Fracture toughness of welded joints of ASTM A543 steel plate
International Nuclear Information System (INIS)
Susukida, H.; Uebayashi, T.; Yoshida, K.; Ando, Y.
1977-01-01
Fracture toughness and weldability tests have been performed on a high strength steel which is a modification of ASTM A543 Grade B Class 1 steel, with a view to using it for nuclear reactor containment vessels. The results showed that fracture toughness of welded joints of ASTM A543 modified high strength steel is superior and the steel is suitable for manufacturing the containment vessels
International Nuclear Information System (INIS)
Harsisto; Ginting, Immanuel; Eddy, D.C
2001-01-01
One of the methods to protect a carbon steel material from corrosion attack of sulfuric acid environment is with anodic protection. This research was intended to investigate the effect of anodic protection quickened with potential polarization, The material under investigation were ASTM A 516 and JIS G 3131-SPHC in highly concentrated H 2 SO 4 solution. The results showed that potential that was effective for anodic protection in ASTM A 516-60 were at 236-436 mV for 75%, 276-476 mV for 80%, 264-514 mV for 85%,285-485 mV for 90%, and 231-431 mV for 97% H 2 SO 4 so that in JlS G 3131-SPHC were at 303 -503 mV for 75%, 290-490 mV for 80%, 269- 516 mV for 85%, 264-514 mV for 90%, and 287 -487 mV for 97% H 2 SO 4
Combating Wear of ASTM A36 Steel by Surface Modification Using Thermally Sprayed Cermet Coatings
Directory of Open Access Journals (Sweden)
Vineet Shibe
2016-01-01
Full Text Available Thermal spray coatings can be applied economically on machine parts to enhance their requisite surface properties like wear, corrosion, erosion resistance, and so forth. Detonation gun (D-Gun thermal spray coatings can be applied on the surface of carbon steels to improve their wear resistance. In the present study, alloy powder cermet coatings WC-12% Co and Cr3C2-25% NiCr have been deposited on ASTM A36 steel with D-Gun thermal spray technique. Sliding wear behavior of uncoated ASTM A36 steel and D-Gun sprayed WC-12% Co and Cr3C2-25% NiCr coatings on base material is observed on a Pin-On-Disc Wear Tester. Sliding wear performance of WC-12% Co coating is found to be better than the Cr3C2-25% NiCr coating. Wear performance of both these cermet coatings is found to be better than uncoated ASTM A36 steel. Thermally sprayed WC-12% Co and Cr3C2-25% NiCr cermet coatings using D-Gun thermal spray technique is found to be very useful in improving the sliding wear resistance of ASTM A36 steel.
2011-11-02
... DEPARTMENT OF COMMERCE International Trade Administration [A-580-810, A-583-815] Welded ASTM A-312... the antidumping duty orders on welded ASTM A-312 stainless steel pipe from South Korea and Taiwan... duty orders on welded ASTM A-312 stainless steel pipe from South Korea and Taiwan pursuant to section...
International Nuclear Information System (INIS)
Williams, J.A.
1979-09-01
The ductile fracture toughness, J/sub Ic/, of ASTM A 533, Grade B, Class 1 and ASTM A 533, heat treated to simulate irradiation, was determined for 10- to 100-mm thick compact specimens. The toughness at maximum specimen load was also measured to determine the conservatism of J/sub Ic/. The toughness of ASTM A 533, Grade B, Class 1 steel was 349 kJ/m 2 and at the equivalent upper shelf temperature, the heat treated material exhibited 87 kJ/m 2 . The maximum load fracture toughness was found to be linearly proportional to specimen size, and only specimens which failed to meet ASTM size criteria exhibited maximum load toughness less than J/sub Ic/
Combating Wear of ASTM A36 Steel by Surface Modification Using Thermally Sprayed Cermet Coatings
Shibe, Vineet; Chawla, Vikas
2016-01-01
Thermal spray coatings can be applied economically on machine parts to enhance their requisite surface properties like wear, corrosion, erosion resistance, and so forth. Detonation gun (D-Gun) thermal spray coatings can be applied on the surface of carbon steels to improve their wear resistance. In the present study, alloy powder cermet coatings WC-12% Co and Cr3C2-25% NiCr have been deposited on ASTM A36 steel with D-Gun thermal spray technique. Sliding wear behavior of uncoated ASTM A36 ste...
2011-12-19
... DEPARTMENT OF COMMERCE International Trade Administration [A-580-810, A-583-815] Welded ASTM A-312... revocation of the antidumping duty orders on welded ASTM A-312 stainless steel pipe from South Korea (Korea... December 30, 1992, the Department published the antidumping duty orders on welded ASTM A-312 stainless...
Peasura, Prachya
2015-01-01
This research studied the application of the response surface methodology (RSM) and central composite design (CCD) experiment in mathematical model and optimizes postweld heat treatment (PWHT). The material of study is a pressure vessel steel ASTM A516 grade 70 that is used for gas metal arc welding. PWHT parameters examined in this study included PWHT temperatures and time. The resulting materials were examined using CCD experiment and the RSM to determine the resulting material tensile strength test, observed with optical microscopy and scanning electron microscopy. The experimental results show that using a full quadratic model with the proposed mathematical model is YTS = -285.521 + 15.706X1 + 2.514X2 - 0.004X1(2) - 0.001X2(2) - 0.029X1X2. Tensile strength parameters of PWHT were optimized PWHT time of 5.00 hr and PWHT temperature of 645.75°C. The results show that the PWHT time is the dominant mechanism used to modify the tensile strength compared to the PWHT temperatures. This phenomenon could be explained by the fact that pearlite can contribute to higher tensile strength. Pearlite has an intensity, which results in increased material tensile strength. The research described here can be used as material data on PWHT parameters for an ASTM A516 grade 70 weld.
Reactor pressure vessel steels ASTM A533B and A508 Cl.2
International Nuclear Information System (INIS)
Pelli, R.; Kemppainen, M.; Toerroenen, K.
1979-11-01
This report presents the tensile test results of steels ASTM A533B and A508 Cl.2 obtained in connection with a programme initiated to gather and create information needed for the assessment of the structural integrity of the reactor pressure vessels. The tensile properties were studied between -196 and 300 degC varying austenitizing and tempering temperatures and having two different carbon contents for the heats of A533B. (author)
Comparative Study of API 5L X60 and ASTM 572 Gr50 Steel Exposed to Crude Oil and Seawater
Directory of Open Access Journals (Sweden)
Marcy Viviana Chiquillo Márquez
2018-04-01
Full Text Available In the petroleum industry, the biphasic conditions in storage and separation tanks allow that the material to remain exposed to two different environments, causing its deterioration. In this article, an evaluation is made of the corrosive behavior and Vickers microhardness (HV of two high strength low alloy (HSLA steels and how their surfaces are characterized. The ASTM 572 Gr50 steel showed a lower corrosion rate in all systems after being immersed for 720 and 1440 hours. Characterizing the surface by means of Scanning Electron Microscopy (SEM showed uniform and localized corrosion for the both steels, and revealed that the ASTM 572 Gr50 steel shows pitting corrosion in crude oil systems. The electrochemical results revealed that the corrosion potential of API X60 steel was more negative; however the ASTM 572 Gr50 steel had a higher current density and a lower polarization resistance when immersed in an oil/seawater mixture. It also observed that, after being immersed in the corrosive fluids, the microstructures of the steels were not modified and variations in their microhardness (HV were minute.
International Nuclear Information System (INIS)
Han, C. H.; Baek, J. H.; Kim, S. H.; Lee, C. B.; Kim, Y. K.; Hong, S. I.
2009-01-01
SFR (Sodium-Cooled Fast Reactor) is one of the prospective nuclear reactor for the next generation (Gen-IV) systems. The fuel claddings in the SFR are subject to a high fast nuclear irradiation and a high temperature. Fuel technology is a key aspect of an SFR system, with implications for reactor safety, reactor operations, fuel reprocessing technology, and overall system economics. ASTM Gr.92 steel has been considered as the one of the main candidate fuel cladding materials in the design of SFR in that it has higher thermal conductivity as well as dimensional stability under irradiation when compared as austenitic stainless steel. The changes in microstructure and heat-treatment varying M 23 C 6 , MX, M 2 X, and precipitation by ASTM Gr.92 steels to improve high temperature mechanical properties is the attention. According to several researchers, it plays an important role in the mechanical properties of precipitates V, Nb, Cr, C, N as a form of MX and M 2 X precipitates. These fine precipitates formed in the sub- grain by preventing the movement of dislocations in high-temperature mechanical properties will contribute effectively. This study investigated the effects of tempering temperature and heat-treatment path on microstructure and mechanical properties of ASTM Gr.92 steels
Afolalu, S. A.; Abioye, O. P.; Salawu, E. Y.; Okokpujie, I. P.; Abioye, A. A.; Omotosho, O. A.; Ajayi., O. O.
2018-04-01
Carburization is one the best heat treatment that responded well to hardening with Palm Kernel Shell giving the best hardness value. This work studied the influence of carburization on HSStool(ASTM A600) and its behaviour during machining of mild steel (ASTM A36). Composition of the samples (12 pieces of 180 × 12 × 12 mm) HSS tools were checked using UV-VIS spectrometer and the tools were carburized with PKS at holding temperatures and time of 800, 850, 900, 950 °C and 60,90 120 minutes using muffle furnance. The micro structural analysis, surface and core hardnessof the treated samples gave better results than the untreated samples when checked withsoft driven and optical microscope. It wasalso observed that increase in the feed rate and depth for length of cut of 50 mm significantly reduces the wear progression and thereby gave best machining time at maximum carburizing temperature and time(950 °C / 120 minutes) when it was used to cut mild steelon the lathe machine.
International Nuclear Information System (INIS)
Allen, R.M.; Hall, J.F.
1978-07-01
The LWBR closure head and support flange are manufactured from forgings of ASTM A508 Class 4 steel rather than the ASTM A508 Class 2 forging material more commonly used in reactor vessels and closure heads. Forgings involved were approximately 300,000 pounds and 46,000 pounds. The extensive material test program conducted on ASTM A508 Class 4 LWBR forgings is described. The results of the tests confirm that the A508 Class 4 material used for the LWBR forgings has been quite good through thickness, fracture toughness, and strength properties and fully meet all specified requirements
Characterization of ASTM A335 P92 steel in continuous cooling cycles
International Nuclear Information System (INIS)
Xaubet, M. N.; Danón, C. A.; Ramos, C. P.
2013-01-01
The operating conditions demanded by Generation IV reactors include high temperatures, higher radiation doses and highly corrosive environments. Among the structural materials proposed both for in-core and out-of-core applications, elevated-temperature P91/P92 ferritic/martensitic steels have been considered. This work studies the transformation behavior and microstructural evolution of ASTM A335 P92 steel in continuous cooling cycles (CCT). The material was austenized at 1050 ºC and afterwards cooled down at controlled rates (300, 50 and 15 ºC/h). The determination and characterization of the phases present in the samples was performed by optical microscopy, field emission scanning electron microscopy, Mössbauer spectroscopy and X-ray diffraction. Samples whose cooling rates were on the limits of the studied range (300 and 15 ºC/h) presented completely martensitic and completely ferritic structures, respectively. The sample cooled down at intermediate rate exhibited, though, a mixed structure of martensite and ferrite. Second-phase precipitation has also been observed in all the samples. (author)
International Nuclear Information System (INIS)
Carneiro, T.; Cescon, T.
1982-01-01
The influence of normalizing time and temperature, as well as the plate thickness, on the impact properties of ASTM A-516 grade 70 steel, is studied. Results show that different normalizing conditions may lead to equivalent microstructure with different impact properties. Normalizing conditions that cause low cooling rate in the critical zone exhibit banded microstructure with inferior impact properties. (Author) [pt
Tekken tests in a steel 'ASTM A 514 GR B' to determine the preheating temperature
International Nuclear Information System (INIS)
Quesada, Hector Juan; Zalazar, Monica; Asta, Eduardo Pablo
2004-01-01
Cold fissure tests are used to determine the proper preheating temperature in order to prevent fissures during the steel welding process. Tekken tests were carried out on a quenched and tempered high resistance 25.4 mm thick steel (ASTM A514 Gr.B) used in structural applications. The welding was carried out using a FCAW semiautomatic process with gas protection and low hydrogen tubular electrode E110T5-K4. Similar parameters and splicing design were later applied in production. The microstructures of the base material and the welding were determined by optic and electron microscopy. The thermal cycles of the welding were recorded in order to relate the preheating temperature with the cooling time from 800 o C - 500 o C (t 8/5 ) and from 800 o C - 100 o C (tg/1) and the presence or not of fissures. Preheating at 150 o C and t 8/5 greater than 17 s was found to guarantee fissure free welding (CW)
International Nuclear Information System (INIS)
James, L.A.
1987-01-01
The fatigue-crack propagation (FCP) behavior of ASTM A533-B-1 steel was characterized in vacuo at 288 0 C. Tests were conducted at two stress ratios: R = 0.05 and R = 0.7. Results of these tests were compared with results from previous studies for the same type of steel tested in an air environment, and FCP rates in vacuo were generally lower than those in air. Stress ratio effects in vacuo were not as great as those in air, and both stress ratio effects and environmental effects are discussed from the standpoint of crack closure concepts
Cavitation erosion - corrosion behaviour of ASTM A27 runner steel in natural river water
International Nuclear Information System (INIS)
Tôn-Thât, L
2014-01-01
Cavitation erosion is still one of the most important degradation modes in hydraulic turbine runners. Part of researches in this field focuses on finding new materials, coatings and surface treatments to improve the resistance properties of runners to this phenomenon. However, only few studies are focused on the deleterious effect of the environment. Actually, in some cases a synergistic effect between cavitation erosion mechanisms and corrosion kinetics can establish and increase erosion rate. In the present study, the cavitation erosion-corrosion behaviour of ASTM A27 steel in natural river water is investigated. This paper state the approach which has been used to enlighten the synergy between both phenomena. For this, a 20 kHz vibratory test according ASTM G32 standard is coupled to an electrochemical cell to be able to follow the different corrosion parameters during the tests to get evidence of the damaging mechanism. Moreover, mass losses have been followed during the exposure time. The classical degradation parameters (cumulative weight loss and erosion rate) are determined. Furthermore, a particular effort has been implemented to determine the evolution of surface damages in terms of pitting, surface cracking, material removal and surface corrosion. For this, scanning electron microscopy has been used to link the microstructure to the material removal mechanisms
Tekken testing to determine the preheating temperature on ASTM A514 GR B steel
International Nuclear Information System (INIS)
Asta, Eduardo; Zalazar, Monica; Quesada, Hector
2003-01-01
The cold cracking test methods are used to determine the preheating temperature in order to avoid cracking in steel welding.In this work Tekken tests on high strength quenching and tempering (ASTM A514 GrB) structural steel with a thickness of 25 mm have been made.The welds were done using a FCAW process with gas shielding and basic low hydrogen cored wire E 110T5-K4.The welding parameters and joint design applied in this work are similar to the ones used on site production.The base metal, HAZ and weld metal microstructure have been evaluated by optical and SEM microscopy.Thermal cycles records of each welding have been made to relate preheat temperature with the cooling time on the range of 800-500 degC (t8/5) or 800-100degC (t8/1) and the evidence of crack or no crack condition.Finally, a preheat temperature of 150degC and the cooling time larger than 17 s improve a welding integrity without cracks
Studies on the welding of heavy-section ASTM A542 Cl. 1 steel for large-sized pressure vessels
International Nuclear Information System (INIS)
Shimizu, Shigeki; Aota, Toshiichi; Kasahara, Masayuki
1977-01-01
ASTM A 542, Cl. 1 steel was developed and standardized recently, and is excellent in the high temperature strength and toughness as compared with conventionally used A 387, Grade 22 steel, accordingly the application to large pressure vessels is planned. This steel is a low alloy steel, and in case of large thickness, the possibility of cracking in the welded part is large. Also many times of annealing are required for the prevention of welding cracking, the relieving of residual stress, and the softening of hardened portion, but the possibility of cracking during stress-relieving annealing is large. In this study, Tekken type cracking test was carried out by coated electrode welding, and restricted cracking test was carried out by submerged arc welding of the A 542, Cl. 1 steel and A 387, Grade 22 steel, thus the welding cracking property was investigated, and the optimal welding conditions were selected. Also the test of cracking during the stress-relieving annealing of both steels was carried out, and the method of preventing the cracking was studied. The optimal conditions of stress-relieving annealing were selected, and the mechanism of the cracking was clarified. The mechanical properties of the joints welded and stress-relieved under the selected conditions were confirmed. (Kako, I.)
International Nuclear Information System (INIS)
Oliveira, George Luiz Gomes de; Miranda, Helio Cordeiro de
2010-01-01
The aim of this work is to evaluate the effect of using the double layer technique on the microstructure, microhardness and residual stresses of welded ASTM A516 Gr70 structural steel. Samples were welded with the same welding parameters and two types of chamfers, while the samples welded using the double layer technique underwent a buttering process on their chamfer face. Residual stress measurement was accomplished through x-ray diffraction, using a mini diffractometer for measurement in field. Metallographic analysis was accomplished in the transverse section of the welded joint, using optic microscopy and scanning electron microscopy. The double layer technique showed that can be used in the welding of ASTM A516 Gr70 steel, because, besides promote a refinement and a drawing back of the CG-HAZ, it increased compressive residual stress in the whole surface of the analyzed samples.(author)
Scalise, Taís Campos; de Oliveira, Mara Cristina Lopes; Sayeg, Isaac Jamil; Antunes, Renato Altobelli
2014-06-01
Stainless steels employed for manufacturing automotive exhaust systems must withstand severe thermal cycles, corrosive environment due to urea decomposition, and welding operations. AISI 409 ferritic stainless steel can be considered a low-cost alternative for this application. However, depending on the manufacturing conditions during welding cycles, this material can be sensitized due to the precipitation of chromium carbides at grain boundaries. In this work, the intergranular corrosion resistances of the AISI 409 ferritic stainless steel were evaluated after annealing at 300, 500, and 700 °C for 2, 4, and 6 h. Solution-annealed samples were also tested for comparison purposes. Two methodologies were used to assess the sensitization behavior of the 409 stainless steel samples: the first one was based on the ASTM A763 (practice W), while the second one was based on the double-loop electrochemical potentiodynamic reactivation test. It was possible to identify that the annealing treatment performed at 500 °C was more critical to the occurrence of intergranular corrosion.
Heat treatment temperature influence on ASTM A890 GR 6A super duplex stainless steel microstructure
International Nuclear Information System (INIS)
Martins, Marcelo; Casteletti, Luiz Carlos
2005-01-01
Duplex and super duplex stainless steels are ferrous alloys with up to 26% chromium, 8% nickel, 5% molybdenum and 0.3% nitrogen, which are largely used in applications in media containing ions from the halogen family, mainly the chloride ion (Cl - ). The emergence of this material aimed at substituting Copper-Nickel alloys (Cupro-Nickel) that despite presenting good corrosion resistance, has mechanical properties quite inferior to steel properties. The metallurgy of duplex and super duplex stainless steel is complex due to high sensitiveness to sigma phase precipitation that becomes apparent, due to the temperatures they are exposed on cooling from solidification as well as from heat treatment processes. The objective of this study was to verify the influence of heat treating temperatures on the microstructure and hardness of ASTM A890/A890M Gr 6A super duplex stainless steel type. Microstructure control is of extreme importance for castings, as the chemical composition and cooling during solidification inevitably provide conditions for precipitation of sigma phase. Higher hardness in these materials is directly associated to high sigma phase concentration in the microstructure, precipitated in the ferrite/austenite interface. While heat treatment temperature during solution treatment increases, the sigma phase content in the microstructure decreases and consequently, the material hardness diminishes. When the sigma phase was completely dissolved by the heat treatment, the material hardness was influenced only due to ferrite and austenite contents in the microstructure
Directory of Open Access Journals (Sweden)
Luciana Iglésias Lourenço Lima
2010-06-01
Full Text Available As soldas dissimilares (dissimilar metal welds - DMWs são utilizadas em diversos segmentos da indústria. No caso específico de usinas nucleares, tais soldas são necessárias para conectar tubulações de aço inoxidável com componentes fabricados em aços baixa liga. Os materiais de adição mais utilizados neste tipo de solda são as ligas de níquel 82 e 182. Este trabalho consistiu na soldagem de uma junta dissimilar de aço baixa liga ASTM A-508 G3 e aço inoxidável austenítico AISI 316L utilizando as ligas de níquel 82 e 182 como metais de adição. A soldagem foi realizada manualmente empregando os processos de soldagem ao arco SMAW (Shielded Metal Arc Welding e GTAW (Gas Tungsten Arc Welding. Os corpos de prova foram caracterizados microestruturalmente utilizando-se microscópio óptico e microscópio eletrônico de varredura com microanálise por dispersão de energia de raios X (EDS e ensaios de microdureza Vickers. Observou-se uma microestrutura constituída de dendritas de austenita com a presença de precipitados com formas e dimensões definidas pelo aporte térmico e pela direção de soldagem. Não houve variação significativa da dureza ao longo da junta soldada, demonstrando a adequação dos parâmetros de soldagem utilizados.The dissimilar metal welds (DMWs are used in several areas of the industries. In the nuclear power plant, this weld using nickel alloy welding wires is used to connect stainless steel pipes to low alloy steel components on the reactor pressured vessels. The filler materials commonly used in this type of weld are nickel alloys 82 and 182.. In this study, dissimilar metal welds composed of low alloy steel ASTM A-508 G3, nickel alloys 82 e 182 as weld metals, and austenitic stainless steel AISI 316L were prepared by manual shielded metal arc welding (SMAW and gas tungsten arc welding techniques (GTAW. Samples were microstructural characterized by optical microscopy and scanning electron microscopy
Heat treatment evaluation of steel ASTM A-131 grade A by X-Ray diffraction
Energy Technology Data Exchange (ETDEWEB)
Ferreira Junior, Francisco; Feio, Luciana Gaspar; Costa, Ednelson Silva; Rodrigues, Lino Alberto Soares; Braga, Eduardo Magalhaes, E-mail: juniorferrer93@gmail.com [Universidade Federal do Pará (UFPA), Belém, PA (Brazil)
2016-07-01
Full text: This study evaluates the residual stress of naval steel ASTM A-131 grade A before and after heat treatment. Residual stresses were determined by the technique of X-ray diffraction (XRD). Before heat treatment the residual stress measurements were made at 36 (thirty six) points distributed in a specimen with dimensions of 400 mm long, 200 mm wide and 95 mm thick, then the plate under analysis was brought to the oven for the implementation of heat treatment. To check the performance of the heat treatment, the plate was again subjected to XRD measurements of the same points previously measured in order to compare the residual stresses. As result, there was a reduction of residual stresses with the application of heat treatment. References: [1] COLPAERT, H. Metalografia dos Produtos Siderurgicos Comuns. 4 Edição. Editora Blucher. Saõ Paulo, SP, 2008. [2] HILL, R. Princípios de Metalurgia Física, 1992. (author)
Directory of Open Access Journals (Sweden)
Alberto Velázquez-del Rosario
2015-07-01
Full Text Available The weldability assets of ASTM A 240 S41500 (ASTM A 240/A 240M martensitic stainless steel are presented through the study of the effects of single and double thermal weld cycles on mechanical properties and microstructure of base metal (BM and the artificial heat affected zone (HAZ created by thermal weld simulations. For single cycles, separate peak temperatures of 1000 ºC/12 s and 1350 ºC/12 s (cooling times: 12 s in both cases were evaluated, whilst two combinations of peak temperatures: (1350 ºC/5 s + 1000 ºC/5 s ºC and (1350 ºC/12 s + 1000 ºC/12 s ºC (cooling times: 5 s and 12 s, were applied for double cycles. Post weld heat treatment (PWHT with short and long holding times were applied and Vickers hardness, impact toughness and metallographic examinations were used in order to assess mechanical and metallographic properties in the as-simulated (no heat treated and postweld heat treated conditions. Best properties of the welded joint for double thermal weld cycles with long holding times were reached, which reveals the good weldability and applicability of the tested material in post weld heat treated conditions.
Energy Technology Data Exchange (ETDEWEB)
Souza, Danilo Olzon Dionysio de; Ardisson, Jose Domingos, E-mail: dolzon@gmail.com [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil); Silva, Edilaine Honorio [Studiecentrum voor Kernenergie (Belgium); Olzon-Dionysio, Maristela; Souza, Sylvio Dionysio de; Fabris, Jose Domingos [Universidade Federal dos Vales do Jequitinhonha e Mucuri (UFVJM), Diamantina, MG (Brazil); Martinez, L.G. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)
2016-07-01
Full text: systematic investigation of samples of plasma-nitriding austenitic stainless steels ASTM F138 and AISI 316L is reported. The surface treatment of the steels through plasma-nitriding was used to improve further the hardness, wear and corrosion resistance of these stainless steels. The resulting layered crystallographic structure actually corresponds to several phases with close cell parameters, making their identification and quantification a real experimental challenge. The ASTM F138 and AISI 316L stainless steel disks were plasma nitrided for 4 h at 400 deg C in a 80% H{sub 2} -20% N2 atmosphere at 6 torr, using plasma current frequencies between 6 and 100 kHz. Data of Moessbauer (CEMS and CXMS) and grazing incidence synchrotron X-ray diffraction (XRD-SR) were systematically collected. The nitrided layer thickness were not in general influenced by the plasma frequency, except at 12 kHz, which produced a layer thickness of approximately 8.0 mm, being in average 40% thicker than for the other samples. CXMS and CEMS Moessbauer spectra for this 12 kHz-sample show a much more pronounced magnetic resonance lines than for the other samples. The Fe{sub 4}N phase presents a single magnetic hyperfine interaction; the other two (Fe{sub 2-3}N and the expanded austenite) present both paramagnetic and magnetic components, even though their hyperfine parameters may not be safely separated. We also present the results of XRD-SR that were probed at several depths. The data from these techniques may be consistently correlated and this leads to an improved model to explain the structure of the nitrided layers. (author)
Phases Evolution of an ASTM 335 steel under continuous cooling P91
International Nuclear Information System (INIS)
Carrizo, D.A; Danon, C.A; Ramos, C.P
2012-01-01
This paper studies the influence of the cooling rate on phase transformations and the resulting microstructure in continuous cooling cycles for an ASTM A335 P91 steel, under fixed austenization conditions. The CCT (Continuous Cooling Transformation) diagram of this material is reported in the literature, so the main phase fields are known. The final structure of the samples depends on the austenitic grain size and the cooling rate. The studied samples were austenized at 1050 o C for 30 minutes and then cooled at different rates between 50 o C/h and 300 o C/h. The identification and characterization of the phases was carried out by using Scanning Electron Microscopy, X-ray Diffraction and Moessbauer Spectroscopy. From the results so obtained, additions to the CCT diagram of the material are proposed, providing new information to it
Isothermal Bainite Processing of ASTM A723 Components
1993-09-01
4 List of Illustrations 1. Photograph of typical cylinders used in the present study ................................. 7 2. CCT diagram for... CCT ) diagram obtained by thermal and magnetic analyses for the high nickel (-3 percent) ASTM A723 steel. The bainite knee for the 2 percent nickel...block. Also shown is the slope giving the average cooling rate in the critical region of the CCT diagram . This average rate happens to approximately
Directory of Open Access Journals (Sweden)
Fabio Henrique Casarini Geronimo
2013-06-01
Full Text Available ASTM F 138 austenitic stainless steel has being used in the manufacture of orthopedical devices by hot forging. In this work, the flow stress curves are determined by hot torsion tests in a wide range of temperatures and strain rates. With the observed microestrutural evolution by optical microscopy in different hot forming conditions in addiction with EBSD (Electron Backscatter Diffraction techniques it is possible to obtained the recrystallized volume fraction and the misorientation angles of the samples. Due to the intermediate level of stacking fault energy of this material, during the dynamic softening occurs a competition between recrystallization and recovery. The aim of this work is to identify the softening mechanisms in this stainless steel, as well as in which hot work conditions they become more active.
Hydrogen embrittlement of ASTM A 203 D nuclear structural steel
International Nuclear Information System (INIS)
Chakravartty, J.K.; Prasad, G.E.; Sinha, T.K.; Asundi, M.K.
1986-01-01
The influence of hydrogen on the mechanical properties of ASTM A 203 D nuclear structural steel has been studied by tension, bend and delayed-failure tests at room temperature. While the tension tests of hydrogen charged unnotched specimens reveal no change in ultimate strength and ductility, the effect of hydrogen is manifested in notched specimens (tensile and bend) as a decrease in ultimate strength (maximum load in bend test) and ductility; the effect increases with increasing hydrogen content. It is observed that for a given hydrogen concentration, the decrease in bend ductility is remarkably large compared to that in tensile ductility. Hydrogen charging does not cause any delayed-failure upto 200 h under an applied tensile stress, 0.85 times the notch tensile strength. However delayed failure occurs in hydrogen charged bend samples in less than 10 h under an applied bending load of about 0.80 times of the uncharged maximum load. Fractographs of hydrogen charged unnotched specimens show ductile dimple fracture, while those of notched tension and bend specimens under hydrogen-charged conditions show a mixture of ductile dimple and quasi-cleavage cracking. The proportion of quasi-cleavage cracking increases with increasing hydrogen content and this fracture mode is more predominant in bend specimens. The changes in tensile properties and fracture modes can reasonably be explained by existing theories of hydrogen embrittlement. An attempt is made to explain the significant difference in the embrittlement susceptibility of bend and tensile specimens in the light of difference in triaxiality and plastic zone size near the notch tip. (orig.)
Microstructure evolution of ASTM 335 P91 steel, subjected to continuous cooling
International Nuclear Information System (INIS)
Carrizo, D.A; Danon, C.A; Ramos, C.P
2012-01-01
This paper studies the influence of the cooling rate on an isothermal phase transformations in ASTM A335 P91 steel, by the analysis of the resulting microstructure after several continuous cooling cycles under fixed austenization conditions. The CCT (Continuous Cooling Transformation) diagram of this material has already been reported in the literature, so the main phase fields are known, and they depend on the austenitic grain size and the cooling rate. Five samples were tested in a dilatometer, they were austenized and then cooled at different rates between 50 o C/h and 300 o C/h. The identification and characterization of the resulting phases was carried out by using Scanning Electron Microscopy, X-ray Diffraction and Mossbauer Spectroscopy. The obtained results allowed to add information about the presence of retained austenite and (Fe,Cr) 3 C - type carbides to the CCT diagram of the material (author)
Effects of heat treatment to the sound velocity and microstructural changes of ASTM A516 steels
International Nuclear Information System (INIS)
Norasiah Abdul Kasim; Azali Muhammad; Amry Amin Abas; Zaiton Selamat
2010-01-01
Full-text: The used of ultrasonic testing as a thickness measurement for structural components (pipeline and pressure vessel) is among the popular inspection tool widely use in the industrial power plant such as at petrochemical and nuclear power plant. Currently, there are cases where the thickness grows and the result will affect the reliability of the test. There are many factors that can affect the reliability of measurement. One of it is the material under test itself. In the Malaysian Nuclear Agency, initial efforts are underway to study the understanding on the effects of heat treatment to the sound velocity and microstructure changes of ASTM A516 steel. Few samples of thin square shaped prepared were heat treated under the following conditions: austenitization at 9800 degree Celsius - 2 hours, quenching; tempering at various temperature 4000, 5000, 6000 and 7000 degree Celsius. The results show that the microstructure changes and samples exhibit different sound velocity at different heat treatment. (author)
Heat treatments in a conventional steel to reproduce the microstructure of a nuclear grade steel
International Nuclear Information System (INIS)
Rosalio G, M.
2014-01-01
The ferritic steels used in the manufacture of pressurized vessels of Boiling Water Reactors (BWR) suffer degradation in their mechanical properties due to damage caused by the neutron fluxes of high energy bigger to a Mega electron volt (E> 1 MeV) generated in the reactor core. The materials with which the pressurized vessels of nuclear reactors cooled by light water are built correspond to low alloy ferritic steels. The effect of neutron irradiation on these steels is manifested as an increase in hardness, mechanical strength, with the consequent decrease in ductility, fracture toughness and an increase in temperature of ductile-brittle transition. The life of a BWR is 40 years, its design must be considered sufficient margin of safety because pressure forces experienced during operation, maintenance and testing of postulated accident conditions. It is necessary that under these conditions the vessel to behave ductile and likely to propagate a fracture is minimized. The vessels of light water nuclear reactors have a bainite microstructure. Specifically, the reactor vessels of the nuclear power plant of Laguna Verde (Veracruz, Mexico) are made of a steel Astm A-533, Grade B Class 1. At present they are carrying out some welding tests for the construction of a model of a BWR, however, to use nuclear grade steel such as Astm A-533 to carry out some of the welding tests, is very expensive; perform these in a conventional material provides basic information. Although the microstructure present in the conventional material does not correspond exactly to the degree of nuclear material, it can take of reference. Therefore, it is proposed to conduct a pilot study to establish the thermal treatment that reproduces the microstructure of nuclear grade steel, in conventional steel. The resulting properties of the conventional steel samples will be compared to a JRQ steel, that is a steel Astm A-533, Grade B Class 1, provided by IAEA. (Author)
International Nuclear Information System (INIS)
Herrera, V.; Zamora R, L.
1997-01-01
At the water storage of the irradiated nuclear fuel has been an important factor in its management. The actual pools have its walls covered with inoxidable steel and heat exchangers to dissipate the residual heat from fuel. It is essential to control the water purity to eliminate those conditions which aid to the corrosion process in fuel and at related components. The steel used in this research was obtained from an austenitic inoxidizable steel standardized with titanium 08x18H10T (Type 321) similar to one of the two steel coatings used to cover walls and the pools floor. the test consisted in the specimen deformation through an U ply according to the Astm G30-90 standard. The exposition of the deformed specimen it was realized in simulated conditions to the chemical regime used in pools. (Author)
Orozco, J. C.; Kafarov, V.; Y Peña, D.; Alviz, A.
2017-12-01
This research studies the physical and chemical changes in steel ASTM A335 P92, produced from a typical refinery corrosion environment. The environment evaluated was oxidation-nitridation with the presence of water vapor. In this study five (5) exposure times were selected: 1, 20, 50, 100 and 200 hours; As well as two (2) analysis temperatures: 450 and 550°C. The working pressure used was one (1) atmosphere. Bearing in mind the kinetic study, the behaviour shown in ASTM A335 P92 steel describes an accelerated growth until 50 hours, after this time growth is less. For the tests carried out at 450°C, the kinetic constant was 2x10-8g2mm-4h-1, as well as for 550°C the calculated kinetic constant was 3.1×10-7g2mm-4h-1 through the SEM-EDS characterization techniques, it was possible to appreciate a good adhesion and homogeneity of the layers formed on the metal matrix until a time of exposure of 100 hours at 450 and 550°C, different from that evidenced to 200 hours of exposure where the layer formed near to the substrate showed detachment, this is attributed to the formation of hydroxides product of water vapor. Among the results obtained are the elemental composition, the presence of nitrides such as Si3N4, also NSiO2 and NSi2O, molybdenum oxides: MoO2 and MoO3 and iron oxides: FeO and Fe2O3 can be evidenced.
International Nuclear Information System (INIS)
Souza, S.D. de; Olzon-Dionysio, M.; Basso, R.L.O.; Souza, S. de
2010-01-01
Plasma nitriding of ASTM F138 stainless steel samples has been carried out using dc glow discharge under 80% H 2 -20% N 2 gas mixture, at 673 K, and 2, 4, and 7 h time intervals, in order to investigate the influence of treatment time on the microstructure and the corrosion resistance properties. The samples were characterized by scanning electron microscopy, glancing angle X-ray diffraction and conversion electron Moessbauer spectroscopy, besides electrochemical tests in NaCl aerated solution. A modified layer of about 6 μm was observed for all the nitrided samples, independent of nitriding time. The X-ray diffraction analysis shows broad γ N phase peaks, signifying a great degree of nitrogen supersaturation. Besides γ N, the Moessbauer spectroscopy results indicated the occurrence of γ' and ε phases, as well as some other less important phases. Corrosion measurements demonstrate that the plasma nitriding time affects the corrosion resistance and the best performance is reached at 4 h treatment. It seems that the ε/γ' fraction ratio plays an important role on the resistance corrosion. Additionally, the Moessbauer spectroscopy was decisive in this study, since it was able to identify and quantify the iron phases that influence the corrosion resistance of plasma nitrided ASTM F138 samples.
A study on the welding characteristics of Mn-Ni-Mo type A302-C steel plate for pressure vessel
International Nuclear Information System (INIS)
Yoon, Byoung Hyun; Chang, Woong Seong; Kweon, Young Gak
2003-01-01
In order to develop ASTM A302 grade C type steel plate with excellent weldability, several steels with different chemistry have been manufactured and evaluated their mechanical properties and weldability. Trial A302-C steels have revealed tensile strength in the range of 61-67kg/mm 2 and elongation in the range of 27∼32%, depending on chemical compositions within the ASTM specification range. In case of impact toughness, trial steels showed in the range of 58-70J at 0 .deg. C. From the weldability test, the minimum preheat temperature was found to be about 150 .deg. C, and automatic welding condition satisfied the requirements of both ASTM specification and users
Application of MCDM based hybrid optimization tool during turning of ASTM A588
Directory of Open Access Journals (Sweden)
Himadri Majumder
2017-07-01
Full Text Available Multi-criteria decision making approach is one of the most troublesome tools for solving the tangled optimization problems in the machining area due to its capability of solving the complex optimization problems in the production process. Turning is widely used in the manufacturing processes as it offers enormous advantages like good quality product, customer satisfaction, economical and relatively easy to apply. A contemporary approach, MOORA coupled with PCA, was used to ascertain an optimal combination of input parameters (spindle speed, depth of cut and feed rate for the given output parameters (power consumption, average surface roughness and frequency of tool vibration using L27 orthogonal array for turning on ASTM A588 mild steel. Comparison between MOORA-PCA and TOPSIS-PCA shows the effectiveness of MOORA over TOPSIS method. The optimum parameter combination for multi-performance characteristics has been established for ASTM A588 mild steel are spindle speed 160 rpm, depth of cut 0.1 mm and feed rate 0.08 mm/rev. Therefore, this study focuses on the application of the hybrid MCDM approach as a vital selection making tool to deal with multi objective optimization problems.
International Nuclear Information System (INIS)
Arganis J, C. R.; Zenteno S, J. C.; Robles F, J. L.; Rodriguez M, E.; Vazquez P, A.
2014-10-01
A stainless steel 308l coating was deposited by the shielded metal arc welding (SMAW) on steel A36 with a thickness of 4.726 mm in three layers. The sensitization was measured with the technique of Electrochemical Potentiodynamic Reactivation of Double-loop (EPR-Dl), using a portable cell and other of conventional window. The standard Astm A-262, practice A was used to verify the sensitization values. Two samples were used, a welding on a plate of 323 x 172 x 76.2 mm and the second welding on the end of a plate of 12.7 mm of thickness and 280 mm of longitude, with a post-welding process with gas tungsten arc welding (GTAW) with electrode ERNiCr 3 and a process SMAW with electrode ENICRFe 3 . The coating on the plate showed low values of sensitization grade (DOS) in all the points, indicating a very quick heat extraction and an inter dendritic structure type step. The second sample presented DOS values that are related with a structure of low sensitization and the influence of the heat of the post-welding process and a structure of recrystallized grains. (Author)
Nine, H. M. Zulker
The adversity of metallic corrosion is of growing concern to industrial engineers and scientists. Corrosion attacks metal surface and causes structural as well as direct and indirect economic losses. Multiple corrosion monitoring tools are available although those are time-consuming and costly. Due to the availability of image capturing devices in today's world, image based corrosion control technique is a unique innovation. By setting up stainless steel SS 304 and low carbon steel QD 1008 panels in distilled water, half-saturated sodium chloride and saturated sodium chloride solutions and subsequent RGB image analysis in Matlab, in this research, a simple and cost-effective corrosion measurement tool has identified and investigated. Additionally, the open circuit potential and electrochemical impedance spectroscopy results have been compared with RGB analysis to gratify the corrosion. Additionally, to understand the importance of ambiguity in crisis communication, the communication process between Union Carbide and Indian Government regarding the Bhopal incident in 1984 was analyzed.
47 CFR 90.379 - ASTM E2213-03 DSRC Standard (ASTM-DSRC Standard).
2010-10-01
... 47 Telecommunication 5 2010-10-01 2010-10-01 false ASTM E2213-03 DSRC Standard (ASTM-DSRC Standard... Communications Service (dsrcs) § 90.379 ASTM E2213-03 DSRC Standard (ASTM-DSRC Standard). Roadside Units... incorporated by reference: American Society for Testing and Materials (ASTM) E2213-03, “Standard Specification...
High-cycle notch sensitivity of alloy steel ASTM A743 CA6NM used in hydrogenator turbine components
Directory of Open Access Journals (Sweden)
José Alexander Araújo
2010-10-01
Full Text Available The presence of notches and other stress concentrations in turbine blades and other notch hydraulic components is a current problem in engineering. It causes a reduction of endurance limit of material. In that sense, specimens of the ASTM A743 CA6NM alloy steel using in several hydrogenator turbine components was tested. The specimens were tested under uniaxial fatigue loading with a load ratio equal to -1, and the considered stress concentration factors, Kt, values, calculated with respect to net area, were 1.55, 2.04 and 2.42. In order to determine the fatigue limit for such notch type, a reduction data method by Dixon and Mood, Staircase method was used. This approach is based on the assumed target distribution of the fatigue limit. For such geometry at least 8 specimens were tested. In addition, the Peterson and Neuber’s notch fatigue factor were compared through fatigue notch reduction factor, Kf, obtained from experimental data. According to results obtained it was possible to conclude that the tested material is less sensitive to notches than the prediction of the Peterson and Neuber’s empirical models.
Mulligan, C. P.; Vigilante, G. N.; Cannon, J. J.
2017-11-01
High and low cycle fatigue tests were conducted on high-strength steel using four-point bending. The materials tested were ASTM A723 steel in the as-machined condition, grit-blasted condition, MIL-DTL-16232 heavy manganese phosphate-coated condition, and ASTM A1059 Zn-alloy thermo-diffusion coated (Zn-TDC). The ASTM A723 steel base material exhibits a yield strength of 1000 MPa. The effects of the surface treatments versus uncoated steel were examined. The fatigue life of the Zn-TDC specimens was generally reduced on as-coated specimens versus uncoated or phosphate-coated specimens. Several mechanisms are examined including the role of compressive residual stress relief with the Zn-TDC process as well as fatigue crack initiation from the hardened Zn-Fe alloy surface layer produced in the gas-metal reaction. Additionally, the effects of corrosion pitting on the fatigue life of coated specimens are explored as the Zn-TDC specimens exhibit significantly improved corrosion resistance over phosphate-coated and oiled specimens.
Gamma spectrometry of 285-04 ILAS gamma scan wires
International Nuclear Information System (INIS)
Dassel, G.; Buurveld, H.A.; Plakman, J.C.
1996-12-01
In the frame work of their on-going sustain programme for the material development and characterization of fusion reactors, ECN is investigating the irradiation behaviour of ferritic/martensitic steels. In the fourth irradiation experiment 285-04, 55 steel tensile samples have been irradiated up to 2.5 dpa. Four gamma scan wires from this experiment have been examined by gamma scanning. The results of the measurements have been described in this report. (orig.)
Jiang, Min; Wang, Xin-Hua; Yang, Die; Lei, Shao-Long; Wang, Kun-Peng
2015-12-01
Present work was attempted to explore the possibility of preventing CaO-containing inclusions in Al-deoxidized low-oxygen special steel during basic slag refining, which were known as ASTM D-type inclusions. Based on the analysis on formation thermodynamics of CaO-containing inclusions, a series of laboratory experiments were designed and carried out in a vacuum induction furnace. During the experiments, slag/steel reaction equilibrium was intentionally suppressed with the aim to decrease the CaO contents in inclusions, which is different from ordinary concept that slag/steel reaction should be promoted for better control of inclusions. The obtained results showed that high cleanliness of steel was obtained in all the steel melts, with total oxygen contents varied between 0.0003 and 0.0010 pct. Simultaneously, formation of CaO-containing inclusions was successfully prohibited, and all the formed oxide inclusions were MgO-Al2O3 or/and Al2O3 in very small sizes of about 1 to 3 μm. And 90 pct to nearly 98 pct of them were wrapped by relative thicker MnS outer surface layers to produce dual-phased "(MgO-Al2O3) + MnS" or "Al2O3 + MnS" complex inclusions. Because of much better ductility of MnS, certain deformability of these complex inclusions can be expected which is helpful to improve fatigue resistance property of steel. Only very limited number of singular MnS inclusions were with sizes larger than 13 μm, which were formed during solidification because of. In the end, formation of oxide inclusions in steel was qualitatively evaluated and discussed.
International Nuclear Information System (INIS)
Balderrama, Juan J.; Iorio, Antonio F.
1999-01-01
The steels used in pressure vessels generally present a non-homogenous microstructure across the thickness of their walls due to their manufacturing process. Average thickness being between 200-250 mm also makes the problem more serious. These facts lead us to think that the variation affects not only microstructure, but also mechanical properties. For this reason the methodology for the evaluation of materials should be standardized for their use before and after radiation by means of a surveillance program which allows us to verify the conditions of the steel of the pressure vessel by using Charpy-v, tensile and fracto-mechanics specimens inside the reactor to obtain information about the condition of the pressure vessel material. In order to analyze these changes, tests were carried out using Charpy-v specimens with different orientation inside the block representing the wall thickness and the corresponding ductile-to-brittle transition curves were made for each direction. The orientations to be considered will be four in all and will be those called TL, LT, ST and LS by ASTM E 399 (1993). The conclusions reached arise from a comparative analysis of the results obtained for each orientation under study and confirm the recommendation by Standards regarding the selection of the TL orientation as the most conservative. (author)
Energy Technology Data Exchange (ETDEWEB)
Arganis J, C. R.; Zenteno S, J. C.; Robles F, J. L.; Rodriguez M, E.; Vazquez P, A., E-mail: carlos.arganis@inin.gob.mx [ININ, Carretera Mexico-Toluca s/n, 52750 Ocoyoacac, Estado de Mexico (Mexico)
2014-10-15
A stainless steel 308l coating was deposited by the shielded metal arc welding (SMAW) on steel A36 with a thickness of 4.726 mm in three layers. The sensitization was measured with the technique of Electrochemical Potentiodynamic Reactivation of Double-loop (EPR-Dl), using a portable cell and other of conventional window. The standard Astm A-262, practice A was used to verify the sensitization values. Two samples were used, a welding on a plate of 323 x 172 x 76.2 mm and the second welding on the end of a plate of 12.7 mm of thickness and 280 mm of longitude, with a post-welding process with gas tungsten arc welding (GTAW) with electrode ERNiCr{sub 3} and a process SMAW with electrode ENICRFe{sub 3}. The coating on the plate showed low values of sensitization grade (DOS) in all the points, indicating a very quick heat extraction and an inter dendritic structure type step. The second sample presented DOS values that are related with a structure of low sensitization and the influence of the heat of the post-welding process and a structure of recrystallized grains. (Author)
High strength reinforcing steel bars : concrete shear friction interface : final report : Part A.
2017-03-01
High-strength steel (HSS) reinforcement, specifically ASTM A706 Grade 80 (550), is now permitted by the AASHTO LRFD Bridge Design Specifications for use in reinforced concrete bridge components in non-seismic regions. Using Grade 80 (550) steel reinf...
International Nuclear Information System (INIS)
Tonti, Andrea; Lega, Daniela; Antonini, Alessandra; Romitelli, Manuela; Alvino, Antonello
2015-01-01
ASTM A213 T91 steel is used in power plants and petrochemical industry, for long-term service components. The improved mechanical properties of grade 91 are strictly related to its specific microstructure: a tempered martensite matrix with fine precipitates embedded in. Despite low alloy heat resistant ferritic steels, that have a well known operational experience, T91 service performances are still faintly consolidated, because this material has serviced only in a limited number of plants, since the eighties. Most of the available data were obtained by laboratory tests on relatively short term creep strength and corrosion properties. The investigations reported in this paper represent an important opportunity to describe and better evaluate the damage evolution of the grade T91 steel after more than 100000 h of exposure in severe conditions (580 °C, 18–26 bar, combustion environment). Our results suggest that the steel suffered by different damage forms, which appear on definite portions of the tube cross section. The main degradation forms observed, in fact, into the tube bulk are both the martensite recovery and the microstructural evolution. This latter promoted mostly Laves phase precipitation and coarsening. On the other hand, both the outer and the inner wall side, suffered mainly by severe oxidation/carburization. Especially on the outer surface, the massive carbide precipitation has caused an evident loss of ductility so that the mechanical properties of the tube appear appreciably reduced. - Highlights: • ASTM A213 T91 steel is used in petrochemical industry, for long-term service components. • The investigations reported an evaluation of the damage evolution of the grade T91 steel. • Our results suggest that the steel suffered both the martensite recovery and the microstructural evolution. • The outer and the inner wall side, suffered mainly by severe oxidation/carburization. • Carbide precipitation caused loss of ductility so that the
International Nuclear Information System (INIS)
Pieretti, Eurico F.; Manhabosco, Sara M.; Dick, Luís F.P.; Hinder, Steve; Costa, Isolda
2014-01-01
Graphical abstract: SEM image of pits found at the centred marked area, where the laser beam focused twice. - Highlights: • The effect of laser engraving on the corrosion resistance of the ASTM F139 was studied. • Scanning vibrating electrode technique was used to identify the anodic zone. • Laser engraving of austenitic stainless steels produces highly defective surfaces. • Laser engraving causes large chemical modification of the surface. • Pitting nucleates at the interface between laser affected and unaffected areas. - Abstract: The effect of laser engraving on the corrosion resistance of ASTM F139 stainless steel (SS) has been investigated by electrochemical techniques. The nucleation of localized corrosion on this biomaterial was evaluated by scanning vibrating electrode technique (SVET) in a phosphate buffered saline solution (PBS) of pH 7.4. The Mott–Schottky approach was used to determine the electronic properties of the passive film, also chemically characterized by X-ray photoelectron spectroscopy (XPS). SVET allowed the identification of the anodic zones on the surface of the SS marked by laser technique that were associated with the heat-affected areas. Metallic drops solidified on the laser marked surface dissolved actively at OCP and favoured the nucleation of crevice corrosion, while at the pitting potential, pits nucleate preferentially on the laser marks. XPS results showed that laser engraving caused large chemical modification of the surface. Mott–Schottky results indicated a more defective oxide layer with a larger number of donors on the laser marked surface comparatively to that without marks
International Nuclear Information System (INIS)
Steele, L.E.
1978-01-01
ASTM is an international society for managing the development of standards on characteristics and performance of materials, products, systems and services and the promotion of related knowledge. This paper provides on overview of ASTM, emphasizing its contribution to nuclear systems reliability. In so doing, the author, from his perspective as chairman of ASTM committee E 10 on ''Nuclear Applications and the Measurement of Radiation Effects and the Committee on Standards'', illustrates ASTM contributions to the understanding and control of radiation embrittlement of light-water reactor pressure vessels. Four major related taks are summarized and pertinent standards identified. These include: (1) surveillance practice (5 standards), (2) neutron dosimetry (8 standards), (3) specification for steels for nuclear service (7 standards) and (4) basic guidelines for thermal annealing to correct radiation embrittlement (1 standard). This illustration, a specific accomplishment using ASTM standards, is cited within the context of the broader nuclear-related activities of ASTM. (author)
Energy Technology Data Exchange (ETDEWEB)
Herrera, V.; Zamora R, L. [Centro de Estudios Aplicados al Desarrollo Nuclear (Cuba)
1997-07-01
At the water storage of the irradiated nuclear fuel has been an important factor in its management. The actual pools have its walls covered with inoxidable steel and heat exchangers to dissipate the residual heat from fuel. It is essential to control the water purity to eliminate those conditions which aid to the corrosion process in fuel and at related components. The steel used in this research was obtained from an austenitic inoxidizable steel standardized with titanium 08x18H10T (Type 321) similar to one of the two steel coatings used to cover walls and the pools floor. the test consisted in the specimen deformation through an U ply according to the Astm G30-90 standard. The exposition of the deformed specimen it was realized in simulated conditions to the chemical regime used in pools. (Author)
Study of Irradiation Effects on the Fracture Properties of A533-Series Ferritic Steels
International Nuclear Information System (INIS)
Lee, Yong Bok; Lee, Gyeong Geun; Kwon, Jun Hyun
2011-01-01
Since the Kori nuclear power plant unit 3 (Kori-3) was founded in 1986, the surveillance tests have been conducted five times. One of the primary objectives of the surveillance test is to determine the effects of irradiation on reactor pressure vessel (RPV) steel embrittlement. The RPV is made out of ferritic steels such as SA533 type B class 1, which were used for early nuclear power plants industry including Kori-2, 3, 4 and Yonggwang-1, 2 units in Korea. The Westinghouse supplied Kori-3 with the RPV steels ASTM A533 grade B class 1, which is equivalent to SA533 type B class 1. The irradiation effects on tensile properties in ASTM A533 grade B class 1 steel had been studied by Steichen and Williams. They experimentally determined the effect of strain rate and temperature on the tensile properties of unirradiated and irradiated A533 grade B steel 1. The effects of neutron irradiation on ferritic steels could be determined from tensile properties, as well as the fracture strength and toughness measurements. Hunter and Williams have reported that the strength and ductility for unirradiated material at a low strain rate increase with decreasing test temperature. Also, neutron irradiation increases strength and decreases ductility. Crosley and Ripling revealed that the yield strength of unirradiated material rapidly increases with the strain rate. Therefore, yield strength for unirradiated and irradiated materials should be determined by test parameters along with strain rate and temperature. In this study we compare ASTM A533 grad B class 1 steel obtained from several papers with SA533 type B class 1 steel taken from the surveillance data of Kori-3 unit, whose mechanical property of unirradiated and irradiated materials was correlated with the rate-temperature parameter
Embrittlement of Intercritically Reheated Coarse Grain Heat-Affected Zone of ASTM4130 Steel
Li, Liying; Han, Tao; Han, Bin
2018-04-01
In this investigation, a thermal welding simulation technique was used to investigate the microstructures and mechanical properties of the intercritically reheated coarse grain heat-affected zone (IR CGHAZ) of ASTM4130 steel. The effect of post weld heat treatment (PWHT) on the toughness of IR CGHAZ was also analyzed. The toughness of IR CGHAZ was measured by means of Charpy impact, and it is found that IR CGHAZ has the lowest toughness which is much lower than that of the base metal regardless of whether PWHT is applied or not. The as-welded IR CGHAZ is mainly composed of ferrite, martensite, and many blocky M-A constituents distributing along grain boundaries and subgrain boundaries in a near-connected network. Also, the prior austenite grains are still as coarse as those in the coarse grain heat-affected zone (CGHAZ). The presence of the blocky M-A constituents and the coarsened austenite grains result in the toughness deterioration of the as-welded IR CGHAZ. Most of the blocky M-A constituents are decomposed to granular bainite due to the effect of the PWHT. However, PWHT cannot refine the prior austenite grains. Thus, the low toughness of IR CGHAZ after PWHT can be attributed to two factors, i.e., the coarsened austenite grains, and the presence of the remaining M-A constituents and granular bainite, which are located at grain boundaries and subgrain boundaries in a near-connected network. The absorbed energy of the IR CGHAZ was increased by about 3.75 times, which means that the PWHT can effectively improve the toughness but it cannot be recovered to the level of base metal.
Mechanical behaviour of Astm A 297 grade Hp joints welded using different processes
International Nuclear Information System (INIS)
Emygdio, Paulo Roberto Oliveira; Zeemann, Annelise; Almeida, Luiz Henrique de
1996-01-01
The influence of different arc welding processes on mechanical behaviour was studied for cast heat resistant stainless steel welded joints, in the as welded conditions. ASTM A 297 grade HP with niobium and niobium/titanium additions were welded following three different welding procedures, using shielded metal arc welding gas tungsten arc welding and plasma arc welding, in six welded joints. The welded joint mechanical behaviour was evaluated by ambient temperature and 870 deg C tensile tests; and creep tests at 900 deg C and 50 MPa. Mechanical test results showed that the welding procedure qualification following welding codes is not suitable for high temperature service applications. (author)
International Nuclear Information System (INIS)
McHenry, H.I.; Alers, G.A.
1998-01-01
The Nuclear Regulatory Commission recently initiated a study by NIST to assess the feasibility of using physical-property measurements for evaluating radiation embrittlement in reactor pressure vessel (RPV) steels. Ultrasonic and magnetic measurements provide the most promising approaches for nondestructive characterization of RPV steels because elastic waves and magnetic fields can sense the microstructural changes that embrittle materials. The microstructural changes of particular interest are copper precipitation hardening, which is the likely cause of radiation embrittlement in RPV steels, and the loss of dislocation mobility that is an attribute of the ductile-to-brittle transition. Measurements were made on a 1% copper steel, ASTM grade A710, in the annealed, peak-aged and overaged conditions, and on an RPV steel, ASTM grade A533B. Nonlinear ultrasonic and micromagnetic techniques were the most promising measures of precipitation hardening. Ultrasonic velocity measurements and the magnetic properties associated with hysteresis-loop measurements were not particularly sensitive to either precipitation hardening or the ductile-to-brittle transition. Measurements of internal friction using trapped ultrasonic resonance modes detected energy losses due to the motion of pinned dislocations; however, the ultrasonic attenuation associated with these measurements was small compared to the attenuation caused by beam spreading that would occur in conventional ultrasonic testing of RPVs
46 CFR 163.003-3 - ASTM standard.
2010-10-01
... 46 Shipping 6 2010-10-01 2010-10-01 false ASTM standard. 163.003-3 Section 163.003-3 Shipping...: SPECIFICATIONS AND APPROVAL CONSTRUCTION Pilot Ladder § 163.003-3 ASTM standard. The following standard of the American Society for Testing and Materials (ASTM) is incorporated by reference into this subpart: ASTM D...
Bernardes, Fabiano R; Rodrigues, Samuel F; Silva, Eden S; Reis, Gedeon S; Silva, Mariana B R; Junior, Alberto M J; Balancin, Oscar
2015-06-01
Precipitation-recrystallization interactions in ASTM F-1586 austenitic stainless steel were studied by means of hot torsion tests with multipass deformation under continuous cooling, simulating an industrial laminating process. Samples were deformed at 0.2 and 0.3 at a strain rate of 1.0s(-1), in a temperature range of 900 to 1200°C and interpass times varying from 5 to 80s. The tests indicate that the stress level depends on deformation temperature and the slope of the equivalent mean stress (EMS) vs. 1/T presents two distinct behaviors, with a transition at around 1100°C, the non-recrystallization temperature (Tnr). Below the Tnr, strain-induced precipitation of Z-phase (NbCrN) occurs in short interpass times (tpass<30s), inhibiting recrystallization and promoting stepwise stress build-up with strong recovery, which is responsible for increasing the Tnr. At interpass times longer than 30s, the coalescence and dissolution of precipitates promote a decrease in the Tnr and favor the formation of recrystallized grains. Based on this evidence, the physical simulation of controlled processing allows for a domain refined grain with better mechanical properties. Copyright © 2015 Elsevier B.V. All rights reserved.
Application of high strength steel to nuclear reactor containment vessel
International Nuclear Information System (INIS)
Susukida, H.; Sato, M.; Takano, G.; Uebayashi, T.; Yoshida, K.
1976-01-01
Nuclear reactor containment vessels are becoming larger in size with the increase in the power generating capacity of nuclear power plants. For example, a containment vessel for a PWR power plant with an output of 1,000 MWe becomes an extremely large one if it is made of the conventional JIS SGV 49 (ASTM A 516 Gr. 70) steel plates less than 38 mm in thickness. In order to design the steel containment vessel within the conventional dimensional range, therefore, it is necessary to use a high strength steel having a higher tensile strength than SGV 49 steel, good weldability and a higher fracture toughness and moreover, possessing satisfactory properties without undergoing post-weld heat treatment. The authors conducted a series of verification tests on high strength steel developed by modifying the ASTM A 543 Grade B Class 1 steel with a view to adopting it as a material for the nuclear reactor containment vessels. As the result of evaluation of the test results from various angles, we confirmed that the high strength steel is quite suitable for the manufacture of nuclear reactor containment vessels. (auth.)
Studies on Stress Corrosion Cracking of Super 304H Austenitic Stainless Steel
Prabha, B.; Sundaramoorthy, P.; Suresh, S.; Manimozhi, S.; Ravishankar, B.
2009-12-01
Stress corrosion cracking (SCC) is a common mode of failure encountered in boiler components especially in austenitic stainless steel tubes at high temperature and in chloride-rich water environment. Recently, a new type of austenitic stainless steels called Super304H stainless steel, containing 3% copper is being adopted for super critical boiler applications. The SCC behavior of this Super 304H stainless steel has not been widely reported in the literature. Many researchers have studied the SCC behavior of steels as per various standards. Among them, the ASTM standard G36 has been widely used for evaluation of SCC behavior of stainless steels. In this present work, the SCC behavior of austenitic Fe-Cr-Mn-Cu-N stainless steel, subjected to chloride environments at varying strain conditions as per ASTM standard G36 has been studied. The environments employed boiling solution of 45 wt.% of MgCl2 at 155 °C, for various strain conditions. The study reveals that the crack width increases with increase in strain level in Super 304H stainless steels.
ASTM reference radiologic digital image standards
International Nuclear Information System (INIS)
Wysnewski, R.; Wysnewski, D.
1996-01-01
ASTM Reference Radiographs have been essential in defining industry's material defect grade levels for many years. ASTM Reference Radiographs are used extensively as even the American Society for Metals Nondestructive Inspection and Quality Control Metals Handbook, Volume 11, eighth edition refers to ASTM Standard Reference Radiographs. The recently published E 1648 Standard Reference Radiographs for Examination of Aluminum Fusion Welds is a prime example of the on-going need for these references. To date, 14 Standard Reference Radiographs have been published to characterize material defects. Standard Reference Radiographs do not adequately address film-less radiologic methods. There are differences in mediums to content with. On a computer CRT defect indications appear differently when compared to indications viewed in a radiograph on a view box. Industry that uses non-film radiologic methods of inspection can be burdened with additional time and money developing internal standard reference radiologic images. These references may be deemed necessary for grading levels of product defects. Because there are no ASTM Standard Reference Radiologic data files for addressing this need in the industry, the authors of this paper suggested implementing a method for their creation under ASTM supervision. ASTM can assure continuity to those users making the transition from analog radiographic images to digital image data by swiftly addressing the requirements for reference digital image standards. The current status and possible future activities regarding a method to create digital data files is presented in this paper summary
International Nuclear Information System (INIS)
Moreno G, N.
2014-01-01
In this work a study was conducted on the steel Astm A-533, Grade B, Class 1 of reference JRQ, for the purpose of carrying out a study by transmission electron microscopy on the size and distribution of precipitates in steel samples JRQ previously subjected to heat treatments. This because the reactor vessels of the nuclear power plant of Laguna Verde, are made of a steel Astm A-533 Grade B, Class 1. It is known that the neutron radiation causes damage primarily embrittlement in materials that are exposed to it. However, observable damage through mechanical tests result from microstructural defects and atomic, induced by the neutron radiation. In previous studies hardening by precipitation of a JRQ steel (provided by the IAEA) was induced by heat treatments, finding that the conditions of heat treatment that reproduce the hardness and stress mechanical properties of a steel Astm A-533, Grade B, Class 1 irradiated for 8 years to a fluence of 3.5 x 10 17 neutrons/cm 2 and to a temperature of 290 grades C are achieved with annealing treatments at 550 grades C. In the studied samples it was found that the more hardening phase both the heat treatments as the neutron radiation, is the bainite, being the ferrite practically unchanged. Which it gave the tone to believe that the ferrite is the phase that provides at level macro the mechanical properties in stress, since in the irradiated samples such properties remained unchanged with respect to the non-irradiated material, however changes were observed in material ductility, which may be attributable to the change of hardness in the bainite, which opens a possibility for modeling the micromechanical behavior of this material. (Author)
Gamma spectrometry of 285-03 ILAS gamma scan wires
International Nuclear Information System (INIS)
Dassel, G.; Buurveld, H.A.; Plakman, J.C.
1996-12-01
In the frame work of their on-going sustain programme for the material development and characterization of fusion reactors, ECN is investigating the irradiation behaviour of ferritic/martensitic steels. In the third irradiation experiment 285-03, 55 vanadium (V-4Cr-4Ti) tensile samples have been irradiated up to 6 dpa. Four gamma scan wires from this experiment have been examined by gamma scanning. The results of the measurements have been described in this report. (orig.)
Coating and Interface Degradation of Coated steel, Part 2: Accelerated Laboratory Tests
International Nuclear Information System (INIS)
Cambier, S.M.; Frankel, G.S.
2014-01-01
In a previous paper, it was demonstrated that the measurement of cathodic delamination by the Scanning Kelvin Probe can assess the interface stability of poly(vinyl butyral) (PVB) coated steel after field exposure. This technique was utilized to characterize the degradation of the polymer/metal interface in several outdoor climates. In this paper, the effects of environmental factors on the interface degradation were investigated in the laboratory. The mechanisms measured in the field were reproduced to provide input in the development of an appropriate accelerated test for PVB coated steel. The ASTM B117 and G154 standardized tests were investigated individually and sequentially. The interface stability improved after 24 h of ASTM G154 exposure. After 144 h of exposure to ASTM G154 exposure, polymer oxidation took place simultaneously with interface degradation. The condensation phase of the ASTM G154 test was responsible for the interface improvement while the ultraviolet radiation triggered the interface degradation. Pre-exposure to ASTM G154 delayed wet de-adhesion during ASTM B117 exposure. After wet de-adhesion caused by 6 h of ASTM B117, exposure to ASTM G154 for 24 h increased the interface stability. The effects of ultraviolet radiation, relative humidity, temperature and environment on interface degradation were investigated in a special chamber. Humidity was the primary factor found to influence the interface improvement during G154 exposure. A wet/dry salt fog cycle with irradiation by an ultraviolet or filtered xenon arc lamp around room temperature was suggested to reproduce the competition between the interface improvement and the interface degradation that takes place in the field
Mechanical properties of dynamic diffusion bonded joints in a mild alloy steel
International Nuclear Information System (INIS)
Gomez de Salazar, J. M.; Urena, A.; Menendez, M.
2001-01-01
Mechanical properties in Dynamic Diffusion Bonded (DDB) in a A.S.T.M. 1045 steel (=.45%C) joints were studied. The thermomechanical cycle added to the process, favours both the initial deformation stage and probably the diffusion mechanisms which participate in bond formation. (Author) 11 refs
Data development for ASTM E24.06.02 round robin program on instability prediction
Mccabe, D. E.
1979-01-01
Basis data for use in an ASTM E24.06.02 task group round robin activity was developed. Compact specimens were made of 2024-T351, 7075-T651 aluminum alloys, and 304 stainless steel. All were 12.7 mm thick and planar dimension variables incorporated were for 1T, 2T and 4T sizes. Representative raw data for each material and specimen size are contained herein. R-curves plotted in terms of delta a physical and delta a effective are plotted for each material.
Directory of Open Access Journals (Sweden)
Maysa Terada
2006-09-01
Full Text Available The resistance to localised corrosion of the full austenitic 15%Cr-15%Ni-1.2%Mo titanium stabilized stainless steel (DIN W. Nr. 1.4970 was investigated by electrochemical methods including electrochemical impedance spectroscopy (EIS, potentiodynamic polarization and potentiostatic polarization measurements in a phosphate-buffered solution (PBS. The low carbon and non-stabilized austenitic stainless steel, AISI 316L (ASTM F-138, widely used for surgical implants, was also tested for comparison. The tests were conducted at room temperature after a stable potential had been reached. After the electrochemical measurements, the surfaces of the specimens were observed using SEM to evaluate the presence of pits. Potentiodynamic polarization results showed that both steels are prone to localized corrosion. Larger pits were found on the surface of AISI 316L specimens after the electrochemical tests. EIS response has indicated the duplex structure of the passive oxides. The results showed that the electrochemical behaviour of the DIN W. Nr. 1.4970 is better than of AISI 316L steel. Therefore, their application as an implant material may be considered.
Fatigue crack propagation in neutron-irradiated ferritic pressure-vessel steels
International Nuclear Information System (INIS)
James, L.A.
1977-01-01
The results of a number of experiments dealing with fatigue crack propagation in irradiated reactor pressure-vessel steels are reviewed. The steels included ASTM alloys A302B, A533B, A508-2, and A543, as well as weldments in A543 steel. Fluences and irradiation conditions were generally typical of those experienced by most power reactors. In general, the effect of neutron irradiation on the fatigue crack propagation behavior of these steels was neither significantly beneficial nor significantly detrimental
Heat treated 9 Cr-1 Mo steel material for high temperature application
Jablonski, Paul D.; Alman, David; Dogan, Omer; Holcomb, Gordon; Cowen, Christopher
2012-08-21
The invention relates to a composition and heat treatment for a high-temperature, titanium alloyed, 9 Cr-1 Mo steel exhibiting improved creep strength and oxidation resistance at service temperatures up to 650.degree. C. The novel combination of composition and heat treatment produces a heat treated material containing both large primary titanium carbides and small secondary titanium carbides. The primary titanium carbides contribute to creep strength while the secondary titanium carbides act to maintain a higher level of chromium in the finished steel for increased oxidation resistance, and strengthen the steel by impeding the movement of dislocations through the crystal structure. The heat treated material provides improved performance at comparable cost to commonly used high-temperature steels such as ASTM P91 and ASTM P92, and requires heat treatment consisting solely of austenization, rapid cooling, tempering, and final cooling, avoiding the need for any hot-working in the austenite temperature range.
Micromechanics based simulation of ductile fracture in structural steels
Yellavajjala, Ravi Kiran
The broader aim of this research is to develop fundamental understanding of ductile fracture process in structural steels, propose robust computational models to quantify the associated damage, and provide numerical tools to simplify the implementation of these computational models into general finite element framework. Mechanical testing on different geometries of test specimens made of ASTM A992 steels is conducted to experimentally characterize the ductile fracture at different stress states under monotonic and ultra-low cycle fatigue (ULCF) loading. Scanning electron microscopy studies of the fractured surfaces is conducted to decipher the underlying microscopic damage mechanisms that cause fracture in ASTM A992 steels. Detailed micromechanical analyses for monotonic and cyclic loading are conducted to understand the influence of stress triaxiality and Lode parameter on the void growth phase of ductile fracture. Based on monotonic analyses, an uncoupled micromechanical void growth model is proposed to predict ductile fracture. This model is then incorporated in to finite element program as a weakly coupled model to simulate the loss of load carrying capacity in the post microvoid coalescence regime for high triaxialities. Based on the cyclic analyses, an uncoupled micromechanics based cyclic void growth model is developed to predict the ULCF life of ASTM A992 steels subjected to high stress triaxialities. Furthermore, a computational fracture locus for ASTM A992 steels is developed and incorporated in to finite element program as an uncoupled ductile fracture model. This model can be used to predict the ductile fracture initiation under monotonic loading in a wide range of triaxiality and Lode parameters. Finally, a coupled microvoid elongation and dilation based continuum damage model is proposed, implemented, calibrated and validated. This model is capable of simulating the local softening caused by the various phases of ductile fracture process under
Study of radiation damage of steels for light water pressure vessels at UJV
International Nuclear Information System (INIS)
Vacek, N.; Stoces, B.
1980-01-01
Preoperational determination of radiation resistance of pressure vessel steels is performed at accelerated neutron exposure in a test or materials research reactor. The results obtained at accelerated and operating exposure are not fully identical and surveillance bodies are therefore used manufactured from the pressure vessel material. Currently, the following steels are used for the manufacture of light water reactor pressure vessels: Mn-Mo-Ni (ASTM-A533-B, ASTM-A508), Cr-Mo-V (15Kh2M1FA). At UJV Rez, for irradiation Chanca-M probes imported from France are used featuring electric temperature control. Almost identical radiation embrittlement was measured for all three steels after irradiation with a neutron fluence of 3x10 23 n.m -2 at a temperature of 290 degC. (H.S.)
International Nuclear Information System (INIS)
Christianus, D.; Fischer, K.H.
1978-01-01
Up to present, the non-destructive testing in german steel castings and delivery conditions has hardly been described. DIN 17245 was an exception for heat-resistant ferrite cast steel (July 1967 version) which for the first time contained data on maximum permissible defects in irradiation testing. The US (ultrasonic) method to find internal defects was named together with irradiation, the error limits however were also valid for this method according to the reference picture series of ASTM (American Society for Testing and Materials). It is clear to every practician that especially in the case of steel, due to the numerous possible defects and their unpredictable orientation, it is not always possible to determine the true type of defects based on reflection behaviour of an inhomogenity. In any case one cannot directly compare two physically different methods. If one considers foreign cast steel norms, then one finds somewhat more about non-destructive testing. The set standard measures mostly however take after the irradiation testing guidelines according to ASTM. A Westinghouse regulation, norm ASTM-A-609 and the ASME (Am. Soc. of Mech. Engineers) regulations for components of nuclear reactors are the exception. (orig.) [de
International Nuclear Information System (INIS)
Jutla, T.; Lidbury, D.P.G.; Ziebs, J.; Zimmermann, C.
1986-01-01
The proposed ASTM test method for measuring the crack arrest toughness of ferritic materials using wedge-loaded, side-grooved, compact specimens was applied to three steels: A514 bridge steel, A588 bridge steel, and A533B pressure vessel steel. Five sets of results from different laboratories are discussed here. Notches were prepared by spark erosion, although root radii varied from ∝0.1-1.5 mm. Although fast fractures were successfully initiated, arrest did not occur in a significant number of cases. The results showed no obvious dependence of crack arrest toughness, K a , (determined by a static analysis) on crack initiation toughness, K 0 . It was found that K a decreases markedly with increasing crack jump distance. A limited amount of further work on smaller specimens of the A533B steel showed that lower K a values tended to be recorded. It is concluded that a number of points relating to the proposed test method and notch preparation are worthy of further consideration. It is pointed out that the proposed validity criteria may screen out lower bound data. Nevertheless, for present practical purposes, K a values may be regarded as useful in providing an estimate of arrest toughness - although not necessarily a conservative estimate. (orig./HP)
International Nuclear Information System (INIS)
Burkart, A.L.; Garavaglia, R.N.
1983-05-01
The passivation on carbon steels, in particular ASTM A 516 Degree 60 and ASTM A 333 steels is made, submitting it to the action of H 2 S/H 2 O 1,2 corrosive medium. The steel is rapidly corroded by H 2 S in aqueous solution, forming iron sulfides on the metallic surface in a crystalline layer of various μm of thickness. During this process, various types of iron sulfides at different phases, with different sulfur and iron contents are formed. The influence of temperature, the pH, the exposure time and the corrosive medium composition on formation and quality of the iron sulfides protective layer was also studied. (Author) [es
Microstructure and Mechanical Properties of ASTM A743 CA6NM Steel Welded by FCAW Process
Silva, Rafael de Paula; Faria, Maria Ismenia Sodero Toledo; Almeida, Luiz Fernando Cursino Briet de; Nunes, Carlos Angelo; Vieira, Décio; Borges Júnior, Wanderlei
2017-01-01
CA6NM steel is widely used in the manufacture of hydraulic turbines metallic parts, due to its resistance to corrosion and cavitation damage, combined with good weldability and fatigue properties. However, welding of this type of steel is complex and to ensure a minimum residual stress after welding it is necessary perform a post welding heat treatment (PWHT) of the part. This study aims to analyze the effect of a PWHT on the microstructure and mechanical properties of CA6NM steel weld joint ...
Fatoba, Olawale S.; Akinlabi, Stephen A.; Akinlabi, Esther T.
2018-03-01
Aluminium and its alloys have been successful metal materials used for many applications like commodity roles, automotive and vital structural components in aircrafts. A substantial portion of Al-Fe-Si alloy is also used for manufacturing the packaging foils and sheets for common heat exchanger applications. The present research was aimed at studying the morphology and surface analyses of laser deposited Al-Sn-Si coatings on ASTM A29 steel. These Fe-intermetallic compounds influence the material properties during rapid cooling by laser alloying technique and play a crucial role for the material quality. Thus, it is of considerable technological interest to control the morphology and distribution of these phases in order to eliminate the negative effects on microstructure. A 3 kW continuous wave ytterbium laser system (YLS) attached to a KUKA robot which controls the movement of the alloying process was utilized for the fabrication of the coatings at optimum laser parameters. The fabricated coatings were investigated for its hardness and wear resistance performance. The field emission scanning electron microscope equipped with energy dispersive spectroscopy (SEM/EDS) was used to study the morphology of the fabricated coatings and X-ray diffractometer (XRD) for the identification of the phases present in the coatings. The coatings were free of cracks and pores with homogeneous and refined microstructures. The enhanced hardness and wear resistance performance were attributed to metastable intermetallic compounds formed.
Final Scientific Report - "Novel Steels for High Temperature Carburizing"
Energy Technology Data Exchange (ETDEWEB)
McKimpson, Marvin G.; Liu, Tianjun; Maniruzzaman, Md
2012-07-27
This program was undertaken to develop a microalloy-modified grade of standard carburizing steel that can successfully exploit the high temperature carburizing capabilities of current commercial low pressure (i.e. 'vacuum') carburizing systems. Such steels can lower the amount of energy required for commercial carburizing operations by reducing the time required for deep-case carburizing operations. The specific technical objective of the work was to demonstrate a carburizing steel composition capable of maintaining a prior austenite grain size no larger than ASTM grain size number 5 after exposure to simulated carburizing conditions of 1050 C for 8 hr. Such thermal exposure should be adequate for producing carburized case depths up to about 2 mm. Such carburizing steels are expected to be attractive for use across a wide range of industries, including the petroleum, chemical, forest products, automotive, mining and industrial equipment industries. They have potential for reducing energy usage during low pressure carburizing by more than 25%, as well as reducing cycle times and process costs substantially. They also have potential for reducing greenhouse gas emissions from existing low pressure carburizing furnaces by more than 25%. High temperature carburizing can be done in most modern low pressure carburizing systems with no additional capital investment. Accordingly, implementing this technology on carburizing furnaces will provide a return on investment significantly greater than 10%. If disseminated throughout the domestic carburizing community, the technology has potential for saving on the order of 23 to 34 trillion BTU/year in industrial energy usage. Under the program, two compositions of microalloyed, coarsening-resistant low alloy carburizing steels were developed, produced and evaluated. After vacuum annealing at 1050oC for 8 hrs and high pressure gas quenching, both steels exhibited a prior austenite ASTM grain size number of 5.0 or finer
International Nuclear Information System (INIS)
Kirk, M.; Brian Hall, J.; Server, W.; Lucon, E.; Erickson, M.; Stoller, R.
2015-01-01
ASTM E900-07, Standard Guide for Predicting Radiation-Induced Transition Temperature Shift in Reactor Vessel Materials, includes an embrittlement trend curve. The trend curve can be used to predict the effect of neutron irradiation on the embrittlement of ferritic pressure vessel steels, as quantified by the shift in the Charpy V-Notch transition curve at 41 Joules of absorbed energy (ΔT 41J ). The current E900 trend curve was first adopted in the 2002 revision. In 2011 ASTM Subcommittee E10.02 undertook an extensive effort to evaluate the adequacy of the E900 trend curve for continued use. This paper summarizes the current status of this effort, which has produced a trend curve calibrated using a database of over 1800 ΔT 41J values from the light water reactor surveillance programs in thirteen countries. (authors)
Cathodic disbonding of organic coatings on submerged steel
Energy Technology Data Exchange (ETDEWEB)
Knudsen, Ole oeystein
1998-12-31
In offshore oil production, submerged steel structures are commonly protected by an organic coating in combination with cathodic protection. The main advantage is that the coating decreases the current demand for cathodic protection. But the coating degrades with time. This thesis studies one of the most important mechanisms for coating degradation in seawater, cathodic disbonding. Seven commercial coatings and two model coatings with various pigmentations have been studied. Parameter studies, microscopy and studies of free films were used in the mechanism investigations. Exposure to simulated North Sea conditions was used in the performance studies. The effect of aluminium and glass barrier pigments on cathodic disbonding was investigated. The mechanism for the effect of the aluminium pigments on cathodic disbonding was also investigated. The transport of charge and oxygen to the steel/coating interface during cathodic disbonding was studied for two epoxy coatings. Cathodic disbonding, blistering and current demand for cathodic protection was measured for nine commercial coatings for submerged steel structures, using the ASTM-G8 standard test and a long term test under simulated North Sea conditions. The relevance of the ASTM-G8 test as a prequalification test was evaluated. 171 refs., 40 figs., 6 tabs.
Corrosion fatigue crack growth in clad low-alloy steels: Part 1, medium-sulfur forging steel
International Nuclear Information System (INIS)
James, L.A.; Poskie, T.J.; Auten, T.A.; Cullen, W.H.
1996-01-01
Corrosion fatigue crack propagation tests were conducted on a medium- sulfur ASTM A508-2 forging steel overlaid with weld-deposited Alloy EN82H cladding. The specimens featured semi-elliptical surface cracks penetrating approximately 6.3 mm of cladding into the underlying steel. The initial crack sizes were relatively large with surface lengths of 30.3--38.3 mm, and depths of 13.1--16.8 mm. The experiments were conducted in a quasi-stagnant low-oxygen (O 2 < 10 ppb) aqueous environment at 243 degrees C, under loading conditions (ΔK, R, and cyclic frequency) conductive to environmentally-assisted cracking (EAC) in higher-sulfur steels under quasi-stagnant conditions. Earlier experiments on unclad compact tension specimens of this heat of steel did not exhibit EAC, and the present experiments on semi-elliptical surface cracks penetrating cladding also did not exhibit EAC
Ionic nitriding of high chromium martensitic stainless steels
International Nuclear Information System (INIS)
Bruhl, S.P; Charadia, R; Vaca, L.S; Cimetta, J
2008-01-01
Martensitic stainless steels are used in industrial applications where resistance to corrosion and mechanical resistance are needed simultaneously. These steels are normally used in tempering and annealing condition which gives them hardnesses of 500 and 600 HV (about 54 HRC). Ionic nitriding is an assisted diffusion technique that has recently been successfully applied to harden austenitic stainless steels without reducing their resistance to corrosion. The application with AISI 420 martensitic steels has not given good results yet, because in most cases, it affects their corrosion resistance. This work presents the results of the pulsed nitriding of martensitic steels with a higher chrome content, such as the M340 and M333 Boehler steels and they are compared with the same materials after tempering and annealing, without nitriding. The influence of the variations in the parameters of the process, such as the percentage of active time in the pulsed wave, partial nitrogen pressure, current density and effective tension in the microstructure, hardness and wear and corrosion resistance was studied. The microstructure was studied with an optic microscope; the wear resistance with abrasion tests following ASTM G-65 and corrosion with 100 hour long saline haze tests, in a device built according to ASTM B117. Hardness was found to rise to values of 1000 to 1350 HV in all the steels after ionic nitriding, the modified layers oscillated from 3 to 15 microns. As a result, wear resistance also increased, with differences depending on the microstructure and the thickness of the modified layer. However, corrosion resistance was not good, except in the case of the M333 steel test piece with less hardness and a less thick nitrided layer without a noticeable interphase (au)
Corrosion of carbon steel in neutral water
International Nuclear Information System (INIS)
Kawai, Noboru; Iwahori, Toru; Kurosawa, Tatsuo
1983-01-01
The initial corrosion behavior of materials used in the construction of heat exchanger and piping system of BWR nuclear power plants and thermal power plants have been examined in neutral water at 30, 50, 100, 160, 200, and 285 deg C with two concentrations of dissolved oxygen in the water. In air-saturated water, the corrosion rate of carbon steel was so higher than those in deaerated conditions and the maximum corrosion rate was observed at 200 deg C. The corrosion rate in deaerated water gradually increased with increasing the water temperature. Low alloy steel (2.25 Cr, 1Mo) exhibited good corrosion resistance compared with the corrosion of carbon steel under similar testing conditions. Oxide films grown on carbon steel in deaerated water at 50, 100, 160, 200, and 285 deg C for 48 and 240 hrs were attacked by dissolved oxygen in room temperature water respectively. However the oxide films formed higher than about 160 deg C showed more protective. The electrochemical behavior of carbon steel with oxide films was also similar to the effect of temperature on the stability of oxide films. (author)
International Nuclear Information System (INIS)
Cieslak, W.R.; Cieslak, M.J.; Hills, C.R.
1987-01-01
Compared to the austenitic stainless steels, relatively few studies have been reported of the intergranular corrosion suceptibility of martensitic stainless steels, particularly those containing 0.05 corresponds to a ditch structure in ASTM A 262-A (oxalic acid)
Comparison of ASTM D613 and ASTM D6890
2016-04-01
cetane values outside of the routine range of traditional CN testing by ASTM D613, this is an important advantage in fuel blending and disposition...Number testing. Particular emphasis was placed on evaluating fuels, and blends thereof, having cetane values outside of the normal range of the...interest covers both petroleum-based and synthetic-based, as well as blends thereof in order to improve the confidence in using DCN as a replacement
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLH285 (Link to dictyBase) - - - Contig-U16287-1 SLH285F (Link to Original site) SLH2...85F 326 - - - - - - Show SLH285 Library SL (Link to library) Clone ID SLH285 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-D/SLH285Q.Seq.d/ Representative seq. ID SLH28...5F (Link to Original site) Representative DNA sequence >SLH285 (SLH285Q) /CSM/SL/SLH2-D/SLH285Q.Seq.d/ AAAAA...ue SSF805 (SSF805Q) /CSM/SS/SSF8-A/SSF805Q.Seq.d/ 617 e-176 SLH288 (SLH288Q) /CSM/SL/SLH2-D/SLH288Q.Seq.d/ 617 e-176 SLH285 (SLH2
A study on fatigue crack growth in dual phase martensitic steel in air
Indian Academy of Sciences (India)
Dual phase (DP) steel was intercritically annealed at different temperatures from fully martensitic state to achieve martensite plus ferrite, microstructures with martensite contents in the range of 32 to 76%. Fatigue crack growth (FCG) and fracture toughness tests were carried out as per ASTM standards E 647 and E 399, ...
Experimental and numerical study of a modified ASTM C633 adhesion test for strongly-bonded coatings
Energy Technology Data Exchange (ETDEWEB)
Bernardie, Raphaëlle; Berkouch, Reda; Valette, Stéphane; Absi, Joseph; Lefort, Pierre [University of Limoges, Limoges Cedex (France)
2017-07-15
When coatings are strongly bonded to their substrates it is often difficult to measure the adhesion values. The proposed method, which is suggested naming “silver print test”, consists in covering the central part of the samples with a thin layer of silver paint, before coating. The process used for testing this new method was the Air plasma spraying (APS), and the materials used were alumina coatings on C35 steel substrates, previously pre-oxidized in CO{sub 2}. The silver painted area was composed of small grains that did not oxidize but that significantly sintered during the APS process. The silver layer reduced the surface where the coating was linked to the substrate, which allowed its debonding, using the classical adhesion test ASTM C633-13, while the direct use of this test (without silver painting) led to ruptures inside the glue used in this test. The numerical modelling, based on the finite element method with the ABAQUS software, provided results in good agreement with the experimental measurements. This concordance validated the used method and allowed accessing to the values of adherence when the experimental test ASTM C633-13 failed, because of ruptures in the glue. After standardization, the “silver print test” might be used for other kinds of deposition methods, such as PVD, CVD, PECVD.
Corrosion performance tests for reinforcing steel in concrete : test procedures.
2009-09-01
The existing test method to assess the corrosion performance of reinforcing steel embedded in concrete, mainly : ASTM G109, is labor intensive, time consuming, slow to provide comparative results, and often expensive. : However, corrosion of reinforc...
FLEXURAL TOUGHNESS OF STEEL FIBER REINFORCED CONCRETE
Directory of Open Access Journals (Sweden)
Fehmi ÇİVİCİ
2006-02-01
Full Text Available Fiber concrete is a composite material which has mechanical and physical characteristics unlike plain concrete. One of the important mechanical characteristics of fiber concrete is its energy absorbing capability. This characteristics which is also called toughness, is defined as the total area under the load-deflection curve. A number of composite characteristics such as crack resistance, ductility and impact resistance are related to the energy absorbtion capacity. According to ASTM C 1018 and JSCE SF-4 the calculation of toughness is determined by uniaxial flexural testing. Fiber concrete is often used in plates such as bridge decks, airport pavements, parking areas, subjected to cavitation and erosion. In this paper, toughness has been determined according to ASTM C 1018 and JSCE SF-4 methods by testing beam specimens. Energy absorbing capacities of plain and steel fiber reinforced concrete has been compared by evaluating the results of two methods. Also plain and steel fiber reinforced plate specimens behaviors subjected to biaxial flexure are compared by the loaddeflection curves of each specimen.
Corrosion performance tests for reinforcing steel in concrete : technical report.
2009-10-01
The existing test method used to assess the corrosion performance of reinforcing steel embedded in : concrete, mainly ASTM G 109, is labor intensive, time consuming, slow to provide comparative results, : and can be expensive. However, with corrosion...
47 CFR 95.1509 - ASTM E2213-03 DSRC Standard.
2010-10-01
... 47 Telecommunication 5 2010-10-01 2010-10-01 false ASTM E2213-03 DSRC Standard. 95.1509 Section 95... ASTM E2213-03 DSRC Standard. On-Board Units operating in the 5850-5925 MHz band shall comply with the... Materials (ASTM) E2213-03, Standard Specification for Telecommunications and Information Exchange Between...
Preparation and study of new rubber to steel adhesive systems
International Nuclear Information System (INIS)
Labaj, I.; Ondrusova, D.; Dubec, A.; Pajtasova, M.; Kohutiar, M.
2017-01-01
The present paper deals with the preparation of new rubber to steel adhesive systems using the steel surface treatment by applying the adhesive coats based on Co (II) and Cu(II) salts. For demonstration of coats chemical composition EDX analysis was used. The topography and microstructure of prepared adhesive coats were investigated using Scanning Electron Microscopy. Finally the efficiency of adhesion between rubber blends and coated metal steel pieces was evaluated according to Test ASTM D429 Rubber to metal adhesion, method A. The adhesive strength resulting values of prepared steel samples with new adhesive coats were compared with samples covered with adhesive systems commonly used in industry. (authors)
Experimental comparison of cavitation erosion rates of different steels used in hydraulic turbines
International Nuclear Information System (INIS)
Ton-That, L
2010-01-01
The prediction of cavitation erosion rates has an important role in order to evaluate the exact life of components in fluid machineries. Hydro-Quebec has studied this phenomenon for several years, in particular in hydraulic turbine runners, to try to understand the different degradation mechanisms related to this phenomenon. This paper presents part of this work. In this study, we carried out experimental erosion tests to compare different steels used in actual hydraulic turbine runners (carbon steels, austenitic and martensitic stainless steels) to high strength steels in terms of cavitation erosion resistance. The results for these different classes of steels are presented. The tests have been performed in a cavitating liquid jet apparatus according to the ASTM G134-95 standard to simulate the flow conditions. The mass loss has been followed during the exposure time. The maximum depth of erosion, the mean depth of erosion, and the mean depth erosion rate are determined. As a result we found that ASTM-A514 high strength steels present excellent cavitation erosion resistance properties. The cavitation eroded surface is followed by optical profilometry technique. Determination of mechanical properties and examinations of the eroded surfaces of the samples have also been carried out in order to identify the erosion mechanisms involved in the degradation of these kinds of materials.
77 FR 10358 - Acceptance of ASTM F963-11 as a Mandatory Consumer Product Safety Standard
2012-02-22
... CONSUMER PRODUCT SAFETY COMMISSION 16 CFR Chapter II Acceptance of ASTM F963-11 as a Mandatory... have accepted the revised ASTM F963-11 standard titled, Standard Consumer Safety Specifications for Toy Safety. Pursuant to section 106 of the Consumer Product Safety Improvement Act of 2008, ASTM F963-11 will...
Lifescience Database Archive (English)
Full Text Available VH (Link to library) VHK285 (Link to dictyBase) - - - - - (Link to Original site) VHK2...85F 531 - - - - - - Show VHK285 Library VH (Link to library) Clone ID VHK285 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2-D/VHK2...85Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >VHK2...85 (VHK285Q) /CSM/VH/VHK2-D/VHK285Q.Seq.d/ AACTCTCGAGTGCAAAAAAAGTAAAGTACAAAATGGTTAATTTCA
International Nuclear Information System (INIS)
Ghanei, S.; Kashefi, M.; Mazinani, M.
2014-01-01
The magnetic properties of ferrite–martensite dual-phase steels were evaluated using eddy current and Barkhausen noise nondestructive testing methods and correlated with their microstructural changes. Several routes were used to produce different microstructures of dual-phase steels. The first route was different heat treatments in γ region to vary the ferrite grain size (from 9.47 to 11.12 in ASTM number), and the second one was variation in intercritical annealing temperatures (from 750 to 890 °C) in order to produce different percentages of martensite in dual-phase microstructure. The results concerning magnetic Barkhausen noise are discussed in terms of height, position and shape of Barkhausen noise profiles, taking into account two main aspects: ferrite grain size, and different percentages of martensite. Then, eddy current testing was used to study the mentioned microstructural changes by detection of impedance variations. The obtained results show that microstructural changes have a noticeable effect on the magnetic properties of dual-phase steels. The results reveal that both magnetic methods have a high potential to be used as a reliable nondestructive tool to detect and monitor microstructural changes occurring during manufacturing of dual-phase steels. - Highlights: • Normalized impedance decreased as the ASTM grain size number increased. • An increase in martensite percentage resulted in a decrease in normalized impedance. • As the martensite in the DP steels increased, the MBN signals increased. • Barkhausen jumps increased with increasing the ASTM grain size number. • Both ECT and MBN had a high potential to detect microstructural changes of DP steels
32 CFR 285.5 - Information requirements.
2010-07-01
... 32 National Defense 2 2010-07-01 2010-07-01 false Information requirements. 285.5 Section 285.5 National Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE (CONTINUED) FREEDOM OF INFORMATION ACT PROGRAM DOD FREEDOM OF INFORMATION ACT (FOIA) PROGRAM § 285.5 Information...
The Properties of Arc-Sprayed Aluminum Coatings on Armor-Grade Steel
Directory of Open Access Journals (Sweden)
Marcin Adamiak
2018-02-01
Full Text Available This article presents the results of an examination of the properties of arc-sprayed aluminum on alloyed armor-grade steel. Thermal arc spraying was conducted with a EuTronic Arc Spray 4 wire arc sprayer. Aluminum wire 1.6 mm in diameter was used to produce dense, abrasion- and erosion-resistant coatings approx. 1.0 mm thick with and without nickel/5% aluminum-buffered subcoating. Aluminum coatings were characterized in accordance with ASTM G 65-00 abrasion resistance test, ASTM G 76-95 erosion resistance tests, ASTM C 633-01 adhesion strength, HV0.1 hardness tests and metallographic analyses. Results demonstrate properties of arc-sprayed aluminum and aluminum-nickel material coatings that are especially promising in industrial applications where erosion-, abrasion- and corrosion-resistant coating properties are required.
Tribological Response of Heat Treated AISI 52100 Steels Against Steel and Ceramic Counterparts
Directory of Open Access Journals (Sweden)
Türedi E.
2017-09-01
Full Text Available AISI 52100 bearing steels are commonly used in applications requiring high hardness and abrasion resistance. The bearing steels are working under dynamic loads in service conditions and their toughness properties become important. In order to provide the desired mechanical properties, various heat treatments (austenizing, quenching and tempering are usually applied. In this study, AISI 52100 bearing steel samples were austenized at 900°C for ½ h and water quenched to room temperature. Then tempering was carried out at 795°C, 400°C and 200°C for ½ h. In order to investigate the effect of heat treatment conditions on wear behavior, dry friction tests were performed according to ASTM G99-05 Standard with a ‘ball-on-disk’ type tribometer. The samples were tested against steel and ceramic counterparts using the parameters of 100 m distance and 30 N load and 0.063 m/s rotational speed. After wear test, the surface characterization was carried out using microscopy. Wear loss values were calculated using a novel optical method on both flat and counterpart specimens.
Borated stainless steel joining technology. Final report
International Nuclear Information System (INIS)
Smith, R.J.
1994-12-01
EPRI had continued investigating the application of borated stainless steel products within the US commercial nuclear power industry through participation in a wide range of activities. This effort provides the documentation of the data obtained in the development of the ASTM-A887 Specification preparation effort conducted by Applied Science and Technology and the most recent efforts for the development of joining technologies conducted under a joint effort by EPRI, Carpenter Technologies and Sandia National Laboratory under a US DOE CRADA program. The data presented in this report provides the basis for the ASTM specification which has been previously unpublished by EPRI and the data generated in support of the Joining Technology research effort conducted at Sandia. The results of the Sandia research, although terminated prior to the completion, confirms earlier data that the degradation of material properties in fusion welded borated stainless steels occurs in the heat affected zone of the weld area and not in the base material. The data obtained also supports the conclusion that the degradation of material properties can be overcome by post weld heat treatment which can result in material properties near the original unwelded metal
Energy Technology Data Exchange (ETDEWEB)
Moreno G, N.
2014-07-01
In this work a study was conducted on the steel Astm A-533, Grade B, Class 1 of reference JRQ, for the purpose of carrying out a study by transmission electron microscopy on the size and distribution of precipitates in steel samples JRQ previously subjected to heat treatments. This because the reactor vessels of the nuclear power plant of Laguna Verde, are made of a steel Astm A-533 Grade B, Class 1. It is known that the neutron radiation causes damage primarily embrittlement in materials that are exposed to it. However, observable damage through mechanical tests result from microstructural defects and atomic, induced by the neutron radiation. In previous studies hardening by precipitation of a JRQ steel (provided by the IAEA) was induced by heat treatments, finding that the conditions of heat treatment that reproduce the hardness and stress mechanical properties of a steel Astm A-533, Grade B, Class 1 irradiated for 8 years to a fluence of 3.5 x 10 {sup 17} neutrons/cm{sup 2} and to a temperature of 290 grades C are achieved with annealing treatments at 550 grades C. In the studied samples it was found that the more hardening phase both the heat treatments as the neutron radiation, is the bainite, being the ferrite practically unchanged. Which it gave the tone to believe that the ferrite is the phase that provides at level macro the mechanical properties in stress, since in the irradiated samples such properties remained unchanged with respect to the non-irradiated material, however changes were observed in material ductility, which may be attributable to the change of hardness in the bainite, which opens a possibility for modeling the micromechanical behavior of this material. (Author)
Final Report, Volume 2, The Development of Qualification Standards for Cast Duplex Stainless Steel
Energy Technology Data Exchange (ETDEWEB)
Russell, Steven, W.; Lundin, Carl, D.
2005-09-30
The scope of testing cast Duplex Stainless Steel (DSS) required testing to several ASTM specifications, while formulating and conducting industry round robin tests to verify and study the reproducibility of the results. ASTM E562 (Standard Test Method for Determining Volume Fraction by Systematic manual Point Count) and ASTM A923 (Standard Test Methods for Detecting Detrimental Intermetallic Phase in Wrought Duplex Austenitic/Ferritic Stainless Steels) were the specifications utilized in conducting this work. An ASTM E562 industry round robin, ASTM A923 applicability study, ASTM A923 industry round robin, and an ASTM A923 study of the effectiveness of existing foundry solution annealing procedures for producing cast DSS without intermetallic phases were implemented. In the ASTM E562 study, 5 samples were extracted from various cast austenitic and DSS in order to have varying amounts of ferrite. Each sample was metallographically prepared by UT and sent to each of 8 participants for volume fraction of ferrite measurements. Volume fraction of ferrite was measured using manual point count per ASTM E562. FN was measured from the Feritescope{reg_sign} and converted to volume fraction of ferrite. Results indicate that ASTM E562 is applicable to DSS and the results have excellent lab-to-lab reproducibility. Also, volume fraction of ferrite conversions from the FN measured by the Feritescope{reg_sign} were similar to volume fraction of ferrite measured per ASTM E562. In the ASTM A923 applicability to cast DSS study, 8 different heat treatments were performed on 3 lots of ASTM A890-4A (CD3MN) castings and 1 lot of 2205 wrought DSS. The heat treatments were selected to produce a wide range of cooling rates and hold times in order to study the suitability of ASTM A923 to the response of varying amounts on intermetallic phases [117]. The test parameters were identical to those used to develop ASTM A923 for wrought DSS. Charpy V-notch impact samples were extracted from the
Final Report, Volume 2, The Development of Qualification Standards for Cast Duplex Stainless Steel
Energy Technology Data Exchange (ETDEWEB)
Russell, Steven, W.; Lundin, Carl, W.
2005-09-30
The scope of testing cast Duplex Stainless Steel (DSS) required testing to several ASTM specifications, while formulating and conducting industry round robin tests to verify and study the reproducibility of the results. ASTM E562 (Standard Test Method for Determining Volume Fraction by Systematic manual Point Count) and ASTM A923 (Standard Test Methods for Detecting Detrimental Intermetallic Phase in Wrought Duplex Austenitic/Ferritic Stainless Steels) were the specifications utilized in conducting this work. An ASTM E562 industry round robin, ASTM A923 applicability study, ASTM A923 industry round robin, and an ASTM A923 study of the effectiveness of existing foundry solution annealing procedures for producing cast DSS without intermetallic phases were implemented. In the ASTM E562 study, 5 samples were extracted from various cast austenitic and DSS in order to have varying amounts of ferrite. Each sample was metallographically prepared by UT and sent to each of 8 participants for volume fraction of ferrite measurements. Volume fraction of ferrite was measured using manual point count per ASTM E562. FN was measured from the Feritescope® and converted to volume fraction of ferrite. Results indicate that ASTM E562 is applicable to DSS and the results have excellent lab-to-lab reproducibility. Also, volume fraction of ferrite conversions from the FN measured by the Feritescope® were similar to volume fraction of ferrite measured per ASTM E562. In the ASTM A923 applicability to cast DSS study, 8 different heat treatments were performed on 3 lots of ASTM A890-4A (CD3MN) castings and 1 lot of 2205 wrought DSS. The heat treatments were selected to produce a wide range of cooling rates and hold times in order to study the suitability of ASTM A923 to the response of varying amounts on intermetallic phases [117]. The test parameters were identical to those used to develop ASTM A923 for wrought DSS. Charpy V-notch impact samples were extracted from the castings and wrought
Directory of Open Access Journals (Sweden)
Joshua Olusegun Okeniyi
2018-01-01
Full Text Available This paper studies behaviours of Cymbopogon citratus leaf-extract and NaNO2, used as equal-mass admixture models, in 3.5% NaCl-immersed steel-reinforced concrete by nondestructive electrochemical methods and by compressive-strength improvement/reduction effects. Corrosion-rate, corrosion-current, and corrosion-potential constitute electrochemical test-techniques while compressive-strength effect investigations followed ASTM C29 and ASTM C33, in experiments using positive-controls for the electrochemical and compressive-strength studies. Analyses of the different electrochemical test-results mostly portrayed agreements on reinforcing-steel anticorrosion effects by the concentrations of natural plant and of chemical admixtures in the saline/marine simulating-environment and in the distilled H2O (electrochemical positive control of steel-reinforced concrete immersions. These indicated that little amount (0.0833% cement for concrete-mixing of Cymbopogon citratus leaf-extract was required for optimal inhibition efficiency, η = 99.35%, on reinforcing-steel corrosion, in the study. Results of compressive-strength change factor also indicated that the 0.0833% Cymbopogon citratus concentration outperformed NaNO2 admixture concentrations also in compressive-strength improvement effects on the NaCl-immersed steel-reinforced concrete. These established implications, from the study, on the suitability of the eco-friendly Cymbopogon citratus leaf-extract for replacing the also highly effective NaNO2 inhibitor of steel-in-concrete corrosion in concrete designed for the saline/marine service-environment.
Corrosion resistance and microstructure of alloy 625 weld overlay on ASTM A516 grade 70
Energy Technology Data Exchange (ETDEWEB)
Moradi, Mohammad J. [Amirkabir Univ. of Technology, Tehran (Iran, Islamic Republic of). Petroleum Engineering Dept.; Ketabchi, Mostafa [Amirkabir Univ. of Technology, Tehran (Iran, Islamic Republic of). Mining and Metallurgical Engineering Dept.
2016-02-01
Nickel-based alloys are a crucial class of materials because of their excellent corrosion resistance. In the present study, single layer and two layers alloy 625 weld overlays were deposited by GTAW process on A516 grade 70 carbon steel. The dilution in terms of Fe, Ni, Mo and Nb content was calculated in 30 points of weld overlay. Microstructure observations showed that alloy 625 had austenitic structure with two types of Laves and NbC secondary phases. The uniform and pitting corrosion resistance of alloy 625 weld overlay as casted and as forged were evaluated in accordance with ASTM G48-2011 standard at different temperatures to determine the weight loss and critical pitting temperature. For achieving a better comparison, samples from alloy 625 as casted and as forged were tested under the same conditions. The results point out that single layer alloy 625 weld overlay is not suitable for chloride containing environments, two layers alloy 625 weld overlay and alloy 625 as casted have acceptable corrosion resistance and almost the same critical pitting temperature. Alloy 625 as forged has the best corrosion resistance and the highest critical pitting temperature among all test specimens. Also, the corrosion behavior was evaluated in accordance with ASTM G28 standard. The corrosion rate of single layer weld overlay was unacceptable. The average corrosion rate of two layers weld overlay and in casted condition were 35.82 and 33.01 mpy, respectively. [German] Nickellegierungen sind aufgrund ihres exzellenten Korrosionswiderstandes eine bedeutende Werkstoffklasse. In der diesem Beitrag zugrunde liegenden Studie wurden mittels WIG-Schweissens ein- und zweilagige Schweissplattierungen auf den Kohlenstoffstahl A516 (Grade 70) aufgebracht. Die Vermischung in Form des Fe-, Ni-, Mo- und Nb-Gehaltes wurde an 30 Punkten der Schweissplattierungen berechnet. Die mikrostrukturellen Untersuchungen ergaben, dass die Legierung 625 eine austenitische Struktur mit zwei Arten von
30 CFR 285.706 - How do I nominate a CVA for MMS approval?
2010-07-01
... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How do I nominate a CVA for MMS approval? 285..., Fabrication, and Installation Certified Verification Agent § 285.706 How do I nominate a CVA for MMS approval... (§ 285.610(a)(9)) or GAP (§ 285.645(c)(5)), you must nominate a CVA for MMS approval. You must specify...
Reference manual on the IAEA JRQ correlation monitor steel for irradiation damage studies
International Nuclear Information System (INIS)
2001-07-01
The objective of this report is to provide information on the mechanical properties of the ASTM A533 grade B class 1 steel that was designated as 'JRQ reference steel' and for many years served as a radiation/mechanical property correlation monitor in a number of international and national studies of irradiation embrittlement of reactor pressure vessel steel. This report provides the most comprehensive listing of material test data obtained on the JRQ manufacturing history and material properties in the initial, and as delivered condition during the implementation of two IAEA co-ordinated research projects (CRPs) on behaviour of reactor pressure vessel steels under neutron irradiation
Directory of Open Access Journals (Sweden)
Brytan Z.
2016-06-01
Full Text Available This paper presents results of pitting corrosion resistance of TIG (autogenous and with filler metal and A-TIG welded lean duplex stainless steel S82441/1.4662 evaluated according to ASTM G48 method, where autogenous TIG welding process was applied using different amounts of heat input and shielding gases like pure Ar and Ar+N2 and Ar+He mixtures. The results of pitting corrosion resistance of the welded joints of lean duplex stainless steel S82441 were studied in as weld conditions and after different mechanical surface finish treatments. The results of the critical pitting temperature (CPT determined according to ASTM G48 at temperatures of 15, 25 and 35°C were presented. Three different surface treatment after welding were applied: etching, milling, brushing + etching. The influence of post weld surface treatment was studied in respect to the pitting corrosion resistance, basing on CPT temperature.
Energy Technology Data Exchange (ETDEWEB)
Hariharan, Vasudevan; Lundin, Carl, W.
2005-09-30
The objective of the program is to determine the suitability of ASTM A923 Standard Test methods for Detecting Detrimental Intermetallic Phase in Wrought Duplex Austenitic-Ferritic Stainless Steels for 25 Cr Cast Super Duplex Stainless Steels (ASTM A890-5A). Different tests were carried out on the materials procured from various steel foundries as stated in the ASTM A923. The foundries were designated as Foundry A, B, C and D. All the materials were foundry solution annealed. Materials from Foundry D were solution heat treated at The University of Tennessee also and then they were subjected to heat treatment schedule which was derived from the testing of wrought DSS to establish the A923 specification. This was possible because the material from the same heat was sufficient for conducting the full scope of heat treatment. This was done prior to carrying out various other tests. Charpy samples were machined. The Ferrite content was measured in all the Charpy samples using Feritscope® and ASTM E562 Manual Point Count Method. After the ferrite content was measured the samples were sent to AMC-Vulcan, Inc. in Alabama to conduct the Charpy impact test based on ASTM A923 Test Method B. This was followed by etch testing and corrosion analysis based on ASTM A923 Test Methods A and C respectively at University of Tennessee. Hardness testing using Rockwell B and C was also carried out on these samples. A correlation was derived between all the three test methods and the best method for evaluating the presence of intermetallic in the material was determined. The ferrite content was correlated with the toughness values. Microstructural analysis was carried out on the etch test samples using Scanning Electron Microscopy in order to determine if intermetallic phases were present. The fracture surfaces from Charpy test specimens were also observed under SEM in order to determine the presence of any cracks and whether it was a brittle or a ductile fracture. A correlation was
Compositional homogeneity in a medical-grade stainless steel sintered with a Mn–Si additive
International Nuclear Information System (INIS)
Salahinejad, E.; Hadianfard, M.J.; Ghaffari, M.; Mashhadi, Sh. Bagheri; Okyay, A.K.
2012-01-01
In this paper, chemical composition uniformity in amorphous/nanocrystallization medical-grade stainless steel (ASTM ID: F2581) sintered with a Mn–Si additive was studied via scanning electron microscopy, energy dispersive X-ray spectroscopy, and transmission electron microscopy. The results show that as a result of sintering at 1000 °C, no dissociation of Mn–Si additive particles embedded in the stainless steel matrix occurs. In contrast, sintering at 1050 °C develops a relatively homogeneous microstructure from the chemical composition viewpoint. The aforementioned phenomena are explained by liquation of the Mn–Si eutectic additive, thereby wetting of the main powder particles, penetrating into the particle contacts and pore zones via capillary forces, and providing a path of high diffusivity. - Highlights: ► Local chemical composition in a sintered stainless steel was studied. ► Due to sintering at 1000 °C, no dissociation of additive particles occurs. ► Sintering at 1050 °C provides a uniform chemical composition.
Predicting the Abrasion Resistance of Tool Steels by Means of Neurofuzzy Model
Directory of Open Access Journals (Sweden)
Dragutin Lisjak
2013-07-01
Full Text Available This work considers use neurofuzzy set theory for estimate abrasion wear resistance of steels based on chemical composition, heat treatment (austenitising temperature, quenchant and tempering temperature, hardness after hardening and different tempering temperature and volume loss of materials according to ASTM G 65-94. Testing of volume loss for the following group of materials as fuzzy data set was taken: carbon tool steels, cold work tool steels, hot work tools steels, high-speed steels. Modelled adaptive neuro fuzzy inference system (ANFIS is compared to statistical model of multivariable non-linear regression (MNLR. From the results it could be concluded that it is possible well estimate abrasion wear resistance for steel whose volume loss is unknown and thus eliminate unnecessary testing.
International Nuclear Information System (INIS)
Walker, W.L.
1978-09-01
Corrosion tests were performed to evaluate the extent of intergranular attack on sensitized Type-304 stainless steel by a proprietary Dow Chemical solvent, NS-1, which is to be used in the chemical cleaning of the Dresden 1 primary system. In addition, tests were performed to evaluate stress corrosion cracking of sensitized Type-304 stainless steel and post-weld heat-treated ASTM A336-F1, A302-B, and A106-B carbon and low alloy steels in a solution to be used to remove residual metallic copper from the Dresden 1 primary system surfaces following the chemical cleaning. No evidence of deleterious corrosion was observed in either set of tests
49 CFR 40.285 - When is a SAP evaluation required?
2010-10-01
... 49 Transportation 1 2010-10-01 2010-10-01 false When is a SAP evaluation required? 40.285 Section... § 40.285 When is a SAP evaluation required? (a) As an employee, when you have violated DOT drug and... unless you complete the SAP evaluation, referral, and education/treatment process set forth in this...
ASTM Standards for Reactor Dosimetry and Pressure Vessel Surveillance
International Nuclear Information System (INIS)
GRIFFIN, PATRICK J.
1999-01-01
The ASTM standards provide guidance and instruction on how to field and interpret reactor dosimetry. They provide a roadmap towards understanding the current ''state-of-the-art'' in reactor dosimetry, as reflected by the technical community. The consensus basis to the ASTM standards assures the user of an unbiased presentation of technical procedures and interpretations of the measurements. Some insight into the types of standards and the way in which they are organized can assist one in using them in an expeditious manner. Two example are presented to help orient new users to the breadth and interrelationship between the ASTM nuclear metrology standards. One example involves the testing of a new ''widget'' to verify the radiation hardness. The second example involves quantifying the radiation damage at a pressure vessel critical weld location through surveillance dosimetry and calculation
Directory of Open Access Journals (Sweden)
Ali Abd_Elhakam Aliabdo
2013-09-01
Full Text Available This paper presents an experimental program to investigate the impact and penetration resistance of concrete. The research work is divided into two approaches. These approaches are effect of concrete constituents and effect of surface layer. Effect of concrete aggregate type, w/c ratio, fiber type, fiber shape, fiber volume fraction, and steel reinforcement is considered in the first approach. The second approach includes using fiber reinforced concrete and glass fiber reinforced polymer as surface layers. The evaluating tests include standard impact test according to ASTM D 1557 and suggested simulated penetration test to measure the impact and penetration resistance of concrete. The test results of plain and fibrous concrete from ASTM D 1557 method indicated that steel fiber with different configurations and using basalt have a great positive effect on impact resistance of concrete. Moreover, the simulated penetration test indicates that steel fibers are more effective than propylene fibers, type of coarse aggregate has negligible effect, and steel fiber volume fraction has a more significant influence than fiber shape for reinforced concrete test panels. Finally, as expectable, surface properties of tested concrete panels have a significant effect on impact and penetration resistance.
2011-03-07
... Production Act of 1993--ASTM International Standards Notice is hereby given that, on February 4, 2011... seq. (``the Act''), ASTM International Standards (``ASTM'') has filed written notifications.... Specifically, ASTM has provided an updated list of current, ongoing ASTM standards activities originating...
78 FR 1884 - Notice Pursuant to the National Cooperative Research and Production Act of 1993-ASTM...
2013-01-09
... Production Act of 1993--ASTM International Standards Notice is hereby given that, on December 12, 2012... seq. (``the Act''), ASTM International (``ASTM'') has filed written notifications simultaneously with..., ASTM has provided an updated list of current, ongoing ASTM standards activities originating between...
2013-06-13
... Production Act of 1993--ASTM International Standards Notice is hereby given that, on May 10, 2013, pursuant... seq. (``the Act''), ASTM International (``ASTM'') has filed written notifications simultaneously with..., ASTM has provided an updated list of current, ongoing ASTM standards activities originating between...
2012-06-08
... Production Act of 1993--ASTM International Standards Notice is hereby given that, on May 11, 2012, pursuant... seq. (``the Act''), ASTM International (``ASTM'') has filed written notifications simultaneously with..., ASTM has provided an updated list of current, ongoing ASTM standards activities originating between...
2012-10-11
... Production Act of 1993--ASTM International Standards Notice is hereby given that, on September 10, 2012... seq. (``the Act''), ASTM International (``ASTM'') has filed written notifications simultaneously with..., ASTM has provided an updated list of current, ongoing ASTM standards activities originating between May...
2013-10-28
... Production Act of 1993--ASTM International Standards Notice is hereby given that, on September 16, 2013... seq. (``the Act''), ASTM International (``ASTM'') has filed written notifications simultaneously with..., ASTM has provided an updated list of current, ongoing ASTM standards activities originating between May...
2011-06-13
... Production Act of 1993; ASTM International Standards Notice is hereby given that, on May 11, 2011, pursuant... seq. (``the Act''), ASTM International Standards (``ASTM'') has filed written notifications.... Specifically, ASTM has provided an updated list of current, ongoing ASTM standards activities originating...
2013-03-07
... Production Act of 1993--ASTM International Standards Notice is hereby given that, on February 11, 2013... seq. (``the Act''), ASTM International (``ASTM'') has filed written notifications simultaneously with..., ASTM has provided an updated list of current, ongoing ASTM standards activities originating between...
30 CFR 285.201 - How will MMS issue leases?
2010-07-01
... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How will MMS issue leases? 285.201 Section 285... Energy Leases General Lease Information § 285.201 How will MMS issue leases? The MMS will issue leases on... noncompetitively, as provided under §§ 285.230 and 285.232. We will issue leases on forms approved by MMS and will...
Cladding nuclear steels - the application of plasma-arc hot wire surfacing
International Nuclear Information System (INIS)
Trarbach, K.O.
1981-01-01
The effect of one and two layer plasma-arc hot wire cladding on the HAZ microstructure of the fine grained structural steel 22 NiMoCr 3 7, which is similar to ASTM A 508, class 2, and steel 20 MnMoNi 5 5, similar to ASTM A 533, grade B, class 1 is determined. Attention is directed particularly to the behaviour of the susceptible region, and the consumables considered are cladding materials X 2 CrNiNb 19 9, similar to ER 347 Elc, and S-NiCr 20 Nb, similar to ER NiCr-3 (Inconel 82). Results of corrosion resistance tests show that this cladding technique can be recommended for manufacture of equipment for the chemical industry to avoid corrosion failure. Plasma-arc hot wire surfacing is also shown to be capable of depositing single or double clad layers to meet the highest safety requirements and could be applied to nuclear power plants for the special manufacture of wear resistant parts and for protection of equipment subject to a variety of corrosive environments. (U.K.)
International Nuclear Information System (INIS)
Sreenivasan, P.R.
2014-01-01
Many researchers had suggested a sort of scaling procedure for predicting the quasi-static J–R curves from dynamic J–R curves obtained from instrumented Charpy V-notch (CVN) impact tests using key-curve, compliance or other procedures. Chaouadi, based on extensive tests and literature data, had quantitatively formalized the method and suggested general applicability of his method for a class of steels. In this paper, first, the Chauoadi-procedure is tried on some selected data from the literature (including the data used by Chaouadi and other workers) and an adaptation of the method is suggested using Wallin's as well as Landes's lower bound methods for upper-shelf J–R curve estimation from CVN energy. Using Chaouadi and other data as the benchmark, suitable scaling factors have been determined that enable estimation of quasi-static J–R curves from CVN energy alone, without the need for dynamic CVN J–R curves. The final formulae are given. This new method can be called modified Wallin–Landes procedure. Then this method is applied to fracture toughness and reference temperature (T 0 – ASTM E-1921) estimation from the full Charpy-transition data. The results are compared with those from the author's IGC-procedure, and modifications, if any, are suggested. Based on the new results, it is suggested that the IGC-procedure may be modified as: final T Q-est = T Q-IGC for T Q-Sch dy ≤ 20 °C (in the IGC-procedure the dividing temperature was 60 °C); and for T Q-Sch dy > 20 °C, T Q-IGC = T Q-WLm (different from the IGC-procedre and subscript WLm indicating modified Wallin–Landes procedure). For the 59 or more steels examined (including highly irradiated steels), the T Q-WL estimates at higher temperatures are consistent and conservative; a few non-conservative values are acceptably less than 20 °C, whereas other predictions show non-conservatism of up to 40–50 °C. At lower temperatures, T Q-IGC is consistently conservative and not over
Energy Technology Data Exchange (ETDEWEB)
Sreenivasan, P.R., E-mail: sreeprs@yahoo.co.in
2014-04-01
Many researchers had suggested a sort of scaling procedure for predicting the quasi-static J–R curves from dynamic J–R curves obtained from instrumented Charpy V-notch (CVN) impact tests using key-curve, compliance or other procedures. Chaouadi, based on extensive tests and literature data, had quantitatively formalized the method and suggested general applicability of his method for a class of steels. In this paper, first, the Chauoadi-procedure is tried on some selected data from the literature (including the data used by Chaouadi and other workers) and an adaptation of the method is suggested using Wallin's as well as Landes's lower bound methods for upper-shelf J–R curve estimation from CVN energy. Using Chaouadi and other data as the benchmark, suitable scaling factors have been determined that enable estimation of quasi-static J–R curves from CVN energy alone, without the need for dynamic CVN J–R curves. The final formulae are given. This new method can be called modified Wallin–Landes procedure. Then this method is applied to fracture toughness and reference temperature (T{sub 0} – ASTM E-1921) estimation from the full Charpy-transition data. The results are compared with those from the author's IGC-procedure, and modifications, if any, are suggested. Based on the new results, it is suggested that the IGC-procedure may be modified as: final T{sub Q-est} = T{sub Q-IGC} for T{sub Q-Sch}{sup dy} ≤ 20 °C (in the IGC-procedure the dividing temperature was 60 °C); and for T{sub Q-Sch}{sup dy} > 20 °C, T{sub Q-IGC} = T{sub Q-WLm} (different from the IGC-procedre and subscript WLm indicating modified Wallin–Landes procedure). For the 59 or more steels examined (including highly irradiated steels), the T{sub Q-WL} estimates at higher temperatures are consistent and conservative; a few non-conservative values are acceptably less than 20 °C, whereas other predictions show non-conservatism of up to 40–50 °C. At lower temperatures
Energy Technology Data Exchange (ETDEWEB)
Chowdhury, Tamshuk, E-mail: tamshuk@gmail.com [Deep Sea Technologies, National Institute of Ocean Technology, Chennai, 600100 (India); Sivaprasad, S.; Bar, H.N.; Tarafder, S. [Fatigue & Fracture Group, Materials Science and Technology Division, CSIR-National Metallurgical Laboratory, Jamshedpur, 831007 (India); Bandyopadhyay, N.R. [School of Materials Science and Engineering, Indian Institute of Engineering, Science and Technology, Shibpur, Howrah, 711103 (India)
2016-04-15
Cyclic J-R behaviour of a reactor pressure vessel steel using different methods available in literature has been examined to identify the best suitable method for cyclic fracture problems. Crack opening point was determined by moving average method. The η factor was experimentally determined for cyclic loading conditions and found to be similar to that of ASTM value. Analyses showed that adopting a procedure analogous to the ASTM standard for monotonic fracture is reasonable for cyclic fracture problems, and makes the comparison to monotonic fracture results straightforward. - Highlights: • Different methods of cyclic J-R evaluation compared. • A moving average method for closure point proposed. • η factor for cyclic J experimentally validated. • Method 1 is easier, provides a lower bound and direct comparison to monotonic fracture.
7 CFR 285.1 - General purpose and scope.
2010-01-01
... 7 Agriculture 4 2010-01-01 2010-01-01 false General purpose and scope. 285.1 Section 285.1... COMMONWEALTH OF PUERTO RICO § 285.1 General purpose and scope. This part describes the general terms and... government of the Commonwealth of Puerto Rico for the purpose of designing and conducting a nutrition...
Annual Book of ASTM Standards, Part 23: Water; Atmospheric Analysis.
American Society for Testing and Materials, Philadelphia, PA.
Standards for water and atmospheric analysis are compiled in this segment, Part 23, of the American Society for Testing and Materials (ASTM) annual book of standards. It contains all current formally approved ASTM standard and tentative test methods, definitions, recommended practices, proposed methods, classifications, and specifications. One…
International Nuclear Information System (INIS)
Antunes, Renato Altobelli
2002-01-01
The performance of four different organic coating systems applied to carbon and weathering steel coupons has been assessed in this investigation. applied on the surface of carbon steel and weathering steel coupons. The coupons have been evaluated using five different tests, three field tests and two accelerated tests. The field tests were carried out at three atmospheric stations, located at COSIPA in Cubatao-SP, at Alto da Serra in Cubatao-SP and at Paula Souza in Sao Paulo city. The accelerated tests consisted of (a) exposure to alternate cycles of ultraviolet radiation/condensation combined with salt spray cycles (UVCON combined with Salt Spray) and of (b) exposure to alternate cycles of ultraviolet radiation/condensation combined with the Prohesion test. The performance of the coatings was assessed by visual observation and photographs, using a method based on ASTM D-610, ASTM D-714 and ASTM-1654 standards to rank them. The oxide phases formed on the surfaces of the non-coated specimens of carbon and weathering steels, exposed to the same tests performed with the coated specimens, were identified using three different techniques: X-ray diffraction, Raman microscopy and Moessbauer spectroscopy. In the field tests, the specimens have been exposed for 1, 2, 3, 6 and 9 months. In the accelerated ones, the results were obtained after 1340 hours (4 cycles) test. The main component identified in all the specimens collected from the field tests and from the UVCON combined with the Prohesion test was lepidocrocite (γ-FeOOH). Goethite (α-FeOOH ) and magnetite (Fe 3 O 4 ) were identified as the other two main phases present in ali the specimens. In the UVCON combined with Salt Spray test, the dominant phase was magnetite, followed by goethite and lepidocrocite. The morphology of the rust formed on the specimens was examined by scanning electron microscopy (SEM). Structures corresponding to goethite and lepidocrocited were recognized on ali specimens, except those
2010-01-01
... such audit shall be reported to FNS no later than 120 days from the end of each fiscal year in which the audit is made. (b) Within 120 days of the end of each fiscal year, the Commonwealth of Puerto Rico... 7 Agriculture 4 2010-01-01 2010-01-01 false Audits. 285.4 Section 285.4 Agriculture Regulations of...
Apparent embrittlement saturation and radiation mechanisms of reactor pressure vessel steels
International Nuclear Information System (INIS)
Pachur, D.
1981-01-01
The irradiation and annealing results of three different reactor pressure vessel steels are reported. Steel A, a basic material according to ASTM A-533 B having 0.15 percent vanadium; and Steel C contained 3.2 percent nickel. The steels were irradiated at 150, 300, and 400 degree C with neutron fluxes of 6 multiplied by 10 11 and 3 multiplied by 10 13 neutrons (n)/cm 2 /s. An apparent saturation-in-irradiation effect was found within certain neutron fluence ranges. During the annealing, various recovery processes occur in different temperature ranges. These are characterized by various activation energies. The individual processes were determined by the different time dependencies at various temperatures. Two causes for the apparent saturation were discovered from the behavior of the annealing curves
Creep and microstructural processes in a low-alloy 2.25%Cr1.6%W steel (ASTM Grade 23)
Czech Academy of Sciences Publication Activity Database
Kuchařová, Květa; Sklenička, Václav; Kvapilová, Marie; Svoboda, Milan
2015-01-01
Roč. 109, NOV (2015), s. 1-8 ISSN 1044-5803 R&D Projects: GA TA ČR TA02010260; GA MŠk(CZ) ED1.1.00/02.0068 Institutional support: RVO:68081723 Keywords : Bainitic steel * Low-alloy steel * Creep strength * Microstructural changes * Carbide precipitation Subject RIV: JG - Metallurgy Impact factor: 2.383, year: 2015
Spectrophotometric determination of the ASTM color of diesel oil
Energy Technology Data Exchange (ETDEWEB)
Douglas Willian Emanuel Alves Santana; Marcelle Prates Sepulveda; Paulo Jorge Sanches Barbeira
2007-03-15
One of the parameters analyzed to determine the quality of diesel oil is its ASTM color. Changes in color may be indicative of problems in the production process, contamination, degradation or the oxidation of diesel. The methodology recommended for determining the color of automotive diesel oil samples is the colorimetry according to standard ASTM D1500, in which a sample is introduced into a glass cell and the color of the sample is compared with an optical filter color scale. Although it is very simple, the manual method requires good visual acuity from the operator. This procedure becomes somewhat subjective in some cases since different operators can make distinct evaluations of the same sample. In this way, this work proposes the development of a spectrophotometric analysis methodology to eliminate the subjectiveness in the determination of ASTM color of diesel oil samples by using operator-independent parameters and making quality assay more accurate and precise. Short communication. 7 refs., 2 figs., 2 tabs.
Dynamic fracture characterization of a pressure vessel steel
International Nuclear Information System (INIS)
Schmitt, W.; Boehme, W.; Klemm, W.; Memhard, D.; Winkler, S.
1991-01-01
Dynamic events are characterized by time and space-dependent stress and strain fields caused by wave or inertia effect. The dynamic effect at cracks may be originated from the rapid loading rate or impact loading of a structure containing a stationary crack or the time-dependent stress and strain fields of a propagating or arresting crack itself. Dynamic effects complicate the analysis of crack tip stress and strain fields, and usually considerable experimental effort and numerical technique are required. High loading rate influences the deformation and yield behavior and also the fracture toughness of materials. In order to know the propagation and arrest behavior of cracks, a heat of a German reactor pressure vessel steel was investigated, and the dynamic J-resistance curves were evaluated with large three-point bending specimens by impact loading, moreover, the crack propagation energy at large crack extension was determined with wide tension plates. The material tested was a ferritic pressure vessel steel, ASTM A 508 Cl 2. The dynamic J-resistance curves and numerical simulation and fractographic examination, and crack propagation energy are reported. (K.I.)
Results of crack-arrest tests on irradiated a 508 class 3 steel
International Nuclear Information System (INIS)
Iskander, S.K.; Milella, P.P.; Pini, M.A.
1998-02-01
Ten crack-arrest toughness values for irradiated specimens of A 508 class 3 forging steel have been obtained. The tests were performed according to the American Society for Testing and Materials (ASTM) Standard Test Method for Determining Plane-Strain Crack-Arrest Fracture Toughness, K la of Ferritic Steels, E 1221-88. None of these values are strictly valid in all five ASTM E 1221-88 validity criteria. However, they are useful when compared to unirradiated crack-arrest specimen toughness values since they show the small (averaging approximately 10 degrees C) shifts in the mean and lower-bound crack-arrest toughness curves. This confirms that a low copper content in ASTM A 508 class 3 forging material can be expected to result in small shifts of the transition toughness curve. The shifts due to neutron irradiation of the lower bound and mean toughness curves are approximately the same as the Charpy V-notch (CVN) 41-J temperature shift. The nine crack-arrest specimens were irradiated at temperatures varying from 243 to 280 degrees C, and to a fluence varying from 1.7 to 2.7 x 10 19 neutrons/cm 2 (> 1 MeV). The test results were normalized to reference values that correspond to those of CVN specimens irradiated at 284 degrees C to a fluence of 3.2 x 10 19 neutrons/cm 2 (> 1 MeV) in the same capsule as the crack-arrest specimens. This adjustment resulted in a shift to lower temperatures of all the data, and in particular moved two data points that appeared to lie close to or lower than the American Society of Mechanical Engineers K la curve to positions that seemed more reasonable with respect to the remaining data. A special fixture was designed, fabricated, and successfully used in the testing. For reasons explained in the text, special blocks to receive the Oak Ridge National Laboratory clip gage were designed, and greater-than-standard crack-mouth opening displacements measured were accounted for. 24 refs., 13 figs., 12 tabs
Development of ferritic steels for steam generators of fast breeder reactors
International Nuclear Information System (INIS)
Nguyen-Thanh; Vigneron, G.; Vanderschaeghe, A.
1988-01-01
STEIN INDUSTRIE, a manufacturer of equipment for the conventional and nuclear power industry, has built up expertise in the use of Cr-Mo steels used at high temperatures. The main ferritic steels developed were 10 CD 9-10 (AFNOR), Z10 CDNb V 9-2 (AFNOR), X 20 Cr Mo V 12-1 (DIN) and ASTM Grade 9.1. For the fast breeder reactor system, STEIN INDUSTRIE proposes the use of these steels in the construction of steam generators. The wide programme of development undertaken by STEIN INDUSTRIE is aimed at the following main subjects: - characterization of materials - welding and bending tests - studies of special junctions. This article reports the results obtained
2012-01-09
... Production Act of 1993--ASTM International Notice is hereby given that, on December 5, 2011, pursuant to.... (``the Act''), ASTM International (``ASTM'') has filed written notifications simultaneously with the..., ASTM has provided an updated list of current, ongoing ASTM standards activities originating between...
Energy Technology Data Exchange (ETDEWEB)
Hariharan, Vasudevan; Lundin, Carl, D.
2005-09-30
The objective of the program is to determine the suitability of ASTM A923 Standard Test methods for Detecting Detrimental Intermetallic Phase in Wrought Duplex Austenitic-Ferritic Stainless Steels for 25 Cr Cast Super Duplex Stainless Steels (ASTM A890-5A). Different tests were carried out on the materials procured from various steel foundries as stated in the ASTM A923. The foundries were designated as Foundry A, B, C and D. All the materials were foundry solution annealed. Materials from Foundry D were solution heat treated at The University of Tennessee also and then they were subjected to heat treatment schedule which was derived from the testing of wrought DSS to establish the A923 specification. This was possible because the material from the same heat was sufficient for conducting the full scope of heat treatment. This was done prior to carrying out various other tests. Charpy samples were machined. The Ferrite content was measured in all the Charpy samples using Feritscope{reg_sign} and ASTM E562 Manual Point Count Method. After the ferrite content was measured the samples were sent to AMC-Vulcan, Inc. in Alabama to conduct the Charpy impact test based on ASTM A923 Test Method B. This was followed by etch testing and corrosion analysis based on ASTM A923 Test Methods A and C respectively at University of Tennessee. Hardness testing using Rockwell B and C was also carried out on these samples. A correlation was derived between all the three test methods and the best method for evaluating the presence of intermetallic in the material was determined. The ferrite content was correlated with the toughness values. Microstructural analysis was carried out on the etch test samples using Scanning Electron Microscopy in order to determine if intermetallic phases were present. The fracture surfaces from Charpy test specimens were also observed under SEM in order to determine the presence of any cracks and whether it was a brittle or a ductile fracture. A correlation
2010-03-10
... Production Act of 1993--ASTM International Notice is hereby given that, on February 16, 2010, pursuant to.... (``the Act''), ASTM International (``ASTM'') has filed written notifications simultaneously with the..., ASTM has provided an updated list of current, ongoing ASTM standards activities originating between May...
2010-10-26
... Production Act of 1993--ASTM International Notice is hereby given that, on September 23, 2010, pursuant to.... (``the Act''), ASTM International (``ASTM'') has filed written notifications simultaneously with the..., ASTM has provided an updated list of current, ongoing ASTM standards activities originating between May...
2011-10-13
... Production Act of 1993; ASTM International Notice is hereby given that, on August 31, 2011, pursuant to.... (``the Act''), ASTM International (``ASTM'') has filed written notifications simultaneously with the..., ASTM has provided an updated list of current, ongoing ASTM standards activities originating between May...
30 CFR 285.231 - How will MMS process my unsolicited request for a noncompetitive lease?
2010-07-01
... a noncompetitive lease? 285.231 Section 285.231 Mineral Resources MINERALS MANAGEMENT SERVICE... described in §§ 285.640 through 285.648. (e) The MMS will coordinate and consult with affected Federal.... (1) Within 10 business days after you receive the lease copies you must: (i) Execute the lease; (ii...
2012-03-08
... Research and Production Act of 1993--ASTM International Standards Notice is hereby given that, on February..., 15 U.S.C. 4301 et seq. (``the Act''), ASTM International Standards (``ASTM'') has filed written... circumstances. Specifically, ASTM has provided an updated list of current, ongoing ASTM standards activities...
Melham, T J; Sevier, T L; Malnofski, M J; Wilson, J K; Helfst, R H
1998-06-01
This clinical case report demonstrates the clinical effectiveness of a new form of soft tissue mobilization in the treatment of excessive connective tissue fibrosis (scar tissue) around an athlete's injured ankle. The scar tissue was causing the athlete to have pain with activity, pain on palpation of the ankle, decreased range of motion, and loss of function. Surgery and several months of conventional physical therapy failed to alleviate the athlete's symptoms. As a final resort, augmented soft tissue mobilization (ASTM) was administered. ASTM is an alternative nonsurgical treatment modality that is being researched at Performance Dynamics (Muncip, IN). ASTM is a process that uses ergonomically designed instruments that assist therapists in the rapid localization and effective treatment of areas exhibiting excessive soft tissue fibrosis. This is followed by a stretching and strengthening program. Upon the completion of 6 wk of ASTM therapy, the athlete had no pain and had regained full range of motion and function. This case report is an example of how a noninvasive augmented form of soft tissue mobilization (ASTM) demonstrated impressive clinical results in treating a condition caused by connective tissue fibrosis.
Microbiological corrosion of ASTM SA105 carbon steel pipe for industrial fire water usage
Chidambaram, S.; Ashok, K.; Karthik, V.; Venkatakrishnan, P. G.
2018-02-01
The large number of metallic systems developed for last few decades against both general uniform corrosion and localized corrosion. Among all microbiological induced corrosion (MIC) is attractive, multidisciplinary and complex in nature. Many chemical processing industries utilizes fresh water for fire service to nullify major/minor fire. One such fire water service line pipe attacked by micro-organisms leads to leakage which is industrially important from safety point of view. Also large numbers of leakage reported in similar fire water service of nearby food processing plant, paper & pulp plant, steel plant, electricity board etc…In present investigation one such industrial fire water service line failure analysis of carbon steel line pipe was analyzed to determine the cause of failure. The water sample subjected to various chemical and bacterial analyses. Turbidity, pH, calcium hardness, free chlorine, oxidation reduction potential, fungi, yeasts, sulphide reducing bacteria (SRB) and total bacteria (TB) were measured on water sample analysis. The corrosion rate was measured on steel samples and corrosion coupon measurements were installed in fire water for validating non flow assisted localized corrosion. The sulphide reducing bacteria (SRB) presents in fire water causes a localized micro biological corrosion attack of line pipe.
Directory of Open Access Journals (Sweden)
Verônica Santos de Morais
2013-01-01
Full Text Available In this study, 23 biodiesel samples were produced, 20 from used cooking oil and the remaining 3 from refined soybean oil. The following properties were determined in all of the samples (oil and its respective biodiesel: density; viscosity; total acid number and ASTM color. The results indicated high correlation (R > 0.6 between ASTM color of used cooking oil and total acid number of its resultant biodiesel. This high correlation allows prediction of the quality of the biodiesel produced using a simple and fast procedure such as ASTM color.
Directory of Open Access Journals (Sweden)
Muhammad Luhung Pribadi
2016-12-01
Full Text Available This research aims to study the effect of organizational culture toward employee work discipline at Directorate Production PT Krakatau Steel (Persero Tbk Cilegon. The subjects of this research are 115 employees from several divisions at Directorate Production of PT Krakatau Steel (Persero Tbk Cilegon. The data were collected through cluster sampling technique. Instrument used are organizational culture scale, and work discipline scale. Data were analized using correlational test regression analysis technique. The result show that there is significant correlation of organizational culture for employee work discipline at Directorate Production PT Krakatau Steel (Persero Tbk Cilegon. It is shown by correlation coefficient of regression analysis as R=0,534, with effective contribution R square (R2= 0,285 or 28,5%, and significance level p = 0,000. Thus, it proves the hypothesis in this research is accepted.
30 CFR 285.607 - How do I submit my SAP?
2010-07-01
... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How do I submit my SAP? 285.607 Section 285.607... Assessment Plan and Information Requirements for Commercial Leases § 285.607 How do I submit my SAP? You must submit one paper copy and one electronic version of your SAP to MMS at the address listed in § 285.110(a). ...
International Nuclear Information System (INIS)
Anon.
1981-01-01
The recommended guide is the first American Society for Testing and Materials (ASTM) matrix in a family of such documents that combined, will help manage the development of the ASTM standards considered necessary to implement the current National Plan for Energy Research, Development, and Demonstration. It is expected that the guide will provide a framework for standards development to complement the nation's research and development in support of critical energy needs. The recommended guide identifies the energy-critical areas that are to be developed, the master ASTM recommended guide for developing the standards required to help the National Plan, the section in which each energy-critical area is covered, and the suggested ASTM lead committee responsible for each area (fossil, solar, geothermal, conservation, fusion, and fission reactor development). A comprehensive matrix to identify the areas of need for which ASTM standards will be required to help implement the National Energy Plan is also presented
Characterization of ASTM round-robin tungsten-powder samples
International Nuclear Information System (INIS)
Slettevold, C.A.; Biermann, A.H.
1975-01-01
The Lawrence Livermore Laboratory Particle Characterization Laboratory Group has participated in an industry-wide round-robin investigation on characterization of tungsten powder. sponsored by the ASTM Subcommittee on Refractory-Metal Powders (B-09.3). The analyses performed at the suggestion of the ASTM subcommittee included measurements of tap density, apparent density, true density, average particle size, and surface area. Determinations of particle-weight and size distributions were also performed and particle inspection conducted by microscopy. This report describes the equipment and procedures used and summarizes the results of these analyses. (9 tables, 17 fig) (U.S.)
ASTM standards associated with PWR and BWR power plant licensing, operation and surveillance
International Nuclear Information System (INIS)
McElroy, W.N.; McElroy, R.J.; Gold, R.; Lippincott, E.P.; Lowe, A.L. Jr.
1994-01-01
This paper considers ASTM Standards that are available, under revision, and are being considered in support of Pressurized Water Reactor (PWR) and Boiling Water Reactor (BWR) Nuclear Power Plant (NPP) licensing, regulation, operation, surveillance and life attainment. The current activities of ASTM Committee E10 and its Subcommittees E10.02 and current activities of ASTM Committee E10 and its Subcommittees E10.02 and E10.05 and their Task Groups (TG) are described. A very important aspect of these efforts is the preparation, revision, and balloting of standards identified in the ASTM E706 Standard on Master Matrix for Light Water Reactor (LWR) Pressure Vessel (PV) Surveillance Standards. The current version (E706-87) of the Master Matrix identifies 21 ASTM LWR physics-dosimetry-metallurgy standards for Reactor Pressure Vessel (RPV) and Support Structure (SS) surveillance programs, whereas, for the next revision 34 standards are identified. The need for national and international coordination of Standards Technology Development, Transfer and Training (STDTT) is considered in this and other Symposium papers that address specific standards related physics-dosimetry-metallurgy issues. 69 refs
Lifescience Database Archive (English)
Full Text Available VH (Link to library) VHI285 (Link to dictyBase) - - - Contig-U16073-1 - (Link to Or...iginal site) VHI285F 136 - - - - - - Show VHI285 Library VH (Link to library) Clone ID VHI285 (Link to dicty...Base) Atlas ID - NBRP ID - dictyBase ID - Link to Contig Contig-U16073-1 Original site URL http://dictycdb.b... DNA Score E Sequences producing significant alignments: (bits) Value N ( BJ423035 ) Dict...yostelium discoideum cDNA clone:ddv47i22, 5' ... 72 2e-27 3 ( BJ419916 ) Dictyostelium discoideum cD
The USCG/environment Canada/ASTM standards development program
International Nuclear Information System (INIS)
Whittaker, H.
1992-01-01
Environment Canada's Emergencies Engineering Division (EED) has been charged, as a result of the Public Review Panel on Tanker Safety and Marine Emergency Response report, with increased R ampersand D in marine oil spills. This activity will, of necessity, include development of standards and guidelines for the testing and/or usage of oil spill cleanup equipment. The United States Coast Guard (USCG) has been charged with implementing the provisions of the Oil Pollution Act of 1990 (OPA-90), as it pertains to marine transportation vessels and facilities. Among the provisions are requirements for vessel and facility owners and operators to develop comprehensive response plans that specifically match response resources to spill removal requirements. Meeting the response plan provisions of OPA-90 requires common standards for testing, selecting and assigning resources to anticipated response needs and objectively evaluating response plans for adequacy. In August of 1991, the USCG OPA-90 office approached ASTM to determine the feasibility of developing standards through that organizations procedures. Meetings were then held between the OPA-90 staff and members of the ASTM Committee F-20 on Hazardous Substances and Oil Spill Response. An agreement was reached to commence standards development in the areas of: Barriers, Skimmers, Treating Agents, Pumps, Beach Clean-up, Sorbents, Bioremediation, In-situ Burning, Temporary Storage Devices, Communications, Remote Sensing. It was recognized that ASTM and other organizational standards existed in several of these areas, but there were those where none were known to exist. Standards development was, therefore, expected to be a complicated and time-consuming process. Both the USCG OPA-90 and EC/EED offices required standards to be developed quickly, without subverting the ASTM process. Mechanical containment and recovery was considered to be the primary area of concern for both groups
Annealing effect on restoration of irradiation steel properties
International Nuclear Information System (INIS)
Vishkarev, O.M.; Kolesova, T.N.; Myasnikova, K.P.; Pecherin, A.M.; Shamardin, V.K.
1986-01-01
The effect of temperature and annealing time on the restoration of properties of the 15Kh2NMFAA and 15Kh2MFA steels after irradiation at 285 deg with the fluence of 6x10 23 neutr/m 2 (E>0.5 MeV) is studied. Microhardness (H μ ) restoration in the irradiated 15Kh2NMFAA steel is shown to start from 350 deg C annealing temperature. The complete microhardness restoration is observed at the annealing temperature of 500 deg C for 10 hours
Practical measurement of silicon in low alloy steels by differential pulse stripping voltammetry
International Nuclear Information System (INIS)
Rahier, A.; Lunardi, S.; Triki, C.
2005-01-01
A sensitive differential pulse anodic stripping voltammetry has been adapted to allow the determination of Si in low-alloy steels using a hanging mercury drop electrode. The method has been qualified using certified ASTM standards and is now running in routine. The present report describes the experimental details, thereby allowing the reader to carry out the measurements precisely. (author)
Standard guide for high-resolution gamma-ray spectrometry of soil samples. ASTM standard
International Nuclear Information System (INIS)
1998-12-01
This guide is under the jurisdiction of ASTM Committee C-26 on Nuclear Fuel Cycle and is the direct responsibility of Subcommittee C26.05 on Methods of Test. The current edition was approved on Jul. 10, 1998. It was published in December 1998. Copyright American Society for Testing and Materials (ASTM), 100 Barr Harbor Drive, West Conshohocken, PA, 19428, USA. This document is available from NTIS under license from ASTM
Effect of the radiation in the reference temperature T0 in ferritic steel
International Nuclear Information System (INIS)
Villanueva O, A.; Gachuz M, M.E.
2004-01-01
The present work studies the effect that produces the irradiation in ferritic steels (AISI 8620) on the reference temperature (T 0 ) that characterizes the tenacity to the fractures (K JC ) of these materials obtaining this way a characteristic curve (Master Curve) of this steel. The approach of the 'Master curve' is based on the Astm E-1921. Following this standard the methodology of a sub size settled down in Charpy type test tubes. Due to this type of steels is used mainly in pressure vessels of the reactor in Nuclear Power plants, the fracture tenacity gives the rule at the moment for the verification of structural integrity of the pressure vessel of the reactor. (Author)
Tannin bark Melalauca cajuputi powell (gelam) as green corrosion inhibitor of mild steel
Energy Technology Data Exchange (ETDEWEB)
Talib, Nur Atiqah Abu; Zakaria, Sarani; Hua, Chia Chin; Othman, Norinsan Kamil [School of Applied Physic, Faculty Science and Technology, Universiti Kebangsaan Malaysia, 43600 UKM Bangi, Selangor (Malaysia)
2014-09-03
Tannin was extracted from gelam bark and used to produce corrosion inhibitor for mild steel. Tannin was extracted from gelam bark using 70% aqueous acetone for 6 hour. Tannin powder was characterization using fourier transform infrared spectroscopy to analyse chemical component in tannin and Scanning electron microscope (SEM) for tannin physical structure. The tannin effect on the corrosion inhibition of mild steel has been investigated in 1Mol HCl solution for 6 hour followed ASTM. The weight loss method were applied to study the mild steel corrosion behavior in the present and absend of different concentration of tannin (250, 300, 350)ppm. Tannin act good inhibitor as corrosion inhibitor for mild steel in acid medium. Surface morphology of carbon steel with and without inhibitor was investigated by scanning electron microscopy.
Determination of ASTM 1016 structural welded joints fracture toughness through J integral
International Nuclear Information System (INIS)
Martins, Geraldo de Paula; Villela, Jefferson Jose; Terra, Jose Lucio; Rabello, Emerson Giovani; Martins, Geraldo Antonio Scoralick; Carneiro, Jose Rubens Goncalves
2009-01-01
Fracture toughness is an important parameter for studies of materials behavior in nuclear and conventional industry. Crack propagation resistance is, in general, evaluate using one of the fracture mechanics parameters K IC , for the case of the materials that exhibits a linear elastic behavior, the CTOD (crack tip opening displacement) and J IC , the critical value of J Integral, for the case of materials with elastic-plastic behavior. On this work the fracture mechanics parameters of the ASTM 1016 structural steel welded joints were obtained, using the J Integral. Charpy V tests at several temperatures were also obtained, with the purpose to obtain the curves of ductile-brittle of the regions of the welded joints: Base Metal, (MB), and Melted Zone (MZ). The joints were welded by Gas Metal Arc Welding (GMAW) with V bevel for evaluation the MZ toughness properties. The tests were accomplished at temperatures varying from -100 deg C to 100 deg C using the technical of compliance variation for J IC determination, the critical value that defines the initial stable crack growth, that applies to brittle and ductile materials. The J Integral alternative specimens has square cross section 10mmX10mm, according ASTM E 1820, with notch localized respectively at the BM and MZ. After the tests, the specimens fractured were analyzed in a scanning microscopic electronic (SME) for verification of the fracture surface. The fractography of the specimens at elevated temperatures presented dimples at the region of stable crack growth, characteristic of ductile fracture. The results of J Integral and Charpy V presented a good correlation between these two parameters. From these correlations it can be concluded that in some applications, the use Charpy V energy to infer fracture toughness can be substitute the Integral J tests. (author)
International Nuclear Information System (INIS)
Cheruvu, N.S.; Seth, B.B.
1989-01-01
The influences of impurity levels, grain size, and tensile strength on in-service temper embrittlement of CrMoV steels have been investigated. The samples for this study were taken from steam turbine CrMoV rotors which had operated for 15 to 26 years. The effects of grain size and tensile strength on embrittlement susceptibility were separated by evaluating the embrittlement behavior of two rotor forgings made from the same ingot after an extended step-cooling treatment. Among the residual elements in the steels, only P produces a significant embrittlement. The variation of P and tensile strength has no effect on in-service temper embrittlement susceptibility, as measured by the shift in fracture appearance transition temperature (FATT). However, the prior austenite grain size plays a major role in service embrittlement. The fine grain steels with a grain size of ASTM No. 9 or higher are virtually immune to in-service embrittlement. In steels having duplex grain sizes, embrittlement susceptibility is controlled by the size of coarser grains. For a given steel chemistry, the coarse grain steel is more susceptible to in-service embrittlement, and a decrease in ASTM grain size number from 4 to 0/1 increases the shift in FATT by 61 degrees C (10/10 degrees F). It is demonstrated that long-term service embrittlement can be simulated, except in very coarse grain steels, by using the extended step-cooling treatment. The results of step-cooling studies show that the coarse grain rotor steels take longer time during service to reach a fully embrittled state than the fine grain rotor steels
ASTM standards for fire debris analysis: a review.
Stauffer, Eric; Lentini, John J
2003-03-12
The American Society for Testing and Materials (ASTM) recently updated its standards E 1387 and E 1618 for the analysis of fire debris. The changes in the classification of ignitable liquids are presented in this review. Furthermore, a new standard on extraction of fire debris with solid phase microextraction (SPME) was released. Advantages and drawbacks of this technique are presented and discussed. Also, the standard on cleanup by acid stripping has not been reapproved. Fire debris analysts that use the standards should be aware of these changes.
Inhibiting pitting corrosion in carbon steel exposed to dilute radioactive waste slurries
International Nuclear Information System (INIS)
Zapp, P.E.; Hobbs, D.T.
1991-01-01
Dilute caustic high-level radioactive waste slurries can induce pitting corrosion in carbon steel. Cyclic potentiodynamic polarization tests were conducted in simulated and actual waste solutions to determine minimum concentrations of sodium nitrate which inhibit pitting in ASTM A537 class 1 steel exposed to these solutions. Susceptibility to pitting was assessed through microscopic inspection of specimens and inspection of polarization scans. Long-term coupon immersion tests were conducted to verify the nitrite concentrations established by the cyclic potentiodynamic polarization tests. The minimum effective nitrite concentration is expressed as a function of the waste nitrate concentration and temperature
Porosity Defect Remodeling and Tensile Analysis of Cast Steel
Directory of Open Access Journals (Sweden)
Linfeng Sun
2016-02-01
Full Text Available Tensile properties on ASTM A216 WCB cast steel with centerline porosity defect were studied with radiographic mapping and finite element remodeling technique. Non-linear elastic and plastic behaviors dependent on porosity were mathematically described by relevant equation sets. According to the ASTM E8 tensile test standard, matrix and defect specimens were machined into two categories by two types of height. After applying radiographic inspection, defect morphologies were mapped to the mid-sections of the finite element models and the porosity fraction fields had been generated with interpolation method. ABAQUS input parameters were confirmed by trial simulations to the matrix specimen and comparison with experimental outcomes. Fine agreements of the result curves between simulations and experiments could be observed, and predicted positions of the tensile fracture were found to be in accordance with the tests. Chord modulus was used to obtain the equivalent elastic stiffness because of the non-linear features. The results showed that elongation was the most influenced term to the defect cast steel, compared with elastic stiffness and yield stress. Additional visual explanations on the tensile fracture caused by void propagation were also given by the result contours at different mechanical stages, including distributions of Mises stress and plastic strain.
Energy Technology Data Exchange (ETDEWEB)
Kohlar, Stefanie
2017-07-01
The heat-resistant chromium steel X10CrMoVNb9-1 specified as P91 is based on its good properties at high temperatures and high mechanical Stresses as a potential material for use as reactor pressure vessel material in fourth generation nuclear reactors. Subject of this work was the characterization of the microstructure and mechanical properties of this material. For this purpose it was metallographically examined and technically important characteristic values were determined. Different etching methods and imaging techniques were used, with the method of oxalic acid etching newly applied to this material providing meaningful results. Tensile tests, hardness tests and notched bar impact tests provided mechanical-technological characteristics. The fracture mechanical behavior was determined by means of fracture mechanics tests on bending and compact tensile tests. The main focus was on the investigation of the applicability of the evaluation methods described in standards ASTM 1921 and ASTM 1820 for low alloy steels. The investigations showed that the P91 is expected to have a homogeneous martensitic structure consisting of annealed martensite with embedded carbides and carbonitrides. The location and size of the found carbides could be represented by the process of oxalic acid etching newly applied to this material. The mechanical-technological tests showed a good strength and toughness behavior typical for tempered steel. The application of the linear-elastic fracture mechanics and the yielding fracture mechanics made it possible to determine a reference temperature according to ASTM 1921-08a, but also showed that the evaluation methods and geometries described for this high-alloy steel in ASTM 1820-08 do not lead to valid material characteristics. In order to determine the suitability of this material for nuclear applications, the irradiation and creep behavior of the P91 should be characterized more precisely in further investigations. [German] Der als P91
2010-06-01
... Production Act of 1993--ASTM International Notice is hereby given that, on May 6, 2010, pursuant to Section 6... Act''), ASTM International (``ASTM'') has filed written notifications simultaneously with the Attorney... recovery of antitrust plaintiffs to actual damages under specified circumstances. Specifically, ASTM has...
Ballistic Characterization Of A Typical Military Steel Helmet
Directory of Open Access Journals (Sweden)
Mohamed Ali Maher
2017-08-01
Full Text Available In this study the ballistic limit of a steel helmet against a FMJ 919 mm caliber bullet is estimated. The helmet model is the typical polish helmet wz.31.The helmet material showed high strength low alloy steel material of 0.28 carbon content and 9.125 kgm2 areal density. The tensile test according to ASTM E8 showed a tensile strength of 1236.4 MPa .The average hardness value was about HV550. First shooting experiment has been executed using a 9 mm pistol based on 350 ms muzzle velocity at 5m against the simply supported helmet complete penetrations rose in this test were in the form of cracks on the helmet surface and partial penetrations were in the form of craters on the surface whose largest diameter and depth were 43 mm and 20.2 mm consequently .The second experiment was on a rifled gun arrangement 13 bullets of 919 mm caliber were shot on the examined simply supported steel helmet at a zero obliquity angle at different velocities to determine the ballistic limit velocity V50 according to MIL-STD-662F. Three major outcomes were revealed 1 the value V50 which found to be about 390 ms is higher than the one found in literature 360 ms German steel helmet model 1A1. 2 The smallest the standard deviation of the mixed results zone data the most accurate the ballistic limit is. 3Similar to the performance of blunt-ended projectiles impacting overmatching targets tD near 11 or larger It was found that the dominating failure mode of the steel helmet stuck by a hemispherical-nose projectile was plugging mode despite of having tD ratio of about 19 undermatching.
2016-08-10
IM/CLO) FROM ASTM STANDARD SINGLE WIND VELOCITY MEASURES DISCLAIMER The opinions or assertions contained herein are the private views of the...USARIEM TECHNICAL REPORT T16-14 METHOD FOR ESTIMATING EVAPORATIVE POTENTIAL (IM/CLO) FROM ASTM STANDARD SINGLE WIND VELOCITY... ASTM STANDARD SINGLE WIND VELOCITY MEASURES Adam W. Potter Biophysics and Biomedical Modeling Division U.S. Army Research Institute of Environmental
Corrosion of steel tendons used in prestressed concrete pressure vessels
International Nuclear Information System (INIS)
Griess, J.C.; Naus, D.J.
The purpose of this investigation was to determine the corrosion behavior of a high strength steel (ASTM A416-74 grade 270), typical of those used as tensioning tendons in prestressed concrete pressure vessels, in several corrosive environments and to demonstrate the protection afforded by coating the steel with either of two commercial petroleum-base greases or Portland Cement grout. In addition, the few reported incidents of prestressing steel failures in concrete pressure vessels used for containment of nuclear reactors are reviewed. The susceptibility of the steel to stress corrosion cracking and hydrogen embrittlement and its general corrosion rate were determined in several salt solutions. Wires coated with the greases and grout were soaked for long periods in the same solutions and changes in their mechanical properties were subsequently determined. All three coatings appeared to give essentially complete protection but small flaws in the grease coatings were detrimental; flaws or cracks less than 1 mm wide in the grout were without effect
Elevated temperature tensile properties of borated 304 stainless steel
International Nuclear Information System (INIS)
Stephens, J.J.; Sorenson, K.B.; McConnell, P.
1993-01-01
This paper presents a comparison of the tensile properties of Powder Metallurgy (PM) 'Grade A' material with that of the conventional IM 'Grade B' material for two selected Types (i.e., boron contents) as defined by the ASTM A887 specification: Types 304B5 and 304B7. Tensile properties have been generated for these materials at temperatures ranging from room temperature to 400degC (752degF). The data at higher temperatures are required for ASME Code Case purposes, since the use temperature of a basket under 'worst case' cask conditions may be as high as 343degC (650degF), due to self-heating by the activated fuel elements. We will also discuss the current status of efforts aimed at obtaining an ASME Boiler and Pressure Vessel Code Case for selected grades of borated stainless steel covered by the ASTM A887 specification. (J.P.N.)
30 CFR 285.1000 - What activities does this subpart regulate?
2010-07-01
... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What activities does this subpart regulate? 285.1000 Section 285.1000 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR... Activities § 285.1000 What activities does this subpart regulate? (a) This subpart provides the general...
Niobium stainless steel for implants
International Nuclear Information System (INIS)
Rollo, J.M.D.A.
1983-01-01
The materials that have often been used, during the last two or three decades, to carry out materials for implants are made according to the specifications: a)A.S.T.M. (F.55-76, F.56-76, F.138-76, F.139-76) stainless steel b)A.S.T.M. (F.75-76), cobalt-chromium-molybdenum alloys. c)A.S.T.M. (F.90-76), cobalt-chromium-tungsten-nickel alloys. d)A.S.T.M. (F.67-77), unalloyed titanium. e)A.S.T.M. (F.136-70), titanium alloys. It was the purpose of retaking them, toverify the niobium influence as alloy element in ANSI/ASTM F.55-76 classification stainless steels, usually for these materials elaboration. The problem by substituting molybdenum total or partially for niobium, by comparing the mechanical and corrosion properties, and biocompatibility is presented, by pointing out the variables of these substitutions, when we employ this new material to perform materials for implants. (Author) [pt
ASTM Validates Air Pollution Test Methods
Chemical and Engineering News, 1973
1973-01-01
The American Society for Testing and Materials (ASTM) has validated six basic methods for measuring pollutants in ambient air as the first part of its Project Threshold. Aim of the project is to establish nationwide consistency in measuring pollutants; determining precision, accuracy and reproducibility of 35 standard measuring methods. (BL)
Verification of the ASTM G-124 Purge Equation
Robbins, Katherine E.; Davis, Samuel Eddie
2009-01-01
ASTM G-124 seeks to evaluate combustion characteristics of metals in high-purity (greater than 99%) oxygen atmospheres. ASTM G-124 provides the following equation to determine the minimum number of purges required to reach this level of purity in a test chamber: n = -4/log10(Pa/Ph), where "n" is the total number of purge cycles required, Ph is the absolute pressure used for the purge on each cycle and Pa is the atmospheric pressure or the vent pressure. The origin of this equation is not known and has been the source of frequent questions as to its accuracy and reliability. This paper shows the derivation of the G-124 purge equation, and experimentally explores the equation to determine if it accurately predicts the number of cycles required.
2011-01-10
... Production Act of 1993-ASTM International Notice is hereby given that, on December 6, 2010, pursuant to.... (``the Act''), ASTM International (``ASTM'') has filed written notifications simultaneously with the...
Effect of aging on impact properties of ASTM A890 Grade 1C super duplex stainless steel
International Nuclear Information System (INIS)
Martins, Marcelo; Forti, Leonardo Rodrigues Nogueira
2008-01-01
Super duplex stainless steels in the solution annealed condition are thermodynamically metastable systems which, when exposed to heat, present a strong tendency to 'seek' the most favorable thermodynamic condition. The main purpose of this study was to characterize the microstructure of a super duplex stainless steel in the as cast and solution annealed conditions, and to determine the influence of aging heat treatments on its impact strength, based on Charpy impact tests applied to V-notched test specimens. The sigma phase was found to begin precipitating at heat treatment temperatures above 760 deg. C and to dissolve completely only above 1040 deg. C, with the highest peak concentration of this phase appearing at close to 850 deg. C. Heat treatments conducted at temperatures of 580 deg. C to 740 deg. C led to a reduction of the energy absorbed in the Charpy impact test in response to the precipitation of a particulate phase with particle sizes ranging from 0.5 μm to 1.0 μm, with a chromium and iron-rich chemical composition
Irradiation damage behavior of low alloy steel wrought and weld materials
International Nuclear Information System (INIS)
Stofanak, R.J.; Poskie, T.J.; Li, Y.Y.; Wire, G.L.
1993-01-01
A study was undertaken to evaluate the irradiation damage response of several different types of low alloy steel: vintage type ASTM A302 Grade B (A302B) plates and welds containing different Ni and Cu concentrations, 3.5% Ni steels similar to ASTM A508 Class 4, welds containing about 1% Ni (similar to type 105S), and 3.5% Ni steels with ''superclean'' composition. All materials were irradiated at several different irradiation damage levels ranging from 0.0003 to 0.06 dpa at 232C (450F). Complete Charpy V-notch impact energy transition temperature curves were generated for all materials before and after irradiation to determine transition temperature at 4IJ (30 ft-lb) or 47J (35 ft-lb) and the upper shelf energy. Irradiation damage behavior was measured by shift in Charpy 41J or 47J transition temperature (ΔTT4 41J or ΔTT 47J ) and lowering of upper shelf Charpy energy at a given irradiation damage level. It was found that chemical composition greatly influenced irradiation damage behavior; highest irradiation damage (greatest ΔTT) was found in an A302B type weld containing 1.28% Ni and 0.20% Cu while the least damage was found in 3.5% Ni, 0.05% Cu, superclean wrought materials. Combination of Ni and Cu was found to affect irradiation damage behavior at higher irradiation damage levels in the A302B welds where the 1.28% Ni, 0.20% Cu weld showed more damage than a 0.60% Ni, 0.31% Cu weld. For the 3.5% Ni steels, fabrication influenced irradiation behavior in that a silicon (Si) killed material showed greater irradiation damage than a low silicon material. In general, the 3.5% Ni materials with low copper showed less irradiation damage than the A302B materials
International Nuclear Information System (INIS)
Druce, S.G.
1982-02-01
Results obtained at AERE Harwell as part of the first phase of the European Group on Fracture round robin activity into ductile crack initiation detection are presented and discussed. Data are analysed using the current ASTM Jsub(IC) testing procedure and by an alternative procedure. Difficulties in the definition of 'initiation' are highlighted and deficiencies of the ASTM procedure exposed. The ASTM Jsub(IC) value for 2 1/4 Cr 1 Mo steel was determined as 0.21 MN/m. The alternative procedure provides a more accurate evaluation of the 'initiation' value of J, that is, at the point of crack advance in excess of that due to crack tip blunting. Using this procedure the 'initiation' value, Jsub(i), was measured as 0.14 MN/m. (author)
Demonstration/Validation of Tertiary Butyl Acetate (TBAC) for Hand Wipe Cleaning Applications
2010-10-01
Visual Inspection Pass Materials Compatibility - Metals Total Immersion Corrosion – none Material Mg (AZ 31B-H24, SAE AMS...plated steel (ASTM A 153) Carbon steel (ASTM A 36) 4140 alloy steel (ASTM A 29) Al (6061, ASTM B 209...constructed from clad aluminum alloy 2024 (T3 temper) conforming to SAE -AMS-QQ-A-250/5, with dimensions of 6 by 3 by 0.025 inch (150 by 76 by 0.6 mm
2015-11-05
Undissolved Water in Aviation Turbine Fuels per ASTM D3240 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) Joel Schmitigal... water ) in Aviation Turbine Fuels per ASTM D3240 15. SUBJECT TERMS fuel, JP-8, aviation fuel, contamination, free water , undissolved water , Aqua-Glo 16...Michigan 48397-5000 Evaluation of Instrumentation for Measuring Undissolved Water in Aviation Turbine Fuels per ASTM D3240 Joel Schmitigal Force
30 CFR 285.613 - How will MMS process my SAP?
2010-07-01
... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How will MMS process my SAP? 285.613 Section... Requirements Contents of the Site Assessment Plan § 285.613 How will MMS process my SAP? (a) The MMS will review your submitted SAP, and additional information provided pursuant to § 285.611, to determine if it...
30 CFR 285.628 - How will MMS process my COP?
2010-07-01
... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How will MMS process my COP? 285.628 Section... Requirements Contents of the Construction and Operations Plan § 285.628 How will MMS process my COP? (a) The MMS will review your submitted COP, and the information provided pursuant to § 285.627, to determine...
Corrosion Protection Of Mild Steel In Sea Water Using Chemical Inhibitor
Araoyinbo, Alaba O.; Salleh, Mohd Arif Anuar Mohd; Zulerwan Jusof, Muhammad
2018-03-01
The effect of sodium nitrite as a corrosion inhibitor of mild steel in sea water (i.e ASTM standard prepared sea water and sea water obtained from a local river) was investigated, using the weight loss technique. Different amount of sodium nitrite were prepared (i.e 2 % to 10 %) in the inhibition of the mild steel corrosion in sea water exposed to irradiation condition from sunlight exposure. The cut samples of mild steel were exposed to these corrosive media and the corresponding weight loss subsequently obtained was recorded at intervals of 1 to 4 weeks. It was observed that corrosion rate increases with the time of exposure to the corrosive medium exposed to sunlight and that sodium nitrite that was used at the chemical inhibitor was able to retard the corrosion rate of mild steel if the appropriate concentration is applied. The results obtained from the weight loss analysis shows that the optimum percentage of sodium nitrate in sea water that gives the optimum corrosion inhibition of mild steel is 4 %.
Influence of sigma-phase formation on the localized corrosion behavior of a duplex stainless steel
International Nuclear Information System (INIS)
Adhe, K.N.; Kain, V.; Madangopal, K.; Gadiyar, H.S.
1996-01-01
Because of their austenitic-ferritic microstructures, duplex stainless steels offer a good combination of mechanical and corrosion resistance properties. However, heat treatments can lower the mechanical strength of these stainless steels as well as render them susceptible to intergranular corrosion (IGC) and pitting corrosion. In this study, a low-carbon (0.02%) duplex stainless steel is subjected to various heat treatments at 450 to 950 C for 30 min to 10 h. The heat-treated samples than undergo ASTM IGC and pitting corrosion tests, and the results are correlated with the microstructures obtained after each heat treatment. In the absence of Cr 23 C 6 precipitation, σ-phase precipitates render this duplex stainless steel susceptible to IGC and pitting corrosion. Even submicroscopic σ-phase precipitates are deleterious for IGC resistance. Longer-duration heat treatments (at 750 to 850 C) induce chromium diffusion to replenish the chromium-depleted regions around the σ-phase precipitates and improve IGC resistance; pitting resistance, however, is not fully restored. Various mechanisms of σ-phase formation are discussed to show that regions adjacent to σ-phase are depleted of chromium and molybdenum. The effect of chemical composition (pitting resistance equivalent) on the pitting resistance of various stainless steels is also noted
30 CFR 285.907 - How will MMS process my decommissioning application?
2010-07-01
... application? 285.907 Section 285.907 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR OFFSHORE RENEWABLE ENERGY ALTERNATE USES OF EXISTING FACILITIES ON THE OUTER CONTINENTAL SHELF Decommissioning Decommissioning Applications § 285.907 How will MMS process my decommissioning application? (a...
International Nuclear Information System (INIS)
Stephens, J.J.; Sorenson, K.B.; McConnell, P.
1992-01-01
Conventional cast and wrought (open-quotes Ingot Metallurgyclose quotes) borated 304 stainless steel has been used for a number of years in spent fuel storage applications where a combination of structural integrity and neutron criticality control are required. Similar requirements apply for materials used in transport cask baskets. However, in the high boron contents (>1.0 wt. %) which are most useful for criticality control, the conventional cast and wrought material suffers from low ductility as well as low impact toughness. The microstructural reason for these poor properties is the relatively coarse size of the boride particles in these alloys, which act as sites for crack initiation. Recently, a open-quotes premiumclose quotes grade of borated 304 stainless steel has been introduced (Strober and Smith, 1988) which is made by a Powder Metallurgy (PM) process. This material has greatly improved ductility and impact properties relative to the conventional cast and wrought product. In addition, an ASTM specification (ATSM A887) has been developed for borated stainless steel, containing 8 different material Types with respect to boron content - with the highest level (Type B7) having permissible range from 1.75 to 2.25 wt. % boron - and each Type contains two different Grades of material based on tensile and impact properties. While the ASTM specification is properties-based and does not require a specific production process for a particular grade of material, the PM material qualifies as open-quotes Grade Aclose quotes material while the conventional Ingot Metallurgy (IM) material generally qualifies as open-quotes Grade Bclose quotes material. This paper presents a comparison of the tensile properties of PM open-quotes Grade Aclose quotes material with that of the conventional IM open-quotes Grade Bclose quotes material for two selected Types (i.e., boron contents) as defined by the ASTM A887 specification: Types 304B5 and 304B7
HACCP: Integrating Science and Management through ASTM Standards
From a technical perspective, hazard analysis-critical control point (HACCP) evaluation may be considered a risk management tool suited to a wide range of applications. As one outcome of a symposium convened by American Society for Testing and Materials (ASTM) in August, 2005, th...
Use of ASTM D5304 in assessing unstable diesel fuel
Energy Technology Data Exchange (ETDEWEB)
Turner, L.M.; Martin, C.J. [Defense Fuel Supply Center, Alexandria, VA (United States); Beal, E.J.; Hardy, D.R. [Naval Research Lab., Washington, DC (United States)
1995-05-01
The storage stability, or the length of time a fuel can be stored, is of great concern to diesel fuel users. This paper reports on the use of the new ASTM accelerated test for storage stability by oxygen overpressure (D5304) to predict future storage life span of 63,000,000 gallons of a diesel fuel for US Naval vessel use. This paper demonstrates the use of ASTM D5304 at storage times of 16, 40 and 96 hours to accurately determine the length of time that this large quantity of diesel fuel could be stored at ambient temperatures before the maximum allowable amount of particulate contamination was reached.
30 CFR 285.534 - When may MMS cancel my bond?
2010-07-01
... 30 Mineral Resources 2 2010-07-01 2010-07-01 false When may MMS cancel my bond? 285.534 Section 285.534 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR OFFSHORE RENEWABLE... Assurance Requirements Changes in Financial Assurance § 285.534 When may MMS cancel my bond? When your lease...
International Nuclear Information System (INIS)
Gerischer, K.
1986-01-01
The article explains the significant role of ASTM and marks out basic elements of the specification system of ASTM standards. Usefulness in practice is taken as the main criterion for the subsequent comparison of ASTM or DIN activities and procedures, and results, for standardization in the field of test methods for metallic materials. The main differences are shown to exist with regard to tropicality of test standards, presentation of useful information and background knowledge, and importance attached to formal questions. ASTM standardization work is shown to be more up-to-date, contain more information, and to be less concerned with formal matters. A closer cooperation between ASTM and DIN is strongly recommended. (orig.) [de
Stainless steel recycle FY94 progress report
International Nuclear Information System (INIS)
Imrich, K.J.
1994-01-01
The Materials Technology Section (MTS) of the Savannah River Technology Center (SRTC) was asked to demonstrate the practicality of recycling previously contaminated stainless steel components such as reactor heat exchanger heads, process water piping and slug buckets into 208 liters (55 gallon) drums and 2.8 cubic meter (100 ft 3 ) storage boxes. Radioactively contaminated stainless steel scrap will be sent to several industrial partners where it will be melted, decontaminated/cast into ingots, and rolled into plate and sheet and fabricated into the drums and boxes. As part of this recycle initiative, MTS was requested to demonstrate that radioactively contaminated Type 304L stainless steel could be remelted and cast to meet the applicable ASTM specification for fabrication of drums and boxes. In addition, MTS was requested to develop the technical basis of melt decontamination and establish practicality of using this approach for value added products. The findings presented in this investigation lead to the following conclusions: recycle of 18 wt% Cr-8 wt% Ni alloy can be achieved by melting Type 304 stainless steel in a air vacuum induction furnace; limited melt decontamination of the contaminated stainless steel was achieved, surface contamination was removed by standard decontamination techniques; carbon uptake in the as-cast ingots resulted from the graphite susceptor used in this experiment and is unavoidable with this furnace configuration. A new furnace optimized for melting stainless steel has been installed and is currently being tested for use in this program
Conversion of MX Nitrides to Modified Z-Phase in 9-12%Cr Ferritic Steels
DEFF Research Database (Denmark)
Cipolla, Leonardo
for Z-phase formation was highlighted during the studies. Several 9-12%Cr commercial steels with prolonged high-temperature exposures have been investigated, too. The same mechanism of Z-phase formation observed in 12%Cr model alloys was identified in industrial 9-12%Cr steels after thousands of hours......The 9-12%Cr ferritic steels are extensively used in modern steam power plants at service temperature up to 620°C. Currently the best perform ing ferritic creep resistance steel is the ASTM Grade 92, whose high temperature strength has recently been assessed by European Creep Collaborative Committee...... in 2005 as 600°C/113MPa/10 5h. All previous attempts made in the last twenty years to develop ferritic steels for 650°C applications have failed due to the incapacity to combine the superior oxidation resistance, given by 12%Cr content, with excellent creep resistance of high-alloyed ferritic steels...
Okeniyi, Joshua Olusegun; Omotosho, Olugbenga Adeshola; Popoola, Abimbola Patricia Idowu; Loto, Cleophas Akintoye
2016-07-01
This paper investigates Phyllanthus muellerianus leaf-extract and C6H15NO3 (triethanolamine: TEA) synergistic effects on reinforcing-steel corrosion-inhibition and the compressive-strength of steel-reinforced concrete immersed in 0.5 M H2SO4. This is to assess suitability of the synergistic admixture usage for wind-energy steel-reinforced concrete structures designed for industrial environments. Steel-reinforced concrete specimens were admixed with individual and synergistic designs of Phyllanthus muellerianus leaf-extract and C6H15NO3 admixtures and immersed in the 0.5 M H2SO4. Electrochemical monitoring of corrosion potential, as per ASTM C876-91 R99, and corrosion current were obtained and statistically analysed, as per ASTM G16-95 R04, for modelling noise resistance. Post-immersion compressive-strength testing then followed, as per ASTM C39/C39M-03, for detailing the admixture effect on load-bearing strength of the steel-reinforced concrete specimens. Results showed that while individual Phyllanthus muellerianus leaf-extract concentrations exhibited better inhibition-efficiency performance than C6H15NO3, synergistic additions of C6H15NO3 to Phyllanthus muellerianus leaf-extract improved steel-rebar corrosion-inhibition. Thus, 6 g Phyllanthus muellerianus + 2 g C6H15NO3 synergistically improved inhibition-efficiency to η = 84.17%, from η = 55.28% by the optimal chemical or from η = 74.72% by the optimal plant-extract admixtures. The study also established that improved compressive strength of steel-reinforced concrete with acceptable inhibition of the steel-rebar corrosion could be attained through optimal combination of the Phyllanthus muellerianus leaf-extract and C6H15NO3 admixtures.
Electrochemical Methods for the Intergranular Corrosion Property Evaluation of Stainless Steels
International Nuclear Information System (INIS)
Lee, Jung Bok
1987-01-01
For the last fifteen years, the Electrochemical Potentiokinetic Reactivation (EPR) method, an electrochemical method, has been actively investigated for use in determining the degree of sensitization (DOS) in stainless steels (a metallurgical structure susceptible to intergranular corrosion). One of the reasons for this active investigation was due to the fact that the technique may be usable for field nondestructive measurements of DOS in stainless steels. In this paper, a brief overview of the technique, including the advantages and limitations, is discussed. Then, a new test method which is able to detect the sensitized metallurgical structures nondestructively after field welding is introduced. This new nondestructive method is a modification of the ASTM A262-A (the oxalic acid etch test). The improved test method employs a 30 second etching in a 10% oxalic acid solution under an anodic current density of 1 ampere per square centimeter at the temperatures above 60 .deg. C. Between 50 and 60 .deg. C the thirty second etching test should be used first. When the thirty second etching shows an under etched grain boundary, the etching time should be increased to ninety seconds. At temperatures below 50 .deg. C the ninety second etching, as described in ASTM A 262-A, should be employed. This improved test method can be used in the temperature range of 0 and 100 .deg. C
Energy Technology Data Exchange (ETDEWEB)
Halim, Zakiah Abd [Universiti Teknikal Malaysia Melaka (Malaysia); Jamaludin, Nordin; Junaidi, Syarif [Faculty of Engineering and Built, Universiti Kebangsaan Malaysia, Bangi (Malaysia); Yahya, Syed Yusainee Syed [Universiti Teknologi MARA, Shah Alam (Malaysia)
2015-04-15
Current steel tubes inspection techniques are invasive, and the interpretation and evaluation of inspection results are manually done by skilled personnel. This paper presents a statistical analysis of high frequency stress wave signals captured from a newly developed noninvasive, non-destructive tube inspection technique known as the vibration impact acoustic emission (VIAE) technique. Acoustic emission (AE) signals have been introduced into the ASTM A179 seamless steel tubes using an impact hammer, and the AE wave propagation was captured using an AE sensor. Specifically, a healthy steel tube as the reference tube and four steel tubes with through-hole artificial defect at different locations were used in this study. The AE features extracted from the captured signals are rise time, peak amplitude, duration and count. The VIAE technique also analysed the AE signals using statistical features such as root mean square (r.m.s.), energy, and crest factor. It was evident that duration, count, r.m.s., energy and crest factor could be used to automatically identify the presence of defect in carbon steel tubes using AE signals captured using the non-invasive VIAE technique.
46 CFR 56.01-2 - Incorporation by reference.
2010-10-01
... Welded Ferritic and Martensitic Stainless Steel Tubing for General Service (“ASTM A 268”), 56.60-1; (21) ASTM A 276-98, Standard Specification for Stainless Steel Bars and Shapes (“ASTM A 276”), 56.60-2; (22... (27) ASME B36.19M-2004 Stainless Steel Pipe (2004) (“ASME B36.19M”), 56.07-5; 56.60-1. (28) ASME SA...
30 CFR 285.905 - When must I submit my decommissioning application?
2010-07-01
... application? 285.905 Section 285.905 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR OFFSHORE RENEWABLE ENERGY ALTERNATE USES OF EXISTING FACILITIES ON THE OUTER CONTINENTAL SHELF Decommissioning Decommissioning Applications § 285.905 When must I submit my decommissioning application? You must...
S. Verrill; D. Kretschmann
2012-01-01
It is generally accepted that there should be an upward repetitive member allowable property adjustment. ASTM D245 (2011c) and ASTM D1990 (2011b) specify a 1.15 factor for allowable bending stress. This factor is also listed in ASTM D6555 (2011a, Table 1). In this technical note, sources of confusion regarding appropriate repetitive member factors are identified. This...
Stress corrosion cracking for 316 stainless steel clips in a condensate stabilizer
Energy Technology Data Exchange (ETDEWEB)
Al-Awar, A.; Aldajah, S.; Harhara, A. [Department of Mechanical Engineering, United Arab Emirates University, P. O. Box 17555 Al-AIn 17555 (United Arab Emirates)
2011-09-15
In one of the gas processing facilities in Abu Dhabi, UAE; a case of 316L stainless steel material failure occurred in the fractionating column due to stress cracking corrosion twice in a cycle of less than 2 years. This paper studies the stress corrosion cracking behavior of the 316L stainless steel in an accelerated corrosion environment and compares it with a higher corrosion resistant nickel alloy (Inconel 625). The experimental work was designed according to ASTM G36 standard, the samples were immersed in a boiling magnesium chloride medium which provided the accelerated corrosion environment and the tested samples were shaped into U-bend specimens as they underwent both plastic and elastic stresses. The specimens were then tested to determine the time required for cracks to initiate. The results of the experimental work showed that the main mode of failure was stress corrosion cracking initiated by the proven presence of chlorides, hydrogen sulfide, and water at elevated temperatures. Inconel 625 samples placed in the controlled environment showed better corrosion resistance as it took them an average of 56 days to initiate cracks, whereas it took an average of 24 days to initiate cracks in the stainless steel 316L samples. The scanning electron microscopy (SEM) micrographs showed that the cracks in the stainless steel 316L samples were longer, wider, and deeper compared to the cracks of Inconel 625. (Copyright copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
Mesquita, Ramaiany Carneiro; Mecury, José Manoel Rivas; Tanaka, Auro Atsumi; Sousa, Regina Célia de
2015-01-01
This paper describes the feasibility of using direct current electrical resistivity measurements to evaluate AISI 304 austenitic stainless steel sensitization. ASTM A262 – Practice A and double loop electrochemical potentiodynamic reactivation (DL-EPR) tests were performed to assess the degree of sensitization (DoS) qualitatively and quantitatively, and electrical resistivity (ER) was measured by the four-point direct-current potential drop method. The results indicate that the DoS incr...
21 CFR 137.285 - Degerminated yellow corn meal.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Degerminated yellow corn meal. 137.285 Section 137... Cereal Flours and Related Products § 137.285 Degerminated yellow corn meal. Degerminated yellow corn meal, degermed yellow corn meal, conforms to the definition and standard of identity prescribed by § 137.265 for...
Microstructural characteristics and corrosion behavior of a super duplex stainless steel casting
International Nuclear Information System (INIS)
Martins, Marcelo; Casteletti, Luiz Carlos
2009-01-01
The machining of super duplex stainless steel castings is usually complicated by the difficulty involved in maintaining the dimensional tolerances required for given applications. Internal stresses originating from the solidification process and from subsequent heat treatments reach levels that exceed the material's yield strength, promoting plastic strain. Stress relief heat treatments at 520 deg. C for 2 h are an interesting option to solve this problem, but because these materials present a thermodynamically metastable condition, a few precautions should be taken. The main objective of this work was to demonstrate that, after solution annealing at 1130 deg. C and water quenching, stress relief at 520 deg. C for 2 h did not alter the duplex microstructure or impair the pitting corrosion resistance of ASTM A890/A890M Grade 6A steel. This finding was confirmed by microstructural characterization techniques, including light optical and scanning electron microscopy, and X-ray diffraction. Corrosion potential measurements in synthetic sea water containing 20,000 ppm of chloride ions were also conducted at three temperatures: 5 deg. C, 25 deg. C and 60 deg. C
18 CFR 284.285 - Pregrant of abandonment of unbundled sales services.
2010-04-01
... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Pregrant of abandonment of unbundled sales services. 284.285 Section 284.285 Conservation of Power and Water Resources... Sales by Interstate Pipelines § 284.285 Pregrant of abandonment of unbundled sales services. Abandonment...
QUANTITATIVE ANALYSIS OF BANDED STRUCTURES IN DUAL-PHASE STEELS
Directory of Open Access Journals (Sweden)
Benoit Krebs
2011-05-01
Full Text Available Dual-Phase (DP steels are composed of martensite islands dispersed in a ductile ferrite matrix, which provides a good balance between strength and ductility. Current processing conditions (continuous casting followed by hot and cold rolling generate 'banded structures' i.e., irregular, parallel and alternating bands of ferrite and martensite, which are detrimental to mechanical properties and especially for in-use properties. We present an original and simple method to quantify the intensity and wavelength of these bands. This method, based on the analysis of covariance function of binary images, is firstly tested on model images. It is compared with ASTM E-1268 standard and appears to be more robust. Then it is applied on real DP steel microstructures and proves to be sufficiently sensitive to discriminate samples resulting from different thermo-mechanical routes.
Integration of Nanofluids into Commercial Antifreeze Concentrates with ASTM D15 Corrosion Testing
2013-05-01
Lockwood1 1 Valvoline New Product Development Laboratory, Ashland Consumer Markets , Lexington, Kentucky. 2 Tank Automotive Research, Development...Development Laboratory,Ashland Consumer Markets ,P.O. Box 14000,Lexington,KY,40512 8. PERFORMING ORGANIZATION REPORT NUMBER ; #23826 9. SPONSORING...Technology, Performance, and Life for Light-Duty Applications, Engine Coolant Testing: Fourth Volume, ASTM STP 1335, R.E. Beale ed., ASTM, Philadelphia
An Automated Safe-to-Mate (ASTM) Tester
Nguyen, Phuc; Scott, Michelle; Leung, Alan; Lin, Michael; Johnson, Thomas
2013-01-01
Safe-to-mate testing is a common hardware safety practice where impedance measurements are made on unpowered hardware to verify isolation, continuity, or impedance between pins of an interface connector. A computer-based instrumentation solution has been developed to resolve issues. The ASTM is connected to the circuit under test, and can then quickly, safely, and reliably safe-to-mate the entire connector, or even multiple connectors, at the same time.
Choice of steel for the ISABELLE magnet tubes
International Nuclear Information System (INIS)
Dew-Hughes, D.; Lee, K.S.
1979-01-01
It is concluded that the low temperature ductility of cast duplex stainless steels can be reduced by high ferrite content, excessive amounts of nitrogen or strong carbide forming elements, and lack of heat treatment particularly at higher ferrite levels. While all samples investigated, with the exception of No. 14 (non-heat treated 12% delta), had mechanical properties more than adequate for the intended service, it was felt advisable to modify the specifications for the tube steels. The requirement is for CF8 as per ASTM specification number A743 with the following modifications: nitrogen content must not exceed 0.08%; niobium content must not exceed 0.1% and total of all carbide formers (Nb, Ti, V, W) must not exceed 0.2%; ferrite content of the casting, as determined from the heat chemistry using the DeLong diagram, must not exceed 10%. A743 already calls for suitable solution heat treatment
International Nuclear Information System (INIS)
Bruzzoni, P.; Burkart, A.L.; Garavaglia, R.N.
1981-11-01
An ASTM A 516 degree 60 carbon steel superficial protection technique submitted to a hydrogen-water sulfide corrosive medium at 2 MPa of pressure and 40-125 deg C forming on itself an iron sulfide layer was tested. Studies on pH influence, temperature, passivating mean characteristics and exposure time as well as the mechanical resistance of sulfide layers to erosion are included. (Author) [es
30 CFR 285.202 - What types of leases will MMS issue?
2010-07-01
... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What types of leases will MMS issue? 285.202 Section 285.202 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR OFFSHORE... Renewable Energy Leases General Lease Information § 285.202 What types of leases will MMS issue? The MMS may...
An evaluation of efforts by nuclear power plants to use ASTM D3803-89
International Nuclear Information System (INIS)
Freeman, W.P.
1995-01-01
The number of nuclear power plants are now using ASTM D3803-89, open-quotes Standard Test Method for Nuclear-Grade Activated Carbonclose quotes for routine surveillance testing of adsorbents. In order to judge the impact of this change, we have gathered radioiodine removal test results from our data base on a system-by-system basis (i.e. control room, technical support center, and spent fuel pool) and compared test results obtained for the same kind of systems using the new and older test methods. Included in this comparison are systems with and without humidity control. Results are discussed from the standpoint of what to expect if a change to testing using ASTM D3803-89 is contemplated, especially regarding test results in light existing acceptance criteria. Additionally, the results are discussed from the standpoint of the sensitivity of the ASTM test method to detect when the performance of the carbon in air cleaning systems has been compromised (compared to the older methods). Finally, we offer some suggestions for how other plants might upgrade their carbon testing to incorporate testing to ASTM D3803-89
An evaluation of efforts by nuclear power plants to use ASTM D3803-89
Energy Technology Data Exchange (ETDEWEB)
Freeman, W.P.
1995-02-01
The number of nuclear power plants are now using ASTM D3803-89, {open_quotes}Standard Test Method for Nuclear-Grade Activated Carbon{close_quotes} for routine surveillance testing of adsorbents. In order to judge the impact of this change, we have gathered radioiodine removal test results from our data base on a system-by-system basis (i.e. control room, technical support center, and spent fuel pool) and compared test results obtained for the same kind of systems using the new and older test methods. Included in this comparison are systems with and without humidity control. Results are discussed from the standpoint of what to expect if a change to testing using ASTM D3803-89 is contemplated, especially regarding test results in light existing acceptance criteria. Additionally, the results are discussed from the standpoint of the sensitivity of the ASTM test method to detect when the performance of the carbon in air cleaning systems has been compromised (compared to the older methods). Finally, we offer some suggestions for how other plants might upgrade their carbon testing to incorporate testing to ASTM D3803-89.
International Nuclear Information System (INIS)
Meriguet, P.J.-L.
1992-01-01
The presence of non-metallic inclusions in steels and nickel alloys may create leak-paths under Ultra High Vacuum conditions. This paper shows the application of the ASTM E45 standard to the assessment of these inclusions and gives some design recommendations. Three case-histories encountered at the Joint European Torus Joint Undertaking and a possible explanation of the phenomenon are also presented. (Author)
Deriving allowable properties of lumber : a practical guide for interpretation of ASTM standards
Alan Bendtsen; William L. Galligan
1978-01-01
The ASTM standards for establishing clear wood mechanical properties and for deriving structural grades and related allowable properties for visually graded lumber can be confusing and difficult for the uninitiated to interpret. This report provides a practical guide to using these standards for individuals not familiar with their application. Sample stress...
Producing A615 / A615M High Strength Construction Re-Bars Without Use of Microalloys: Part 2
Directory of Open Access Journals (Sweden)
Ignatius C. Okafor
2015-05-01
Full Text Available The metallurgy of ASTM A615/A615M Gr. 60 steels made from three different chemistries was studied to suggest an economically advantageous route to produce a steel grade that saves the extra cost of alloying elements. Metallographic examinations, along with microhardness and XRD studies, were performed to rate the steel chemistries based on their superheats. This study of the steel grades revealed that producing steel for requisite standards like ASTM 615/A615M Grade 60 may not be dependent on starting superheat but on the chemistry and rolling process. Study of the three chemistries A, B and C indicated that the standards were met in all 3 chemistries; however, sample A had the lowest cost chemistry and therefore is a suggested route for this product.
International Nuclear Information System (INIS)
Kim, Nam In; Kim, Young Sik; Kim, Kyung Soo; Chang, Hyun Young; Park, Heung Bae; Sung, Gi Ho; Sung, Gi Ho
2015-01-01
The usage of bending products recently have increased since many industries such as automobile, aerospace, shipbuilding, and chemical plants need the application of pipings. Bending process is one of the inevitable steps to fabricate the facilities. Induction heat bending is composed of compressive bending process by local heating and cooling. This work focused on the effect of induction heat bending process on the properties of ASME SA312 Gr. TP304 stainless steel pipes. Tests were performed for base metal and bended area including extrados, intrados, crown up, and down parts. Microstructure was analyzed using an optical microscope and SEM. In order to determine intergranular corrosion resistance, Double Loop Electrochemical Potentiokinetic Reactivation (DL-EPR) test and ASTM A262 practice A and C tests were done. Every specimen revealed non-metallic inclusion free under the criteria of 1.5i of the standard and the induction heat bending process did not affect the non-metallic inclusion in the alloys. Also, all the bended specimens had finer grain size than ASTM grain size number 5 corresponding to the grain sizes of the base metal and thus the grain size of the pipe bended by induction heat bending process is acceptable. Hardness of transition start, bend, and transition end areas of ASME SA312 TP304 stainless steel was a little higher than that of base metal. Intergranular corrosion behavior was determined by ASTM A262 practice A and C and DL-EPR test, and respectively step structure, corrosion rate under 0.3 mm/y, and Degree of Sensitization (DOS) of 0.001 - 0.075 % were obtained. That is, the induction heat bending process didn't affect the intergranular corrosion behavior of ASME SA312 TP304 stainless steel
Risk Based Corrosion Studies at SRS
International Nuclear Information System (INIS)
Hoffman, E.
2010-01-01
TYPE I and II (ASTM 285-B) - Experienced stress corrosion cracking (SCC), 2 have been closed; 22 scheduled for closure by 2017, and No active leak sites today. TYPE III (ASTM A516-70 and A537 Class I) - Post-fabrication relief of weld residual stresses, Improved resistance to SCC and brittle fracture, No leakage history, and Receives new waste. The objectives are to utilize statistical methods to reduce conservatism in current chemistry control program; and express nitrite inhibitor limits in terms of pitting risk on waste tank steel. Conclusions are: (1) A statistically designed experimental study has been undertaken to improve the effectiveness of the minimum nitrite concentrations to inhibit pitting corrosion; (2) Mixture/amount model supports that pitting depends on the ratio of aggressive to inhibitive anions, as well as the concentration of each species; (3) Secondary aggressive species, Cl - and SO 4 2- , significantly effect the corrosion response; and (4) Results support the reduction of the chemistry control nitrite inhibitor concentrations in the regime of 0.8-1.0 M nitrate.
International Nuclear Information System (INIS)
Frund, J.M.; Difant, M.; Bethmont, M.
1994-01-01
A crack arrest study is under way at Electricite de France as part of the analysis of the risk of fast fracture of PWR vessels in emergency conditions. The first objective of this study is to evaluate the toughness which characterizes crack arrest through tests on reduced-size specimens. Some of the tests on a forging steel (A508 Cl.3) were conducted in conformity with two experimental methods. One method recommended by the ASTM calls for the use of an imposed-displacement mechanical loading on specimens kept under homogeneous temperature. Since the stress intensity factor K applied to the outside loading decreases along the crack growth, we can observe the arrest of the crack. In order to obtain brittle crack initiations in cleavage in the whole studied range of temperature and crack propagation of a sufficient length, the application of a weld point at the top of the notch is done. The other experimental method is based on a thermal loading. It requires the use of a disk or a cylinder with a longitudinal initial crack of the external surface. We dip this specimen in liquid nitrogen and we heat its internal surface with inducing current. There is a temperature gradient in the thickness of the specimen which produces a stress field which tends to open the crack. When the value of K is reached the crack initiation takes place. Several phenomena act to oppose the crack growth, they even go as far as stopping it. First the value of K, after increasing, gets steady then decreases, then, the rate of energy dissipated by plasticity at the top of the crack increases because the crack meets warmer and warmer areas on its way. The arrest toughness values which were obtained were then analyzed and compared to one another and with values proposed by RCC-m code. (authors). 12 refs., 11 figs., 3 tabs
30 CFR 285.543 - Example of how the inverse distance formula works.
2010-07-01
... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Example of how the inverse distance formula works. 285.543 Section 285.543 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR... Financial Assurance Requirements Revenue Sharing with States § 285.543 Example of how the inverse distance...
30 CFR 285.1016 - When will an Alternate Use RUE be cancelled?
2010-07-01
... 30 Mineral Resources 2 2010-07-01 2010-07-01 false When will an Alternate Use RUE be cancelled? 285.1016 Section 285.1016 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR... Rue Administration § 285.1016 When will an Alternate Use RUE be cancelled? The Secretary may cancel an...
An Evaluation of a Proposed Revision of the ASTM D 1990 Grouping Procedure
Steve P Verrill; James W. Evans; David E. Kretschmann; Cherilyn A. Hatfield
2013-01-01
Lum, Taylor, and Zidek have proposed a revised procedure for wood species grouping in ASTM standard D 1990. We applaud the authorsâ recognition of the importance of considering a strength distributionâs variability as well as its fifth percentile. However, we have concerns about their proposed method of incorporating this information into a standard. We detail these...
Sigma phase morphologies in cast and aged super duplex stainless steel
International Nuclear Information System (INIS)
Martins, Marcelo; Casteletti, Luiz Carlos
2009-01-01
Solution annealed and water quenched duplex and super duplex stainless steels are thermodynamically metastable systems at room temperature. These systems do not migrate spontaneously to a thermodynamically stable condition because an energy barrier separates the metastable and stable states. However, any heat input they receive, for example through isothermal treatment or through prolonged exposure to a voltaic arc in the welding process, cause them to reach a condition of stable equilibrium which, for super duplex stainless steels, means precipitation of intermetallic and carbide phases. These phases include the sigma phase, which is easily identified from its morphology, and its influence on the material's impact strength. The purpose of this work was to ascertain how 2-hour isothermal heat treatments at 920 deg. C and 980 deg. C affect the microstructure of ASTM A890/A890M GR 6A super duplex stainless steel. The sigma phase morphologies were found to be influenced by these two aging temperatures, with the material showing a predominantly lacy microstructure when heat treated at 920 deg. C and block-shaped when heat treated at 980 deg. C.
Directory of Open Access Journals (Sweden)
L. Dumitrescu
2010-01-01
Full Text Available ResumenEl diseno de Ingenieria de un producto o componente constituye una actividad dificil, compleja ymultidisciplinaria, enfocada a la resolucion de problemas. En el presente trabajo se muestra eldesarrollo de una herramienta automatizada para la seleccion de los aceros mas utilizados en laconstruccion de maquinarias. La herramienta constituye una ayuda para la seleccion de losmateriales desde la etapa conceptual del proceso de diseno, donde se identifican las diferentescategorias de materiales a utilizar. La herramienta comprende las caracteristicas y propiedades masrelevantes de los aceros de Ingenieria disponibles en seis normas internacionales: Japonesa (JIS,Alemana (DIN, Vbn, DIN-Vbn, Rusa (GOST, Americana (AISI, SAE, AISI-SAE, ASTM, Inglesa (BS, EN,GB, Francesa (AFNOR y la Norma Cubana (NC vigente.Palabras claves: materiales, automatizada, aceros, ingenieria.____________________________________________________________AbstractThe product or component design constitutes a difficult, complex and multidisciplinary activity,focused to the resolution of problems. Presently work show the development of an automated toolfor the selection of the more used steels in the construction of machineries. The tool constitute ahelp for the selection of the materials from the conceptual stage of the design process, where thedifferent categories of materials are identified to use. The tool analyze the characteristics and morecommon properties of the available steels in six international standards: JIS (Japan, DIN, Vbn, DINVbn(Germany, GOST (Russia, AISI, SAE, AISI-SAE, ASTM (USA, BS, IN, GB (England, AFNOR(France and NC (Cuba.Key words: materials, automated, steels, engineering.
Trial manufacturing of titanium-carbon steel composite overpack
International Nuclear Information System (INIS)
Honma, Nobuyuki; Chiba, Takahiko; Tanai, Kenji
1999-11-01
This paper reports the results of design analysis and trial manufacturing of full-scale titanium-carbon steel composite overpacks. The overpack is one of the key components of the engineered barrier system, hence, it is necessary to confirm the applicability of current technique in their manufacture. The required thickness was calculated according to mechanical resistance analysis, based on models used in current nuclear facilities. The Adequacy of the calculated dimensions was confirmed by finite-element methods. To investigate the necessity of a radiation shielding function of the overpack, the irradiation from vitrified waste has been calculated. As a result, it was shown that shielding on handling and transport equipment is a more reasonable and practical approach than to increase thickness of overpack to attain a self-shielding capability. After the above investigation, trial manufacturing of full-scale model of titanium-carbon steel composite overpack has been carried out. For corrosion-resistant material, ASTM Grade-2 titanium was selected. The titanium layer was bonded individually to a cylindrical shell and fiat cover plates (top and bottom) made of carbon steel. For the cylindrical shell portion, a cylindrically formed titanium layer was fitted to the inner carbon steel vessel by shrinkage. For the flat cover plates (top and bottom), titanium plate material was coated by explosive bonding. Electron beam welding and gas metal arc welding were combined to weld of the cover plates to the body. No significant failure was evident from inspections of the fabrication process, and the applicability of current technology for manufacturing titanium-carbon steel composite overpack was confirmed. Future research and development items regarding titanium-carbon steel composite overpacks are also discussed. (author)
Corrosivity Index Copper and Steel at Two Locations in Villahermosa, Tabasco
Directory of Open Access Journals (Sweden)
Tejero-Rivas María Candelaria
2015-03-01
Full Text Available This paper presents a study of the atmospheric corrosion of copper and carbon steel made in two environments Villahermosa, Tabasco for six months. The test site of the industrial zone started Villahermosa Institute of Technology (ITVH and rural-urban site at the Technological University of Tabasco (UTTAB. Aluminum in combination with a screw carbon steel provided the index marine corrosivity (MA, the brass screw gives the index of industrial corrosivity (IA; wire method of screw according to ASTM G116-93 was used and the plastic screw nylon gives the rate of rural-urban corrosivity (RUA. The determination of air pollutants (sulfur dioxide and chlorides, was with the methods of wet candle and sulfation plates according to ISO 9225. Morphology studies were performed on the corrosion products formed on the specimens screw, using scanning electron microscopy coupled with energy dispersive. The corrosion products that formed on the surface of copper and carbon steel, having a bulb-shaped morphology characteristic of the addition of soluble salts, particularly sulphates and chlorides, were identified in the two stations.
Directory of Open Access Journals (Sweden)
Anderson Geraldo Marenda Pukasiewicz
2012-03-01
Full Text Available ASTM A743-CA6NM é um aço inoxidável martensítico muito utilizado na fabricação de turbinas hidráulicas devido a sua elevada tenacidade, entretanto apresenta restrições com relação à regiões recuperadas por soldagem. Diferentes técnicas de deposição tem sido aplicadas com o intuito de reduzir ou eliminar a tensão residual. A deposição de revestimentos resistentes a cavitação é outra forma importante de aumentar a vida útil destes componentes. O objetivo deste trabalho é avaliar a influência do tipo e intensidade de corrente de refusão por plasma na microestrutura, composição química e microdureza de um revestimento Fe-Mn-Cr-Si resistente a cavitação depositado por aspersão térmica arco elétrico sobre aço ASTMA743-CA6NM. Observou-se que a adoção de menores valores de corrente média, assim como a utilização de corrente pulsada reduziram a formação de ferrita δ e a espessura final da ZTA, possibilitando a formação do revestimento com menores alterações na microestrutura do metal base. Verificou-se que a microestrutura e microdureza dos revestimentos refundidos não se mostraram muito sensível a variações na diluição do metal base. A utilização de corrente contínua promoveu um alinhamento da estrutura dendrítica no sentido da movimentação da tocha, entretanto este comportamento não foi observado em revestimentos refundidos com corrente pulsada.ASTM A743-CA6NM martensitic stainless steel have been used in hydraulic turbines manufacturing, but show some restrictions in welded recovered areas. Different techniques have been applied in order to reduce or eliminate residual stress, with life increase. The deposition of cavitation resistant coatings is another important way to increase the service life of these components. The objective of this study is evaluate the influence of type and intensity of plasma remelting current on the microstructure, chemical composition and microhardness of the Fe
A new method to determine J0-integral values (ASTM E 813) without any auxiliary equipment
International Nuclear Information System (INIS)
Ullrich, G.; Krompholz, K.
1987-01-01
In this contribution the path independent J-integral according to J.R. Rice, respective J.D. Landes and J.A. Begley due to ASTME 813 is calculated by the product J pl = d v J el for 3 point bend type specimen. Here d v is the load point displacement up to the point of the onset of stable crack growth V, which is taken from the load versus load point displacement diagram and J el a value which is equivalent to K 2 /E, where K is the stress intensity factor (ASTME 399) and E is Young's modulus. The advantage of the new procedure is the simplicity of the test arrangement and of the evaluation with the determination of initiation point V without computer or other auxiliary equipment. (orig.) [de
Comparison between instrumented precracked Charpy and compact specimen tests of carbon steels
International Nuclear Information System (INIS)
Nanstad, R.K.
1980-01-01
The General Atomic Company High Temperature Gas-Cooled Reactor (HTGR) is housed within a prestressed concrete reactor vessel (PCRV). Various carbon steel structural members serve as closures at penetrations in the vessel. A program of testing and evaluation is underway to determine the need for reference fracture toughness (K/sub IR/) and indexing procedures for these materials as described in Appendix G to Section III, ASME Code for light water reactor steels. The materials of interest are carbon steel forgings (SA508, Class 1) and plates (SA537, Classes 1 and 2) as well as weldments of these steels. The fracture toughness behavior is characterized with instrumented precracked Charpy V-votch specimens (PCVN) - slow-bend and dynamic - and compact specimens (10-mm and 25-mm thicknesses) using both linear elastic (ASTM E399) and elastic-plastic (equivalent Energy and J-Integral) analytical procedures. For the dynamic PCVN tests, force-time traces are analyzed according to the procedures of the Pressure Vessel Research Council (PVRC)/Metal Properties Council (MPC). Testing and analytical procedures are discussed and PCVN results are compared to those obtained with compact specimens
Stress corrosion cracking of A515 grade 60 carbon steel
International Nuclear Information System (INIS)
Moore, E.L.
1971-01-01
An investigation was conducted to evaluate the effect of welding method plate thickness, and subsequent stress relief treatment on the stress corrosion cracking propensity of ASTM A515 Grade 60 carbon steel plate exposed to a 5 M NaNO 3 solution at 190 0 F for eight weeks. It was found that all weld coupons receiving no thermal stress relief treatment cracked within eight weeks; all weld coupons given a vibratory stress relief cracked within eight weeks; two of the eight weld coupons stress relieved at 600 0 F for one hour cracked within eight weeks; none of the weld coupons stress relieved at 1100 0 F for one hour cracked within eight weeks; and that cracking was generally more severe in coupons fabricated from 7/8 inch plate by shielded metal arc welding than it was in coupons fabricated by other welding methods. (U.S.)
41 CFR 102-117.285 - What are my choices if a TSP's performance is not satisfactory?
2010-07-01
... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false What are my choices if a TSP's performance is not satisfactory? 102-117.285 Section 102-117.285 Public Contracts and Property... are my choices if a TSP's performance is not satisfactory? You may choose to place a TSP in temporary...
30 CFR 285.614 - When may I begin conducting activities under my approved SAP?
2010-07-01
... approved SAP? 285.614 Section 285.614 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE... Plans and Information Requirements Activities Under An Approved Sap § 285.614 When may I begin conducting activities under my approved SAP? (a) You may begin conducting the activities approved in your SAP...
ASTM International Workshop on Standards & Measurements for Tissue Engineering Scaffolds
Simon, Carl G.; Yaszemski, Michael J.; Ratcliffe, Anthony; Tomlins, Paul; Luginbuehl, Reto; Tesk, John A.
2016-01-01
The “Workshop on Standards & Measurements for Tissue Engineering Scaffolds” was held on May 21, 2013 in Indianapolis, IN and was sponsored by the ASTM International (ASTM). The purpose of the workshop was to identify the highest priority items for future standards work for scaffolds used in the development and manufacture of tissue engineered medical products (TEMPs). Eighteen speakers and 78 attendees met to assess current scaffold standards and to prioritize needs for future standards. A key finding was that the ASTM TEMPs subcommittees (F04.41-46) have many active “guide” documents for educational purposes, but that few standard “test methods” or “practices” have been published. Overwhelmingly, the most clearly identified need was standards for measuring the structure of scaffolds, followed by standards for biological characterization, including in vitro testing, animal models and cell-material interactions. The third most pressing need was to develop standards for assessing the mechanical properties of scaffolds. Additional needs included standards for assessing scaffold degradation, clinical outcomes with scaffolds, effects of sterilization on scaffolds, scaffold composition and drug release from scaffolds. Discussions also highlighted the need for additional scaffold reference materials and the need to use them for measurement traceability. Finally, dialogue emphasized the needs to promote the use of standards in scaffold fabrication, characterization, and commercialization and to assess the use and impact of standards in the TEMPs community. Many scaffold standard needs have been identified and focus should now turn to generating these standards to support the use of scaffolds in TEMPs. PMID:25220952
Energy Technology Data Exchange (ETDEWEB)
Gomes, Samuel I.N.; Spinelli, Dirceu [Sao Paulo Univ., Sao Carlos, SP (Brazil). Escola de Engenharia; Souza, Paulo C.R. D. de [SICOM Compressores Ltda., Sao Carlos, SP (Brazil); Magalhaes Bento Goncalves, Gilberto de [Bauru Univ., SP (Brazil)
1993-12-31
Welding metals with and without iron powder addition were produced in steel plates ASTM A 242 by submerged arc process. as a conclusion, the mechanical properties of hardness and toughness of weld metal and heat affect zone were more affected when the welding were done with lower heat input. (author). 16 refs., 3 figs., 9 tabs.
30 CFR 285.606 - What must I demonstrate in my SAP?
2010-07-01
... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What must I demonstrate in my SAP? 285.606 Section 285.606 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR OFFSHORE... demonstrate in my SAP? (a) Your SAP must demonstrate that you have planned and are prepared to conduct the...
International Nuclear Information System (INIS)
Schimmoeller, H.A.; Ruge, J.L.
1978-01-01
The equations to determine a two-dimensional state of residual stress in flat laminated plates are well known from an earlier work by one of the authors. The derivation of these equations leads to a linear, inhomogeneous system of Volterra's integral equations of the second kind. To ascertain the unknown residual stresses from these equations it is necessary to cut down the thickness of the test plate layer by layer. This results in two-dimensional deformation reactions in the rest of the test plate, which can be measured, e.g. by a strain gauge rosette applied to the opposite side of the plate. The above-mentioned stress analysis has been transferred to 86mm thick reactor pressure vessel steel specimens (Type 22NiMoCr 37, DIN-No. 1.6751, similar to ASTM A508, Class 2) double-run clad by austenitic stainless steel strip electrodes (first layer 24/13 Cr-Ni steel, second layer 21/10 Cr-Ni steel). The overall dimensions of the clad specimens investigated amounted to 200 x 200 x (86+4.5+4.5)mm. At the surface of the austenitic cladding there is a two-dimensional tensile normal stress state of about 200N/mm 2 parallel, and about 300N/mm 2 transverse, to the welding direction. The maximum tensile stress was 8mm below the interface (fusion line, material transition) in the parent material. The stress distributions of the specimens investigated, determined on the basis of the above-mentioned combined experimental mathematical procedure, are presented graphically for the as-welded (as-delivered) and annealed (600 0 C/12hr) conditions. (author)
The draft of the ASTM Test Method for air entitled: "Airborne Asbestos Concentration in Ambient and Indoor Atmospheres as Determined by Transmission Electron Microscopy Direct Transfer (TEM)" (ASTM Z7077Z) is an adaptation of the International Standard, ISO 10312. It is currently...
Energy Technology Data Exchange (ETDEWEB)
Spencer, G.L.; Duquette, D.J.
1998-08-01
High strength alloy steels typically used for gun steel were investigated to determine their susceptibility to hydrogen embrittlement. Although AISI grade 4340 was quite susceptible to hydrogen embrittlement, ASTM A723 steel, which has identical mechanical properties but slightly different chemistries, was not susceptible to hydrogen embrittlement when exposed to the same conditions. The degree of embrittlement was determined by conducting notched tensile testing on uncharged and cathodically charged specimens. Chemical composition was modified to isolate the effect of alloying elements on hydrogen embrittlement susceptibility. Two steels-Modified A723 (C increased from 0.32% to 0.40%) and Modified 4340 (V increased from 0 to O.12%) were tested. X-ray diffraction identified the presence of vanadium carbide, V{sub 4}C{sub 3}, in A-23 steels, and subsequent hydrogen extraction studies evaluated the trapping effect of vanadium carbide. Based on these tests, it was determined that adding vanadium carbide to 4340 significantly decreased hydrogen embrittlement susceptibility because vanadium carbide traps ties up diffusible hydrogen. The effectiveness of these traps is examined and discussed in this paper.
30 CFR 285.222 - What does MMS do with my bid?
2010-07-01
... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What does MMS do with my bid? 285.222 Section... Energy Leases Competitive Lease Award Process § 285.222 What does MMS do with my bid? (a) If sealed... any proposal submitted will be made by a panel composed of members selected by MMS. The details of the...
30 CFR 285.810 - What must I include in my Safety Management System?
2010-07-01
... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What must I include in my Safety Management System? 285.810 Section 285.810 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR..., COPs and GAPs Safety Management Systems § 285.810 What must I include in my Safety Management System...
Lifescience Database Archive (English)
Full Text Available MeCab user dictionary for science technology term ASTM 名詞 一般 * * * * 米国材料試験協会 ベイコクザ...イリョウシケンキョウカイ ベイコクザイリョーシケンキョーカイ Thesaurus2015 200906091611619997 C IA02 UNKNOWN_1 ASTM
Acoustic Emission Methodology to Evaluate the Fracture Toughness in Heat Treated AISI D2 Tool Steel
Mostafavi, Sajad; Fotouhi, Mohamad; Motasemi, Abed; Ahmadi, Mehdi; Sindi, Cevat Teymuri
2012-10-01
In this article, fracture toughness behavior of tool steel was investigated using Acoustic Emission (AE) monitoring. Fracture toughness ( K IC) values of a specific tool steel was determined by applying various approaches based on conventional AE parameters, such as Acoustic Emission Cumulative Count (AECC), Acoustic Emission Energy Rate (AEER), and the combination of mechanical characteristics and AE information called sentry function. The critical fracture toughness values during crack propagation were achieved by means of relationship between the integral of the sentry function and cumulative fracture toughness (KICUM). Specimens were selected from AISI D2 cold-work tool steel and were heat treated at four different tempering conditions (300, 450, 525, and 575 °C). The results achieved through AE approaches were then compared with a methodology proposed by compact specimen testing according to ASTM standard E399. It was concluded that AE information was an efficient method to investigate fracture characteristics.
CASTI handbook of stainless steels and nickel alloys. 2. ed.
International Nuclear Information System (INIS)
Lamb, S.
2002-01-01
This is the only up-to-date (2002) reference book that covers both stainless steels and nickel alloys. Written by 30 authors and peer reviewers with over 700 years of combined industrial experience, this CASTI handbook provides the latest stainless steels and nickel alloys information in a practical and comprehensive manner. For the project engineer, maintenance engineer or inspector, this book provides solutions to many of the corrosion problems encountered in aggressive environmental conditions. Some of the corrosive conditions covered are: stress corrosion cracking, reducing environments, halogenation, highly oxidizing environments, and high temperatures. Hundreds of different material applications and selections, throughout many industries, are referenced. It is an ideal reference source to assist in preventing or minimizing corrosion related problems, including those encountered during welding fabrication. This practical handbook also contains a handy 'Alloy Index' which lists each alloy by its ASTM Specification, UNS Number, common name, trade name and page number references. The second edition includes additional coverage of corrosion resistant alloys for downhole production tubing. The new material covers corrosion processes, corrosion rates, hydrogen sulfide environments, corrosion inhibitors, corrosion resistant alloys, the application of stainless steel in production conditions, and more
Energy Technology Data Exchange (ETDEWEB)
Antunes, Renato Altobelli
2002-07-01
The performance of four different organic coating systems applied to carbon and weathering steel coupons has been assessed in this investigation. applied on the surface of carbon steel and weathering steel coupons. The coupons have been evaluated using five different tests, three field tests and two accelerated tests. The field tests were carried out at three atmospheric stations, located at COSIPA in Cubatao-SP, at Alto da Serra in Cubatao-SP and at Paula Souza in Sao Paulo city. The accelerated tests consisted of (a) exposure to alternate cycles of ultraviolet radiation/condensation combined with salt spray cycles (UVCON combined with Salt Spray) and of (b) exposure to alternate cycles of ultraviolet radiation/condensation combined with the Prohesion test. The performance of the coatings was assessed by visual observation and photographs, using a method based on ASTM D-610, ASTM D-714 and ASTM-1654 standards to rank them. The oxide phases formed on the surfaces of the non-coated specimens of carbon and weathering steels, exposed to the same tests performed with the coated specimens, were identified using three different techniques: X-ray diffraction, Raman microscopy and Moessbauer spectroscopy. In the field tests, the specimens have been exposed for 1, 2, 3, 6 and 9 months. In the accelerated ones, the results were obtained after 1340 hours (4 cycles) test. The main component identified in all the specimens collected from the field tests and from the UVCON combined with the Prohesion test was lepidocrocite ({gamma}-FeOOH). Goethite ({alpha}-FeOOH ) and magnetite (Fe{sub 3}O{sub 4}) were identified as the other two main phases present in ali the specimens. In the UVCON combined with Salt Spray test, the dominant phase was magnetite, followed by goethite and lepidocrocite. The morphology of the rust formed on the specimens was examined by scanning electron microscopy (SEM). Structures corresponding to goethite and lepidocrocited were recognized on ali specimens
Directory of Open Access Journals (Sweden)
JAIME ALEJANDRO OSPINA
2011-12-01
Full Text Available Este artículo muestra la importancia de la caracterización de la energía de combustibles líquidos y gaseosos obtenidos del conocido tratamiento térmico de pirolisis a través de un microondas. La caracterización de estos combustibles tomará en cuenta los estándares técnicos tales como ASTM D3452 – 93 para la cromatografía de gases (GC, ASTM D2549 para cromatografía de gas/ espectrometría de masa (GC/MS y ASTM D6370 -99 para termogravimetría en el análisis de la composición de llantas.También muestra que estos combustibles y gases de pirolisis tiene una alta valor calorífico de 42 MJ / Kg y un contenido de azufre entre 0.8 y 1.65 Wt%, dependiendo en el tipo de llanta y las condiciones del proceso.
Energy Technology Data Exchange (ETDEWEB)
Dr. Manish Metha; Dr. Tom Oakwood
2004-04-28
The purpose of this collaborative project was to develop a standard practice for obtaining and archiving quantitative steel transformation kinetic data and thermal strain data. Two families of dilatometric equipment were employed to develop this standard practice for testing bar product steels. These include high-speed quenching and deformation dilatometers and Gleeble{reg_sign} thermomechanical simulation instruments. Standard measurement, data interpretation and data reporting methods were developed and defined by the cross-industry QMST Consortium members consisting of steel-manufacturers, forgers, heat-treaters, modelers, automotive and heavy vehicle OEMs along with team expert technologists from the National Labs and academia. The team designed phase transformation experiments on two selected steel grades to validate the standard practices--a medium carbon grade SAE 1050 and an alloy steel SAE 8620. A final standard practice document was developed based on the two dilatometry methods, and was submitted to and approved by ASTM (available as A1033-04). The standard practice specifies a method for measuring austenite transformation under no elastic stress or plastic deformation. These methods will be an enabler for the development and electronic archiving of a quantitative database for process modeling using computer simulation software, and will greatly assist endusers in developing accurate process and product simulations during the thermo-mechanical processing of bar and rod product steels.
30 CFR 285.224 - What happens if MMS accepts my bid?
2010-07-01
... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What happens if MMS accepts my bid? 285.224... Renewable Energy Leases Competitive Lease Award Process § 285.224 What happens if MMS accepts my bid? If we... withdraw an OCS area in which we have held a lease sale before you and MMS execute the lease in that area...
Characterization and Evaluation of Aged Chromium Nickel Niobium Stainless Steels
Dewar, Matthew
20Cr-32Ni-1Nb stainless steel alloys are commonly used in hydrogen reformer manifolds for transporting hot hydrogen by-products at 750-950°C. After long periods of exposure, embrittling secondary carbides and intermetallic phases can precipitate at the grain boundaries which can drastically reduce the ductility, and the repair weldability of the alloy. The intermetallic silicide, G-phase, is commonly observed in 20Cr-32Ni-1Nb stainless steels, and is prone to liquation cracking during welding operations. G-phase is deleterious to the material, where a high degree of G-phase coarsening will render the material unweldable. The present work will investigate various methods in mitigating G-phase precipitation. Variations in casting methods, wall thickness, homogenization treatments, and alloy chemistry will be examined by evaluating their microstructure after periodically aging the samples. Thermodynamic equilibrium modeling using computational thermodynamic tools will be used to optimize the 20Cr-32Ni-1Nb chemistry following ASTM specifications.
International Nuclear Information System (INIS)
Davidson, J.A.; Ceschini, L.J.; Shogan, R.P.; Rao, G.V.
1976-10-01
As a result of the Heavy Section Steel Technology Program (HSST), sponsored by the Nuclear Regulatory Commission, Westinghouse Electric Corporation conducted dynamic fracture toughness tests on irradiated HSST Plate 02 and submerged arc weldment material. Testing performed at the Westinghouse Research and Development Laboratory in Pittsburgh, Pennsylvania, included 0.394T compact tension, 1.9T compact tension, and 4T compact tension specimens. This data showed that, in the transition region, dynamic test procedures resulted in lower (compared to static) fracture toughness results, and that weak direction (WR) oriented specimen data were lower than the strong direction (RW) oriented specimen results. Irradiated lower-bound fracture toughness results of the HSST Program material were well above the adjusted ASME Section III K/sub IR/ curve. An irradiated and nonirradiated 4T-CT specimen was tested during a fracture toughness test as a preliminary study to determine the effect of irradiation on the acoustic emission-stress intensity factor relation in pressure vessel grade steel. The results indicated higher levels of acoustic emission activity from the irradiated sample as compared to the unirradiated one at a given stress intensity factor (K) level
Recommendations for fluorescence instrument qualification: the new ASTM Standard Guide.
DeRose, Paul C; Resch-Genger, Ute
2010-03-01
Aimed at improving quality assurance and quantitation for modern fluorescence techniques, ASTM International (ASTM) is about to release a Standard Guide for Fluorescence, reviewed here. The guide's main focus is on steady state fluorometry, for which available standards and instrument characterization procedures are discussed along with their purpose, suitability, and general instructions for use. These include the most relevant instrument properties needing qualification, such as linearity and spectral responsivity of the detection system, spectral irradiance reaching the sample, wavelength accuracy, sensitivity or limit of detection for an analyte, and day-to-day performance verification. With proper consideration of method-inherent requirements and limitations, many of these procedures and standards can be adapted to other fluorescence techniques. In addition, procedures for the determination of other relevant fluorometric quantities including fluorescence quantum yields and fluorescence lifetimes are briefly introduced. The guide is a clear and concise reference geared for users of fluorescence instrumentation at all levels of experience and is intended to aid in the ongoing standardization of fluorescence measurements.
Study of corrosion resistance of AISI 444 ferritic stainless steel for application as a biomaterial
International Nuclear Information System (INIS)
Marques, Rogerio Albuquerque
2014-01-01
Ferritic stainless steels are ferromagnetic materials. This property does not allow their use in orthopedic prosthesis. Nevertheless, in some specific applications, this characteristic is very useful, such as, for fixing dental and facial prostheses by using magnetic attachments. In this study, the corrosion resistance and cytotoxicity of the AISI 444 ferritic stainless steel, with low nickel content, extra-low interstitial levels (C and N) and Ti and Nb stabilizers, were investigated for magnetic dental attachments application. The ISO 5832-1 (ASTM F-139) austenitic stainless steel and a commercial universal keeper for dental attachment (Neo-magnet System) were evaluated for comparison reasons. The first stainless steel is the most used metallic material for prostheses, and the second one, is a ferromagnetic keeper for dental prostheses (NeoM). In vitro cytotoxicity analysis was performed by the red neutral incorporation method. The results showed that the AISI 444 stainless steel is non cytotoxic. The corrosion resistance was studied by anodic polarization methods and electrochemical impedance spectroscopy (EIS), in a saline phosphate buffered solution (PBS) at 37 °C. The electronic properties of the passive film formed on AISI 444 SS were evaluated by the Mott-Schottky approach. All tested materials showed passivity in the PBS medium and the passive oxide film presented a duplex nature. The highest susceptibility to pitting corrosion was associated to the NeoM SS. This steel was also associated to the highest dopant concentration. The comparatively low levels of chromium (nearly 12.5%) and molybdenum (0.3%) of NeoM relatively to the other studied stainless steels are the probable cause of its lower corrosion resistance. The NeoM chemical composition does not match that of the SUS444 standards. The AISI 444 SS pitting resistance was equivalent to the ISO 5832-1 pointing out that it is a potential candidate for replacement of commercial ferromagnetic alloys used
Corrosion Prevention and Control Planning Guidebook Spiral 3
2007-09-01
applications. Corrosion resistant 19-9DL and 431 steels should not be used for any applications. Series 400 martensitic grade cor- rosion resistant steels ...contact ASTM, 100 Barr Harbor Drive, West Conshohocken, PA 19428-2959, Phone (610)832-9585, Fax (610)832-9555. ASTM A380, Stainless Steel Parts...drilling of holes in martensitic steels after hardening to strength lev- els of 180,000 psi and above should be avoided. When such drilling is
30 CFR 285.605 - What is a Site Assessment Plan (SAP)?
2010-07-01
... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What is a Site Assessment Plan (SAP)? 285.605... Assessment Plan (SAP)? (a) A SAP describes the activities (e.g., installation of meteorological towers... project easement, or to test technology devices. (1) Your SAP must describe how you will conduct your...
International Nuclear Information System (INIS)
Burkart, A.L.
1986-04-01
This work describes the assays aimed to passivate the steel carbon of the process pipings. This steel is marked by the ASTM A 333 G6 and is chemically similar to those of isotopic exchange towers which corrode in contact with in-water hydrogen sulfide solutions forming iron sulfide protective layers. The differences between both materials lie in the surface characteristics to be passivated. The steel of towers has an internal side covered by paint which shall be removed prior to passivation. The steel's internal side shall be covered by a film formed during the fabrication process and constituted by calcinated wastes and iron oxides (magnetite, hematite and wustite). This film interferes in the formation process of passivating layers of pyrrhotite and pyrite. The possibility to passivate the pipes in their actual state was evaluated since it would result highly laborious and expensive to eliminate the film. (Author) [es
Evaluation of non-conformities of hip prostheses made of titanium alloys and stainless steel
International Nuclear Information System (INIS)
Bezerra, Ewerton de Oliveira Teotonio; Nascimento, Jose Jeferson da Silva; Luna, Carlos Bruno Barreto; Morais, Crislene Rodrigues da Silva; Campos, Karla Valeria Miranda de
2017-01-01
A large number of metallic alloys has satisfactory behavior when used to manufacture implants for hip prostheses. However, they must be in conformity with standards, to ensure their quality for long periods without losing its functionality. Therefore, this paper aims to study the non-conformities in two hip prostheses, one of titanium and other stainless steel according to standards. The implants studied passed by X-ray diffraction (XRD), X-ray fluorescence, tensile test and optical microscopy (OM). Specimens for the tensile test were made according to ASTM E 8M, as well, MO samples passed by metallographic procedure. The results evidenced that some chemical compositions showed in relation to the standards. The XRD analysis showed peaks of austenite and absence of ferrite for the stainless steel, while the titanium alloy presents an alpha phase (HCP) more significant than the beta phase (BCC). The stainless steel alloys and titanium have yield strength and tensile strength that meet the standards. On the other hand, the elastic modulus of the titanium alloy and stainless steel, comes to be ten times greater than the human bone. Therefore, the high modulus of elasticity of the alloys, favors bone resorption problems. The stainless steel microstructure is typical of an austenitic matrix, while the titanium alloy presents α + β microstructure. (author)
ASTM international workshop on standards and measurements for tissue engineering scaffolds.
Simon, Carl G; Yaszemski, Michael J; Ratcliffe, Anthony; Tomlins, Paul; Luginbuehl, Reto; Tesk, John A
2015-07-01
The "Workshop on Standards & Measurements for Tissue Engineering Scaffolds" was held on May 21, 2013 in Indianapolis, IN, and was sponsored by the ASTM International (ASTM). The purpose of the workshop was to identify the highest priority items for future standards work for scaffolds used in the development and manufacture of tissue engineered medical products (TEMPs). Eighteen speakers and 78 attendees met to assess current scaffold standards and to prioritize needs for future standards. A key finding was that the ASTM TEMPs subcommittees (F04.41-46) have many active "guide" documents for educational purposes, but few standard "test methods" or "practices." Overwhelmingly, the most clearly identified need was standards for measuring the structure of scaffolds, followed by standards for biological characterization, including in vitro testing, animal models and cell-material interactions. The third most pressing need was to develop standards for assessing the mechanical properties of scaffolds. Additional needs included standards for assessing scaffold degradation, clinical outcomes with scaffolds, effects of sterilization on scaffolds, scaffold composition, and drug release from scaffolds. Discussions highlighted the need for additional scaffold reference materials and the need to use them for measurement traceability. Workshop participants emphasized the need to promote the use of standards in scaffold fabrication, characterization, and commercialization. Finally, participants noted that standards would be more broadly accepted if their impact in the TEMPs community could be quantified. Many scaffold standard needs have been identified and focus is turning to generating these standards to support the use of scaffolds in TEMPs. © 2014 Wiley Periodicals, Inc.
Uwamahoro, Marie Christine; Massicotte, Richard; Hurtubise, Yves; Gagné-Bourque, François; Mafu, Akier Assanta; Yahia, L'Hocine
2018-01-01
Spore-forming pathogenic bacteria, such as Clostridium difficile , are associated with nosocomial infection, leading to the increased use of sporicidal disinfectants, which impacts socioeconomic costs. However, C. difficile can be prevented using microorganisms such as Bacillus amyloliquefaciens , a prophylactic agent that has been proven to be effective against it in recent tests or it can be controlled by sporicidal disinfectants. These disinfectants against spores should be evaluated according to a known and recommended standard. Unfortunately, some newly manufactured disinfectants like Bioxy products have not yet been tested. ASTM E2197-11 is a standard test that uses stainless steel disks (1 cm in diameter) as carriers, and the performance of the test formulation is calculated by comparing the number of viable test organisms to that on the control carriers. Surface tests are preferable for evaluating disinfectants with sporicidal effects on hard surfaces. This study applies improved methods, based on the ASTM E2197-11 standard, for evaluating and comparing the sporicidal efficacies of several disinfectants against spores of C. difficile and B. amyloliquefaciens , which are used as the test organisms. With the improved method, all spores were recovered through vortexing and membrane filtration. The results show that chlorine-based products are effective in 5 min and Bioxy products at 5% w/v are effective in 10 min. Although Bioxy products may take longer to prove their effectiveness, their non-harmful effects to hospital surfaces and people have been well established in the literature.
A Knowledge- Based Computer System for UO2 Characterization According to ASTM Requirements
International Nuclear Information System (INIS)
Afifi, Y.K.; El-Hakim, E.
2000-01-01
The uranium dioxde (UO 2 ) powder properties and the pellets fabrication processes determine the characteristics of the sintered UO 2 pellets. The powder properties include chemical and physical characteristics. The physical and chemical properties of UO 2 powder are normally checked to ensure consistency and reproducibility of the sintered UO 2 pellets. Powder characteristics are known to influence the subsequent manufacturing performance or the fuel properties. The aim of this paper is to provide the nuclear industry with a program dealing with the processes and the related requirements to determine the specifications of UO 2 powder according to the American Standards for Testing and Materials (ASTM). This program covers the physical and chemical characteristics of UO 2 powder. A group of logic flow charts dealing with the data and information available in the ASTM for each step in the characterization of UO 2 powder process and the technical assistance are constructed. These logic flow charts are collected to form a module of the software to qualify the UO 2 powder. The program contains 8 modules, each one deals with one object. This program saves time, is also considered as a collective schema for all the required UO 2 powder characterization and the related processes, and could be used as a training tool for less skilled personnel involved in UO 2 powder characterization laboratories
Master curve characterization of the fracture toughness behavior in SA508 Gr.4N low alloy steels
Energy Technology Data Exchange (ETDEWEB)
Lee, Ki-Hyoung, E-mail: shirimp@kaist.ac.k [Department of Materials Science and Engineering, KAIST, Daejeon 305-701 (Korea, Republic of); Kim, Min-Chul; Lee, Bong-Sang [Nuclear Materials Research Division, KAERI, Daejeon 305-353 (Korea, Republic of); Wee, Dang-Moon [Department of Materials Science and Engineering, KAIST, Daejeon 305-701 (Korea, Republic of)
2010-08-15
The fracture toughness properties of the tempered martensitic SA508 Gr.4N Ni-Mo-Cr low alloy steel for reactor pressure vessels were investigated by using the master curve concept. These results were compared to those of the bainitic SA508 Gr.3 Mn-Mo-Ni low alloy steel, which is a commercial RPV material. The fracture toughness tests were conducted by 3-point bending with pre-cracked charpy (PCVN) specimens according to the ASTM E1921-09c standard method. The temperature dependency of the fracture toughness was steeper than those predicted by the standard master curve, while the bainitic SA508 Gr.3 steel fitted well with the standard prediction. In order to properly evaluate the fracture toughness of the Gr.4N steels, the exponential coefficient of the master curve equation was changed and the modified curve was applied to the fracture toughness test results of model alloys that have various chemical compositions. It was found that the modified curve provided a better description for the overall fracture toughness behavior and adequate T{sub 0} determination for the tempered martensitic SA508 Gr.4N steels.
International Nuclear Information System (INIS)
Mueller, P. F.
2009-10-01
average size around 100 nanometers. In contrast in F82H it does not form small carbides but big oxide inclusions with a size up to 30 μm. The different behaviour of tantalum in these steels is believed to be mainly a consequence of the larger content of oxygen present and the smaller amount of aluminum in F82H compared to Eurofer97. Fracture tests with pre-cracked sub-sized compact tension specimens (three different sizes, 0.18T, 0.35T and 0.87T of Eurofer97) were carried out in the temperature range from -196 to -40 °C. The toughness-temperature behaviour and scatter were shown to deviate from the ASTM-E1921 standard predictions near the lower shelf. The athermal component of the Master-Curve was calculated to better fit our fracture toughness data from the lower to the middle transition region. The ASTM-E1921 specimen size limitations were found to be too lenient for this kind of steels. A more stringent specimen size requirement was proposed to avoid inconsistent transition temperature determinations. A promising local fracture model with the potential of predicting cleavage fracture toughness was studied. Finite element simulations were undertaken for compact specimens, notched specimens and tensile specimens of Eurofer97 steel tested from 20 °C down to -197 °C. Three and two dimensional as well as axisymmetric simulations were run in order to calculate the stress and strain fields at the onset of brittle fracture. The calculated load-displacement curves were found to reproduce very well those of the experiments. This model is able to predict the minimum fracture load of the notched specimens with the same values of critical stress and critical volume that were calibrated to predict the lower bound of fracture in compact specimens. The local approach model was also successfully used to predict the strong size effect observed experimentally in pre-cracked compact tension specimens in the upper transition region. The critical fracture stress determined in the
Li, Hui; Kayhanian, Masoud; Harvey, John T
2013-03-30
Fully permeable pavement is gradually gaining support as an alternative best management practice (BMP) for stormwater runoff management. As the use of these pavements increases, a definitive test method is needed to measure hydraulic performance and to evaluate clogging, both for performance studies and for assessment of permeability for construction quality assurance and maintenance needs assessment. Two of the most commonly used permeability measurement tests for porous asphalt and pervious concrete are the National Center for Asphalt Technology (NCAT) permeameter and ASTM C1701, respectively. This study was undertaken to compare measured values for both methods in the field on a variety of permeable pavements used in current practice. The field measurements were performed using six experimental section designs with different permeable pavement surface types including pervious concrete, porous asphalt and permeable interlocking concrete pavers. Multiple measurements were performed at five locations on each pavement test section. The results showed that: (i) silicone gel is a superior sealing material to prevent water leakage compared with conventional plumbing putty; (ii) both methods (NCAT and ASTM) can effectively be used to measure the permeability of all pavement types and the surface material type will not impact the measurement precision; (iii) the permeability values measured with the ASTM method were 50-90% (75% on average) lower than those measured with the NCAT method; (iv) the larger permeameter cylinder diameter used in the ASTM method improved the reliability and reduced the variability of the measured permeability. Copyright © 2013 Elsevier Ltd. All rights reserved.
30 CFR 285.436 - Can MMS require lease or grant contraction?
2010-07-01
... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Can MMS require lease or grant contraction? 285... Administration Lease Or Grant Contraction § 285.436 Can MMS require lease or grant contraction? At an interval no more frequent than every 5 years, the MMS may review your lease or grant area to determine whether the...
30 CFR 285.437 - When can my lease or grant be canceled?
2010-07-01
... 30 Mineral Resources 2 2010-07-01 2010-07-01 false When can my lease or grant be canceled? 285.437... Administration Lease Or Grant Cancellation § 285.437 When can my lease or grant be canceled? (a) The Secretary will cancel any lease or grant issued under this part upon proof that it was obtained by fraud or...
Zhang, Peng; Zhao, Ya-Nan; Li, Qing-Fu; Wang, Peng; Zhang, Tian-Hang
2014-01-01
This paper aims to clarify the effect of steel fiber on the flexural toughness of the high performance concrete containing fly ash and nano-SiO2. The flexural toughness was evaluated by two methods, which are based on ASTM C1018 and DBV-1998, respectively. By means of three-point bending method, the flexural toughness indices, variation coefficients of bearing capacity, deformation energy, and equivalent flexural strength of the specimen were measured, respectively, and the relational curves between the vertical load and the midspan deflection (P(V)-δ) were obtained. The results indicate that steel fiber has great effect on the flexural toughness parameters and relational curves (P(V)-δ) of the three-point bending beam specimen. When the content of steel fiber increases from 0.5% to 2%, the flexural toughness parameters increase gradually and the curves are becoming plumper and plumper with the increase of steel fiber content, respectively. However these flexural toughness parameters begin to decrease and the curves become thinner and thinner after the steel fiber content exceeds 2%. It seems that the contribution of steel fiber to the improvement of flexural toughness of the high performance concrete containing fly ash and nano-SiO2 is well performed only when the steel fiber content is less than 2%.
Energy Technology Data Exchange (ETDEWEB)
Villanueva O, A.; Gachuz M, M.E. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico)
2004-07-01
The present work studies the effect that produces the irradiation in ferritic steels (AISI 8620) on the reference temperature (T{sub 0}) that characterizes the tenacity to the fractures (K{sub JC}) of these materials obtaining this way a characteristic curve (Master Curve) of this steel. The approach of the 'Master curve' is based on the Astm E-1921. Following this standard the methodology of a sub size settled down in Charpy type test tubes. Due to this type of steels is used mainly in pressure vessels of the reactor in Nuclear Power plants, the fracture tenacity gives the rule at the moment for the verification of structural integrity of the pressure vessel of the reactor. (Author)
Energy Technology Data Exchange (ETDEWEB)
Halim, Zakiah Abd [Universiti Teknikal Malaysia Melaka (Malaysia); Jamaludin, Nordin; Junaidi, Syarif [Faculty of Engineering and Built, Universiti Kebangsaan Malaysia, Bangi (Malaysia); Yahya, Syed Yusainee Syed [Universiti Teknologi MARA, Shah Alam (Malaysia)
2015-04-15
Current steel tubes inspection techniques are invasive, and the interpretation and evaluation of inspection results are manually done by skilled personnel. Part A of this work details the methodology involved in the newly developed non-invasive, non-destructive tube inspection technique based on the integration of vibration impact (VI) and acoustic emission (AE) systems known as the vibration impact acoustic emission (VIAE) technique. AE signals have been introduced into a series of ASTM A179 seamless steel tubes using the impact hammer. Specifically, a good steel tube as the reference tube and four steel tubes with through-hole artificial defect at different locations were used in this study. The AEs propagation was captured using a high frequency sensor of AE systems. The present study explores the cluster analysis approach based on autoregressive (AR) coefficients to automatically interpret the AE signals. The results from the cluster analysis were graphically illustrated using a dendrogram that demonstrated the arrangement of the natural clusters of AE signals. The AR algorithm appears to be the more effective method in classifying the AE signals into natural groups. This approach has successfully classified AE signals for quick and confident interpretation of defects in carbon steel tubes.
International Nuclear Information System (INIS)
Halim, Zakiah Abd; Jamaludin, Nordin; Junaidi, Syarif; Yahya, Syed Yusainee Syed
2015-01-01
Current steel tubes inspection techniques are invasive, and the interpretation and evaluation of inspection results are manually done by skilled personnel. Part A of this work details the methodology involved in the newly developed non-invasive, non-destructive tube inspection technique based on the integration of vibration impact (VI) and acoustic emission (AE) systems known as the vibration impact acoustic emission (VIAE) technique. AE signals have been introduced into a series of ASTM A179 seamless steel tubes using the impact hammer. Specifically, a good steel tube as the reference tube and four steel tubes with through-hole artificial defect at different locations were used in this study. The AEs propagation was captured using a high frequency sensor of AE systems. The present study explores the cluster analysis approach based on autoregressive (AR) coefficients to automatically interpret the AE signals. The results from the cluster analysis were graphically illustrated using a dendrogram that demonstrated the arrangement of the natural clusters of AE signals. The AR algorithm appears to be the more effective method in classifying the AE signals into natural groups. This approach has successfully classified AE signals for quick and confident interpretation of defects in carbon steel tubes.
30 CFR 285.620 - What is a Construction and Operations Plan (COP)?
2010-07-01
... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What is a Construction and Operations Plan (COP... Information Requirements Construction and Operations Plan for Commercial Leases § 285.620 What is a Construction and Operations Plan (COP)? The COP describes your construction, operations, and conceptual...
30 CFR 285.610 - What must I include in my SAP?
2010-07-01
... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What must I include in my SAP? 285.610 Section... Requirements Contents of the Site Assessment Plan § 285.610 What must I include in my SAP? Your SAP must... SAP, you must provide the following information: ER29AP09.115 (b) You must provide the results of...
24 CFR 234.285 - Waived title objections.
2010-04-01
... have not been violated to a material extent. (f) Federal tax liens and rights of redemption arising... Commissioner will not object to an outstanding right of redemption in IRS if: (1) The Federal tax lien was... CONDOMINIUM OWNERSHIP MORTGAGE INSURANCE Contract Rights and Obligations-Individually Owned Units § 234.285...
Study of new rubber to steel adhesive systems based on Co(II and Cu(II sulphides coats
Directory of Open Access Journals (Sweden)
Labaj Ivan
2018-01-01
Full Text Available The presented paper deals with the preparation of new rubber to steel adhesive systems using the steel surface treatment with deposition of adhesive coats based on Co(II and Cu(II sulphides. Efficiency of new prepared adhesive systems containing Co(II and Cu(II sulphides has been compared with the efficiency of double layer adhesive system commonly used in industry. The chemical composition of prepared adhesive systems was determined using the EDX analysis. Scanning Electron Microscopy (SEM was used for study of topography and microstructure of prepared rubber to steel adhesive systems (Co(II, Cu(II sulphide, double layer adhesive system. For determination of adhesion strength between rubber blends and metal pieces with various adhesive systems deposited on these pieces, the test according to ASTM D429 standard relating to Rubber to metal adhesion, method A was used. For all test samples, the same type of rubber blend and the same curing conditions have been used.
Wolf, Heinz; Stauffer, Tony; Chen, Shu-Chen Y; Lee, Yoojin; Forster, Ronald; Ludzinski, Miron; Kamat, Madhav; Godorov, Phillip; Guazzo, Dana Morton
2009-01-01
ASTM F2338-09 Standard Test Method for Nondestructive Detection of Leaks in Packages by Vacuum Decay Method is applicable for leak-testing rigid and semi-rigid non-lidded trays; trays or cups sealed with porous barrier lidding materials; rigid, nonporous packages; and flexible, nonporous packages. Part 1 of this series describes the precision and bias studies performed in 2008 to expand this method's scope to include rigid, nonporous packages completely or partially filled with liquid. Round robin tests using three VeriPac 325/LV vacuum decay leak testers (Packaging Technologies & Inspection, LLC, Tuckahoe, NY) were performed at three test sites. Test packages were 1-mL glass syringes. Positive controls had laser-drilled holes in the barrel ranging from about 5 to 15 microm in nominal diameter. Two different leak tests methods were performed at each site: a "gas leak test" performed at 250 mbar (absolute) and a "liquid leak test" performed at about 1 mbar (absolute). The gas leak test was used to test empty, air-filled syringes. All defects with holes > or = 5.0 microm and all no-defect controls were correctly identified. The only false negative result was attributed to a single syringe with a ASTM F2338-09 test method and the precision and bias study report are available by contacting ASTM International in West Conshohocken, PA, USA (www.astm.org).
International Nuclear Information System (INIS)
Mathieu, Jean-Philippe; Inal, Karim; Berveiller, Sophie; Diard, Olivier
2010-01-01
Local approach to brittle fracture for low-alloyed steels is discussed in this paper. A bibliographical introduction intends to highlight general trends and consensual points of the topic and evokes debatable aspects. French RPV steel 16MND5 (equ. ASTM A508 Cl.3), is then used as a model material to study the influence of temperature on brittle fracture. A micromechanical modelling of brittle fracture at the elementary volume scale already used in previous work is then recalled. It involves a multiscale modelling of microstructural plasticity which has been tuned on experimental inter-phase and inter-granular stresses heterogeneities measurements. Fracture probability of the elementary volume can then be computed using a randomly attributed defect size distribution based on realistic carbides repartition. This defect distribution is then deterministically correlated to stress heterogeneities simulated within the microstructure using a weakest-link hypothesis on the elementary volume, which results in a deterministic stress to fracture. Repeating the process allows to compute Weibull parameters on the elementary volume. This tool is then used to investigate the physical mechanisms that could explain the already experimentally observed temperature dependence of Beremin's parameter for 16MND5 steel. It is showed that, assuming that the hypothesis made in this work about cleavage micro-mechanisms are correct, effective equivalent surface energy (i.e. surface energy plus plastically dissipated energy when blunting the crack tip) for propagating a crack has to be temperature dependent to explain Beremin's parameters temperature evolution.
Energy Technology Data Exchange (ETDEWEB)
Fontenelle, Marcellus; Alves, Helton Jose, E-mail: helquimica@gmail.com [Universidade Estadual do Oeste do Parana (UNIOESTE), Cascavel, PR (Brazil); Pellizzer, Eder Luis [Universidade do Oeste de Santa Catarina (UNOESC), Xanxere, SC (Brazil); Monteiro, Marcos Roberto; Rovere, Carlos Alberto Della [Universidade Federal de Sao Carlos (UFSCar), SP (Brazil); Higa, Silvia Midori [Universidade Tecnologica Federal do Parana (UTFPR), Londrina, PR (Brazil); Fontenelle, Isaddora [Universidade Federal de Santa Catarina (UFSC), Florianopolis, SC (Brazil)
2017-05-15
This work evaluates the corrosion process caused by the presence of hydrogen sulfide in the biogas in natura, in steels commonly used in the construction of steam generator boilers, simulating conditions close to those found on the real application of these materials, exposing the test bodies directly to biogas in natura, flame of combustion and gases resulting from the combustion of this biofuel, in chimney. After 314 hours of exposure under the specified conditions, the corroded surfaces of ASTM A178 and ASTM A516 were analyzed, by optical microscopy, electronic scanning microscopy, X-ray diffraction and surface hardness. The determination of corrosion rates for each test condition and each material tested can be used as a parameter for the determination of the minimum tolerance for mechanical stability, in the calculation of the minimum required thickness of the structural elements of the steam generator boilers fed to biogas. (author)
International Nuclear Information System (INIS)
Fontenelle, Marcellus; Alves, Helton Jose; Pellizzer, Eder Luis; Monteiro, Marcos Roberto; Rovere, Carlos Alberto Della; Higa, Silvia Midori; Fontenelle, Isaddora
2017-01-01
This work evaluates the corrosion process caused by the presence of hydrogen sulfide in the biogas in natura, in steels commonly used in the construction of steam generator boilers, simulating conditions close to those found on the real application of these materials, exposing the test bodies directly to biogas in natura, flame of combustion and gases resulting from the combustion of this biofuel, in chimney. After 314 hours of exposure under the specified conditions, the corroded surfaces of ASTM A178 and ASTM A516 were analyzed, by optical microscopy, electronic scanning microscopy, X-ray diffraction and surface hardness. The determination of corrosion rates for each test condition and each material tested can be used as a parameter for the determination of the minimum tolerance for mechanical stability, in the calculation of the minimum required thickness of the structural elements of the steam generator boilers fed to biogas. (author)
Fretting-corrosion at the modular tapers interface: Inspection of standard ASTM F1875-98.
Bingley, Rachel; Martin, Alan; Manfredi, Olivia; Nejadhamzeeigilani, Mahdiyar; Oladokun, Abimbola; Beadling, Andrew Robert; Siddiqui, Sohail; Anderson, James; Thompson, Jonathan; Neville, Anne; Bryant, Michael
2018-05-01
Interest in the degradation mechanisms at the modular tapers interfaces has been renewed due to increased reported cases of adverse reactions to metal debris and the appearance of wear and corrosion at the modular tapers interfaces at revision. Over the past two decades, a lot of research has been expended to understand the degradation mechanisms, with two primary implant loading procedures and orientations used consistently across the literature. ASTM F1875-98 is often used as a guide to understand and benchmark the tribocorrosion processes occurring within the modular tapers interface. This article presents a comparison of the two methods outlined in ASTM F1875-98 as well as a critique of the standard considering the current paradigm in pre-clinical assessment of modular tapers.
SCC of 2304 Duplex Stainless Steel-Microstructure, Residual Stress and Surface Grinding Effects.
Zhou, Nian; Peng, Ru Lin; Schönning, Mikael; Pettersson, Rachel
2017-02-23
The influence of surface grinding and microstructure on chloride induced stress corrosion cracking (SCC) behavior of 2304 duplex stainless steel has been investigated. Grinding operations were performed both parallel and perpendicular to the rolling direction of the material. SCC tests were conducted in boiling magnesium chloride according to ASTM G36; specimens were exposed both without external loading and with varied levels of four-point bend loading. Residual stresses were measured on selected specimens before and after exposure using the X-ray diffraction technique. In addition, in-situ surface stress measurements subjected to four-point bend loading were performed to evaluate the deviation between the actual applied loading and the calculated values according to ASTM G39. Micro-cracks, initiated by grinding induced surface tensile residual stresses, were observed for all the ground specimens but not on the as-delivered surfaces. Loading transverse to the rolling direction of the material increased the susceptibility to chloride induced SCC. Grinding induced tensile residual stresses and micro-notches in the as-ground surface topography were also detrimental.
High-Temperature Corrosion of T92 Steel in N{sub 2}/H{sub 2}O/H{sub 2}S-Mixed Gas
Energy Technology Data Exchange (ETDEWEB)
Shi, Yuke; Kim, Min Jung; Park, Soon Yong; Abro, M. Ali; Yadav, Poonam; Lee, Dong Bok [Sungkyunkwan University, Suwon (Korea, Republic of)
2016-06-15
The ASTM T92 steel was corroded at 600 ℃ and 800 ℃ at 1 atm of N{sub 2}/3.1%H{sub 2}O/2.42%H{sub 2}S-mixed gas. The formed scales were thick and fragile. They consisted primarily of the outer FeS scale and the inner (FeS, FeCr{sub 2}S{sub 4})-mixed scale containing a small amount of the Cr{sub 2}O{sub 3} scale. This indicated that corrosion occurred mainly via sulfidation rather than oxidation due to the H{sub 2}S gas. Since FeS was present throughout the whole scale, T92 steel was non-protective, displaying high corrosion rates.
International Nuclear Information System (INIS)
Silva, Carlos Eduardo da
2009-01-01
The increase of gas and petroleum demanding in the national and international markets, the specification and certification of the chemical analysis results of gas and oil pipe-line have became more and more challenging. A continuous development has been outlined to improve API grade alloy steels (American Petroleum Institute). The steel properties depend on the chemical composition control and process parameters during its manufacturing. In this work, a comparison of the measurement uncertainty between X-ray fluorescence (WD system) and Optical Emission (OES-spark) spectrometry, for API grade steel plant samples analysis, was outlined. Usually, this kind of analyze requires less than 40 seconds for full chemical characterization for adjustment in the process parameters production. The main influence source in the chemical analysis was evaluated for design of experiments. The constituents and trace elements such as Al, Si, P, S, Ti, V, Cr, Mn, Co, Ni, Cu, As, Nb, Mo and Sn were determined using the ASTM E-322, E-415, E-1009 and E-1085 standard methodologies. The 185A and 187A certified reference materials from CMI (Czech Metrology Institute) were used for evaluation of the methods. The uncertainty of the measurement, precision, accuracy, repeatability and reproducibility of the measurements were obtained applying statistic tests, recommended by ISO/IEC 17025. The uncertainty of measurement for each element is discussed for both techniques. (author)
2010-07-01
... installing facilities described in my approved SAP, COP, or GAP? 285.700 Section 285.700 Mineral Resources... § 285.700 What reports must I submit to MMS before installing facilities described in my approved SAP... in your approved COP (§ 285.632(a)) and, when required by this part, your SAP (§ 285.614(b)) or GAP...
30 CFR 285.913 - What happens if I fail to comply with my approved decommissioning application?
2010-07-01
... approved decommissioning application? 285.913 Section 285.913 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR OFFSHORE RENEWABLE ENERGY ALTERNATE USES OF EXISTING FACILITIES ON THE OUTER CONTINENTAL SHELF Decommissioning Compliance with An Approved Decommissioning Application § 285.913 What...
Energy Technology Data Exchange (ETDEWEB)
Kim, Min-Chul; Park, Sang-Gyu; Lee, Bong-Sang [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of); Lee, Ki-Hyoung [Korea Institute of Nuclear Safety, Daejeon (Korea, Republic of)
2014-10-15
In this study, microstructure and mechanical properties of SA508 Gr.3 Cl. 1, Cl.2, and Gr.4N low alloy steels are characterized to compare their properties. To evaluate the fracture toughness in the transition region, the master curve method according to ASTM E1921 was adopted in the cleavage transition region. Tensile tests and Charpy impact tests were also performed to evaluate the mechanical properties, and a microstructural investigation was carried out. The microstructure and mechanical properties of SA508 Gr.3 Cl.1, Cl2 and Gr.4N low alloy steels were characterized.. The predominant microstructure of SA508 Gr.4N model alloy is tempered martensite, while SA508 Gr.3 Cl.1 and Cl.2 steels show a typical tempered upper bainitic structure. SA508 Gr. 4N model alloy shows the best strength and transition behavior among the three SA508 steels. SA508 Gr.3 Cl.2 steel also has quite good strength, but there is a loss of toughness.
31 CFR 285.1 - Collection of past-due support by administrative offset.
2010-07-01
... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Collection of past-due support by administrative offset. 285.1 Section 285.1 Money and Finance: Treasury Regulations Relating to Money and Finance... include current basic pay, special pay, incentive pay, retainer pay, overtime, or in the case of an...
Compatibility testing of vitrified waste forms
International Nuclear Information System (INIS)
Rankin, W.N.
1978-01-01
The compatibility of vitrified radioactive waste with candidate canister materials will be evaluated with both cast and in-can melted vitrified waste. Both real and simulated sludges will be used. In addition, the compatibility of these materials with salt from a possible final storage location will be determined. Cast vitrified waste will be tested with ASTM A 333 and ASTM A 516 low-carbon steels and Type 304L stainless steel at 100, 600 and 800 0 C. Cast vitrified waste that has been devitrified by heat treatment will be tested at 100 0 C. Two types of test specimens will be used with either simulated or real sludges: (1) unsealed capsules made of pieces of mill-finished pipe into which vitrified waste is cast, and (2) sealed capsules containing a small container of vitrified waste identical to the ones in the unsealed capsule. In-can melted vitrified waste will be tested with synthetic sludge only and with ASTM A 333 and ASTM A 516 low-carbon steels, Type 304L stainless steel and Inconel 600. Two types of tests will be carried out: (1) melting vitrified waste in miniature metal canisters and (2) exposure of small (carefully measured) metal coupons to molten glass. The air oxidation rates of candidate canister materials will be determined, and specimens will also be exposed to salt from Drill Hole AEC-8 in Carlsbad, New Mexico. Sealed capsules containing an ASTM A 516 low-carbon steel or Type 304L stainless steel specimen partially embedded in a small block of salt will be heated
Intergranular Corrosion Behavior of Low-Nickel and 304 Austenitic Stainless Steels
Bansod, Ankur V.; Patil, Awanikumar P.; Moon, Abhijeet P.; Khobragade, Nilay N.
2016-09-01
Intergranular corrosion (IGC) susceptibility for Cr-Mn austenitic stainless steel and 304 austenitic stainless steel (ASS) was estimated using electrochemical techniques. Optical and SEM microscopy studies were carried out to investigate the nature of IGC at 700 °C with increasing time (15, 30, 60, 180, 360, 720, 1440 min) according to ASTM standard 262 A. Quantitative analysis was performed to estimate the degree of sensitization (DOS) using double loop electrochemical potentiokinetic reactivation (DLEPR) and EIS technique. DLEPR results indicated that with the increase in thermal aging duration, DOS becomes more severe for both types of stainless steel. The DOS for Cr-Mn ASS was found to be higher (65.12% for 1440 min) than that of the AISI 304 ASS (23% for 1440 min). The higher degree of sensitization resulted in lowering of electrical charge capacitance resistance. Chronoamperometry studies were carried out at a passive potential of 0.4 V versus SCE and was observed to have a higher anodic dissolution of the passive film of Cr-Mn ASS. EDS studies show the formation of chromium carbide precipitates in the vicinity of the grain boundary. The higher Mn content was also observed for Cr-Mn ASS at the grain boundary.
Creep crack growth in a reactor pressure vessel steel at 360 deg C
Energy Technology Data Exchange (ETDEWEB)
Wu, Rui; Seitisleam, F; Sandstroem, R [Swedish Institute for Metals Research, Stockholm (Sweden)
1999-12-31
Plain creep (PC) and creep crack growth (CCG) tests at 360 deg C and post metallography were carried out on a low alloy reactor pressure vessel steel (ASTM A508 class 2) with different microstructures. Lives for the CCG tests were shorter than those for the PC tests and this is more pronounced for simulated heat affected zone microstructure than for the parent metal at longer lives. For the CCG tests, after initiation, the cracks grew constantly and intergranularly before they accelerated to approach rupture. The creep crack growth rate is well described by C*. The relations between reference stress, failure time and steady crack growth rate are presented for the CCG tests. It is demonstrated that the failure stress due to CCG is considerably lower than the yield stress at 360 deg C. Consequently, the CCG will control the static strength of a reactor vessel. (orig.) 17 refs.
Creep crack growth in a reactor pressure vessel steel at 360 deg C
Energy Technology Data Exchange (ETDEWEB)
Rui Wu; Seitisleam, F.; Sandstroem, R. [Swedish Institute for Metals Research, Stockholm (Sweden)
1998-12-31
Plain creep (PC) and creep crack growth (CCG) tests at 360 deg C and post metallography were carried out on a low alloy reactor pressure vessel steel (ASTM A508 class 2) with different microstructures. Lives for the CCG tests were shorter than those for the PC tests and this is more pronounced for simulated heat affected zone microstructure than for the parent metal at longer lives. For the CCG tests, after initiation, the cracks grew constantly and intergranularly before they accelerated to approach rupture. The creep crack growth rate is well described by C*. The relations between reference stress, failure time and steady crack growth rate are presented for the CCG tests. It is demonstrated that the failure stress due to CCG is considerably lower than the yield stress at 360 deg C. Consequently, the CCG will control the static strength of a reactor vessel. (orig.) 17 refs.
International Nuclear Information System (INIS)
Guillen M, A.N.
1997-01-01
In the mid 19704s, the intergranular corrosion with stress corrosion cracking (IGSCC) have been identified as a greater problem in Boiling Water Reactors BWR in several places of the world. The Electrochemical Potentiokinetic Reactivation - Single Loop (EPR-SL) test and the Double Loop (EPR-DL) test, were developed as methods for measuring the Degree of Sensitization (DOS), show sensitised materials at subject to Intergranular Corrosion. In Mexico, the Laguna Verde4s reactor is BWR type and many of its principal components was built with AISI 304 stainless steels, while that in VVER reactors as well as Juragua4s reactor in Cuba is used 321 Stainless stell in its Russian equivalent designation 08Ch18N10T. In this work, were studied 304 and 08Ch18N10T stainless steels by means of EPR-SL, EPR-DL and ASTM A-262 techniques, they have been found a good correlation for 304 steel but not in 08Ch18N10T steel and was proposed one modification in the criterion by the evaluation on the sensitisation in this steels. Finally, both materials were welded with procedures used in the nuclear industry, by Slow Strain Rate Test (SSRT) to determine the Stress Corrosion Cracking SCC susceptibility, and subsequently the susceptibility to localized corrosion was studied by means of Cyclic Polarization test and the uniform corrosion rate in a solution with chlorides by the Tafel plot, Potentiodynamic Anodic Polarization Resistance. (Author)
Overview (this manuscript is an overview of an ASTM ...
The Symposium on Developing Consensus Standards for Measuring Chemical Emissions from Spray Polyurethane Foam (SPF) Insulation was held on April 30th and May 1, 2015. Sponsored by ASTM Committee D22 on Air Quality, the symposium was held in Anaheim, CA, in conjunction with the standards development meetings of the Committee. ASTM D22.05 is developing tools to answer fundamental questions: what is emitted from SPF, how long do the emissions persist, how does ventilation impact concentrations and potential exposures? How can we model these processes to address the multiplicity of products, applications, and environmental conditions that may impact exposure to emissions over the life cycle of the material? These are complex and interrelated questions that have challenged the indoor environments research community for many years. Objectives of Symposium: Standardized methods are needed to assess the potential impacts of SPF insulation products on indoor air quality, establish re-entry times for trade workers or re-occupancy times for building occupants after product installation and to evaluate post-occupancy ventilation. The objective of the symposium was to provide a forum for the exchange of ideas from SPF manufacturers, regulatory agencies, indoor air quality professionals, testing labs, air quality consultants, instrument vendors and other stakeholders. Following the presentations on the current status of measuring emissions from SPF insulation, participants di
The Effects of Shallow Cryogenic Process On The Mechanical Properties of AISI 4140 Steel
Directory of Open Access Journals (Sweden)
Eşref KIZILKAYA
2018-03-01
Full Text Available In this study, shallow cryogenic treatments were carried out for various holding time to AISI 4140 steel and the effects of heat treatment parameters on wear behavior, impact strength and tensile strength were investigated. Three different holding times were used for cryogenic heat treatments. After the cryogenic process, single tempering was applied. In addition, the abrasion tests were carried out at three different forces (5N, 10N and 15N at a constant slip speed (3.16 m / s and at three different slip distances (95 m, 190 m, 285 m. It has been determined that the shallow cryogenic process parameters significantly influence the mechanical properties of the AISI 4140 steel as a result of experimental studies., Low heat treatment times in cryogenic heat treatment have been found to have a positive effect on many mechanical properties, especially wear. The mechanical properties of the AISI 4140 steel can be optimized by controlling the shallow cryogenic heat treatment parameters.
ASTM clustering for improving coal analysis by near-infrared spectroscopy.
Andrés, J M; Bona, M T
2006-11-15
Multivariate analysis techniques have been applied to near-infrared (NIR) spectra coals to investigate the relationship between nine coal properties (moisture (%), ash (%), volatile matter (%), fixed carbon (%), heating value (kcal/kg), carbon (%), hydrogen (%), nitrogen (%) and sulphur (%)) and the corresponding predictor variables. In this work, a whole set of coal samples was grouped into six more homogeneous clusters following the ASTM reference method for classification prior to the application of calibration methods to each coal set. The results obtained showed a considerable improvement of the error determination compared with the calibration for the whole sample set. For some groups, the established calibrations approached the quality required by the ASTM/ISO norms for laboratory analysis. To predict property values for a new coal sample it is necessary the assignation of that sample to its respective group. Thus, the discrimination and classification ability of coal samples by Diffuse Reflectance Infrared Fourier Transform Spectroscopy (DRIFTS) in the NIR range was also studied by applying Soft Independent Modelling of Class Analogy (SIMCA) and Linear Discriminant Analysis (LDA) techniques. Modelling of the groups by SIMCA led to overlapping models that cannot discriminate for unique classification. On the other hand, the application of Linear Discriminant Analysis improved the classification of the samples but not enough to be satisfactory for every group considered.
2010-07-01
... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What activities require a revision to my SAP, and when will MMS approve the revision? 285.617 Section 285.617 Mineral Resources MINERALS MANAGEMENT...: (1) Designed not to cause undue harm or damage to natural resources; life (including human and...
International Nuclear Information System (INIS)
Cabo, Amado; Bruhl, Sonia P.; Vaca, Laura S.; Charadia, Raul Charadia
2010-01-01
Precipitation hardening stainless steels are used as structural materials in the aircraft and the chemical industry because of their good combination of mechanical and corrosion properties. The aim of this work is to analyze the structural changes produced by plasma nitriding in the near surface of Thyroplast PH X Supra®, a PH stainless steel from ThyssenKrupp, and to study the effect of nitriding parameters in wear and corrosion resistance. Samples were first aged and then nitriding was carried out in an industrial facility at two temperatures, with two different nitrogen partial pressures in the gas mixture. After nitriding, samples were cut, polished, mounted in resin and etched with Vilella reagent to reveal the nitrided case. Nitrided structure was also analyzed with XRD. Erosion/Corrosion was tested against sea water and sand flux, and corrosion in a salt spray fog (ASTM B117). All nitrided samples presented high hardness. Samples nitrided at 390 deg C with different nitrogen partial pressure showed similar erosion resistance against water and sand flux. The erosion resistance of the nitrided samples at 500 deg C was the highest and XRD revealed nitrides. Corrosion resistance, on the contrary, was diminished; the samples suffered of general corrosion during the salt spray fog test. (author)
Thermal Stability and Lubrication Properties of Biodegradable Castor Oil on AISI 4140 Steel
Directory of Open Access Journals (Sweden)
María Teresa Hernández-Sierra
2018-06-01
Full Text Available Lubricants have much importance in several industries, principally serving to reduce friction and wear in mechanical elements. In this study, the influence of Castor oil as bio-lubricant on the friction and wear performance of AISI 4140 steel was investigated. For that purpose, pin-on-disk friction tests were conducted according to ASTM G-99, by using pins of tungsten carbide (WC as counterparts. The experiments were performed at two different temperatures. This work also presents the Attenuated Total Reflection Fourier Transform Infrared Spectroscopy (ATR-FTIR and 1H-NMR analyses for the chemical characterization of oils and a study of their degradation by oxidation. The analysis of the damage caused to steel due to friction was deepened by analyzing its microhardness and microstructure in the worn zone. As a reference, the same experiments were performed with a commercial oil. The friction behavior of 4140 steel/WC with Castor oil lubrication at the two temperatures was notably better than that obtained under the reference oil lubrication. The kinetic friction coefficient (µk was up to 76% lower. However, a slight increase in steel wear was observed under Castor oil lubrication. Despite this, these results suggest that Castor oil could be used as bio-lubricant in systems which are susceptible to levels of high friction.
Sensitization of Laser-beam Welded Martensitic Stainless Steels
Dahmen, Martin; Rajendran, Kousika Dhasanur; Lindner, Stefan
Ferritic and martensitic stainless steels are an attractive alternative in vehicle production due to their inherent corrosion resistance. By the opportunity of press hardening, their strength can be increased to up to 2000 MPa, making them competitors for unalloyed ultra-high strength steels. Welding, nevertheless, requires special care, especially when it comes to joining of high strength heat treated materials. With an adopted in-line heat treatment of the welds in as-rolled as well as press hardened condition, materials with sufficient fatigue strength and acceptable structural behavior can be produced. Because of microstructural transformations in the base material such as grain coarsening and forced carbide precipitation, the corrosion resistance of the weld zone may be locally impaired. Typically the material in the heat-affected zone becomes sensitive to intergranular cracking in the form of knife-edge corrosion besides the fusion line. The current study comprises of two text scenarios. By an alternating climate test, general response in a corroding environment is screened. In order to understand the corrosion mechanisms and to localize the sensitive zones, sensitisation tests were undertaken. Furthermore, the applicability of a standard test according to ASTM 763-83 was examined. It was found that the alternative climate test does not reveal any corrosion effects. Testing by the oxalic acid test revealed clearly the effect of welding, weld heat treatment and state of thermal processing. Also application of the standard which originally suited for testing ferritic stainless steels could have been justified.
14 CFR 125.285 - Pilot qualifications: Recent experience.
2010-01-01
... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Pilot qualifications: Recent experience... Requirements § 125.285 Pilot qualifications: Recent experience. (a) No certificate holder may use any person, nor may any person serve, as a required pilot flight crewmember unless within the preceding 90...
International Nuclear Information System (INIS)
Hackett, E.M.; Kirk, M.T.; Hays, R.A.
1986-08-01
A method is described for developing J-R curves for nuclear piping materials using the DC Potential Drop (DCPD) technique. Experimental calibration curves were developed for both three point bend and compact specimen geometries using ASTM A106 steel, a type 304 stainless steel and a high strength aluminum alloy. These curves were fit with a power law expression over the range of crack extension encountered during J-R curve tests (0.6 a/W to 0.8 a/W). The calibration curves were insensitive to both material and sidegrooving and depended solely on specimen geometry and lead attachment points. Crack initiation in J-R curve tests using DCPD was determined by a deviation from a linear region on a plot of COD vs. DCPD. The validity of this criterion for ASTM A106 steel was determined by a series of multispecimen tests that bracketed the initiation region. A statistical differential slope procedure for determination of the crack initiation point is presented and discussed. J-R curve tests were performed on ASTM A106 steel and type 304 stainless steel using both the elastic compliance and DCPD techniques to assess R-curve comparability. J-R curves determined using the two approaches were found to be in good agreement for ASTM A106 steel. The applicability of the DCPD technique to type 304 stainless steel and high rate loading of ferromagnetic materials is discussed. 15 refs., 33 figs
Sigma phase transformation in super duplex steel in the range of 900-1050 oC
International Nuclear Information System (INIS)
Garin, J.L; Manheim, R.L; Rios, D
2012-01-01
The embrittlement phenomenon observed in duplex stainless steels obeys to the presence of intermediate phases in the microstructure, principally the so-called sigma-phase, which preferently arises by heating over the range of 540 to 850 o C. The present article describes the dissolution of sigma-phase in welded joints of cast super duplex stainless steels (ASTM A890), at temperatures from 900 to 1050 o C. The experimental procedure utilized usual techniques of quantitative metallography and X-ray diffraction. Annealing of the samples at 850 o C yielded starting contents of sigma of 40,4 % (vol) in the fusion zone and 45,4 % (vol) in the heat-affected zone. The dissolution of the compound was observed after annealing of the specimens at 900, 950, 1.000 and 1.050 o C, with a moderate kinetics at lesser temperatures, while the transformation became fully achieved at 1.050 o C
Considerations on the ASTM standards 1789-04 and 1422-05 on the forensic examination of ink.
Neumann, Cedric; Margot, Pierre
2010-09-01
The ASTM standards on Writing Ink Identification (ASTM 1789-04) and on Writing Ink Comparison (ASTM 1422-05) are the most up-to-date guidelines that have been published on the forensic analysis of ink. The aim of these documents is to cover most aspects of the forensic analysis of ink evidence, from the analysis of ink samples, the comparison of the analytical profile of these samples (with the aim to differentiate them or not), through to the interpretation of the result of the examination of these samples in a forensic context. Significant evolutions in the technology available to forensic scientists, in the quality assurance requirements brought onto them, and in the understanding of frameworks to interpret forensic evidence have been made in recent years. This article reviews the two standards in the light of these evolutions and proposes some practical improvements in terms of the standardization of the analyses, the comparison of ink samples, and the interpretation of ink examination. Some of these suggestions have already been included in a DHS funded project aimed at creating a digital ink library for the United States Secret Service. © 2010 American Academy of Forensic Sciences.
Improving electron beam weldability of heavy steel plates for PWR-steam generator
International Nuclear Information System (INIS)
Tomita, Yukio; Mabuchi, Hidesato; Koyama, Kunio
1996-01-01
Installation and replacement of many PWR-steam generators are planned inside and outside Japan. The steel plates for steam generators are heavy in thickness, and increase the number of welding passes and prolong the welding time. Electron beam welding (EBW) can greatly reduce the welding period compared with conventional welding methods (narrow-gap gas metal arc welding (GMAW) and submerged arc welding (SAW)). The problems in applying EBW are to prevent weld defects and to improve the toughness of the weld metal. Defect-free welding procedures were successfully established even in thick steel plates. The factors that deteriorate weld-metal (WM) toughness of EBW were investigated. The manufacturing process, which utilizes a new secondary refining process at steelmaking and a high-torque mill at plate mill in actual mass-production, were established. EBW base metal and WM have better properties including fracture toughness than those of conventional welding processes. As a result, an application of EBW to the fabrication of PWR-steam generators has become possible. Large amounts of ASTM A533 Gr B Cl 2 (JIS SQV2B) steel plates in actual PWR-steam generators have come to be produced (more than 1,500 ton) by applying EBW. (author)
Variability of chemical analysis of reinforcing bar produced in Saudi Arabia
Salman, A.; Djavanroodi, F.
2018-04-01
In view of the importance and demanding roles of steel rebar’s in the reinforced concrete structures, accurate information on the properties of the steels is important at the design stage. In the steelmaking process, production variations in chemical composition are unavoidable. The aim of this work is to study the variability of the chemical composition of reinforcing steel produced throughout the Saudi Arabia and asses the quality of steel rebar’s acoording to ASTM A615. 68 samples of ASTM A615 Grade 60 from different manufacturers were collected and tested using the Spectrometer test to obtain Chemical Compositions. EasyFit (5.6) software is utilized to conducted statistical analysis. Chemical compositions distributions and, control charts are generated for the compositions. Results showed that some compositions are above the upper line of the control chart. Finally, the analyses show that less than 3% of the steel failed to meet minimum ASTM standards for chemical composition.
Energy Technology Data Exchange (ETDEWEB)
Sreenivasan, P.R.
2016-02-15
The semi-empirical cleavage fracture stress model (CFS), based on the microscopic cleavage fracture stress, s{sub f}, for estimating the ASTM E1921 reference temperature (T{sub 0}) of ferritic steels from instrumented impact testing of unprecracked Charpy V-notch specimens is further confirmed by test results for additional steels, including steels highly embrittled by thermal aging or irradiation. In addition to the ferrite-pearlite, bainitic or tempered martensitic steels (which was examined earlier), acicular or polygonal ferrite, precipitation-strengthened or additional simulated heat affected zone steels are also evaluated. The upper limit for the applicability of the present CFS model seems to be T{sub 41J} ∝160 to 170 C or T{sub 0} or T{sub Qcfs} (T{sub 0} estimate from the present CFS model) ∝100 to 120 C. This is not a clear-cut boundary, but indicative of an area of caution where generation and evaluation of further data are required. However, the present work demonstrates the applicability of the present CFS model even to substantially embrittled steels. The earlier doubts expressed about T{sub Qcfs} becoming unduly non-conservative for highly embrittled steels has not been fully substantiated and partly arises from the necessity of modifications in the T{sub 0} evaluation itself at high degrees of embrittlement suggested in the literature.
Sidhom, H.; Amadou, T.; Sahlaoui, H.; Braham, C.
2007-06-01
The evaluation of the degree of sensitization (DOS) to intergranular corrosion (IGC) of a commercial AISI 316L austenitic stainless steel aged at temperatures ranging from 550 °C to 800 °C during 100 to 80,000 hours was carried out using three different assessment methods. (1) The microstructural method coupled with the Strauss standard test (ASTM A262). This method establishes the kinetics of the precipitation phenomenon under different aging conditions, by transmission electronic microscope (TEM) examination of thin foils and electron diffraction. The subsequent chromium-depleted zones are characterized by X-ray microanalysis using scanning transmission electronic microscope (STEM). The superimposition of microstructural time-temperature-precipitation (TTP) and ASTM A262 time-temperature-sensitization (TTS) diagrams provides the relationship between aged microstructure and IGC. Moreover, by considering the chromium-depleted zone characteristics, sensitization and desensitization criteria could be established. (2) The electrochemical method involving the double loop-electrochemical potentiokinetic reactivation (DL-EPR) test. The operating conditions of this test were initially optimized using the experimental design method on the bases of the reliability, the selectivity, and the reproducibility of test responses for both annealed and sensitized steels. The TTS diagram of the AISI 316L stainless steel was established using this method. This diagram offers a quantitative assessment of the DOS and a possibility to appreciate the time-temperature equivalence of the IGC sensitization and desensitization. (3) The analytical method based on the chromium diffusion models. Using the IGC sensitization and desensitization criteria established by the microstructural method, numerical solving of the chromium diffusion equations leads to a calculated AISI 316L TTS diagram. Comparison of these three methods gives a clear advantage to the nondestructive DL-EPR test when it is
Fracture toughness of manet II steel
International Nuclear Information System (INIS)
Gboneim, M.M.; Munz, D.
1997-01-01
High fracture toughness was evaluated according to the astm and chromium (9-12) martensitic steels combine high strength and toughness with good corrosion and oxidation resistance in a range of environments, and also show relatively high creep strength at intermediate temperatures. They therefore find applications in, for example, the offshore oil and gas production and chemical industries i pipe work and reaction vessels, and in high temperature steam plant in power generation systems. Recently, the use of these materials in the nuclear field was considered. They are candidates as tubing materials for breeder reactor steam generators and as structural materials for the first wall and blanket in fusion reactors. The effect of ageing on the tensile properties and fracture toughness of a 12 Cr-1 Mo-Nb-v steel, MANET II, was investigated in the present work. Tensile specimens and compact tension (CT) specimens were aged at 550 degree C for 1000 h. The japanese standards. Both microstructure and fracture surface were examined using optical and scanning electron microscopy (SEM). The results showed that ageing did not affect the tensile properties. However, the fracture toughness K Ic and the tearing modules T were reduced due to the ageing treatment. The results were discussed in the light of the chemical composition and the fracture surface morphology. 9 figs., 3 tabs
Grain Refinement of Steels through Solidification Modification
2017-09-14
machined the tensile bar samples into 0.5 inch diameter tensile bars that met ASTM E8. Tensile testing occurred on a 450 kN hydraulic mechanical test...frame. The tests followed ASTM E8 guidelines and used gage marks for elongation measurement. An optical emission spectrometer (OES) analyzed the...emission spectrometer samples. Half-inch diameter tensile bars were turned on a Lathe in accordance with ASTM ES and tested on a hydraulic universal
2010-07-01
... decommissioning for facilities authorized under my SAP, COP, or GAP? 285.902 Section 285.902 Mineral Resources... SAP, COP, or GAP? (a) Except as otherwise authorized by MMS under § 285.909, within 2 years following... under your SAP, COP, or GAP, you must submit a decommissioning application and receive approval from the...
Prediction of fracture toughness K/sub Ic/ of steel from Charpy impact test results
Energy Technology Data Exchange (ETDEWEB)
Iwadate, Tadao; Tanaka, Yasuhiko; Takemata, Hiroyuki; Terashima, Shuhei
1986-08-01
This paper presents a method to predict the fracture toughness K/sub Ic/ and/or K/sub Id/ of steels using their Charpy impact test results and tensile properties. The fracture toughness, Charpy impact and tensile properties of 2 1/4 Cr-1Mo, ASTM A508 Cl.1, A508 Cl.2 A508 Cl.3 and A533 Gr.B Cl.1 steels were measured and analysed on the basis of the excess temperature (test temperature minus FATT) and Rolfe-Novak correlation. The relationship between K/sub Ic//K/sub Ic-us/ and the excess temperature, where K/sub Ic-us/ is the upper-shelf fracture toughness K/sub Ic/ predicted by Rolfe-Novak correlation, discloses that the K/sub Ic/ transition curves of several steels are representable by only one trend curve of K/sub Ic//K/sub Ic-us/ or K/sub Id//K/sub Id-us/ versus excess temperature relation. This curve is denoted as a ''master curve''. By using this curve, the fracture toughness of steel can be predicted using Charpy impact and tensile test results. By taking account of the scattering of both the fracture toughness and Charpy impact test results, the confidence limits of the master curve were also determined. Another approach to develop more general procedure of predicting the fracture toughness K/sub Ic/ is also discussed.
Park, Yu Rang; Yoon, Young Jo; Jang, Tae Hun; Seo, Hwa Jeong; Kim, Ju Han
2014-01-01
Extension of the standard model while retaining compliance with it is a challenging issue because there is currently no method for semantically or syntactically verifying an extended data model. A metadata-based extended model, named CCR+, was designed and implemented to achieve interoperability between standard and extended models. Furthermore, a multilayered validation method was devised to validate the standard and extended models. The American Society for Testing and Materials (ASTM) Community Care Record (CCR) standard was selected to evaluate the CCR+ model; two CCR and one CCR+ XML files were evaluated. In total, 188 metadata were extracted from the ASTM CCR standard; these metadata are semantically interconnected and registered in the metadata registry. An extended-data-model-specific validation file was generated from these metadata. This file can be used in a smartphone application (Health Avatar CCR+) as a part of a multilayered validation. The new CCR+ model was successfully evaluated via a patient-centric exchange scenario involving multiple hospitals, with the results supporting both syntactic and semantic interoperability between the standard CCR and extended, CCR+, model. A feasible method for delivering an extended model that complies with the standard model is presented herein. There is a great need to extend static standard models such as the ASTM CCR in various domains: the methods presented here represent an important reference for achieving interoperability between standard and extended models.
Effect of cryogenic treatment on tensile behavior of case carburized steel-815M17
International Nuclear Information System (INIS)
Bensely, A.; Senthilkumar, D.; Mohan Lal, D.; Nagarajan, G.; Rajadurai, A.
2007-01-01
The crown wheel and pinion represent the most highly stressed parts of a heavy vehicle; these are typically made of 815M17 steel. The reasons for the frequent failure of these components are due to tooth bending impact, wear and fatigue. The modern processes employed to produce these as high, durable components include cryogenic treatment as well as conventional heat treatment. It helps to convert retained austenite into martensite as well as promote carbide precipitation. This paper deals with the influence of cryogenic treatment on the tensile behavior of case carburized steel 815M17. The impetus for studying the tensile properties of gear steels is to ensure that steels used in gears have sufficient tensile strength to prevent failure when gears are subjected to tensile or fatigue loads, and to provide basic design information on the strength of 815M17 steel. A comparative study on the effects of deep cryogenic treatment (DCT), shallow cryogenic treatment (SCT) and conventional heat treatment (CHT) was made by means of tension testing. This test was conducted as per ASTM standard designation E 8M. The present results confirm that the tensile behavior is marginally reduced after cryogenic treatment (i.e. both shallow and deep cryogenic treatment) for 815M17 when compared with conventional heat treatment. Scanning electron microscopic (SEM) analysis of the fracture surface indicates the presence of dimples and flat fracture regions are more common in SCT specimens than for CHT and DCT-processed material
Fracture toughness evaluation in the transition region of reactor pressure vessel steel
International Nuclear Information System (INIS)
Onizawa, K.; Suzuki, M.
1995-01-01
The fracture toughness (K jc and Jc) values at the cleavage fracture initiation in the transition region of a RPV steel were investigated using mainly precracked Charpy specimens. A conventional statistical approach and a fractographic study were applied to analyze the scatter of the fracture toughness values from precracked Charpy specimens. The material used was an ASTM A533B class 1 steel, which was designated as an IAEA correlation monitor material, JRQ. A lower bound transition curve of the fracture toughness for unirradiated condition was determined by the 5% confidence limit from the Weibull and fractographic analyses. The lower bound transition curve after irradiation was evaluated based on the statistics of unirradiated specimens. The results indicated that the shift of the fracture toughness transition curbe were somewhat larger than the Charpy 41J transition temperature. The parameters to determine the lower bound toughness such as the Weibull slope and the amount of ductile crack growth are discussed. The results are also compared with a model based on weakest link theory. (author). 12 refs, 12 figs, 5 tabs
30 CFR 285.615 - What other reports or notices must I submit to MMS under my approved SAP?
2010-07-01
... MMS under my approved SAP? 285.615 Section 285.615 Mineral Resources MINERALS MANAGEMENT SERVICE... CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 285.615 What other reports or notices must I submit to MMS under my approved SAP? (a) You must notify MMS in writing within...
Boron-bearing Influences of 9Cr-0.5Mo-2W-V-Nb Ferritic/Martensitic Steels for a SFR Fuel Cladding
International Nuclear Information System (INIS)
Baek, Jong-Hyuk; Han, Chang-Hee; Kim, Woo-Gon; Kim, Sung-Ho; Lee, Chan-Bock
2008-01-01
Currently the principal materials in a SFR (sodium-cooled fast reactor) of Gen-IV nuclear system are considering stainless steels (e.g. austenitic steels and ferritic/martensitic steels) for pressure boundary and structural applications in the primary circuit (cladding, duct, cold and hot leg piping, and pressure vessel). There are sound technical justifications for these material selections, and the adoption of these stainless steels for a wide range of nuclear and non-nuclear applications has generated much industrial technology and experience. However, there are strong incentives to develop advanced materials, especially cladding, for the Gen-IV SFR. The Gen-IV SFR is to have a considerable increase in safety and be economically competitive when compared with the conventional water reactors. To accomplish these objectives, the development of the fuel cladding material should be set forth as a premise because its integrity is directly related to those of the reactor system as well as the fuel in the Gen-IV SFR. Since last year, a R and D program was launched to develop the improved ferritic/martensitic steel for the Gen-IV SFR fuel cladding. Categories of materials considered in the program included 8 - 12% Cr ferritic/ martensitic steels. A strong recommendation was made for the development of a high strength steel equivalent to or superior to ASTM Gr.92 steel to offset the difficulties encountered with commercial available steels of the 8 - 12% Cr group. That is, since fuel cladding in the Gen-IV SFR would operate under higher temperatures than 600 .deg. C, contacting with liquid sodium, and be irradiated by neutrons to as high as 200dpa, the cladding should thus sustain both superior irradiation and temperature stabilities during an operational life. The newly developed advanced steel should overcome the severe drawback; mechanical properties, especially creep, are deteriorated at a higher temperature over 600 .deg. C. In this study, as one of the composition
Fracture toughness of China low activation martensitic (CLAM) steel at room temperature
Energy Technology Data Exchange (ETDEWEB)
Li, Kunfeng [University of Science and Technology of China, Hefei, Anhui 230027 (China); Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Liu, Shaojun, E-mail: shaojun.liu@fds.org.cn [Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Huang, Qunying [University of Science and Technology of China, Hefei, Anhui 230027 (China); Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Xu, Gang; Jiang, Siben [Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China)
2014-04-15
Highlights: • The fracture toughness of CLAM steel at room temperature is 417.9 kJ/m{sup 2} measured by unloading compliance method according to the ASTM E1820-11. • The fracture toughness of CLAM steel at room temperature can be calculated on the basis of the fractal dimensions measured under plane strain conditions. The calculated result and relative error for this experiment are 454.6 kJ/m{sup 2} and 8.78% respectively. • The calculation method could be used to estimate the fracture toughness of materials with analysis of the fracture surface. - Abstract: The fracture toughness (J{sub IC}) of China low activation martensitic (CLAM) steel was tested at room temperature through the compact tension specimen, the result is 417.9 kJ/m{sup 2}, which is similar to the JLF-1 at same experimental conditions. The microstructural observation of the fracture surface shows that the fracture mode is a typical ductile fracture. Meanwhile, the fracture toughness is also calculated on the basis of the fractal dimension and the calculated result is 454.6 kJ/m{sup 2}, which is consistent well with the experimental result. This method could be used to estimate the fracture toughness of materials by analyzing of the fracture surface.
Directory of Open Access Journals (Sweden)
Matheus David Inocente Domingos
2016-12-01
especially the AC+rubber and the AC+rubber+PPA. The AC+PPA showed low stress sensitivity and the best results for the parameters R and Jnr at 3,200 Pa either in the ASTM or the AASHTO protocols, which justifies its choice as the best formulation. The data from the modified asphalt binders suggest that the change from the ASTM protocol to the AASHTO one is recommended.
ASTM Committee D-7 : Wood : promoting safety and standardization for 100 years
David W. Green; Robert L. Ethington
2004-01-01
In October 2004, Committee D-7 on Wood of the American Society for Testing and Materials (ASTM) is celebrating 100 years of contributions to the safe and efficient use of wood as a building material. Born during a period of rapid social, economic, and technological change, the Committee faced controversial issues and the challenge of a changing forest resource. This...
Autogenous shrinkage of Ducorit S5R ASTM C 1698-09 test method
DEFF Research Database (Denmark)
Damkilde, Lars
The report deals with experimental measurement of autogenous shrinkage of Ducorit S5R according to the test method ASTM C 1698-09. This test method measures the bulk strain of a sealed cementitious specimen, at constant temperature and not subjected to external forces, from the time of final...
Corrosion of a carbon steel in simulated liquid nuclear wastes
International Nuclear Information System (INIS)
Saenz Gonzalez, Eduardo
2005-01-01
This work is part of a collaboration agreement between CNEA (National Atomic Energy Commission of Argentina) and USDOE (Department of Energy of the United States of America), entitled 'Tank Corrosion Chemistry Cooperation', to study the corrosion behavior of carbon steel A537 class 1 in different simulated non-radioactive wastes in order to establish the safety concentration limits of the tank waste chemistry at Hanford site (Richland-US). Liquid high level nuclear wastes are stored in tanks made of carbon steel A537 (ASTM nomenclature) that were designed for a service life of 20 to 50 years. A thickness reduction of some tank walls, due to corrosion processes, was detected at Hanford site, beyond the existing predicted values. Two year long-term immersion tests were started using non radioactive simulated liquid nuclear waste solutions at 40 C degrees. This work extends throughout the first year of immersion. The simulated solutions consist basically in combinations of the 10 most corrosion significant chemical components: 5 main components (NaNO 3 , NaCl, NaF, NaNO 2 and NaOH) at three concentration levels and 5 secondary components at two concentration levels. Measurements of the general corrosion rate with time were performed for carbon steel coupons, both immersed in the solutions and in the vapor phases, using weight loss and electrochemistry impedance spectroscopy techniques. Optic and scanning electron microscopy examination, analysis of U-bend samples and corrosion potential measurements, were also done. Localized corrosion susceptibility (pitting and crevice corrosion) was assessed in isolated short-term tests by means of cyclic potentiodynamic polarization curves. The effect of the simulated waste composition on the corrosion behavior of A537 steel was studied based on statistical analyses. The Surface Response Model could be successfully applied to the statistical analysis of the A537 steel corrosion in the studied solutions. General corrosion was not
International Nuclear Information System (INIS)
Invernizzi, Bruno Pizol
2017-01-01
This study carried out circumferential welding experiments in UNS S32750 Super Duplex Stainless Steel tubes using diameters of 19,05 mm and 48,20 mm. Welds were performed using various welding parameters on a MIG machine with Cold Metal Transfer® CMT control. The weld joints were evaluated by visual and dimensional inspection in addition to the Vickers microhardness and traction tests, as well as the microstructural analysis in conjunction with phase precipitation analysis, which was performed according to practice A of ASTM A923, and corrosion test in accordance with practice A of ASTM G48 in conjunction with ASTM A923. The results indicated that welds performed in pipes with a diameter of 19.05 mm showed a weld joint with unacceptable dimensions according to the standard, this condition being attributed the use of a high wire diameter for the welding conditions used. Welding performed for pipes with a diameter of 48.20 mm showed a lack of penetration under the conditions employed when welded by the conventional CMT® process. In the case of the use of CMT® combined with pulsed arc, under conditions that generated greater heat input during welding, this resulted in total penetration of the joint and adequate surface finish. The results indicated that welding using the CMT® process combined with pulsed arc, under the conditions (parameters) employed generated good surface finish, combined mechanical properties, meeting standards requirements, as well as a balanced microstructure and high resistance to corrosion. (author)
Tantalum-Addition Effect on Tensile and Creep Properties in 9Cr-0.5Mo-2W-V-Nb Steels
International Nuclear Information System (INIS)
Kim, Woo Gon; Kim, Sung Ho; Back, Jong Hyuk; Kim, Tae Kyu; Lee, Chan Bock
2011-01-01
Ferritic/martensitic steels (FMS) are being considered prospectively as cladding materials of a SFR fuel in Gen-IV nuclear systems. There are sound technical justifications for these material selections, and the adoption of the FM steels for a wide range of nuclear and non-nuclear applications has generated much industrial technology and experience. However, there are strong incentives to develop advanced materials, especially cladding, for a Gen-IV SFR. To develop an improved FM steel for the Gen-IV SFR fuel cladding in Korea, a R and D program has been progressed since 2007. Categories of materials considered in the program included 8∼12% Cr FM steels. A strong recommendation was made for the development of a high strength steel equivalent to or superior to ASTM Gr.92 steel (hereafter Gr. 92) to offset the difficulties encountered with commercial available high Cr (8∼12%) steels. Since the fuel cladding in a Gen-IV SFR would operate under higher temperatures than 600 .deg. C, contacting with liquid sodium, and be irradiated by neutrons to as high as 200dpa, the developed cladding should thus sustain both superior irradiation and temperature stabilities during its operational life. The newly developed advanced steel should also overcome severe drawbacks: mechanical properties, especially creep, are deteriorated at a higher temperature over 600 .deg. C. The aim of this study is to investigate the effect of Ta addition on the tensile and creep properties of the three alloys which are designed, manufactured and tested. Their properties are obtained and compared for developing new FM fuel cladding materials
The Status of silicosis in the world: Feedback on the ASTM Silica Symposium
CSIR Research Space (South Africa)
Pretorius, CJ
2013-06-01
Full Text Available The second ASTM Silica Symposium was held in Oct 2012 where speakers reported on the status of silicosis in their respective countries. Speakers reported on findings of research that they carried out on sampling equipment and analytical techniques...
International Nuclear Information System (INIS)
James, L.A.
1986-03-01
Modified WOL specimens were employed to evaluate the susceptibility of two candidate container materials, A36 and A387-9 steels, to SCC in simulated groundwater at 250 0 C. The test duration was 20,000 hours. Post-test measurements of specimen compliance were not possible because significant build-up of corrosion products and/or mineral deposits on the fracture faces prevented a linear relationship between load and displacement. Considerable load was ''lost'' due to time-independent plasticity, time-dependent deformation and crack-face wedging, but the amounts lost were comparable to similar short-term tests conducted earlier. A number of direct and indirect observations suggested that no crack extension occurred during the environmental exposure. One indirect observation, the initial pre-test compliance measurements, suggested a possibility of crack extension occurred, but it is believed that these measurements were in error because of the experimental test set-up used in the program
International Nuclear Information System (INIS)
Baer, D.R.
2005-01-01
An updated version of the American Society for Testing and Materials (ASTM) guide E 1523 to the methods to charge control and charge referencing techniques in x-ray photoelectron spectroscopy has been released by ASTM [Annual Book of ASTM Standards Surface Analysis (American Society for Testing and Materials, West Conshohocken, PA, 2004), Vol. 03.06]. The guide is meant to acquaint x-ray photoelectron spectroscopy (XPS) users with the various charge control and charge referencing techniques that are and have been used in the acquisition and interpretation of XPS data from surfaces of insulating specimens. The current guide has been expanded to include new references as well as recommendations for reporting information on charge control and charge referencing. The previous version of the document had been published in 1997 [D. R. Baer and K. D. Bomben, J. Vac. Sci. Technol. A 16, 754 (1998)
Directory of Open Access Journals (Sweden)
Pavel Michel Almaguer‐Zaldivar
2015-01-01
Full Text Available Las uniones soldadas son un componente importante de una estructura, por lo que siempre es necesario conocer la respuesta de las mismas sometidas a cargas cíclicas. El objetivo de este trabajo es obtener la curva S-N de una unión soldada a tope de acero AISI 1015 y electrodo E6013 como material de aporte. Los ensayos a fatiga se realizaron de acuerdo a la norma ASTM en una máquina universal MTS810. Se utilizaron probetas de sección rectangular. El ciclo de carga fueasimétrico a tracción, con un coeficiente de asimetría de 0,1. Se obtuvo que la unión estudiada tiene un límite de resistencia a la fatiga de 178 MPa, a un punto de corte de 2 039 093 ciclos.Palabras claves: unión soldada, fatiga, curva S-N, AISI 1015, electrodo E6013._______________________________________________________________________________AbstractWelded joints are an important component in structures, by this reason is necessary to know the behaviour of these elements under cyclic loads. The objective of this work is to obtain the S-N curve of the butt welded joint of AISI 1015 steel and electrode E6013 as the contribution material. Fatiguetest was realized within the ASTM standard in the MTS810 testing machine. Rectangular cross section specimens was used. Cyclic loads was asymmetric tensile and the asymmetry ratio used was 0,1. In this study was obtained the fatigue limit equal to 178 MPa, at the cut point of 2 039 093 cycles.Key words: welded joint, fatigue, S-N curve, AISI 1015 steel, electrode E6013.
International Nuclear Information System (INIS)
Pereira, L.C.; Darwish, F.A.I.
1981-01-01
The specimen strength ratio (R sub(sb)) determined for precraked Charpy specimens fractured in dynamic bending was correlated with plane strain fracture toughness (K sub(Id)) obtained through valid measurements of the J-integral at the moment of fracture initiation in various microstructures of the AISI 4140 steel. The results indicate a linear relationship between K sub(Id) and R sub(sb) for the microstructures considered in this work. The range of validity of this linear correlation is presented and discussed in terms of the ASTM E399 specimen size criterion. (Author) [pt
Ghanei, S.; Kashefi, M.; Mazinani, M.
2014-04-01
The magnetic properties of ferrite-martensite dual-phase steels were evaluated using eddy current and Barkhausen noise nondestructive testing methods and correlated with their microstructural changes. Several routes were used to produce different microstructures of dual-phase steels. The first route was different heat treatments in γ region to vary the ferrite grain size (from 9.47 to 11.12 in ASTM number), and the second one was variation in intercritical annealing temperatures (from 750 to 890 °C) in order to produce different percentages of martensite in dual-phase microstructure. The results concerning magnetic Barkhausen noise are discussed in terms of height, position and shape of Barkhausen noise profiles, taking into account two main aspects: ferrite grain size, and different percentages of martensite. Then, eddy current testing was used to study the mentioned microstructural changes by detection of impedance variations. The obtained results show that microstructural changes have a noticeable effect on the magnetic properties of dual-phase steels. The results reveal that both magnetic methods have a high potential to be used as a reliable nondestructive tool to detect and monitor microstructural changes occurring during manufacturing of dual-phase steels.
International Nuclear Information System (INIS)
Munoz C, A. E.
2008-01-01
A study of a process known as plasma immersion ion implantation (PIII) of nitrogen at low voltages (< 4 kV) into three kind of samples: 1) austenitic stainless AISI 316-L steel plates, 2) ferritic stainless AISI 434 steel-based dentistry drills and 3) commercially pure titanium (CPTi) disks. On the case of CPTi the study was conducted in nitrogen- oxygen calibrated mixtures: 90% N-10% O, 80% N-20% O, 70% N-30% O and in 99.5% pure oxygen and 99.9% pure nitrogen. The PIII process was carried out by using a direct current plasma source controlled both in voltage and current, a negative voltage pulse modulator, a stainless AISI 304 steel vacuum chamber and a rod of the same material, horizontally located in the upper region of the chamber, which plays the role of anode in the plasma discharge. The purpose of the nitriding is forming a relatively thick layer on the surface of the steel specimens in order to enhance their both microhardness and general corrosion performances, desirable in medical applications. This layer contains interstitial nitrogen atoms (∼24% at.) which gives place to a deformed lattice (expanded phase) of the steel. Vickers microhardness and potentiodynamic tests (the latter in agreement to the norm ASTM G-61-89) confirm an increase of microhardness up to three times and a decrease of general corrosion rate in one order of magnitude. The nitriding of de dentistry drills is aimed at inhibiting the pitting corrosion produced by the asepsis process which results in pit nucleations, their propagation and consequent fractures when being under cyclic stress (fatigue). Scanning electron microscope micrographs reveal the risks involved in surpassing the critical treatment simple temperature of 450 C as the PIII process itself induces pitting. On its part, cyclic (ASTM G-61) potentiodynamic tests indicate an excellent pitting corrosion resistance of the samples treated under 450 C. In turn, the treatment of CPTi was meant to develop oxidized and
Comparing the Methodologies in ASTM G198 Using Combined Hygrothermal-Corrosion Modeling
Samuel L. Zelinka
2013-01-01
ASTM G198, âStandard test method for determining the relative corrosion performance of driven fasteners in contact with treated wood,â was accepted by consensus and published in 2011. The method has two different exposure conditions for determining fastener corrosion performance in treated wood. The first method places the wood and embedded fasteners in a...
Modification of ASTM Standard E1681 on Environmental Cracking to Include Bolt-Load Specimen Testing
National Research Council Canada - National Science Library
Underwood, Jean D. M
1997-01-01
Benet Laboratories experience with environmental cracking of cannon components has been combined with the technical expertise of various participants at ASTM technical meetings and symposia to develop...
Genotyping of Global Yersinia Pestis Isolates by Using IS285
National Research Council Canada - National Science Library
Bobrov, A. G; Huang, X.-Z; Garcia, E; Lindler, L. E; Filippov, A. A
2006-01-01
.... We come to conclusion that a mobile genetic element, IS285, is one of the most powerful molecular tools allowing to trace the circulation of epidemic clones and to detect their geographical/animal origin.
Fracture toughness behavior and its analysis on nuclear pressure vessel steels
Energy Technology Data Exchange (ETDEWEB)
Iwadate, Tadao; Tanaka, Yasuhiko; Ono, Shin-ichi; Tsukada, Hisashi [Japan Steel Works Ltd., Muroran, Hokkaido. Muroran Plant
1983-02-01
A drop weight J sub(Id) testing machine has been developed successfully, by which the multiple specimen J resistance curve test technique can be applied to measure the fracture toughness. In this study, the use of a small size round compact tension (RCT) specimen for measuring the fracture toughness J sub(Ic) or J sub(Id) of the nuclear pressure vessel steels is recommended and confirmed for the surveillance tests. The static and dynamic fracture toughness of ASTM A508 C 1.2, A508 C 1.3 and A533 Gr.B C 1.1 steels in the wide range of temperature including the upper shelf have been measured and their behavior has been analysed. The fracture toughness behavior under various strain rates and in a wide temperature range can be explained by the behavior of stretched zone formation preceding the crack initiation. The scatter of K sub(J) values in the transition range is caused by the amount of crack extension contained in the specimens. In this paper, the method to obtain the fracture toughness equivalent to the K sub(Ic) from the K sub(J) value is also presented.
International Nuclear Information System (INIS)
Serna, J A; Afanador, W
2001-01-01
In ECOPETROL-ICP was carried out an evaluation of the mechanical and micro structural properties of modified 9 Cr-1 Mo alloy, ASTM A-335 Gr. P91, finding higher strength mechanical properties, allowable stresses and creep rupture strength, than the conventional 9 Cr-1 Mo alloy, ASTM A-335 Gr. P9, recommending the alloy P91 as substitute tube material in the radiation zone of the Visbreaking heater of Cartagena's refinery (furnace in revamping process). The results obtained permit a thickness reduction of radiation tubes of material P91 close to 25% and increase the internal volume tube over up 8%, which is a parameter to consider in improving productivity and efficiency process. Also would be obtained a significant savings cost in the material among 5 and 10%. Additionally, expectations of both design and remaining useful life would be seen extensively favored with this change of alloy
Energy Technology Data Exchange (ETDEWEB)
McAnulty, Michael J., E-mail: mcanulmj@id.doe.gov [Department of Energy, 1955 Fremont Avenue, Idaho Falls, ID 83402 (United States); Potirniche, Gabriel P. [Mechanical Engineering Department, University of Idaho, Moscow, ID 83844 (United States); Tokuhiro, Akira [Mechanical Engineering Department, University of Idaho, Idaho Falls, ID 83402 (United States)
2012-09-15
Highlights: Black-Right-Pointing-Pointer An internal state variable approach is used to predict the plastic behavior of irradiated metals. Black-Right-Pointing-Pointer The model predicts uniaxial tensile test data for irradiated 304L stainless steel. Black-Right-Pointing-Pointer The model is implemented as a user-defined material subroutine in the finite element code ABAQUS. Black-Right-Pointing-Pointer Results are compared for the unirradiated and irradiated specimens loaded in uniaxial tension. - Abstract: Neutron irradiation of metals results in decreased fracture toughness, decreased ductility, increased yield strength and increased ductile-to-brittle transition temperature. Designers use the most limiting material properties throughout the reactor vessel lifetime to determine acceptable safety margins. To reduce analysis conservatism, a new model is proposed based on an internal state variable approach for the plastic behavior of unirradiated ductile materials to support its use for analyzing irradiated materials. The proposed modeling addresses low temperature irradiation of 304L stainless steel, and predicts uniaxial tensile test data of irradiated experimental specimens. The model was implemented as a user-defined material subroutine (UMAT) in the finite element software ABAQUS. Results are compared between the unirradiated and irradiated specimens subjected to tension tests.
Effects of Rare Earth Metal Addition on Wear Resistance of Chromium-Molybdenum Cast Steel
Directory of Open Access Journals (Sweden)
Kasinska J.
2017-09-01
Full Text Available This paper discusses changes in the microstructure and abrasive wear resistance of G17CrMo5-5 cast steel modified with rare earth metals (REM. The changes were assessed using scanning microscopy. The wear response was determined in the Miller test to ASTM G75. Abrasion tests were supplemented with the surface profile measurements of non-modified and modified cast steel using a Talysurf CCI optical profilometer. It was demonstrated that the modification substantially affected the microstructure of the alloy, leading to grain size reduction and changed morphology of non-metallic inclusions. The observed changes in the microstructure resulted in a three times higher impact strength (from 33 to 99 kJ/cm2 and more than two times higher resistance to cracking (from 116 to 250 MPa. The following surface parameters were computed: Sa: Arithmetic mean deviation of the surface, Sq: Root-mean-square deviation of the surface, Sp: Maximum height of the peak Sv: Maximum depth of the valley, Sz: Ten Point Average, Ssk: Asymmetry of the surface, Sku: Kurtosis of the surface. The findings also indicated that the addition of rare earth metals had a positive effect on the abrasion behaviour of G17CrMo5-5 cast steel.
Fisher, D. M.; Repko, A. J.
1972-01-01
Tests of bend and compact specimens were conducted according to ASTM Tentative Method E 399-70T on a 200 grade maraging steel over a range of yield strengths from 123 to 234 ksi. The toughness of any given yield strength level was greater for the overaged condition than for the underaged. Some results which met the specimen size requirements of the method were distinctly lower than corresponding results from larger specimens. Inconsistencies in both validation and invalidation of results by the requirement for linearity of the test record were also noted.
International Nuclear Information System (INIS)
Kilian, R.; Ilg, U.; Meier, V.; Teichmann, H.; Wachter, O.
1995-01-01
Stress corrosion cracking occurs if the three parameters -- material condition, tensile stress and water chemistry -- are in a critical range. In this study the material conditions especially of Ti- and Nb-stabilized steels are considered. The purpose of this work is to show the influence of the degree of sensitization of Ti- and Nb-stabilized stainless steels on stress corrosion cracking susceptibility in BWR water chemistry. This is an on-going research program. Preliminary results will be presented. Different types of stabilized, and for comparison unstabilized, stainless steels are examined in various heat treatment conditions with regard to their sensitization behavior by EPR tests (double loop) and TEM. The results are plotted in sensitization diagrams. The sensitization behavior depends on many parameters such as carbon content, stabilization element, stabilization ratio and materials history, e.g. solution heat treatment or cold working. The obtained EPR sensitization diagrams are compared with the well known sensitization diagrams from the literature, which were determined by standard IC test according to e.g. German standard DIN 50914 (equivalent to ASTM A 262, Pract. E). Based on the obtained EPR sensitization diagrams material conditions for SSRT tests were selected. The EPR values (Ir/Ia x 100%) of the tested Ti-stabilized stainless steel are in the range of ∼ 0.1--20%. The SSRT tests are carried out in high-temperature water with 0.4 ppm O 2 , a conductivity of 0.5 microS/cm and a strain rate of 1x10 -6-1 . The test temperature is 280 C. Ti-stabilized stainless steel with Ir/Ia x 100% > 1% suffered intergranular stress corrosion cracking under these conditions. The SCC tests for Nb-stabilized stainless steel are still in progress. The correlation between EPR value, chromium depletion and SSRT result will be shown for a selected material condition of sensitized Ti-stabilized stainless steel
Marchionna, N. R.
1974-01-01
An annular gas turbine combustor was tested with heated ASTM Jet-A fuel to determine the effect of increased fuel temperature on the formation of oxides of nitrogen. Fuel temperature ranged from ambient to 700 K. The NOx emission index increased at a rate of 6 percent per 100 K increase in fuel temperature.
International Nuclear Information System (INIS)
Sarafian, P.G.
1975-12-01
The influence of alloy microstructure on stress corrosion cracking of mild steel in caustic-nitrate synthetic nuclear waste solutions was studied. An evaluation was made of the effect of heat treatment on a representative material (ASTM A 516 Grade 70) used in the construction of high activity radioactive waste storage tanks at Savannah River Plant. Several different microstructures were tested for susceptibility to stress corrosion cracking. Precracked fracture specimens loaded in either constant load or constant crack opening displacement were exposed to a variety of caustic-nitrate and nitrate solutions. Results were correlated with the mechanical and corrosion properties of the microstructures. Crack velocity and crack arrest stress intensity were found to be related to the yield strength of the steel microstructures. Fractographic evidence indicated pH depletion and corrosive crack tip chemistry conditions even in highly caustic solutions. Experimental results were compatible with crack growth by a strain-assisted anodic dissolution mechanism; however, hydrogen embrittlement also was considered possible
International Nuclear Information System (INIS)
Phillips, Ann Marie; Meservey, Richard H.
2003-01-01
Within the nuclear industry, many contaminated facilities that require decommissioning contain huge volumes of concrete. This concrete is generally disposed of as low-level waste at a high cost. Much of the concrete is lightly contaminated and could be reused as roadbed, fill material, or aggregate for new concrete, thus saving millions of dollars. However, because of the possibility of volumetric contamination and the lack of a method to evaluate the risks and costs of reusing concrete, reuse is rarely considered. To address this problem, Argonne National Laboratory-East (ANL-E) and the Idaho National Engineering and Environmental Laboratory teamed to write a ''concrete protocol'' to help evaluate the ramifications of reusing concrete within the U.S. Department of Energy (DOE). This document, titled the Protocol for Development of Authorized Release Limits for Concrete at U.S. Department of Energy Site (1) is based on ANL-E's previously developed scrap metal recycle protocols; on the 10-step method outlined in DOE's draft handbook, Controlling Release for Reuse or Recycle of Property Containing Residual Radioactive Material (2); and on DOE Order 4500.5, Radiation Protection of the Public and the Environment (3). The DOE concrete protocol was the basis for the ASTM Standard Guide for Evaluating Disposal Options for Concrete from Nuclear Facility Decommissioning, which was written to make the information available to a wider audience outside DOE. The resulting ASTM Standard Guide is a more concise version that can be used by the nuclear industry worldwide to evaluate the risks and costs of reusing concrete from nuclear facility decommissioning. The bulk of the ASTM Standard Guide focuses on evaluating the dose and cost for each disposal option. The user calculates these from the detailed formulas and tabulated data provided, then compares the dose and cost for each disposal option to select the best option that meets regulatory requirements. With this information
46 CFR 175.600 - Incorporation by reference.
2010-10-01
... Vessels Under 61 Meters (200 feet) in Length, 1983 (“ABS Steel Vessel Rules (Meters)”) 177.300. Rules..., Standard Practice for Operating Salt Spray (Fog) Apparatus (“ASTM B 117”) 175.400. ASTM B 122/B 122M-95... (“ASTM D 93”) 175.400. ASTM D 635-97, Standard test Method for Rate of Burning and or Extent and Time of...
Kitagawa, Hiroyuki; Matsuura, Tsukasa; Kato, Toshihito; Kamata, Kin-ya
2015-06-01
N-type Bi2Te2.85Se0.15 thermoelectric materials were prepared by liquid phase growth (LPG) using a sliding boat, a simple and short fabrication process for Bi2Te3-related materials. Cu was selected as a donor dopant, and its effect on thermoelectric properties was investigated. Thick sheets and bars of Cu x Bi2 Te2.85Se0.15 ( x=0-0.25) of 1-2mm in thickness were obtained using the process. X-ray diffraction patterns and scanning electron micrographs showed that the in-plane direction tended to correspond to the hexagonal c-plane, which is the preferred direction for thermoelectric conversion. Cu-doping was effective in controlling conduction type and carrier (electron) concentration. The conduction type was p-type for undoped Bi2Te2.85Se0.15 and became n-type after Cu-doping. The Hall carrier concentration was increased by Cu-doping. Small resistivity was achieved in Cu0.02Bi2Te2.85Se0.15 owing to an optimized amount of Cu-doping and high crystal orientation. As a result, the maximum power factor near 310K for Cu0.02Bi2Te2.85Se0.15 was approximately 4×10-3W/K2m and had good reproducibility. Furthermore, the thermal stability of Cu0.02Bi2Te2.85Se0.15 was also confirmed by thermal cycling measurements of electrical resistivity. Thus, n-type Bi2Te2.85Se0.15 with a large power factor was prepared using the present LPG process.
Obrien, T. Kevin; Martin, Roderick H.
1992-01-01
The results are summarized of several interlaboratory 'round robin' test programs for measuring the mode 1 interlaminar fracture toughness of advanced fiber reinforced composite materials. Double Cantilever Beam (DCB) tests were conducted by participants in ASTM committee D30 on High Modulus Fibers and their Composites and by representatives of the European Group on Fracture (EGF) and the Japanese Industrial Standards Group (JIS). DCB tests were performed on three AS4 carbon fiber reinforced composite materials: AS4/3501-6 with a brittle epoxy matrix; AS4/BP907 with a tough epoxy matrix; and AS4/PEEK with a tough thermoplastic matrix. Difficulties encountered in manufacturing panels, as well as conducting the tests are discussed. Critical issues that developed during the course of the testing are highlighted. Results of the round robin testing used to determine the precision of the ASTM DCB test standard are summarized.
Directory of Open Access Journals (Sweden)
Milena Rizzo
2017-01-01
Full Text Available miR-28-5p is an intragenic miRNA which is underexpressed in several tumor types showing a tumor suppressor (TS activity. Routinely, the known miR-28-5p targets are validated in specific tumor contexts but it is unclear whether these targets are also being regulated in other tumor types. To this end, we adopted the miRNA pull out assay to capture the miR-28-5p targets in DU-145 prostate cancer (PCa cells. Firstly, we demonstrated that miR-28-5p acts as a TS-miRNA in PCa, affecting cell proliferation, survival, and apoptosis. Secondly, we evaluated the enrichment of the 10 validated miR-28-5p targets in the pull out sample. We showed that E2F6, TEX-261, MAPK1, MPL, N4BP1, and RAP1B but not BAG1, OTUB1, MAD2L1, and p21 were significantly enriched, suggesting that not all the miR-28-5p targets are regulated by this miRNA in PCa. We then verified whether the miR-28-5p-interacting targets were regulated by this miRNA. We selected E2F6, the most enriched target in the pull out sample, and demonstrated that miR-28-5p downregulated E2F6 at the protein level suggesting that our approach was effective. In general terms, these findings support the miRNA pull out assay as a useful method to identify context-specific miRNA targets.
Laser composite surfacing of A681 steel with WC + Cr + Co for improved wear resistance
Directory of Open Access Journals (Sweden)
Moisés Felipe Teixeira
2017-01-01
Full Text Available Laser surface alloying (LSA is a surface treatment technique. It involves the near surface melting by a powerful laser beam with a pre-deposited or concomitantly added alloying element along with a part of the underlying substrate to form a surface alloyed zone. In this paper, it is reported the treatment by laser surface alloying of a cold work steel ASTM A681 substrate simultaneously fed with a powder mixture of 86 wt.% WC + 8 wt.% Cr + 6 wt.% Co. It was carried out using a continuous wave λ = 1064 nm fiber-coupled diode laser with five different laser intensities – resulting in five specimens – and then studied and analyzed their microstructure, phases, composition and microhardness. One of these configurations was applied to enhance a deep drawing tool for automotive steel sheet stamping. The process modified the specimens near surface layer, from a ferritic structure into an austenitic matrix with a refined dendritic microstructure, with an enhanced surface hardness from 250 HV to ∼560 HV. The treated deep drawing tool showed remarkable wear improvement compared to a non-treated one after one thousand stamps. This result allows the process for industrial applications.
Quantitative determination of grain sizes by means of scattered ultrasound
International Nuclear Information System (INIS)
Goebbels, K.; Hoeller, P.
1976-01-01
The scattering of ultrasounds makes possible the quantitative determination of grain sizes in metallic materials. Examples of measurements on steels with grain sizes between ASTM 1 and ASTM 12 are given
Chen, Hao; Sago, Alan; West, Shari; Farina, Jeff; Eckert, John; Broadley, Mark
2011-01-01
We present a comparative analysis between biocompatibility test results of wrought and Metal Injection Molded (MIM) ASTM F562-02 UNS R30035 (MP35N) and F1537 UNS R31538 (CCM) alloy samples that have undergone the same generic orthopedic implant's mechanical, chemical surface pre-treatment, and a designed pre-testing sample preparation method. Because the biocompatibility properties resulting from this new MIM cobalt alloy process are not well understood, we conducted tests to evaluate cytotoxicity (in vitro), hemolysis (in vitro), toxicity effects (in vivo), tissue irritation level (in vivo), and pyrogenicity count (in vitro) on such samples. We show that our developed MIM MP35N and CCM materials and treatment processes are biocompatible, and that both the MIM and wrought samples, although somewhat different in microstructure and surface, do not show significant differences in biocompatibility.
Comparing the Methodologies in ASTM G198: Is There an Easy Way Out?
Samuel L. Zelinka
2013-01-01
ASTM(1) G198, Standard test method for determining the relative corrosion performance of driven fasteners in contact with treated wood, was accepted by consensus and published in 2011. The method has two different exposure conditions for determining fastener corrosion performance in treated wood. The first method places the wood and embedded...
EFFICIENCY OF MOMENT AMPLIFICATION PROCEDURES FOR THE SECOND-ORDER ANALYSIS OF STEEL FRAMES
Directory of Open Access Journals (Sweden)
Paschal Chiadighikaobi
2018-02-01
Full Text Available Beam-column is the member subjected to axial compression and bending. Secondary Moment was accounted for in the design and was additional moment induced by axial load. Comparing the results analysis from two computer aided software (SAP2000 and Java. The moment amplification factor Af was inputted in the Java code. Af did not create any change in the result outputs in the Java Code results. There are many different ways to apply amplification factors to first-order analysis results, each with various ranges of applicability. The results shown in this paper are the comparative results of the moment diagrams, axial forces, and shear forces. The type of steel used in the design and analysis is ASTM A992.
30 CFR 285.116 - Requests for information on the state of the offshore renewable energy industry.
2010-07-01
... offshore renewable energy industry. 285.116 Section 285.116 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR OFFSHORE RENEWABLE ENERGY ALTERNATE USES OF EXISTING FACILITIES ON THE OUTER... the state of the offshore renewable energy industry, including the identification of potential...
2010-07-01
... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How will my SAP be processed for Federal consistency under the Coastal Zone Management Act? 285.612 Section 285.612 Mineral Resources MINERALS... Plan § 285.612 How will my SAP be processed for Federal consistency under the Coastal Zone Management...
2010-07-01
... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How will my GAP be processed for Federal consistency under the Coastal Zone Management Act? 285.647 Section 285.647 Mineral Resources MINERALS... Activities Plan § 285.647 How will my GAP be processed for Federal consistency under the Coastal Zone...
International Nuclear Information System (INIS)
Elayathu, N.S.D.; Balachandra, J.
1974-01-01
The gate cooling system of the Trombay R-5 reactor, now under construction, is proposed to be a laminated gate designed to operate with 50 % KBO 2 solution within the temperature limits 30 deg C and 50 deg C. With a view to find suitable constructional materials for the gate, the corrosion behaviour of stainless steel 304 L(ASTM 240-69), lead (ASTM B-29), aluminium (as Boral), neoprene, perspex and carbon steel (ASTM A 302 grade B) has been investigated in 50 % KBO 2 solution at 45 deg C. After definite periods of exposure, their coupons were examined metallographically at different magnifications to assess the nature and extent of sub-surface attack. The results show that out of the materials studied, carbon steel, lead and aluminium are more liable to corrosion in the borate solution and hence their use should be avoided. (M.G.B.)
Standard specification for tantalum and tantalum alloy plate, sheet, and strip. ASTM standard
International Nuclear Information System (INIS)
1998-09-01
This specification is under the jurisdiction of ASTM Committee B-10 on Reactive and Refractory Metals and Alloys and is the direct responsibility of Subcommittee B10.03 on Niobium and Tantalum. Current edition approved May 10, 1998 and published September 1998. Originally published as B 708-82. Last previous edition was B 708-92
International Nuclear Information System (INIS)
James, L.A.; Lee, H.B.; Wire, G.L.; Novak, S.R.; Cullen, W.H.
1997-01-01
Corrosion fatigue crack propagation tests were conducted on a high-sulfur ASTM A302-B plate steel overlaid with weld-deposited Alloy EN82H cladding. The specimens featured semi-elliptical surface cracks penetrating approximately 6.3 mm of cladding into the underlying steel. The initial crack sizes were relatively large with surface lengths of 22.8--27.3 mm, and depths of 10.5--14.1 mm. The experiments were initiated in a quasi-stagnant low-oxygen (O 2 < 10 ppb) aqueous environment at 243 C, under loading conditions (ΔK, R, cyclic frequency) conducive to environmentally assisted cracking (EAC) under quasi-stagnant conditions. Following fatigue testing under quasi-stagnant conditions where EAC was observed, the specimens were then fatigue tested under conditions where active water flow of either 1.7 m/s or 4.7 m/s was applied parallel to the crack. Earlier experiments on unclad surface-cracked specimens of the same steel exhibited EAC under quasi-stagnant conditions, but water flow rates at 1.7 m/s and 5.0 m/s parallel to the crack mitigated EAC. In the present experiments on clad specimens, water flow at approximately the same as the lower of these velocities did not mitigate EAC, and a free stream velocity approximately the same as the higher of these velocities resulted in sluggish mitigation of EAC. The lack of robust EAC mitigation was attributed to the greater crack surface roughness in the cladding interfering with flow induced within the crack cavity. An analysis employing the computational fluid dynamics code, FIDAP, confirmed that frictional forces associated with the cladding crack surface roughness reduced the interaction between the free stream and the crack cavity
Experimental Study of Axially Tension Cold Formed Steel Channel Members
Apriani, Widya; Lubis, Fadrizal; Angraini, Muthia
2017-12-01
Experimental testing is commonly used as one of the steps to determine the cause of the collapse of a building structure. The collapse of structures can be due to low quality materials. Although material samples have passed laboratory tests and the existing technical specifications have been met but there may be undetected defects and known material after failure. In this paper will be presented Experimental Testing of Axially Tension Cold Formed Steel Channel Members to determine the cause of the collapse of a building roof truss x in Pekanbaru. Test of tensile strength material cold formed channel sections was performed to obtain the main characteristics of Cold Formed steel material, namely ultimate tensile strength loads that can be held by members and the yield stress possessed by channel sections used in construction. Analysis of axially tension cold formed steel channel section presents in this paper was conducted through experimental study based on specificationsAnnualBook of ASTM Standards: Metal Test methods and Analitical Procedures, Section 3 (1991). The result of capacity loads experimental test was compared with design based on SNI 03-7971-2013standard of Indonesia for the design of cold formed steel structural members. The results of the yield stress of the material will be seen against the minimum allowable allowable stress range. After the test, the percentace of ultimate axial tension capacity theory has a result that is 16.46% larger than the ultimate axial tension capacity experimental. When compared with the load that must be borne 5.673 kN/m it can be concluded that 2 specimens do not meet. Yield stress of member has fulfilled requirement that wass bigger than 550 MPa. Based on the curve obtained ultimate axial tension capacity theory, results greater than experimental. The greatest voltage value (fu) is achieved under the same conditions as its yield stress. For this specimen with a melting voltage value fy = 571.5068 MPa has fulfilled the
Performance of high molybdenum superaustenitic stainless steel welds in harsh chloride environments
International Nuclear Information System (INIS)
Stenvall, P.; Liljas, M.; Wallen, B.
1996-01-01
Superaustenitic steels are normally welded with nickel-based alloys as filler materials. To clarify the understanding of weld behavior in superaustenitic stainless steels this paper presents the development history of 6Mo and 7Mo steels, and results of laboratory tests and field tests on welds of UNS S31254 (6Mo) and UNS S32654 (7 Mo) in different types of chloride containing environments. The laboratory tests consisted of the well known ferric chloride test (ASTM G 48 Method A). Shielded metal arc welds, gas tungsten arc welds and submerged arc welds in both grades were tested. The critical pitting temperatures were determined and the locations of the attack were noted. Some specimens were sectioned at the position of the attack followed by studies using light optical microscopy. The critical pitting temperatures of the welds in S31254 and S32654 were at normal levels for both grades, i.e., 40--50 C for S31254 and 60--75 C for S32654. The locations of the attack differed depending on the welding process. In shielded metal arc welds the attack was mostly located in the weld metal. In gas tungsten arc welds the attack was predominantly located next to the fusion line. The field tests showed that the behavior of welds and parent metal of superaustenitic stainless steels, as well as of nickel-based alloys, is much dependent on the corrosive environment. In oxidizing chloride solutions, similar results to those of the ferric chloride test, are observed. However, crevice corrosion in the parent material is at a greater risk than pitting corrosion in the welds. In very oxidizing solutions of low chloride concentrations, welds made of nickel-based fillers may corrode faster than the stainless steel base metal due to transpassive uniform corrosion. The opposite situation exists when active uniform corrosion prevails, i.e., welds made of nickel-based fillers corrode less than the stainless steel parent material
Xu, Wei; Guan, Zhiyu; Cao, Hongxin; Zhang, Haiyan; Lu, Min; Li, Tiejun
2011-08-01
To analyze and evaluate the newly issued Electronic Health Record (EHR) Architecture and Data Standard of China (Chinese EHR Standard) and identify areas of improvement for future revisions. We compared the Chinese EHR Standard with the standard of the American Society for Testing and Materials Standard Practice for Content and Structure of Electronic Health Records in the United States (ASTM E 1384 Standard). The comparison comprised two steps: (1) comparing the conformance of the two standards to the international standard: Health Informatics-Requirements for an Electronic Health Record Architecture (ISO/TS 18308), and showing how the architectures of the two standards satisfy or deviate from the ISO requirements and (2) comparing the detailed data structures between the two standards. Of the 124 requirement items in ISO/TS 18308, the Chinese EHR Standard and the ASTM E 1384 Standard conformed to 77 (62.1%) and 111 (89.5%), respectively. The Chinese EHR Standard conformed to 34 of 50 Structure requirements (68.0%), 22 of 24 Process requirements (91.7%), and 21 of 50 Other requirements (42.0%). The ASTM E 1384 Standard conformed to 49 of 50 Structure requirements (98.0%), 23 of 24 Process requirements (95.8%), and 39 of 40 Other requirements (78.0%). Further development of the Chinese EHR Standard should focus on supporting privacy and security mechanism, diverse data types, more generic and extensible lower level data structures, and relational attributes for data elements. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
27 CFR 25.285 - Refund of beer tax excessively paid.
2010-04-01
... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Refund of beer tax... TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS BEER Refund or Adjustment of Tax or Relief From Liability § 25.285 Refund of beer tax excessively paid. (a) Eligibility. A brewer who, under the provisions...
Investigation of Wear Coefficient of Manganese Phosphate Coated Tool Steel
Directory of Open Access Journals (Sweden)
S. Ilaiyavel
2013-03-01
Full Text Available In recent years the properties of the coating in terms of wear resistance is of paramount importance in order to prevent the formation of severe damages. In this study, Wear coefficient of uncoated, Manganese Phosphate coated, Manganese Phosphate coated with oil lubricant, Heat treated Manganese Phosphate coated with oil lubricant on AISI D2 steels was investigated using Archard’s equation. The wear tests were performed in a pin on disk apparatus as per ASTM G-99 Standard. The volumetric wear loss and wear coefficient were evaluated through pin on disc test using a sliding velocity of 3.0 m/s under normal load of 40 N and controlled condition of temperature and humidity. Based on the results of the wear test, the Heat treated Manganese Phosphate with oil lubricant exhibited the lowest average wear coefficient and the lowest wear loss under 40 N load.
International Nuclear Information System (INIS)
Hernandez, R.; Orozco, E.
1996-01-01
The aim of this work is to show the validity in the employment of small test tubes (1/2 T) in order to determine the fracture thoughness in ferritic steels that experience the beginning of cracking by cleavage, to elastic instability, and/or elasto-plastic. It was calculated the change of fracture thoughness in the ductile brittle transition region like function of the temperature employing statistic methods for steel to the annealed carbon of the type AISI4140. The testings were carried out within an interval of temperatures, where the cracking by cleavage and/or pop-in occurs. The thoughness curve of the cracking in the transition region was determined, in small test tubes 1/2 T, and in standard test tubes, 1T. It was calculated the beginning of instability of the integral J, J IC , and was converted to its equivalent in K JC units based in the ASTM Standard rev. 6-12-95 (ref. 6). (Author)
Energy Technology Data Exchange (ETDEWEB)
Hojna, Anna, E-mail: anna.hojna@cvrez.cz; Di Gabriele, Fosca; Klecka, Jakub
2016-04-15
This paper summarizes results of the work carried out on the evaluation of the susceptibility to LME (Liquid Metal Embrittlement) of the ferritic/martensitic steel T91 in contact with LBE (Lead–Bismuth Eutectic). The influence of LBE on the fracture toughness of the steel was studied using 0.5T CT specimen at 355 °C, pre-cracked by cyclic loading in the liquid metal. Tests were carried out in well-defined conditions and according to ASTM standard. It was observed that the LBE decreased the apparent fracture toughness, J{sub IC}, by more than 30%, compared to the value in air. The results are discussed based on examinations of the fracture surface evidencing LME occurrence. The stretch zone accompanying the pre-crack tip blunting was not observed in the specimens exhibiting LME. Therefore, a new fracture toughness, J{sub map}, determined as J integral at the maximum applied load, is proposed to be the appropriate value for fracture resistance evaluation in LBE. The J{sub map} can be applied for the assessment of a pre-existing LME crack stability.
MiR-285 targets P450 (CYP6N23) to regulate pyrethroid resistance in Culex pipiens pallens.
Tian, Mengmeng; Liu, Bingqian; Hu, Hongxia; Li, Xixi; Guo, Qin; Zou, Feifei; Liu, Xianmiao; Hu, Mengxue; Guo, Juxin; Ma, Lei; Zhou, Dan; Sun, Yan; Shen, Bo; Zhu, Changliang
2016-12-01
MicroRNAs play critical roles in post-transcriptional regulation of gene expression, which participate in the modulation of almost all of the cellular processes. Although emerging evidence indicates that microRNAs are related with antineoplastic drugs resistance, whether microRNAs are responsible for insecticide resistance in mosquitos is poorly understood. In this paper, we found that miR-285 was significantly upregulated in the deltamethrin-resistant strain of Culex pipiens pallens, and overexpression miR-285 through microinjection increased mosquito survival rate against deltamethrin treatement. Using bioinformatic software, quantitative reverse transcription PCR, luciferase reporter assay and microinjection approaches, we conformed that CYP6N23 was the target of miR-285. Lower expression of CYP6N23 was observed in the deltamethrin-resistant strain. While, mosquito mortality rate was decreased after downregulating expression of CYP6N23 by dsRNA against CYP6N23 or miR-285 mimic microinjection. These findings revealed that miR-285 could target CYP6N23 to regulate pyrethroid resistance, providing new insights into mosquito insecticide resistance surveillance and control.
30 CFR 285.906 - What must my decommissioning application include?
2010-07-01
... OFFSHORE RENEWABLE ENERGY ALTERNATE USES OF EXISTING FACILITIES ON THE OUTER CONTINENTAL SHELF Decommissioning Decommissioning Applications § 285.906 What must my decommissioning application include? You must... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What must my decommissioning application...
2010-04-01
... 21 Food and Drugs 1 2010-04-01 2010-04-01 false What happens to food that is imported or offered....285 Section 1.285 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL GENERAL ENFORCEMENT REGULATIONS Prior Notice of Imported Food Consequences § 1.285 What happens to...
Fatigue-crack growth correlations for design and analysis of stainless steel components
International Nuclear Information System (INIS)
James, L.A.
1981-10-01
A relatively large collection of fatigue-crack growth results for annealed Types 304 and 316 stainless steels over a wide range of temperature was processed and analyzed in a consistent way. Only data that satisfied the criteria of ASTM E647-82 was retained and used in the statistical treatments that followed. Linear least-squares regression equations and 95% confidence intervals were fitted through the results for each material/temperature set. The regression results (and their associated limits of validity) provide useful equations for the analysis of structural components. Overlap (or the lack of overlap) of the confidence intervals was employed as a criterion as to whether the results for Types 304 and 316 should be separated into discrete sets, and on this basis it was concluded that the two alloys should be treated separately. 38 references, 16 figures, 1 table
Glysson, G. Douglas; Skinner, John V.
1991-01-01
In the late 1950's, intense demands for water and growing concerns about declines in the quality of water generated the need for more water-resources data. About thirty Federal agencies, hundreds of State, county and local agencies, and many private organizations had been collecting water data. However, because of differences in procedures and equipment, many of the data bases were incompatible. In 1964, as a step toward establishing more uniformity, the Bureau of the Budget (now the Office of Management and Budget, OMB) issued 'Circular A-67' which presented guidelines for collecting water data and also served as a catalyst for creating the Office of Water Data Coordination (OWDC) within the U.S. Geological Survey. This paper discusses past, present, and future aspects of the relation between methods in the National Handbook and standards published by ASTM (American Society for Testing and Materials) Committee D-19 on Water's Subcommittee D-19.07 on Sediment, Geomorphology, and Open Channel Flow. The discussion also covers historical aspects of standards - development work jointly conducted by OWDC and ASTM.
Tensile Stress-Strain Results for 304L and 316L Stainless-Steel Plate at Temperature
International Nuclear Information System (INIS)
R. K. Blandford; D. K. Morton; S. D. Snow; T. E. Rahl
2007-01-01
The Idaho National Laboratory (INL) is conducting moderate strain rate (10 to 200 per second) research on stainless steel materials in support of the Department of Energy's (DOE) National Spent Nuclear Fuel Program (NSNFP). For this research, strain rate effects are characterized by comparison to quasi-static tensile test results. Considerable tensile testing has been conducted resulting in the generation of a large amount of basic material data expressed as engineering and true stress-strain curves. The purpose of this paper is to present the results of quasi-static tensile testing of 304/304L and 316/316L stainless steels in order to add to the existing data pool for these materials and make the data more readily available to other researchers, engineers, and interested parties. Standard tensile testing of round specimens in accordance with ASTM procedure A 370-03a were conducted on 304L and 316L stainless-steel plate materials at temperatures ranging from -20 F to 600 F. Two plate thicknesses, eight material heats, and both base and weld metal were tested. Material yield strength, Young's modulus, ultimate strength, ultimate strain, failure strength and failure strain were determined, engineering and true stress-strain curves to failure were developed, and comparisons to ASME Code minimums were made. The procedures used during testing and the typical results obtained are described in this paper
Temperature and environmentally assisted cracking in low alloy steel
International Nuclear Information System (INIS)
Auten, T.A.; Monter, J.V.
1995-04-01
Environmental assisted cracking (EAC) can be defined as the propagation of fatigue cracks in water at rates from 3 to over 40 times the growth rates in air. For low alloy steels with sulfur contents > 0.0125% by weight, EAC is normal behavior in the 240 to 290C range. However, literature yields mixed results for low alloy steels with compositions just below this sulfur level; some reports indicate EAC while others do not. Also, several authors have reported an increased tendency toward EAC when the water temperatures were lowered. In the present work, five ASTM A 508 Class 2 forgings with ladle and check analyses that ranged from 0.010 to 0.019 wt% S were tested in high purity deaerated water in the temperature range of 93 to 260C. At 260C these forgings did not exhibit EAC, reinforcing earlier results for two similar forgings. This broad sampling indicates strong resistance to EAC for this class of forging at 260C. On the other hand, EAC occurred consistently in the three of these forgings that were tested below 204C, provided the test conditions (loading frequency, ΔK, and R) were high enough to produce a high baseline fatigue crack growth rate (FCGR), where the baseline FCGR is that expected in air. At 149C, EAC occurred at test conditions that combined to yield a baseline FCGR greater than ∼2E-6 mm/s. At 204, 121, and 93C, this critical crack growth rate appeared to shift to lower baseline values. The EAC that occurred at lower temperatures was a factor of 3 to 12 times higher than baseline air rates, which was not as strong as the effect for higher sulfur steels at 240 to 290C. Also, no plateau in the growth rates occurred as it does with the higher sulfur steels. In another approach, EAC was induced at 93 and at 260C by raising the dissolved oxygen content of the water from 15 ppb
2010-07-01
... RUE grants associated with renewable energy projects? 285.508 Section 285.508 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR OFFSHORE RENEWABLE ENERGY ALTERNATE USES OF... § 285.508 What rent payments must I pay on ROW grants or RUE grants associated with renewable energy...
Assessment of fracture toughness of structural steels
Energy Technology Data Exchange (ETDEWEB)
Gomes Junyor, José Onésimo; Faria, Stéfanno Bruno; Rocha, Nirlando Antônio; Reis, Emil; Vilela, Jefferson José, E-mail: ze_onezo@hotmail.com, E-mail: sbrunofaria@gmail.com, E-mail: nar@cdtn.br, E-mail: emilr@cdtn.br, E-mail: jjv@cdtn.br [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil); Centro Universitário de Belo Horizonte (UNIBH), MG (Brazil); Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)
2017-11-01
The fracture toughness parameters are applied to estimate the lifetime of mechanical components and define the criteria of safe failure and tolerable damages. This information allows equipment to be used longer with a high degree of safety. These techniques are applied in the Leak-Before-Break (LBB) concept that is accepted for designing the piping system of the primary circuit of the pressurized water reactor (PWR). In this work, fracture toughness tests such as J{sub IC} and CTOD were performed on some structural steels. The fracture toughness parameters were determined using SE(B) and C(T) test specimens. The fracture toughness values for the same material varied according to the type specimen. The parameter δ{sub 1c} showed different values when it was calculated using the ASTM E1820 standard and using the BS 7448: Part 1 standard. These results indicate that procedures of these standards need to be improved. Two systems with different sensitivity in the force measurement were used that showed similar results for toughness fracture but the dispersion was different. (author)
2010-07-01
... 30 Mineral Resources 2 2010-07-01 2010-07-01 false When conducting onsite installation inspections, what must the CVA or project engineer do? 285.710 Section 285.710 Mineral Resources MINERALS MANAGEMENT...: (1) Loadout and initial flotation procedures; (2) Towing operation procedures to the specified...
International Nuclear Information System (INIS)
Whorlow, K.M.; Hutto, F.B. Jr.
1997-07-01
The drip procedure from the Standard Test Method for Evaluating the Influence of Thermal Insulation on External Stress Corrosion Cracking Tendency of Austenitic Stainless Steel (ASTM C 692-95a) was used to research the effect of halogens and inhibitors on the External Stress Corrosion Cracking (ESCC) of Type 304 stainless steel as it applies to Nuclear Regulatory Commission Regulatory Guide 1.36, Nonmetallic Thermal Insulation for Austenitic Stainless Steel. The solutions used in this research were prepared using pure chemical reagents to simulate the halogens and inhibitors found in insulation extraction solutions. The results indicated that sodium silicate compounds that were higher in sodium were more effective for preventing chloride-induced ESCC in Type 304 austenitic stainless steel. Potassium silicate (all-silicate inhibitor) was not as effective as sodium silicate. Limited testing with sodium hydroxide (all-sodium inhibitor) indicated that it may be effective as an inhibitor. Fluoride, bromide, and iodide caused minimal ESCC which could be effectively inhibited by sodium silicate. The addition of fluoride to the chloride/sodium silicate systems at the threshold of ESCC appeared to have no synergistic effect on ESCC. The mass ratio of sodium + silicate (mg/kg) to chloride (mg/kg) at the lower end of the NRC RG 1.36 Acceptability Curve was not sufficient to prevent ESCC using the methods of this research
Investigating liquid-metal embrittlement of T91 steel by fracture toughness tests
Energy Technology Data Exchange (ETDEWEB)
Ersoy, Feyzan, E-mail: fersoy@sckcen.be [SCK-CEN (Belgian Nuclear Research Centre), Boeretang 200, B-2400, Mol (Belgium); Department of Materials Science and Engineering, Ghent University (UGent), Technologiepark 903, B-9052, Ghent (Belgium); Gavrilov, Serguei [SCK-CEN (Belgian Nuclear Research Centre), Boeretang 200, B-2400, Mol (Belgium); Verbeken, Kim [Department of Materials Science and Engineering, Ghent University (UGent), Technologiepark 903, B-9052, Ghent (Belgium)
2016-04-15
Heavy liquid metals such as lead bismuth eutectic (LBE) are chosen as the coolant to innovative Generation IV (Gen IV) reactors where ferritic/martensitic T91 steel is a candidate material for high temperature applications. It is known that LBE has a degrading effect on the mechanical properties of this steel. This degrading effect, which is known as liquid metal embrittlement (LME), has been screened by several tests such as tensile and small punch tests, and was most severe in the temperature range from 300 °C to 425 °C. To meet the design needs, mechanical properties such as fracture toughness should be addressed by corresponding tests. For this reason liquid-metal embrittlement of T91 steel was investigated by fracture toughness tests at 350 °C. Tests were conducted in Ar-5%H{sub 2} and LBE under the same experimental conditions Tests in Ar-5%H{sub 2} were used as reference. The basic procedure in the ASTM E 1820 standard was followed to perform tests and the normalization data reduction (NDR) method was used for the analysis. Comparison of the tests demonstrated that the elastic–plastic fracture toughness (J{sub 1C}) of the material was reduced by a factor in LBE and the fracture mode changed from ductile to quasi-cleavage. It was also shown that the pre-cracking environment played an important role in observing LME of the material since it impacts the contact conditions between LBE and steel at the crack tip. It was demonstrated that when specimens were pre-cracked in air and tested in LBE, wetting of the crack surface by LBE could not be achieved. When specimens were pre-cracked in LBE though, they showed a significant reduction in fracture toughness.
International Nuclear Information System (INIS)
Mizia, R.E.; Atteridge, D.G.; Buckentin, J.; Carter, J.; Davis, H.L.; Devletian, J.H.; Scholl, M.R.; Turpin, R.B.; Webster, S.L.
1994-08-01
The research addressed under this project is the recycling of metallic nuclear-related by-product materials under the direction of Westinghouse Idaho Nuclear Company (WINCO). The program addresses the recycling of radioactive scrap metals (RSM) for beneficial re-use within the DOE complex; in particular, this program addresses the recycling of stainless steel RSM. It is anticipated that various stainless steel components under WINCO control at the Idaho Falls Engineering Laboratory (INEL), such as fuel pool criticality barriers and fuel storage racks will begin to be recycled in FY94-95. The end product of this recycling effort is expected to be waste and overpack canisters for densified high level waste for the Idaho Waste Immobilization Facility and/or the Universal Canister System for dry (interim) storage of spent fuel. The specific components of this problem area that are presently being, or have been, addressed by CAAMSEC are: (1) the melting/remelting of stainless steel RSM into billet form; (2) the melting/remelting initial research focus will be on the use of radioactive surrogates to study; (3) the cost effectiveness of RSM processing oriented towards privatization of RSM reuse and/or resale. Other components of this problem that may be addressed under program extension are: (4) the melting/remelting of carbon steel; (5) the processing of billet material into product form which shall meet all applicable ASTM requirements; and, (6) the fabrication of an actual prototypical product; the present concept of an end product is a low carbon Type 304/316 stainless steel cylindrical container for densified and/or vitrified high level radioactive waste and/or the Universal Canister System for dry (interim) storage of spent fuel. The specific work reported herein covers the melting/remelting of stainless steel open-quotes scrapclose quotes metal into billet form and the study of surrogate material removal effectiveness by various remelting techniques
Energy Technology Data Exchange (ETDEWEB)
Marques, Rogerio Albuquerque
2014-09-01
Ferritic stainless steels are ferromagnetic materials. This property does not allow their use in orthopedic prosthesis. Nevertheless, in some specific applications, this characteristic is very useful, such as, for fixing dental and facial prostheses by using magnetic attachments. In this study, the corrosion resistance and cytotoxicity of the AISI 444 ferritic stainless steel, with low nickel content, extra-low interstitial levels (C and N) and Ti and Nb stabilizers, were investigated for magnetic dental attachments application. The ISO 5832-1 (ASTM F-139) austenitic stainless steel and a commercial universal keeper for dental attachment (Neo-magnet System) were evaluated for comparison reasons. The first stainless steel is the most used metallic material for prostheses, and the second one, is a ferromagnetic keeper for dental prostheses (NeoM). In vitro cytotoxicity analysis was performed by the red neutral incorporation method. The results showed that the AISI 444 stainless steel is non cytotoxic. The corrosion resistance was studied by anodic polarization methods and electrochemical impedance spectroscopy (EIS), in a saline phosphate buffered solution (PBS) at 37 °C. The electronic properties of the passive film formed on AISI 444 SS were evaluated by the Mott-Schottky approach. All tested materials showed passivity in the PBS medium and the passive oxide film presented a duplex nature. The highest susceptibility to pitting corrosion was associated to the NeoM SS. This steel was also associated to the highest dopant concentration. The comparatively low levels of chromium (nearly 12.5%) and molybdenum (0.3%) of NeoM relatively to the other studied stainless steels are the probable cause of its lower corrosion resistance. The NeoM chemical composition does not match that of the SUS444 standards. The AISI 444 SS pitting resistance was equivalent to the ISO 5832-1 pointing out that it is a potential candidate for replacement of commercial ferromagnetic alloys used
Deben, Christophe; Op de Beeck, Ken; Van den Bossche, Jolien; Jacobs, Julie; Lardon, Filip; Wouters, An; Peeters, Marc; Van Camp, Guy; Rolfo, Christian; Deschoolmeester, Vanessa; Pauwels, Patrick
2017-01-01
Objectives: Two functional polymorphisms in the MDM2 promoter region, SNP309T>G and SNP285G>C, have been shown to impact MDM2 expression and cancer risk. Currently available data on the prognostic value of MDM2 SNP309 in non-small cell lung cancer (NSCLC) is contradictory and unavailable for SNP285. The goal of this study was to clarify the role of these MDM2 SNPs in the outcome of NSCLC patients. Materials and Methods: In this study we genotyped SNP309 and SNP285 in 98 NSCLC adenocarcinoma patients and determined MDM2 mRNA and protein levels. In addition, we assessed the prognostic value of these common SNPs on overall and progression free survival, taking into account the TP53 status of the tumor. Results and Conclusion: We found that the SNP285C allele, but not the SNP309G allele, was significantly associated with increased MDM2 mRNA expression levels (p = 0.025). However, we did not observe an association with MDM2 protein levels for SNP285. The SNP309G allele was significantly associated with the presence of wild type TP53 (p = 0.047) and showed a strong trend towards increased MDM2 protein levels (p = 0.068). In addition, patients harboring the SNP309G allele showed a worse overall survival, but only in the presence of wild type TP53. The SNP285C allele was significantly associated with an early age of diagnosis and metastasis. Additionally, the SNP285C allele acted as an independent predictor for worse progression free survival (HR = 3.97; 95% CI = 1.51 - 10.42; p = 0.005). Our data showed that both SNP309 (in the presence of wild type TP53) and SNP285 act as negative prognostic markers for NSCLC patients, implicating a prominent role for these variants in the outcome of these patients. PMID:28819417
Systematic Approach to Design Tailor Made Fuel Blends That Meets ASTM Standards
DEFF Research Database (Denmark)
Intikhab, S.; Kalakul, Sawitree; H., Choudhury
2015-01-01
point, vapor pressure, and heat content were determined using analytical instruments according to their respective American Society for Testing and Materials (ASTM) standards. Most of the properties complied well with the industry standards. However, model gasoline had a comparatively low RVP....... On the other hand, model diesel had a significantly higher cloud point and pour point than what is recommended. This deviation will have an impact on the cold flow properties of the fuels. For both fuels, different additives along with their composition have also been determined using the same computational...
Mendes Filho, A. de A.; Sordi, V. L.; Kliauga, A. M.; Ferrante, M.
2010-07-01
Titanium and F-138 stainless steel are employed in bone replacement and repair. The former material was ECAP-deformed at room temperature and at 300°C, followed in some cases by cold rolling. The steel was ECAP-deformed at room temperature only. Work-hardening behavior was studied by making use of the Kocks-mecking plots and microstructural evolution was followed by TEM. Conclusions show that for Ti, ECAP combined with cold rolling gives the best strength-ductility combination, whilst room temperature ECAP increases the tensile strength of the steel but caused substantial ductility loss.
Mechanical Behaviour of 304 Austenitic Stainless Steel Processed by Room Temperature Rolling
Singh, Rahul; Goel, Sunkulp; Verma, Raviraj; Jayaganthan, R.; Kumar, Abhishek
2018-03-01
To study the effect of room temperature rolling on mechanical properties of 304 Austenitic Stainless Steel, the as received 304 ASS was rolled at room temperature for different percentage of plastic deformation (i.e. 30, 50, 70 and 90 %). Microstructural study, tensile and hardness tests were performed in accordance with ASTM standards to study the effect of rolling. The ultimate tensile strength (UTS) and hardness of a rolled specimen have enhanced with rolling. The UTS has increased from 693 MPa (as received) to 1700 MPa (after 90% deformation). The improvement in UTS of processed samples is due to combined effect of grain refinement and stress induced martensitic phase transformation. The hardness values also increases from 206 VHN (as received) to 499 VHN (after 90% deformation). Magnetic measurements were also conducted to confirm the formation of martensitic phase.
Interpreting the ASTM 'content standard for digital geospatial metadata'
Nebert, Douglas D.
1996-01-01
ASTM and the Federal Geographic Data Committee have developed a content standard for spatial metadata to facilitate documentation, discovery, and retrieval of digital spatial data using vendor-independent terminology. Spatial metadata elements are identifiable quality and content characteristics of a data set that can be tied to a geographic location or area. Several Office of Management and Budget Circulars and initiatives have been issued that specify improved cataloguing of and accessibility to federal data holdings. An Executive Order further requires the use of the metadata content standard to document digital spatial data sets. Collection and reporting of spatial metadata for field investigations performed for the federal government is an anticipated requirement. This paper provides an overview of the draft spatial metadata content standard and a description of how the standard could be applied to investigations collecting spatially-referenced field data.
Energy Technology Data Exchange (ETDEWEB)
Invernizzi, Bruno Pizol
2017-07-01
This study carried out circumferential welding experiments in UNS S32750 Super Duplex Stainless Steel tubes using diameters of 19,05 mm and 48,20 mm. Welds were performed using various welding parameters on a MIG machine with Cold Metal Transfer® CMT control. The weld joints were evaluated by visual and dimensional inspection in addition to the Vickers microhardness and traction tests, as well as the microstructural analysis in conjunction with phase precipitation analysis, which was performed according to practice A of ASTM A923, and corrosion test in accordance with practice A of ASTM G48 in conjunction with ASTM A923. The results indicated that welds performed in pipes with a diameter of 19.05 mm showed a weld joint with unacceptable dimensions according to the standard, this condition being attributed the use of a high wire diameter for the welding conditions used. Welding performed for pipes with a diameter of 48.20 mm showed a lack of penetration under the conditions employed when welded by the conventional CMT® process. In the case of the use of CMT® combined with pulsed arc, under conditions that generated greater heat input during welding, this resulted in total penetration of the joint and adequate surface finish. The results indicated that welding using the CMT® process combined with pulsed arc, under the conditions (parameters) employed generated good surface finish, combined mechanical properties, meeting standards requirements, as well as a balanced microstructure and high resistance to corrosion. (author)
Energy Technology Data Exchange (ETDEWEB)
Pardo, A.; Merino, M.C.; Carboneras, M.; Coy, A.E.; Viejo, F.; Arrabal, R.; Munoz, J.A. [Departamento de Ciencia de Materiales, Facultad de Quimica, Universidad Complutense, 28040, Madrid (Spain)
2004-07-01
The influence of Ti, C, and N concentration on the intergranular corrosion resistance of AISI 316 Ti stainless steel has been studied. A kinetic study of the corrosion process has been carried out using gravimetric tests according to ASTM A-262 practices B and C (Streicher and Huey, respectively). The TTS diagrams were drawn as a function of alloying elements concentration (C, N and Ti). Materials characterization under several test conditions was carried out using Scanning Electron Microscopy (SEM) analysing microstructural characteristics and the attack microstructure. The chemical resistance of these steels to intergranular test was function of N, C and Ti concentration. High Ti and N concentration favoured the precipitation of TiN during the material manufacture process. N forms TiN very stable, causing the removal of Ti from the matrix and, indirectly, favouring the Cr{sub 23}C{sub 6} precipitation during the sensitization process and increasing the corrosion rate. In order to inhibit the intergranular corrosion in these materials the N and Ti concentrations must be optimised. (authors)
International Nuclear Information System (INIS)
Pardo, A.; Merino, M.C.; Carboneras, M.; Coy, A.E.; Viejo, F.; Arrabal, R.; Munoz, J.A.
2004-01-01
The influence of Ti, C, and N concentration on the intergranular corrosion resistance of AISI 316 Ti stainless steel has been studied. A kinetic study of the corrosion process has been carried out using gravimetric tests according to ASTM A-262 practices B and C (Streicher and Huey, respectively). The TTS diagrams were drawn as a function of alloying elements concentration (C, N and Ti). Materials characterization under several test conditions was carried out using Scanning Electron Microscopy (SEM) analysing microstructural characteristics and the attack microstructure. The chemical resistance of these steels to intergranular test was function of N, C and Ti concentration. High Ti and N concentration favoured the precipitation of TiN during the material manufacture process. N forms TiN very stable, causing the removal of Ti from the matrix and, indirectly, favouring the Cr 23 C 6 precipitation during the sensitization process and increasing the corrosion rate. In order to inhibit the intergranular corrosion in these materials the N and Ti concentrations must be optimised. (authors)
30 CFR 285.659 - What requirements must I include in my SAP, COP, or GAP regarding air quality?
2010-07-01
... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What requirements must I include in my SAP, COP, or GAP regarding air quality? 285.659 Section 285.659 Mineral Resources MINERALS MANAGEMENT SERVICE... must I include in my SAP, COP, or GAP regarding air quality? (a) You must comply with the Clean Air Act...
Energy Technology Data Exchange (ETDEWEB)
Filho, A de A Mendes; Sordi, V L; Kliauga, A M; Ferrante, M, E-mail: ferrante@ufscar.b [Federal University of Sao Carlos, Materials Engineering Department, Sao Carlos, 13565-905 (Brazil)
2010-07-01
Titanium and F-138 stainless steel are employed in bone replacement and repair. The former material was ECAP-deformed at room temperature and at 300{sup 0}C, followed in some cases by cold rolling. The steel was ECAP-deformed at room temperature only. Work-hardening behavior was studied by making use of the Kocks-mecking plots and microstructural evolution was followed by TEM. Conclusions show that for Ti, ECAP combined with cold rolling gives the best strength-ductility combination, whilst room temperature ECAP increases the tensile strength of the steel but caused substantial ductility loss.
Development of ASTM Standard for SiC-SiC Joint Testing Final Scientific/Technical Report
Energy Technology Data Exchange (ETDEWEB)
Jacobsen, George [General Atomics, San Diego, CA (United States); Back, Christina [General Atomics, San Diego, CA (United States)
2015-10-30
As the nuclear industry moves to advanced ceramic based materials for cladding and core structural materials for a variety of advanced reactors, new standards and test methods are required for material development and licensing purposes. For example, General Atomics (GA) is actively developing silicon carbide (SiC) based composite cladding (SiC-SiC) for its Energy Multiplier Module (EM2), a high efficiency gas cooled fast reactor. Through DOE funding via the advanced reactor concept program, GA developed a new test method for the nominal joint strength of an endplug sealed to advanced ceramic tubes, Fig. 1-1, at ambient and elevated temperatures called the endplug pushout (EPPO) test. This test utilizes widely available universal mechanical testers coupled with clam shell heaters, and specimen size is relatively small, making it a viable post irradiation test method. The culmination of this effort was a draft of an ASTM test standard that will be submitted for approval to the ASTM C28 ceramic committee. Once the standard has been vetted by the ceramics test community, an industry wide standard methodology to test joined tubular ceramic components will be available for the entire nuclear materials community.
49 CFR 192.285 - Plastic pipe: Qualifying persons to make joints.
2010-10-01
... 49 Transportation 3 2010-10-01 2010-10-01 false Plastic pipe: Qualifying persons to make joints... Materials Other Than by Welding § 192.285 Plastic pipe: Qualifying persons to make joints. (a) No person may make a plastic pipe joint unless that person has been qualified under the applicable joining procedure...
International Nuclear Information System (INIS)
Kim, Seunghyun; Kim, Taeho; Lee, Yun Ju; Kim, Ji Hyun
2017-01-01
Flow-accelerated corrosion (FAC) is an environment assisted degradation of structural materials, which usually occurs in pipelines of power plants. There have been many studies to investigate the fundamental mechanism and corresponding countermeasures against FAC, and recently the carbon steels have been replaced by ASTM A 335 P22, which contains approximately 2.2 wt.% of Cr and 1 wt.% of Mo. By enhancing passivity of P22 by Cr, it is reported that FAC rate has been greatly reduced. However, while corrosion behavior of Fe-based alloys is relatively well known, their behavior under high-temperature flowing water is not well investigated. In other words, effects of Cr and its corrosion and oxidation behavior is not clearly revealed. Furthermore, it is known that Mo enhances the pitting corrosion resistance of alloys however its mechanism is not clearly investigated. Recently, replacement of Mo in alloy contents has been widely studied because of the cost of Mo. Carbon steels undergo severe environmental-assisted degradation behavior so called FAC, and as its countermeasure the carbon steel has been replaced by P22 which contains Cr and Mo. It is generally known that Cr and Mo enhances passivity of Fe-based alloys however their corrosion and oxidation behavior has not been fully investigated especially in high-temperature flowing water environments. In this study, we employed HRTEM and synchrotron XAS techniques in order to investigate detailed microstructure evolution and chemical bonding of the commercialized carbon steel and the Fe-Cr-Mo alloys. From the analysis, it is found that while carbon steels exhibit porous oxide P22 exhibit oxide structures with thin Cr-rich oxide and spinel. Therefore, carbon steel undergoes severe FAC compared to P22 however effects of Cr and Mo and their behavior in high-temperature flowing water will be investigated.
Directory of Open Access Journals (Sweden)
A Nikkhah
2016-04-01
Full Text Available Introduction: Too many people are working in the agricultural sector and therefore, pay more attention to the safety and health at work in the agricultural sector is important. This issue is more important in developing industrial countries where the level of the ergonomic working condition is less than that of developed countries. Attention to ergonomic condition of agricultural machinery drivers is one of the goals of agricultural mechanization. Therefore, in this study the ergonomic conditions of brake and accelerator mechanisms for MF285 and MF399 tractor's drivers were investigated using a new method. Materials and Methods: 25 people were selected for experiment. The electrical activity of Medialis gastrocnemius, Lateralis gastrocnemius, Vastus medialis, Vastus lateralis, Quadratus Lumborum and Trapezius muscles of drivers before and during pressing the pedal and after rest time were recorded using Biovision device. Measurements were performed for each person on each muscle 30 seconds before pressing the pedal, 60 seconds after pressing the pedal and after 60 seconds of rest. For all drivers, the muscles on the right side (brake and accelerator side have been selected and tested. The measurements were performed in compliance with appropriate time intervals between the measurements. Results and Discussion: Ergonomic assessment of brake pedal: The results showed that the RMS electrical activity of muscles of Vastus medialis and Medial gastrocnemius, during 60 seconds braking were 2.47 and 1.97. So, Vastus medialis and Medial gastrocnemius had the highest stress during pressing the MF399 tractor's brake pedal. Moreover, the Medial gastrocnemius and Lateral gastrocnemius with RMS electrical activity ratio of 2.47 and 1.74 had the highest RMS electrical activity ratio respectively, during 60 seconds braking compared to before braking of MF285 tractor. The comparison of results showed that the Vastus medialis and Trapezius had the higher stress
Application of the EPR technique in welded couplings in 08X18H10T (AISI 321) stainless steel
International Nuclear Information System (INIS)
Fuentes, D.A.; Menendez, C.M.; Dominguez, H.; Sendoya, F.
1993-01-01
Stainless steel samples, one AISI 304 and the other 08X18H10T of Soviet origin (equivalent to AISI 320) were welded for the TIG method, submitted to a thermal treatment in order to its sensitization against the intergranular corrosion, then the samples were submitted to the EPR technique in order to establish the sensitization degree which is an indicative of susceptibility to intergranular corrosion. The result were corroborated by two different methodologies, the ASTM A262 standard and the soviet standard GOST 6032-89. The state of the tested surface was analyzed using optical microscopy in order to quantify the number of pricking since its presence disturbs the normalized charge, Pa. (Author)
Fabrication and Thermoelectric Properties of n-Type CoSb2.85Te0.15 Using Selective Laser Melting.
Yan, Yonggao; Ke, Hongquan; Yang, Jihui; Uher, Ctirad; Tang, Xinfeng
2018-04-25
We report a nonequilibrium fabrication method of n-type CoSb 2.85 Te 0.15 skutterudites using selective laser melting (SLM) technology. A powder of CoSb 2.85 Te 0.15 was prepared by self-propagating high-temperature synthesis (SHS) and served as the raw material for the SLM process. The effect of SLM processing parameters such as the laser power and scanning speed on the quality of the forming CoSb 2.85 Te 0.15 thin layers was systematically analyzed, and the optimal processing window for SLM was determined. A brief postannealing at 450 °C for 4 h, following the SLM process, has resulted in a phase-pure CoSb 2.85 Te 0.15 bulk material deposited on a Ti substrate. The Seebeck coefficient of the annealed SLM prepared bulk material is close to that of the sample prepared by the traditional sintering method, and its maximum ZT value reached 0.56 at 823 K. Moreover, a Ti-Co-Sb ternary compound transition layer of about 70 μm in thickness was found at a dense interface between CoSb 2.85 Te 0.15 and the Ti substrate. The contact resistivity was measured as 37.1 μΩcm 2 . The results demonstrate that SLM, coupled with postannealing, can be used for fabrication of incongruently melting skutterudite compounds on heterogeneous substrates. This lays an important foundation for the follow-up research utilizing energy efficient SHS and SLM processes in rapid printing of thermoelectric modules.
30 CFR 285.102 - What are MMS's responsibilities under this part?
2010-07-01
... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What are MMS's responsibilities under this part... Provisions § 285.102 What are MMS's responsibilities under this part? (a) The MMS will ensure that any..., monitoring, and enforcement of activities authorized by a lease or grant under this part. (b) The MMS will...
Schultz, D. F.; Branstetter, J. R.
1973-01-01
A brief testing program was undertaken to determine if spontaneous ignition and stable combustion could be obtained in a jet engine afterburning operating with an inlet temperature of 1240 K and a pressure of 1 atmosphere with ASTM Jet-A fuel. Spontaneous ignition with 100-percent combustion efficiency and stable burning was obtained using water-cooled fuel spraybars as flameholders.
30 CFR 285.821 - Will MMS conduct scheduled and unscheduled inspections?
2010-07-01
... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Will MMS conduct scheduled and unscheduled..., COPs and GAPs Inspections and Assessments § 285.821 Will MMS conduct scheduled and unscheduled inspections? The MMS will conduct both scheduled and unscheduled inspections. ...
Hand Book of Metal Material Contrast
International Nuclear Information System (INIS)
Park, Yeong Hui
1989-06-01
This book first gives descriptions of using of this hand book and contents. It tells of steel such as bar steel, section steel, and steel sheet which are steel for general structure and steel for pressure vessel, a steel pipe, carbon steel for machine structure and alloy steel, steel for special things, stainless steel, heat resisting steel, tool steel, spring steel, forging, steel casting, nonferrous metal such as aluminium and aluminium alloy, casting, list of similar steel per metal, list of steel like ASTM, AISI per number, and list of collecting standard per metal material.
Corrosivity of solutions from evaporation of radioactive liquid wastes. Final report
International Nuclear Information System (INIS)
Payer, H.; Kolic, E.S.; Boyd, W.K.
1977-01-01
New double-shell storage tanks are constructed with ASTM A-516 Grade 65 steel. This study had two main objectives: To characterize the corrosivity of synthetic nonradioactive terminal waste solutions to ASTM A-516 Grade 65 steel and to determine the severity of stress-corrosion cracking of carbon steel in terminal waste solutions. The information developed provides guidance in the characterization of the aggressiveness of actual terminal liquors and in the design and operation of fail-safe tanks. Corrosion behavior was measured over a range of oxidizing conditions by the potentiodynamic polarization technique. Oxidizing conditions in a solution likely to promote general corrosion, pitting or stress-corrosion cracking (SCC) were identified. Absolute stress-corrosion cracking susceptibility was determined by constant strain rate procedure for ASTM A-516 Grade 65 steel for conditions identified by polarization experiments as likely to promote SCC. Based on the results of this study, terminal waste storage tanks are safe from stress-corrosion cracking under freely corroding conditions. Corrosion potential of steel in solutions within anticipated compositions is at the positive end of the critical range for stress-corrosion cracking, and no conditions were observed which would lower the potential to more negative values within the cracking range under freely corroding conditions. Measurement of corrosion potential and hydroxide concentration provides a means to extend these results to compositions outside of the composition range studied
International Nuclear Information System (INIS)
Leistikow, S.; Kraft, R.; Schanz, G.
1989-07-01
Extended ASTM Standard Huey Testing has been performed in at 120 0 C boiling 14.4 molar (65%) nitric acid during 15 periods (15x48 = 720 h duration) for quality control of numerous commercial nitric acid resistant austenitic CrNi steels. It was shown how sensitively the chosen testing conditions could differentiate between CrNi steels of the same nominal composition as specified for DIN W.Nr. 1.4306 (AISI Type 304 L), but with varying residual element contents. Within an attempt to differentiate within this group of steels by application of electrochemical methods, potentiostatic tests at 1250 mV in nitric acid of equal concentration and temperature were able to detect remarkable differences in corrosion behaviour already after one hour. Another approach, more typical for the electrochemical potentials during materials application in reprocessing plants of nuclear fuel, gave preference to long-term immersion tests, which were performed in nitric acid of lower concentration and temperature. Reference tests in pure 7 molar, 90 0 C nitric acid could only reveal by surface attack small differences in steel quality by exposures of 720 h duration. To shorten the test time by an increase of the redox potential chromium (VI) ions were added to the nitric acid. In a solution of 0,5 g Gr (VI)/l at 90 0 C remarkable differences in corrosion behavior of the steels - similar to the Huey test results - became measurable by means of gravimetry and metallography already during a short-term exposure of 24-71 h. (orig./MM) [de
Ergonomic assessment of drivers in MF285 and MF399 tractors during clutching using algometer
Directory of Open Access Journals (Sweden)
Hossein Fallahi
2016-03-01
The results showed that the clutching forces for MF285 and MF399 tractors were 340 N and 290 N, respectively. The knee angle of the drivers of the two tractors was statistically different at the one percent level of significance. The reduction of pain threshold after 30 and 60 s clutching and also 60 s rest after clutching in MF285 tractor, for all three muscles, were more than those of MF399 tractor. The impact of clutching on the average decreases of pain threshold, for all drivers and all clutching periods, during and after clutching, in the Quadratus lumborum muscle was more than the other two muscles, in both tractors. In order to reduce the clutching force for MF285 tractor some modifications is suggested. In this regard the force transfer joint between the pedal and the clutch release linkage may be replaced with one made of cast iron.
Impact of ASTM Standard E722 update on radiation damage metrics
Energy Technology Data Exchange (ETDEWEB)
DePriest, Kendall Russell [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)
2014-06-01
The impact of recent changes to the ASTM Standard E722 is investigated. The methodological changes in the production of the displacement kerma factors for silicon has significant impact for some energy regions of the 1-MeV(Si) equivalent fluence response function. When evaluating the integral over all neutrons energies in various spectra important to the SNL electronics testing community, the change in the response results in an increase in the total 1-MeV(Si) equivalent fluence of 2 7%. Response functions have been produced and are available for users of both the NuGET and MCNP codes.
Krishnamurthy, Narayanan; Maddali, Siddharth; Romanov, Vyacheslav; Hawk, Jeffrey
We present some structural properties of multi-component steel alloys as predicted by a random forest machine-learning model. These non-parametric models are trained on high-dimensional data sets defined by features such as chemical composition, pre-processing temperatures and environmental influences, the latter of which are based upon standardized testing procedures for tensile, creep and rupture properties as defined by the American Society of Testing and Materials (ASTM). We quantify the goodness of fit of these models as well as the inferred relative importance of each of these features, all with a conveniently defined metric and scale. The models are tested with synthetic data points, generated subject to the appropriate mathematical constraints for the various features. By this we highlight possible trends in the increase or degradation of the structural properties with perturbations in the features of importance. This work is presented as part of the Data Science Initiative at the National Energy Technology Laboratory, directed specifically towards the computational design of steel alloys.
Improved ASTM G72 Test Method for Ensuring Adequate Fuel-to-Oxidizer Ratios
Juarez, Alfredo; Harper, Susana Tapia
2016-01-01
The ASTM G72/G72M-15 Standard Test Method for Autogenous Ignition Temperature of Liquids and Solids in a High-Pressure Oxygen-Enriched Environment is currently used to evaluate materials for the ignition susceptibility driven by exposure to external heat in an enriched oxygen environment. Testing performed on highly volatile liquids such as cleaning solvents has proven problematic due to inconsistent test results (non-ignitions). Non-ignition results can be misinterpreted as favorable oxygen compatibility, although they are more likely associated with inadequate fuel-to-oxidizer ratios. Forced evaporation during purging and inadequate sample size were identified as two potential causes for inadequate available sample material during testing. In an effort to maintain adequate fuel-to-oxidizer ratios within the reaction vessel during test, several parameters were considered, including sample size, pretest sample chilling, pretest purging, and test pressure. Tests on a variety of solvents exhibiting a range of volatilities are presented in this paper. A proposed improvement to the standard test protocol as a result of this evaluation is also presented. Execution of the final proposed improved test protocol outlines an incremental step method of determining optimal conditions using increased sample sizes while considering test system safety limits. The proposed improved test method increases confidence in results obtained by utilizing the ASTM G72 autogenous ignition temperature test method and can aid in the oxygen compatibility assessment of highly volatile liquids and other conditions that may lead to false non-ignition results.
30 CFR 285.109 - When must I notify MMS of mergers, name changes, or changes of business form?
2010-07-01
... business form? You must notify MMS in writing of any merger, name change, or change of business form. You must notify MMS as soon as practicable following the merger, name change, or change in business form..., or changes of business form? 285.109 Section 285.109 Mineral Resources MINERALS MANAGEMENT SERVICE...
2010-08-11
... (ASTM): ASTM A53/A53M-07 (2007), ``Standard Specification for Pipe, Steel, Black and Hot-Dipped, Zinc-Coated, Welded and Seamless'' (September 1, 2007). Replaces IBR: 2004 edition; Referenced in 49 CFR 192...), we clarify that cast iron, malleable iron, or ductile iron may be used in the valve ball or plug...
Hofer, Jeffrey D; Rauk, Adam P
2017-02-01
The purpose of this work was to develop a straightforward and robust approach to analyze and summarize the ability of content uniformity data to meet different criteria. A robust Bayesian statistical analysis methodology is presented which provides a concise and easily interpretable visual summary of the content uniformity analysis results. The visualization displays individual batch analysis results and shows whether there is high confidence that different content uniformity criteria could be met a high percentage of the time in the future. The 3 tests assessed are as follows: (a) United States Pharmacopeia Uniformity of Dosage Units , (b) a specific ASTM E2810 Sampling Plan 1 criterion to potentially be used for routine release testing, and (c) another specific ASTM E2810 Sampling Plan 2 criterion to potentially be used for process validation. The approach shown here could readily be used to create similar result summaries for other potential criteria. Copyright © 2017 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Bezerra, Ewerton de Oliveira Teotonio; Nascimento, Jose Jeferson da Silva; Luna, Carlos Bruno Barreto; Morais, Crislene Rodrigues da Silva; Campos, Karla Valeria Miranda de, E-mail: ewerton.teotonio@hotmail.com, E-mail: brunobarretodemaufcg@hotmail.com [Universidade Federal de Campina Grande (UAEMa/CCT/UFCG), PB (Brazil). Unidade Academinca de Engenharia de Materiais
2017-01-15
A large number of metallic alloys has satisfactory behavior when used to manufacture implants for hip prostheses. However, they must be in conformity with standards, to ensure their quality for long periods without losing its functionality. Therefore, this paper aims to study the non-conformities in two hip prostheses, one of titanium and other stainless steel according to standards. The implants studied passed by X-ray diffraction (XRD), X-ray fluorescence, tensile test and optical microscopy (OM). Specimens for the tensile test were made according to ASTM E 8M, as well, MO samples passed by metallographic procedure. The results evidenced that some chemical compositions showed in relation to the standards. The XRD analysis showed peaks of austenite and absence of ferrite for the stainless steel, while the titanium alloy presents an alpha phase (HCP) more significant than the beta phase (BCC). The stainless steel alloys and titanium have yield strength and tensile strength that meet the standards. On the other hand, the elastic modulus of the titanium alloy and stainless steel, comes to be ten times greater than the human bone. Therefore, the high modulus of elasticity of the alloys, favors bone resorption problems. The stainless steel microstructure is typical of an austenitic matrix, while the titanium alloy presents α + β microstructure. (author)
Peng, Mei; Jaeger, Sara R; Hautus, Michael J
2014-03-01
Psychometric functions are predominately used for estimating detection thresholds in vision and audition. However, the requirement of large data quantities for fitting psychometric functions (>30 replications) reduces their suitability in olfactory studies because olfactory response data are often limited (ASTM) E679. The slope parameter of the individual-judge psychometric function is fixed to be the same as that of the group function; the same-shaped symmetrical sigmoid function is fitted only using the intercept. This study evaluated the proposed method by comparing it with 2 available methods. Comparison to conventional psychometric functions (fitted slope and intercept) indicated that the assumption of a fixed slope did not compromise precision of the threshold estimates. No systematic difference was obtained between the proposed method and the ASTM method in terms of group threshold estimates or threshold distributions, but there were changes in the rank, by threshold, of judges in the group. Overall, the fixed-slope psychometric function is recommended for obtaining relatively reliable individual threshold estimates when the quantity of data is limited.
Light-water reactor pressure vessel surveillance standards
International Nuclear Information System (INIS)
Anon.
1981-01-01
The master matrix standard describes a series of standard practices, guides, and methods for the prediction of neutron-induced changes in light-water reactor (LWR) pressure vessel steels throughout a pressure vessel's service life. Some of these are existing American Society for Testing and Materials (ASTM) standards, some are ASTM standards that have been modified, and some are newly proposed ASTM standards. The current (1) scope, (2) areas of application, (3) interrelationships, and (4) status and time table of development, improvement, validation, and calibration for a series of 16 ASTM standards are defined. The standard also includes a discussion of LWR pressure vessel surveillance - justification, requirements, and status of work
Effect of C content on the mechanical properties of solution treated as-cast ASTM F-75 alloys.
Herrera, M; Espinoza, A; Méndez, J; Castro, M; López, J; Rendón, J
2005-07-01
The mechanical properties of solution treated ASTM F-75 alloys with various carbon contents have been studied. Alloys cast under the same conditions were subjected to solution treatment for several periods and then their tensile properties were evaluated. In the as-cast conditions, the alloys exhibited higher strength values with increasing carbon content whereas their ductility was not significantly affected. For the solution treated alloys, the variation of the strength was characterized by a progressive increase for short treatment times until a maximum value was achieved, which was followed by a diminution in this property for longer treatment times. This behavior was more accentuated for the case of the alloys with medium carbon contents, which also exhibited the highest values of strength. Furthermore, the alloy's ductility was enhanced progressively with increasing solution treatment time. This improvement in ductility was significantly higher for the medium carbon alloys compared with the rest of the studied alloys. Thus, high and low carbon contents in solution treated ASTM F-75 alloys did not produced sufficiently high tensile properties.
Investigation of the effects on Charpy impact characteristics by shape of pendulum striking edge
International Nuclear Information System (INIS)
Kawai, Toshihiko; Etoh, Mikio; Hanawa, Namio; Shibaike, Masayuki; Inoue, Kazuo.
1983-01-01
Charpy impact test is used versatilely and practically as the method of evaluating the toughness of metals. In Japan, usually the JIS type testing machines are used, but recently, the test with ASTM type testing machines has been often demanded for steel materials for export or for nuclear use. Accordingly, the testing machines of both types must be installed, the testing works become troublesome, and the costs of initial investment, maintenance, management and so on increase. When the standards in various countries were investigated, the stipulation on the various particulars of the testing machines was almost similar except the shape of striking edges, which are 8mm radius in ASTM and 2mm radius in other standards. Recently it was clarified that there was some difference between the impact values of high toughness steel using JIS and ASTM machines. In order to clarify the cause of this difference and to unify the shape of edges, the investigation was carried out by the working group. The investigation of the effect of the difference of edge shapes on impact values, the analysis of fracture phenomena in impact test and the consideration on the results are reported. ASTM type testing machines should not be used for mild steel when absorbed energy exceeds 10kgf-m. (Kako, I.)
Effects of Head Size on the Performance of Twist-Off Bolts
Schnupp, Keith Otto
2003-01-01
This study examines a specific application of button-head type twist-off bolts. Currently, the Research Council on Structural Connections Specification (2000) removes the requirement for ASTM F436 washers (ASTM 2000a) under the bolt head of twist-off bolts where the head diameter equals or exceeds that of an ASTM F436 washer when oversized and slotted holes are used. The need for washers is also removed for A490 strength bolts used on steels with specified yield strengths less than 40 ksi p...
30 CFR 285.540 - How will MMS equitably distribute revenues to States?
2010-07-01
... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How will MMS equitably distribute revenues to... Financial Assurance Requirements Revenue Sharing with States § 285.540 How will MMS equitably distribute revenues to States? (a) The MMS will distribute among the eligible coastal States 27 percent of the...
Biaxial fatigue tests and crack paths for AISI 304L stainless steel
Directory of Open Access Journals (Sweden)
V. Chaves
2014-10-01
Full Text Available AISI 304L stainless steel specimens have been tested in fatigue. The tests were axial, torsional and in-phase biaxial, all of them under load control and R=-1. The S-N curves were built following the ASTM E739 standard and the method of maximum likelihood proposed by Bettinelli. The fatigue limits of the biaxial tests were represented in axes σ-τ. The elliptical quadrant, appropriate for ductile materials, and the elliptical arc, appropriate for fragile materials, were included in the graph. The experimental values were better fitted with an elliptical quadrant, despite the ratio between the pure torsion and tension fatigue limits, τFL/σFL, is 0.91, close to 1, which is a typical value for fragile materials. The crack direction along the surface has been analyzed by using a microscope, with especial attention to the crack initiation zones. The crack direction during the Stage I has been compared with theoretical models.
Energy Technology Data Exchange (ETDEWEB)
Guillen M, A N
1997-09-01
In the mid 19704s, the intergranular corrosion with stress corrosion cracking (IGSCC) have been identified as a greater problem in Boiling Water Reactors BWR in several places of the world. The Electrochemical Potentiokinetic Reactivation - Single Loop (EPR-SL) test and the Double Loop (EPR-DL) test, were developed as methods for measuring the Degree of Sensitization (DOS), show sensitised materials at subject to Intergranular Corrosion. In Mexico, the Laguna Verde4s reactor is BWR type and many of its principal components was built with AISI 304 stainless steels, while that in VVER reactors as well as Juragua4s reactor in Cuba is used 321 Stainless stell in its Russian equivalent designation 08Ch18N10T. In this work, were studied 304 and 08Ch18N10T stainless steels by means of EPR-SL, EPR-DL and ASTM A-262 techniques, they have been found a good correlation for 304 steel but not in 08Ch18N10T steel and was proposed one modification in the criterion by the evaluation on the sensitisation in this steels. Finally, both materials were welded with procedures used in the nuclear industry, by Slow Strain Rate Test (SSRT) to determine the Stress Corrosion Cracking SCC susceptibility, and subsequently the susceptibility to localized corrosion was studied by means of Cyclic Polarization test and the uniform corrosion rate in a solution with chlorides by the Tafel plot, Potentiodynamic Anodic Polarization Resistance. (Author).
Glove powder's carrying capacity for latex protein: analysis using the ASTM ELISA test.
Beezhold, D; Horton, K; Hickey, V; Daddona, J; Kostyal, D
2003-01-01
Glove donning powders carry latex proteins and disperse them into the workplace environment. We have used the ASTM D6499 ELISA to quantify the amount of latex antigen bound to and carried by glove powders. We could differentiate between a small amount of protein actually bound to the powders and a larger amount carried by the powder. Enhanced binding of a major allergen, Hev b 5, to the starch powders was demonstrated by Western blot. The D6499 ELISA is able to measure total latex antigen, soluble and powder bound, simultaneously without the need to centrifuge the samples.
The new ASTM Manual for scrubber linings the evolution of a consensus guide
International Nuclear Information System (INIS)
Spires, G.V.; Cavallo, J.R.
1984-01-01
Faced with spiraling fuel oil costs, power utilities turned to abundant and inexpensive domestic coal and lignite. Conversions and new units designed to burn solid fossil fuels were pursued at a near crisis pace to get out from under the economic penalties associated with the continued use of oil. Coal contains much more sulfur than oil; EPA limitations on SO 2 necessitated costly flue gas desulfurization (FGD) systems when burning coal. Scrubbed gas presented a particularly corrosive environment in and downstream from the FGD system. Problems which often accompany a new technology were soon evident. Materials and linings initially selected were often seen to be inadequate. Severe and rapid degradation was commonplace. This paper traces the development of the recently published ASTM Manual of Protective Linings From Flue Gas Desulfurization System. The scope of the Manual is outlined and some of the more commonly used FGD lining systems are reviewed. Finally some views on the impact of foreseeable changes in regulations and FGD technology on the use and maintenance of FGD system linings are discussed
30 CFR 285.210 - How does MMS initiate the competitive leasing process?
2010-07-01
... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How does MMS initiate the competitive leasing... OCS Renewable Energy Leases Competitive Lease Process § 285.210 How does MMS initiate the competitive leasing process? The MMS may publish in the Federal Register a public notice of Request for Interest to...
International Nuclear Information System (INIS)
Pillot, Sylvain; Chauvy, Cédric; Corre, Stéphanie; Coudreuse, Lionel; Gingell, Andrew; Héritier, Déborah; Toussaint, Patrick
2013-01-01
Standard and Vanadium-alloyed 2,25Cr–1Mo steel grades (EN 10028-2 12CrMo9-10/ASTM A387 gr. 22 and 13CrMoV9-10/ASTM A542 tp. D) are commonly used for the fabrication of heavy pressure vessels for applications in petroleum refining plants. These reactors are made of heavy plates, forged shells, forged nozzles and fittings. They are subjected to thermal cycles (stop and go) and to severe service conditions (high temperatures and high hydrogen partial pressures). A primary concern for end-users is the definition of the Minimum Pressurizing Temperature (MPT) of the equipment. This temperature is the lowest temperature at which the vessel can be repressurized after shutdown and insures no risk of brittle failure of the containment body. The MPT is defined by fracture mechanics and/or CVN approaches and calculations. This first part of the paper presents the impact of thermal aging and exposure to hydrogen on materials' mechanical properties and consequently on the value of MPT
Taiwade, R. V.; Patil, A. P.; Patre, S. J.; Dayal, R. K.
2013-06-01
In general, as-received (AR) austenitic stainless steels (ASSs) contain complex carbide precipitates due to manufacturing operations, subsequent annealing treatment, or due to the fabrication processes such as welding. The presence of pre-existing carbides leads to cumulative sensitization and make the steel susceptible to intercrystalline corrosion (ICC)/intergranular corrosion (IGC) which causes premature failure during service. Solution annealing (SA) is one of the ways to deal with such situations. In this present investigation, the AR (hot rolled and mill annealed) chromium-nickel (Cr-Ni) ASS is compared with SA Cr-Ni ASS. The extent of ICC/IGC was evaluated qualitatively and quantitatively by various electrochemical tests including ASTM standard A-262 Practice A and Practice E, double loop electrochemical potentiokinetic reactivation and electrochemical impedance spectroscopy. The degree of sensitization for hot rolled mill annealed AR condition is found to be substantially higher (51.55%) than that of SA condition (26.9%) for thermally aged samples (at 700 °C). The chemical composition across the grain boundary was measured using electron probe micro-analyzer for both (AR and SA) conditions and confirms that the pre-sensitization effect was completely removed after SA treatment.
Energy Technology Data Exchange (ETDEWEB)
Gonzalez Velasquez, Jorge L.; Godinez Salcedo, Jesus G.; Lopez Fajardo, Pedro [Instituto Politecnico Nacional (IPN), Mexico D.F. (Mexico). Escuela Superior de Ingenieria Quimica e Industrias Extractivas (ESIQIE). Dept. de Ingenieria Metalurgica
2009-07-01
The corrosion resistance of ERW seam welds and the base metal in API 5L X70 steel pipes was evaluated by Tafel tests. The procedure was according to ASTM G3 standard. The study was completed with metallographic and chemical characterization of the tested zones, that is, the welded zone and the base metal away of the weld. All tests were made on the internal surface of the pipe in order to assess the internal corrosion of an in-service pipeline made of the API 5L X70 steel. The test solution was acid brine prepared according to NACE Publications 1D182 and 1D196. The results showed that the ERW seam weld corrodes as much as three times faster than the base material. This behavior is attributed to a more heterogeneous microstructure with higher internal energy in the ERW seam weld zone, as compared to the base metal, which is basically a ferrite pearlite microstructure in a normalized condition. This result also indicates that pipeline segments made of ERW steel pipe where the seam weld is located near or at the bottom of the pipe are prone to a highly localized attack that may form channels of metal loss if there is water accumulation at the bottom of the pipeline. (author)
International Nuclear Information System (INIS)
Klueh, R.L.; Grossbeck, M.L.
1984-01-01
The USSR steel EP-838 is a high-manganese, low-nickel steel that also has lower chromium and molybdenum than type 316 stainless steel. Tensile specimens of 20%-cold-worked EP-838 and type 316 stainless steel were irradiated in the High Flux Isotope Reactor (HFIR) at the coolant temperature (approx.=50 0 C). A displacement damage level of 5.2 dpa was reached for the EP-838 and up to 9.5 dpa for the type 316 stainless steel. Tensile tests at room temperature and 300 0 C on the two steels indicated that the irradiation led to increased strength and decreased ductility compared to the unirradiated steels. Although the 0.2% yield stress of the type 316 stainless steel in the unirradiated condition was greater than that for the EP-838, after irradiation there was essentially no difference between the strength or ductility of the two steels. The results indicate that the replacement of the majority of the nickel by manganese and a reduction of chromium and molybdenum in an austenitic stainless steel of composition near that for type 316 stainless steel has little effect on the irradiated and unirradiated tensile properties at low temperatures. (orig.)
Heilprin, Laurence B.
The Committee to Investigate Copyright Problems (CICP), a non-profit organization dedicated to resolving the conflict known as the "copyright photocopying problem" was joined by the American Society for Testing and Materials (ASTM), a large national publisher of technical and scientific standards, in a plan to simulate a long-proposed…
Application of ASTM E-1559 Apparatus to Study H2O Desorption
Woronowicz, Michael; Perry, Radford, III; Meadows, George A.
2015-01-01
The NASA James Webb Space Telescope project identified a need to measure water vapor desorption from cryogenic surfaces in order to validate predictions of spacecraft design performance. A review of available scientific literature indicated no such measurements had been reported below 131 K. Contamination control personnel at NASA Goddard Space Flight Center recognized the possibility they readily possessed the means to collect these measurements at lower temperatures using an existing apparatus commonly employed for making outgassing observations. This presentation will relate how the ASTM E-1559 Molekit apparatus was used without physical modification to measure water vapor sublimation down to 120 K and compare this data to existing equilibrium vapor pressure models.
Intergranular Corrosion Behavior of 304LN Stainless Steel Heat Treated at 623 K (350 °C)
Singh, Raghuvir; Kumar, Mukesh; Ghosh, Mainak; Das, Gautam; Singh, P. K.; Chattoraj, I.
2013-01-01
Low temperature sensitization of 304LN stainless steel from the two pipes, differing slightly in chemical composition, has been investigated; specimens were aged at 623 K (350 °C) for 20,000 hours and evaluated for intergranular corrosion and degree of sensitization. The base and heat-affected zone (HAZ) of the 304LN-1 appear resistant to sensitization, while 304LN-2 revealed a "dual" type microstructure at the transverse section and HAZ. The microstructure at 5.0-mm distance from the fusion line indicates qualitatively less sensitization as compared to that at 2.0 mm. The 304LN-2 base alloy shows overall lower degree of sensitization values as compared to the 304LN-1. A similar trend of degree of sensitization was observed in the HAZ where it was higher in the 304LN-1 as compared to the 304LN-2. The weld zone of both the stainless steels suffered from cracking during ASTM A262 practice E, while the parent metals and HAZs did not show such fissures. A mottled image within the ferrite lamella showed spinodal decomposition. The practice E test and transmission electron microscopy results indicate that the interdendritic regions may suffer from failure due to carbide precipitation and due to the evolution of brittle phase from spinodal decomposition.
Mobile Robot and Mobile Manipulator Research Towards ASTM Standards Development.
Bostelman, Roger; Hong, Tsai; Legowik, Steven
2016-01-01
Performance standards for industrial mobile robots and mobile manipulators (robot arms onboard mobile robots) have only recently begun development. Low cost and standardized measurement techniques are needed to characterize system performance, compare different systems, and to determine if recalibration is required. This paper discusses work at the National Institute of Standards and Technology (NIST) and within the ASTM Committee F45 on Driverless Automatic Guided Industrial Vehicles. This includes standards for both terminology, F45.91, and for navigation performance test methods, F45.02. The paper defines terms that are being considered. Additionally, the paper describes navigation test methods that are near ballot and docking test methods being designed for consideration within F45.02. This includes the use of low cost artifacts that can provide alternatives to using relatively expensive measurement systems.
Directory of Open Access Journals (Sweden)
Renato Altobelli Antunes
2014-01-01
Full Text Available The aim of this work was to compare the corrosion products formed on carbon steel plates submitted to atmospheric corrosion in urban and industrial atmospheres with those formed after accelerated corrosion tests. The corrosion products were characterized by X-ray diffraction, Mössbauer spectroscopy, and Raman spectroscopy. The specimens were exposed to natural weathering in both atmospheres for nine months. The morphologies of the corrosion products were evaluated using scanning electron microscopy. The main product found was lepidocrocite. Goethite and magnetite were also found on the corroded specimens but in lower concentrations. The results showed that the accelerated test based on the ASTM B117 procedure presented poor correlation with the atmospheric corrosion tests whereas an alternated fog/dry cycle combined with UV radiation exposure provided better correlation.
NAVFAC Ocean Thermal Energy Conversion (OTEC) Project; OTEC Technology Development Report
2010-11-01
INSIDE FACE OF THE PLATE MUST BE SMOOTH AND FREE FROM WELD SLAG . 9255 WELLINGTON ROAD MANASSAS, VA 20110-4121LOCKHEED MARTIN NAVAL FACILITIES...document by their basic designation number shown below: A. A36 Structural Steel American Society for Testing and Materials (ASTM): A123 Zinc (Hot...Galvanized) Coatings on Iron and Steel Products A153 Zinc Coating (Hot Dip) On Iron and Steel Hardware A307 Specification for Carbon Steel Bolts and
Directory of Open Access Journals (Sweden)
Willian Aperador
2011-01-01
Full Text Available En este trabajo se utilizó la técnica de espectroscopia de impedancia electroquímica (EIS para evaluar la acción del dióxido de carbono sobre la corrosión de un acero estructural ASTM A 706 embebido en un concreto de escoria activado alcalinamente (AAS, el concreto AAS es una mezcla de escoria molida granulada, agregados finos y gruesos y solución alcalina (silicato de sodio en la cantidad requerida para la mezcla de concreto. El estudio se realizó comparativamente con especímenes expuestos a condiciones naturales con una baja concentración de CO2 (0,03% CO2. La carbonatación del concreto se obtuvo de forma acelerada bajo condiciones controladas (3% CO2, 65% de humedad relativa y 20°C de temperatura. Los datos de Impedancia fueron adquiridos en un rango de 1mHz hasta 100kHz. A las frecuencias altas se encontró la respuesta de la interfase medio de exposición-concreto y a frecuencias bajas la respuesta de la interfase correspondiente al concreto - acero. Mediante EIS se estableció la capacidad de lograr la pasivación del acero embebido en concreto AAS, en condiciones ambientales naturales y aceleradas.In this work the technique of impedance spectroscopy electrochemistry (EIS was used to evaluate the effects of carbon dioxide on the corrosion of ASTM A 706 structural steel embedded in concrete with alkali activated slag (AAS, AAS concrete is a mixture of ground granulated slag, fine and coarse aggregates and alkaline solution (sodium silicate in the amount required for the concrete mix. The study was conducted in comparison with specimens exposed to natural conditions with a low concentration of CO2 (0.03% CO2. The carbonation of the concrete was obtained through accelerated carbonation under controlled conditions (3% CO2, 65% of relative humidity and 20°C of temperature. The data of Impedance in the middle frequency region 1mHz - 100KHz. A high frequency response was found using the interface-specific exposure and low frequency
CSIR Research Space (South Africa)
O'Quigley, DGF
1997-01-01
Full Text Available This paper reports the results of a comprehensive investigation into the abrasion resistance of WC-Co alloys, as measured by the ASTM Standard B 611-85 test. The alloys ranged from 3 to 50 wt% and from 0.6 to 5 mu-m average grain size. Careful...
Energy Technology Data Exchange (ETDEWEB)
Lee, Jin Kyung, E-mail: leejink@deu.ac.kr [Department of Mechanical Engineering, Dongeui University, Busan (Korea, Republic of); Bae, Dong Su [Department of Advanced Materials Engineering, Dongeui University, Busan (Korea, Republic of); Lee, Sang Pill; Hwang, Sung Guk [Department of Mechanical Engineering, Dongeui University, Busan (Korea, Republic of); Lee, Joon Hyun [School of Mechanical Engineering, Pusan National University, Busan (Korea, Republic of)
2016-11-01
Highlights: • We have studied on the nondestructive technique application for corrosion evaluation by hydrogen charging of stainless steel. An ultrasonic test (UT) is an useful method to evaluate the mechanical properties of material. By measuring the velocity and the attenuation of ultrasonic wave propagating the hydrogen charged stainless steel, the relation of ultrasonic wave and mechanical properties of hydrogen charged 316L stainless steel was discussed. However, in order to evaluate the dynamic behavior of materials, an acoustic emission (AE) technique was applied to investigate the corrosion characteristics of hydrogen charged specimen. Acoustic emission is one of elastic waves caused by dislocation, cracks initiation and propagation within material from loading outside. The waveform of the acoustic emission is different depending on the damage mechanism of material. Lots of AE parameters such as energy, duration time, event and amplitude were used to analyze the dynamic behavior of the hydrogen charged specimen. • A conventional 316L stainless steel was used in this study, and electrochemical treat system for hydrogen charging of the specimen. ASTM (G142) type tensile specimens (diameter 6.0 mm, gage length 28.6 mm) were prepared, and sulfuric acid(H{sub 2}SO{sub 4}) and arsenic trioxide(As{sub 2}O{sub 3}) were used as the electrolyte, and potentiostat(HA 151) supplied the current to platinum wire and specimen. • Tensile strength and attenuation coefficient has a relation to some extent. Therefore, we could estimate the tensile strength and the hydrogen charging time by measuring the attenuation coefficient using ultrasonic wave nondestructively. • Acoustic emission technique was useful to evaluate the dynamic damage because AE parameters of AE event, average energy and average frequency showed various change by external loading at the specimens with and without hydrogen. - Abstract: Caused corrosion by hydrogen on stainless steel using
ASTM and VAMAS activities in titanium matrix composites test methods development
Johnson, W. S.; Harmon, D. M.; Bartolotta, P. A.; Russ, S. M.
1994-01-01
Titanium matrix composites (TMC's) are being considered for a number of aerospace applications ranging from high performance engine components to airframe structures in areas that require high stiffness to weight ratios at temperatures up to 400 C. TMC's exhibit unique mechanical behavior due to fiber-matrix interface failures, matrix cracks bridged by fibers, thermo-viscoplastic behavior of the matrix at elevated temperatures, and the development of significant thermal residual stresses in the composite due to fabrication. Standard testing methodology must be developed to reflect the uniqueness of this type of material systems. The purpose of this paper is to review the current activities in ASTM and Versailles Project on Advanced Materials and Standards (VAMAS) that are directed toward the development of standard test methodology for titanium matrix composites.
Dosimetry-adjusted reactor physics parameters for pressure vessel neutron exposure assessment
International Nuclear Information System (INIS)
McElroy, W.N.; Kellogg, L.S.
1988-01-01
The ASTM E706 master matrix standard describes a series of 20 American Society for Testing and Materials (ASTM) standard practices, guides, and methods for use in the prediction of neutron-induced changes in light water reactor (LWR) pressure vessel (PV) and support structure steels throughout a PV's service life. Some of these are existing ASTM standards, some are ASTM standards that have been modified, and some are new ASTM standards. These standards are periodically revised to assume their applicability during the 40-yr (32 effective full-power years) design license period for a nuclear power plant. They are now under review by two new ASTM plant life extension task groups: E10.05.11 on physics dosimetry and E10.02.11 on metallurgy. A brief review on the current application of these standards and a discussion of the status of work to verify the accuracy of derived physics-dosimetry parameter values is presented in this paper
Analysis of the resistance to the stable propagation of fissures in structural steels
International Nuclear Information System (INIS)
Alvarez Villar, Nelson; Aquino, Daniel; Aguera, Francisco; Fierro, Victor; Ansaldi, Andrea; Chomik, Enrique; Iorio, Antonio
2008-01-01
Linear Elastic Fracture Mechanic (LEFM) is applied to the analysis of highly resistant materials, with correction for plasticity. For moderately ductile materials, structural analysis and design methodologies based on Elastoplastic Fracture Mechanics (EPFM) still have to be developed. The J integral is used in EPFM as a parameter to characterize tenacity to the fracture, following the ASTM standard. It is important to obtain J-Resistant curves, since the use of the stable propagation initiation value (J IC ) as failure criteria, leads to results that are too conservative in most design situations. The application of direct methods allows for results under conditions where the standard methods for obtaining the J-Resistant curve are not applicable. This work analyzes the application of direct methods that are alternatives for the standard, in ferritic-perlitic steels used in gas transport pipes. Experimental results are presented with numerical analysis (FEA) for the adjustment of J-Resistant curves (au)
International Nuclear Information System (INIS)
Hamilton, M.L.; Johnson, G.D.; Puigh, R.J.; Garner, F.A.; Maziasz, P.J.; Yang, W.J.S.; Abraham, N.
1988-08-01
Austenitic stainless steels are used for core component materials in liquid metal cooled reactors (LMRs). To extend the lifetime of LMR fuel assemblies, considerable effort was expended by the US breeder materials program to find ways to minimize radiation-induced dimensional changes (swelling and creep) and to maximize the creep rupture strength. After various elements were shown to strongly affect swelling and creep behavior, compositional modifications to a commercial grade austenitic stainless steel (AISI 316) produced an alloy with significant improvement in swelling resistance over the standard 300 series alloys. Changes were primarily in the concentrations of chromium, nickel, silicon and titanium, ASTM specification A771-83 was approved in 1983 for the new alloy, designated UNS S38660. Substantial improvement can be produced in the creep rupture behavior of this alloy. Elements such as phosphorus and boron, typically present in trace quantities, have a significant influence on the creep strength of austenitic stainless steels. Several heats of alloy S38660 were made that systematically varied the phosphorus and boron contents. Uniaxial creep tests were conducted at 704/degree/C (1300/degree/F) to evaluate the effects of these elements on the creep rate and the rupture life. The results of these tests were used to guide the production of reactor grade fuel pin cladding for further evaluations. Pressurized tube specimens were tested in the laboratory and also in a fast reactor. Results of these investigations have shown that the elements phosphorus and boron, present in minute but controlled amounts, increase both the in- reactor and ex-reactor rupture life and reduce both in-reactor swelling and creep rate. Microstructural evaluations were also conducted to help ascertain the mechanisms by which the improved properties were obtained. 41 refs., 28 figs., 3 tabs
STEFINS: a steel freezing integral simulation program
International Nuclear Information System (INIS)
Frank, M.V.
1980-09-01
STEFINS (STEel Freezing INtegral Simulation) is a computer program for the calculation of the rate of solidification of molten steel on solid steel. Such computations arize when investigating core melt accidents in fast reactors. In principle this problem involves a coupled two-dimensional thermal and hydraulic approach. However, by physically reasonable assumptions a decoupled approach has been developed. The transient solidification of molten steel on a cold wall is solved in the direction normal to the molten steel flow and independent from the solution for the molten steel temperature and Nusselt number along the direction of flow. The solutions to the applicable energy equations have been programmed in cylindrical and slab geometries. Internal gamma heating of steel is included
Energy Technology Data Exchange (ETDEWEB)
Ordonez, Robert E. Cooper; Silva, Jose Hilton F.; Trevisan, Roseana E. [Universidade Estadual de Campinas, SP (Brazil). Faculdade de Engenharia Mecanica. Dept. de Engenharia de Fabricacao
2003-07-01
Flux Core Arc Welding processes (FCAW) are beginning to be applied in pipeline welds, however, very limited experimental data regarding mechanical properties of pipeline weld joints with these processes are available in the literature. In this paper, the effects of preheat temperature and type of FCAW on mechanical properties (microhardness and tensile strength) of API X80 weld joint steel are presented. FCAW processes with gas protection and self-shielded were used. Multipasses welding were applied in 30'' diameter and 0,625'' thickness tubes. Influence factors were: FCAW type and preheat temperature. Acceptance criteria of welded joints were evaluated by API 1104 standard for tensile strength test and ASTM E384-99 for microhardness test. The results obtained showed that FCAW type and preheat temperature have no influence on mechanical properties of API X80 joint steel. (author)
A Tool for Rating the Resilience of Critical Infrastructures in Extreme Fires
2014-05-01
Rapid Rise Fire Tests of Protection Materials for Structural Steel - Efectis Nederland Report – 2008-Efectis-R0695, Fire Testing Procedure for Concrete...extreme fire conditions such as ASTM E1529 [5], NFPA 502 [8], UL 1709 [4] and Efectis Nederland BV report [9]. One of the critical features of a
International Nuclear Information System (INIS)
Singh, Umesh Pratap; Kain, Vivekanand; Chandra, Kamlesh
2011-01-01
The sea water cooled condensers have to resist severe corrosion as marine environment is the most corrosive natural environment. Copper alloys are being phased out due to difficulties in water chemistry control and Titanium base alloys are extremely expensive. Austenitic stainless steels (SS) remain prone to localized corrosion in marine environments hence not suitable. These heat exchangers operate at temperatures not exceeding 50 deg C and at very low pressures. The tubes of these heat exchangers are joined to the carbon steel tube sheets by roll expansion or by roll expansion followed by seam welding. These conditions are expected to affect the localized corrosion resistance of the tube in roll joined region due to cold working and in the tube-tube sheet welded joint due to thermal effects of welding. In this study, the localized corrosion behaviour of a Hyper Duplex Stainless Steel (HDSS) has been evaluated, and compared with other materials e.g. types 304L SS, 316L SS, Duplex SS 2205, Titanium grade - 2, and Al Brass. The evaluation is done in three metallurgical conditions (a) as received, (b) cold rolled and (c) welded condition in synthetic sea water at room temperature and at 50 deg C to assess the resistance to crevice, pitting and stress corrosion cracking using standard ASTM exposure and electrochemical techniques. The results provide comparative assessment of these alloys and show their susceptibility in the three metallurgical conditions as encountered in condensers. Hyper-duplex SS has been shown to be highly resistant in sea water for the condenser tubing application. (author)
International Nuclear Information System (INIS)
1998-10-01
DoD adopted. This test method is under the jurisdiction of ASTM Committee C-9 on Concrete and Concrete Aggregates and is the direct responsibility of Subcommittee C09.41 on Concrete for Radiation Shielding. Current edition approved Feb. 10, 1986 and published October 1998. Originally published as C 942-81. Last previous edition was C 942-86(1991)
International Nuclear Information System (INIS)
1998-10-01
This test method is under the jurisdiction of ASTM Committee C-26 on Nuclear Fuel Cycles and is the direct responsibility of Subcommittee C26.07 on Waste Materials. The current edition was approved July 10, 1998, and published in October 1998. It was originally published as C 1220-92. The last previous edition was C 1220-92
Piping equipment; Materiel petrole
Energy Technology Data Exchange (ETDEWEB)
NONE
2001-07-01
This 'blue bible' of the perfect piping-man appeals to end-users of industrial facilities of the petroleum and chemical industries (purchase services, standardization, new works, maintenance) but also to pipe-makers and hollow-ware makers. It describes the characteristics of materials (carbon steels, stainless steels, alloyed steels, special alloys) and the dimensions of pipe elements: pipes, welding fittings, flanges, sealing products, forged steel fittings, forged steel valves, cast steel valves, ASTM standards, industrial valves. (J.S.)
Research of a fracture criterion for ductile metals. Application to austenitic stainless steels
International Nuclear Information System (INIS)
Chavaillard, J.P.
1984-01-01
Elasto-plastic Fracture Mechanics has been used when plasticity spreads over the ligament or the whole specimen. Then, the theoretic basis of the J-Integral breaks down; the value obtained with the J-Integral's definitions is a still usable parameter. The Crack - Opening - Displacement, COD, also is still a measure of the singularity's severity in the crack-tip surrounding (whom description is not necessary). These observations stem from many experiments conducted on traction specimens, with central or lateral cracks, and shape factor ranging from 0.2 to 0.8, width 40 or 80mm, thickness 10mm; extracted from the transverse direction of Z1 NCDU 25 20 and Z2 CND 17 13 (AISI 316 L) steel plates. The experiment did not fulfil ASTM's size requirement. Critical values of J and COD obtained here (in plane stress), from interrumpted tests or not, are practically independent of shape factor and geometry. They are very similar to the published values (AISI 316 L, 304). The net section stress in the ligament, in tension, is not a fracture parameter because it depends on width. The integral definition of J has been computed by a finite difference program analysing deformed grids in surface. These values are practically path independent here, they are in good agreement with those obtained by the compliance method [fr
Corrosion resistant properties and weldabilities of ASTM Grade 12 titanium alloy
International Nuclear Information System (INIS)
Tsumori, Yoshikatsu; Itoh, Hideo
1988-01-01
Plates, sheets, bars, wires and thinner seam-welded tubings were manufactured from large-scaled ingot of ASTM Grade 12 alloy (Ti-0.8Ni-0.3Mo). The processability of G-12 alloy has proved almost similar to that of conventional commercially pure titanium grades. It has been clarified that the G-12 alloy showed several advantageous features: Chlorides-Crevice corrosion resistance of the alloy was almost equals to G-7 and Pd0/TiO 2 coated titanium, and the maximum allowable stress was able to be designed higher than that of commercially pure titanium. This alloy has been in applications also offers where such environments as seawater, brines and moist chlorine, various oil refinery and chemical industries, and others. (author)
2013-08-26
Magazine, 2004, Vol. 60, No. 68, pp. 7-11. 2. A. Wrigley: Aerospace Metals, American Metal Market , of May 1994. 3. L. L. Sherir: in Corrosion 1...Electrochemistry and Engineering, ASTM STP 801, T. W. Crooker and B. N Leis, Eds., American Society for Testing and Materials, 1983, pp. 5-25. 8. B. Fitzsimons
Manjili, Mohsen Hajipour; Halali, Mohammad
2018-02-01
Samples of INCONEL 718 were levitated and melted in a slag by the application of an electromagnetic field. The effects of temperature, time, and slag composition on the inclusion content of the samples were studied thoroughly. Samples were compared with the original alloy to study the effect of the process on inclusions. Size, shape, and chemical composition of remaining non-metallic inclusions were investigated. The samples were prepared by Standard Guide for Preparing and Evaluating Specimens for Automatic Inclusion Assessment of Steel (ASTM E 768-99) method and the results were reported by means of the Standard Test Methods for Determining the Inclusion Content of Steel (ASTM E 45-97). Results indicated that by increasing temperature and processing time, greater level of cleanliness could be achieved, and numbers and size of the remaining inclusions decreased significantly. It was also observed that increasing calcium fluoride content of the slag helped reduce inclusion content.
Energy Technology Data Exchange (ETDEWEB)
Silva, Carlos Eduardo da
2009-07-01
The increase of gas and petroleum demanding in the national and international markets, the specification and certification of the chemical analysis results of gas and oil pipe-line have became more and more challenging. A continuous development has been outlined to improve API grade alloy steels (American Petroleum Institute). The steel properties depend on the chemical composition control and process parameters during its manufacturing. In this work, a comparison of the measurement uncertainty between X-ray fluorescence (WD system) and Optical Emission (OES-spark) spectrometry, for API grade steel plant samples analysis, was outlined. Usually, this kind of analyze requires less than 40 seconds for full chemical characterization for adjustment in the process parameters production. The main influence source in the chemical analysis was evaluated for design of experiments. The constituents and trace elements such as Al, Si, P, S, Ti, V, Cr, Mn, Co, Ni, Cu, As, Nb, Mo and Sn were determined using the ASTM E-322, E-415, E-1009 and E-1085 standard methodologies. The 185A and 187A certified reference materials from CMI (Czech Metrology Institute) were used for evaluation of the methods. The uncertainty of the measurement, precision, accuracy, repeatability and reproducibility of the measurements were obtained applying statistic tests, recommended by ISO/IEC 17025. The uncertainty of measurement for each element is discussed for both techniques. (author)
Assessment of wrought ASTM F1058 cobalt alloy properties for permanent surgical implants.
Clerc, C O; Jedwab, M R; Mayer, D W; Thompson, P J; Stinson, J S
1997-01-01
The behavior of the ASTM F1058 wrought cobalt-chromium-nickel-molybdenum-iron alloy (commonly referred to as Elgiloy or Phynox) is evaluated in terms of mechanical properties, magnetic resonance imaging, corrosion resistance, and biocompatibility. The data found in the literature, the experimental corrosion and biocompatibility results presented in this article, and its long track record as an implant material demonstrate that the cobalt superalloy is an appropriate material for permanent surgical implants that require high yield strength and fatigue resistance combined with high elastic modulus, and that it can be safely imaged with magnetic resonance.
Energy Technology Data Exchange (ETDEWEB)
Guimaraes, R.F.; Miranda, H.C. de; Farias, J.P. [Universidade Federal do Ceara (DEMM/UFC), Fortaleza, CE (Brazil). Dept. de Engenharia Metalurgica e de Materiais. Lab. de Caracterizacao de Materiais], e-mail: rf.guimaraes@yahoo.com.br
2008-07-01
In this work, the behavior of the AISI 444 ferritic stainless steel submitted to thermal fatigue test and their corrosion resistance in heavy crude oil was evaluated. The AWS E309MoL-16 and E316L-17 weld metal was employed as filler metal. Plates of the AISI 444 were welded on ASTM A-516 Gr. 60 plates and submitted to fatigue thermal cycle. Samples were extracted from plates welded and heat treated immersed in heavy crude oil at 300 deg C. Optical microscopy (OM), scanning electron microscopy (SEM) and energy dispersive of X-ray analysis (EDX) were used to characterize the microstructure and the corroded surface. The results show that the AISI 444 stainless steels did not present cracks after the thermal fatigue cycle and the heat treated immerse in heavy crude oil. The electrode AWS E309MoL-16 show better corrosion resistance than the AWS E316L-17. (author)
Mehanical Properties of Electron Beam Welded Joints in Thick Gage CA6NM Stainless Steel
Sarafan, Sheida; Wanjara, Priti; Gholipour, Javad; Champliaud, Henri; Mathieu, Louis
2017-10-01
Design of hydroelectric turbine components requires high integrity welds (without detectable volumetric defects) in heavy gage sections of stainless steel materials, such as ASTM A743 grade CA6NM—a low carbon 13% Cr-4% Ni martensitic stainless steel that is manufactured in cast form. In this work, 90-mm-thick plates of CA6NM were joined using a single-pass autogenous electron beam (EB) welding process and the mechanical properties were evaluated in the as-welded condition to characterize the performance of the joints. The static tensile properties that were evaluated in two directions—transverse and longitudinal to the EB weld seam—demonstrated conformance of the joints with the requirements of the ASME Section IX standard. The Charpy impact energies of the EB welds—measured at -18 °C on samples with V-notch roots located in the fusion and heat-affected zones—met the minimum requirements of 27 J specified in ASME Section VIII standard. In addition, bend tests that were conducted on the entire weld cross section displayed no discontinuities on the tension side of the bent joints. Hence, the developed EB welding process was demonstrated to render high-performance joints and promises key advantages for industrialization, such as cost savings through reductions in consumable material, production time and labor intensity.
Garrett, J. W.; Glassford, A. P. M.; Steakley, J. M.
1994-01-01
The American Society for Testing and Materials has published a new standard test method for characterizing time and temperature-dependence of material outgassing kinetics and the deposition kinetics of outgassed species on surfaces at various temperatures. This new ASTM standard, E 1559(1), uses the quartz crystal microbalance (QCM) collection measurement approach. The test method was originally developed under a program sponsored by the United States Air Force Materials Laboratory (AFML) to create a standard test method for obtaining outgassing and deposition kinetics data for spacecraft materials. Standardization by ASTM recognizes that the method has applications beyond aerospace. In particular, the method will provide data of use to the electronics, semiconductor, and high vacuum industries. In ASTM E 1559 the material sample is held in vacuum in a temperature-controlled effusion cell, while its outgassing flux impinges on several QCM's which view the orifice of the effusion cell. Sample isothermal total mass loss (TML) is measured as a function of time from the mass collected on one of the QCM's which is cooled by liquid nitrogen, and the view factor from this QCM to the cell. The amount of outgassed volatile condensable material (VCM) on surfaces at higher temperatures is measured as a function of time during the isothermal outgassing test by controlling the temperatures of the remaining QCM's to selected values. The VCM on surfaces at temperatures in between those of the collector QCM's is determined at the end of the isothermal test by heating the QCM's at a controlled rate and measuring the mass loss from the end of the QCM's as a function of time and temperature. This reevaporation of the deposit collected on the QCM's is referred to as QCM thermogravimetric analysis. Isothermal outgassing and deposition rates can be determined by differentiating the isothermal TML and VCM data, respectively, while the evaporation rates of the species can be obtained as a
Evaluation of Galvanized and Galvalume/Paint Duplex Coating Systems for Steel Building Panels
National Research Council Canada - National Science Library
Race, Timothy
2002-01-01
...) or silicone modified polyester (SMP). Specimens having these coating systems were subjected to ASTM B 117, conventional salt spray exposure testing and ASTM D 5894 Testing in the laboratory, which combines the environmental effects...
Energy Technology Data Exchange (ETDEWEB)
Gonzalez-Rodriguez, Carlos A. [Facultad de Quimica UNAM, Ciudad Universitaria, C.P. 04510 Mexico, D.F. (Mexico)], E-mail: gorc74@yahoo.com; Rodriguez-Gomez, Francisco J.; Genesca-Llongueras, Joan [Facultad de Quimica UNAM, Ciudad Universitaria, C.P. 04510 Mexico, D.F. (Mexico)
2008-12-01
The action of Desulfovibrio vulgaris (Dv) during a corrosion process has been reported in literature, but the influence of imidazoline in the formation of biofilms is not clear, as well as the effect of bacteria on the efficiency of the corrosion inhibitors. The aim of this work is to determine the behavior of bacteria in the presence of imidazoline. Therefore, the growth of Dv, isolated and characterized from a morphological point of view, was monitored during 21 days, during which synthetic seawater was used as the culture medium, according to the ASTM D665-98 standard. Electrochemical noise (EN) was employed to establish the corrosion type generated by the microorganism on an AISI 1018 steel cylinder. The attack was observed using scanning electron microscopy (SEM). In order to evaluate the efficiency of the corrosion inhibitor, Tafel extrapolation was used; the optimum concentration of the inhibitor was used in the presence of sulphate-reducing bacteria (SRB). In general, two forms of corrosion were observed: localized corrosion (in the LAG phase) and mixed corrosion (in the LOG phase)
International Nuclear Information System (INIS)
Gonzalez-Rodriguez, Carlos A.; Rodriguez-Gomez, Francisco J.; Genesca-Llongueras, Joan
2008-01-01
The action of Desulfovibrio vulgaris (Dv) during a corrosion process has been reported in literature, but the influence of imidazoline in the formation of biofilms is not clear, as well as the effect of bacteria on the efficiency of the corrosion inhibitors. The aim of this work is to determine the behavior of bacteria in the presence of imidazoline. Therefore, the growth of Dv, isolated and characterized from a morphological point of view, was monitored during 21 days, during which synthetic seawater was used as the culture medium, according to the ASTM D665-98 standard. Electrochemical noise (EN) was employed to establish the corrosion type generated by the microorganism on an AISI 1018 steel cylinder. The attack was observed using scanning electron microscopy (SEM). In order to evaluate the efficiency of the corrosion inhibitor, Tafel extrapolation was used; the optimum concentration of the inhibitor was used in the presence of sulphate-reducing bacteria (SRB). In general, two forms of corrosion were observed: localized corrosion (in the LAG phase) and mixed corrosion (in the LOG phase)
Appropriate welding conditions of temper bead weld repair for SQV2A pressure vessel steel
International Nuclear Information System (INIS)
Mizuno, R.; Matsuda, F.; Brziak, P.; Lomozik, M.
2004-01-01
Temper bead welding technique is one of the most important repair welding methods for large structures for which it is difficult to perform the specified post weld heat treatment. In this study, appropriate temper bead welding conditions to improve the characteristics of heat affected zone (HAZ) are studied using pressure vessel steel SQV2A corresponding to ASTM A533 Type B Class 1. Thermal/mechanical simulator is employed to give specimens welding thermal cycles from single to quadruple cycle. Charpy absorbed energy and hardness of simulated CGHAZ by first cycle were degraded as compared with base metal. Improvability of these degradations by subsequent cycles is discussed and appropriate temper bead thermal cycles are clarified. When the peak temperature lower than Ac1 and near Ac1 in the second thermal cycle is applied to CGAHZ by first thermal cycle, the characteristics of CGHAZ improve enough. When the other peak temperatures (that is, higher than Ac1) in the second thermal cycle are applied to the CGHAZ, third or more thermal cycle temper bead process should be applied to improve the properties. Appropriate weld condition ranges are selected based on the above results. The validity of the selected ranges is verified by the temper bead welding test. (orig.)
International Nuclear Information System (INIS)
Parvathavarthini, N.; Dayal, R.K.; Khatak, H.S.; Shankar, V.; Shanmugam, V.
2006-01-01
Sensitization behaviour of austenitic stainless steel weld metals prepared using indigenously developed modified 316N (C = 0.05%; N = 0.12%) and 316L (C = 0.02%; N = 0.07%) electrodes was studied. Detailed optical and scanning electron microscopic examination was carried out to understand the microstructural changes occurring in the weld metal during isothermal exposure at various temperatures ranging from 500 deg. C to 850 deg. C (773-1123 K). Based on these studies the mechanism of sensitization in the austenite-ferrite weld metal has been explained. Time-temperature-sensitization (TTS) diagrams were established using ASTM A262 Practice E test. From the TTS diagrams, critical cooling rate (CCR) above which there is no risk of sensitization was calculated for both materials. The heating/cooling rates to be followed for avoiding sensitization during heat treatment cycles consisting of solution-annealing and stress-relieving in fabrication of welded components of AISI 316LN stainless steel (SS) were estimated taking into account the soaking time and the number of times the component undergoes thermal excursions in the sensitization regime. The results were validated by performing controlled heating and cooling heat treatment trials on welded specimens
Mankari, Kamal; Acharyya, Swati Ghosh
2017-12-01
We hereby report a simple surface engineering technique to make AISI grade 321 stainless steel (SS) welds resistant to stress corrosion cracking (SCC) in chloride environment. Heat exchanger tubes of AISI 321 SS, welded either by (a) laser beam welding (LBW) or by (b) metal inert gas welding (MIG) were used for the study. The welds had high magnitude of tensile residual stresses and had undergone SCC in chloride environment while in service. The welds were characterized using field emission scanning electron microscopy (FESEM) and X-ray diffraction (XRD). Subsequently, the welded surfaces were subjected to buffing operation followed by determination of residual stress distribution and surface roughness by XRD and surface profilometer measurements respectively. The susceptibility of the welds to SCC was tested in buffed and un-buffed condition as per ASTM G-36 in boiling MgCl2 for 5 h and 10 h, followed by microstructural characterization by using optical microscope and FESEM. The results showed that the buffed surfaces (both welds and base material) were resistant to SCC even after 10 h of exposure to boiling MgCl2 whereas the un-buffed surfaces underwent severe SCC for the same exposure time. Buffing imparted high magnitude of compressive stresses on the surface of stainless steel together with reduction in its surface roughness and reduction in plastic strain on the surface which made the welded surface, resistant to chloride assisted SCC. Buffing being a very simple, portable and economic technique can be easily adapted by the designers as the last step of component fabrication to make 321 stainless steel welds resistant to chloride assisted SCC.
Energy Technology Data Exchange (ETDEWEB)
Munoz C, A. E. [ININ, 52750 La Marquesa, Estado de Mexico (Mexico)
2008-07-01
A study of a process known as plasma immersion ion implantation (PIII) of nitrogen at low voltages (< 4 kV) into three kind of samples: 1) austenitic stainless AISI 316-L steel plates, 2) ferritic stainless AISI 434 steel-based dentistry drills and 3) commercially pure titanium (CPTi) disks. On the case of CPTi the study was conducted in nitrogen- oxygen calibrated mixtures: 90% N-10% O, 80% N-20% O, 70% N-30% O and in 99.5% pure oxygen and 99.9% pure nitrogen. The PIII process was carried out by using a direct current plasma source controlled both in voltage and current, a negative voltage pulse modulator, a stainless AISI 304 steel vacuum chamber and a rod of the same material, horizontally located in the upper region of the chamber, which plays the role of anode in the plasma discharge. The purpose of the nitriding is forming a relatively thick layer on the surface of the steel specimens in order to enhance their both microhardness and general corrosion performances, desirable in medical applications. This layer contains interstitial nitrogen atoms ({approx}24% at.) which gives place to a deformed lattice (expanded phase) of the steel. Vickers microhardness and potentiodynamic tests (the latter in agreement to the norm ASTM G-61-89) confirm an increase of microhardness up to three times and a decrease of general corrosion rate in one order of magnitude. The nitriding of de dentistry drills is aimed at inhibiting the pitting corrosion produced by the asepsis process which results in pit nucleations, their propagation and consequent fractures when being under cyclic stress (fatigue). Scanning electron microscope micrographs reveal the risks involved in surpassing the critical treatment simple temperature of 450 C as the PIII process itself induces pitting. On its part, cyclic (ASTM G-61) potentiodynamic tests indicate an excellent pitting corrosion resistance of the samples treated under 450 C. In turn, the treatment of CPTi was meant to develop oxidized and
Design and fabrication of stainless steel components for long life of spent fuel reprocessing plants
International Nuclear Information System (INIS)
Natarajan, R.; Ramkumar, P.; Sundararaman, V.; Kamachi Mudali, U.; Baldev Raj; Shanmugam, K.
2010-01-01
Reprocessing of spent nuclear fuels based on the PUREX process is the proven process with many commercial plants operating satisfactorily worldwide. The process medium being nitric acid, austenitic stainless steel is the material of construction as it is the best commercially available material for meeting the conditions in the reprocessing plants. Because of the high radiation fields, contact maintenance of equipment and systems of these plants are very time consuming and costly unlike other chemical process plants. Though the plants constructed in the early years required extensive shut downs for replacement of equipment and systems within the first fifteen years of operation itself, development in the field of stainless steel metallurgy and fabrication techniques have made it possible to design the present day plants for an operating life period of forty years. A review of the operational experience of the PUREX process based aqueous reprocessing plants has been made in this paper and reveals that life limiting failures of equipment and systems are mainly due to corrosion while a few are due to stresses. Presently there are no standards for design specification of materials and fabrication of reprocessing plants like the nuclear power plants, where well laid down ASTM and ASME codes and standards are available which are based on the large scale operational feedbacks on pressure vessels for conventional and nuclear industries. (author)
30 CFR 285.103 - When may MMS prescribe or approve departures from these regulations?
2010-07-01
... 30 Mineral Resources 2 2010-07-01 2010-07-01 false When may MMS prescribe or approve departures... CONTINENTAL SHELF General Provisions § 285.103 When may MMS prescribe or approve departures from these regulations? (a) The MMS may prescribe or approve departures from these regulations when departures are...
International Nuclear Information System (INIS)
Pillot, Sylvain; Chauvy, Cédric; Corre, Stéphanie; Coudreuse, Lionel; Gingell, Andrew; Héritier, Déborah; Toussaint, Patrick
2013-01-01
Standard and Vanadium-alloyed 2,25Cr–1Mo steel grades (EN 10028-2 12CrMo9-10/ASTM A387 gr. 22 and 13CrMoV9-10/ASTM A542 tp. D) are commonly used for the fabrication of heavy pressure vessels for applications in petroleum refining plants. These reactors are made of heavy plates, forged shells, forged nozzles and fittings. They are subjected to thermal cycles (stop and go) and to severe service conditions (high temperatures and high hydrogen partial pressures). A primary concern for end-users is the definition of the Minimum Pressurizing Temperature (MPT) of the equipment. This temperature is the lowest temperature at which the vessel can be repressurized after shutdown and insures no risk of brittle failure of the containment body. The MPT is defined by fracture mechanics and/or CVN approaches and calculations. This second part of the paper presents the methodology of MPT determination and the particular case of vintage reactors. MPT determination methodology is explained by using a virtual pressure vessel representative of vessels found in petroleum refineries. A special focus is also set on the evolution of embedded defects
Jenkins, Michael G.; Salem, Jonathan A.
2016-01-01
Physical and mechanical properties and performance of advanced ceramics and glasses are difficult to measure correctly without the proper techniques. For over three decades, ASTM Committee C28 on Advanced Ceramics, has developed high-quality, technically-rigorous, full-consensus standards (e.g., test methods, practices, guides, terminology) to measure properties and performance of monolithic and composite ceramics that may be applied to glasses in some cases. These standards contain testing particulars for many mechanical, physical, thermal, properties and performance of these materials. As a result these standards are used to generate accurate, reliable, repeatable and complete data. Within Committee C28, users, producers, researchers, designers, academicians, etc. have written, continually updated, and validated through round-robin test programs, 50 standards since the Committee's founding in 1986. This paper provides a detailed retrospective of the 30 years of ASTM Committee C28 including a graphical pictogram listing of C28 standards along with examples of the tangible benefits of standards for advanced ceramics to demonstrate their practical applications.
Jenkins, Michael G.; Salem, Jonathan A.
2016-01-01
Physical and mechanical properties and performance of advanced ceramics and glasses are difficult to measure correctly without the proper techniques. For over three decades, ASTM Committee C28 on Advanced Ceramics, has developed high quality, rigorous, full-consensus standards (e.g., test methods, practices, guides, terminology) to measure properties and performance of monolithic and composite ceramics that may be applied to glasses in some cases. These standards testing particulars for many mechanical, physical, thermal, properties and performance of these materials. As a result these standards provide accurate, reliable, repeatable and complete data. Within Committee C28 users, producers, researchers, designers, academicians, etc. have written, continually updated, and validated through round-robin test programs, nearly 50 standards since the Committees founding in 1986. This paper provides a retrospective review of the 30 years of ASTM Committee C28 including a graphical pictogram listing of C28 standards along with examples of the tangible benefits of advanced ceramics standards to demonstrate their practical applications.
Data for a steel industry model
Mæstad, Ottar
2000-01-01
SNF has recently developed a new model of the steel market and some of the major factor markets connected to the steel industry. The aim of the model has been to study how regulations of the emissions of carbon dioxide (CO2) in the steel industry might affect the structure of the industry. It has also been an objective to investigate how structural changes in the steel industry might influence on the industry’s demand for transport services. This paper outlines the details about the data that...
Hydrogen Induced Intergranular Cracking of Nickel-Base Alloys.
1982-02-01
alloys are discussed. Experimental The steel used in the present investigation is a fully bainitic 2 1/4 Cr-lMo pressure vessel steel , ASTM A542 Class 3...Appendix A describes recent experiments performed in order to study the influence of plastic deformation on hydrogen transport in a 214 Cr-lMo steel (8...PLASTIC DEFORMATION ON HYDROGEN TRANSPORT IN 2 1/4 Cr-lMo STEEL M. Kurkela, G.S. Frankel, and R.M. Latanision Department of Materials Science and
DEFF Research Database (Denmark)
Rizzo, Milena; Berti, Gabriele; Russo, Francesco
2017-01-01
targets in the pull out sample. We showed that E2F6, TEX-261, MAPK1, MPL, N4BP1, and RAP1B but not BAG1, OTUB1, MAD2L1, and p21 were significantly enriched, suggesting that not all the miR-28-5p targets are regulated by this miRNA in PCa. We then verified whether the miR-28-5p-interacting targets were...
DETERMINANTS OF RETAINED EARNINGS IN PROFITABLE STEEL COMPANIES IN INDIA: A STUDY OF STEEL SECTOR
Dr. Sohaib Masood
2018-01-01
In this paper an attempt has been made to identify the important determinants of retained earnings in profitable steel companies in steel sector of India and which have impact on the retention of earnings of steel companies under study. Multiple linear regression is used to identify the determinants of retained earnings for a period of sixteen years. Also the importance of retained earnings as a source of finance for steel sector companies is also studied in the paper.
Indian Academy of Sciences (India)
manufacture of steel in south India by a crucible process at ... indicates that the production of wootz steel was almost on an industrial scale in ... in an Age of Design marked by ... The Russian Anasoff also studied the process of manufacturing.
Chakrabarti, A K
2014-01-01
"Steel Making" is designed to give students a strong grounding in the theory and state-of-the-art practice of production of steels. This book is primarily focused to meet the needs of undergraduate metallurgical students and candidates for associate membership examinations of professional bodies (AMIIM, AMIE). Besides, for all engineering professionals working in steel plants who need to understand the basic principles of steel making, the text provides a sound introduction to the subject.Beginning with a brief introduction to the historical perspective and current status of steel making together with the reasons for obsolescence of Bessemer converter and open hearth processes, the book moves on to: elaborate the physiochemical principles involved in steel making; explain the operational principles and practices of the modern processes of primary steel making (LD converter, Q-BOP process, and electric furnace process); provide a summary of the developments in secondary refining of steels; discuss principles a...
Initial Assessment of CSA Group Niobium Boron Based Coatings on 4340 Steel
2017-07-01
1 2.3. ASTM Adhesion Testing...Model Leptoskop 2040) on each coated plate. A minimum of five (5) measurements were taken on each side of each plate. 2.3. ASTM Adhesion Testing...Adhesion testing was conducted in accordance with ASTM B571, “Standard Practice for Qualitative Adhesion Testing of Metallic Coatings”, using Method
Laser cutting of thick steel plates and simulated steel components using a 30 kW fiber laser
International Nuclear Information System (INIS)
Tamura, Koji; Ishigami, Ryoya; Yamagishi, Ryuichiro
2016-01-01
Laser cutting of thick steel plates and simulated steel components using a 30 kW fiber laser was studied for application to nuclear decommissioning. Successful cutting of carbon steel and stainless steel plates up to 300 mm in thickness was demonstrated, as was that of thick steel components such as simulated reactor vessel walls, a large pipe, and a gate valve. The results indicate that laser cutting applied to nuclear decommissioning is a promising technology. (author)
2009-02-19
component usage. PH 13-8Mo is a precipitation-hardenable martensitic stainless steel combining excellent corrosion resistance with strength. Custom 465 is...a martensitic , age-hardenable stainless steel capable of about 1,724 MPa (250 ksi) UTS when peak-aged (H900 condition). Especially, this steel can...NOTES 14. ABSTRACT Five high strength steels (4340, 300M, AerMet 100, Ferrium S53, and Hy-Tuf) and four stainless steels (High Nitrogen, 13
Hippensteele, S. A.; Colladay, R. S.
1978-01-01
A computer program for determining desired thermodynamic and transport property values by means of a three-dimensional (pressure, fuel-air ratio, and either enthalpy or temperature) interpolation routine was developed. The program calculates temperature (or enthalpy), molecular weight, viscosity, specific heat at constant pressure, thermal conductivity, isentropic exponent (equal to the specific heat ratio at conditions where gases do not react), Prandtl number, and entropy for air and a combustion gas mixture of ASTM-A-1 fuel and air over fuel-air ratios from zero to stoichiometric, pressures from 1 to 40 atm, and temperatures from 250 to 2800 K.
Applying consensus standards to cask development
International Nuclear Information System (INIS)
Leatham, J.; Abbott, D.G.; Warrant, M.M.
1987-01-01
The Department of Energy's (DOE's) Office of Civilian Radioactive Waste Management is procuring cask systems for transporting commercial spent nuclear fuel and is encouraging development of innovative cask designs and materials to improve system efficiency. New designs and innovative materials require that consensus standards be established so that cask designers and regulators have criteria for determining acceptability. Recent DOE experience in certifying three spent fuel shipping casks, NUPAC-125B, TN-BRP, and TN-REG, is discussed. Certification of the NUPAC-125B was expedited because it was made of conventional American Society for Testing and Materials (ASTM) materials and complied with the American Society of Mechanical Engineers (ASME) Code and Nuclear Regulatory Commission Regulatory Guides. The TN-BRP and TN-REG cask designs are still being reviewed because baskets included in the casks are made of borated stainless steel, which has no ASTM Specification or ASME Code approval. The process of developing and approving consensus standards is discussed, including the role of ANSI and ANSI N14. Specific procedures for ASTM and ASME are described. A draft specification or standard must be prepared and then approved by the appropriate body. For new material applications to the ASME Code, an existing ASTM Specification is needed. These processes may require several years. The status of activities currently in progress to develop consensus standards for spent fuel casks is discussed, including (1) ASME NUPAC, and (2) ASTM Specifications for ductile cast iron and borated stainless steel
Oxidación a alta temperatura de un acero ASTM A335 P92 en contacto con una mezcla de sales de
Jessica Rodríguez Pérez; Eduardo Santos Sánchez; Darío Yesid Peña Ballesteros; Anderson Sandoval Amador; Hugo Armando Estupiñán Durán
2016-01-01
En esta investigación se evaluó la oxidación del acero ASTM A335 P92 en una mezcla de sales 40% K2SO4 - 60% NaCl a temperaturas de 500ºC a 700ºC, a intervalos de 50°C con tiempos de exposición de 1, 3, 10, 30, 100 y 150 horas, utilizando la norma estandarizada por la Federación Europea de Corrosión. Se realizó análisis metalográfico y de dureza antes y después del ensayo para identificar el posible cambio estructural; se realizan pruebas de difracción de rayos X (DRX), microscopía electrónica...
Comparative study between EDXRF and ASTM E572 methods using two-way ANOVA
Krummenauer, A.; Veit, H. M.; Zoppas-Ferreira, J.
2018-03-01
Comparison with reference method is one of the necessary requirements for the validation of non-standard methods. This comparison was made using the experiment planning technique with two-way ANOVA. In ANOVA, the results obtained using the EDXRF method, to be validated, were compared with the results obtained using the ASTM E572-13 standard test method. Fisher's tests (F-test) were used to comparative study between of the elements: molybdenum, niobium, copper, nickel, manganese, chromium and vanadium. All F-tests of the elements indicate that the null hypothesis (Ho) has not been rejected. As a result, there is no significant difference between the methods compared. Therefore, according to this study, it is concluded that the EDXRF method was approved in this method comparison requirement.
30 CFR 285.510 - May MMS reduce or waive my lease or grant payments?
2010-07-01
... 30 Mineral Resources 2 2010-07-01 2010-07-01 false May MMS reduce or waive my lease or grant... Financial Assurance Requirements Payments § 285.510 May MMS reduce or waive my lease or grant payments? (a) The MMS Director may reduce or waive the rent or operating fee or components of the operating fee...
A model for TRIP steel constitutive behaviour
Perdahcioglu, Emin Semih; Geijselaers, Hubertus J.M.; Menari, G
2011-01-01
A constitutive model is developed for TRIP steel. This is a steel which contains three or four different phases in its microstructure. One of the phases in TRIP steels is metastable austenite (Retained Austenite) which transforms to martensite upon deformation. The accompanying transformation strain
Energy Technology Data Exchange (ETDEWEB)
Yang, Zhaorui; Kang, Hansaem; Lee, Young Seog [Chung-Ang University, Seoul (Korea, Republic of)
2016-05-15
This paper presents an experimental study that examines variations of Charpy impact energy of a welded steel plate, depending upon the welding method and the method for obtaining the Charpy specimens. Flux cored arc welding (FCAW) and Gas tungsten arc welding (GTAW) were employed to weld an SA516 Gr. 70 steel plate. The methods of wire cutting and water-jet cutting were adopted to take samples from the welded plate. The samples were machined according to the recommendations of ASTM SEC. II SA370, in order to fit the specimen dimension that the Charpy impact test requires. An X-ray diffraction (XRD) method was used to measure the as-weld residual stress and its redistribution after the samples were cut. The Charpy impact energy of specimens was considerably dependent on the cutting methods and locations in the welded plate where the specimens were taken. The specimens that were cut by water jet followed by FCAW have the greatest resistance-to-fracture (Charpy impact energy). Regardless of which welding method was used, redistributed transverse residual stress becomes compressive when the specimens are prepared using water-jet cutting. Meanwhile, redistributed transverse residual stress becomes tensile when the specimens are prepared using wire cutting.
International Nuclear Information System (INIS)
Joyce, James A.
1988-01-01
During the past three years a test method has been developed for dynamic testing of fracture mechanics specimens which is specifically designed for application to the upper transition temperature range. The method uses drop tower loading rates of 2.5 m/sec and obtains a J IC or a J-R curve using an analytical key curve approach verified by initial and final crack length measurements obtained from the fracture surface. A J-R curve is obtained from each specimen and contains crack growth corrections so that it is directly comparable with static results obtained in accordance with the ASTM E1152 J-R curve test method. The test procedure has been applied to A106 steel, A533B steel and US Navy HY80 and HY100 steels at temperatures from -200F to 150F. Standard 1T three point bend specimens were used for the A533B and the HY100 steel. Static test results have shown that the J at cleavage initiation (which is presently an unstandardized quantity) is specimen a/W independent throughout the ductile to brittle transition but of course demonstrates considerable statistical scatter in the vicinity of the ductile upper shelf. Dynamic J-R tests have shown an increase in J IC with test rate for most, but not for all, materials. Separation of J into elastic and plastic components shows that the elastic J component increases with test rate in a fashion consistent with the materials tensile sensitivity to test rate but the plastic J component decreases with test rate - an apparent visco-plastic phenomena. For A106 steel the plastic J decrease exceeds the elastic J increase and the upper shelf toughness falls - while the other materials have demonstrated a relatively larger increase in the elastic J component and a smaller decrease in the plastic J component giving an overall increase in upper shelf toughness. Separation of the J integral into elastic and plastic components has demonstrated that J EL is specimen scale and geometry dependent while J PL is relatively scale and geometry
Energy Technology Data Exchange (ETDEWEB)
Porto, P.C.R.; Spim, J.A. [Universidade Federal do Rio Grande do Sul (UFRGS), Porto Alegre, RS (Brazil). Centro de Tecnologia. Lab. de Fundicao], e-mail: spim@ufrgs.br; Santos, C.A. [Pontificia Universidade Catolica do Rio Grande do Sul (PUC-RS), Porto Alegre, RS (Brazil). Fac. de Engenharia. Programa de Pos-Graduacao em Engenharia e Tecnologia de Materiais (PGETEMA)
2006-07-01
The objective of this work was to evaluate the change in mechanic properties and phase transformations of ferritic stainless steel tube, ASTM 268 Gr 446, applied in high temperature conditions. The work has used tubes from radiation furnaces of the PETROBRAS Xisto Industrialization Unit. The samples used for comparison were obtained from new tubes and tubes already used in furnaces. The test analyses were optical metallography, scanning electron microscopy, energy dispersive spectrometer, hardness and microhardness test and tension test. Results have shown that the new tubes presented a ferritic matrix and in old tubes were observed a great quantity of sigma phase and carbides. Along with the thickness of the tubes it was verified that the inside region presented an increase of sulfate and the outside region an increase of carbides. (author)
Mansouri, Hamidreza; Alavi, Seyed Abolhasan; Fotovat, Meysam
2015-07-01
The microbial corrosion behavior of three important steels (carbon steel, stainless steel, and Corten steel) was investigated in semi petroleum medium. This work was done in modified nutrient broth (2 g nutrient broth in 1 L oily wastewater) in the presence of Pseudomonas aeruginosa and mixed culture (as a biotic media) and an abiotic medium for 2 weeks. The behavior of corrosion was analyzed by spectrophotometric and electrochemical methods and at the end was confirmed by scanning electron microscopy. The results show that the degree of corrosion of Corten steel in mixed culture, unlike carbon steel and stainless steel, is less than P. aeruginosa inoculated medium because some bacteria affect Corten steel less than other steels. According to the experiments, carbon steel had less resistance than Corten steel and stainless steel. Furthermore, biofilm inhibits separated particles of those steels to spread to the medium; in other words, particles get trapped between biofilm and steel.
Corrosion properties of pulse-plated zinc-nickel alloy coatings
Energy Technology Data Exchange (ETDEWEB)
Alfantazi, A.M. [Univ. of British Columbia, Vancouver, British Columbia (Canada). Dept. of Metals and Materials Engineering; Erb, U. [Queen`s Univ., Kingston, Ontario (Canada)
1996-11-01
Corrosion properties of pulse-plated Zn-Ni alloy coating on a steel substrate were investigated using the neutral salt-spray test (ASTM B 117-81) and the potentiodynamic polarization technique (ASTM G 5-82). Performance of these alloy coatings with various Ni contents (up to 62 wt%) was compared to that of laboratory-prepared electrodeposited Zn coatings and commercial galvannealed (GA) steel. Results of the neutral salt-spray test indicated corrosion resistance of pulse-plated Zn-Ni alloy coatings was superior to that of the pure Zn and commercial GA coating. The Zn-20 wt% Ni and Zn-14 wt% Ni alloys gave the best protection of the Zn-Ni coatings tested. Potentiodynamic polarization tests confirmed excellent corrosion performance of the 20 wt% Ni alloy
International Nuclear Information System (INIS)
1998-09-01
This specification is under the jurisdiction of ASTM Committee B-2 on Nonferrous Metals and Alloys and is the direct responsibility of Subcommittee B02.07 on Refined Nickel and Cobalt, and Alloys Containing Nickel or Cobalt or Both as Principal Constituents. Current edition approved Apr. 10, 1998 and published September 1998. Originally published as B 818-91. Last previous edition was B 818-93
Directory of Open Access Journals (Sweden)
Elison da Fonseca e Silva
2011-01-01
Full Text Available OBJETIVO: Este trabalho estudou a composição química e metalográfica (microestrutura, tamanho de grão, teor de inclusões de aços inoxidáveis austeníticos, desenvolvidos para aplicações como biomateriais, utilizados na fabricação de implantes ortopédicos. MÉTODO: Foram analisados doze implantes removidos de pacientes afetados por quadro inflamatório. As análises químicas foram desenvolvidas pelas técnicas Espectrometria de Emissão Ótica e Microanálise por Dispersão de Energia (EDS e o tamanho de grão foi determinado por microscopia ótica e Microscopia Eletrônica de Varredura (MEV conforme norma ASTM E 1382 97. RESULTADOS: Observou-se que, todos os implantes apresentavam tamanho de grão superior ao recomendado pela norma, constatou-se também a presença de ferrita delta em dez dos doze implantes removidos, que de acordo com a norma ASTM F138-92 não deveriam ser percebidas microscopicamente com um aumento de 100 vezes. CONCLUSÕES: Em oito casos existe forte indicação de que as inflamações foram desencadeadas pela corrosão por pite. Nivel de Evidência III, Revisão sistemática de Estudos .OBJECTIVE: This study examines the chemical and metallographic composition (microstructure, grain size, inclusion content of austenitic stainless steel developed as biomaterials for used in the manufacture of orthopedic implants. METHOD: An analysis was carried out of twelve implants removed from patients affected by inflammation. Chemical analyses were carried out using Optical Emission Spectrometry and Energy Dispersive Microanalysis (EDS, and the grain size was determined by optical microscopy and scanning electron microscopy (SEM according to ASTM Standard E 1382 97. RESULTS: It was observed that all the implants had a larger grain size than is recommended by the Standard. The presence of delta ferrite was also observed in ten of the twelve implants removed, which according to ASTM Standard F138-92, should not be perceived
White Paper Summary of 2nd ASTM International Workshop on Hydrides in Zirconium Alloy Cladding
Energy Technology Data Exchange (ETDEWEB)
Sindelar, R. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Louthan, M. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); PNNL, B. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)
2015-05-29
This white paper recommends that ASTM International develop standards to address the potential impact of hydrides on the long term performance of irradiated zirconium alloys. The need for such standards was apparent during the 2nd ASTM International Workshop on Hydrides in Zirconium Alloy Cladding and Assembly Components, sponsored by ASTM International Committee C26.13 and held on June 10-12, 2014, in Jackson, Wyoming. The potentially adverse impacts of hydrogen and hydrides on the long term performance of irradiated zirconium-alloy cladding on used fuel were shown to depend on multiple factors such as alloy chemistry and processing, irradiation and post irradiation history, residual and applied stresses and stress states, and the service environment. These factors determine the hydrogen content and hydride morphology in the alloy, which, in turn, influence the response of the alloy to the thermo-mechanical conditions imposed (and anticipated) during storage, transport and disposal of used nuclear fuel. Workshop presentations and discussions showed that although hydrogen/hydride induced degradation of zirconium alloys may be of concern, the potential for occurrence and the extent of anticipated degradation vary throughout the nuclear industry because of the variations in hydrogen content, hydride morphology, alloy chemistry and irradiation conditions. The tools and techniques used to characterize hydrides and hydride morphologies and their impacts on material performance also vary. Such variations make site-to-site comparisons of test results and observations difficult. There is no consensus that a single material or system characteristic (e.g., reactor type, burnup, hydrogen content, end-of life stress, alloy type, drying temperature, etc.) is an effective predictor of material response during long term storage or of performance after long term storage. Multi-variable correlations made for one alloy may not represent the behavior of another alloy exposed to
Baron, Szymon; Ahearne, Eamonn
2017-04-01
An ageing population, increased physical activity and obesity are identified as lifestyle changes that are contributing to the ongoing growth in the use of in-vivo prosthetics for total hip and knee arthroplasty. Cobalt-chromium-molybdenum (Co-Cr-Mo) alloys, due to their mechanical properties and excellent biocompatibility, qualify as a class of materials that meet the stringent functional requirements of these devices. To cost effectively assure the required dimensional and geometric tolerances, manufacturers rely on high-precision machining. However, a comprehensive literature review has shown that there has been limited research into the fundamental mechanisms in mechanical cutting of these alloys. This article reports on the determination of the basic cutting-force coefficients in orthogonal cutting of medical grade Co-Cr-Mo alloy ASTM F1537 over an extended range of cutting speeds ([Formula: see text]) and levels of undeformed chip thickness ([Formula: see text]). A detailed characterisation of the segmented chip morphology over this range is also reported, allowing for an estimation of the shear plane angle and, overall, providing a basis for macro-mechanic modelling of more complex cutting processes. The results are compared with a baseline medical grade titanium alloy, Ti-6Al-4V ASTM F136, and it is shown that the tangential and thrust-force components generated were, respectively, ≈35% and ≈84% higher, depending primarily on undeformed chip thickness but with some influence of the cutting speed.
30 CFR 285.823 - Will MMS reimburse me for my expenses related to inspections?
2010-07-01
... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Will MMS reimburse me for my expenses related... Conducted Under SAPs, COPs and GAPs Inspections and Assessments § 285.823 Will MMS reimburse me for my expenses related to inspections? Upon request, MMS will reimburse you for food, quarters, and...
International Nuclear Information System (INIS)
Apel, W.D.; Augenstein, K.H.; Bertolucci, E.; Donskov, S.V.; Inyakin, A.V.; Kachanov, V.A.; Krasnokutsky, R.N.; Kruger, M.; Leder, G.; Lednev, A.A.; Mannelli, I.; Mikhailov, Yu.V.; Mueller, H.; Pierazzini, G.M.; Prokoshkin, Yu.D.; Quaglia, M.; Schneider, H.; Scribano, A.; Sergiampietri, F.; Shuvalov, R.S.; Sigurdsson, G.; Toropin, A.N.; Vincelli, M.L.
1978-01-01
The invariant mass spectrum of neutral final states produced in π - p charge-exchange scattering at 40 GeV/c has been studied, searching for heavy particles decaying into 2γ. A peak is observed around 2.85 GeV/c 2 . The cross section of the reaction π - p→X(2.85)+n, times the branching ratio of the X→2γ decay, is measured to be sigma X BR approximately =2X10 -34 cm 2 . (Auth.)
Directory of Open Access Journals (Sweden)
Demian J. Kotecki
2010-12-01
Full Text Available Duplex stainless steels (DSS, including super duplex stainless steels {SDSS} have proven to be very useful engineering materials, albeit with somewhat different welding requirements than those of the more familiar austenitic stainless steels. Despite a generally good track record in welding of duplex stainless steels, certain pitfalls have been encountered with enough frequency that they deserve review. Inappropriate base metal specification often leads to unsuitable heat affected zone (HAZ properties. Autogenous fusion zones are also of concern. This issue centers around nitrogen limits. The most frequently encountered is applying the UNS S31803 composition for 2205 DSS, instead of the S32205 composition. Inappropriate welding heat input arises most frequently with SDSS. While 0.5 to 1.5 kJ/mm is a normal heat input recommendation for SDSS, either a root pass or many small beads towards the low end of this heat input range tends to result in precipitation and/or secondary austenite formation in weld metal subjected to repeated thermal cycles from multiple weld passes. Inappropriate PWHT occurs when the enhanced nickel filler metals (typically 9% Ni are used. DSS are not normally given PWHT, but extensive forming of heads, for example, or repair welding of castings, may require a postweld anneal. Specifications such as ASTM A790 and A890 call for annealing at 1040ºC minimum, and the fabricator tends to use temperatures close to that minimum. However, the enhanced nickel filler metals require higher temperatures to dissolve sigma phase that forms during heating to the annealing temperature.Aços inoxidáveis duplex (AID, incluindo os aços super duplex, AISD provaram ser materiais de engenharia muito úteis, embora com requerimentos de soldagem em alguma medida diferentes daqueles dos aços inoxidáveis austeníticos mais usuais. Apesar do histórico geralmente bom dos aços inoxidáveis duplex quanto a soldagem, algumas dificuldades têm sido
An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET
Energy Technology Data Exchange (ETDEWEB)
Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)
2011-01-15
Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.
Marchionna, N. R.; Diehl, L. A.; Trout, A. M.
1973-01-01
Tests were conducted to determine the effect of water injection on oxides of nitrogen (NOx) emissions of a full annular, ram induction gas turbine combustor burning ASTM Jet-A fuel. The combustor was operated at conditions simulating sea-level takeoff and cruise conditions. Water at ambient temperature was injected into the combustor primary zone at water-fuel ratios up to 2. At an inlet-air temperature of 589 K (600 F) water injection decreased the NOx emission index at a constant exponential rate: NOx = NOx (o) e to the -15 W/F power (where W/F is the water-fuel ratio and NOx(o) indicates the value with no injection). The effect of increasing combustor inlet-air temperature was to decrease the effect of the water injection. Other operating variables such as pressure and reference Mach number did not appear to significantly affect the percent reduction in NOx. Smoke emissions were found to decrease with increasing water injection.
Fracture toughness evaluation using small specimens for assuring structural integrity of PRV's
International Nuclear Information System (INIS)
Lee, Bong Sang; Hong, J. H.; Chi, S. H.; Kim, J. H.; Yang, W. J.
1999-08-01
This report summarizes the results obtained from the three year contribution of KAERI to the IAEA-CRP on ''Assuring Structural Integrity of Reactor Pressure Vessels''. The mandatory part of this programme is to perform fracture toughness K jc tests using pre-cracked Charpy specimens on the IAEA reference material JRQ (ASTM A533-B1 steel). The results will be used to validate the small specimens for surveillance tests. In this report, three different heats of reactor pressure vessel materials are characterized by the ASTM E 1921-97 s tandard test method for determination of reference temperature, T o , for ferritic steels in the transition range . The materials are the IAEA reference plate (JRQ), a Japanese forging (JEL), and a Korean forging (KFY5). 6 refs., 7 tabs., 20 figs
Observation and study of centrally produced pion clusters in 28.5-GeV/c p-p interactions
International Nuclear Information System (INIS)
Erwin, A.R.; Harvey, E.H.; Larson, G.P.; Collins, G.B.; Ficenec, J.R.; Stringfellow, B.C.; Trower, W.P.; Gutay, L.J.; Laasanen, A.; Willmann, R.B.; Anderson, E.W.; Fisher, G.P.; Lazuras, E.; von Lindern, L.; Ramanauskas, A.; Schubelin, P.; Thorndike, A.M.; Turkot, F.
1976-01-01
A double-arm spectrometer is used to identify a pion cluster produced in central p-p collisions at 28.5 GeV/c. Cluster properties studied are angular momentum, quantum statistics, multiplicity, and effective mass. There is some speculation on the production mechanism
Model of ASTM Flammability Test in Microgravity: Iron Rods
Steinberg, Theodore A; Stoltzfus, Joel M.; Fries, Joseph (Technical Monitor)
2000-01-01
There is extensive qualitative results from burning metallic materials in a NASA/ASTM flammability test system in normal gravity. However, this data was shown to be inconclusive for applications involving oxygen-enriched atmospheres under microgravity conditions by conducting tests using the 2.2-second Lewis Research Center (LeRC) Drop Tower. Data from neither type of test has been reduced to fundamental kinetic and dynamic systems parameters. This paper reports the initial model analysis for burning iron rods under microgravity conditions using data obtained at the LERC tower and modeling the burning system after ignition. Under the conditions of the test the burning mass regresses up the rod to be detached upon deceleration at the end of the drop. The model describes the burning system as a semi-batch, well-mixed reactor with product accumulation only. This model is consistent with the 2.0-second duration of the test. Transient temperature and pressure measurements are made on the chamber volume. The rod solid-liquid interface melting rate is obtained from film records. The model consists of a set of 17 non-linear, first-order differential equations which are solved using MATLAB. This analysis confirms that a first-order rate, in oxygen concentration, is consistent for the iron-oxygen kinetic reaction. An apparent activation energy of 246.8 kJ/mol is consistent for this model.
Brayda-Bruno, M; Fini, M; Pierini, G; Giavaresi, G; Rocca, M; Giardino, R
2001-01-01
It is known that titanium alloys cause more extensive local metallosis due to fretting corrosion than stainless steel implants. The aim of the present study was to investigate possible systemic metal releases (Ti, Al, V, Cr, Ni) in sheep where L4-L5 were implanted with titanium alloy (Ti6Al4V, ASTM F 136) and stainless steel (AISI 316 L). 16 sheep were used: 8 were implanted with Ti6Al4V and 8 with stainless steel. At 6, 12, 24 and 36 months, the following examinations were performed: histology, atomic absorption spectrophotometry (AAS) and scanning electron microscopy (SEM), on liver, lung, kidney, brain, spleen and lumbo-aortic lymph nodes. Hair, urine and arteria blood samples were also analysed by AAS before implantation and at sacrifices. A histologic and ultrastructural study was performed on peri-implant tissues, too. Particular attention was paid to avoid contamination from dissection instruments or use of containers. In basal and in samples at 6 and 12 months, no metals were found in blood, urine, hair or other target tissues of the animals implanted with either Ti6Al4V or stainless steel. Regarding Al, V, Co and Ni, negative results in all tissues and body fluids were obtained also at 24 and 36 months. On the contrary, Ti traces were found in lumbo-aortic lymph nodes and lungs of one sheep only (10 and 30 ng/g, respectively) at 24 months. At 36 months, a systemic diffusion of Ti was observed in all tissues of both sheep instrumented with Ti6Al4V (2-16.5 ng/g), except for body fluids and hair. Metal research in target tissues by light and SEM micro-probe analysis provided negative results. Current data suggest that the amount of Ti found in organs after stable pedicular fixation is extremely low and not biologically available. This observation would lead us to exclude the hypothesis of any toxic reaction and such a release seems to be due to the passive diffusion through lymphatic fluids. Additional studies are needed to confirm if this long-term release
International Nuclear Information System (INIS)
Sakai, Yuzuru; Ogura, Nobukazu; Takahashi, Isao; Miya, Kenzo; Ando, Yoshio.
1985-01-01
As another parameter for evaluating the toughness of structural materials, there is crack arrest toughness. This is a parameter showing the resistance of materials to stop the cracks rapidly propagating in brittle state within the materials, unlike static and dynamic fracture toughness related to the occurrence of breaking. As the conventional method of determining the crack arrest toughness, the relatively large testing method such as double tensile test and ESSO test have been known, but the establishment of a smaller convenient testing method is desired. In this study, the evaluation of the crack arrest toughness of the very thick steel materials produced in Japan was carried out by the testing method using small test pieces. In order to make test pieces small, tapered type DCB test and the three-point bending test using DWTT test pieces were examined as well as the testing method recommended by ASTM. The test materials were A 533B, Cl. 1 and A 508, Cl. 3. The test pieces, the various testing methods and the experimental results are reported. The temperature dependence of the crack arrest toughness was shown. (Kako, I.)
Evaluation of elastic-plastic fracture of toughness and fracture resistance of carbon steel STS42
International Nuclear Information System (INIS)
Kobayashi, Hideo; Nakamura, Haruo; Kashiwagi, Kohmei
1987-01-01
The elastic-plastic fracture toughness (J Ic ) and fracture resistance (J-R curve) of a carbon steel, STS42, used for piping in a nuclear reactor were evaluated according to the several evaluating methods recommended or proposed so far, to discuss their applicability and utility. The results obtained are as follows: (1) In evaluating J Ic , the multiple specimen method recommended by the Japan Society for Mechanical Engineers (JSME standard S001) gives the most reliable results by using smaller sized specimens. (2) The single-specimen methods by using the compliance technique, adopted in the ASTM standards (E813, E813 modified, Tentative test procedure for determining the plain strain J-R curve), do not give an accurate J-R curve or J Ic , due to an error in the calculated crack length. (3) In evaluating the J-R curve, it is necessary to account for crack extension in calculating the J-integral. (4) According to the above results, a new standard method for determining the J-R curve including the J Ic test method should be poprosed. (author)
The Symposium on Developing Consensus Standards for Measuring Chemical Emissions from Spray Polyurethane Foam (SPF) Insulation was held on April 30th and May 1, 2015. Sponsored by ASTM Committee D22 on Air Quality, the symposium was held in Anaheim, CA, in conjunction with the st...
International Nuclear Information System (INIS)
Mejia; I; Maldonado, C; Bedolla, A; Velez, M; Medina, A; Bejar, L
2006-01-01
AISI H-13 steel is considered to be a highly ultra resistant steel because its resistance to stress surpasses 1380 MPa. This steel is widely used in tools that heavily used, especially under high temperatures, such as: awls, molds for pressing, extrusion dies, extrusion tools from heat impact, tools for producing screws, bolts, rivets and taps, molds for centrifugal smelting, tools for presses with shaped pieces, knives for hot cutting, among others. The weldability of AISI H-13 steel is generally poor, but it is possible if the proper precautions are taken. Cracking is perhaps the factor that most limits the weldability of AISI H-13 steel. The tendency to crack during welding for this type of steel occurs in the base metal and the zone close to the supporting material (cold cracking). The interlayer covering technique is used in the repair, welding and recovery of pieces of high alloy steels in order to avoid cracking and to lower the residual stresses generated by obstructed contraction and martensitic transformation. This work defined the type, magnitude and direction of residual stresses at different distances starting from the center of the welded union on the 25.4 mm thick AISI H-13 steel sheet. The welding was carried out in a test piece with Y-Groove geometry following JIS Z 3158 standard, using the SMAW process and an AISI 312 stainless steel interlayer between the base metal and the supporting metal. The hole-drilling method was used to measure the type, magnitude and direction of residual stresses using extensometric gauge rosette CEA-06-062UM-120 and CEA-06-062RE-120 following the guidelines established by ASTM E 837 standard. Based on the relaxed deformations that were measured, the type, magnitude and direction of residual stresses were determined with the H-DRILL residual stress program for biaxial condition. The results indicate that under these welding conditions the residual strains at different distances from the welded union are from stress and
2010-10-01
... 42 Public Health 1 2010-10-01 2010-10-01 false Are Self-Governance Tribes required to accept..., DEPARTMENT OF HEALTH AND HUMAN SERVICES TRIBAL SELF-GOVERNANCE Construction Nepa Process § 137.285 Are Self-Governance Tribes required to accept Federal environmental responsibilities to enter into a construction...
Energy Technology Data Exchange (ETDEWEB)
Choi, So Young; Kim, Jong Do [Korea Maritime and Ocean University, Busan (Korea, Republic of); Kim, Jong Su [Korea Institute of Machinery and Materials, Daejeon (Korea, Republic of)
2015-01-15
This study was conducted to compare the laser weldability of boron steel and hot-stamped steel. In general, boron steel is used in the hot-stamping process. Hot-stamping is a method for simultaneously forming and cooling boron steel in a press die after heating it to the austenitizing temperature. Hot-stamped steel has a strength of 1500 MPa or more. Thus, in this study, the laser weldability of boron steel and that of hot-stamped steel were investigated and compared. A continuous wave disk laser was used to produce butt and lap joints. In the butt welding, the critical cooling speed at which full penetration was obtained in the hot-stamped steel was lower than that of boron steel. In the lap welding, the joint widths were similar regardless of the welding speed when full penetration was obtained.
International Nuclear Information System (INIS)
Choi, So Young; Kim, Jong Do; Kim, Jong Su
2015-01-01
This study was conducted to compare the laser weldability of boron steel and hot-stamped steel. In general, boron steel is used in the hot-stamping process. Hot-stamping is a method for simultaneously forming and cooling boron steel in a press die after heating it to the austenitizing temperature. Hot-stamped steel has a strength of 1500 MPa or more. Thus, in this study, the laser weldability of boron steel and that of hot-stamped steel were investigated and compared. A continuous wave disk laser was used to produce butt and lap joints. In the butt welding, the critical cooling speed at which full penetration was obtained in the hot-stamped steel was lower than that of boron steel. In the lap welding, the joint widths were similar regardless of the welding speed when full penetration was obtained