanism leads to the prediction of the effect of temperature and doping level on the performance of the scintillator. A mechanism is proposed to explain the thermally stimulated luminescence processes that cause slow components in the light emission and a loss of light yield. Eventually the study of afterglow reveals a charge transfer to deep traps involved in the high temperature thermally stimulated luminescence. (author)

  2. Two-dimensional diced scintillator array for innovative, fine-resolution gamma camera

    International Nuclear Information System (INIS)

    Fujita, T.; Kataoka, J.; Nishiyama, T.; Ohsuka, S.; Nakamura, S.; Yamamoto, S.

    2014-01-01

    We are developing a technique to fabricate fine spatial resolution (FWHM<0.5mm) and cost-effective photon counting detectors, by using silicon photomultipliers (SiPMs) coupled with a finely pixelated scintillator plate. Unlike traditional X-ray imagers that use a micro-columnar CsI(Tl) plate, we can pixelate various scintillation crystal plates more than 1 mm thick, and easily develop large-area, fine-pitch scintillator arrays with high precision. Coupling a fine pitch scintillator array with a SiPM array results in a compact, fast-response detector that is ideal for X-ray, gamma-ray, and charged particle detection as used in autoradiography, gamma cameras, and photon counting CTs. As the first step, we fabricated a 2-D, cerium-doped Gd 3 Al 2 Ga 3 O 12 (Ce:GAGG) scintillator array of 0.25 mm pitch, by using a dicing saw to cut micro-grooves 50μm wide into a 1.0 mm thick Ce:GAGG plate. The scintillator plate is optically coupled with a 3.0×3.0mm pixel 4×4 SiPM array and read-out via the resistive charge-division network. Even when using this simple system as a gamma camera, we obtained excellent spatial resolution of 0.48 mm (FWHM) for 122 keV gamma-rays. We will present our plans to further improve the signal-to-noise ratio in the image, and also discuss a variety of possible applications in the near future

  3. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  4. Liquid scintillation solution

    International Nuclear Information System (INIS)

    Long, E.C.

    1976-01-01

    The invention deals with a liquid scintillation solution which contains 1) a scintillation solvent (toluol), 2) a primary scintillation solute (PPO), 3) a secondary scintillation solute (dimethyl POPOP), 4) several surfactants (iso-octyl-phenol polyethoxy-ethanol and sodium di-hexyl sulfosuccinate) essentially different from one another and 5) a filter resolution and/or transparent-making agent (cyclic ether, especially tetrahydrofuran). (HP) [de

  5. Characterization of Ca co-doped LSO:Ce scintillators coupled to SiPM for PET applications

    International Nuclear Information System (INIS)

    Bisogni, M.G.; Collazuol, G.M.; Marcatili, S.; Melcher, C.L.; Del Guerra, A.

    2011-01-01

    Scintillators suitable for PET applications must be characterized by a high efficiency for gamma-ray detection, determined by a high density and atomic number of the crystal; a fast light signal that allows to achieve a good time resolution and to cope with high counting rates; a high light yield for a good energy and time resolution; a good linearity of the light output as a function of the energy to preserve the intrinsic energy resolution of the scintillator. Recently developed LSO:Ce scintillators, co-doped with Ca, have been produced by the University of Tennessee group. They are characterized by the improved performance of most the above-mentioned characteristics. The crystals, initially tested with PMTs, showed a higher light output, faster light pulse, improved energy resolution and reduced afterglow, as compared to the standard LSO:Ce crystals. Even though the PMTs still represent the gold standard photodetectors, the recently available SiPMs are now valid candidate to replace PMTs in the next generation of PET scanners thanks to their compactness, high spatial resolution performances, low bias operating voltage and, most important for combined PET/MRI systems, insensitivity to static and RF fields. In this work we present the performance of Ca co-doped LSO:Ce samples coupled to SiPMs and PMTs. In particular we have assessed their performances by evaluating the energy and time resolution.

  6. Status of LUMINEU program to search for neutrinoless double beta decay of {sup 100}Mo with cryogenic ZnMoO{sub 4} scintillating bolometers

    Energy Technology Data Exchange (ETDEWEB)

    Danevich, F. A., E-mail: danevich@kinr.kiev.ua; Boiko, R. S.; Chernyak, D. M.; Kobychev, V. V. [Institute for Nuclear Research, MSP 03680 Kyiv (Ukraine); Bergé, L.; Chapellier, M.; Drillien, A.-A.; Dumoulin, L.; Humbert, V.; Marcillac, P. de; Marnieros, S.; Marrache-Kikuchi, C.; Olivieri, E.; Plantevin, O.; Tenconi, M. [Centre de Sciences Nucléaires et de Sciences de la Matière, CNRS/IN2P3, Université Paris-Sud, 91405 Orsay (France); Coron, N.; Redon, T.; Torres, L. [IAS, CNRS, Université Paris-Sud, 91405 Orsay (France); Devoyon, L.; Koskas, F. [CEA, Centre d’Etudes Saclay, Orphée, 91191 Gif-Sur-Yvette Cedex (France); and others

    2015-10-28

    The LUMTNEU program aims at performing a pilot experiment on 0ν2β decay of {sup 100}Mo using radiopure ZnMoO{sub 4} crystals enriched in {sup 100}Mo operated as cryogenic scintillating bolometers. Large volume ZnMoO{sub 4} crystal scintillators (∼ 0.3 kg) were developed and tested showing high performance in terms of radiopurity, energy resolution and α/β particle discrimination capability. Zinc molybdate crystal scintillators enriched in {sup 100}Mo were grown for the first time by the low-thermal-gradient Czochralski technique with a high crystal yield and an acceptable level of enriched molybdenum irrecoverable losses. A background level of ∼ 0.5 counts/(yr keV ton) in the region of interest can be reached in a large detector array thanks to the excellent detectors radiopurity and particle discrimination capability, suppression of randomly coinciding events by pulse-shape analysis, and anticoincidence cut. These results pave the way to future sensitive searches based on the LUMTNEU technology, capable of approachingand exploring the inverted hierarchy region of the neutrino mass pattern.

  7. Comparative study using Monte Carlo methods of the radiation detection efficiency of LSO, LuAP, GSO and YAP scintillators for use in positron emission imaging (PET)

    International Nuclear Information System (INIS)

    Nikolopoulos, Dimitrios; Kandarakis, Ioannis; Tsantilas, Xenophon; Valais, Ioannis; Cavouras, Dionisios; Louizi, Anna

    2006-01-01

    The radiation detection efficiency of four scintillators employed, or designed to be employed, in positron emission imaging (PET) was evaluated as a function of the crystal thickness by applying Monte Carlo Methods. The scintillators studied were the LuSiO 5 (LSO), LuAlO 3 (LuAP), Gd 2 SiO 5 (GSO) and the YAlO 3 (YAP). Crystal thicknesses ranged from 0 to 50 mm. The study was performed via a previously generated photon transport Monte Carlo code. All photon track and energy histories were recorded and the energy transferred or absorbed in the scintillator medium was calculated together with the energy redistributed and retransported as secondary characteristic fluorescence radiation. Various parameters were calculated e.g. the fraction of the incident photon energy absorbed, transmitted or redistributed as fluorescence radiation, the scatter to primary ratio, the photon and energy distribution within each scintillator block etc. As being most significant, the fraction of the incident photon energy absorbed was found to increase with increasing crystal thickness tending to form a plateau above the 30 mm thickness. For LSO, LuAP, GSO and YAP scintillators, respectively, this fraction had the value of 44.8, 36.9 and 45.7% at the 10 mm thickness and 96.4, 93.2 and 96.9% at the 50 mm thickness. Within the plateau area approximately (57-59)% (59-63)% (52-63)% and (58-61)% of this fraction was due to scattered and reabsorbed radiation for the LSO, GSO, YAP and LuAP scintillators, respectively. In all cases, a negligible fraction (<0.1%) of the absorbed energy was found to escape the crystal as fluorescence radiation

  8. Characterization of the intrinsic scintillator Cs2LiCeCl6

    Energy Technology Data Exchange (ETDEWEB)

    James, R. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

    2017-10-02

    In this work, we report on the scintillation properties of the intrinsic scintillator Cs2LiCeCl6 (CLCC), which is potentially useful for dual gamma-ray and neutron detection. CLCC is from the elpasolite family with a cubic structure. We grew the crystals at BNL by the vertical Bridgman growth technique. The luminescence spectrum of CLCC showed a doublet with peak maxima at 384 nm and 402 nm. The light yield of CLCC was approximately 20,000 photons/MeV, and the energy resolution was about 6% for 662-keV gamma radiation. A scintillation decay of ~81% of the total light was observed to be ~ 90 nanoseconds.

  9. Time- and wavelength-resolved luminescence evaluation of several types of scintillators using streak camera system equipped with pulsed X-ray source

    Energy Technology Data Exchange (ETDEWEB)

    Furuya, Yuki, E-mail: f.yuki@mail.tagen.tohoku.ac.j [Institute of Multidisciplinary Research for Advanced Materials, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai 980-8577 (Japan); Yanagida, Takayuki; Fujimoto, Yutaka; Yokota, Yuui; Kamada, Kei [Institute of Multidisciplinary Research for Advanced Materials, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai 980-8577 (Japan); Kawaguchi, Noriaki [Institute of Multidisciplinary Research for Advanced Materials, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai 980-8577 (Japan); Research and Development Division, Tokuyama., Co. Ltd., ICR-Building, Minamiyoshinari, Aoba-ku, Sendai (Japan); Ishizu, Sumito [Research and Development Division, Tokuyama., Co. Ltd., ICR-Building, Minamiyoshinari, Aoba-ku, Sendai (Japan); Uchiyama, Koro; Mori, Kuniyoshi [Hamamatsu Photonics K.K., 325-6, Sunayama-cho, Naka-ku, Hamamatsu, Shizuoka 430-8587 (Japan); Kitano, Ken [Vacuum and Optical Instruments, 2-18-18 Shimomaruko, Ota, Tokyo 146-0092 (Japan); Nikl, Martin [Institute of Physics ASCR, Cukrovarnicka 10, Prague 6, 162-53 (Czech Republic); Yoshikawa, Akira [Institute of Multidisciplinary Research for Advanced Materials, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai 980-8577 (Japan); NICHe, Tohoku University, 6-6-10 Aoba, Aramaki, Aoba-ku, Sendai 980-8579 (Japan)

    2011-04-01

    To design new scintillating materials, it is very important to understand detailed information about the events, which occurred during the excitation and emission processes under the ionizing radiation excitation. We developed a streak camera system equipped with picosecond pulsed X-ray source to observe time- and wavelength-resolved scintillation events. In this report, we test the performance of this new system using several types of scintillators including bulk oxide/halide crystals, transparent ceramics, plastics and powders. For all samples, the results were consistent with those reported previously. The results demonstrated that the developed system is suitable for evaluation of the scintillation properties.

  10. Synthesis of stilbene derivatives via visible-light-induced cross-coupling of aryl diazonium salts with nitroalkenes using -NO2 as a leaving group.

    Science.gov (United States)

    Zhang, Na; Quan, Zheng-Jun; Zhang, Zhang; Da, Yu-Xia; Wang, Xi-Cun

    2016-12-06

    The straightforward visible-light-induced synthesis of stilbene compounds via the cross-coupling of nitroalkenes and diazonium tetrafluoroborates under transition-metal-free conditions is described. The protocol uses green LEDs as light sources and eosin Y as an organophotoredox catalyst. Broad substrate scope and exclusive selectivity for the (E)-configuration of stilbenes are observed. This protocol proceeds via a radical pathway, with nitroalkenes serving as the radical acceptor, and the nitro group is cleaved during the process.

  11. Crystal growth and scintillation properties of multi-component oxide single crystals: Ce:GGAG and Ce:La-GPS

    Czech Academy of Sciences Publication Activity Database

    Yoshikawa, A.; Kamada, K.; Kurosawa, S.; Shoji, Y.; Yokota, Y.; Chani, V.I.; Nikl, Martin

    2016-01-01

    Roč. 169, Jan (2016), s. 387-393 ISSN 0022-2313. [International Conference on Luminescence and Optical Spectroscopy of Condensed Matter /17./. Wroclaw, 13.07.2014-18.07.2014] Institutional support: RVO:68378271 Keywords : scintillator * luminescent materials * Ce 3+ * radioluminescence Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.686, year: 2016

  12. Scintillation and radiation damage of doped BaF2 crystals

    International Nuclear Information System (INIS)

    Gong Zufang; Xu Zizong; Chang Jin

    1992-01-01

    The emission spectra and the radiation damage of BaF 2 crystals doped Ce and Dy have been studied. The results indicate that the doped BaF 2 crystals have the intrinsic spectra of impurity besides the intrinsic spectra of BaF 2 crystals. The crystals colored and the transmissions decrease with the concentration of impurity in BaF 2 crystals after radiation by γ-ray of 60 Co. The doped Ce BaF 2 irradiated by ultraviolet has faster recover of transmissions but for doped Dy the effect is not obvious. The radiation resistance is not good as pure BaF 2 crystals

  13. Scintillating Quantum Dots for Imaging X-rays (SQDIX) for Aircraft Inspection

    Science.gov (United States)

    Burke, Eric (Principal Investigator); Williams, Phillip (Principal Investigator); Dehaven, Stan

    2015-01-01

    Scintillation is the process currently employed by conventional x-ray detectors to create x-ray images. Scintillating quantum dots or nano-crystals (StQDs) are a novel, nanometer-scale material that upon excitation by x-rays, re-emit the absorbed energy as visible light. StQDs theoretically have higher output efficiency than conventional scintillating materials and are more environmental friendly. This paper will present the characterization of several critical elements in the use of StQDs that have been performed along a path to the use of this technology in wide spread x-ray imaging. Initial work on the SQDIX system has shown great promise to create state-of-the-art sensors using StQDs as a sensor material. In addition, this work also demonstrates a high degree of promise using StQDs in microstructured fiber optics. Using the microstructured fiber as a light guide could greatly increase the capture efficiency a StQDs based imaging sensor.

  14. Factors Influencing Time Resolution of Scintillators and Ways to Improve Them

    CERN Document Server

    Lecoq, P; Brunner, S; Meyer, T; Auffray, E; Knapitsch, A; Jarron, P

    2010-01-01

    The renewal of interest in Time of Flight Positron Emission Tomography (TOF-PET), as well as the necessity to precisely tag events in high energy physics (HEP) experiments at future colliders are pushing for an optimization of all factors affecting the time resolution of the whole acquisition chain comprising the crystal, the photo detector, and the electronics. The time resolution of a scintillator-based detection system is determined by the rate of photo electrons at the detection threshold, which depends on the time distribution of photons being converted in the photo detector. The possibility to achieve time resolution of about 100 ps Full Width at Half Maximum (FWHM) requires an optimization of the light production in the scintillator, the light transport and its transfer from the scintillator to the photo detector. In order to maximize the light yield, and in particular the density of photons in the first nanosecond, while minimizing the rise time and decay time, particular attention must be paid to the...

  15. PTR, PCR and Energy Resolution Study of GAGG:Ce Scintillator

    Science.gov (United States)

    Limkitjaroenporn, Pruittipol; Hongtong, Wiraporn; Kim, Hong Joo; Kaewkhao, Jakrapong

    2018-03-01

    In this paper, the peak to total ratio (PTR), the peak to Compton ratio (PCR) and the energy resolution of cerium doped gadolinium aluminium gallium garnet (GAGG:Ce) scintillator are measured in the range of energy from 511 keV to 1332 keV using the radioactive source Na-22, Cs-137 and Co-60. The crystal is coupled with the PMT number R1306 and analyzed by the nuclear instrument module (NIM). The results found that the PTR and PCR of GAGG:Ce scintillator decrease with the increasing of energy. The results of energy resolution show the trend is decrease with the increasing of energy which corresponding to the higher energy resolution at higher energy. Moreover the energy resolution found to be linearly with.

  16. Solid scintillator 'Ready Cap' for measurement with a liquid scintillation counter

    International Nuclear Information System (INIS)

    Ijiri, Kenichi; Endo, Masashi; Nogawa, Norio; Tsuda, Shoko; Nakamura, Aiko; Morikawa, Naotake; Osaki, Susumu.

    1990-01-01

    'Ready Cap', a small plastic container coated with solid scintillator has recently been introduced (Beckman Instruments, Inc.). Pulse height spectra and counting efficiencies obtained with a liquid scintillator and Ready Cap using a liquid scintillation counter were compared for 15 different radionuclides. For radionuclides emitting low-energy β-rays or characteristic X-rays, the spectra for Ready Cap shifted toward the higher energy side compared with the spectra for the liquid scintillator. This tendency was reversed for the nuclides emitting higher-energy β-radiations ( 36 Cl and 32 P). Generally, counting efficiencies both in Ready Cap and in liquid scintillator increased with increase in the energy of β- or X-rays. For some nuclides, Ready Cap gave higher counting efficiencies and for others it gave lower values than in the liquid scintillator. However, the differences were not large within each nuclide. The use of Ready Cap is recommended for measurements of radionuclides when liquid scintillation cocktails have no means of waste disposal under the present Japanese radioisotope regulation. (author)

  17. Gold-catalyzed aerobic epoxidation of trans-stilbene in methylcyclohexane. Part II: Identification and quantification of a key reaction intermediate

    KAUST Repository

    Guillois, Kevin

    2013-03-01

    The gold-catalyzed aerobic oxidations of alkenes are thought to rely on the in situ synthesis of hydroperoxide species, which have however never been clearly identified. Here, we show direct experimental evidence for the presence of 1-methylcyclohexyl hydroperoxide in the aerobic co-oxidation of stilbene and methylcyclohexane catalyzed by the Au/SiO2-R972 optimized catalyst prepared in Part I. Determination of its response in gas chromatography, by triphenylphosphine titration followed by 31P NMR, allows to easily follow its concentration throughout the co-oxidation process and to clearly highlight the simultaneous existence of the methylcyclohexane autoxidation pathway and the stilbene epoxidation pathway. © 2012 Elsevier B.V. All rights reserved.

  18. Gold-catalyzed aerobic epoxidation of trans-stilbene in methylcyclohexane. Part II: Identification and quantification of a key reaction intermediate

    KAUST Repository

    Guillois, Kevin; Mangematin, Sté phane; Tuel, Alain; Caps, Valerie

    2013-01-01

    The gold-catalyzed aerobic oxidations of alkenes are thought to rely on the in situ synthesis of hydroperoxide species, which have however never been clearly identified. Here, we show direct experimental evidence for the presence of 1-methylcyclohexyl hydroperoxide in the aerobic co-oxidation of stilbene and methylcyclohexane catalyzed by the Au/SiO2-R972 optimized catalyst prepared in Part I. Determination of its response in gas chromatography, by triphenylphosphine titration followed by 31P NMR, allows to easily follow its concentration throughout the co-oxidation process and to clearly highlight the simultaneous existence of the methylcyclohexane autoxidation pathway and the stilbene epoxidation pathway. © 2012 Elsevier B.V. All rights reserved.

  19. Improvement on the light yield of a high-Z inorganic scintillator GSO(Ce)

    CERN Document Server

    Kamae, T; Isobe, N; Kokubun, M; Kubota, A; Osone, S; Takahashi, T; Tsuchida, N; Ishibashi, H

    2002-01-01

    Cerium-doped gadolinium silicic dioxide crystal, GSO(Ce), is a high-Z non-hydroscopic scintillator that gives higher light yield than BGO, and can potentially replace NaI(Tl), CsI(Tl) and BGO in many applications. Its production cost, however, has been substantially higher than any of them, while its energy resolution has been worse than that of NaI(Tl) or CsI(Tl). The merit did not overcome these deficiencies except in limited applications. We developed a low background phoswich counter (the well-type phoswich counter) for the Hard X-ray Detector of the Astro-E project based on GSO scintillator. In the developmental work, we have succeeded in improving the light yield of GSO(Ce) by 40-50%. For energies above 500 keV, a large GSO(Ce) crystal (4.5 cmx4.5phi cm) now gives energy resolution comparable to or better than the best NaI(Tl) when read out with a phototube. With a small GSO(Ce) crystal (5x5x5 mm sup 3) and a photodiode, an energy resolution comparable to or better than the best CsI(Tl) has been obtaine...

  20. Scintillation crystals for positron emission tomography having a non reflecting band

    International Nuclear Information System (INIS)

    Thompson, C.J.

    1992-01-01

    This invention relates generally to positron emission tomography, a sub-field of the class of medical imaging techniques using ionizing radiation and image reconstruction techniques; and more particularly to devices which use an array of scintillation detectors to detect the annihilation radiation from positron disintegration and use this information to reconstruct an image of the distribution of positron emitting isotope within a body section. 6 figs

  1. Identification of isomers in the gas phase and as adsorbates by near-edge X-ray absorption fine structure spectroscopy: Cis- and trans-stilbene

    International Nuclear Information System (INIS)

    Püttner, Ralph; Schmidt-Weber, Philipp; Kampen, Thorsten; Kolczewski, Christine; Hermann, Klaus; Horn, Karsten

    2017-01-01

    Highlights: • NEXAFS spectra of the cis- and trans-isomer of stilbene reveal distinct differences by which the isomers can be distinguished. • DFT calculations using the transition potential approach assign specific transitions that are different in the two isomers. • On Si(100), these differences in NEXAFS are also observed, suggesting that their conformations survive in the bonding situation. • NEXAFS is thus shown to be a sensitive tool to distinguish isomers in adsorbed species. - Abstract: Near-edge x-ray absorption fine structure spectra of the cis- and trans-isomers of stilbene in the gas phase reveal clear differences, which are analyzed by results from density-functional theory calculations using the transition potential approach. The differences between the two species also occur in stilbene adsorbed on Si(100), opening the way towards studying structural changes in molecules in different surface environments, and configurational switching in organic molecules on surfaces in particular.

  2. Identification of isomers in the gas phase and as adsorbates by near-edge X-ray absorption fine structure spectroscopy: Cis- and trans-stilbene

    Energy Technology Data Exchange (ETDEWEB)

    Püttner, Ralph [Department of Physics, Freie Universität Berlin, 14195 Berlin (Germany); Schmidt-Weber, Philipp [Fritz Haber Institute of the Max Planck Society, 14195 Berlin (Germany); Kampen, Thorsten [SPECS Surface Nano Analysis GmbH, 13355 Berlin (Germany); Kolczewski, Christine [Deutsches Museum München, 80538 Munich (Germany); Hermann, Klaus [Fritz Haber Institute of the Max Planck Society, 14195 Berlin (Germany); Horn, Karsten, E-mail: horn@fhi-berlin.mpg.de [Fritz Haber Institute of the Max Planck Society, 14195 Berlin (Germany)

    2017-02-15

    Highlights: • NEXAFS spectra of the cis- and trans-isomer of stilbene reveal distinct differences by which the isomers can be distinguished. • DFT calculations using the transition potential approach assign specific transitions that are different in the two isomers. • On Si(100), these differences in NEXAFS are also observed, suggesting that their conformations survive in the bonding situation. • NEXAFS is thus shown to be a sensitive tool to distinguish isomers in adsorbed species. - Abstract: Near-edge x-ray absorption fine structure spectra of the cis- and trans-isomers of stilbene in the gas phase reveal clear differences, which are analyzed by results from density-functional theory calculations using the transition potential approach. The differences between the two species also occur in stilbene adsorbed on Si(100), opening the way towards studying structural changes in molecules in different surface environments, and configurational switching in organic molecules on surfaces in particular.

  3. Characterisation of cerium-doped lanthanum bromide scintillation detector

    International Nuclear Information System (INIS)

    Etim, I. P.; Obu, J. A.; Ushie, J. O.

    2011-01-01

    LaBr 3 (Ce) crystals is one of the new scintillating detectors that has been developed in recent years which has proven to be superior to other scintillating materials in terms of resolution and efficiency. The energy resolution, intrinsic photo peak, total intrinsic and total absolute efficiency of this detector have been measured for a 25mm x 25mm Brillance T M 380 LaBr 3 (Ce) detector. The energy dependence of the resolution has been studied with a variety of gamma ray sources with variable energy range (122KeV-1408KeV). LaBr 3 (Ce) detector shows an excellent energy resolution of 2.6% (FWHM) at 662KeV photons ( 137 Cs source) at room temperature. A full-energy peak efficiency of 90.1-4.3% has been obtained for the 122 - 1408KeV energy range for a source-detector distance of 150mm.

  4. Synthesis, structure, and properties of supramolecular charge-transfer complexes between bis(18-crown-6)stilbene and ammonioalkyl derivatives of 4,4'-bipyridine and 2,7-diazapyrene.

    Science.gov (United States)

    Vedernikov, Artem I; Ushakov, Evgeny N; Efremova, Asya A; Kuz'mina, Lyudmila G; Moiseeva, Anna A; Lobova, Natalia A; Churakov, Andrei V; Strelenko, Yuri A; Alfimov, Michael V; Howard, Judith A K; Gromov, Sergey P

    2011-08-19

    4,4'-Bipyridine and 2,7-diazapyrene derivatives (A) having two ammonioalkyl N-substituents were synthesized. The complex formation of these compounds with bis(18-crown-6)stilbene (D) was studied by spectrophotometry, cyclic voltammetry, (1)H NMR spectroscopy, and X-ray diffraction analysis. In MeCN, π-donor D and π-acceptors A form supramolecular 1:1 (D·A) and 2:1 (D·A·D) charge-transfer complexes. The D·A complexes have a pseudocyclic structure as a result of ditopic binding of the ammonium groups to the crown-ether fragments. The better the geometric matching between the components, the higher the stability of the D·A complexes (log K up to 9.39). A key driving force of the D·A·D complex formation is the excessive steric strain in the precursor D·A complexes. The pseudocyclic D·A complexes involving the ammoniopropyl derivative of 4,4'-bipyridine were obtained as single crystals. Crystallization of the related ammonioethyl derivative was accompanied by transition of the D·A complexes to a structure of the (D·A)(m) coordination polymer type.

  5. Low-temperature relative reflectivity measurements of reflective and scintillating foils used in rare event searches

    Science.gov (United States)

    Langenkämper, A.; Ulrich, A.; Defay, X.; Feilitzsch, F. v.; Lanfranchi, J.-C.; Mondragón, E.; Münster, A.; Oppenheimer, C.; Potzel, W.; Roth, S.; Schönert, S.; Steiger, H.; Trinh Thi, H. H.; Wawoczny, S.; Willers, M.; Zöller, A.

    2018-03-01

    In this work we investigate the reflectivity of highly reflective multilayer polymer foils used in the CRESST experiment. The CRESST experiment searches directly for dark matter via operating scintillating CaWO4 crystals as targets for elastic dark matter-nucleon scattering. In order to suppress background events, the experiment employs the so-called phonon-light technique which is based on the simultaneous measurement of the heat signal in the main CaWO4 target crystal and of the emitted scintillation light with a separate cryogenic light detector. Both detectors are surrounded by a highly reflective and scintillating multilayer polymer foil to increase the light collection efficiency and to veto surface backgrounds. While this study is motivated by the CRESST experiment, the results are also relevant for other rare event searches using scintillating cryogenic bolometers in the field of the search of dark matter and neutrinoless double beta decay (0 νββ). In this work a dedicated experiment has been set up to determine the relative reflectivity at 300 K and 20 K of three multilayer foils ("VM2000", "VM2002", "Vikuiti") produced by the company 3M. The intensity of a light beam reflected off the foil is measured with a CCD camera. The ratio of the intensities at 300 K and 20 K corresponds to the relative reflectivity change. The measurements performed in this work show no variation of the reflectivity with temperature at a level of ∼1%.

  6. Evaluating scintillator performance in time-resolved hard X-ray studies at synchrotron light sources

    International Nuclear Information System (INIS)

    Rutherford, Michael E.; Chapman, David J.; White, Thomas G.; Drakopoulos, Michael; Rack, Alexander; Eakins, Daniel E.

    2016-01-01

    Scintillator performance in time-resolved, hard, indirect detection X-ray studies on the sub-microsecond timescale at synchrotron light sources is reviewed, modelled and examined experimentally. LYSO:Ce is found to be the only commercially available crystal suitable for these experiments. The short pulse duration, small effective source size and high flux of synchrotron radiation is ideally suited for probing a wide range of transient deformation processes in materials under extreme conditions. In this paper, the challenges of high-resolution time-resolved indirect X-ray detection are reviewed in the context of dynamic synchrotron experiments. In particular, the discussion is targeted at two-dimensional integrating detector methods, such as those focused on dynamic radiography and diffraction experiments. The response of a scintillator to periodic synchrotron X-ray excitation is modelled and validated against experimental data collected at the Diamond Light Source (DLS) and European Synchrotron Radiation Facility (ESRF). An upper bound on the dynamic range accessible in a time-resolved experiment for a given bunch separation is calculated for a range of scintillators. New bunch structures are suggested for DLS and ESRF using the highest-performing commercially available crystal LYSO:Ce, allowing time-resolved experiments with an interframe time of 189 ns and a maximum dynamic range of 98 (6.6 bits)

  7. Evaluating scintillator performance in time-resolved hard X-ray studies at synchrotron light sources

    Energy Technology Data Exchange (ETDEWEB)

    Rutherford, Michael E.; Chapman, David J.; White, Thomas G. [Imperial College London, London (United Kingdom); Drakopoulos, Michael [Diamond Light Source, I12 Joint Engineering, Environmental, Processing (JEEP) Beamline, Didcot, Oxfordshire (United Kingdom); Rack, Alexander [European Synchrotron Radiation Facility, Grenoble (France); Eakins, Daniel E., E-mail: d.eakins@imperial.ac.uk [Imperial College London, London (United Kingdom)

    2016-03-24

    Scintillator performance in time-resolved, hard, indirect detection X-ray studies on the sub-microsecond timescale at synchrotron light sources is reviewed, modelled and examined experimentally. LYSO:Ce is found to be the only commercially available crystal suitable for these experiments. The short pulse duration, small effective source size and high flux of synchrotron radiation is ideally suited for probing a wide range of transient deformation processes in materials under extreme conditions. In this paper, the challenges of high-resolution time-resolved indirect X-ray detection are reviewed in the context of dynamic synchrotron experiments. In particular, the discussion is targeted at two-dimensional integrating detector methods, such as those focused on dynamic radiography and diffraction experiments. The response of a scintillator to periodic synchrotron X-ray excitation is modelled and validated against experimental data collected at the Diamond Light Source (DLS) and European Synchrotron Radiation Facility (ESRF). An upper bound on the dynamic range accessible in a time-resolved experiment for a given bunch separation is calculated for a range of scintillators. New bunch structures are suggested for DLS and ESRF using the highest-performing commercially available crystal LYSO:Ce, allowing time-resolved experiments with an interframe time of 189 ns and a maximum dynamic range of 98 (6.6 bits)

  8. Range-energy relation, range straggling and response function of CsI(Tl), BGO and GSO(Ce) scintillators for light ions

    CERN Document Server

    Avdeichikov, V; Jakobsson, B; Rodin, A M; Ter-Akopian, G M

    2000-01-01

    Range-energy relations and range straggling of sup 1 sup , sup 2 sup , sup 3 H and sup 4 sup , sup 6 He isotopes with the energy approx 50A MeV are measured for the CsI(Tl), BGO and GSO(Ce) scintillators with an accuracy better than 0.2% and 5%, respectively. The Si-Sci/PD telescope was exposed to secondary beams from the mass separator ACCULINNA. The experimental technique is based on the registration of the 'jump' in the amplitude of the photodiode signal for ions passing through the scintillation crystal. Light response of the scintillators for ions 1<=Z<=4 is measured in energy range (5-50)A MeV, the results are in good agreement with calculations based on Birks model. The energy loss straggling for particles with DELTA E/E=0.01-0.50 and mass up to A=10 in 286 mu m DELTA E silicon detector is studied and compared with theoretical prescriptions. The results allow a precise absolute calibration of the scintillation crystal and to optimize the particle identification by the DELTA E-E(Sci/PD) method.

  9. Alkali earth co-doping effects on luminescence and scintillation properties of Ce doped Gd.sub.3./sub.Al.sub.2./sub.Ga.sub.3./sub.O.sub.12./sub. scintillator

    Czech Academy of Sciences Publication Activity Database

    Kamada, K.; Nikl, Martin; Kurosawa, S.; Beitlerová, Alena; Nagura, A.; Shoji, Y.; Pejchal, Jan; Ohashi, Y.; Yokota, Y.; Yoshikawa, A.

    2015-01-01

    Roč. 41, Mar SI (2015), s. 63-66 ISSN 0925-3467 R&D Projects: GA MŠk(CZ) LH14266 EU Projects: European Commission(XE) 316906 - LUMINET Institutional support: RVO:68378271 Keywords : scintillator * garnet * single crystal growth Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.183, year: 2015

  10. Polarimetry concept based on heavy crystal hadron calorimeter

    Science.gov (United States)

    Keshelashvili, I.; Müller, F.; Mchedlishvili, D.; JEDI Collaboration

    2017-11-01

    In the ongoing JEDI (Jülich Electric Dipole moment Investigations) project, the essential point will be to measure a tiny beam polarization change over an extended period of time. The particle scarcity in the polarized deuteron or proton beams and the required slow extraction rate puts tough experimental constrains on the polarimetry. For the EDM measurements, a dedicated high precision polarimeter is required. To fulfill specifications, a fast, dense, high resolution (energy and time), and radioactive hard novel crystal scintillating material is required. LYSO crystals are supposed to be used as an ideal scintillating material for this kind of detector. The LYSO crystal PMT and SiPM readout, with a FADC based system is under development. The first proton and deuteron beam test of the prototypes are presented here. In this paper, the new polarimetry concept and preliminary results from first proton and deuteron beam time are presented.

  11. Coincidence resolution time of two small scintillators coupled to high quantum-efficiency photomultipliers in a PET-like system

    Science.gov (United States)

    Galetta, G.; De Leo, R.; Garibaldi, F.; Grodzicka, M.; Lagamba, L.; Loddo, F.; Masiello, G.; Nappi, E.; Perrino, R.; Ranieri, A.; Szczęśniak, T.

    2014-03-01

    The lower limit of the time resolution for a positron emission tomography (PET) system has been measured for two scintillator types, LYSO:Ce and LuAG:Pr. Small dimension crystals and ultra bi-alkali phototubes have been used in order to increase the detected scintillation photons. Good timing resolutions of 118 ps and 223 ps FWHM have been obtained for two LYSO and two LuAG, respectively, exposed to a 22Na source.

  12. Synthesis of plastic scintillation microspheres: Evaluation of scintillators

    International Nuclear Information System (INIS)

    Santiago, L.M.; Bagán, H.; Tarancón, A.; Garcia, J.F.

    2013-01-01

    The use of plastic scintillation microspheres (PSm) appear to be an alternative to liquid scintillation for the quantification of alpha and beta emitters because it does not generate mixed wastes after the measurement (organic and radioactive). In addition to routine radionuclide determinations, PSm can be used for further applications, e.g. for usage in a continuous monitoring equipment, for measurements of samples with a high salt concentration and for an extractive scintillation support which permits the separation, pre-concentration and measurement of the radionuclides without additional steps of elution and sample preparation. However, only a few manufacturers provide PSm, and the low number of regular suppliers reduces its availability and restricts the compositions and sizes available. In this article, a synthesis method based on the extraction/evaporation methodology has been developed and successfully used for the synthesis of plastic scintillation microspheres. Seven different compositions of plastic scintillation microspheres have been synthesised; PSm1 with polystyrene, PSm2 with 2,5-Diphenyloxazol(PPO), PSm3 with p-terphenyl (pT), PSm4 with PPO and 1,4-bis(5-phenyloxazol-2-yl) (POPOP), PSm5 pT and (1,4-bis [2-methylstyryl] benzene) (Bis-MSB), PSm6 with PPO, POPOP and naphthalene and PSm7 with pT, Bis-MSB and naphthalene. The synthesised plastic scintillation microspheres have been characterised in terms of their morphology, detection capabilities and alpha/beta separation capacity. The microspheres had a median diameter of approximately 130 μm. Maximum detection efficiency values were obtained for the PSm4 composition as follows 1.18% for 3 H, 51.2% for 14 C, 180.6% for 90 Sr/ 90 Y and 76.7% for 241 Am. Values of the SQP(E) parameter were approximately 790 for PSm4 and PSm5. These values show that the synthesised PSm exhibit good scintillation properties and that the spectra are at channel numbers higher than in commercial PSm. Finally, the addition

  13. A scintillating bolometer array for double beta decay studies: The LUCIFER experiment

    Energy Technology Data Exchange (ETDEWEB)

    Gironi, L., E-mail: luca.gironi@mib.infn.it [Università degli Studi di Milano-Bicocca, Milano (Italy); INFN – Sezione di Milano-Bicocca, Milano (Italy)

    2016-07-11

    The main goal of the LUCIFER experiment is to study the neutrinoless double beta decay, a rare process allowed if neutrinos are Majorana particles. Although aiming at a discovery, in the case of insufficient sensitivity the LUCIFER technique will be the demonstrator for a higher mass experiment able to probe the entire inverted hierarchy region of the neutrino mass. In order to achieve this challenging result, high resolution detectors with active background discrimination capability are required. This very interesting possibility can be largely fulfilled by scintillating bolometers thanks to the simultaneous read-out of heat and light emitted by the interactions in the detector or by pulse shape analysis. - Highlights: • The LUCIFER technique will be the demonstrator for a higher mass experiment. • Scintillating bolometers allow high energy resolution and background discrimination. • The first choice for the LUCIFER tower are ZnSe crystals. • The LUCIFER setup will consist of an array of 30 individual single module detectors. • An array of ZnMoO4 crystals allowed the bolometric observation of the 2vDBD of {sup 100}Mo.

  14. A feasibility study of ortho-positronium decays measurement with the J-PET scanner based on plastic scintillators

    Science.gov (United States)

    Kamińska, D.; Gajos, A.; Czerwiński, E.; Alfs, D.; Bednarski, T.; Białas, P.; Curceanu, C.; Dulski, K.; Głowacz, B.; Gupta-Sharma, N.; Gorgol, M.; Hiesmayr, B. C.; Jasińska, B.; Korcyl, G.; Kowalski, P.; Krzemień, W.; Krawczyk, N.; Kubicz, E.; Mohammed, M.; Niedźwiecki, Sz.; Pawlik-Niedźwiecka, M.; Raczyński, L.; Rudy, Z.; Silarski, M.; Wieczorek, A.; Wiślicki, W.; Zgardzińska, B.; Zieliński, M.; Moskal, P.

    2016-08-01

    We present a study of the application of the Jagiellonian positron emission tomograph (J-PET) for the registration of gamma quanta from decays of ortho-positronium (o-Ps). The J-PET is the first positron emission tomography scanner based on organic scintillators in contrast to all current PET scanners based on inorganic crystals. Monte Carlo simulations show that the J-PET as an axially symmetric and high acceptance scanner can be used as a multi-purpose detector well suited to pursue research including e.g. tests of discrete symmetries in decays of ortho-positronium in addition to the medical imaging. The gamma quanta originating from o-Ps decay interact in the plastic scintillators predominantly via the Compton effect, making the direct measurement of their energy impossible. Nevertheless, it is shown in this paper that the J-PET scanner will enable studies of the { o-Ps }→ 3γ decays with angular and energy resolution equal to σ (θ ) ≈ {0.4°} and σ (E) ≈ 4.1 {keV}, respectively. An order of magnitude shorter decay time of signals from plastic scintillators with respect to the inorganic crystals results not only in better timing properties crucial for the reduction of physical and instrumental background, but also suppresses significantly the pile-ups, thus enabling compensation of the lower efficiency of the plastic scintillators by performing measurements with higher positron source activities.

  15. A Monte Carlo investigation of Swank noise for thick, segmented, crystalline scintillators for radiotherapy imaging

    International Nuclear Information System (INIS)

    Wang Yi; Antonuk, Larry E.; El-Mohri, Youcef; Zhao Qihua

    2009-01-01

    Thick, segmented scintillating detectors, consisting of 2D matrices of scintillator crystals separated by optically opaque septal walls, hold considerable potential for significantly improving the performance of megavoltage (MV) active matrix, flat-panel imagers (AMFPIs). Initial simulation studies of the radiation transport properties of segmented detectors have indicated the possibility of significant improvement in DQE compared to conventional MV AMFPIs based on phosphor screen detectors. It is therefore interesting to investigate how the generation and transport of secondary optical photons affect the DQE performance of such segmented detectors. One effect that can degrade DQE performance is optical Swank noise (quantified by the optical Swank factor I opt ), which is induced by depth-dependent variations in optical gain. In this study, Monte Carlo simulations of radiation and optical transport have been used to examine I opt and zero-frequency DQE for segmented CsI:Tl and BGO detectors at different thicknesses and element-to-element pitches. For these detectors, I opt and DQE were studied as a function of various optical parameters, including absorption and scattering in the scintillator, absorption at the top reflector and septal walls, as well as scattering at the side surfaces of the scintillator crystals. The results indicate that I opt and DQE are only weakly affected by absorption and scattering in the scintillator, as well as by absorption at the top reflector. However, in some cases, these metrics were found to be significantly degraded by absorption at the septal walls and scattering at the scintillator side surfaces. Moreover, such degradations are more significant for detectors with greater thickness or smaller element pitch. At 1.016 mm pitch and with optimized optical properties, 40 mm thick segmented CsI:Tl and BGO detectors are predicted to provide DQE values of ∼29% and 42%, corresponding to improvement by factors of ∼29 and 42

  16. Application of PWO crystals for detection of low-activity gamma- radiation in the energy range above 3 MeV

    CERN Document Server

    Drobychev, G Yu; Fedorov, A A; Khruschinsky, A A; Korjik, M V; Lecoq, P; Missevitch, O V; 10.1016/j.nima.2004.08.059

    2005-01-01

    Lead tungstate PbWO4 (PWO) scintillator was developed during the R&D project initiated in a frame of preparation of experiments in high- energy physics to be carried out at new generation of colliders like LHC (CERN, Geneva, Switzerland). Compared to other promising fast and dense scintillators, PWO is an optimal compromise to make a very compact detector with good performance and the best price/performance ratio. Moreover, the results of PWO development carried out by the INP team together with collaborators show that scintillation parameters of PWO crystals can be further modified, which significantly extends opportunities of PWO application. One such field where an application of PWO scintillator can be very advantageous is a detection of low-activity gamma-radiation in the energy range above 3 MeV. Application of heavy scintillator allows to decrease a detector volume and therefore to reduce background. According to our preliminary estimations, PWO scintillation crystal will allow to reach significant...

  17. Experimental Study of the Lead Tungstate Scintillator Proton-Induced Damage and Recovery

    CERN Document Server

    Auffray, Etiennette; Singovski , A

    2011-01-01

    Lead tungstate (PbWO4, or PWO) scintillating crystals are used by two of the four experiments at the Large Hadron Collider (LHC): 75848 in CMS and 17920 in ALICE. For the CMS electromagnetic calorimeter, one of the most important crystal properties is its radiation hardness. With the increase of luminosity, the radiation level will increase drastically, particularly in the high pseudorapidity regions of the calorimeter. Beside the effects of color-centre formation caused by gamma-radiation, additional measurable effect originated by hadron irradiation could appear, which will further deteriorate the optical transmission of the crystals and therefore their efficiency. In this paper, we will present results of the proton-induced damage in PWO and a study of optical transmission recovery at different temperatures and under different light-induced "bleaching" conditions for proton-irradiated crystals.

  18. Plastic scintillator

    International Nuclear Information System (INIS)

    Andreeshchev, E.A.; Kilin, S.F.; Kavyrzina, K.A.

    1978-01-01

    A plastic scintillator for ionizing radiation detectors with high time resolution is suggested. To decrease the scintillation pulse width and to maintain a high light yield, the 4 1 , 4 5 -dibromo-2 1 , 2 5 , 5 1 , 5 5 -tetramethyl-n-quinquiphenyl (Br 2 Me 4 Ph) in combination with n-terphenyl (Ph 3 ) or 2, 5-diphenyloxadiazol-1, 3, 4 (PPD) is used as a luminescent addition. Taking into consideration the results of a special study, it is shown, that the following ratio of ingradients is the optimum one: 3-4 mass% Ph 3 or 4-7 mas% PPD + 2-5 mass% Br 2 Me 4 Ph + + polymeric base. The suggested scintillator on the basis of polystyrene has the light yield of 0.23-0.26 arbitrary units and the scintillation pulse duration at half-height is 0.74-0.84 ns

  19. Systematic study of the short-term instability of PbWO4 scintillator parameters under irradiation

    International Nuclear Information System (INIS)

    Annenkov, A.N.; Ligun, A.B.; Auffray, E.; Lecoq, P.; Chipaux, R.; Geleoc, M.; Drobychev, G. Yu; Fedorov, A.A.; Korzhik, M.V.; Missevitch, O.V.; Pavlenko, V.B.; Golubev, N.A.; Lednev, A.A.; Peigneux, J.-P.; Singovski, A.V.

    1998-01-01

    The effect of irradiation on lead tungstate PbWO 4 (PWO) scintillator properties has been studied at different irradiation facilities. Lead tungstate crystals, grown with the oxide content in the melt tuned to the stoichiometry of pure sheelite or sheelite-like crystal types and doped with heterovalent, trivalent and pentavalent impurities, have been studied in order to optimize their resistance to irradiation. A combination of a selective cleaning of raw materials, a tuning of the melt from crystallization to crystallization and a destruction or compensation of the point-structure defects has to be used to minimize the short-term instability of PWO parameters under irradiation

  20. Characterizing and simulation the scintillation properties of zinc oxide nanowires in AAO membrane for medical imaging applications

    International Nuclear Information System (INIS)

    Esfandi, F.; Saramad, S.; Shahmirzadi, M. Rezaei

    2017-01-01

    In this work, a new method is proposed for extracting some X-ray detection properties of ZnO nanowires electrodeposited on Anodized Aluminum Oxide (AAO) nanoporous template. The results show that the detection efficiency for 12μm thickness of zinc oxide nano scintillator at an energy of 9.8 keV, near the K-edge of ZnO (9.65 keV), is 24%. The X-rays that interact with AAO can also generate electrons that reach the nano scintillator. The scintillation events of these electrons are seen as a low energy tail in the spectrum. In addition, it is found that all the X-rays that are absorbed in 300 nm thickness of the gold layer on the top of the zinc oxide nanowires can participate in the scintillation process with an efficiency of 6%. Hence, the scintillation detection efficiency of the whole detector for 9.8 keV X-ray energy is 30%. The simulation results from Geant4 and the experimental detected photons per MeV energy deposition are also used to extract the light yield of the zinc oxide nano scintillator. The results show that the light yield of the zinc oxide nanowires deposited by the electrochemical method is approximately the same as for single crystal zinc oxide scintillator (9000). Much better spatial resolution of this nano scintillator in comparison to the bulk ones is an advantage which candidates this nano scintillator for medical imaging applications.

  1. New crystals for dual-readout calorimetry

    Czech Academy of Sciences Publication Activity Database

    Akchurin, N.; Bedeschi, F.; Cardini, A.; Carosi, R.; Ciapetti, G.; Ferrari, R.; Franchino, S.; Fraternali, M.; Gaudio, G.; Hauptman, J.; Incagli, M.; Korzhik, M.; Lacava, F.; La Rotonda, L.; Livan, M.; Meoni, E.; Nikl, Martin; Pinci, D.; Policicchio, A.; Popescu, S.; Scuri, F.; Sill, A.; Vandelli, W.; Vedda, A.; Venturelli, T.; Voena, C.; Volobouev, I.; Wigmans, R.

    2009-01-01

    Roč. 604, č. 3 (2009), s. 512-526 ISSN 0168-9002 Institutional research plan: CEZ:AV0Z10100521 Keywords : calorimetry * Cherenkov light * high-Z scintillating crystals Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.317, year: 2009

  2. Effect of crystal shape, size and reflector type on operation characteristics of gamma-radiation detectors based on CsI(Tl) and CsI(Na) scintillators

    International Nuclear Information System (INIS)

    Globus, M.E.; Grinyov, B.V.; Ratner, M.A.

    1996-01-01

    Operation characteristics of CsI(Tl) and CsI(Na) scintillation detectors, to a large degree connected with light collection in crystals, are calculated for various shapes, sizes and reflecting surface types. Allowance is made for the true light reflection indicatrix which is characterized by the effective mirror constituent of the reflected light, p. Its value , averaged over incidence angle, is used for the classification of reflecting surfaces. Operation characteristics (in particular, spectrometric ones) are found to be essentially dependent on . Tables of operation characteristics, given below, permit one to make inferential conclusions on an optimal combination of the shape, sizes an the reflecting surface version

  3. Stilbene induced inhibition of androgen receptor dimerization: implications for AR and ARΔLBD-signalling in human prostate cancer cells.

    Directory of Open Access Journals (Sweden)

    Wolfgang Streicher

    Full Text Available BACKGROUND: Advanced castration resistant prostate cancer (CRPC is often characterized by an increase of C-terminally truncated, constitutively active androgen receptor (AR variants. Due to the absence of a ligand binding domain located in the AR-C-terminus, these receptor variants (also termed ARΔLBD are unable to respond to all classical forms of endocrine treatments like surgical/chemical castration and/or application of anti-androgens. METHODOLOGY: In this study we tested the effects of the naturally occurring stilbene resveratrol (RSV and (E-4-(2, 6-Difluorostyryl-N, N-dimethylaniline, a fluorinated dialkylaminostilbene (FIDAS on AR- and ARΔLBD in prostate cancer cells. The ability of the compounds to modulate transcriptional activity of AR and the ARΔLBD-variant Q640X was shown by reporter gene assays. Expression of endogenous AR and ARΔLBD mRNA and protein levels were determined by qRT-PCR and Western Blot. Nuclear translocation of AR-molecules was analyzed by fluorescence microscopy. AR and ARΔLBD/Q640X homo-/heterodimer formation was assessed by mammalian two hybrid assays. Biological activity of both compounds in vivo was demonstrated using a chick chorioallantoic membrane xenograft assay. RESULTS: The stilbenes RSV and FIDAS were able to significantly diminish AR and Q640X-signalling. Successful inhibition of the Q640X suggests that RSV and FIDAS are not interfering with the AR-ligand binding domain like all currently available anti-hormonal drugs. Repression of AR and Q640X-signalling by RSV and FIDAS in prostate cancer cells was caused by an inhibition of the AR and/or Q640X-dimerization. Although systemic bioavailability of both stilbenes is very low, both compounds were also able to downregulate tumor growth and AR-signalling in vivo. CONCLUSION: RSV and FIDAS are able to inhibit the dimerization of AR and ARΔLBD molecules suggesting that stilbenes might serve as lead compounds for a novel generation of AR-inhibitors.

  4. Proposal for the award of a contract for the supply of 26 000 lead-tungstate scintillation crystals for the CMS electromagnetic calorimeter

    CERN Document Server

    2001-01-01

    This document concerns the award of a contract for the supply of 26 000 lead-tungstate scintillation crystals for the barrel part of the CMS Electromagnetic Calorimeter (ECAL). Following a CERN market survey (MS-2727/EP/CMS) carried out among seven firms in four Member States and two firms in two non-Member States, the Eidgenössische Technische Hochschule in Z rich (ETHZ) published on 15 February 2001 an open call for tenders and, in addition, invited tenders from four firms in two non-Member States, including the two firms identified in the CERN market survey. By the closing date, the ETHZ had received one bid from a firm in a CERN Member State and three bids from three firms in two non-Member States. The Finance Committee is invited to agree to the negotiation of a contract to be placed by CERN, on behalf of the ETHZ, with the lowest bidder, SCIONIX (NL), for the supply of 26 000 lead-tungstate crystals for the barrel part of the CMS ECAL for a total amount of 9 392 000 US dollars (16 060 320 Swiss francs)...

  5. Sintered pellets: A simple and cost effective method to predict the performance of GGAG:Ce single crystals

    International Nuclear Information System (INIS)

    Meng, Fang; Koschan, Merry; Melcher, Charles L.; Cohen, Peter

    2015-01-01

    Highlights: • Sintered pellets were firstly used to predict the performance of single crystals. • Similar properties between sintered pellets and single crystals were investigated. • B and Ba increase luminescence intensity in pellets and light yield in crystals. • Ca shortens photoluminescence decay in pellets and scintillation decay in crystals. - Abstract: Polycrystalline Gd 3 Ga 3 Al 2 O 12 :Ce (GGAG:Ce) pellets with various codopants were prepared via solid-state synthesis and characterized by X-ray diffraction, radioluminescence (RL), photoluminescence (PL), reflectivity and PL decay measurements. GGAG:Ce pellets codoped with B and Ba were found to have higher RL intensity than pellets with other codopants, while Ca codoping improved the decay time but reduced the RL intensity. These results were strongly correlated with the performance of these codopants in GGAG:Ce single crystals. The light yield of the single crystals codoped with B or Ba was ∼15% higher than the light yield of the GGAG:Ce crystal without codoping, while Ca codoping in single crystals resulted in lower light yield but shorter scintillation decay time (43 ns vs. 56 ns). The consistent performance of these codopants in both matrix forms indicates that sintering pellets may be used as a simple cost effective technique to evaluate compositions for likely single crystal scintillator performance

  6. New semiconductor scintillators ZnSe(Te,O) and integrated radiation detectors based thereon

    NARCIS (Netherlands)

    Ryzhikov, [No Value; Starzhinskiy, N; Gal'chinetskii, L; Gashin, P; Kozin, D; Danshin, E

    Data are presented on properties of a new type of scintillator based on isovalently doped crystals of zinc selenide. Depending upon concentration of activating dopants Te and O, the wavelength of the luminescence maximum is 590-640 nm, response time is 1-50 mus, and afterglow level after 5 ms is not

  7. Structure and scintillation yield of Ce-doped Al–Ga substituted yttrium garnet

    International Nuclear Information System (INIS)

    Sidletskiy, Oleg; Kononets, Valerii; Lebbou, Kheirreddine; Neicheva, Svetlana; Voloshina, Olesya; Bondar, Valerii; Baumer, Vyacheslav; Belikov, Konstantin; Gektin, Alexander; Grinyov, Boris; Joubert, Marie-France

    2012-01-01

    Highlights: ► Range of Y 3 (Al 1−x Ga x ) 5 O 12 :Ce solid solution crystals are grown from melt by the Czochralski method. ► Light yield of mixed crystals reaches 130% of the YAG:Ce value at x ∼ 0.4. ► ∼1% of antisite defects is formed in YGG:Ce, but no evidence of this is obtained for the rest of crystals. -- Abstract: Structure and scintillation yield of Y 3 (Al 1−x Ga x ) 5 O 12 :Ce solid solution crystals are studied. Crystals are grown from melt by the Czochralski method. Distribution of host cations in crystal lattice is determined. Quantity of antisite defects in crystals is evaluated using XRD and atomic emission spectroscopy data. Trend of light output at Al/Ga substitution in Y 3 (Al 1−x Ga x ) 5 O 12 :Ce is determined for the first time. Light output in mixed crystals reaches 130% comparative to Ce-doped yttrium–aluminum garnet. Luminescence properties at Al/Ga substitution are evaluated.

  8. Simulation study of LYSO crystal pixels for In-Beam TOF-PET prototype

    International Nuclear Information System (INIS)

    Chen Ze; Hu Zhengguo; Chen Jinda; Zhang Xiuling

    2014-01-01

    In-beam TOF-PET is currently the only feasible method implemented for in-situ and noninvasive monitoring of the precision of the treatment in highly conformal ion radiotherapy. It ensures the safety of patient and accurate implementation of treatment plan. Therefore, we intent to carry out the development of In-beam TOF-PET prototype, which is made of LYSO crystal, for ion radiotherapy. LYSO crystal has perfect properties such as high light yield, fast decay time, good energy and time resolution, which makes it a good candidate. In the development of positron emission tomography (PET) detectors, understanding and optimizing scintillator light collection and energy resolution is critical for achieving high performance, particularly when the design incorporates depth-of-interaction (DOI) encoding or time-of-flight information. Monte Carlo simulations play an important role in guiding research in detector designs and popular software such as Gate now include models of light transport in scintillators. This study uses Gate software to investigate the influence of crystal length and wrapping materials to the light collection. Accurate physical modeling of scintillation detection process, from scintillation light generation through detection, is devised and performed for varying detector attributes, such as the crystal pixel length, light yield, decay time, attenuation length and surface treatment. The dependence of light output and energy resolution is studied and compared with experiment results. The results show that LYSO pixel with length of 5 mm has better light yield and energy resolution, meanwhile prove that it is possible to accurately simulate the light output using Gate. (authors)

  9. Scintillator device using a combined organic-inorganic scintillator as dose ratemeter

    International Nuclear Information System (INIS)

    Kolb, W.; Lauterbach, U.

    1974-01-01

    The dose ratemeter independent of energy in the energy region 17 keV to 3 MeV consists of an organic and an inorganic scintillator. The organic scintillation material of an anthracene monocrystal is surrounded by ZnS surface coating. The coating thickness of the inorganic scintillator ZnS is measured in such a manner for gamma and X-radiation below 100 keV that the light produced due to the incident radiation compensates for the decrease of light produced in the organic scintillator. The whole energy and dose rate region of interest for radiation protection can thus be measured with a detector volume of 135 cm 3 . (DG) [de

  10. Instruments and methods of scintillation spectra processing for radiation control tasks

    International Nuclear Information System (INIS)

    Antropov, S.Yu.; Ermilov, A.P.; Ermilov, S.A.; Komarov, N.A.; Krokhin, I.I.

    2005-01-01

    On gamma-spectrometer the response function could be calculated on the base of sensitivity data, energy resolution and form of Compton spectrum part. On the scintillation gamma-spectrometer with Na-I(Tl) crystal 63x63 mm the method allows to divide the 5-10 components mixtures, and on the beta-spectrometer of 2-3 component mixtures. The approach is realized in the 'Progress' program-instrumental complexes

  11. Scintillation response of Y.sub.3./sub.Al.sub.5./sub.O.sub.12./sub.:Pr.sup.3+./sup. single crystal scintillators

    Czech Academy of Sciences Publication Activity Database

    Sreebunpeng, K.; Chewpraditkul, W.; Babin, Vladimir; Nikl, Martin; Nejezchleb, K.

    2013-01-01

    Roč. 56, Sept (2013), s. 94-97 ISSN 1350-4487 R&D Projects: GA ČR GAP204/12/0805 Institutional support: RVO:68378271 Keywords : energy resolution * light yield * photofraction * scintillation detectors * YAG:Pr Subject RIV: BH - Optics, Masers, Lasers Impact factor: 1.140, year: 2013

  12. WE-DE-201-10: Pitfalls When Using Ruby as An Inorganic Scintillator Detector for Ir-192 Brachytherapy Dosimetry

    Energy Technology Data Exchange (ETDEWEB)

    Kertzscher, G; Beddar, S [The University of Texas MD Anderson Cancer Center, Houston, TX (United States)

    2016-06-15

    Purpose: To study the promising potential of inorganic scintillator detectors (ISDs) and investigate various unwanted luminescence properties which may compromise their accuracy. Methods: The ISDs were comprised of a ruby crystal coupled to a polymethyl methacrylate (PMMA) fiber-optic cable and a charged coupled device camera. A new type of ISD was manufactured and included a long-pass filter that was sandwiched between the crystal and the fiber-optic cable. The purpose of the filter was to suppress the Cerenkov and fluorescence background light induced in the PMMA (the stem signal) from striking the ruby crystal, generating unwanted ruby excitation. A variety of experiments were performed to characterize the ruby based ISDs. The relative contribution of the induced ruby signal and the stem signal were quantified while exposing the detector and a bare fiber-optic cable to a high dose rate (HDR) brachytherapy (BT) source, respectively. The unwanted ruby excitation was quantified while irradiating the fiber-optic cable with the detector volume shielded. Other experiments addressed time-dependent luminescence properties and a comparison to other commonly used organic scintillator detectors (BCF-12, BCF-60). Results: When the BT source dwelled 0.5 cm away from the fiber-optic cable, the unwanted ruby excitation amounted to >5% of the total signal if the source-distance from the scintillator was >7 cm. However, the unwanted excitation was suppressed to <1% if the ISD incorporated an optic filter. The stem signal was suppressed with a 20 nm band-pass filter and was <3% as long as the source-distance was <7 cm. The ruby based ISDs generated signal up to 20(40) times that of BCF-12(BCF-60). Conclusion: The study presents solutions to unwanted luminescence properties of ruby based ISDs for HDR BT. An optic filter should be sandwiched between the scintillator volume and the fiber-optic cable to prevent the stem signal to excite the ruby crystal.

  13. Borehole instrument for scintillation gamma spectrometer

    International Nuclear Information System (INIS)

    Sinitsyn, A.Ya.; Gabitov, R.M.

    1979-01-01

    Described are a schematic diagram and main specifications of a borehole instrument with autostabilization of energy scale measure by gamma bench-mark of 137 Cs, intended for the application in a logging gamma spectrometer to determine separately the concentrations of nature radioactive elements. The instrument may be connected to the KOBDFM-2 cable of 600 m length. It contains a scintillation counter for gamma quanta consisting of 30x70 mm NaI(Tl) crystal and a FEU-85 photoamplifier, an input conforming stage, a diagram of threshold pulse formation and regulating high-voltage generator. The borehole instrument has been proved under laboratory and field conditions at 10-40 deg C

  14. Performance of molded plastic scintillators

    International Nuclear Information System (INIS)

    Gen, N.S.; Leman, V.E.; Solomonov, V.M.

    1989-01-01

    The performance of molded plastic scintillators is studied. The plastic scintillators studied were formed by transfer molding and intrusion from a scintillation composition consisting of polystyrene and a standard system of luminescent additives: 2 mass % of paraterphenyl + 0.06 mass % 1,4-di-/2-[5-phenyloxazoyly]/benzene and a plasticizer. The combined effect of mechanical load and temperature was studied. The effect of radiation on molded plastic scintillators was studied using gamma radiation from a 60 Co source. The studies show that the main operating characteristics of molded plastic scintillators are on a par with those of polymerized plastic scintillators. At the same time, molded plastic scintillators are superior in thermal stability at temperatures below the glass transition temperature and with respect to their working temperature range

  15. Cryogenic scintillators for rare events detection in the Edelweiss and EURECA experiments

    International Nuclear Information System (INIS)

    Verdier, M.A.

    2010-10-01

    The riddle of the dark matter in astrophysics could be solved by the detection of WIMPs (Weakly Interactive Massive Particles), particles that are predicted by supersymmetry. The direct detection of WIMPs requires a large mass of detectors, able to identify these particles in the background of natural radioactivity and cosmic rays. This thesis takes place within the framework of the EDELWEISS and the future EURECA experiments. These experiments use a technology based on two channel cryogenic detectors (bolometers), working at a few tens of mK. They are composed of crystals in which the energy deposited by particle interactions will produce a temperature increase (phonon signal), and where the ionization of the crystals results in either a charge or photon signal, depending on their nature. In order to broaden the range of targets for scintillating bolometers, we have built a setup to study the scintillation of crystals cooled down to 3 K. It is based on a cryostat with a compact optical geometry allowing enhanced light collection. Thanks to an individual photon counting technique and a statistical treatment of data, it allows us to measure the evolution of the the light yields and the decay time components between room temperature and 3 K. Thus this thesis presents the results obtained at 3 K on two well known room temperature crystals: BGO (Bi 4 Ge 3 O 12 ) and BaF 2 . We also study the luminescence properties of titanium sapphire (Ti:Al 2 O 3 ), under VUV excitation cooled down to 8 K. (author)

  16. Photoluminescence and scintillation properties of Ce-doped Sr2(Gd1-xLux)8(SiO4)6O2 (x = 0.1, 0.2, 0.4, 0.5, 0.6) crystals

    Science.gov (United States)

    Igashira, Takuya; Kawano, Naoki; Okada, Go; Kawaguchi, Noriaki; Yanagida, Takayuki

    2018-05-01

    Apatite crystals with chemical compositions of 0.5% Ce-doped Sr2(Gd1-xLux)8(SiO4)6O2 (x = 0.1, 0.2, 0.4, 0.5, 0.6) were synthesized by the Floating Zone method, and then we evaluated their photoluminescence (PL) and scintillation properties. All the Ce-doped samples exhibited PL and scintillation with an intense broad emission in 400-550 nm in which the origin was attributed to the 5d-4f transition of Ce3+, and the emission peak became broader with increasing the concentration of Lu3+. Both PL and scintillation decay time profiles were best-approximated by a sum of two exponential decay functions, and the origin of slower component was attributed to the 5d-4f transition of Ce3+. In the X-ray induced afterglow measurements, the Ce-doped Sr2(Gd0.4Lu0.6)8(SiO4)6O2 sample exhibited the lowest afterglow level. Furthermore, the Ce-doped Sr2(Gd0.5Lu0.5)8(SiO4)6O2 and Sr2(Gd0.4Lu0.6)8(SiO4)6O2 samples showed a clear full energy deposited peak under 5.5 MeV 241Am α-ray irradiation, and the estimated absolute scintillation light yields were around 290 and 1300 ph/5.5 MeV-α, respectively.

  17. Testing a new NIF neutron time-of-flight detector with a bibenzyl scintillator on OMEGA.

    Science.gov (United States)

    Glebov, V Yu; Forrest, C; Knauer, J P; Pruyne, A; Romanofsky, M; Sangster, T C; Shoup, M J; Stoeckl, C; Caggiano, J A; Carman, M L; Clancy, T J; Hatarik, R; McNaney, J; Zaitseva, N P

    2012-10-01

    A new neutron time-of-flight (nTOF) detector with a bibenzyl crystal as a scintillator has been designed and manufactured for the National Ignition Facility (NIF). This detector will replace a nTOF20-Spec detector with an oxygenated xylene scintillator currently operational on the NIF to improve the areal-density measurements. In addition to areal density, the bibenzyl detector will measure the D-D and D-T neutron yield and the ion temperature of indirect- and direct-drive-implosion experiments. The design of the bibenzyl detector and results of tests on the OMEGA Laser System are presented.

  18. The recent developments in the technology of scintillator detectors for gamma-ray spectroscopy

    International Nuclear Information System (INIS)

    Verdebout, J.

    1988-01-01

    The goal of this report is to review the recent developments in the use of high stopping power materials and solid state readout for scintillation gamma -ray spectroscopy as these techniques may give rise to a new generation of low powered portable instruments. The report is a bibliographical study based on papers published mainly these last five years. The main subject is preceded by a general introduction in which the principal characteristics of a scintillator gamma-ray spectrometer are discussed. The properties of some scintillator materials (NaI(T1), CsI(T1), CsI(Na), BGO, GSO(Ce) and CdWO 4 ) are then briefly presented. In this section, a special emphasis has been given to BGO as this material has recently received much attention and is now well documented. Finally, the results obtained by measuring the intensity of the light generated in the crystal with three types of solid-state photodetectors (Si photodiodes, HgI 2 photodetectors and avalanche Si photodiodes) are summarized

  19. Response of Inorganic Scintillators to Neutrons of 3 and 15 MeV Energy

    CERN Document Server

    Lucchini, M; Pizzichemi, M; Chipaux, R; Jacquot, F; Mazue, H; Wolff, H; Lecoq, P; Auffray, E

    2014-01-01

    In the perspective of the development of future high energy physics experiments, homogeneous calorimeters based on inorganic scintillators can be considered for the detection of hadrons (e.g., calorimeter based on dual-readout technique). Although of high importance in the high energy physics framework as well as for homeland security applications, the response of these inorganic scintillators to neutrons has been only scarcely investigated. This paper presents results obtained using five common scintillating crystals (of size around 2x2x2 cm 3), namely lead tungstate (PbWO4), bismuth germanate (BGO), cerium fluoride (CeF3), Ce-doped lutetium-yttrium orthosilicate (LYSO:Ce) and lutetium aluminum garnet (LuAG:Ce) in a pulsed flux of almost mono-energetic (similar to 3 MeV and similar to 15 MeV) neutrons provided by the Van de Graff accelerator SAMES of CEA Valduc. Energy spectra have been recorded, calibrated and compared with Geant4 simulations computed with different physics models. The neutron detection eff...

  20. Luminescence mechanism in doubly Gd, Nd-codoped fluoride crystals for VUV scintillators

    Czech Academy of Sciences Publication Activity Database

    Pejchal, Jan; Fukuda, K.; Babin, Vladimir; Kurosawa, S.; Yokota, Y.; Yoshikawa, A.; Nikl, Martin

    2016-01-01

    Roč. 169, Jan (2016), s. 682-689 ISSN 0022-2313. [International Conference on Luminescence and Optical Spectroscopy of Condensed Matter /17./. Wroclaw, 13.07.2014-18.07.2014] R&D Projects: GA MŠk(CZ) LH14266 Institutional support: RVO:68378271 Keywords : barium –lutetium–yttrium fluoride * lutetium fluoride * scintillator * VUV luminescence Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.686, year: 2016

  1. Scintillation hodoscopes on the basis of hodoscopic photomultipliers using scintillation fibers

    International Nuclear Information System (INIS)

    Alimova, T.V.; Vasil'chenko, V.G.; Vechkanov, G.N.

    1986-01-01

    Scintillation hodoscopes characteristics and their design features have been considered. The space resolution for hodoscopes consisting of 4 layers of scintillation fibres 200 mm long and 1 mm in diameter is 0.4-0.6 mm. With 2 fibres layer 1 m long and 3.8 mm in diameter the space resolution 3 mm has been obtained. A possibility to construct 0.1 mm resolution scintillation hodoscopes is discussed

  2. Luminescence and scintillation properties of scintillators based on orthorhombic and monoclinic BaLu.sub.2./sub.F.sub.8./sub. single crystals

    Czech Academy of Sciences Publication Activity Database

    Pejchal, Jan; Fukuda, K.; Kurosawa, S.; Yokota, Y.; Král, Robert; Nikl, Martin; Yoshikawa, A.

    2014-01-01

    Roč. 61, č. 1 (2014), s. 411-417 ISSN 0018-9499 R&D Projects: GA MŠk LH12150 Institutional support: RVO:68378271 Keywords : fluorides * rare-earth doping * scintillator * x-ray and gamma-ray detection Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.283, year: 2014

  3. Subpicosecond luminescence rise time in magnesium codoped GAGG:Ce scintillator

    Czech Academy of Sciences Publication Activity Database

    Tamulaitis, G.; Vaitkevičius, A.; Nargelas, S.; Augulis, R.; Gulbinas, V.; Boháček, Karel; Nikl, Martin; Borisevich, A.; Fedorov, A.; Korjik, M.; Auffray, E.

    2017-01-01

    Roč. 870, Oct (2017), s. 25-29 ISSN 0168-9002 R&D Projects: GA ČR GA16-15569S EU Projects: European Commission(XE) 654168 - AIDA-2020 Grant - others:COST(XE) TD1401 Institutional support: RVO:68378271 Keywords : scintillator * GAGG garnet crystal * luminescence kinetics * radiation detector Subject RIV: BM - Solid Matter Physics ; Magnetism OBOR OECD: Condensed matter physics (including formerly solid state physics, supercond.) Impact factor: 1.362, year: 2016

  4. PREFACE: Applications of Novel Scintillators for Research and Industry (ANSRI 2015)

    Science.gov (United States)

    Roberts, O. J.

    2015-06-01

    Scintillator detectors are used widely in the field of γ- and X-ray spectroscopy, particularly in the mid 1900s when the invention of NaI(Tl) by nobel laureate Robert Hofstadter in 1948, spurred the creation of new scintillator materials. In the development of such new scintillators, important characteristics such as its intrinsic efficiency, position sensitivity, robustness, energy and timing response, light output, etc, need to be addressed. To date, these requirements cannot be met by a single type of scintillator alone and therefore the development of an ''ideal'' scintillator remains the holy grail of nuclear instrumentation. Consequently, the last two decades have seen significant progress in the development of scintillator crystals, driven largely by technological advances. Conventional inorganic scintillators such as NaI(Tl) and BGO are now being replaced with better, novel organic, inorganic, ceramic and plastic scintillators offering a wider variety of options for many applications. The workshop on the Applications of Novel Scintillators in Research and Industry was held at University College Dublin in January 2015 and covered a wide range of topics that characterise modern advances in the field of scintillator technology. This set of proceedings covers areas including the growth, production and characterisation of such contemporary scintillators, along with their applications in various fields, such as; Medical Imaging; Defence/Security; Astrophysics; and Nuclear/Particle Physics. We would like to thank all those who presented their recent results on their research at the workshop. These proceedings atest to the excitement and interest in such a broad field, that pervades the pursuit of the development of novel materials for future applications. We would also like to thank Professor Luigi Piro, for giving an interesting public talk during the conference, and to the Institute of Physics Ireland Group for supporting the event. We thank ORTEC for

  5. Performance of a prototype active veto system using liquid scintillator for a dark matter search experiment

    Energy Technology Data Exchange (ETDEWEB)

    Park, J.S. [Center for Underground Physics, Institute for Basic Science (IBS), Daejeon 34047 (Korea, Republic of); Adhikari, P.; Adhikari, G.; Oh, S.Y. [Department of Physics, Sejong University, Seoul 05006 (Korea, Republic of); Kim, N.Y. [Center for Underground Physics, Institute for Basic Science (IBS), Daejeon 34047 (Korea, Republic of); Kim, Y.D. [Center for Underground Physics, Institute for Basic Science (IBS), Daejeon 34047 (Korea, Republic of); Department of Physics, Sejong University, Seoul 05006 (Korea, Republic of); Ha, C.; Park, K.S. [Center for Underground Physics, Institute for Basic Science (IBS), Daejeon 34047 (Korea, Republic of); Lee, H.S., E-mail: hyunsulee@ibs.re.kr [Center for Underground Physics, Institute for Basic Science (IBS), Daejeon 34047 (Korea, Republic of); Jeon, E.J. [Center for Underground Physics, Institute for Basic Science (IBS), Daejeon 34047 (Korea, Republic of)

    2017-04-11

    We report the performance of an active veto system using a liquid scintillator with NaI(Tl) crystals for use in a dark matter search experiment. When a NaI(Tl) crystal is immersed in the prototype detector, the detector tags 48% of the internal {sup 40}K background in the 0–10 keV energy region. We also determined the tagging efficiency for events at 6–20 keV as 26.5±1.7% of the total events, which corresponds to 0.76±0.04 events/keV/kg/day. According to a simulation, approximately 60% of the background events from U, Th, and K radioisotopes in photomultiplier tubes are tagged at energies of 0–10 keV. Full shielding with a 40-cm-thick liquid scintillator can increase the tagging efficiency for both the internal {sup 40}K and external background to approximately 80%.

  6. A feasibility study of ortho-positronium decays measurement with the J-PET scanner based on plastic scintillators

    International Nuclear Information System (INIS)

    Kaminska, D.; Gajos, A.; Czerwinski, E.; Alfs, D.; Bednarski, T.; Bialas, P.; Dulski, K.; Glowacz, B.; Gupta-Sharma, N.; Korcyl, G.; Krawczyk, N.; Kubicz, E.; Mohammed, M.; Niedzwiecki, Sz.; Pawlik-Niedzwiecka, M.; Rudy, Z.; Wieczorek, A.; Zielinski, M.; Moskal, P.; Curceanu, C.; Silarski, M.; Gorgol, M.; Jasinska, B.; Zgardzinska, B.; Hiesmayr, B.C.; Kowalski, P.; Raczynski, L.; Wislicki, W.; Krzemien, W.

    2016-01-01

    We present a study of the application of the Jagiellonian positron emission tomograph (J-PET) for the registration of gamma quanta from decays of ortho-positronium (o-Ps). The J-PET is the first positron emission tomography scanner based on organic scintillators in contrast to all current PET scanners based on inorganic crystals. Monte Carlo simulations show that the J-PET as an axially symmetric and high acceptance scanner can be used as a multi-purpose detector well suited to pursue research including e.g. tests of discrete symmetries in decays of ortho-positronium in addition to the medical imaging. The gamma quanta originating from o-Ps decay interact in the plastic scintillators predominantly via the Compton effect, making the direct measurement of their energy impossible. Nevertheless, it is shown in this paper that the J-PET scanner will enable studies of the o-Ps → 3γ decays with angular and energy resolution equal to σ(θ) ∼ 0.4 circle and σ(E) ∼ 4.1 keV, respectively. An order of magnitude shorter decay time of signals from plastic scintillators with respect to the inorganic crystals results not only in better timing properties crucial for the reduction of physical and instrumental background, but also suppresses significantly the pile-ups, thus enabling compensation of the lower efficiency of the plastic scintillators by performing measurements with higher positron source activities. (orig.)

  7. A feasibility study of ortho-positronium decays measurement with the J-PET scanner based on plastic scintillators

    Energy Technology Data Exchange (ETDEWEB)

    Kaminska, D.; Gajos, A.; Czerwinski, E.; Alfs, D.; Bednarski, T.; Bialas, P.; Dulski, K.; Glowacz, B.; Gupta-Sharma, N.; Korcyl, G.; Krawczyk, N.; Kubicz, E.; Mohammed, M.; Niedzwiecki, Sz.; Pawlik-Niedzwiecka, M.; Rudy, Z.; Wieczorek, A.; Zielinski, M.; Moskal, P. [Jagiellonian University, Faculty of Physics, Astronomy and Applied Computer Science, Krakow (Poland); Curceanu, C.; Silarski, M. [INFN, Laboratori Nazionali di Frascati, CP 13, Frascati (Italy); Gorgol, M.; Jasinska, B.; Zgardzinska, B. [Maria Curie-Sklodowska University, Department of Nuclear Methods, Institute of Physics, Lublin (Poland); Hiesmayr, B.C. [University of Vienna, Faculty of Physics, Vienna (Austria); Kowalski, P.; Raczynski, L.; Wislicki, W. [Swierk Computing Centre, National Centre for Nuclear Research, Otwock-Swierk (Poland); Krzemien, W. [National Centre for Nuclear Research, High Energy Department, Otwock-Swierk (Poland)

    2016-08-15

    We present a study of the application of the Jagiellonian positron emission tomograph (J-PET) for the registration of gamma quanta from decays of ortho-positronium (o-Ps). The J-PET is the first positron emission tomography scanner based on organic scintillators in contrast to all current PET scanners based on inorganic crystals. Monte Carlo simulations show that the J-PET as an axially symmetric and high acceptance scanner can be used as a multi-purpose detector well suited to pursue research including e.g. tests of discrete symmetries in decays of ortho-positronium in addition to the medical imaging. The gamma quanta originating from o-Ps decay interact in the plastic scintillators predominantly via the Compton effect, making the direct measurement of their energy impossible. Nevertheless, it is shown in this paper that the J-PET scanner will enable studies of the o-Ps → 3γ decays with angular and energy resolution equal to σ(θ) ∼ 0.4 {sup circle} and σ(E) ∼ 4.1 keV, respectively. An order of magnitude shorter decay time of signals from plastic scintillators with respect to the inorganic crystals results not only in better timing properties crucial for the reduction of physical and instrumental background, but also suppresses significantly the pile-ups, thus enabling compensation of the lower efficiency of the plastic scintillators by performing measurements with higher positron source activities. (orig.)

  8. Thermoluminescence and electron spin resonance studies of irradiated biological single crystals

    International Nuclear Information System (INIS)

    Cooke, D.W.

    1977-01-01

    Single crystals of x-irradiated L-alanine:Cr 3+ have been studied between 90 and 300K by electron spin resonance (ESR) and thermoluminescence (TL) techniques. Ultraviolet (uv) photobleaching of the Cr 3+ electron traps and L-alanine radical centers was also investigated. The results demonstrate that the x-ray generated radical centers can be destroyed by uv-induced electron transport activity, and this destruction follows first order kinetics. Also, the transformation of the primary neutral radical species to a secondary radical in L-alanine was found not to be induced by intermolecular electron transport. The TL glow was determined to proceed by first-order kinetics at a temperature of 160K with an activation energy of 0.3 eV and a frequency factor of 1.0 x 10 8 s -1 . The emission spectrum consisted of a broad band (FWHM approx. = 100 nm) which peaked at approximately 420 nm. Scintillation activity was observed in the ferroelectric crystals triglycine sulfate (TGS), deuterated TGS, and TGS: L-alanine. The emission spectrum of TGS:L-alanine was obtained. New observations of scintillations and current pulses from glycine, a nonferroelectric crystal, which result from heating or cooling the sample between 77 and 300K with no previous irradiation were made. The scintillations and current pulses occur approximately in coincidence. Scintillations were also observed from the potent oncogen 3-hydroxyxanthine by cooling the sample from 300 to 90K with no previous irradiation

  9. Synthesis of amide isosteres of schweinfurthin-based stilbenes.

    Science.gov (United States)

    Stockdale, David P; Beutler, John A; Wiemer, David F

    2017-10-15

    The schweinfurthins are plant-derived stilbenes with an intriguing profile of anti-cancer activity. To obtain analogues of the schweinfurthins that might preserve the biological activity but have greater water solubility, a formal replacement of the central olefin with an amide has been explored. Two pairs of amides have been prepared, each containing the same hexahydroxanthene "left half" joined through an amide linkage to two different "right halves." In each series, the amide has been inserted in both possible orientations, placing the carbonyl group on the tricyclic ABC ring system and the amine on the D-ring, or placing the amine on the hexahydroxanthene and the carbonyl group on the D-ring. The four new schweinfurthin analogues have been tested in the NCI 60 cell line screen, and in both cases the more active isomer carried the carbonyl group on the C-ring. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Preparative isolation and purification of three stilbene glycosides from the tibetan medicinal plant Rheum tanguticum maxim. Ex Balf. by high-speed counter-current chromatography.

    Science.gov (United States)

    Zhao, Xiao-Hui; Han, Fa; Li, Yu-Lin; Yue, Hui-Lan

    2013-02-01

    Stilbene glycosides are the primary constituents of Rheum tanguticum Maxim. ex Balf., to which different bioactivities has been attributed, including: anti-HIV, anti-oxidant, anti-tumour, anti-malarial, and anti-allergy activity. However, effective methods for the isolation and purification of stilbene glycosides, such as trans-rhapontin, cis-rhapontin and trans-desoxyrhaponticin, from this herb are not currently available. To develop an efficient method for the preparative isolation and purification of three stilbene glycosides from Rheum tanguticum Maxim. ex Balf. via high-speed counter-current chromatography (HSCCC). A solvent system composed of chloroform:n-butanol:methanol:water (4:1:3:2, v/v/v/v) was developed for the separation. The upper phase was used as the stationary phase, and the lower phase was used as the mobile phase. The flow rate was 1.8 mL/min. The apparatus was controlled at 800 rpm and 25 °C, and the effluent was monitored at 280 nm. Chemical constituents were analysed by high-performance liquid chromatography (HPLC), and their structures were identified by ¹H- and ¹³C-NMR. Under the optimised conditions, 25.5 mg trans-rhapontin, 16.0 mg cis-rhapontin and 20.5 mg trans-desoxyrhaponticin were separated from 80 mg crude sample; the isolates had purities of 99.6, 97.2 and 99.2%, respectively. A simple and efficient HSCCC method has been optimised for the preparative separation of stilbene glycosides from Rheum tanguticum Maxim. ex Balf. Copyright © 2012 John Wiley & Sons, Ltd.

  11. Can Transient Phenomena Help Improving Time Resolution in Scintillators?

    CERN Document Server

    Lecoq, P; Vasiliev, A

    2014-01-01

    The time resolution of a scintillator-based detector is directly driven by the density of photoelectrons generated in the photodetector at the detection threshold. At the scintillator level it is related to the intrinsic light yield, the pulse shape (rise time and decay time) and the light transport from the gamma-ray conversion point to the photodetector. When aiming at 10 ps time resolution, fluctuations in the thermalization and relaxation time of hot electrons and holes generated by the interaction of ionization radiation with the crystal become important. These processes last for up to a few tens of ps and are followed by a complex trapping-detrapping process, Poole-Frenkel effect, Auger ionization of traps and electron-hole recombination, which can last for a few ns with very large fluctuations. This paper will review the different processes at work and evaluate if some of the transient phenomena taking place during the fast thermalization phase can be exploited to extract a time tag with a precision in...

  12. Genome-wide analysis of the grapevine stilbene synthase multigenic family: genomic organization and expression profiles upon biotic and abiotic stresses

    Directory of Open Access Journals (Sweden)

    Vannozzi Alessandro

    2012-08-01

    Full Text Available Abstract Background Plant stilbenes are a small group of phenylpropanoids, which have been detected in at least 72 unrelated plant species and accumulate in response to biotic and abiotic stresses such as infection, wounding, UV-C exposure and treatment with chemicals. Stilbenes are formed via the phenylalanine/polymalonate-route, the last step of which is catalyzed by the enzyme stilbene synthase (STS, a type III polyketide synthase (PKS. Stilbene synthases are closely related to chalcone synthases (CHS, the key enzymes of the flavonoid pathway, as illustrated by the fact that both enzymes share the same substrates. To date, STSs have been cloned from peanut, pine, sorghum and grapevine, the only stilbene-producing fruiting-plant for which the entire genome has been sequenced. Apart from sorghum, STS genes appear to exist as a family of closely related genes in these other plant species. Results In this study a complete characterization of the STS multigenic family in grapevine has been performed, commencing with the identification, annotation and phylogenetic analysis of all members and integration of this information with a comprehensive set of gene expression analyses including healthy tissues at differential developmental stages and in leaves exposed to both biotic (downy mildew infection and abiotic (wounding and UV-C exposure stresses. At least thirty-three full length sequences encoding VvSTS genes were identified, which, based on predicted amino acid sequences, cluster in 3 principal groups designated A, B and C. The majority of VvSTS genes cluster in groups B and C and are located on chr16 whereas the few gene family members in group A are found on chr10. Microarray and mRNA-seq expression analyses revealed different patterns of transcript accumulation between the different groups of VvSTS family members and between VvSTSs and VvCHSs. Indeed, under certain conditions the transcriptional response of VvSTS and VvCHS genes appears to be

  13. Development of crystals based in cesium iodide for application as radiation detectors

    International Nuclear Information System (INIS)

    Pereira, Maria da Conceicao Costa

    2006-01-01

    Inorganic scintillators with fast luminescence decay time, high density and high light output have been the object of studies for application in nuclear physics, high energy physics, nuclear tomography and other fields of science and engineering. Scintillation crystals based on cesium iodide (CsI) are matters with relatively low higroscopy, high atomic number, easy handling and low cost, characteristics that favor their use as radiation detectors. In this work, the growth of pure CsI crystals, CsI:Br and CsI:Pb, using the Bridgman technique, is described. The concentration of the bromine doping element (Br) was studied in the range of 1,5x10 -1 M to 10 -2 M and the lead (Pb) in the range of 10 -2 M to 5x10 -4 M. To evaluate the scintillators developed, systematic measurements were carried out for luminescence emission and luminescence decay time for gamma radiation, optical transmittance assays, Vickers micro-hardness assays, determination of the doping elements distribution along the grown crystals and analysis of crystals response to the gamma radiation in the energy range of 350 keV to 1330 keV and alpha particles from a 241 Am source, with energy of 5.54 MeV. It was obtained 13 ns to 19 ns for luminescence decay time for CsI:Br and CsI:Pb crystals. These results were very promising. The results obtained for micro-hardness showed a significant increase in function of the doping elements concentration, when compared to the pure CsI crystal, increasing consequently the mechanical resistance of the grown crystals. The validity of using these crystals as radiation sensors may be seen from the results of their response to gamma radiation and alpha particles. (author)

  14. Detection of gamma-neutron radiation by solid-state scintillation detectors. Detection of gamma-neutron radiation by novel solid-state scintillation detectors

    Energy Technology Data Exchange (ETDEWEB)

    Ryzhikov, V.; Grinyov, B.; Piven, L.; Onyshchenko, G.; Sidletskiy, O. [Institute for Scintillation Materials of the NAS of Ukraine, Kharkov, (Ukraine); Naydenov, S. [Institute for Single Crystals of the National Academy of Sciences of Ukraine, Kharkov, (Ukraine); Pochet, T. [DETEC-Europe, Vannes (France); Smith, C. [Naval Postgraduate School, Monterey, CA (United States)

    2015-07-01

    It is known that solid-state scintillators can be used for detection of both gamma radiation and neutron flux. In the past, neutron detection efficiencies of such solid-state scintillators did not exceed 5-7%. At the same time it is known that the detection efficiency of the gamma-neutron radiation characteristic of nuclear fissionable materials is by an order of magnitude higher than the efficiency of detection of neutron fluxes alone. Thus, an important objective is the creation of detection systems that are both highly efficient in gamma-neutron detection and also capable of exhibiting high gamma suppression for use in the role of detection of neutron radiation. In this work, we present the results of our experimental and theoretical studies on the detection efficiency of fast neutrons from a {sup 239}Pu-Be source by the heavy oxide scintillators BGO, GSO, CWO and ZWO, as well as ZnSe(Te, O). The most probable mechanism of fast neutron interaction with nuclei of heavy oxide scintillators is the inelastic scattering (n, n'γ) reaction. In our work, fast neutron detection efficiencies were determined by the method of internal counting of gamma-quanta that emerge in the scintillator from (n, n''γ) reactions on scintillator nuclei with the resulting gamma energies of ∼20-300 keV. The measured efficiency of neutron detection for the scintillation crystals we considered was ∼40-50 %. The present work included a detailed analysis of detection efficiency as a function of detector and area of the working surface, as well as a search for new ways to create larger-sized detectors of lower cost. As a result of our studies, we have found an unusual dependence of fast neutron detection efficiency upon thickness of the oxide scintillators. An explanation for this anomaly may involve the competition of two factors that accompany inelastic scattering on the heavy atomic nuclei. The transformation of the energy spectrum of neutrons involved in the (n, n

  15. Scintillating properties of frozen new liquid scintillators

    CERN Document Server

    Britvich, G I; Golovkin, S V; Martellotti, G; Medvedkov, A M; Penso, G; Soloviev, A S; Vasilchenko, V G

    1999-01-01

    The light emission from scintillators which are liquid at room temperature was studied in the interval between $+20$~$^{\\circ}$C and $-120$~$^{\\circ}$C, where the phase transition from liquid to solid takes place. The light yield measured at $-120$~$^{\\circ}$C is about twice as much as that observed at $+20$~$^{\\circ}$C. By cooling the scintillator from $+20$~$^{\\circ}$C to $-120$~$^{\\circ}$C and then heating it from $-120$~$^{\\circ}$C to $+20$~$^{\\circ}$C, the light yield varies in steps at well defined temperatures, which are different for the cooling and heating processes. These hysteresis phenomena appear to be related to the solvent rather than to the dopant. The decay time of scintillation light was measured at $+20$~$^{\\circ}$C and $-120$~$^{\\circ}$C. Whilst at room temperature most of the light is emitted with a decay time of 6--8 ns, at $-120$~$^{\\circ}$C a slower component, with a decay time of 25--35 ns, becomes important.

  16. Scintillator manufacture at Fermilab

    Energy Technology Data Exchange (ETDEWEB)

    Mellott, K.; Bross, A.; Pla-Dalmau, A.

    1998-08-01

    A decade of research into plastic scintillation materials at Fermilab is reviewed. Early work with plastic optical fiber fabrication is revisited and recent experiments with large-scale commercial methods for production of bulk scintillator are discussed. Costs for various forms of scintillator are examined and new development goals including cost reduction methods and quality improvement techniques are suggested.

  17. Response function study of a scintillator detector of NaI(Tl); Estudo da funcao resposta de um detector cintilador de NaI(Tl)

    Energy Technology Data Exchange (ETDEWEB)

    Villa, Marcelo Barros; Costa, Alessandro Martins da, E-mail: amcosta@usp.br [Universidade de Sao Paulo (FFCLRP/USP), Ribeirao Preto, SP (Brazil). Faculdade de Filosofia, Ciencias e Letras. Dept. de Fisica

    2014-07-01

    In measurements of gamma rays with Nai (Tl) scintillator, the detectors output data are pulse height spectra, that corresponding to distorted information about the radiation source due to various errors associated with the crystal scintillation process and electronics associated, instead of power spectra photons. Pulse height spectra are related to the real power spectra by means of scintillator detector response function NaI (Tl). In this work, the response function for a cylindrical crystal of Nal (Tl) of 7,62 x 7,62 cm (diameter x length) was studied, by Monte Carlo method, using the EGSnrc tool to model the transport of radiation, combined with experimental measurements. An inverse response matrix, even with the energy of the square root, which transforms the pulse height spectrum of photon energy spectrum was obtained. The results of this transformation of pulse height spectrum for photon energy spectrum is presented, showing that the methodology employed in this study is suitable.

  18. Basic performance of Mg co-doped new scintillator used for TOF-DOI-PET systems

    International Nuclear Information System (INIS)

    Kobayashi, Takahiro; Yamamoto, Seiichi; Okumura, Satoshi; Yeom, Jung Yeol; Kamada, Kei; Yoshikawa, Akira

    2017-01-01

    Phoswich depth-of-interaction (DOI) detectors utilizing multiple scintillators with different decay time are a useful device for developing a high spatial resolution, high sensitivity PET scanner. However, in order to apply pulse shape discrimination (PSD), there are not many combinations of scintillators for which phoswich technique can be implemented. Ce doped Gd_3Ga_3Al_2O_1_2 (GFAG) is a recently developed scintillator with a fast decay time. This scintillator is similar to Ce doped Gd_3Al_2Ga_3O_1_2 (GAGG), which is a promising scintillator for PET detector with high light yield. By stacking these scintillators, it may be possible to realize a high spatial resolution and high timing resolution phoswich DOI detector. Such phoswich DOI detector may be applied to time-of-flight (TOF) systems with high timing performance. Therefore, in this study, we tested the basic performance of the new scintillator –GFAG for use in a TOF phoswich detector. The measured decay time of a GFAG element of 2.9 mmx2.9 mmx10 mm in dimension, which was optically coupled to a photomultiplier tube (PMT), was faster (66 ns) than that of same sized GAGG (103 ns). The energy resolution of the GFAG element was 5.7% FWHM which was slightly worse than that of GAGG with 4.9% FWHM for 662 keV gamma photons without saturation correction. Then we assembled the GFAG and the GAGG crystals in the depth direction to form a 20 mm long phoswich element (GFAG/GAGG). By pulse shape analysis, the two types of scintillators were clearly resolved. Measured timing resolution of a pair of opposing GFAG/GAGG phoswich scintillator coupled to Silicon Photomultipliers (Si-PM) was good with coincidence resolving time of 466 ps FWHM. These results indicate that the GFAG combined with GAGG can be a candidate for TOF-DOI-PET systems.

  19. High-Z Nanoparticle/Polymer Nanocomposites for Gamma-Ray Scintillation Detectors

    Science.gov (United States)

    Liu, Chao

    An affordable and reliable solution for spectroscopic gamma-ray detection has long been sought after due to the needs from research, defense, and medical applications. Scintillators resolve gamma energy by proportionally converting a single high-energy photon into a number of photomultiplier-tube-detectable low-energy photons, which is considered a more affordable solution for general purposes compared to the delicate semiconductor detectors. An ideal scintillator should simultaneously exhibit the following characteristics: 1) high atomic number (Z) for high gamma stopping power and photoelectron production; 2) high light yield since the energy resolution is inversely proportional to the square root of light yield; 3) short emission decay lifetime; and 4) low cost and scalable production. However, commercial scintillators made from either inorganic single crystals or plastics fail to satisfy all requirements due to their intrinsic material properties and fabrication limitations. The concept of adding high-Z constituents into plastic scintillators to harness high Z, low cost, and fast emission in the resulting nanocomposite scintillators is not new in and of itself. Attempts have been made by adding organometallics, quantum dots, and scintillation nanocrystals into the plastic matrix. High-Z organometallics have long been used to improve the Z of plastic scintillators; however, their strong spin-orbit coupling effect entails careful triplet energy matching using expensive triplet emitters to avoid severe quenching of the light yield. On the other hand, reported quantum dot- and nanocrystal-polymer nanocomposites suffer from moderate Z and high optical loss due to aggregation and self-absorption at loadings higher than 10 wt%, limiting their potential for practical application. This dissertation strives to improve the performance of nanoparticle-based nanocomposite scintillators. One focus is to synthesize transparent nanocomposites with higher loadings of high

  20. Extruding plastic scintillator at Fermilab

    International Nuclear Information System (INIS)

    Pla-Dalmau, Anna; Bross, Alain D.; Rykalin, Viktor V.

    2003-01-01

    An understanding of the costs involved in the production of plastic scintillators and the development of a less expensive material have become necessary with the prospects of building very large plastic scintillation detectors. Several factors contribute to the high cost of plastic scintillating sheets, but the principal reason is the labor-intensive nature of the manufacturing process. In order to significantly lower the costs, the current casting procedures had to be abandoned. Since polystyrene is widely used in the consumer industry, the logical path was to investigate the extrusion of commercial-grade polystyrene pellets with dopants to yield high quality plastic scintillator. This concept was tested and high quality extruded plastic scintillator was produced. The D0 and MINOS experiments are already using extruded scintillator strips in their detectors. An extrusion line has recently been installed at Fermilab in collaboration with NICADD (Northern Illinois Center for Accelerator and Detector Development). This new facility will serve to further develop and improve extruded plastic scintillator. This paper will discuss the characteristics of extruded plastic scintillator and its raw materials, the different manufacturing techniques and the current R andD program at Fermilab

  1. Scintillation counting apparatus

    International Nuclear Information System (INIS)

    Noakes, J.E.

    1978-01-01

    Apparatus is described for the accurate measurement of radiation by means of scintillation counters and in particular for the liquid scintillation counting of both soft beta radiation and gamma radiation. Full constructional and operating details are given. (UK)

  2. Mapping residual stresses in PbWO4 crystals using photo-elastic analysis

    International Nuclear Information System (INIS)

    Lebeau, M.; Gobbi, L.; Majni, G.; Paone, N.; Pietroni, P.; Rinaldi, D.

    2005-01-01

    Large scintillating crystals are affected by internal stresses induced by the crystal growth temperature gradient remanence. Cutting boules (ingots) into finished crystal shapes allows for a partial tension relaxation but residual stresses remain the main cause of breaking. Quality control of residual stresses is essential in the application of Scintillating Crystals to high-energy physics calorimeters (e.g. CMS ECAL at CERN LHC). In this context the industrial process optimisation towards stress reduction is mandatory. We propose a fast technique for testing samples during the production process in order to evaluate the residual stress distribution after the first phases of mechanical processing. We mapped the stress distribution in PbWO 4 slabs cut from the same production boule. The analysis technique is based on the stress intensity determination using the photo-elastic properties of the samples. The stress distribution is mapped in each sample. The analysis shows that there are regions of high residual tension close to the seed position and at the boule periphery. These results should allow for adapting the industrial process to producing crystals with lower residual stresses

  3. Treatment of alcaline metals halides for developing crystals

    International Nuclear Information System (INIS)

    Spurney, R.W.

    1974-01-01

    A process is described whereby crystals of an alkaline metal halide may be dried and placed in a crucible for development by the Bridgeman-Stockbarger method. Purified alkaline halides from a suspension are dried and formed into dense cakes of transverse section slightly smaller than that of the crucible, where they are packed, melted and grown into crystals according to the Bridgeman-Stockbarger technique. This method applies to the preparation of alkaline halide crystals, particularly sodium iodide for optical elements or scintillation counters [fr

  4. Digital pulse shape discrimination between fast neutrons and gamma rays with para-terphenyl scintillator

    Science.gov (United States)

    Chepurnov, A. S.; Kirsanov, M. A.; Klenin, A. A.; Klimanov, S. G.; Kubankin, A. S.

    2017-12-01

    In the presented work, we investigated several digital methods of a discrimination signals from fast neutrons and gamma quanta. The experimental setup consists of a Pu-Be neutron source, a scintillation detector with an organic para-terphenyl monocrystal, and a digitizer (CAEN DT5730, 500 MS/s). Mixed waveform sequences were stored and then separated by pulse shape. Four methods were used for signals separation. Comparison of the traditional and the new methods of Figure of Merit (FOM) calculation is given. FOM = 1.5 was obtained in our setup for the minimum threshold value. A scintillation detector with a para-terphenyl crystal was used to measure neutron yield in the neutron generator with carbon nanotubes.

  5. Effects of Zr4+ codoping on the Lu0.8Sc0.2BO3:Ce scintillation materials

    International Nuclear Information System (INIS)

    Wu, Yuntao; Ren, Guohao; Ding, Dongzhou; Shang, Shanshan; Sun, Dandan; Zhang, Guoqing; Wang, Jiayu; Pan, Shangke; Yang, Fan

    2013-01-01

    Both Zr-codoped Lu 0.8 Sc 0.2 BO 3 :Ce polycrystalline powders and single crystals were obtained by solid-state reaction and Czochralski method, respectively. The effects of Zr codoping on the optical absorption, Ce 3+ /Ce 4+ ratio, scintillation efficiency, decay time and point defect in Lu 0.8 Sc 0.2 BO 3 :Ce materials were examined systematically. Our results show that there is no positive contribution of Zr 4+ ion codoping to the scintillation efficiency. And the reasons for the deterioration of scintillation efficiency by codoping Zr 4+ were revealed. - Highlights: ► No positive contribution of the Zr 4+ ions on the scintillation efficiency was found. ► New optical absorption band was in the region from 200 to 225 nm. ► Continuously accelerated decay time indicated that Zr 4+ codoping induced new point defects. ► The induced hole trap located at 1.91 eV below the conduction band.

  6. Liquid scintillation measurement. I

    International Nuclear Information System (INIS)

    Rexa, R.; Tykva, R.

    1983-01-01

    The individual components of scintillation solutions and their tasks are listed. Explained briefly is the scintillation process in a liquid scintillator. Factors are discussed which influence this process as are methods applied to supress their influence. They include: ionization quenching, quenching by dilution and concentration, chemical, colour, phase and photon quenching and single-photon events causing an undesirable backgorund. (M.D.)

  7. Development of {sup 100}Mo-containing scintillating bolometers for a high-sensitivity neutrinoless double-beta decay search

    Energy Technology Data Exchange (ETDEWEB)

    Armengaud, E.; Gros, M.; Herve, S.; Magnier, P.; Navick, X.F.; Nones, C.; Paul, B.; Penichot, Y.; Zolotarova, A.S. [Universite Paris-Saclay, IRFU, CEA, Gif-sur-Yvette (France); Augier, C.; Billard, J.; Cazes, A.; Charlieux, F.; Jesus, M. de; Gascon, J.; Juillard, A.; Queguiner, E.; Sanglard, V.; Vagneron, L. [Univ Lyon, Universite Lyon 1, CNRS/IN2P3, IPN-Lyon, Villeurbanne (France); Barabash, A.S.; Konovalov, S.I.; Umatov, V.I. [National Research Centre Kurchatov Institute, Institute of Theoretical and Experimental Physics, Moscow (Russian Federation); Beeman, J.W. [Lawrence Berkeley National Laboratory, Berkeley, CA (United States); Bekker, T.B. [V.S. Sobolev Institute of Geology and Mineralogy of the Siberian Branch of the RAS, Novosibirsk (Russian Federation); Bellini, F.; Ferroni, F. [Sapienza Universita di Roma, Dipartimento di Fisica, Rome (Italy); INFN, Sezione di Roma, Rome (Italy); Benoit, A.; Camus, P. [CNRS-Neel, Grenoble (France); Berge, L.; Chapellier, M.; Dumoulin, L.; Humbert, V.; Le Sueur, H.; Marcillac, P. de; Marnieros, S.; Marrache-Kikuchi, C.; Novati, V.; Olivieri, E.; Plantevin, O. [CSNSM, Univ. Paris-Sud, CNRS/IN2P3, Universite Paris-Saclay, Orsay (France); Bergmann, T.; Kleifges, M.; Tcherniakhovski, D.; Weber, M. [Karlsruhe Institute of Technology, Institut fuer Prozessdatenverarbeitung und Elektronik, Karlsruhe (Germany); Boiko, R.S.; Danevich, F.A.; Kobychev, V.V.; Nikolaichuk, M.O.; Tretyak, V.I. [Institute for Nuclear Research, Kyiv (Ukraine); Broniatowski, A. [CSNSM, Univ. Paris-Sud, CNRS/IN2P3, Universite Paris-Saclay, Orsay (France); Karlsruhe Institute of Technology, Institut fuer Experimentelle Teilchenphysik, Karlsruhe (Germany); Brudanin, V.; Rozov, S.; Yakushev, E. [JINR, Laboratory of Nuclear Problems, Dubna, Moscow Region (Russian Federation); Capelli, S.; Gironi, L.; Pavan, M.; Pessina, G. [Universita di Milano Bicocca, Dipartimento di Fisica, Milan (Italy); INFN, Sezione di Milano Bicocca, Milan (Italy); Cardani, L.; Casali, N.; Dafinei, I.; Tomei, C.; Vignati, M. [INFN, Sezione di Roma, Rome (Italy); Chernyak, D.M. [Institute for Nuclear Research, Kyiv (Ukraine); The University of Tokyo, Kavli Institute for the Physics and Mathematics of the Universe (WPI), The University of Tokyo Institutes for Advanced Study, Kashiwa, Chiba (Japan); Combarieu, M. de; Pari, P. [Universite Paris-Saclay, IRAMIS, CEA, Gif-sur-Yvette (France); Coron, N.; Redon, T. [Universite Paris-Sud, IAS, CNRS, Orsay (France); Devoyon, L.; Koskas, F.; Strazzer, O. [Universite Paris-Saclay, Orphee, CEA, Gif-sur-Yvette (France); Di Domizio, S. [Universita di Genova, Dipartimento di Fisica, Genoa (Italy); INFN Sezione di Genova, Genoa (Italy); Eitel, K.; Siebenborn, B. [Karlsruhe Institute of Technology, Institut fuer Kernphysik, Karlsruhe (Germany); Enss, C.; Fleischmann, A.; Gastaldo, L. [Heidelberg University, Kirchhoff Institute for Physics, Heidelberg (Germany); Foerster, N.; Kozlov, V. [Karlsruhe Institute of Technology, Institut fuer Experimentelle Teilchenphysik, Karlsruhe (Germany); Giuliani, A. [CSNSM, Univ. Paris-Sud, CNRS/IN2P3, Universite Paris-Saclay, Orsay (France); Universita dell' Insubria, DISAT, Como (Italy); Grigorieva, V.D.; Ivannikova, N.V.; Ivanov, I.M.; Makarov, E.P.; Shlegel, V.N.; Vasiliev, Ya.V. [Nikolaev Institute of Inorganic Chemistry, Novosibirsk (Russian Federation); Hehn, L. [Lawrence Berkeley National Laboratory, Berkeley, CA (United States); Karlsruhe Institute of Technology, Institut fuer Kernphysik, Karlsruhe (Germany); Jin, Y. [Laboratoire de Photonique et de Nanostructures, CNRS, Marcoussis (France); Kraus, H. [University of Oxford, Department of Physics, Oxford (United Kingdom); Kudryavtsev, V.A. [University of Sheffield, Department of Physics and Astronomy, Sheffield (United Kingdom); Laubenstein, M.; Nagorny, S.; Pattavina, L.; Pirro, S. [INFN, Laboratori Nazionali del Gran Sasso, Assergi, AQ (Italy); Loidl, M.; Rodrigues, M. [CEA-Saclay, CEA, LIST, Laboratoire National Henri Becquerel (LNE-LNHB), Gif-sur-Yvette Cedex (France); Mancuso, M. [CSNSM, Univ. Paris-Sud, CNRS/IN2P3, Universite Paris-Saclay, Orsay (France); Universita dell' Insubria, DISAT, Como (Italy); Max-Planck-Institut fuer Physik, Munich (Germany); Pagnanini, L.; Schaeffner, K. [INFN, Laboratori Nazionali del Gran Sasso, Assergi, AQ (Italy); INFN, Gran Sasso Science Institute, L' Aquila (Italy); Piperno, G. [INFN, Laboratori Nazionali di Frascati, Rome (Italy); Poda, D.V. [CSNSM, Univ. Paris-Sud, CNRS/IN2P3, Universite Paris-Saclay, Orsay (France); Institute for Nuclear Research, Kyiv (Ukraine); Rusconi, C. [INFN, Laboratori Nazionali del Gran Sasso, Assergi, AQ (Italy); University of South Carolina, Department of Physics and Astronomy, Columbia, SC (United States); Scorza, S. [Karlsruhe Institute of Technology, Institut fuer Experimentelle Teilchenphysik, Karlsruhe (Germany); SNOLAB, Lively, ON (Canada); Velazquez, M. [Universite de Bordeaux, ICMCB, CNRS, Pessac (France)

    2017-11-15

    This paper reports on the development of a technology involving {sup 100}Mo-enriched scintillating bolometers, compatible with the goals of CUPID, a proposed next-generation bolometric experiment to search for neutrinoless double-beta decay. Large mass (∝ 1 kg), high optical quality, radiopure {sup 100}Mo-containing zinc and lithium molybdate crystals have been produced and used to develop high performance single detector modules based on 0.2-0.4 kg scintillating bolometers. In particular, the energy resolution of the lithium molybdate detectors near the Q-value of the double-beta transition of {sup 100}Mo (3034 keV) is 4-6 keV FWHM. The rejection of the α-induced dominant background above 2.6 MeV is better than 8σ. Less than 10 μBq/kg activity of {sup 232}Th({sup 228}Th) and {sup 226}Ra in the crystals is ensured by boule recrystallization. The potential of {sup 100}Mo-enriched scintillating bolometers to perform high sensitivity double-beta decay searches has been demonstrated with only 10 kg x d exposure: the two neutrino double-beta decay half-life of {sup 100}Mo has been measured with the up-to-date highest accuracy as T{sub 1/2} = [6.90 ± 0.15(stat.) ± 0.37(syst.)] x 10{sup 18} years. Both crystallization and detector technologies favor lithium molybdate, which has been selected for the ongoing construction of the CUPID-0/Mo demonstrator, containing several kg of {sup 100}Mo. (orig.)

  8. Cherenkov and scintillation light separation in organic liquid scintillators

    Energy Technology Data Exchange (ETDEWEB)

    Caravaca, J.; Descamps, F.B.; Land, B.J.; Orebi Gann, G.D. [University of California, Berkeley, CA (United States); Lawrence Berkeley National Laboratory, Berkeley, CA (United States); Yeh, M. [Brookhaven National Laboratory, Upton, NY (United States)

    2017-12-15

    The CHErenkov/Scintillation Separation experiment (CHESS) has been used to demonstrate the separation of Cherenkov and scintillation light in both linear alkylbenzene (LAB) and LAB with 2 g/L of PPO as a fluor (LAB/PPO). This is the first successful demonstration of Cherenkov light detection from the more challenging LAB/PPO cocktail and improves on previous results for LAB. A time resolution of 338 ± 12 ps FWHM results in an efficiency for identifying Cherenkov photons in LAB/PPO of 70 ± 3% and 63 ± 8% for time- and charge-based separation, respectively, with scintillation contamination of 36 ± 5% and 38 ± 4. LAB/PPO data is consistent with a rise time of τ{sub r} = 0.72 ± 0.33 ns. (orig.)

  9. Cherenkov and scintillation light separation in organic liquid scintillators

    International Nuclear Information System (INIS)

    Caravaca, J.; Descamps, F.B.; Land, B.J.; Orebi Gann, G.D.; Yeh, M.

    2017-01-01

    The CHErenkov/Scintillation Separation experiment (CHESS) has been used to demonstrate the separation of Cherenkov and scintillation light in both linear alkylbenzene (LAB) and LAB with 2 g/L of PPO as a fluor (LAB/PPO). This is the first successful demonstration of Cherenkov light detection from the more challenging LAB/PPO cocktail and improves on previous results for LAB. A time resolution of 338 ± 12 ps FWHM results in an efficiency for identifying Cherenkov photons in LAB/PPO of 70 ± 3% and 63 ± 8% for time- and charge-based separation, respectively, with scintillation contamination of 36 ± 5% and 38 ± 4. LAB/PPO data is consistent with a rise time of τ r = 0.72 ± 0.33 ns. (orig.)

  10. Evaluation of undoped ZnS single crystal materials for x-ray imaging applications

    Science.gov (United States)

    Saleh, Muad; Lynn, Kelvin G.; McCloy, John S.

    2017-05-01

    ZnS-based materials have a long history of use as x-ray luminescent materials. ZnS was one of the first discovered scintillators and is reported to have one of the highest scintillator efficiencies. The use of ZnS for high energy luminescence has been thus far limited to thin powder screens, such as ZnS:Ag which is used for detecting alpha radiation, due to opacity to its scintillation light, primarily due to scattering. ZnS in bulk form (chemical vapor deposited, powder processed, and single crystal) has high transmission and low scattering compared to powder screens. In this paper, the performance of single crystalline ZnS is evaluated for low energy x-ray (PLE) of several undoped ZnS single crystals is compared to their Radioluminescence (RL) spectra. It was found that the ZnS emission wavelength varies on the excitation source energy.

  11. The chemistry of two-component fluoride crystalline optical media for heavy, fast, radiation hard scintillators

    International Nuclear Information System (INIS)

    Sobolev, B.P.; Krivandina, E.A.; Fedorov, P.P.; Vasilchenko, V.G.

    1994-01-01

    Prospects for preparation of two-component dense optical materials for scintillators are shown, using data on phase diagrams of about 300 MF m - RF n (m, n ≤ 4) type systems, formed by metal fluorides. Primary characteristics (decay time and light output of luminescence, radiation hardness, etc.) of some multicomponent crystals are reported

  12. Progress on photonic crystals

    CERN Document Server

    Lecoq, P; Gundacker, S; Hillemanns, H; Jarron, P; Knapitsch, A; Leclercq, J L; Letartre, X; Meyer, T; Pauwels, K; Powolny, F; Seassal, C

    2010-01-01

    The renewal of interest for Time of Flight Positron Emission Tomography (TOF PET) has highlighted the need for increasing the light output of scintillating crystals and in particular for improving the light extraction from materials with a high index of refraction. One possible solution to overcome the problem of total internal reflection and light losses resulting from multiple bouncing within the crystal is to improve the light extraction efficiency at the crystal/photodetector interface by means of photonic crystals, i.e. media with a periodic modulation of the dielectric constant at the wavelength scale. After a short reminder of the underlying principles this contribution proposes to present the very encouraging results we have recently obtained on LYSO pixels and the perspectives on other crystals such as BGO, LuYAP and LuAG. These results confirm the impressive predictions from our previously published Monte Carlo simulations. A detailed description of the sample preparation procedure is given as well ...

  13. Tuning Stilbene Photochemistry by Fluorination: State Reordering Leads to Sudden Polarization near the Franck-Condon Region.

    Science.gov (United States)

    Ioffe, Ilya N; Quick, Martin; Quick, Michael T; Dobryakov, Alexander L; Richter, Celin; Granovsky, Alex A; Berndt, Falko; Mahrwald, Rainer; Ernsting, Nikolaus P; Kovalenko, Sergey A

    2017-10-25

    Spontaneous polarization of a nonpolar molecule upon photoexcitation (the sudden polarization effect) earlier discussed for 90°-twisted alkenes is observed and calculated for planar ring-fluorinated stilbenes, trans-2,3,5,6,2',3',5',6'-octofluorostilbene (tF2356) and trans-2,3,4,5,6,2',3',4',5',6'-decafluorostilbene (tF23456). Due to the fluorination, Franck-Condon states S 1 FC and S 2 FC are dominated by the quasi-degenerate HOMO-1 → LUMO and HOMO-2 → LUMO excitations, while their interaction gives rise to a symmetry-broken zwitterionic S 1 state. After optical excitation of tF2356, one observes an ultrafast (∼0.06 ps) evolution that reflects relaxation from initial nonpolar S 3 FC to long-lived (1.3 ns in n-hexane and 3.4 ns in acetonitrile) polar S 1 . The polarity of S 1 is evidenced by a solvatochromic shift of its fluorescence band. The experimental results provide a sensitive test for quantum-chemical calculations. In particular, our calculations agree with the experiment, and raise concerns about the applicability of the common TDDFT approach to relatively simple stilbenic systems.

  14. The energy spectrum of neutrons from 7Li(d,n)8Be reaction at deuteron energy 2.9 MeV

    Science.gov (United States)

    Mitrofanov, Konstantin V.; Piksaikin, Vladimir M.; Zolotarev, Konstantin I.; Egorov, Andrey S.; Gremyachkin, Dmitrii E.

    2017-09-01

    The neutron beams generated at the electrostatic accelerators using nuclear reactions T(p,n)3He, D(d,n)3He, 7Li(p,n)7Be, T(d,n)4He, 7Li(d,n)8Be, 9Be(d,n)10B are widely used in neutron physics and in many practical applications. Among these reactions the least studied reactions are 7Li(d,n)8Be and 9Be(d,n)10B. The present work is devoted to the measurement of the neutron spectrum from 7Li(d,n)8Be reaction at 0∘ angle to the deuteron beam axis on the electrostatic accelerator Tandetron (JSC "SSC RF - IPPE") using activation method and a stilbene crystal scintillation detector. The first time ever 7Li(d,n)8Be reaction was measured by activation method. The target was a thick lithium layer on metallic backing. The energy of the incident deuteron was 2.9 MeV. As activation detectors a wide range of nuclear reactions were used: 27Al(n,p)27Mg, 27Al(n,α)24Na, 113In(n,n')113mIn, 115In(n,n')115mIn, 115In(n,γ)116mIn, 58Ni(n,p)58mCo, 58Ni(n,2n)57Ni, 197Au(n,γ)198Au, 197Au(n,2n)196Au, 59Co(n,p)59Fe, 59Co(n,2n)58m+gCo, 59Co (n,g)60Co. Measurement of the induced gamma-activity was carried out using HPGe detector Canberra GX5019 [1]. The up-to-date evaluations of the cross sections for these reactions were used in processing of the data. The program STAYSL was used to unfold the energy spectra. The neutron spectra obtained by activation detectors is consistent with the corresponding data measured by a stilbene crystal scintillation detector within their uncertainties.

  15. The energy spectrum of neutrons from 7Li(d,n8Be reaction at deuteron energy 2.9 MeV

    Directory of Open Access Journals (Sweden)

    Mitrofanov Konstantin V.

    2017-01-01

    Full Text Available The neutron beams generated at the electrostatic accelerators using nuclear reactions T(p,n3He, D(d,n3He, 7Li(p,n7Be, T(d,n4He, 7Li(d,n8Be, 9Be(d,n10B are widely used in neutron physics and in many practical applications. Among these reactions the least studied reactions are 7Li(d,n8Be and 9Be(d,n10B. The present work is devoted to the measurement of the neutron spectrum from 7Li(d,n8Be reaction at 0∘ angle to the deuteron beam axis on the electrostatic accelerator Tandetron (JSC “SSC RF – IPPE” using activation method and a stilbene crystal scintillation detector. The first time ever 7Li(d,n8Be reaction was measured by activation method. The target was a thick lithium layer on metallic backing. The energy of the incident deuteron was 2.9 MeV. As activation detectors a wide range of nuclear reactions were used: 27Al(n,p27Mg, 27Al(n,α24Na, 113In(n,n'113mIn, 115In(n,n'115mIn, 115In(n,γ116mIn, 58Ni(n,p58mCo, 58Ni(n,2n57Ni, 197Au(n,γ198Au, 197Au(n,2n196Au, 59Co(n,p59Fe, 59Co(n,2n58m+gCo, 59Co (n,g60Co. Measurement of the induced gamma-activity was carried out using HPGe detector Canberra GX5019 [1]. The up-to-date evaluations of the cross sections for these reactions were used in processing of the data. The program STAYSL was used to unfold the energy spectra. The neutron spectra obtained by activation detectors is consistent with the corresponding data measured by a stilbene crystal scintillation detector within their uncertainties.

  16. WORKSHOP: Scintillating fibre detectors

    International Nuclear Information System (INIS)

    Anon.

    1989-01-01

    Scintillating fibre detector development and technology for the proposed US Superconducting Supercollider, SSC, was the subject of a recent workshop at Fermilab, with participation from the high energy physics community and from industry. Sessions covered the current status of fibre technology and fibre detectors, new detector applications, fluorescent materials and scintillation compositions, radiation damage effects, amplification and imaging structures, and scintillation fibre fabrication techniques

  17. Studies of scintillation properties of CaMoO{sub 4} at millikelvin temperatures

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, X.; Lin, J.; Kraus, H. [Department of Physics, University of Oxford, Keble Rd., Oxford OX1 3RH (United Kingdom); Mikhailik, V. B., E-mail: vmikhai@hotmail.com [Diamond Light Source, Harwell Science Campus, Didcot OX11 0DE (United Kingdom)

    2015-06-15

    Application of CaMoO{sub 4} as a scintillation target in cryogenic rare event searches relies on the understanding of scintillation properties of the material at the temperatures at which these detectors operate. We devised and implemented a detection module with a low-temperature photomultiplier from Hamamatsu (model R8520-06) powered by a Cockcroft-Walton generator. The detector module containing the CaMoO{sub 4} crystal was placed in a {sup 3}He/{sup 4}He dilution refrigerator and used to measure scintillation characteristics of CaMoO{sub 4} in the millikelvin temperature range. At the lowest temperature achieved, the energy resolution of CaMoO{sub 4} for 122 keV γ from a {sup 57}Co source is found to be 30%, and the fast and slow decay constants are 40.6 ± 0.8 μs and 3410 ± 50 μs, respectively. The temperature variation of the CaMoO{sub 4} decay kinetics is discussed in terms of a three-level model of the emission center.

  18. Effect of clone selection, nitrogen supply, leaf damage and mycorrhizal fungi on stilbene and emodin production in knotweed

    Czech Academy of Sciences Publication Activity Database

    Kovářová, Marcela; Frantík, Tomáš; Koblihová, Helena; Bartůňková, Kristýna; Nývltová, Z.; Vosátka, Miroslav

    2011-01-01

    Roč. 11, č. 98 (2011), s. 1-14 ISSN 1471-2229 R&D Projects: GA MPO FT-TA3/008; GA MŠk 1M0571 Institutional research plan: CEZ:AV0Z60050516 Keywords : knotweed * stilbenes * leaf damage Subject RIV: EF - Botanics Impact factor: 3.447, year: 2011

  19. Electron traps and scintillation mechanism in YAlO3:Ce and LuAlO3:Ce scintillators

    International Nuclear Information System (INIS)

    Wojtowicz, A.J.; Glodo, J.; Drozdowski, W.; Przegietka, K.R.

    1998-01-01

    In this paper we present the results of thermoluminescence, isothermal decay and scintillation light yield measurements on two isostructural scintillator materials, YAlO 3 :Ce and LuAlO 3 :Ce. In addition to the variety of deep traps identified by thermoluminescence and isothermal decays, scintillation light yield experiments demonstrate the presence in both materials of a number of relatively shallow traps. While the deep traps may reduce the scintillation light yield, they do not influence the kinetics of the process. The shallow traps, on the other hand, by interfering with the process of radiative recombination of charge carriers via Ce 3+ ions, can strongly affect not only the yield of the scintillation process but its kinetics as well. The presence of shallow traps provides a consistent explanation for a number of poorly understood relationships between the two scintillator materials, including a higher room temperature scintillation light yield and longer scintillation decay time in YAlO 3 :Ce, and a longer scintillation rise time in LuAlO 3 :Ce. Theoretical analysis indicates that elimination of these traps would make the two materials nearly identical in scintillator performance. Although the specific identity of all traps remains elusive, the performance of both scintillator materials is now, in practical terms, fully understood. (Copyright (c) 1998 Elsevier Science B.V., Amsterdam. All rights reserved.)

  20. A radioimmunoassay for the detection of diethylstilboestrol and related stilbenes in biological fluids

    International Nuclear Information System (INIS)

    Hallahan, Cornelius; McGarry, Yvonne; Collins, J.D.

    1985-01-01

    A radioimmunoassay for the measurement of the synthetic anabolic agent diethylstilboestrol (DES) is described. It is based on a commercially available antiserum and a tritiated derivative of DES. The method can detect low concentrations of residues (less than 0.5 ng/ml) in small samples (0.05 to 0.2 ml) of biological fluids. DES was measured in plasma, bile and urine obtained from a calf slaughtered 22 days after subcutaneous implantation of 24 mg DES. The assay described is suitable as a rapid screening procedure for identifying animals treated with stilbene substances. (author)