Band structures and localization properties of aperiodic layered phononic crystals

Energy Technology Data Exchange (ETDEWEB)

Yan Zhizhong, E-mail: zzyan@bit.edu.cn [Department of Applied Mathematics, Beijing Institute of Technology, Beijing 100081 (China); Zhang Chuanzeng [Department of Civil Engineering, University of Siegen, D-57078 Siegen (Germany)

2012-03-15

The band structures and localization properties of in-plane elastic waves with coupling of longitudinal and transverse modes oblique propagating in aperiodic phononic crystals based on Thue-Morse and Rudin-Shapiro sequences are studied. Using transfer matrix method, the concept of the localization factor is introduced and the correctness is testified through the Rytov dispersion relation. For comparison, the perfect periodic structure and the quasi-periodic Fibonacci system are also considered. In addition, the influences of the random disorder, local resonance, translational and/or mirror symmetries on the band structures of the aperiodic phononic crystals are analyzed in this paper.

Structural color of a lycaenid butterfly: analysis of an aperiodic multilayer structure

International Nuclear Information System (INIS)

Yoshioka, S; Shimizu, Y; Kinoshita, S; Matsuhana, B

2013-01-01

We investigated the structural color of the green wing of the lycaenid butterfly Chrysozephyrus brillantinus. Electron microscopy revealed that the bottom plate of the cover scale on the wing consists of an alternating air–cuticle multilayer structure. However, the thicknesses of the layers were not constant but greatly differed depending on the layer, unlike the periodic multilayer designs often adopted for artificial laser-reflecting mirrors. The agreement between the experimentally determined and theoretically calculated reflectance spectra led us to conclude that the multilayer interference in the aperiodic system is the primary origin of the structural color. We analyzed optical interference in this aperiodic system using a simple analytical model and found that two spectral peaks arise from constructive interference among different parts of the multilayer structure. We discuss the advantages and disadvantages of the aperiodic system over a periodic one. (paper)

The WFCAM multiwavelength Variable Star Catalog

Science.gov (United States)

Ferreira Lopes, C. E.; Dékány, I.; Catelan, M.; Cross, N. J. G.; Angeloni, R.; Leão, I. C.; De Medeiros, J. R.

2015-01-01

Context. Stellar variability in the near-infrared (NIR) remains largely unexplored. The exploitation of public science archives with data-mining methods offers a perspective for a time-domain exploration of the NIR sky. Aims: We perform a comprehensive search for stellar variability using the optical-NIR multiband photometric data in the public Calibration Database of the WFCAM Science Archive (WSA), with the aim of contributing to the general census of variable stars and of extending the current scarce inventory of accurate NIR light curves for a number of variable star classes. Methods: Standard data-mining methods were applied to extract and fine-tune time-series data from the WSA. We introduced new variability indices designed for multiband data with correlated sampling, and applied them for preselecting variable star candidates, i.e., light curves that are dominated by correlated variations, from noise-dominated ones. Preselection criteria were established by robust numerical tests for evaluating the response of variability indices to the colored noise characteristic of the data. We performed a period search using the string-length minimization method on an initial catalog of 6551 variable star candidates preselected by variability indices. Further frequency analysis was performed on positive candidates using three additional methods in combination, in order to cope with aliasing. Results: We find 275 periodic variable stars and an additional 44 objects with suspected variability with uncertain periods or apparently aperiodic variation. Only 44 of these objects had been previously known, including 11 RR Lyrae stars on the outskirts of the globular cluster M 3 (NGC 5272). We provide a preliminary classification of the new variable stars that have well-measured light curves, but the variability types of a large number of objects remain ambiguous. We classify most of the new variables as contact binary stars, but we also find several pulsating stars, among which

Aperiodicity Correction for Rotor Tip Vortex Measurements

Science.gov (United States)

Ramasamy, Manikandan; Paetzel, Ryan; Bhagwat, Mahendra J.

2011-01-01

The initial roll-up of a tip vortex trailing from a model-scale, hovering rotor was measured using particle image velocimetry. The unique feature of the measurements was that a microscope was attached to the camera to allow much higher spatial resolution than hitherto possible. This also posed some unique challenges. In particular, the existing methodologies to correct for aperiodicity in the tip vortex locations could not be easily extended to the present measurements. The difficulty stemmed from the inability to accurately determine the vortex center, which is a prerequisite for the correction procedure. A new method is proposed for determining the vortex center, as well as the vortex core properties, using a least-squares fit approach. This approach has the obvious advantage that the properties are derived from not just a few points near the vortex core, but from a much larger area of flow measurements. Results clearly demonstrate the advantage in the form of reduced variation in the estimated core properties, and also the self-consistent results obtained using three different aperiodicity correction methods.

Improving emission uniformity and linearizing band dispersion in nanowire arrays using quasi-aperiodicity

Energy Technology Data Exchange (ETDEWEB)

Anderson, P. Duke [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States); Univ. of Southern California, Los Angeles, CA (United States). Ming Hsieh Dept. of Electrical Engineering; Koleske, Daniel D. [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States); Povinelli, Michelle L. [Univ. of Southern California, Los Angeles, CA (United States). Ming Hsieh Dept. of Electrical Engineering; Subramania, Ganapathi [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States)

2017-10-01

For this study, we experimentally investigate a new class of quasi-aperiodic structures for improving the emission pattern in nanowire arrays. Efficient normal emission, as well as lasing, can be obtained from III-nitride photonic crystal (PhC) nanowire arrays that utilize slow group velocity modes near the Γ-point in reciprocal space. However, due to symmetry considerations, the emitted far-field pattern of such modes are often ‘donut’-like. Many applications, including lighting for displays or lasers, require a more uniform beam profile in the far-field. Previous work has improved far-field beam uniformity of uncoupled modes by changing the shape of the emitting structure. However, in nanowire systems, the shape of nanowires cannot always be arbitrarily changed due to growth or etch considerations. Here, we investigate breaking symmetry by instead changing the position of emitters. Using a quasi-aperiodic geometry, which changes the emitter position within a photonic crystal supercell (2x2), we are able to linearize the photonic bandstructure near the Γ-point and greatly improve emitted far-field uniformity. We realize the III-nitride nanowires structures using a top-down fabrication procedure that produces nanowires with smooth, vertical sidewalls. Comparison of room-temperature micro-photoluminescence (µ-PL) measurements between periodic and quasi-aperiodic nanowire arrays reveal resonances in each structure, with the simple periodic structure producing a donut beam in the emitted far-field and the quasi-aperiodic structure producing a uniform Gaussian-like beam. We investigate the input pump power vs. output intensity in both systems and observe the simple periodic array exhibiting a non-linear relationship, indicative of lasing. We believe that the quasi-aperiodic approach studied here provides an alternate and promising strategy for shaping the emission pattern of nanoemitter systems.

An aperiodic phenomenon of the unscented Kalman filter in filtering noisy chaotic signals

Institute of Scientific and Technical Information of China (English)

无

2007-01-01

A non-periodic oscillatory behavior of the unscented Kalman filter (UKF) when used to filter noisy contaminated chaotic signals is reported. We show both theoretically and experimentally that the gain of the UKF may not converge or diverge but oscillate aperiodically. More precisely, when a nonlinear system is periodic, the Kalman gain and error covariance of the UKF converge to zero. However, when the system being considered is chaotic, the Kalman gain either converges to a fixed point with a magnitude larger than zero or oscillates aperiodically.

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

Science.gov (United States)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

Intrinsic periodic and aperiodic stochastic resonance in an electrochemical cell

Science.gov (United States)

Tiwari, Ishant; Phogat, Richa; Parmananda, P.; Ocampo-Espindola, J. L.; Rivera, M.

2016-08-01

In this paper we show the interaction of a composite of a periodic or aperiodic signal and intrinsic electrochemical noise with the nonlinear dynamics of an electrochemical cell configured to study the corrosion of iron in an acidic media. The anodic voltage setpoint (V0) in the cell is chosen such that the anodic current (I ) exhibits excitable fixed point behavior in the absence of noise. The subthreshold periodic (aperiodic) signal consists of a train of rectangular pulses with a fixed amplitude and width, separated by regular (irregular) time intervals. The irregular time intervals chosen are of deterministic and stochastic origins. The amplitude of the intrinsic internal noise, regulated by the concentration of chloride ions, is then monotonically increased, and the provoked dynamics are analyzed. The signal to noise ratio and the cross-correlation coefficient versus the chloride ions' concentration curves have a unimodal shape indicating the emergence of an intrinsic periodic or aperiodic stochastic resonance. The abscissa for the maxima of these unimodal curves correspond to the optimum value of intrinsic noise where maximum regularity of the invoked dynamics is observed. In the particular case of the intrinsic periodic stochastic resonance, the scanning electron microscope images for the electrode metal surfaces are shown for certain values of chloride ions' concentrations. These images, qualitatively, corroborate the emergence of order as a result of the interaction between the nonlinear dynamics and the composite signal.

Simulation of photonic waveguides with deterministic aperiodic nanostructures for biosensing

DEFF Research Database (Denmark)

Neustock, Lars Thorben; Paulsen, Moritz; Jahns, Sabrina

2016-01-01

Photonic waveguides with deterministic aperiodic corrugations offer rich spectral characteristics under surface-normal illumination. The finite-element method (FEM), the finite-difference time-domain (FDTD) method and a rigorous coupled wave algorithm (RCWA) are compared for computing the near...

Outer synchronization of complex networks with internal delay and coupling delay via aperiodically intermittent pinning control

Science.gov (United States)

Zhang, Chuan; Wang, Xingyuan; Wang, Chunpeng; Xia, Zhiqiu

This paper concerns the outer synchronization problem between two complex delayed networks via the method of aperiodically intermittent pinning control. Apart from previous works, internal delay and coupling delay are both involved in this model, and the designed intermittent controllers can be aperiodic. The main work in this paper can be summarized as follows: First, two cases of aperiodically intermittent control with constant gain and adaptive gain are implemented, respectively. The intermittent control and pinning control are combined to reduce consumptions further. Then, based on the Lyapunov stability theory, synchronization protocols are given by strict derivation. Especially, the designed controllers are indeed simple and valid in application of theory to practice. Finally, numerical examples put the proposed control methods to the test.

Non-commutative Chern numbers for generic aperiodic discrete systems

Science.gov (United States)

Bourne, Chris; Prodan, Emil

2018-06-01

The search for strong topological phases in generic aperiodic materials and meta-materials is now vigorously pursued by the condensed matter physics community. In this work, we first introduce the concept of patterned resonators as a unifying theoretical framework for topological electronic, photonic, phononic etc (aperiodic) systems. We then discuss, in physical terms, the philosophy behind an operator theoretic analysis used to systematize such systems. A model calculation of the Hall conductance of a 2-dimensional amorphous lattice is given, where we present numerical evidence of its quantization in the mobility gap regime. Motivated by such facts, we then present the main result of our work, which is the extension of the Chern number formulas to Hamiltonians associated to lattices without a canonical labeling of the sites, together with index theorems that assure the quantization and stability of these Chern numbers in the mobility gap regime. Our results cover a broad range of applications, in particular, those involving quasi-crystalline, amorphous as well as synthetic (i.e. algorithmically generated) lattices.

STAR facility tritium accountancy

International Nuclear Information System (INIS)

Pawelko, R. J.; Sharpe, J. P.; Denny, B. J.

2008-01-01

The Safety and Tritium Applied Research (STAR) facility has been established to provide a laboratory infrastructure for the fusion community to study tritium science associated with the development of safe fusion energy and other technologies. STAR is a radiological facility with an administrative total tritium inventory limit of 1.5 g (14,429 Ci) [1]. Research studies with moderate tritium quantities and various radionuclides are performed in STAR. Successful operation of the STAR facility requires the ability to receive, inventory, store, dispense tritium to experiments, and to dispose of tritiated waste while accurately monitoring the tritium inventory in the facility. This paper describes tritium accountancy in the STAR facility. A primary accountancy instrument is the tritium Storage and Assay System (SAS): a system designed to receive, assay, store, and dispense tritium to experiments. Presented are the methods used to calibrate and operate the SAS. Accountancy processes utilizing the Tritium Cleanup System (TCS), and the Stack Tritium Monitoring System (STMS) are also discussed. Also presented are the equations used to quantify the amount of tritium being received into the facility, transferred to experiments, and removed from the facility. Finally, the STAR tritium accountability database is discussed. (authors)

Topological aperiodicity for product systems over semigroups of Ore type

DEFF Research Database (Denmark)

Kwasniewski, Bartosz; Szymanski, Wojciech

2016-01-01

aperiodicity condition on the latter, we obtain the uniqueness theorem and a simplicity criterion for the algebras in question. These results generalize the corresponding ones for crossed products by discrete groups, due to Archbold and Spielberg, and for Exel's crossed products, due to Exel and Vershik...

Aperiodic spin state ordering of bistable molecules and its photoinducede erasing

Czech Academy of Sciences Publication Activity Database

Collet, E.; Watanabe, H.; Bréfuel, N.; Palatinus, Lukáš; Roudaut, L.; Toupet, L.; Tanaka, K.; Tuchagues, J.-P.; Fertey, P.; Ravy, S.; Toudic, B.; Cailleau, H.

2012-01-01

Roč. 109, č. 25 (2012), "257206-1"-"257206-5" ISSN 0031-9007 Institutional research plan: CEZ:AV0Z10100521 Keywords : photocrystallography * aperiodic structure * spin-state ordering Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 7.943, year: 2012

Diffuse scattering from periodic and aperiodic crystals

International Nuclear Information System (INIS)

Frey, F.

1997-01-01

A (selective) review on diffuse scattering from periodic and aperiodic crystalline solids is given to demonstrate the wide field of applications in basic and applied research. After a general introduction in this field each topic is exemplified by one or two examples. Main emphasis is laid on recent work. More established work, e.g., on diffuse scattering from metals and alloys, polytypes, stacking disorder from layered structures, etc. is omitted due to the availability of excellent textbooks and reviews. Finally a short summary of recent developments of experimental methods and evaluation techniques is presented. (orig.)

Near-to far-field transformation in the aperiodic Fourier modal method

NARCIS (Netherlands)

Rook, R.; Pisarenco, M.; Setija, I.D.

2013-01-01

This paper addresses the task of obtaining the far-field spectrum for a finite structure given the near-field calculated by the aperiodic Fourier modal method in contrast-field formulation (AFMM-CFF). The AFMM-CFF efficiently calculates the solution to Maxwell's equations for a finite structure by

Aperiodic signals processing via parameter-tuning stochastic resonance in a photorefractive ring cavity

Directory of Open Access Journals (Sweden)

Xuefeng Li

2014-04-01

Full Text Available Based on solving numerically the generalized nonlinear Langevin equation describing the nonlinear dynamics of stochastic resonance by Fourth-order Runge-Kutta method, an aperiodic stochastic resonance based on an optical bistable system is numerically investigated. The numerical results show that a parameter-tuning stochastic resonance system can be realized by choosing the appropriate optical bistable parameters, which performs well in reconstructing aperiodic signals from a very high level of noise background. The influences of optical bistable parameters on the stochastic resonance effect are numerically analyzed via cross-correlation, and a maximum cross-correlation gain of 8 is obtained by optimizing optical bistable parameters. This provides a prospective method for reconstructing noise-hidden weak signals in all-optical signal processing systems.

Wide-Area Assessment of Aperiodic Small Signal Rotor Angle Stability in Real-Time

DEFF Research Database (Denmark)

Jóhannsson, Hjörtur; Nielsen, Arne Hejde; Østergaard, Jacob

2013-01-01

This paper presents the details of a new real-time stability assessment method. The method assesses a particular mechanism of stability: each generator’s capability to generate sufficient steady state electromechanical torque. The lack of sufficient steady state torque causes aperiodic increase...... of multiple operating points is derived in the paper. Finally, results from time-domain simulation of instability scenarios in the Nordic32 test system are presented and results used for testing the assessment method. The results illustrate the method’s capability to efficiently identify the location...... in rotor angle and a loss of synchronism, referred to as aperiodic small signal instability. The paper provides the theoretical background of the method and an analytical assessment criterion. Furthermore, a mathematical mapping of the generators’ operating points that enables informative visualization...

Synchronization of coupled stochastic complex-valued dynamical networks with time-varying delays via aperiodically intermittent adaptive control

Science.gov (United States)

Wang, Pengfei; Jin, Wei; Su, Huan

2018-04-01

This paper deals with the synchronization problem of a class of coupled stochastic complex-valued drive-response networks with time-varying delays via aperiodically intermittent adaptive control. Different from the previous works, the intermittent control is aperiodic and adaptive, and the restrictions on the control width and time delay are removed, which lead to a larger application scope for this control strategy. Then, based on the Lyapunov method and Kirchhoff's Matrix Tree Theorem as well as differential inequality techniques, several novel synchronization conditions are derived for the considered model. Specially, impulsive control is also considered, which can be seen as a special case of the aperiodically intermittent control when the control width tends to zero. And the corresponding synchronization criteria are given as well. As an application of the theoretical results, a class of stochastic complex-valued coupled oscillators with time-varying delays is studied, and the numerical simulations are also given to demonstrate the effectiveness of the control strategies.

Joint Optimization of Star P-hub Median Problem and Seat Inventory Control Decisions Considering a Hybrid Routing Transportation System

Directory of Open Access Journals (Sweden)

Hamid Tikani

2016-11-01

Full Text Available In this paper, we study the problem of integrated capacitated hub location problem and seat inventory control considering concept and techniques of revenue management. We consider an airline company maximizes its revenue by utilizing the best network topology and providing proper booking limits for all itineraries and fare classes. The transportation system arises in the form of a star/star network and includes both hub-stop and non-stop flights. This problem is formulated as a two-stage stochastic integer program with mixed-integer recourse. We solve various instances carried out from the Turkish network data set. Due to the NP-hardness of the problem, we propose a hybrid optimization method, consisting of an evolutionary algorithm based on genetic algorithm and exact solution. The quality of the solutions found by the proposed meta-heuristic is compared with the original version of GA and the mathematical programming model. The results obtained by the proposed model imply that integrating hub location and seat inventory control problem would help to increase the total revenue of airline companies. Also, in the case of serving non-stop flights, the model can provide more profit by employing less number of hubs.

Analysis of Nonlinear Periodic and Aperiodic Media: Application to Optical Logic Gates

Science.gov (United States)

Yu, Yisheng

This dissertation is about the analysis of nonlinear periodic and aperiodic media and their application to the design of intensity controlled all optical logic gates: AND, OR, and NOT. A coupled nonlinear differential equation that characterizes the electromagnetic wave propagation in a nonlinear periodic (and aperiodic) medium has been derived from the first principle. The equations are general enough that it reflects the effect of transverse modal fields and can be used to analyze both co-propagating and counter propagating waves. A numerical technique based on the finite differences method and absorbing boundary condition has been developed to solve the coupled differential equations here. The numerical method is simple and accurate. Unlike the method based on characteristics that has been reported in the literature, this method does not involve integration and step sizes of time and space coordinates are decoupled. The decoupling provides independent choice for time and space step sizes. The concept of "gap soliton" has also been re-examined. The dissertation consists of four manuscripts. Manuscript I reports on the design of all optical logic gates: AND, OR, and NOT based on the bistability property of nonlinear periodic and aperiodic waveguiding structures. The functioning of the logic gates has been shown by analysis. The numerical technique that has been developed to solve the nonlinear differential equations are addressed in manuscript II. The effect of transverse modal fields on the bistable property of nonlinear periodic medium is reported in manuscript III. The concept of "gap soliton" that are generated in a nonlinear periodic medium has been re-examined. The details on the finding of the re-examination are discussed in manuscript IV.

Periodic and aperiodic flow patterns around an airfoil with leading-edge protuberances

Science.gov (United States)

Cai, Chang; Zuo, Zhigang; Maeda, Takao; Kamada, Yasunari; Li, Qing'an; Shimamoto, Kensei; Liu, Shuhong

2017-11-01

Recently leading-edge protuberances have attracted great attention as a passive method for separation control. In this paper, the effect of multiple leading-edge protuberances on the performance of a two-dimensional airfoil is investigated through experimental measurement of aerodynamic forces, surface tuft visualization, and numerical simulation. In contrast to the sharp stall of the baseline airfoil with large hysteresis effect during AOA (angle of attack) increasing and decreasing, the stall process of the modified airfoil with leading-edge protuberances is gentle and stable. Flow visualization revealed that the flow past each protuberance is periodic and symmetric at small AOAs. Streamwise vortices are generated on the shoulders of the protuberance, leading to a larger separation around the valley sections and a longer attachment along the peak sections. When some critical AOA is exceeded, aperiodic and asymmetric flow patterns occur on the protuberances at different spanwise positions, with leading-edge separation on some of the valley sections and non-stalled condition elsewhere. A combined mechanism, involving both the compartmentalization effect of the slender momentum-enhanced attached flows on the protuberance peaks and the downwash effect of the local stalled region with low circulation, is proposed to explain the generation of the aperiodic flow patterns. The influence of the number of protuberances is also investigated, which shows similar aperiodic flow patterns. The distance between the neighboring local stalled valley sections is found to be in the range of 4-7 times the protuberance wavelength. According to the proposed mechanism, it is speculated that the distance between the neighboring local stalled valley sections is inclined to increase with a smaller protuberance amplitude or at a larger AOA.

Wide-Area Assessment of Aperiodic Small Signal Rotor Angle Stability in Real-Time

DEFF Research Database (Denmark)

Jóhannsson, Hjörtur; Nielsen, Arne Hejde; Østergaard, Jacob

2014-01-01

in rotor angle and a loss of synchronism, referred to as aperiodic small signal instability. The paper provides the theoretical background of the method and an analytical assessment criterion. Furthermore, a mathematical mapping of the generators' operating points that enables informative visualization...

Wide Area Prosumption Control and Sensitivities of Aperiodic Small Signal Stability Indicators

DEFF Research Database (Denmark)

Wittrock, Martin Lindholm; Jóhannsson, Hjörtur; Nielsen, Arne Hejde

2014-01-01

and patterns, stability indicators for aperiodic small signal angular stability (ASSA) are examined, while the concept of prosumption is described. The methodology presented is shown to be able to assess the margin to instability and to predict how this margin can be affected if a load is changed in the grid...

Combinations of response-reinforcer relations in periodic and aperiodic schedules.

Science.gov (United States)

Kuroda, Toshikazu; Cançado, Carlos R X; Lattal, Kennon A; Elcoro, Mirari; Dickson, Chata A; Cook, James E

2013-03-01

Key pecking of 4 pigeons was studied under a two-component multiple schedule in which food deliveries were arranged according to a fixed and a variable interfood interval. The percentage of response-dependent food in each component was varied, first in ascending (0, 10, 30, 70 and 100%) and then in descending orders, in successive conditions. The change in response rates was positively related to the percentage of response-dependent food in each schedule component. Across conditions, positively accelerated and linear patterns of responding occurred consistently in the fixed and variable components, respectively. These results suggest that the response-food dependency determines response rates in periodic and aperiodic schedules, and that the temporal distribution of food determines response patterns independently of the response-food dependency. Running rates, but not postfood pauses, also were positively related to the percentage of dependent food in each condition, in both fixed and variable components. Thus, the relation between overall response rate and the percentage of dependent food was mediated by responding that occurred after postfood pausing. The findings together extend previous studies wherein the dependency was either always present or absent, and increase the generality of the effects of variations in the response-food dependency from aperiodic to periodic schedules. © Society for the Experimental Analysis of Behavior.

Short-term variability and mass loss in Be stars. II. Physical taxonomy of photometric variability observed by the Kepler spacecraft

Science.gov (United States)

Rivinius, Th.; Baade, D.; Carciofi, A. C.

2016-09-01

Context. Classical Be stars have been established as pulsating stars. Space-based photometric monitoring missions contributed significantly to that result. However, whether Be stars are just rapidly rotating SPB or β Cep stars, or whether they have to be understood differently, remains debated in the view of their highly complex power spectra. Aims: Kepler data of three known Be stars are re-visited to establish their pulsational nature and assess the properties of additional, non-pulsational variations. The three program stars turned out to be one inactive Be star, one active, continuously outbursting Be star, and one Be star transiting from a non-outbursting into an outbursting phase, thus forming an excellent sample to distill properties of Be stars in the various phases of their life-cycle. Methods: The Kepler data was first cleaned from any long-term variability with Lomb-Scargle based pre-whitening. Then a Lomb-Scargle analysis of the remaining short-term variations was compared to a wavelet analysis of the cleaned data. This offers a new view on the variability, as it enables us to see the temporal evolution of the variability and phase relations between supposed beating phenomena, which are typically not visualized in a Lomb-Scargle analysis. Results: The short-term photometric variability of Be stars must be disentangled into a stellar and a circumstellar part. The stellar part is on the whole not different from what is seen in non-Be stars. However, some of the observed phenomena might be to be due to resonant mode coupling, a mechanism not typically considered for B-type stars. Short-term circumstellar variability comes in the form of either a group of relatively well-defined, short-lived frequencies during outbursts, which are called Štefl frequencies, and broad bumps in the power spectra, indicating aperiodic variability on a time scale similar to typical low-order g-mode pulsation frequencies, rather than true periodicity. Conclusions: From a

Investigation of aperiodic W/C multi-layer mirror for X-ray optics

International Nuclear Information System (INIS)

Wang Zhanshan; Cheng Xinbin; Zhu Jingtao; Huang Qiushi; Zhang Zhong; Chen Lingyan

2011-01-01

Design, fabrication and characterization of aperiodic tungsten/carbon (W/C) multi-layer mirror were studied. W/C multi-layer was designed as a broad-angle reflective supermirror for Cu-Kα line (λ = 0.154 nm) in the grazing incident angular range (0.9-1.1 deg.) using simulated annealing algorithm. To deposit the W/C depth-graded multi-layer mirror accurately, we introduce an effective layer growth rate as a function of layer thickness. This method greatly improves the reflectivity curve compared to the conventional multi-layer mirror prepared with constant growth rate. The deposited multi-layer mirror exhibits an average reflectivity of 19% over the grazing incident angle range of 0.88-1.08 deg. which mainly coincides with the designed value. Furthermore, the physical mechanisms were discussed and the re-sputtering process of light-atom layers is accounted for the modification of layer thicknesses which leads to the effective growth rates. Using this calibration method, the aperiodic multi-layer mirrors can be better fabricated for X-ray optics.

Elastic wave localization in two-dimensional phononic crystals with one-dimensional random disorder and aperiodicity

International Nuclear Information System (INIS)

Yan Zhizhong; Zhang Chuanzeng; Wang Yuesheng

2011-01-01

The band structures of in-plane elastic waves propagating in two-dimensional phononic crystals with one-dimensional random disorder and aperiodicity are analyzed in this paper. The localization of wave propagation is discussed by introducing the concept of the localization factor, which is calculated by the plane-wave-based transfer-matrix method. By treating the random disorder and aperiodicity as the deviation from the periodicity in a special way, three kinds of aperiodic phononic crystals that have normally distributed random disorder, Thue-Morse and Rudin-Shapiro sequence in one direction and translational symmetry in the other direction are considered and the band structures are characterized using localization factors. Besides, as a special case, we analyze the band gap properties of a periodic planar layered composite containing a periodic array of square inclusions. The transmission coefficients based on eigen-mode matching theory are also calculated and the results show the same behaviors as the localization factor does. In the case of random disorders, the localization degree of the normally distributed random disorder is larger than that of the uniformly distributed random disorder although the eigenstates are both localized no matter what types of random disorders, whereas, for the case of Thue-Morse and Rudin-Shapiro structures, the band structures of Thue-Morse sequence exhibit similarities with the quasi-periodic (Fibonacci) sequence not present in the results of the Rudin-Shapiro sequence.

Shape control in wafer-based aperiodic 3D nanostructures

International Nuclear Information System (INIS)

Jeong, Hyeon-Ho; Mark, Andrew G; Gibbs, John G; Fischer, Peer; Reindl, Thomas; Waizmann, Ulrike; Weis, Jürgen

2014-01-01

Controlled local fabrication of three-dimensional (3D) nanostructures is important to explore and enhance the function of single nanodevices, but is experimentally challenging. We present a scheme based on e-beam lithography (EBL) written seeds, and glancing angle deposition (GLAD) grown structures to create nanoscale objects with defined shapes but in aperiodic arrangements. By using a continuous sacrificial corral surrounding the features of interest we grow isolated 3D nanostructures that have complex cross-sections and sidewall morphology that are surrounded by zones of clean substrate. (papers)

Storage and Assay of Tritium in STAR

International Nuclear Information System (INIS)

Longhurst, Glen R.; Anderl, Robert A.; Pawelko, Robert J.; Stoots, Carl J.

2005-01-01

The Safety and Tritium Applied Research (STAR) facility at the Idaho National Engineering and Environmental Laboratory (INEEL) is currently being commissioned to investigate tritium-related safety questions for fusion and other technologies. The tritium inventory for the STAR facility will be maintained below 1.5 g to avoid the need for STAR to be classified as a Category 3 nuclear facility. A key capability in successful operation of the STAR facility is the ability to receive, inventory, and dispense tritium to the various experiments underway there. The system central to that function is the Tritium Storage and Assay System (SAS).The SAS has four major functions: (1) receiving and holding tritium, (2) assaying, (3) dispensing, and (4) purifying hydrogen isotopes from non-hydrogen species.This paper describes the design and operation of the STAR SAS and the procedures used for tritium accountancy in the STAR facility

Characteristics of aperiodic sequence of slip events caused by interaction between seismic patches and that caused be self-organized stress heterogeneity

Science.gov (United States)

Kato, N.

2017-12-01

Numerical simulations of earthquake cycles are conducted to investigate the origin of complexity of earthquake recurrence. There are two main causes of the complexity. One is self-organized stress heterogeneity due to dynamical effect. The other is the effect of interaction between some fault patches. In the model, friction on the fault is assumed to obey a rate- and state-dependent friction law. Circular patches of velocity-weakening frictional property are assumed on the fault. On the remaining areas of the fault, velocity-strengthening friction is assumed. We consider three models: Single patch model, two-patch model, and three-patch model. In the first model, the dynamical effect is mainly examined. The latter two models take into consideration the effect of interaction as well as the dynamical effect. Complex multiperiodic or aperiodic sequences of slip events occur when slip behavior changes from the seismic to aseismic, and when the degree of interaction between seismic patches is intermediate. The former is observed in all the models, and the latter is observed in the two-patch model and the three-patch model. Evolution of spatial distribution of shear stress on the fault suggests that aperiodicity at the transition from seismic to aseismic slip is caused by self-organized stress heterogeneity. The iteration maps of recurrence intervals of slip events in aperiodic sequences are examined, and they are approximately expressed by simple curves for aperiodicity at the transition from seismic to aseismic slip. In contrast, the iteration maps for aperiodic sequences caused by interaction between seismic patches are scattered and they are not expressed by simple curves. This result suggests that complex sequences caused by different mechanisms may be distinguished.

DISK-RELATED BURSTS AND FADES IN YOUNG STARS

International Nuclear Information System (INIS)

Findeisen, Krzysztof; Hillenbrand, Lynne; Levitan, David; Sesar, Branimir; Ofek, Eran; Laher, Russ; Surace, Jason

2013-01-01

We present first results from a new, multiyear, time domain survey of young stars in the North America Nebula complex using the Palomar Transient Factory. Our survey is providing an unprecedented view of aperiodic variability in young stars on timescales of days to years. The analyzed sample covers R PTF ≈ 13.5-18 and spans a range of mid-infrared color, with larger-amplitude optical variables (exceeding 0.4 mag root mean squared) more likely to have mid-infrared evidence for circumstellar material. This paper characterizes infrared excess stars with distinct bursts above or fades below a baseline of lower-level variability, identifying 41 examples. The light curves exhibit a remarkable diversity of amplitudes, timescales, and morphologies, with a continuum of behaviors that cannot be classified into distinct groups. Among the bursters, we identify three particularly promising sources that may represent theoretically predicted short-timescale accretion instabilities. Finally, we find that fading behavior is approximately twice as common as bursting behavior on timescales of days to years, although the bursting and fading duty cycle for individual objects often varies from year to year.

Optimized emission in nanorod arrays through quasi-aperiodic inverse design.

Science.gov (United States)

Anderson, P Duke; Povinelli, Michelle L

2015-06-01

We investigate a new class of quasi-aperiodic nanorod structures for the enhancement of incoherent light emission. We identify one optimized structure using an inverse design algorithm and the finite-difference time-domain method. We carry out emission calculations on both the optimized structure as well as a simple periodic array. The optimized structure achieves nearly perfect light extraction while maintaining a high spontaneous emission rate. Overall, the optimized structure can achieve a 20%-42% increase in external quantum efficiency relative to a simple periodic design, depending on material quality.

Aperiodic linear networked control considering variable channel delays: application to robots coordination.

Science.gov (United States)

Santos, Carlos; Espinosa, Felipe; Santiso, Enrique; Mazo, Manuel

2015-05-27

One of the main challenges in wireless cyber-physical systems is to reduce the load of the communication channel while preserving the control performance. In this way, communication resources are liberated for other applications sharing the channel bandwidth. The main contribution of this work is the design of a remote control solution based on an aperiodic and adaptive triggering mechanism considering the current network delay of multiple robotics units. Working with the actual network delay instead of the maximum one leads to abandoning this conservative assumption, since the triggering condition is fixed depending on the current state of the network. This way, the controller manages the usage of the wireless channel in order to reduce the channel delay and to improve the availability of the communication resources. The communication standard under study is the widespread IEEE 802.11g, whose channel delay is clearly uncertain. First, the adaptive self-triggered control is validated through the TrueTime simulation tool configured for the mentioned WiFi standard. Implementation results applying the aperiodic linear control laws on four P3-DX robots are also included. Both of them demonstrate the advantage of this solution in terms of network accessing and control performance with respect to periodic and non-adaptive self-triggered alternatives.

Aperiodic Linear Networked Control Considering Variable Channel Delays: Application to Robots Coordination

Directory of Open Access Journals (Sweden)

Carlos Santos

2015-05-01

Full Text Available One of the main challenges in wireless cyber-physical systems is to reduce the load of the communication channel while preserving the control performance. In this way, communication resources are liberated for other applications sharing the channel bandwidth. The main contribution of this work is the design of a remote control solution based on an aperiodic and adaptive triggering mechanism considering the current network delay of multiple robotics units. Working with the actual network delay instead of the maximum one leads to abandoning this conservative assumption, since the triggering condition is fixed depending on the current state of the network. This way, the controller manages the usage of the wireless channel in order to reduce the channel delay and to improve the availability of the communication resources. The communication standard under study is the widespread IEEE 802.11g, whose channel delay is clearly uncertain. First, the adaptive self-triggered control is validated through the TrueTime simulation tool configured for the mentioned WiFi standard. Implementation results applying the aperiodic linear control laws on four P3-DX robots are also included. Both of them demonstrate the advantage of this solution in terms of network accessing and control performance with respect to periodic and non-adaptive self-triggered alternatives.

Dual-wavelength green laser with a 4.5 THz frequency difference based on self-frequency- doubling in Nd3+ -doped aperiodically poled lithium niobate.

Science.gov (United States)

Maestre, H; Torregrosa, A J; Fernández-Pousa, C R; Rico, M L; Capmany, J

2008-05-01

We report a dual-wavelength continuous-wave laser at 542.4 and 546.8 nm based on an Nd(3+)-doped aperiodically poled lithium niobate crystal. Two fundamental infrared (IR) wavelengths at 1084.8 and 1093.6 nm are simultaneously oscillated and self-frequency-doubled to green. The aperiodic domain distribution patterned in the crystal allows for quasi-phase matched self-frequency-doubling of both IR fundamentals while avoiding their sum-frequency mixing.

Influences of Fundamental Frequency, Formant Frequencies, Aperiodicity, and Spectrum Level on the Perception of Voice Gender

Science.gov (United States)

Skuk, Verena G.; Schweinberger, Stefan R.

2014-01-01

Purpose: To determine the relative importance of acoustic parameters (fundamental frequency [F0], formant frequencies [FFs], aperiodicity, and spectrum level [SL]) on voice gender perception, the authors used a novel parameter-morphing approach that, unlike spectral envelope shifting, allows the application of nonuniform scale factors to transform…

Radiation-disorder and aperiodicity in irradiated ceramics

International Nuclear Information System (INIS)

Hobbs, L.W.

1992-01-01

This final technical report documents the accomplishments of the program of research entitled ''Radiation Disorder and Aperiodicity in Irradiated Ceramics'' for the period June 22, 1989--June 21, 1992. This research forms the latest part on an on-going program, begun at MIT in 1983 under DOE support, which has had as its objectives investigation of the responses in radiation environments of ceramics heavily-irradiated with electrons, neutrons and ions, with potential applications to fusion energy technology and high-level nuclear waste storage. Materials investigated have included SiO 2 , MgAl 2 O 4 , Al 23 O 27 N 5 , SiC, BeO, LiAlO 2 , Li 2 ZrO 3 , CaTiO 3 KTaO 3 and Ca(Zr, Pu)Ti 2 O 7 . The program initially proposed for 1989 had as its major objectives two main thrusts: (1) research on defect aggregation in irradiated non-oxide ceramics, and (2) research on irradiation-induced amorphization of network silicas and phosphates

Theoretical and experimental study of bent fully aperiodic large-pitch fibers for enhancing the high-order modes delocalization

Science.gov (United States)

du Jeu, Rémi; Dauliat, Romain; Darwich, Dia; Auguste, Jean-Louis; Benoît, Aurélien; Leconte, Baptiste; Malleville, Marie-Alicia; Jamier, Raphaël.; Schuster, Kay; Roy, Philippe

2018-02-01

The power scaling of fiber lasers and amplifiers has triggered an extensive development of large-mode area fibers among which the most promising are the distributed mode filtering fibers and the large-pitch fibers. These structures enable for an effective higher-order modes delocalization and subsequently a singlemode emission. An interesting alternative consists in using the fully-aperiodic large-pitch fibers, into which the standard air-silica photonic crystal cladding is replaced by an aperiodic pattern made of solid low-index inclusions cladding. However, in such a structure, the core and the background cladding material surrounding it must have rigorously the same refractive index. Current synthesis processes and measurement techniques offer respectively a maximum resolution of 5×10-4 and 1×10-4 while the indexmatching must be as precise as 1×10-5 . Lately a gain material with a refractive index 1.5×10-4 higher than that of the background cladding material was fabricated, thus re-confining the first higher-order modes in the core. A numerical study is carried out on the benefit of bending such fully-aperiodic fiber to counteract this phenomenon. Optimized bending axis and radius have been determined. Experiments are done in a laser cavity operating at 1030 nm using an 88cm-long 51μm core diameter ytterbium-doped fiber. Results demonstrate an improvement of the M2 from 1.7 when the fiber is kept straight to 1.2 when it is bent with a 100 to 60 cm bend radius. These primary results are promising for future power scaling.

Visuo-manual tracking: does intermittent control with aperiodic sampling explain linear power and non-linear remnant without sensorimotor noise?

Science.gov (United States)

Gollee, Henrik; Gawthrop, Peter J; Lakie, Martin; Loram, Ian D

2017-11-01

A human controlling an external system is described most easily and conventionally as linearly and continuously translating sensory input to motor output, with the inevitable output remnant, non-linearly related to the input, attributed to sensorimotor noise. Recent experiments show sustained manual tracking involves repeated refractoriness (insensitivity to sensory information for a certain duration), with the temporary 200-500 ms periods of irresponsiveness to sensory input making the control process intrinsically non-linear. This evidence calls for re-examination of the extent to which random sensorimotor noise is required to explain the non-linear remnant. This investigation of manual tracking shows how the full motor output (linear component and remnant) can be explained mechanistically by aperiodic sampling triggered by prediction error thresholds. Whereas broadband physiological noise is general to all processes, aperiodic sampling is associated with sensorimotor decision making within specific frontal, striatal and parietal networks; we conclude that manual tracking utilises such slow serial decision making pathways up to several times per second. The human operator is described adequately by linear translation of sensory input to motor output. Motor output also always includes a non-linear remnant resulting from random sensorimotor noise from multiple sources, and non-linear input transformations, for example thresholds or refractory periods. Recent evidence showed that manual tracking incurs substantial, serial, refractoriness (insensitivity to sensory information of 350 and 550 ms for 1st and 2nd order systems respectively). Our two questions are: (i) What are the comparative merits of explaining the non-linear remnant using noise or non-linear transformations? (ii) Can non-linear transformations represent serial motor decision making within the sensorimotor feedback loop intrinsic to tracking? Twelve participants (instructed to act in three prescribed

Voltage dependency of transmission probability of aperiodic DNA molecule

Science.gov (United States)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Aperiodic nanoplasmonic devices for directional colour filtering and sensing.

Science.gov (United States)

Davis, Matthew S; Zhu, Wenqi; Xu, Ting; Lee, Jay K; Lezec, Henri J; Agrawal, Amit

2017-11-07

Exploiting the wave-nature of light in its simplest form, periodic architectures have enabled a panoply of tunable optical devices with the ability to perform useful functions such as filtering, spectroscopy, and multiplexing. Here, we remove the constraint of structural periodicity to enhance, simultaneously, the performance and functionality of passive plasmonic devices operating at optical frequencies. By using a physically intuitive, first-order interference model of plasmon-light interactions, we demonstrate a simple and efficient route towards designing devices with flexible, multi-spectral optical response, fundamentally not achievable using periodic architectures. Leveraging this approach, we experimentally implement ultra-compact directional light-filters and colour-sorters exhibiting angle- or spectrally-tunable optical responses with high contrast, and low spectral or spatial crosstalk. Expanding the potential of aperiodic systems to implement tailored spectral and angular responses, these results hint at promising applications in solar-energy harvesting, optical signal multiplexing, and integrated sensing.

The evolution of the Gutenberg-Richter, b-value, throughout periodic and aperiodic stick-slip cycles

Science.gov (United States)

Bolton, D. C.; Riviere, J.; Marone, C.; Johnson, P. A.

2017-12-01

The Gutenberg-Richter earthquake size statistic, b value, is a useful proxy for documenting the state of stress on a fault and understanding precursory phenomena preceding dynamic failure. It has been shown that the b value varies systematically as a function of position within the seismic cycle. Frictional studies on intact rock samples with saw-cut faults have shown that b value decreases continuously preceding failure. For intact rock samples, the spatiotemporal changes in b value are thought to be related to the evolution of asperities and micro-cracks. However, few studies have shown how b value evolves spatially and temporally for fault zones containing gouge and wear materials. We hypothesize that the micromechanical mechanisms acting within fault gouge, such as creation and destruction of force chains, grain rolling, sliding, jamming and fracturing play an important role in the evolution of b value and that they may have distinct signatures during periodic and aperiodic cycles of stick-slip frictional motion. We report results from experiments conducted on simulated fault gouge using a biaxial deformation apparatus in a double-direct shear configuration. Acoustic emissions (AEs) are recorded at 4 MHz from 36 P-polarized piezoelectric transducers, which are embedded in steel blocks located adjacent to the fault zone. We compute the frequency-magnitude distribution of detected AEs using a moving window in events where each window is overlapped by 75%. We report on the evolution of b value as a function of normal stress and gouge layer thickness. For periodic slip events, b value reaches a maximum value immediately after a slip event and decreases continuously until the next failure. Aperiodic slip events show similar trends in b-value initially, however unlike periodic slip events, b value reaches a steady state value before failure occurs. In addition, for periodic slip events the magnitude of the change in b value scales inversely with gouge layer thickness

Energy band and transport properties in magnetic aperiodic graphene superlattices of Thue-Morse sequence

Science.gov (United States)

Yin, Yiheng; Niu, Yanxiong; Zhang, Huiyun; Zhang, Yuping; Liu, Haiyue

2016-02-01

Utilizing the transfer matrix method, we develop the electronic band structure and transport properties in Thue-Morse aperiodic graphene superlattices with magnetic barriers. It is found that the normal transmission is blocked and the position of the Dirac point can be shifted along the wavevector axis by changing the height and width ratio of magnetic barriers, which is intrinsic different from electronic field modulated superlattices. In addition, the angular threshold property of the transmission spectra and the oscillatory property of the conductance have been studied.

Real-time remedial action against aperiodic small signal rotor angle instability

DEFF Research Database (Denmark)

Weckesser, Johannes Tilman Gabriel; Jóhannsson, Hjörtur; Østergaard, Jacob

2016-01-01

This paper presents a method that in real-time determines remedial actions, which restore stable operation with respect to aperiodic small signal rotor angle stability (ASSRAS) when insecure or unstable operation has been detected. An ASSRAS assessment method is used to monitor the stability...... impedance plane to determine an active power redispatch among selected generators to restore stable and secure operation. Since the method is purely based on analytically derived expression, the computation of the remedial actions is fast and well suited for real-time operation. The method was tested...... boundary for each generator in real-time. The ASSRAS boundary represents the condition when a generator reaches the maximum steady state active power injection. The proposed control method exploits analytically derived expressions for the ASSRAS boundary and other characteristic curves in the injection...

Self-similar transmission properties of aperiodic Cantor potentials in gapped graphene

Science.gov (United States)

Rodríguez-González, Rogelio; Rodríguez-Vargas, Isaac; Díaz-Guerrero, Dan Sidney; Gaggero-Sager, Luis Manuel

2016-01-01

We investigate the transmission properties of quasiperiodic or aperiodic structures based on graphene arranged according to the Cantor sequence. In particular, we have found self-similar behaviour in the transmission spectra, and most importantly, we have calculated the scalability of the spectra. To do this, we implement and propose scaling rules for each one of the fundamental parameters: generation number, height of the barriers and length of the system. With this in mind we have been able to reproduce the reference transmission spectrum, applying the appropriate scaling rule, by means of the scaled transmission spectrum. These scaling rules are valid for both normal and oblique incidence, and as far as we can see the basic ingredients to obtain self-similar characteristics are: relativistic Dirac electrons, a self-similar structure and the non-conservation of the pseudo-spin.

Applied optics. Gain modulation by graphene plasmons in aperiodic lattice lasers.

Science.gov (United States)

Chakraborty, S; Marshall, O P; Folland, T G; Kim, Y-J; Grigorenko, A N; Novoselov, K S

2016-01-15

Two-dimensional graphene plasmon-based technologies will enable the development of fast, compact, and inexpensive active photonic elements because, unlike plasmons in other materials, graphene plasmons can be tuned via the doping level. Such tuning is harnessed within terahertz quantum cascade lasers to reversibly alter their emission. This is achieved in two key steps: first, by exciting graphene plasmons within an aperiodic lattice laser and, second, by engineering photon lifetimes, linking graphene's Fermi energy with the round-trip gain. Modal gain and hence laser spectra are highly sensitive to the doping of an integrated, electrically controllable, graphene layer. Demonstration of the integrated graphene plasmon laser principle lays the foundation for a new generation of active, programmable plasmonic metamaterials with major implications across photonics, material sciences, and nanotechnology. Copyright © 2016, American Association for the Advancement of Science.

Multispectral selective near-perfect light absorption by graphene monolayer using aperiodic multilayer microstructures

Science.gov (United States)

Zand, Iman; Dalir, Hamed; Chen, Ray T.; Dowling, Jonathan P.

2018-03-01

We investigate one-dimensional aperiodic multilayer microstructures in order to achieve near-total absorptions at preselected wavelengths in a graphene monolayer. The proposed structures are designed using a genetic optimization algorithm coupled to a transfer matrix code. Coupled-mode-theory analysis, consistent with transfer matrix method results, indicates the existence of a critical coupling in the graphene monolayer for perfect absorptions. Our findings show that the near-total-absorption peaks are highly tunable and can be controlled simultaneously or independently in a wide range of wavelengths in the near-infrared and visible ranges. The proposed approach is metal-free, does not require surface texturing or patterning, and can be also applied for other two-dimensional materials.

Aperiodic pressure pulsation under non optimal hydraulic turbine regimes at low swirl number

Science.gov (United States)

Skripkin, S. G.; Tsoy, M. A.; Kuibin, P. A.; Shtork, S. I.

2017-09-01

Off-design operating conditions of hydraulic turbines is hindered by pressure fluctuations in the draft tube of the turbine. A precessing helical vortex rope develops, which imperils the mechanical structure and limits the operation flexibility of hydropower station. Understanding of the underlying instabilities of precessing vortex rope at low swirl number is incomplete. In this paper flow regimes with different residual swirl is analysed, particular attention is paid to the regime with a small swirl parameter. Study defines upper and low boundaries of regime where aperiodic pressure surge is observed. Flow field at the runner exit is investigated by Laser Doppler Velocimetry and high-speed visualizations, which are complemented draft tube wall pressure measurements.

Wave propagation in one-dimensional solid-fluid quasi-periodic and aperiodic phononic crystals

Energy Technology Data Exchange (ETDEWEB)

Chen Ali, E-mail: alchen@bjtu.edu.cn [Institute of Engineering Mechanics, Beijing Jiaotong University, Beijing 100044 (China); Wang Yuesheng [Institute of Engineering Mechanics, Beijing Jiaotong University, Beijing 100044 (China); Zhang Chuanzeng [Department of Civil Engineering, University of Siegen, D-57068 Siegen (Germany)

2012-02-01

The propagation of the elastic waves in one-dimensional (1D) solid-fluid quasi-periodic phononic crystals is studied by employing the concept of the localization factor, which is calculated by the transfer matrix method. The solid-fluid interaction effect at the interfaces between the solid and the fluid components is considered. For comparison, the periodic systems and aperiodic Thue-Morse sequence are also analyzed in this paper. The splitting phenomenon of the pass bands and bandgaps are discussed for these 1D solid-fluid systems. At last the influences of the material impedance ratios on the band structures of the 1D solid-fluid quasi-periodic phononic crystals arranged as Fibonacci sequence are discussed.

Achieving sub-50 nm controlled diameter of aperiodic Si nanowire arrays by ultrasonic catalyst removal for photonic applications

Science.gov (United States)

Chaliyawala, Harsh A.; Purohit, Zeel; Khanna, Sakshum; Ray, Abhijit; Pati, Ranjan K.; Mukhopadhyay, Indrajit

2018-05-01

We report an alternative approach to fabricate the vertically aligned aperiodic Si nanowire arrays by controlling the diameter of the Ag nanoparticles and tuneable ultrasonic removal. The process begins by sputtering the Ag thin film (t=5 nm) on the Si/SiO2 substrates. Followed by Ag thin film, annealed for various temperature (T=300°C, 400°C, 500°C and 600°C) to selectively achieve a high density, well-spaced and diameter controlled Ag nanoparticles (AgNPs) on the Si/SiO2 substrates. The sacrificial layer of AgNPs size indicates the controlled diameter of the Si nanowire arrays. Image J analysis for various annealed samples gives an indication of the high density, uniformity and equal distribution of closely packed AgNPs. Furthermore, the AgNPs covered with Au/Pd mesh (5 nm) as a template, was removed by ultrasonication in the etchant solution for several times in different intervals of preparation. The conventional and facile metal assisted electroless etching approach was finally employed to fabricate the vertically aperiodic sub-50 nm SiNWAs, can be applicable to various nanoscale opto-electronic applications.

On the algebraic characterization of aperiodic tilings related to ADE-root systems

International Nuclear Information System (INIS)

Kellendonk, J.

1992-09-01

The algebraic characterization of sets of locally equivalent aperiodic tilings, being examples of quantum spaces, is conducted for a certain type of tilings in a manner proposed by A. Connes. These 2-dimensional tilings are obtained by application of the strip method to the root lattice of an ADE-Coxeter group. The plane along which the strip is constructed is determined by the canonical Coxeter element leading to the result that a 2- dimensional tiling decomposes into a cartesian product of two 1- dimensional tilings. The properties of the tilings are investigated, including selfsimilarity, and the determination of the relevant algebraic is considered, namely the ordered K 0 -group of an algebra naturaly assigned to the quantum space. The result also yields an application of the 2-dimensional abstract gap labelling theorem. (orig.)

The DNA electronic specific heat at low temperature: The role of aperiodicity

Energy Technology Data Exchange (ETDEWEB)

Sarmento, R.G. [Departamento de Física, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Mendes, G.A. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Vasconcelos, M.S. [Escola de Ciências e Tecnologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Ujsághy, O. [Department of Theoretical Physics and Condensed Matter Research Group of the Hungarian Academy of Sciences, Budapest University of Technology and Economics, Budafoki út 8, H-1521 Budapest (Hungary); Freire, V.N. [Departamento de Física, Universidade Federal do Ceará, 60455-760, Fortaleza, CE (Brazil); Caetano, E.W.S. [Instituto Federal de Educação, Ciência e Tecnologia do Ceará, 60040-531, Fortaleza, CE (Brazil)

2012-07-16

The electronic specific heat spectra at constant volume (C{sub V}) of a long-range correlated extended ladder model, mimicking a DNA molecule, is theoretically analyzed for a stacked array of a double-stranded structure made up from the nucleotides guanine G, adenine A, cytosine C and thymine T. The role of the aperiodicity on C{sub V} is discussed, considering two different nucleotide arrangements with increasing disorder, namely the Fibonacci and the Rudin–Shapiro quasiperiodic structures. Comparisons are made for different values of the band fillings, considering also a finite segment of natural DNA, as part of the human chromosome Ch22. -- Highlights: ► Quasiperiodic sequence to mimic the DNA nucleotides arrangement. ► Electronic tight-binding Hamiltonian model. ► Electronic density of states. ► Electronic specific heat spectra.

Computational Modeling of Bloch Surface Waves in One-Dimensional Periodic and Aperiodic Multilayer Structures

Science.gov (United States)

Koju, Vijay

Photonic crystals and their use in exciting Bloch surface waves have received immense attention over the past few decades. This interest is mainly due to their applications in bio-sensing, wave-guiding, and other optical phenomena such as surface field enhanced Raman spectroscopy. Improvement in numerical modeling techniques, state of the art computing resources, and advances in fabrication techniques have also assisted in growing interest in this field. The ability to model photonic crystals computationally has benefited both the theoretical as well as experimental communities. It helps the theoretical physicists in solving complex problems which cannot be solved analytically and helps to acquire useful insights that cannot be obtained otherwise. Experimentalists, on the other hand, can test different variants of their devices by changing device parameters to optimize performance before fabrication. In this dissertation, we develop two commonly used numerical techniques, namely transfer matrix method, and rigorous coupled wave analysis, in C++ and MATLAB, and use two additional software packages, one open-source and another commercial, to model one-dimensional photonic crystals. Different variants of one-dimensional multilayered structures such as perfectly periodic dielectric multilayers, quasicrystals, aperiodic multilayer are modeled, along with one-dimensional photonic crystals with gratings on the top layer. Applications of Bloch surface waves, along with new and novel aperiodic dielectric multilayer structures that support Bloch surface waves are explored in this dissertation. We demonstrate a slow light configuration that makes use of Bloch Surface Waves as an intermediate excitation in a double-prism tunneling configuration. This method is simple compared to the more usual techniques for slowing light using the phenomenon of electromagnetically induced transparency in atomic gases or doped ionic crystals operated at temperatures below 4K. Using a semi

Spectral characterisation of aperiodic normal-incidence Sb/B4C multilayer mirrors for the λ < 124 Å range

Science.gov (United States)

Vishnyakov, E. A.; Kopylets, I. A.; Kondratenko, V. V.; Kolesnikov, A. O.; Pirozhkov, A. S.; Ragozin, E. N.; Shatokhin, A. N.

2018-03-01

Three broadband aperiodic Sb/B4C multilayer mirrors were synthesised for the purposes of soft X-ray optics and spectroscopy in the wavelength range beyond the L-edge of Si (λ plasma radiation source and an electronic detector with a 2D spatial resolution (a CCD matrix with 13 × 13 μm sized pixels). The experimental spectra are compared with theoretical calculations. The effect of lower antimony and B4C layer densities on the reflection spectra is discussed.

DETECTION OF X-RAYS FROM THE SYMBIOTIC STAR V1329 Cyg

International Nuclear Information System (INIS)

Stute, Matthias; Luna, Gerardo J. M.; Sokoloski, Jennifer L.

2011-01-01

We report the detection of X-ray emission from the symbiotic star V1329 Cyg with XMM-Newton. The spectrum from the EPIC pn, MOS1, and MOS2 instruments consists of a two-temperature plasma with k T 1 = 0.11 +0.02 -0.02 keV and k T 2 = 0.93 +0.12 -0.14 keV. Unlike the vast majority of symbiotic stars detected in X-rays, the soft component of the spectrum seems to be absorbed only by interstellar material. The shock velocities corresponding to the observed temperatures are about 300 km s -1 and about 900 km s -1 . We did not find either periodic or aperiodic X-ray variability, with upper limits on the amplitudes of such variations being 46% and 16% (rms), respectively. We also did not find any ultraviolet variability with an rms amplitude of more than approximately 1%. The derived velocities and the unabsorbed nature of the soft component of the X-ray spectrum suggest that some portion of the high energy emission could originate in shocks within a jet and beyond the symbiotic nebula. The lower velocity is consistent with the expansion velocity of the extended structure present in Hubble Space Telescope observations. The higher velocity could be associated with an internal shock at the base of the jet or with shocks in the accretion region.

Design of an amplifier model accounting for thermal effect in fully aperiodic large pitch fibers

Science.gov (United States)

Tragni, K.; Molardi, C.; Poli, F.; Dauliat, R.; Leconte, B.; Darwich, D.; du Jeu, R.; Malleville, M. A.; Jamier, R.; Selleri, S.; Roy, P.; Cucinotta, A.

2018-02-01

Yb-doped Photonic Crystal Fibers (PCFs) have triggered a significant power scaling into fiber-based lasers. However thermally-induced effects, like mode instability, can compromise the output beam quality. PCF design with improved Higher Order Mode (HOM) delocalization and effective thermal resilience can contain the problem. In particular, Fully- Aperiodic Large-Pitch Fibers (FA-LPFs) have shown interesting properties in terms of resilience to thermal effects. In this paper the performances of a Yb-doped FA-LPF amplifier are experimentally and numerically investigated. Modal properties and gain competition between Fundamental Mode (FM) and first HOM have been calculated, in presence of thermal effects. The main doped fiber characteristics have been derived by comparison between experimental and numerical results.

General Services Administration. STAR-PBS' New Program for Tracking and Managing Real Property

National Research Council Canada - National Science Library

King, Ron

1999-01-01

STAR is a real estate inventory management software application that maintains data on projects, leases, buildings, and space assignments that is, who is in what space-in an integrated database environment...

The Pagoda Sequence: a Ramble through Linear Complexity, Number Walls, D0L Sequences, Finite State Automata, and Aperiodic Tilings

Directory of Open Access Journals (Sweden)

Fred Lunnon

2009-06-01

Full Text Available We review the concept of the number wall as an alternative to the traditional linear complexity profile (LCP, and sketch the relationship to other topics such as linear feedback shift-register (LFSR and context-free Lindenmayer (D0L sequences. A remarkable ternary analogue of the Thue-Morse sequence is introduced having deficiency 2 modulo 3, and this property verified via the re-interpretation of the number wall as an aperiodic plane tiling.

THE DUSTIEST POST-MAIN SEQUENCE STARS IN THE MAGELLANIC CLOUDS

Energy Technology Data Exchange (ETDEWEB)

Jones, Olivia C.; Meixner, Margaret; Roman-Duval, Julia [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Sargent, Benjamin A. [Center for Imaging Science and Laboratory for Multiwavelength Astrophysics, Rochester Institute of Technology, 54 Lomb Memorial Drive, Rochester, NY 14623 (United States); Boyer, Martha L. [Observational Cosmology Lab, Code 665, NASA Goddard Space Flight Center, Greenbelt, MD 20771 (United States); Sewiło, Marta [The Johns Hopkins University, Department of Physics and Astronomy, 366 Bloomberg Center, 3400 N. Charles Street, Baltimore, MD 21218 (United States); Hony, Sacha [Institut für Theoretische Astrophysik, Zentrum für Astronomie, Universitt Heidelberg, Albert-Ueberle-Str. 2, D-69120 Heidelberg (Germany)

2015-10-01

Using observations from the Herschel Inventory of The Agents of Galaxy Evolution (HERITAGE) survey of the Magellanic Clouds (MC), we have found 35 evolved stars and stellar end products that are bright in the far-infrared. These 28 (LMC) and 7 (SMC) sources were selected from the 529 evolved star candidates in the HERITAGE far-infrared point source catalogs. Our source identification method is based on spectral confirmation, spectral energy distribution characteristics, careful examination of the multiwavelength images and includes constraints on the luminosity, resulting in a thoroughly vetted list of evolved stars. These sources span a wide range in luminosity and hence initial mass. We found 13 low- to intermediate-mass evolved stars, including asymptotic giant branch (AGB) stars, post-AGB stars, planetary nebulae, and a symbiotic star. We also identify 10 high mass stars, including 4 of the 15 known B[e] stars in the MC, 3 extreme red supergiants that are highly enshrouded by dust, a Luminous Blue Variable, a Wolf–Rayet star, and two supernova remnants. Further, we report the detection of 9 probable evolved objects which were previously undescribed in the literature. These sources are likely to be among the dustiest evolved objects in the MC. The Herschel emission may either be due to dust produced by the evolved star or it may arise from swept-up interstellar medium material.

Application of the three-dimensional aperiodic Fourier modal method using arc elements in curvilinear coordinates.

Science.gov (United States)

Bucci, Davide; Martin, Bruno; Morand, Alain

2012-03-01

This paper deals with a full vectorial generalization of the aperiodic Fourier modal method (AFMM) in cylindrical coordinates. The goal is to predict some key characteristics such as the bending losses of waveguides having an arbitrary distribution of the transverse refractive index. After a description of the method, we compare the results of the cylindrical coordinates AFMM with simulations by the finite-difference time-domain (FDTD) method performed on an S-bend structure made by a 500 nm × 200 nm silicon core (n=3.48) in silica (n=1.44) at a wavelength λ=1550 nm, the bending radius varying from 0.5 up to 2 μm. The FDTD and AFMM results show differences comparable to the variations obtained by changing the parameters of the FDTD simulations.

Aperiodic dynamics in a deterministic adaptive network model of attitude formation in social groups

Science.gov (United States)

Ward, Jonathan A.; Grindrod, Peter

2014-07-01

Adaptive network models, in which node states and network topology coevolve, arise naturally in models of social dynamics that incorporate homophily and social influence. Homophily relates the similarity between pairs of nodes' states to their network coupling strength, whilst social influence causes coupled nodes' states to convergence. In this paper we propose a deterministic adaptive network model of attitude formation in social groups that includes these effects, and in which the attitudinal dynamics are represented by an activato-inhibitor process. We illustrate that consensus, corresponding to all nodes adopting the same attitudinal state and being fully connected, may destabilise via Turing instability, giving rise to aperiodic dynamics with sensitive dependence on initial conditions. These aperiodic dynamics correspond to the formation and dissolution of sub-groups that adopt contrasting attitudes. We discuss our findings in the context of cultural polarisation phenomena. Social influence. This reflects the fact that people tend to modify their behaviour and attitudes in response to the opinions of others [22-26]. We model social influence via diffusion: agents adjust their state according to a weighted sum (dictated by the evolving network) of the differences between their state and the states of their neighbours. Homophily. This relates the similarity of individuals' states to their frequency and strength of interaction [27]. Thus in our model, homophily drives the evolution of the weighted ‘social' network. A precise formulation of our model is given in Section 2. Social influence and homophily underpin models of social dynamics [21], which cover a wide range of sociological phenomena, including the diffusion of innovations [28-32], complex contagions [33-36], collective action [37-39], opinion dynamics [19,20,40,10,11,13,15,41,16], the emergence of social norms [42-44], group stability [45], social differentiation [46] and, of particular relevance

The Time Is Up: Compression of Visual Time Interval Estimations of Bimodal Aperiodic Patterns

Science.gov (United States)

Duarte, Fabiola; Lemus, Luis

2017-01-01

The ability to estimate time intervals subserves many of our behaviors and perceptual experiences. However, it is not clear how aperiodic (AP) stimuli affect our perception of time intervals across sensory modalities. To address this question, we evaluated the human capacity to discriminate between two acoustic (A), visual (V) or audiovisual (AV) time intervals of trains of scattered pulses. We first measured the periodicity of those stimuli and then sought for correlations with the accuracy and reaction times (RTs) of the subjects. We found that, for all time intervals tested in our experiment, the visual system consistently perceived AP stimuli as being shorter than the periodic (P) ones. In contrast, such a compression phenomenon was not apparent during auditory trials. Our conclusions are: first, the subjects exposed to P stimuli are more likely to measure their durations accurately. Second, perceptual time compression occurs for AP visual stimuli. Lastly, AV discriminations are determined by A dominance rather than by AV enhancement. PMID:28848406

A novel scenario of aperiodical impacts appearance in the turbine draft tube

Science.gov (United States)

Alekseenko, S. V.; Kuibin, P. A.; Shtork, S. I.; Skripkin, S. G.; Sonin, V. I.; Tsoy, M. A.; Ustimenko, A. S.

2016-11-01

The swirling flow in the discharge cone of hydroturbine is characterized by various self-induced instabilities and associated low frequency phenomena when the turbine is operated far from the best efficiency point. In particular, the precessing vortex rope develops at part-load regimes in the draft tube. This rope can serve a reason of the periodical low- frequency pressure oscillations in the whole hydrodynamical system. During the experimental research of flow structure in the discharge cone in a regime of free runner new interesting phenomenon was discovered. Due to instability some coils of helical vortex close to each other and reconnection appears with generation of a vortex ring. The experiments were fulfilled at the cavitational conditions when a cavity arises in the vortex core. So the phenomenon was registered with help of visualization by the high speed video recording. The vortex ring after the reconnection moves apart from the main vortex rope toward the wall and downstream. When it reaches the area with high pressure the cavity collapses with generation of pressure impact. The mechanism of cavitational vortex rings generation and their further collapse can serve as a prototype of the aperiodical pressure impacts inside the turbine draft tube.

Stochastic resonance in a bistable system subject to multi-time-delayed feedback and aperiodic signal

International Nuclear Information System (INIS)

Li Jianlong; Zeng Lingzao

2010-01-01

We discuss in detail the effects of the multi-time-delayed feedback driven by an aperiodic signal on the output of a stochastic resonance (SR) system. The effective potential function and dynamical probability density function (PDF) are derived. To measure the performance of the SR system in the presence of a binary random signal, the bit error rate (BER) defined by the dynamical PDF is employed, as is commonly used in digital communications. We find that the delay time, strength of the feedback, and number of time-delayed terms can change the effective potential function and the effective amplitude of the signal, and then affect the BER of the SR system. The numerical simulations strongly support the theoretical results. The goal of this investigation is to explore the effects of the multi-time-delayed feedback on SR and give a guidance to nonlinear systems in the application of information processing.

The MACHO Project LMC Variable Star Inventory. VIII. The Recent Star Formation History of the Large Magellanic Cloud from the Cepheid Period Distribution

International Nuclear Information System (INIS)

Alcock, C.; Allsman, R.A.; Alves, D.R.; Axelrod, T.S.; Becker, A.C.; Bennett, D.P.; Bersier, D.F.; Cook, K.H.; Freeman, K.C.; Griest, K.; Guern, J.A.; Lehner, M.; Marshall, S.L.; Minniti, D.; Peterson, B.A.; Pratt, M.R.; Quinn, P.J.; Rodgers, A.W.; Stubbs, C.W.

1999-01-01

We present an analysis of the period distribution of about 1800 Cepheids in the LMC, based on data obtained by the MACHO microlensing experiment and on a previous catalog by C. H. Payne Gaposchkin. Using stellar evolution and pulsation models, we construct theoretical period-frequency distributions that are compared with the observations. These models reveal that a significant burst of star formation has occurred recently in the LMC (∼1.15x10 8 yr). We also show that during the last ∼10 8 yr, the main center of star formation has been propagating from southeast to northwest along the bar. We find that the evolutionary masses of Cepheids are still smaller than pulsation masses by ∼7% and that the red edge of the Cepheid instability strip could be slightly bluer than indicated by theory. There are approximately 600 Cepheids with periods below ∼2.5 days that cannot be explained by evolution theory. We suggest that they are anomalous Cepheids and that a number of these stars are double-mode Cepheids. copyright copyright 1999. The American Astronomical Society

SUPER-AGB-AGB EVOLUTION AND THE CHEMICAL INVENTORY IN NGC 2419

Energy Technology Data Exchange (ETDEWEB)

Ventura, Paolo; D' Antona, Francesca; Carini, Roberta [INAF-Osservatorio Astronomico di Roma, via Frascati 33, I-00040 Monteporzio (Italy); Di Criscienzo, Marcella [INAF-Osservatorio Astronomico di Capodimonte, Salita Moiariello 16, I-80131 Napoli (Italy); D' Ercole, Annibale [INAF-Osservatorio Astronomico di Bologna, via Ranzani 1, I-40127 Bologna (Italy); Vesperini, Enrico, E-mail: paolo.ventura@oa-roma.inaf.it [Department of Astronomy, Indiana University, Bloomington (United States)

2012-12-20

We follow the scenario of formation of second-generation stars in globular clusters by matter processed by hot bottom burning (HBB) in massive asymptotic giant branch (AGB) stars and super-AGB stars (SAGB). In the cluster NGC 2419 we assume the presence of an extreme population directly formed from the AGB and SAGB ejecta, so we can directly compare the yields for a metallicity Z = 0.0003 with the chemical inventory of the cluster NGC 2419. At such a low metallicity, the HBB temperatures (well above 10{sup 8} K) allow a very advanced nucleosynthesis. Masses {approx}6 M{sub Sun} deplete Mg and synthesize Si, going beyond Al, so this latter element is only moderately enhanced; sodium cannot be enhanced. The models are consistent with the observations, although the predicted Mg depletion is not as strong as in the observed stars. We predict that the oxygen abundance must be depleted by a huge factor (>50) in the Mg-poor stars. The HBB temperatures are close to the region where other p-capture reactions on heavier nuclei become possible. We show that high potassium abundance found in Mg-poor stars can be achieved during HBB by p-captures on the argon nuclei, if the relevant cross section(s) are larger than listed in the literature or if the HBB temperature is higher. Finally, we speculate that some calcium production is occurring owing to proton capture on potassium. We emphasize the importance of a strong effort to measure a larger sample of abundances in this cluster.

STARDUST FROM ASYMPTOTIC GIANT BRANCH STARS

International Nuclear Information System (INIS)

Gail, H.-P.; Zhukovska, S. V.; Hoppe, P.; Trieloff, M.

2009-01-01

The formation of dust in the outflows of low- and intermediate-mass stars on the first giant branch and asymptotic giant branch (AGB) is studied and the relative contributions of stars of different initial masses and metallicities to the interstellar medium (ISM) at the instant of solar system formation are derived. These predictions are compared with the characteristics of the parent stars of presolar dust grains found in primitive meteorites and interplanetary dust particles (IDPs) inferred from their isotopic compositions. For this purpose, model calculations for dust condensation in stellar outflows are combined with synthetic models of stellar evolution on the first giant branch and AGB and an evolution model of the Milky Way for the solar neighborhood. The dust components considered are olivine, pyroxene, carbon, SiC, and iron. The corresponding dust production rates are derived for the solar vicinity. From these rates and taking into account dust destruction by supernova shocks in the ISM, the contributions to the inventory of presolar dust grains in the solar system are derived for stars of different initial masses and metallicities. It is shown that stars on the first giant branch and the early AGB are not expected to form dust, in accord with astronomical observations. Dust formation is concentrated in the last phase of evolution, the thermally pulsing AGB. Due to the limited lifetime of dust grains in the ISM only parent stars from a narrow range of metallicities are expected to contribute to the population of presolar dust grains. Silicate and silicon carbide dust grains are predicted to come from parent stars with metallicities not less than about Z ∼ 0.008 (0.6 x solar). This metallicity limit is higher than that inferred from presolar SiC grain isotope data. The population of presolar carbon dust grains is predicted to originate from a wider range of metallicities, down to Z ∼ 0.004. Masses of AGB stars that produce C-rich dust are in the range �

Inventory Control System by Using Vendor Managed Inventory (VMI)

Science.gov (United States)

Sabila, Alzena Dona; Mustafid; Suryono

2018-02-01

The inventory control system has a strategic role for the business in managing inventory operations. Management of conventional inventory creates problems in the stock of goods that often runs into vacancies and excess goods at the retail level. This study aims to build inventory control system that can maintain the stability of goods availability at the retail level. The implementation of Vendor Managed Inventory (VMI) method on inventory control system provides transparency of sales data and inventory of goods at retailer level to supplier. Inventory control is performed by calculating safety stock and reorder point of goods based on sales data received by the system. Rule-based reasoning is provided on the system to facilitate the monitoring of inventory status information, thereby helping the process of inventory updates appropriately. Utilization of SMS technology is also considered as a medium of collecting sales data in real-time due to the ease of use. The results of this study indicate that inventory control using VMI ensures the availability of goods ± 70% and can reduce the accumulation of goods ± 30% at the retail level.

Inventory Control System by Using Vendor Managed Inventory (VMI

Directory of Open Access Journals (Sweden)

Dona Sabila Alzena

2018-01-01

Full Text Available The inventory control system has a strategic role for the business in managing inventory operations. Management of conventional inventory creates problems in the stock of goods that often runs into vacancies and excess goods at the retail level. This study aims to build inventory control system that can maintain the stability of goods availability at the retail level. The implementation of Vendor Managed Inventory (VMI method on inventory control system provides transparency of sales data and inventory of goods at retailer level to supplier. Inventory control is performed by calculating safety stock and reorder point of goods based on sales data received by the system. Rule-based reasoning is provided on the system to facilitate the monitoring of inventory status information, thereby helping the process of inventory updates appropriately. Utilization of SMS technology is also considered as a medium of collecting sales data in real-time due to the ease of use. The results of this study indicate that inventory control using VMI ensures the availability of goods ± 70% and can reduce the accumulation of goods ± 30% at the retail level.

Inventory Control System by Using Vendor Managed Inventory (VMI)

OpenAIRE

Dona Sabila Alzena; Mustafid Mustafid; Suryono Suryono

2018-01-01

The inventory control system has a strategic role for the business in managing inventory operations. Management of conventional inventory creates problems in the stock of goods that often runs into vacancies and excess goods at the retail level. This study aims to build inventory control system that can maintain the stability of goods availability at the retail level. The implementation of Vendor Managed Inventory (VMI) method on inventory control system provides transparency of sales data an...

Purchasing and inventory management techniques for optimizing inventory investment

International Nuclear Information System (INIS)

McFarlane, I.; Gehshan, T.

1993-01-01

In an effort to reduce operations and maintenance costs among nuclear plants, many utilities are taking a closer look at their inventory investment. Various approaches for inventory reduction have been used and discussed, but these approaches are often limited to an inventory management perspective. Interaction with purchasing and planning personnel to reduce inventory investment is a necessity in utility efforts to become more cost competitive. This paper addresses the activities that purchasing and inventory management personnel should conduct in an effort to optimize inventory investment while maintaining service-level goals. Other functions within a materials management organization, such as the warehousing and investment recovery functions, can contribute to optimizing inventory investment. However, these are not addressed in this paper because their contributions often come after inventory management and purchasing decisions have been made

Optimization of Inventory

OpenAIRE

PROKOPOVÁ, Nikola

2017-01-01

The subject of this thesis is optimization of inventory in selected organization. Inventory optimization is a very important topic in each organization because it reduces storage costs. At the beginning the inventory theory is presented. It shows the meaning and types of inventory, inventory control and also different methods and models of inventory control. Inventory optimization in the enterprise can be reached by using models of inventory control. In the second part the company on which is...

AN INCREASE IN THE MASS OF PLANETARY SYSTEMS AROUND LOWER-MASS STARS

International Nuclear Information System (INIS)

Mulders, Gijs D.; Pascucci, Ilaria; Apai, Dániel

2015-01-01

Trends in the planet population with host star mass provide an avenue to constrain planet formation theories. We derive the planet radius distribution function for Kepler stars of different spectral types, sampling a range in host star masses. We find that M dwarf stars have 3.5 times more small planets (1.0–2.8 R ⨁ ) than main-sequence FGK stars, but two times fewer Neptune-sized and larger (>2.8 R ⨁ ) planets. We find no systematic trend in the planet size distribution between spectral types F, G, and K to explain the increasing occurrence rates. Taking into account the mass–radius relationship and heavy-element mass of observed exoplanets, and assuming those are independent of spectral type, we derive the inventory of the heavy-element mass locked up in exoplanets at short orbits. The overall higher planet occurrence rates around M stars are not consistent with the redistribution of the same mass into more, smaller planets. At the orbital periods and planet radii where Kepler observations are complete for all spectral types, the average heavy-element mass locked up in exoplanets increases roughly inversely with stellar mass from 4 M ⨁ in F stars to 5 M ⨁ in G and K stars to 7 M ⨁ in M stars. This trend stands in stark contrast with observed protoplanetary disk masses that decrease toward lower mass stars, and provides a challenge for current planet formation models. Neither models of in situ formation nor migration of fully formed planets are consistent with these results. Instead, these results are indicative of large-scale inward migration of planetary building blocks—either through type-I migration or radial drift of dust grains—that is more efficient for lower mass stars, but does not result in significantly larger or smaller planets

AN INCREASE IN THE MASS OF PLANETARY SYSTEMS AROUND LOWER-MASS STARS

Energy Technology Data Exchange (ETDEWEB)

Mulders, Gijs D.; Pascucci, Ilaria; Apai, Dániel, E-mail: mulders@lpl.arizona.edu [Lunar and Planetary Laboratory, The University of Arizona, Tucson, AZ 85721 (United States)

2015-12-01

Trends in the planet population with host star mass provide an avenue to constrain planet formation theories. We derive the planet radius distribution function for Kepler stars of different spectral types, sampling a range in host star masses. We find that M dwarf stars have 3.5 times more small planets (1.0–2.8 R{sub ⨁}) than main-sequence FGK stars, but two times fewer Neptune-sized and larger (>2.8 R{sub ⨁}) planets. We find no systematic trend in the planet size distribution between spectral types F, G, and K to explain the increasing occurrence rates. Taking into account the mass–radius relationship and heavy-element mass of observed exoplanets, and assuming those are independent of spectral type, we derive the inventory of the heavy-element mass locked up in exoplanets at short orbits. The overall higher planet occurrence rates around M stars are not consistent with the redistribution of the same mass into more, smaller planets. At the orbital periods and planet radii where Kepler observations are complete for all spectral types, the average heavy-element mass locked up in exoplanets increases roughly inversely with stellar mass from 4 M{sub ⨁} in F stars to 5 M{sub ⨁} in G and K stars to 7 M{sub ⨁} in M stars. This trend stands in stark contrast with observed protoplanetary disk masses that decrease toward lower mass stars, and provides a challenge for current planet formation models. Neither models of in situ formation nor migration of fully formed planets are consistent with these results. Instead, these results are indicative of large-scale inward migration of planetary building blocks—either through type-I migration or radial drift of dust grains—that is more efficient for lower mass stars, but does not result in significantly larger or smaller planets.

ON THE STAR FORMATION RATES IN MOLECULAR CLOUDS

International Nuclear Information System (INIS)

Lada, Charles J.; Lombardi, Marco; Alves, Joao F.

2010-01-01

In this paper, we investigate the level of star formation activity within nearby molecular clouds. We employ a uniform set of infrared extinction maps to provide accurate assessments of cloud mass and structure and compare these with inventories of young stellar objects within the clouds. We present evidence indicating that both the yield and rate of star formation can vary considerably in local clouds, independent of their mass and size. We find that the surface density structure of such clouds appears to be important in controlling both these factors. In particular, we find that the star formation rate (SFR) in molecular clouds is linearly proportional to the cloud mass (M 0.8 ) above an extinction threshold of A K ∼ 0.8 mag, corresponding to a gas surface density threshold of Σ gas ∼ 116 M sun pc 2 . We argue that this surface density threshold corresponds to a gas volume density threshold which we estimate to be n(H 2 ) ∼ 10 4 cm -3 . Specifically, we find SFR (M sun yr -1 ) = 4.6 ± 2.6 x 10 -8 M 0.8 (M sun ) for the clouds in our sample. This relation between the rate of star formation and the amount of dense gas in molecular clouds appears to be in excellent agreement with previous observations of both galactic and extragalactic star-forming activity. It is likely the underlying physical relationship or empirical law that most directly connects star formation activity with interstellar gas over many spatial scales within and between individual galaxies. These results suggest that the key to obtaining a predictive understanding of the SFRs in molecular clouds and galaxies is to understand those physical factors which give rise to the dense components of these clouds.

Neutron Stars and NuSTAR

Science.gov (United States)

Bhalerao, Varun

2012-05-01

My thesis centers around the study of neutron stars, especially those in massive binary systems. To this end, it has two distinct components: the observational study of neutron stars in massive binaries with a goal of measuring neutron star masses and participation in NuSTAR, the first imaging hard X-ray mission, one that is extremely well suited to the study of massive binaries and compact objects in our Galaxy. The Nuclear Spectroscopic Telescope Array (NuSTAR) is a NASA Small Explorer mission that will carry the first focusing high energy X-ray telescope to orbit. NuSTAR has an order-of-magnitude better angular resolution and has two orders of magnitude higher sensitivity than any currently orbiting hard X-ray telescope. I worked to develop, calibrate, and test CdZnTe detectors for NuSTAR. I describe the CdZnTe detectors in comprehensive detail here - from readout procedures to data analysis. Detailed calibration of detectors is necessary for analyzing astrophysical source data obtained by the NuSTAR. I discuss the design and implementation of an automated setup for calibrating flight detectors, followed by calibration procedures and results. Neutron stars are an excellent probe of fundamental physics. The maximum mass of a neutron star can put stringent constraints on the equation of state of matter at extreme pressures and densities. From an astrophysical perspective, there are several open questions in our understanding of neutron stars. What are the birth masses of neutron stars? How do they change in binary evolution? Are there multiple mechanisms for the formation of neutron stars? Measuring masses of neutron stars helps answer these questions. Neutron stars in high-mass X-ray binaries have masses close to their birth mass, providing an opportunity to disentangle the role of "nature" and "nurture" in the observed mass distributions. In 2006, masses had been measured for only six such objects, but this small sample showed the greatest diversity in masses

Joint inventory control and pricing in a service-inventory system

DEFF Research Database (Denmark)

Marand, Ata Jalili; Li, Hongyan Jenny; Thorstenson, Anders

2017-01-01

This study addresses joint inventory control and pricing decisions for a service-inventory system. In such a system both an on-hand inventory item and a positive service time are required to fulfill customer demands. The service-inventory system also captures main features of the classical...... inventory systems with a positive processing time, e.g., make-to-order systems. In this study, the service-inventory system is modeled as an M/M/1 queue in which the customer arrival rate is price dependent. The inventory of an individual item is continuously reviewed under an (r,Q) policy....... The replenishment lead times of the inventory are exponentially distributed. Furthermore, customers arriving during stock-out periods are lost. The stochastic customer inter-arrival times, service times, and inventory replenishment lead times cause the high complexity of the problem and the difficulty in solving it...

Monte Carlo simulation of star/linear and star/star blends with chemically identical monomers

Energy Technology Data Exchange (ETDEWEB)

Theodorakis, P E [Department of Materials Science and Engineering, University of Ioannina, 45110 Ioannina (Greece); Avgeropoulos, A [Department of Materials Science and Engineering, University of Ioannina, 45110 Ioannina (Greece); Freire, J J [Departamento de Ciencias y Tecnicas FisicoquImicas, Universidad Nacional de Educacion a Distancia, Facultad de Ciencias, Senda del Rey 9, 28040 Madrid (Spain); Kosmas, M [Department of Chemistry, University of Ioannina, 45110 Ioannina (Greece); Vlahos, C [Department of Chemistry, University of Ioannina, 45110 Ioannina (Greece)

2007-11-21

The effects of chain size and architectural asymmetry on the miscibility of blends with chemically identical monomers, differing only in their molecular weight and architecture, are studied via Monte Carlo simulation by using the bond fluctuation model. Namely, we consider blends composed of linear/linear, star/linear and star/star chains. We found that linear/linear blends are more miscible than the corresponding star/star mixtures. In star/linear blends, the increase in the volume fraction of the star chains increases the miscibility. For both star/linear and star/star blends, the miscibility decreases with the increase in star functionality. When we increase the molecular weight of linear chains of star/linear mixtures the miscibility decreases. Our findings are compared with recent analytical and experimental results.

Monte Carlo simulation of star/linear and star/star blends with chemically identical monomers

Science.gov (United States)

Theodorakis, P. E.; Avgeropoulos, A.; Freire, J. J.; Kosmas, M.; Vlahos, C.

2007-11-01

The effects of chain size and architectural asymmetry on the miscibility of blends with chemically identical monomers, differing only in their molecular weight and architecture, are studied via Monte Carlo simulation by using the bond fluctuation model. Namely, we consider blends composed of linear/linear, star/linear and star/star chains. We found that linear/linear blends are more miscible than the corresponding star/star mixtures. In star/linear blends, the increase in the volume fraction of the star chains increases the miscibility. For both star/linear and star/star blends, the miscibility decreases with the increase in star functionality. When we increase the molecular weight of linear chains of star/linear mixtures the miscibility decreases. Our findings are compared with recent analytical and experimental results.

Monte Carlo simulation of star/linear and star/star blends with chemically identical monomers

International Nuclear Information System (INIS)

Theodorakis, P E; Avgeropoulos, A; Freire, J J; Kosmas, M; Vlahos, C

2007-01-01

The effects of chain size and architectural asymmetry on the miscibility of blends with chemically identical monomers, differing only in their molecular weight and architecture, are studied via Monte Carlo simulation by using the bond fluctuation model. Namely, we consider blends composed of linear/linear, star/linear and star/star chains. We found that linear/linear blends are more miscible than the corresponding star/star mixtures. In star/linear blends, the increase in the volume fraction of the star chains increases the miscibility. For both star/linear and star/star blends, the miscibility decreases with the increase in star functionality. When we increase the molecular weight of linear chains of star/linear mixtures the miscibility decreases. Our findings are compared with recent analytical and experimental results

International Space Station Aeromedical Support in Star City, Russia

Science.gov (United States)

Cole, Richard; Chamberlin, Blake; Dowell, Gene; Castleberry, Tarah; Savage, Scott

2010-01-01

The Space Medicine Division at Johnson Space Center works with the International Space Station s international partners (IP) to accomplish assigned health care tasks. Each IP may assign a flight surgeon to support their assigned crewmembers during all phases of training, in-flight operations, and postflight activities. Because of the extensive amount of astronaut training conducted in Star City; NASA, in collaboration with its IPs, has elected to keep a flight surgeon assigned to NASA s Star City office to provide support to the U.S., Canadian, Japanese, and European astronauts during hazardous training activities and provide support for any contingency landings of Soyuz spacecraft in Kazakhstan. The physician also provides support as necessary to the Mission Control Center in Moscow for non-Russian crew-related activities. In addition, the physician in Star City provides ambulatory medical care to the non-Russian-assigned personnel in Star City and visiting dependents. Additional work involves all medical supplies, administration, and inventory. The Star City physician assists in medical evacuation and/or in obtaining support from western clinics in Moscow when required care exceeds local resources. Overall, the Russians are responsible for operations and the medical care of the entire crew when training in Star City and during launch/landing operations. However, they allow international partner flight surgeons to care for their crewmembers as agreed to in the ISS Medical Operations Requirements Document. Medical support focuses on pressurized, monitored, and other hazardous training activities. One of the most important jobs is to act as a medical advocate for the astronauts and to reduce the threat that these hazardous activities pose. Although the Russians have a robust medical system, evacuation may be needed to facilitate ongoing medical care. There are several international medical evacuation companies that provide this care.

Applying inventory classification to a large inventory management system

Directory of Open Access Journals (Sweden)

Benjamin Isaac May

2017-06-01

Full Text Available Inventory classification aims to ensure that business-driving inventory items are efficiently managed in spite of constrained resources. There are numerous single- and multiple-criteria approaches to it. Our objective is to improve resource allocation to focus on items that can lead to high equipment availability. This concern is typical of many service industries such as military logistics, airlines, amusement parks and public works. Our study tests several inventory prioritization techniques and finds that a modified multi-criterion weighted non-linear optimization (WNO technique is a powerful approach for classifying inventory, outperforming traditional techniques of inventory prioritization such as ABC analysis in a variety of performance objectives.

Neutron stars

International Nuclear Information System (INIS)

Irvine, J.M.

1978-01-01

The subject is covered in chapters entitled: introduction (resume of stellar evolution, gross characteristics of neutron stars); pulsars (pulsar characteristics, pulsars as neutron stars); neutron star temperatures (neutron star cooling, superfluidity and superconductivity in neutron stars); the exterior of neutron stars (the magnetosphere, the neutron star 'atmosphere', pulses); neutron star structure; neutron star equations of state. (U.K.)

Wolf-Rayet stars in the central region of the Milky Way

Science.gov (United States)

Hamann, Wolf-Rainer; Graefener, Goetz; Oskinova, Lidia; Zinnecker, Hans

2004-09-01

We propose to take mid-IR spectra of two Wolf-Rayet stars in the inner part of our Galaxy, within 30pc projected distance from the central Black Hole. Massive stars dominate the central galactic region by their mass-loss and ionizing radiation. A quantitative analysis of this stellar inventory is essential for understanding the energy, momentum and mass budget, for instance with respect to the feeding of the central black hole. Our group developed a highly advanced model code for the expanding atmospheres of WR stars. Recently we extended the spectrum synthesis to IR wavelengths. These models will be applied for the analysis of the Spitzer IRS data. The proposed mid-IR observations will provide a wide spectral range with many lines which are needed to determine the stellar parameters, such as stellar luminosity, effective temperature, mass-loss rate and chemical composition. Near-IR spectra of the program stars are available and will augment the analysis. The capability of our code to reproduce the observed mid-IR spectrum of a WN star has been demonstrated. The two targets we selected are sufficiently isolated, while the Galactic center cluster is too crowded for the size of Spitzer's spectrograph slit. As estimated from the K-band spectra, one of the stars (WR102ka) is of very late subtype (WN9), while the other star (WR102c) has the early subtype WN6. Hence they represent different stages in the evolutionary sequence of massive stars, the late-WN just having entered the Wolf-Rayet phase and the early WN being further evolved. We expect that the parameters of massive stars in the inner galaxy differ from the usual Galactic population. One reason is that higher metallicity should lead to stronger mass-loss, which affects the stellar evolution. The Spitzer IRS, with its high sensitivity, provides a unique opportunity to study representative members of the stellar population in the vicinity of the Galactic center.

Inventory parameters

CERN Document Server

Sharma, Sanjay

2017-01-01

This book provides a detailed overview of various parameters/factors involved in inventory analysis. It especially focuses on the assessment and modeling of basic inventory parameters, namely demand, procurement cost, cycle time, ordering cost, inventory carrying cost, inventory stock, stock out level, and stock out cost. In the context of economic lot size, it provides equations related to the optimum values. It also discusses why the optimum lot size and optimum total relevant cost are considered to be key decision variables, and uses numerous examples to explain each of these inventory parameters separately. Lastly, it provides detailed information on parameter estimation for different sectors/products. Written in a simple and lucid style, it offers a valuable resource for a broad readership, especially Master of Business Administration (MBA) students.

Neutron Star Science with the NuSTAR

Energy Technology Data Exchange (ETDEWEB)

Vogel, J. K. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

2015-10-16

The Nuclear Spectroscopic Telescope Array (NuSTAR), launched in June 2012, helped scientists obtain for the first time a sensitive high-­energy X-­ray map of the sky with extraordinary resolution. This pioneering telescope has aided in the understanding of how stars explode and neutron stars are born. LLNL is a founding member of the NuSTAR project, with key personnel on its optics and science team. We used NuSTAR to observe and analyze the observations of different neutron star classes identified in the last decade that are still poorly understood. These studies not only help to comprehend newly discovered astrophysical phenomena and emission processes for members of the neutron star family, but also expand the utility of such observations for addressing broader questions in astrophysics and other physics disciplines. For example, neutron stars provide an excellent laboratory to study exotic and extreme phenomena, such as the equation of state of the densest matter known, the behavior of matter in extreme magnetic fields, and the effects of general relativity. At the same time, knowing their accurate populations has profound implications for understanding the life cycle of massive stars, star collapse, and overall galactic evolution.

O stars and Wolf-Rayet stars

International Nuclear Information System (INIS)

Conti, P.S.; Underhill, A.B.; Jordan, S.; Thomas, R.

1988-01-01

Basic information is given about O and Wolf-Rayet stars indicating how these stars are defined and what their chief observable properties are. Part 2 of the volume discussed four related themes pertaining to the hottest and most luminous stars. Presented are: an observational overview of the spectroscopic classification and extrinsic properties of O and Wolf-Rayet stars; the intrinsic parameters of luminosity, effective temperature, mass, and composition of the stars, and a discussion of their viability; stellar wind properties; and the related issues concerning the efforts of stellar radiation and wind on the immediate interstellar environment are presented

O stars and Wolf-Rayet stars

Science.gov (United States)

Conti, Peter S.; Underhill, Anne B.; Jordan, Stuart (Editor); Thomas, Richard (Editor)

1988-01-01

Basic information is given about O and Wolf-Rayet stars indicating how these stars are defined and what their chief observable properties are. Part 2 of the volume discussed four related themes pertaining to the hottest and most luminous stars. Presented are: an observational overview of the spectroscopic classification and extrinsic properties of O and Wolf-Rayet stars; the intrinsic parameters of luminosity, effective temperature, mass, and composition of the stars, and a discussion of their viability; stellar wind properties; and the related issues concerning the efforts of stellar radiation and wind on the immediate interstellar environment are presented.

A robust star identification algorithm with star shortlisting

Science.gov (United States)

Mehta, Deval Samirbhai; Chen, Shoushun; Low, Kay Soon

2018-05-01

A star tracker provides the most accurate attitude solution in terms of arc seconds compared to the other existing attitude sensors. When no prior attitude information is available, it operates in "Lost-In-Space (LIS)" mode. Star pattern recognition, also known as star identification algorithm, forms the most crucial part of a star tracker in the LIS mode. Recognition reliability and speed are the two most important parameters of a star pattern recognition technique. In this paper, a novel star identification algorithm with star ID shortlisting is proposed. Firstly, the star IDs are shortlisted based on worst-case patch mismatch, and later stars are identified in the image by an initial match confirmed with a running sequential angular match technique. The proposed idea is tested on 16,200 simulated star images having magnitude uncertainty, noise stars, positional deviation, and varying size of the field of view. The proposed idea is also benchmarked with the state-of-the-art star pattern recognition techniques. Finally, the real-time performance of the proposed technique is tested on the 3104 real star images captured by a star tracker SST-20S currently mounted on a satellite. The proposed technique can achieve an identification accuracy of 98% and takes only 8.2 ms for identification on real images. Simulation and real-time results depict that the proposed technique is highly robust and achieves a high speed of identification suitable for actual space applications.

Star-Branched Polymers (Star Polymers)

KAUST Repository

Hirao, Akira

2015-09-01

The synthesis of well-defined regular and asymmetric mixed arm (hereinafter miktoarm) star-branched polymers by the living anionic polymerization is reviewed in this chapter. In particular, much attention is being devoted to the synthetic development of miktoarm star polymers since 2000. At the present time, the almost all types of multiarmed and multicomponent miktoarm star polymers have become feasible by using recently developed iterative strategy. For example, the following well-defined stars have been successfully synthesized: 3-arm ABC, 4-arm ABCD, 5-arm ABCDE, 6-arm ABCDEF, 7-arm ABCDEFG, 6-arm ABC, 9-arm ABC, 12-arm ABC, 13-arm ABCD, 9-arm AB, 17-arm AB, 33-arm AB, 7-arm ABC, 15-arm ABCD, and 31-arm ABCDE miktoarm star polymers, most of which are quite new and difficult to synthesize by the end of the 1990s. Several new specialty functional star polymers composed of vinyl polymer segments and rigid rodlike poly(acetylene) arms, helical polypeptide, or helical poly(hexyl isocyanate) arms are introduced.

Forest inventory in Myanmar

Energy Technology Data Exchange (ETDEWEB)

Bo, Sit [Forest Resource Div., Forest Department (Myanmar)

1993-10-01

Forest inventory in Myanmar started in 1850s. Up till 1975, Myanmar Forest Department conducted forest inventories covering approximately one forest division every year. The National Forest Survey and Inventory Project funded by UNDP and assisted by FAO commenced in 1981 and the National Forest Management and Inventory project followed in 1986. Up till end March 1993, pre-investment inventory has covered 26.7 million acres, reconnaissance inventory 5.4 million acres and management inventory has carried out in 12 townships

Forest inventory in Myanmar

International Nuclear Information System (INIS)

Sit Bo

1993-01-01

Forest inventory in Myanmar started in 1850s. Up till 1975, Myanmar Forest Department conducted forest inventories covering approximately one forest division every year. The National Forest Survey and Inventory Project funded by UNDP and assisted by FAO commenced in 1981 and the National Forest Management and Inventory project followed in 1986. Up till end March 1993, pre-investment inventory has covered 26.7 million acres, reconnaissance inventory 5.4 million acres and management inventory has carried out in 12 townships

Interactive Inventory Monitoring

Science.gov (United States)

Garud, Sumedha

2013-01-01

Method and system for monitoring present location and/or present status of a target inventory item, where the inventory items are located on one or more inventory shelves or other inventory receptacles that communicate with an inventory base station through use of responders such as RFIDs. A user operates a hand held interrogation and display (lAD) module that communicates with, or is part of the base station to provide an initial inquiry. lnformation on location(s) of the larget invenlory item is also indicated visibly and/or audibly on the receptacle(s) for the user. Status information includes an assessment of operation readiness and a time, if known, that the specified inventory item or class was last removed or examined or modified. Presentation of a user access level may be required for access to the target inventgory item. Another embodiment provides inventory informatin for a stack as a sight-impaired or hearing-impaired person adjacent to that stack.

Statistical investigation of flare stars. III. Flare stars in the general galactic star field

International Nuclear Information System (INIS)

Mirzoyan, L.V.; Ambaryan, V.V.; Garibdzhanyan, A.T.; Mirzoyan, A.L.

1989-01-01

Some questions relating to the existence of a large number of flare stars in the general star field of the Galaxy are discussed. It is shown that only a small proportion of them can be found by photographic observations, and the fraction of field flare stars among such stars found in the regions of star clusters and associations does not exceed 10%. The ratio of the numbers of flare stars of the foreground and the background for a particular system depends on its distance, reaching zero at a distance of about 500 pc. The spatial density of flare stars in the Pleiades is at least two orders of magnitude greater than in the general galactic field. A lower limit for the number of flare stars in the Galaxy is estimated at 4.2 ·10 9 , and the number of nonflare red dwarfs at 2.1·10 10 . There are grounds for believing that they were all formed in star clusters and associations

Neutron star/red giant encounters in globular clusters

International Nuclear Information System (INIS)

Bailyn, C.D.

1988-01-01

The author presents a simple expression for the amount by which xsub(crit) is diminished as a star evolves xsub(crit) Rsub(crit)/R*, where Rsub(crit) is the maximum distance of closest approach between two stars for which the tidal energy is sufficient to bind the system, and R* is the radius of the star on which tides are being raised. Also it is concluded that tidal capture of giants by neutron stars resulting in binary systems is unlikely in globular clusters. However, collisions between neutron stars and red giants, or an alternative process involving tidal capture of a main-sequence star into an initially detached binary system, may result either in rapidly rotating neutron stars or in white dwarf/neutron star binaries. (author)

Symbiotic stars

International Nuclear Information System (INIS)

Boyarchuk, A.A.

1975-01-01

There are some arguments that the symbiotic stars are binary, where one component is a red giant and the other component is a small hot star which is exciting a nebula. The symbiotic stars belong to the old disc population. Probably, symbiotic stars are just such an evolutionary stage for double stars as planetary nebulae for single stars. (Auth.)

Quark core stars, quark stars and strange stars

International Nuclear Information System (INIS)

Grassi, F.

1988-01-01

A recent one flavor quark matter equation of state is generalized to several flavors. It is shown that quarks undergo a first order phase transition. In addition, this equation of state depends on just one parameter in the two flavor case, two parameters in the three flavor case, and these parameters are constrained by phenomenology. This equation of state is then applied to the hadron-quark transition in neutron stars and the determination of quark star stability, the investigation of strange matter stability and possible strange star existence. 43 refs., 6 figs

Kinematic and spatial distributions of barium stars - are the barium stars and Am stars related?

International Nuclear Information System (INIS)

Hakkila, J.

1989-01-01

The possibility of an evolutionary link between Am stars and barium stars is considered, and an examination of previous data suggests that barium star precursors are main-sequence stars of intermediate mass, are most likely A and/or F dwarfs, and are intermediate-mass binaries with close to intermediate orbital separations. The possible role of mass transfer in the later development of Am systems is explored. Mass transfer and loss from systems with a range of masses and orbital separations may explain such statistical peculiarities of barium stars as the large dispersion in absolute magnitude, the large range of elemental abundances from star to star, and the small number of stars with large peculiar velocities. 93 refs

Competition model for aperiodic stochastic resonance in a Fitzhugh-Nagumo model of cardiac sensory neurons.

Science.gov (United States)

Kember, G C; Fenton, G A; Armour, J A; Kalyaniwalla, N

2001-04-01

Regional cardiac control depends upon feedback of the status of the heart from afferent neurons responding to chemical and mechanical stimuli as transduced by an array of sensory neurites. Emerging experimental evidence shows that neural control in the heart may be partially exerted using subthreshold inputs that are amplified by noisy mechanical fluctuations. This amplification is known as aperiodic stochastic resonance (ASR). Neural control in the noisy, subthreshold regime is difficult to see since there is a near absence of any correlation between input and the output, the latter being the average firing (spiking) rate of the neuron. This lack of correlation is unresolved by traditional energy models of ASR since these models are unsuitable for identifying "cause and effect" between such inputs and outputs. In this paper, the "competition between averages" model is used to determine what portion of a noisy, subthreshold input is responsible, on average, for the output of sensory neurons as represented by the Fitzhugh-Nagumo equations. A physiologically relevant conclusion of this analysis is that a nearly constant amount of input is responsible for a spike, on average, and this amount is approximately independent of the firing rate. Hence, correlation measures are generally reduced as the firing rate is lowered even though neural control under this model is actually unaffected.

A Brightness-Referenced Star Identification Algorithm for APS Star Trackers

Science.gov (United States)

Zhang, Peng; Zhao, Qile; Liu, Jingnan; Liu, Ning

2014-01-01

Star trackers are currently the most accurate spacecraft attitude sensors. As a result, they are widely used in remote sensing satellites. Since traditional charge-coupled device (CCD)-based star trackers have a limited sensitivity range and dynamic range, the matching process for a star tracker is typically not very sensitive to star brightness. For active pixel sensor (APS) star trackers, the intensity of an imaged star is valuable information that can be used in star identification process. In this paper an improved brightness referenced star identification algorithm is presented. This algorithm utilizes the k-vector search theory and adds imaged stars' intensities to narrow the search scope and therefore increase the efficiency of the matching process. Based on different imaging conditions (slew, bright bodies, etc.) the developed matching algorithm operates in one of two identification modes: a three-star mode, and a four-star mode. If the reference bright stars (the stars brighter than three magnitude) show up, the algorithm runs the three-star mode and efficiency is further improved. The proposed method was compared with other two distinctive methods the pyramid and geometric voting methods. All three methods were tested with simulation data and actual in orbit data from the APS star tracker of ZY-3. Using a catalog composed of 1500 stars, the results show that without false stars the efficiency of this new method is 4∼5 times that of the pyramid method and 35∼37 times that of the geometric method. PMID:25299950

Design and application of star map simulation system for star sensors

Science.gov (United States)

Wu, Feng; Shen, Weimin; Zhu, Xifang; Chen, Yuheng; Xu, Qinquan

2013-12-01

Modern star sensors are powerful to measure attitude automatically which assure a perfect performance of spacecrafts. They achieve very accurate attitudes by applying algorithms to process star maps obtained by the star camera mounted on them. Therefore, star maps play an important role in designing star cameras and developing procession algorithms. Furthermore, star maps supply significant supports to exam the performance of star sensors completely before their launch. However, it is not always convenient to supply abundant star maps by taking pictures of the sky. Thus, star map simulation with the aid of computer attracts a lot of interests by virtue of its low price and good convenience. A method to simulate star maps by programming and extending the function of the optical design program ZEMAX is proposed. The star map simulation system is established. Firstly, based on analyzing the working procedures of star sensors to measure attitudes and the basic method to design optical system by ZEMAX, the principle of simulating star sensor imaging is given out in detail. The theory about adding false stars and noises, and outputting maps is discussed and the corresponding approaches are proposed. Then, by external programming, the star map simulation program is designed and produced. Its user interference and operation are introduced. Applications of star map simulation method in evaluating optical system, star image extraction algorithm and star identification algorithm, and calibrating system errors are presented completely. It was proved that the proposed simulation method provides magnificent supports to the study on star sensors, and improves the performance of star sensors efficiently.

TOPoS. IV. Chemical abundances from high-resolution observations of seven extremely metal-poor stars

Science.gov (United States)

Bonifacio, P.; Caffau, E.; Spite, M.; Spite, F.; Sbordone, L.; Monaco, L.; François, P.; Plez, B.; Molaro, P.; Gallagher, A. J.; Cayrel, R.; Christlieb, N.; Klessen, R. S.; Koch, A.; Ludwig, H.-G.; Steffen, M.; Zaggia, S.; Abate, C.

2018-04-01

Context. Extremely metal-poor (EMP) stars provide us with indirect information on the first generations of massive stars. The TOPoS survey has been designed to increase the census of these stars and to provide a chemical inventory that is as detailed as possible. Aims: Seven of the most iron-poor stars have been observed with the UVES spectrograph at the ESO VLT Kueyen 8.2 m telescope to refine their chemical composition. Methods: We analysed the spectra based on 1D LTE model atmospheres, but also used 3D hydrodynamical simulations of stellar atmospheres. Results: We measured carbon in six of the seven stars: all are carbon-enhanced and belong to the low-carbon band, defined in the TOPoS II paper. We measured lithium (A(Li) = 1.9) in the most iron-poor star (SDSS J1035+0641, [Fe/H] measure Li in three stars at [Fe/H] -4.0, two of which lie on the Spite plateau. We confirm that SDSS J1349+1407 is extremely rich in Mg, but not in Ca. It is also very rich in Na. Several of our stars are characterised by low α-to-iron ratios. Conclusions: The lack of high-carbon band stars at low metallicity can be understood in terms of evolutionary timescales of binary systems. The detection of Li in SDSS J1035+0641 places a strong constraint on theories that aim at solving the cosmological lithium problem. The Li abundance of the two warmer stars at [Fe/H] -4.0 places them on the Spite plateau, while the third, cooler star, lies below. We argue that this suggests that the temperature at which Li depletion begins increases with decreasing [Fe/H]. SDSS J1349+1407 may belong to a class of Mg-rich EMP stars. We cannot assess if there is a scatter in α-to-iron ratios among the EMP stars or if there are several discrete populations. However, the existence of stars with low α-to-iron ratios is supported by our observations. Based on observations obtained at ESO Paranal Observatory, Programmes 189.D-0165,090.D-0306, 093.D-0136, and 096.D-0468.

Regular Generalized Star Star closed sets in Bitopological Spaces

OpenAIRE

K. Kannan; D. Narasimhan; K. Chandrasekhara Rao; R. Ravikumar

2011-01-01

The aim of this paper is to introduce the concepts of τ1τ2-regular generalized star star closed sets , τ1τ2-regular generalized star star open sets and study their basic properties in bitopological spaces.

Procedure for taking physical inventories

International Nuclear Information System (INIS)

Anon.

1981-01-01

This session is intended to apprise one of the various aspects of procedures and routines that Exxon Nuclear uses with respect to its nuclear materials physical inventory program. The presentation describes how plant physical inventories are planned and taken. The description includes the planning and preparation for taking the inventory, the clean-out procedures for converting in-process material to measurable items, the administrative procedures for establishing independent inventory teams and for inventorying each inventory area, the verification procedures used to include previously measured tamper-safed items in the inventory, and lastly, procedures used to reconcile the inventory and calculate MUF (materials unaccounted for). The purpose of the session is to enable participants to: (1) understand the planning and pre-inventorty procedures and their importance; (2) understand the need for and the required intensity of clean-out procedures; (3) understand how inventory teams are formed, and how the inventory is conducted; (4) understand the distinction between inventory previously measured tamper-safed items and other materials not so characterized; (5) understand the reconciliation procedures; and (6) calculate a MUF given the book and inventory results

Quantum discord and classical correlation signatures of mobility edges in one-dimensional aperiodic single-electron systems

International Nuclear Information System (INIS)

Gong, Longyan; Zhu, Hao; Zhao, Shengmei; Cheng, Weiwen; Sheng, Yubo

2012-01-01

We investigate numerically the quantum discord and the classical correlation in a one-dimensional slowly varying potential model and a one-dimensional Soukoulis–Economou ones, respectively. There are well-defined mobility edges in the slowly varying potential model, while there are discrepancies on mobility edges in the Soukoulis–Economou ones. In the slowly varying potential model, we find that extended and localized states can be distinguished by both the quantum discord and the classical correlation. There are sharp transitions in the quantum discord and the classical correlation at mobility edges. Based on these, we study “mobility edges” in the Soukoulis–Economou model using the quantum discord and the classical correlation, which gives another perspectives for these “mobility edges”. All these provide us good quantities, i.e., the quantum discord and the classical correlation, to reflect mobility edges in these one-dimensional aperiodic single-electron systems. Moreover, our studies propose a consistent interpretation of the discrepancies between previous numerical results about the Soukoulis–Economou model. -- Highlights: ► Quantum discord and classical correlation can signal mobility edges in two models. ► An interpretation for mobility edges in the Soukoulis–Economou model is proposed. ► Quantum discord and classical correlation can reflect well localization properties.

I-Love relations for incompressible stars and realistic stars

Science.gov (United States)

Chan, T. K.; Chan, AtMa P. O.; Leung, P. T.

2015-02-01

In spite of the diversity in the equations of state of nuclear matter, the recently discovered I-Love-Q relations [Yagi and Yunes, Science 341, 365 (2013), 10.1126/science.1236462], which relate the moment of inertia, tidal Love number (deformability), and the spin-induced quadrupole moment of compact stars, hold for various kinds of realistic neutron stars and quark stars. While the physical origin of such universality is still a current issue, the observation that the I-Love-Q relations of incompressible stars can well approximate those of realistic compact stars hints at a new direction to approach the problem. In this paper, by establishing recursive post-Minkowskian expansion for the moment of inertia and the tidal deformability of incompressible stars, we analytically derive the I-Love relation for incompressible stars and show that the so-obtained formula can be used to accurately predict the behavior of realistic compact stars from the Newtonian limit to the maximum mass limit.

Inventory - Dollars and sense

International Nuclear Information System (INIS)

Samson, J.R.

1992-01-01

Nuclear utilities are becoming more aware of the importance of having an inventory investment that supports two opposing philosophies. The business philosophy wants a minimal inventory investment to support a better return on invested dollars. This increase in return comes from having the dollars available to invest versus having the money tied up in inventory sitting on the shelf. The opposing viewpoint is taken by maintenance/operations organizations, which desire the maximum inventory available on-site to repair any component at any time to keep the units on-line at all times. Financial managers also want to maintain cash flow throughout operations so that plants run without interruptions. Inventory management is therefore a mixture of financial logistics with an operation perspective in mind. A small amount of common sense and accurate perception also help. The challenge to the materials/inventory manager is to optimize effectiveness of the inventory by having high material availability at the lowest possible cost

Search for OB stars running away from young star clusters. II. The NGC 6357 star-forming region

Science.gov (United States)

Gvaramadze, V. V.; Kniazev, A. Y.; Kroupa, P.; Oh, S.

2011-11-01

Dynamical few-body encounters in the dense cores of young massive star clusters are responsible for the loss of a significant fraction of their massive stellar content. Some of the escaping (runaway) stars move through the ambient medium supersonically and can be revealed via detection of their bow shocks (visible in the infrared, optical or radio). In this paper, which is the second of a series of papers devoted to the search for OB stars running away from young ( ≲ several Myr) Galactic clusters and OB associations, we present the results of the search for bow shocks around the star-forming region NGC 6357. Using the archival data of the Midcourse Space Experiment (MSX) satellite and the Spitzer Space Telescope, and the preliminary data release of the Wide-Field Infrared Survey Explorer (WISE), we discovered seven bow shocks, whose geometry is consistent with the possibility that they are generated by stars expelled from the young (~1-2 Myr) star clusters, Pismis 24 and AH03 J1725-34.4, associated with NGC 6357. Two of the seven bow shocks are driven by the already known OB stars, HD 319881 and [N78] 34. Follow-up spectroscopy of three other bow-shock-producing stars showed that they are massive (O-type) stars as well, while the 2MASS photometry of the remaining two stars suggests that they could be B0 V stars, provided that both are located at the same distance as NGC 6357. Detection of numerous massive stars ejected from the very young clusters is consistent with the theoretical expectation that star clusters can effectively lose massive stars at the very beginning of their dynamical evolution (long before the second mechanism for production of runaway stars, based on a supernova explosion in a massive tight binary system, begins to operate) and lends strong support to the idea that probably all field OB stars have been dynamically ejected from their birth clusters. A by-product of our search for bow shocks around NGC 6357 is the detection of three circular

Do All O Stars Form in Star Clusters?

Science.gov (United States)

Weidner, C.; Gvaramadze, V. V.; Kroupa, P.; Pflamm-Altenburg, J.

The question whether or not massive stars can form in isolation or only in star clusters is of great importance for the theory of (massive) star formation as well as for the stellar initial mass function of whole galaxies (IGIMF-theory). While a seemingly easy question it is rather difficult to answer. Several physical processes (e.g. star-loss due to stellar dynamics or gas expulsion) and observational limitations (e.g. dust obscuration of young clusters, resolution) pose severe challenges to answer this question. In this contribution we will present the current arguments in favour and against the idea that all O stars form in clusters.

Giant CP stars

International Nuclear Information System (INIS)

Loden, L.O.; Sundman, A.

1989-01-01

This study is part of an investigation of the possibility of using chemically peculiar (CP) stars to map local galactic structure. Correct luminosities of these stars are therefore crucial. CP stars are generally regarded as main-sequence or near-main-sequence objects. However, some CP stars have been classified as giants. A selection of stars, classified in literature as CP giants, are compared to normal stars in the same effective temperature interval and to ordinary 'non giant' CP stars. There is no clear confirmation of a higher luminosity for 'CP giants', than for CP stars in general. In addition, CP characteristics seem to be individual properties not repeated in a component star or other cluster members. (author). 50 refs., 5 tabs., 3 figs

Bursting star formation and the overabundance of Wolf-Rayet stars

International Nuclear Information System (INIS)

Bodigfee, G.; Deloore, C.

1985-01-01

The ratio of the number of WR-stars to their OB progenitors appears to be significantly higher in some extragalactic systems than in our Galaxy. This overabundance of Wolf-Rayet-stars can be explained as a consequence of a recent burst of star formation. It is suggested that this burst is the manifestation of a long period nonlinear oscillation in the star formation process, produced by positive feedback effects between young stars and the interstellar medium. Star burst galaxies with large numbers of WR-stars must generate gamma fluxes but due to the distance, all of them are beyond the reach of present-day detectors, except probably 30 Dor

Inventory control strategies

International Nuclear Information System (INIS)

Primrose, D.

1998-01-01

Finning International Inc. is in the business of selling, financing and servicing Caterpillar and complementary equipment. Its main markets are in western Canada, Britain and Chile. This paper discusses the parts inventory strategies system for Finning (Canada). The company's territory covers British Columbia, Alberta, the Yukon and the Northwest Territories. Finning's parts inventory consists of 80,000 component units valued at more than $150 M. Distribution centres are located in Langley, British Columbia and Edmonton, Alberta. To make inventory and orders easier to control, Finning has designed a computer-based system, with software written exclusively for Caterpillar dealers. The system makes use of a real time electronic interface with all Finning locations, plus all Caterpillar facilities and other dealers in North America. Details of the system are discussed, including territorial stocking procedures, addition to stock, exhaustion of stock, automatic/suggest order controls, surplus inventory management, and procedures for jointly managed inventory. 3 tabs., 1 fig

TRIGGERED STAR FORMATION SURROUNDING WOLF-RAYET STAR HD 211853

Energy Technology Data Exchange (ETDEWEB)

Liu Tie; Wu Yuefang; Zhang Huawei [Department of Astronomy, Peking University, 100871 Beijing (China); Qin Shengli, E-mail: liutiepku@gmail.com [I. Physikalisches Institut, Universitaet zu Koeln, Zuelpicher Str. 77, 50937 Koeln (Germany)

2012-05-20

The environment surrounding Wolf-Rayet (W-R) star HD 211853 is studied in molecular, infrared, as well as radio, and H I emission. The molecular ring consists of well-separated cores, which have a volume density of 10{sup 3} cm{sup -3} and kinematic temperature {approx}20 K. Most of the cores are under gravitational collapse due to external pressure from the surrounding ionized gas. From the spectral energy distribution modeling toward the young stellar objects, the sequential star formation is revealed on a large scale in space spreading from the W-R star to the molecular ring. A small-scale sequential star formation is revealed toward core 'A', which harbors a very young star cluster. Triggered star formations are thus suggested. The presence of the photodissociation region, the fragmentation of the molecular ring, the collapse of the cores, and the large-scale sequential star formation indicate that the 'collect and collapse' process functions in this region. The star-forming activities in core 'A' seem to be affected by the 'radiation-driven implosion' process.

TRIGGERED STAR FORMATION SURROUNDING WOLF-RAYET STAR HD 211853

International Nuclear Information System (INIS)

Liu Tie; Wu Yuefang; Zhang Huawei; Qin Shengli

2012-01-01

The environment surrounding Wolf-Rayet (W-R) star HD 211853 is studied in molecular, infrared, as well as radio, and H I emission. The molecular ring consists of well-separated cores, which have a volume density of 10 3 cm –3 and kinematic temperature ∼20 K. Most of the cores are under gravitational collapse due to external pressure from the surrounding ionized gas. From the spectral energy distribution modeling toward the young stellar objects, the sequential star formation is revealed on a large scale in space spreading from the W-R star to the molecular ring. A small-scale sequential star formation is revealed toward core 'A', which harbors a very young star cluster. Triggered star formations are thus suggested. The presence of the photodissociation region, the fragmentation of the molecular ring, the collapse of the cores, and the large-scale sequential star formation indicate that the 'collect and collapse' process functions in this region. The star-forming activities in core 'A' seem to be affected by the 'radiation-driven implosion' process.

STAR Infrastructure Database: An effort to know each other

Energy Technology Data Exchange (ETDEWEB)

Mora, J.C.; Real, Almudena [Centro de Investigaciones Energeticas, Medioambientales y Tecnologicas - CIEMAT (Spain); Vesterbacka, Pia; Outola, Iisa [STUK - Radiation and Nuclear Safety Authority (Finland); Barnett, Catherine; Beresford, Nick [Natural Environment Research Council - NERC-CEH (United Kingdom); Bradshaw, Clare [Stockholm University (Sweden); Skipperud, Lindis [Norwegian University of Life Sciences - UMB (Norway); Wilrodt, Christine; Steiner, Martin [Federal Office for Radiation Protection - BfS (Germany); Vanhoudt, Nathalie [Belgian Nuclear Research Centre SCK-CEN (Belgium); Komperoed, Mari [Norwegian Radiation Protection Authority - NRPA (Norway); Gurriaran, Rodolfo; Gilbin, Rodolphe; Hinton, Thomas [Institut de Radioprotection et de Surete Nucleaire - IRSN (France)

2014-07-01

Effort over the last decade to make radioecology stronger and sustainable within Europe crystallized in the creation of the European Radioecology Alliance. The first step for this integrative effort was the establishment of a network of excellence (NoE) under the EU FP7 Strategy for Allied Radioecology (STAR www.star-radioecology.org) project which commenced in 2011. One of the project objectives was to share knowledge of European radioecological capabilities. To help achieve this, a register of these capabilities at each of the STAR laboratories has been created. An Infrastructure Database was designed and programmed using web 2.0 technologies on a 'wiki' platform. Its intended use was to identify what assets were held and where improvements could be made. Information collated includes an inventory of the radioanalytical or conventional equipment and methods, bio-informatics equipment and methods, sample and data archives held, and models and codes used. It also provides a summary of the radioecological expertise of the 170 radio-ecologists at STAR institutes whose knowledge is wide-ranging and encompasses: atmospheric dispersion, dosimetry, ecology, ecotoxicology, environmental radiation protection, environmental surveillance, foodstuffs, terrestrial, freshwater and marine radioecology, modelling, radiobiology and radionuclide analyses, emergency preparedness, education and training, amongst others. In 2013, the EU FP7 Coordination and implementation of a pan-European instrument for radioecology (COMET, www.comet-radioecology.org) project, involving the STAR partners and additionally one Japanese and two Ukrainian research institutes, was initiated. The capabilities of these additional partners will be added to the database in 2014. The aim of the database was to gather information to: - avoid duplication of effort and thereby increase efficiency, - improve synergy and collaboration between the STAR project partners and others involved in

TOWARD COMPLETE STATISTICS OF MASSIVE BINARY STARS: PENULTIMATE RESULTS FROM THE CYGNUS OB2 RADIAL VELOCITY SURVEY

Energy Technology Data Exchange (ETDEWEB)

Kobulnicky, Henry A.; Lundquist, Michael J.; Burke, Jamison; Chapman, James; Keller, Erica; Lester, Kathryn; Rolen, Emily K.; Topel, Eric; Bhattacharjee, Anirban; Smullen, Rachel A.; Álvarez, Carlos A. Vargas; Runnoe, Jessie C.; Dale, Daniel A.; Brotherton, Michael M. [Department of Physics and Astronomy, University of Wyoming, Laramie, WY 82070 (United States); Kiminki, Daniel C., E-mail: chipk@uwyo.edu, E-mail: jburke2@swarthmore.edu, E-mail: jc6380@mcla.edu, E-mail: kelle22e@mtholyoke.edu, E-mail: kvl214@lehigh.edu, E-mail: emily.k.rolen@vanderbilt.edu, E-mail: topel@stolaf.edu [Department of Astronomy, University of Arizona, Tucson, AZ 85721 (United States)

2014-08-01

We analyze orbital solutions for 48 massive multiple-star systems in the Cygnus OB2 association, 23 of which are newly presented here, to find that the observed distribution of orbital periods is approximately uniform in log P for P < 45 days, but it is not scale-free. Inflections in the cumulative distribution near 6 days, 14 days, and 45 days suggest key physical scales of ≅0.2, ≅0.4, and ≅1 A.U. where yet-to-be-identified phenomena create distinct features. No single power law provides a statistically compelling prescription, but if features are ignored, a power law with exponent β ≅ –0.22 provides a crude approximation over P = 1.4-2000 days, as does a piece-wise linear function with a break near 45 days. The cumulative period distribution flattens at P > 45 days, even after correction for completeness, indicating either a lower binary fraction or a shift toward low-mass companions. A high degree of similarity (91% likelihood) between the Cyg OB2 period distribution and that of other surveys suggests that the binary properties at P ≲ 25 days are determined by local physics of disk/clump fragmentation and are relatively insensitive to environmental and evolutionary factors. Fully 30% of the unbiased parent sample is a binary with period P < 45 days. Completeness corrections imply a binary fraction near 55% for P < 5000 days. The observed distribution of mass ratios 0.2 < q < 1 is consistent with uniform, while the observed distribution of eccentricities 0.1 < e < 0.6 is consistent with uniform plus an excess of e ≅ 0 systems. We identify six stars, all supergiants, that exhibit aperiodic velocity variations of ∼30 km s{sup –1} attributed to atmospheric fluctuations.

Star Polymers.

Science.gov (United States)

Ren, Jing M; McKenzie, Thomas G; Fu, Qiang; Wong, Edgar H H; Xu, Jiangtao; An, Zesheng; Shanmugam, Sivaprakash; Davis, Thomas P; Boyer, Cyrille; Qiao, Greg G

2016-06-22

Recent advances in controlled/living polymerization techniques and highly efficient coupling chemistries have enabled the facile synthesis of complex polymer architectures with controlled dimensions and functionality. As an example, star polymers consist of many linear polymers fused at a central point with a large number of chain end functionalities. Owing to this exclusive structure, star polymers exhibit some remarkable characteristics and properties unattainable by simple linear polymers. Hence, they constitute a unique class of technologically important nanomaterials that have been utilized or are currently under audition for many applications in life sciences and nanotechnologies. This article first provides a comprehensive summary of synthetic strategies towards star polymers, then reviews the latest developments in the synthesis and characterization methods of star macromolecules, and lastly outlines emerging applications and current commercial use of star-shaped polymers. The aim of this work is to promote star polymer research, generate new avenues of scientific investigation, and provide contemporary perspectives on chemical innovation that may expedite the commercialization of new star nanomaterials. We envision in the not-too-distant future star polymers will play an increasingly important role in materials science and nanotechnology in both academic and industrial settings.

Wolf-Rayet stars

Energy Technology Data Exchange (ETDEWEB)

Sahade, J

1981-12-01

Aspects of the problems of the Wolf-Rayet stars related to their chemical composition, their evolutionary status, and their apparent dichotomy in two spectral sequences are discussed. Dogmas concerning WR stars are critically discussed, including the belief that WR stars lack hydrogen, that they are helium stars evolved from massive close binaries, and the existence of a second WR stage in which the star is a short-period single-lined binary. The relationship of WR stars with planetary nebulae is addressed, as is the membership of these stars in clusters and associations. The division of WR stars into WN and WC sequences is considered, questioning the reasonability of accounting for WR line formation in terms of abundance differences.

INVENTORY MANAGEMENT IN THE ENTERPRISE THROUGH THE APPLICATION OF IFRS 2 INVENTORIES

Directory of Open Access Journals (Sweden)

Svetlozar Stefanov

2016-07-01

Full Text Available The focus in the article is on the issues of valuation and presentation of the inventories under the meaning on the International Accounting Standard 2 Inventories. The Standard provides guidance on the determination of costs of finished products and its recognition as and expense in the production and sale finished products, including guidance for determination of the net realizable value. The latter is defined as the estimated selling price less the estimated costs of completion and estimated costs necessary to make the sale. The cost of inventories comprises all costs of purchase, cost of conversion and other costs incurred in bringing the inventories to a condition suitable for subsequent use. The amount of the cost for materials used or products sold and the finished product is determined using one of the following methods: a specifically defined value, first-in � first out or weighted average cost of lots delivered. When inventories are sold, the carrying amount of those inventories is recognized as an expense in the period in which the related sales revenue is recognized. The amount of any write-down of inventories to net realizable value is recorded as a current expense and is recognized as an expense in the period the write-down occurs.

StarDOM: From STAR format to XML

International Nuclear Information System (INIS)

Linge, Jens P.; Nilges, Michael; Ehrlich, Lutz

1999-01-01

StarDOM is a software package for the representation of STAR files as document object models and the conversion of STAR files into XML. This allows interactive navigation by using the Document Object Model representation of the data as well as easy access by XML query languages. As an example application, the entire BioMagResBank has been transformed into XML format. Using an XML query language, statistical queries on the collected NMR data sets can be constructed with very little effort. The BioMagResBank/XML data and the software can be obtained at http://www.nmr.embl-heidelberg.de/nmr/StarDOM/

Estimating dead wood during national forest inventories: a review of inventory methodologies and suggestions for harmonization.

Science.gov (United States)

Woodall, Christopher W; Rondeux, Jacques; Verkerk, Pieter J; Ståhl, Göran

2009-10-01

Efforts to assess forest ecosystem carbon stocks, biodiversity, and fire hazards have spurred the need for comprehensive assessments of forest ecosystem dead wood (DW) components around the world. Currently, information regarding the prevalence, status, and methods of DW inventories occurring in the world's forested landscapes is scattered. The goal of this study is to describe the status, DW components measured, sample methods employed, and DW component thresholds used by national forest inventories that currently inventory DW around the world. Study results indicate that most countries do not inventory forest DW. Globally, we estimate that about 13% of countries inventory DW using a diversity of sample methods and DW component definitions. A common feature among DW inventories was that most countries had only just begun DW inventories and employ very low sample intensities. There are major hurdles to harmonizing national forest inventories of DW: differences in population definitions, lack of clarity on sample protocols/estimation procedures, and sparse availability of inventory data/reports. Increasing database/estimation flexibility, developing common dimensional thresholds of DW components, publishing inventory procedures/protocols, releasing inventory data/reports to international peer review, and increasing communication (e.g., workshops) among countries inventorying DW are suggestions forwarded by this study to increase DW inventory harmonization.

STARS no star on Kauai

International Nuclear Information System (INIS)

Jones, M.

1993-01-01

The island of Kuai, home to the Pacific Missile Range Facility, is preparing for the first of a series of Star Wars rocket launches expected to begin early this year. The Strategic Defense Initiative plans 40 launches of the Stategic Target System (STARS) over a 10-year period. The focus of the tests appears to be weapons and sensors designed to combat multiple-warhead ICBMs, which will be banned under the START II Treaty that was signed in January. The focus of this article is to express the dubious value of testing the STARS at a time when their application will not be an anticipated problem

World Glacier Inventory

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — The World Glacier Inventory (WGI) contains information for over 130,000 glaciers. Inventory parameters include geographic location, area, length, orientation,...

Vendor-managed inventory

DEFF Research Database (Denmark)

Govindan, Kannan

2013-01-01

Vendor-managed inventory (VMI) represents the methodology through which the upstream stage of a supply chain (vendor) takes responsibility for managing the inventories at the downstream stage (customer) based on previously agreed limits. VMI is another method by which supply chains can be managed...... review, we have identified six dimensions of VMI: namely, inventory, transportation, manufacturing, general benefits, coordination/collaboration, and information sharing. In addition, there are, three methodological classifications: modelling, simulation, and case studies. Finally, we will consider...

Housing Inventory Count

Data.gov (United States)

Department of Housing and Urban Development — This report displays the data communities reported to HUD about the nature of their dedicated homeless inventory, referred to as their Housing Inventory Count (HIC)....

27 CFR 40.201 - Inventories.

Science.gov (United States)

2010-04-01

... PROCESSED TOBACCO Operations by Manufacturers of Tobacco Products Inventories and Reports § 40.201 Inventories. Every manufacturer of tobacco products shall make true and accurate inventories on Form 5210.9... 27 Alcohol, Tobacco Products and Firearms 2 2010-04-01 2010-04-01 false Inventories. 40.201...

Star-forming galaxy models: Blending star formation into TREESPH

Science.gov (United States)

Mihos, J. Christopher; Hernquist, Lars

1994-01-01

We have incorporated star-formation algorithms into a hybrid N-body/smoothed particle hydrodynamics code (TREESPH) in order to describe the star forming properties of disk galaxies over timescales of a few billion years. The models employ a Schmidt law of index n approximately 1.5 to calculate star-formation rates, and explicitly include the energy and metallicity feedback into the Interstellar Medium (ISM). Modeling the newly formed stellar population is achieved through the use of hybrid SPH/young star particles which gradually convert from gaseous to collisionless particles, avoiding the computational difficulties involved in creating new particles. The models are shown to reproduce well the star-forming properties of disk galaxies, such as the morphology, rate of star formation, and evolution of the global star-formation rate and disk gas content. As an example of the technique, we model an encounter between a disk galaxy and a small companion which gives rise to a ring galaxy reminiscent of the Cartwheel (AM 0035-35). The primary galaxy in this encounter experiences two phases of star forming activity: an initial period during the expansion of the ring, and a delayed phase as shocked material in the ring falls back into the central regions.

EMACSS: Evolve Me A Cluster of StarS

Science.gov (United States)

Alexander, Poul E. R.; Gieles, Mark

2012-03-01

The star cluster evolution code Evolve Me A Cluster of StarS (EMACSS) is a simple yet physically motivated computational model that describes the evolution of some fundamental properties of star clusters in static tidal fields. The prescription is based upon the flow of energy within the cluster, which is a constant fraction of the total energy per half-mass relaxation time. According to Henon's predictions, this flow is independent of the precise mechanisms for energy production within the core, and therefore does not require a complete description of the many-body interactions therein. Dynamical theory and analytic descriptions of escape mechanisms is used to construct a series of coupled differential equations expressing the time evolution of cluster mass and radius for a cluster of equal-mass stars. These equations are numerically solved using a fourth-order Runge-Kutta integration kernel; the results were benchmarked against a data base of direct N-body simulations. EMACSS is publicly available and reproduces the N-body results to within 10 per cent accuracy for the entire post-collapse evolution of star clusters.

Functional Assessment Inventory Manual.

Science.gov (United States)

Crewe, Nancy M.; Athelstan, Gary T.

This manual, which provides extensive new instructions for administering the Functional Assessment Inventory (FAI), is intended to enable counselors to begin using the inventory without undergoing any special training. The first two sections deal with the need for functional assessment and issues in the development and use of the inventory. The…

Barium and Tc-poor S stars: Binary masqueraders among carbon stars

OpenAIRE

Jorissen, A.; Van Eck, S.

1997-01-01

The current understanding of the origin of barium and S stars is reviewed, based on new orbital elements and binary frequencies. The following questions are addressed: (i) Is binarity a necessary condition to produce a barium star? (ii) What is the mass transfer mode (wind accretion or RLOF?) responsible for their formation? (iii) Do barium stars form as dwarfs or as giants? (iv) Do barium stars evolve into Tc-poor S stars? (v) What is the relative frequency of Tc-rich and Tc-poor S stars?

Optimal fuel inventory strategies

International Nuclear Information System (INIS)

Caspary, P.J.; Hollibaugh, J.B.; Licklider, P.L.; Patel, K.P.

1990-01-01

In an effort to maintain their competitive edge, most utilities are reevaluating many of their conventional practices and policies in an effort to further minimize customer revenue requirements without sacrificing system reliability. Over the past several years, Illinois Power has been rethinking its traditional fuel inventory strategies, recognizing that coal supplies are competitive and plentiful and that carrying charges on inventory are expensive. To help the Company achieve one of its strategic corporate goals, an optimal fuel inventory study was performed for its five major coal-fired generating stations. The purpose of this paper is to briefly describe Illinois Power's system and past practices concerning coal inventories, highlight the analytical process behind the optimal fuel inventory study, and discuss some of the recent experiences affecting coal deliveries and economic dispatch

Radio stars

International Nuclear Information System (INIS)

Hjellming, R.M.

1976-01-01

Any discussion of the radio emission from stars should begin by emphasizing certain unique problems. First of all, one must clarify a semantic confusion introduced into radio astronomy in the late 1950's when most new radio sources were described as radio stars. All of these early 'radio stars' were eventually identified with other galactic and extra-galactic objects. The study of true radio stars, where the radio emission is produced in the atmosphere of a star, began only in the 1960's. Most of the work on the subject has, in fact, been carried out in only the last few years. Because the real information about radio stars is quite new, it is not surprising that major aspects of the subject are not at all understood. For this reason this paper is organized mainly around three questions: what is the available observational information; what physical processes seem to be involved; and what working hypotheses look potentially fruitful. (Auth.)

TURBOVELOCITY STARS: KICKS RESULTING FROM THE TIDAL DISRUPTION OF SOLITARY STARS

International Nuclear Information System (INIS)

Manukian, Haik; Guillochon, James; Ramirez-Ruiz, Enrico; O'Leary, Ryan M.

2013-01-01

The centers of most known galaxies host supermassive black holes (SMBHs). In orbit around these black holes are a centrally concentrated distribution of stars, both in single and in binary systems. Occasionally, these stars are perturbed onto orbits that bring them close to the SMBH. If the star is in a binary system, the three-body interaction with the SMBH can lead to large changes in orbital energy, depositing one of the two stars on a tightly-bound orbit, and its companion into a hyperbolic orbit that may escape the galaxy. In this Letter, we show that the disruption of solitary stars can also lead to large positive increases in orbital energy. The kick velocity depends on the amount of mass the star loses at pericenter, but not on the ratio of black hole to stellar mass, and are at most the star's own escape velocity. We find that these kicks are usually too small to result in the ejection of stars from the Milky Way, but can eject the stars from the black hole's sphere of influence, reducing their probability of being disrupted again. We estimate that ∼ 10 5 stars, ∼ 1% of all stars within 10 pc of the galactic center, are likely to have had mass removed by the central black hole through tidal interaction, and speculate that these 'turbovelocity' stars will at first be redder, but eventually bluer, and always brighter than their unharassed peers.

Radio stars

International Nuclear Information System (INIS)

Hjellming, R.M.; Gibson, D.M.

1985-01-01

Studies of stellar radio emission became an important field of research in the 1970's and have now expanded to become a major area of radio astronomy with the advent of new instruments such as the Very Large Array in New Mexico and transcontinental telescope arrays. This volume contains papers from the workshop on stellar continuum radio astronomy held in Boulder, Colorado, and is the first book on the rapidly expanding field of radio emission from stars and stellar systems. Subjects covered include the observational and theoretical aspects of stellar winds from both hot and cool stars, radio flares from active double star systems and red dwarf stars, bipolar flows from star-forming regions, and the radio emission from X-ray binaries. (orig.)

A single-item inventory model for expected inventory order crossovers

NARCIS (Netherlands)

Riezebos, J.; Gaalman, G.J.C.

2009-01-01

Expected inventory order crossovers Occur if at the moment of ordering it is expected that orders will not arrive in the sequence they are ordered. Recent research has shown that (it) expected inventory order crossovers will be encountered more frequently in future, and that (b) use of a myopic

Controlling Inventory: Real-World Mathematical Modeling

Science.gov (United States)

Edwards, Thomas G.; Özgün-Koca, S. Asli; Chelst, Kenneth R.

2013-01-01

Amazon, Walmart, and other large-scale retailers owe their success partly to efficient inventory management. For such firms, holding too little inventory risks losing sales, whereas holding idle inventory wastes money. Therefore profits hinge on the inventory level chosen. In this activity, students investigate a simplified inventory-control…

Inventory analysis and carbon footprint of coastland-hotel services: A Spanish case study.

Science.gov (United States)

Puig, Rita; Kiliç, Eylem; Navarro, Alejandra; Albertí, Jaume; Chacón, Lorenzo; Fullana-I-Palmer, Pere

2017-10-01

Tourism is a key industry in the Spanish economy. Spain was in the World top three ranking by international tourist arrivals and by income in 2015. The development of the tourism industry is essential to maintain the established economic system. However, if the environmental requirements were not taken into account, the country would face a negative effect on depletion of local environmental resources from which tourism depends. This case study evaluates, through a life cycle perspective, the average carbon footprint of an overnight stay in a Spanish coastland hotel by analyzing 14 two-to-five-stars hotels. Inventory and impact data are analyzed and presented both for resource use and greenhouse gases emissions, with the intention of helping in the environmental decision-making process. The main identified potential hotspots are electricity and fuels consumption (6 to 30kWh/overnight stay and 24 to 127MJ/overnight stay respectively), which are proportional to the number of stars and unoccupancy rate and they produce more than 75% of the impact. It is also revealed that voluntary implementation of environmental monitoring systems (like EMAS regulation) promotes collection of more detailed and accurate data, which helps in a more efficient use of resources. A literature review on LCA and tourism is also discussed. Spanish hotels inventory data presented here for the first time will be useful for tourism related managers (destination managers, policy makers and hotel managers among others) to calculate sustainability key indicators, which can lead to achieve real sustainable-tourism goals. Further data collection will be needed in future projects to gather representative data from more hotels, other accommodation facilities and also other products/services offered by tourist sector in Spain (like transport of tourists, food and beverage, culture-sports & recreation and others). Copyright © 2017 Elsevier B.V. All rights reserved.

21 CFR 1304.11 - Inventory requirements.

Science.gov (United States)

2010-04-01

... the inventory of the registered location to which they are subject to control or to which the person... 21 Food and Drugs 9 2010-04-01 2010-04-01 false Inventory requirements. 1304.11 Section 1304.11... REGISTRANTS Inventory Requirements § 1304.11 Inventory requirements. (a) General requirements. Each inventory...

A hybrid method for accurate star tracking using star sensor and gyros.

Science.gov (United States)

Lu, Jiazhen; Yang, Lie; Zhang, Hao

2017-10-01

Star tracking is the primary operating mode of star sensors. To improve tracking accuracy and efficiency, a hybrid method using a star sensor and gyroscopes is proposed in this study. In this method, the dynamic conditions of an aircraft are determined first by the estimated angular acceleration. Under low dynamic conditions, the star sensor is used to measure the star vector and the vector difference method is adopted to estimate the current angular velocity. Under high dynamic conditions, the angular velocity is obtained by the calibrated gyros. The star position is predicted based on the estimated angular velocity and calibrated gyros using the star vector measurements. The results of the semi-physical experiment show that this hybrid method is accurate and feasible. In contrast with the star vector difference and gyro-assisted methods, the star position prediction result of the hybrid method is verified to be more accurate in two different cases under the given random noise of the star centroid.

Star Products and Applications

OpenAIRE

Iida, Mari; Yoshioka, Akira

2010-01-01

Star products parametrized by complex matrices are defined. Especially commutative associative star products are treated, and star exponentials with respect to these star products are considered. Jacobi's theta functions are given as infinite sums of star exponentials. As application, several concrete identities are obtained by properties of the star exponentials.

Effective star tracking method based on optical flow analysis for star trackers.

Science.gov (United States)

Sun, Ting; Xing, Fei; Wang, Xiaochu; Li, Jin; Wei, Minsong; You, Zheng

2016-12-20

Benefiting from rapid development of imaging sensor technology, modern optical technology, and a high-speed computing chip, the star tracker's accuracy, dynamic performance, and update rate have been greatly improved with low power consumption and miniature size. The star tracker is currently one of the most competitive attitude measurement sensors. However, due to restrictions of the optical imaging system, difficulties still exist in moving star spot detection and star tracking when in special motion conditions. An effective star tracking method based on optical flow analysis for star trackers is proposed in this paper. Spot-based optical flow, based on a gray gradient between two adjacent star images, is analyzed to distinguish the star spot region and obtain an accurate star spot position so that the star tracking can keep continuous under high dynamic conditions. The obtained star vectors and extended Kalman filter (EKF) are then combined to conduct an angular velocity estimation to ensure region prediction of the star spot; this can be combined with the optical flow analysis result. Experiment results show that the method proposed in this paper has advantages in conditions of large angular velocity and large angular acceleration, despite the presence of noise. Higher functional density and better performance can be achieved; thus, the star tracker can be more widely applied in small satellites, remote sensing, and other complex space missions.

EXPERIMENTAL RESEARCHES OF ELECTRO-THERMAL RESISTIBILITY OF SEND-OFFS AND CABLES TO ACTION RATIONED ON THE INTERNATIONAL STANDARD OF IEC 62305-1-2010 OF APERIODIC IMPULSE OF CURRENT OF ARTIFICIAL LIGHTNING

Directory of Open Access Journals (Sweden)

M.I. Baranov

2016-03-01

Full Text Available Purpose. Experimental researches of electro-thermal resistibility of cable-explorer products, applied in the power electric circuits of objects of electric-power industry, to action on its copper and aluminum parts bearings a current rationed on the International Standard of IEC 62305-1-2010 aperiodic impulse 10/350 μs of current of artificial lightning. Methodology. Electrophysics bases of technique of high tensions and high pulsed currents (HPC, and also scientific and technical bases of planning of devices of high-voltage impulsive technique and measuring HPC in them. Results. Experimental a way the quantitative levels of maximal values maximum of possible and critical closenesses of aperiodic impulse 10/350 μs of current of artificial lightning with rationed on the international standard of IEC 62305-1-2010 peak-temporal parameters and admittances on them in copper (aluminum parts bearings a current of send-offs and cables with a polyethylene (PET and polyvinylchloride (PVCH isolation. Originality. First in world practice on the unique powerful high-voltage generator of HPC of artificial lightning experimental researches of resistibility to lightning of pre-production models of send-offs (cables are conducted with copper (aluminum tendons, PET and PVCH by an isolation, in-use in power electric circuits of electric-power industry objects. Practical value. The use in practice of protecting from lightning of the got results will allow substantially to promote functional and fire-prevention safety of engineering communications of objects of industrial electroenergy in the conditions of action on them of short shots of linear lightning.

Formation of stars and star clusters in colliding galaxies

International Nuclear Information System (INIS)

Belles, Pierre-Emmanuel

2012-01-01

Mergers are known to be essential in the formation of large-scale structures and to have a significant role in the history of galaxy formation and evolution. Besides a morphological transformation, mergers induce important bursts of star formation. These starburst are characterised by high Star Formation Efficiencies (SFEs) and Specific Star Formation Rates, i.e., high Star Formation Rates (SFR) per unit of gas mass and high SFR per unit of stellar mass, respectively, compared to spiral galaxies. At all redshifts, starburst galaxies are outliers of the sequence of star-forming galaxies defined by spiral galaxies. We have investigated the origin of the starburst-mode of star formation, in three local interacting systems: Arp 245, Arp 105 and NGC 7252. We combined high-resolution JVLA observations of the 21-cm line, tracing the HI diffuse gas, with UV GALEX observations, tracing the young star-forming regions. We probe the local physical conditions of the Inter-Stellar Medium (ISM) for independent star-forming regions and explore the atomic-to-dense gas transformation in different environments. The SFR/HI ratio is found to be much higher in central regions, compared to outer regions, showing a higher dense gas fraction (or lower HI gas fraction) in these regions. In the outer regions of the systems, i.e., the tidal tails, where the gas phase is mostly atomic, we find SFR/HI ratios higher than in standard HI-dominated environments, i.e., outer discs of spiral galaxies and dwarf galaxies. Thus, our analysis reveals that the outer regions of mergers are characterised by high SFEs, compared to the standard mode of star formation. The observation of high dense gas fractions in interacting systems is consistent with the predictions of numerical simulations; it results from the increase of the gas turbulence during a merger. The merger is likely to affect the star-forming properties of the system at all spatial scales, from large scales, with a globally enhanced turbulence

Stars Just Got Bigger - A 300 Solar Mass Star Uncovered

Science.gov (United States)

2010-07-01

Using a combination of instruments on ESO's Very Large Telescope, astronomers have discovered the most massive stars to date, one weighing at birth more than 300 times the mass of the Sun, or twice as much as the currently accepted limit of 150 solar masses. The existence of these monsters - millions of times more luminous than the Sun, losing weight through very powerful winds - may provide an answer to the question "how massive can stars be?" A team of astronomers led by Paul Crowther, Professor of Astrophysics at the University of Sheffield, has used ESO's Very Large Telescope (VLT), as well as archival data from the NASA/ESA Hubble Space Telescope, to study two young clusters of stars, NGC 3603 and RMC 136a in detail. NGC 3603 is a cosmic factory where stars form frantically from the nebula's extended clouds of gas and dust, located 22 000 light-years away from the Sun (eso1005). RMC 136a (more often known as R136) is another cluster of young, massive and hot stars, which is located inside the Tarantula Nebula, in one of our neighbouring galaxies, the Large Magellanic Cloud, 165 000 light-years away (eso0613). The team found several stars with surface temperatures over 40 000 degrees, more than seven times hotter than our Sun, and a few tens of times larger and several million times brighter. Comparisons with models imply that several of these stars were born with masses in excess of 150 solar masses. The star R136a1, found in the R136 cluster, is the most massive star ever found, with a current mass of about 265 solar masses and with a birthweight of as much as 320 times that of the Sun. In NGC 3603, the astronomers could also directly measure the masses of two stars that belong to a double star system [1], as a validation of the models used. The stars A1, B and C in this cluster have estimated masses at birth above or close to 150 solar masses. Very massive stars produce very powerful outflows. "Unlike humans, these stars are born heavy and lose weight as

The Destructive Birth of Massive Stars and Massive Star Clusters

Science.gov (United States)

Rosen, Anna; Krumholz, Mark; McKee, Christopher F.; Klein, Richard I.; Ramirez-Ruiz, Enrico

2017-01-01

Massive stars play an essential role in the Universe. They are rare, yet the energy and momentum they inject into the interstellar medium with their intense radiation fields dwarfs the contribution by their vastly more numerous low-mass cousins. Previous theoretical and observational studies have concluded that the feedback associated with massive stars' radiation fields is the dominant mechanism regulating massive star and massive star cluster (MSC) formation. Therefore detailed simulation of the formation of massive stars and MSCs, which host hundreds to thousands of massive stars, requires an accurate treatment of radiation. For this purpose, we have developed a new, highly accurate hybrid radiation algorithm that properly treats the absorption of the direct radiation field from stars and the re-emission and processing by interstellar dust. We use our new tool to perform a suite of three-dimensional radiation-hydrodynamic simulations of the formation of massive stars and MSCs. For individual massive stellar systems, we simulate the collapse of massive pre-stellar cores with laminar and turbulent initial conditions and properly resolve regions where we expect instabilities to grow. We find that mass is channeled to the massive stellar system via gravitational and Rayleigh-Taylor (RT) instabilities. For laminar initial conditions, proper treatment of the direct radiation field produces later onset of RT instability, but does not suppress it entirely provided the edges of the radiation-dominated bubbles are adequately resolved. RT instabilities arise immediately for turbulent pre-stellar cores because the initial turbulence seeds the instabilities. To model MSC formation, we simulate the collapse of a dense, turbulent, magnetized Mcl = 106 M⊙ molecular cloud. We find that the influence of the magnetic pressure and radiative feedback slows down star formation. Furthermore, we find that star formation is suppressed along dense filaments where the magnetic field is

First stars X. The nature of three unevolved carbon-enhanced metal-poor stars

DEFF Research Database (Denmark)

Sivarani, T.; Beers, T.C.; Bonifacio, P.

2006-01-01

Stars: abundances, stars: population II, Galaxy: abundances, stars: AGB and post-AGB Udgivelsesdato: Nov.......Stars: abundances, stars: population II, Galaxy: abundances, stars: AGB and post-AGB Udgivelsesdato: Nov....

Procedure for taking physical inventories

International Nuclear Information System (INIS)

Boston, R.A.

1984-01-01

Physical inventories are taken periodically to meet Company, State and IAEA requirements. Those physical inventories may be verified by IAEA and/or State inspectors. This presentation describes in an introductory but detailed manner the approaches and procedures used in planning, preparing, conducting, reconciling and reporting physical inventories for the Model Plant. Physical inventories are taken for plant accounting purposes to provide an accurate basis for starting and closing the plant material balance. Physical inventories are also taken for safeguards purposes to provide positive assurance that the nuclear materials of concern are indeed present and accounted for

PLANET HUNTERS: ASSESSING THE KEPLER INVENTORY OF SHORT-PERIOD PLANETS

International Nuclear Information System (INIS)

Schwamb, Megan E.; Lintott, Chris J.; Lynn, Stuart; Smith, Arfon M.; Simpson, Robert J.; Fischer, Debra A.; Giguere, Matthew J.; Brewer, John M.; Parrish, Michael; Schawinski, Kevin

2012-01-01

We present the results from a search of data from the first 33.5 days of the Kepler science mission (Quarter 1) for exoplanet transits by the Planet Hunters citizen science project. Planet Hunters enlists members of the general public to visually identify transits in the publicly released Kepler light curves via the World Wide Web. Over 24,000 volunteers reviewed the Kepler Quarter 1 data set. We examine the abundance of ≥2 R ⊕ planets on short-period ( ⊕ Planet Hunters ≥85% efficient at identifying transit signals for planets with periods less than 15 days for the Kepler sample of target stars. Our high efficiency rate for simulated transits along with recovery of the majority of Kepler ≥4 R ⊕ planets suggests that the Kepler inventory of ≥4 R ⊕ short-period planets is nearly complete.

False star detection and isolation during star tracking based on improved chi-square tests.

Science.gov (United States)

Zhang, Hao; Niu, Yanxiong; Lu, Jiazhen; Yang, Yanqiang; Su, Guohua

2017-08-01

The star sensor is a precise attitude measurement device for a spacecraft. Star tracking is the main and key working mode for a star sensor. However, during star tracking, false stars become an inevitable interference for star sensor applications, which may result in declined measurement accuracy. A false star detection and isolation algorithm in star tracking based on improved chi-square tests is proposed in this paper. Two estimations are established based on a Kalman filter and a priori information, respectively. The false star detection is operated through adopting the global state chi-square test in a Kalman filter. The false star isolation is achieved using a local state chi-square test. Semi-physical experiments under different trajectories with various false stars are designed for verification. Experiment results show that various false stars can be detected and isolated from navigation stars during star tracking, and the attitude measurement accuracy is hardly influenced by false stars. The proposed algorithm is proved to have an excellent performance in terms of speed, stability, and robustness.

White Dwarf Stars

OpenAIRE

Kepler, S. O.; Romero, Alejandra Daniela; Pelisoli, Ingrid; Ourique, Gustavo

2017-01-01

White dwarf stars are the final stage of most stars, born single or in multiple systems. We discuss the identification, magnetic fields, and mass distribution for white dwarfs detected from spectra obtained by the Sloan Digital Sky Survey up to Data Release 13 in 2016, which lead to the increase in the number of spectroscopically identified white dwarf stars from 5000 to 39000. This number includes only white dwarf stars with log g >= 6.5 stars, i.e., excluding the Extremely Low Mass white dw...

THE PREVALENCE AND IMPACT OF WOLF–RAYET STARS IN EMERGING MASSIVE STAR CLUSTERS

Energy Technology Data Exchange (ETDEWEB)

Sokal, Kimberly R.; Johnson, Kelsey E.; Indebetouw, Rémy [Department of Astronomy, University of Virginia, P.O. Box 3818, Charlottesville, VA 22903 (United States); Massey, Philip, E-mail: krs9tb@virginia.edu [Lowell Observatory, 1400 W Mars Hill Road, Flagstaff, AZ 86001 (United States)

2016-08-01

We investigate Wolf–Rayet (WR) stars as a source of feedback contributing to the removal of natal material in the early evolution of massive star clusters. Despite previous work suggesting that massive star clusters clear out their natal material before the massive stars evolve into the WR phase, WR stars have been detected in several emerging massive star clusters. These detections suggest that the timescale for clusters to emerge can be at least as long as the time required to produce WR stars (a few million years), and could also indicate that WR stars may be providing the tipping point in the combined feedback processes that drive a massive star cluster to emerge. We explore the potential overlap between the emerging phase and the WR phase with an observational survey to search for WR stars in emerging massive star clusters hosting WR stars. We select candidate emerging massive star clusters from known radio continuum sources with thermal emission and obtain optical spectra with the 4 m Mayall Telescope at Kitt Peak National Observatory and the 6.5 m MMT.{sup 4} We identify 21 sources with significantly detected WR signatures, which we term “emerging WR clusters.” WR features are detected in ∼50% of the radio-selected sample, and thus we find that WR stars are commonly present in currently emerging massive star clusters. The observed extinctions and ages suggest that clusters without WR detections remain embedded for longer periods of time, and may indicate that WR stars can aid, and therefore accelerate, the emergence process.

Egyptian "Star Clocks"

Science.gov (United States)

Symons, Sarah

Diagonal, transit, and Ramesside star clocks are tables of astronomical information occasionally found in ancient Egyptian temples, tombs, and papyri. The tables represent the motions of selected stars (decans and hour stars) throughout the Egyptian civil year. Analysis of star clocks leads to greater understanding of ancient Egyptian constellations, ritual astronomical activities, observational practices, and pharaonic chronology.

Symbiotic stars

International Nuclear Information System (INIS)

Kafatos, M.; Michalitsianos, A.G.

1984-01-01

Among the several hundred million binary systems estimated to lie within 3000 light years of the solar system, a tiny fraction, no more than a few hundred, belong to a curious subclass whose radiation has a wavelength distribution so peculiar that it long defied explanation. Such systems radiate strongly in the visible region of the spectrum, but some of them do so even more strongly at both shorter and longer wavelengths: in the ultraviolet region and in the infrared and radio regions. This odd distribution of radiation is best explained by the pairing of a cool red giant star and an intensely hot small star that is virtually in contact with its larger companion. Such objects have become known as symbiotic stars. On photographic plate only the giant star can be discerned, but evidence for the existence of the hot companion has been supplied by satellite-born instruments capable of detecting ultraviolet radiation. The spectra of symbiotic stars indicate that the cool red giant is surrounded by a very hot ionized gas. Symbiotic stars also flared up in outbursts indicating the ejection of material in the form of a shell or a ring. Symbiotic stars may therefore represent a transitory phase in the evolution of certain types of binary systems in which there is substantial transfer of matter from the larger partner to the smaller

Initial Radionuclide Inventories

Energy Technology Data Exchange (ETDEWEB)

H. Miller

2004-09-19

The purpose of this analysis is to provide an initial radionuclide inventory (in grams per waste package) and associated uncertainty distributions for use in the Total System Performance Assessment for the License Application (TSPA-LA) in support of the license application for the repository at Yucca Mountain, Nevada. This document is intended for use in postclosure analysis only. Bounding waste stream information and data were collected that capture probable limits. For commercially generated waste, this analysis considers alternative waste stream projections to bound the characteristics of wastes likely to be encountered using arrival scenarios that potentially impact the commercial spent nuclear fuel (CSNF) waste stream. For TSPA-LA, this radionuclide inventory analysis considers U.S. Department of Energy (DOE) high-level radioactive waste (DHLW) glass and two types of spent nuclear fuel (SNF): CSNF and DOE-owned (DSNF). These wastes are placed in two groups of waste packages: the CSNF waste package and the codisposal waste package (CDSP), which are designated to contain DHLW glass and DSNF, or DHLW glass only. The radionuclide inventory for naval SNF is provided separately in the classified ''Naval Nuclear Propulsion Program Technical Support Document'' for the License Application. As noted previously, the radionuclide inventory data presented here is intended only for TSPA-LA postclosure calculations. It is not applicable to preclosure safety calculations. Safe storage, transportation, and ultimate disposal of these wastes require safety analyses to support the design and licensing of repository equipment and facilities. These analyses will require radionuclide inventories to represent the radioactive source term that must be accommodated during handling, storage and disposition of these wastes. This analysis uses the best available information to identify the radionuclide inventory that is expected at the last year of last emplacement

Star tracking method based on multiexposure imaging for intensified star trackers.

Science.gov (United States)

Yu, Wenbo; Jiang, Jie; Zhang, Guangjun

2017-07-20

The requirements for the dynamic performance of star trackers are rapidly increasing with the development of space exploration technologies. However, insufficient knowledge of the angular acceleration has largely decreased the performance of the existing star tracking methods, and star trackers may even fail to track under highly dynamic conditions. This study proposes a star tracking method based on multiexposure imaging for intensified star trackers. The accurate estimation model of the complete motion parameters, including the angular velocity and angular acceleration, is established according to the working characteristic of multiexposure imaging. The estimation of the complete motion parameters is utilized to generate the predictive star image accurately. Therefore, the correct matching and tracking between stars in the real and predictive star images can be reliably accomplished under highly dynamic conditions. Simulations with specific dynamic conditions are conducted to verify the feasibility and effectiveness of the proposed method. Experiments with real starry night sky observation are also conducted for further verification. Simulations and experiments demonstrate that the proposed method is effective and shows excellent performance under highly dynamic conditions.

B- AND A-TYPE STARS IN THE TAURUS-AURIGA STAR-FORMING REGION

International Nuclear Information System (INIS)

Mooley, Kunal; Hillenbrand, Lynne; Rebull, Luisa; Padgett, Deborah; Knapp, Gillian

2013-01-01

We describe the results of a search for early-type stars associated with the Taurus-Auriga molecular cloud complex, a diffuse nearby star-forming region noted as lacking young stars of intermediate and high mass. We investigate several sets of possible O, B, and early A spectral class members. The first is a group of stars for which mid-infrared images show bright nebulae, all of which can be associated with stars of spectral-type B. The second group consists of early-type stars compiled from (1) literature listings in SIMBAD, (2) B stars with infrared excesses selected from the Spitzer Space Telescope survey of the Taurus cloud, (3) magnitude- and color-selected point sources from the Two Micron All Sky Survey, and (4) spectroscopically identified early-type stars from the Sloan Digital Sky Survey coverage of the Taurus region. We evaluated stars for membership in the Taurus-Auriga star formation region based on criteria involving: spectroscopic and parallactic distances, proper motions and radial velocities, and infrared excesses or line emission indicative of stellar youth. For selected objects, we also model the scattered and emitted radiation from reflection nebulosity and compare the results with the observed spectral energy distributions to further test the plausibility of physical association of the B stars with the Taurus cloud. This investigation newly identifies as probable Taurus members three B-type stars: HR 1445 (HD 28929), τ Tau (HD 29763), 72 Tau (HD 28149), and two A-type stars: HD 31305 and HD 26212, thus doubling the number of stars A5 or earlier associated with the Taurus clouds. Several additional early-type sources including HD 29659 and HD 283815 meet some, but not all, of the membership criteria and therefore are plausible, though not secure, members.

Life of a star

International Nuclear Information System (INIS)

Henbest, Nigel.

1988-01-01

The paper concerns the theory of stellar evolution. A description is given of:- how a star is born, main sequence stars, red giants, white dwarfs, supernovae, neutron stars and black holes. A brief explanation is given of how the death of a star as a supernova can trigger off the birth of a new generation of stars. Classification of stars and the fate of our sun, are also described. (U.K.)

Understand B-type stars

Science.gov (United States)

1982-01-01

When observations of B stars made from space are added to observations made from the ground and the total body of observational information is confronted with theoretical expectations about B stars, it is clear that nonthermal phenomena occur in the atmospheres of B stars. The nature of these phenomena and what they imply about the physical state of a B star and how a B star evolves are examined using knowledge of the spectrum of a B star as a key to obtaining an understanding of what a B star is like. Three approaches to modeling stellar structure (atmospheres) are considered, the characteristic properties of a mantle, and B stars and evolution are discussed.

Validation of Schema Coping Inventory and Schema Mode Inventory in Adolescents

NARCIS (Netherlands)

van Wijk-Herbrink, M.F.; Roelofs, J.; Broers, N.J.; Rijkeboer, M.M.; Arntz, A.; Bernstein, D.P.

2018-01-01

This study investigated whether the schema therapy constructs of schema coping and schema modes have validity in adolescents. We examined the validity and reliability of the Schema Coping Inventory (SCI) and an 80-item version of the Schema Mode Inventory (SMI) in a mixed sample of adolescents.

Flare stars

International Nuclear Information System (INIS)

Nicastro, A.J.

1981-01-01

The least massive, but possibly most numerous, stars in a galaxy are the dwarf M stars. It has been observed that some of these dwarfs are characterized by a short increase in brightness. These stars are called flare stars. These flare stars release a lot of energy in a short amount of time. The process producing the eruption must be energetic. The increase in light intensity can be explained by a small area rising to a much higher temperature. Solar flares are looked at to help understand the phenomenon of stellar flares. Dwarfs that flare are observed to have strong magnetic fields. Those dwarf without the strong magnetic field do not seem to flare. It is believed that these regions of strong magnetic fields are associated with star spots. Theories on the energy that power the flares are given. Astrophysicists theorize that the driving force of a stellar flare is the detachment and collapse of a loop of magnetic flux. The mass loss due to stellar flares is discussed. It is believed that stellar flares are a significant contributor to the mass of interstellar medium in the Milky Way

By Draconis Stars

Science.gov (United States)

Bopp, Bernard W.

An optical spectroscopic survey of dK-M stars has resulted in the discovery of several new H-alpha emission objects. Available optical data suggest these stars have a level of chromospheric activity midway between active BY Dra stars and quiet dM's. These "marginal" BY Dra stars are single objects that have rotation velocities slightly higher than that of quiet field stars but below that of active flare/BY Dra objects. The marginal BY Dra stars provide us with a class of objects rotating very near a "trigger velocity" (believed to be 5 km/s) which appears to divide active flare/BY Dra stars from quiet dM's. UV data on Mg II emission fluxes and strength of transition region features such as C IV will serve to fix activity levels in the marginal objects and determine chromosphere and transition-region heating rates. Simultaneous optical magnetic field measures will be used to explore the connection between fieldstrength/filling-factor and atmospheric heating. Comparison of these data with published information on active and quiet dM stars will yield information on the character of the stellar dynamo as it makes a transition from "low" to "high" activity.

Shooting stars

International Nuclear Information System (INIS)

Maurette, M.; Hammer, C.

1985-01-01

A shooting star passage -even a star shower- can be sometimes easily seen during moonless black night. They represent the partial volatilization in earth atmosphere of meteorites or micrometeorites reduced in cosmic dusts. Everywhere on earth, these star dusts are searched to be gathered. This research made one year ago on the Greenland ice-cap is this article object; orbit gathering projects are also presented [fr

On Inventory Control For Perishable Inventory Systems Subject To Uncertainties On Customer Demands

OpenAIRE

Abbou , Rosa; Loiseau , Jean-Jacques; Khaldi , Hajer; Farraa , Berna ,

2017-01-01

International audience; This paper deals with the inventory controller design for constrained production systems subject to uncertainties on the customer demands. The case study focuses on the inventory regulation problem in production systems where contain perishable finite products. Such systems are characterized by the presence of delays due to production processes, and constraints from the instantaneous inventory level, production level and the finite capacities of stocks. To do that, we ...

The Vixen Star Book user guide how to use the star book ten and the original star book

CERN Document Server

Chen, James

2016-01-01

This book is for anyone who owns, or is thinking of owning, a Vixen Star Book Ten telescope mount or its predecessor. A revolution in amateur astronomy has occurred in the past decade with the wide availability of high tech, computer-driven, Go-To telescopes. Vixen Optics is leading the way by offering the Star Book Ten system, with its unique star map graphics software. The Star Book Ten is the latest version of computer telescope control using star map graphics as a user interface, first introduced in the original Star Book first offered in 2003. The increasingly complicated nature of this software means that learning to optimize this program is not straightforward, and yet the resulting views when all features are correctly deployed can be phenomenal. After a short history of computerized Go-To telescopes for the consumer amateur astronomer market, Chen offers a treasury of technical information. His advice, tips, and solutions aid the user in getting the most out of the Star Book Ten system in observing s...

STAR-TO-STAR IRON ABUNDANCE VARIATIONS IN RED GIANT BRANCH STARS IN THE GALACTIC GLOBULAR CLUSTER NGC 3201

International Nuclear Information System (INIS)

Simmerer, Jennifer; Ivans, Inese I.; Filler, Dan; Francois, Patrick; Charbonnel, Corinne; Monier, Richard; James, Gaël

2013-01-01

We present the metallicity as traced by the abundance of iron in the retrograde globular cluster NGC 3201, measured from high-resolution, high signal-to-noise spectra of 24 red giant branch stars. A spectroscopic analysis reveals a spread in [Fe/H] in the cluster stars at least as large as 0.4 dex. Star-to-star metallicity variations are supported both through photometry and through a detailed examination of spectra. We find no correlation between iron abundance and distance from the cluster core, as might be inferred from recent photometric studies. NGC 3201 is the lowest mass halo cluster to date to contain stars with significantly different [Fe/H] values.

Star-to-star Iron Abundance Variations in Red Giant Branch Stars in the Galactic Globular Cluster NGC 3201

Science.gov (United States)

Simmerer, Jennifer; Ivans, Inese I.; Filler, Dan; Francois, Patrick; Charbonnel, Corinne; Monier, Richard; James, Gaël

2013-02-01

We present the metallicity as traced by the abundance of iron in the retrograde globular cluster NGC 3201, measured from high-resolution, high signal-to-noise spectra of 24 red giant branch stars. A spectroscopic analysis reveals a spread in [Fe/H] in the cluster stars at least as large as 0.4 dex. Star-to-star metallicity variations are supported both through photometry and through a detailed examination of spectra. We find no correlation between iron abundance and distance from the cluster core, as might be inferred from recent photometric studies. NGC 3201 is the lowest mass halo cluster to date to contain stars with significantly different [Fe/H] values.

The first stars: CEMP-no stars and signatures of spinstars

Science.gov (United States)

Maeder, André; Meynet, Georges; Chiappini, Cristina

2015-04-01

Aims: The CEMP-no stars are "carbon-enhanced-metal-poor" stars that in principle show no evidence of s- and r-elements from neutron captures. We try to understand the origin and nucleosynthetic site of their peculiar CNO, Ne-Na, and Mg-Al abundances. Methods: We compare the observed abundances to the nucleosynthetic predictions of AGB models and of models of rotating massive stars with internal mixing and mass loss. We also analyze the different behaviors of α- and CNO-elements, as well the abundances of elements involved in the Ne-Na and Mg-Al cycles. Results: We show that CEMP-no stars exhibit products of He-burning that have gone through partial mixing and processing by the CNO cycle, producing low 12C/13C and a broad variety of [C/N] and [O/N] ratios. From a 12C/13C vs. [C/N] diagram, we conclude that neither the yields of AGB stars (in binaries or not) nor the yields of classic supernovae can fully account for the observed CNO abundances in CEMP-no stars. Better agreement is obtained once the chemical contribution by stellar winds of fast-rotating massive stars is taken into account, where partial mixing takes place, leading to various amounts of CNO being ejected. The [(C+N+O)/H] ratios of CEMP-no stars vary linearly with [Fe/H] above [Fe/H] = -4.0 indicating primary behavior by (C+N+O). Below [Fe/H] = -4.0, [(C+N+O)/H] is almost constant as a function of [Fe/H], implying very high [(C+N+O)/Fe] ratios up to 4 dex. In view of the timescales, such abundance ratios reflect more individual nucleosynthetic properties, rather than an average chemical evolution. The high [(C+N+O)/Fe] ratios (as well as the high [(C+N+O)/α-elements]) imply that stellar winds from partially mixed stars were the main source of these excesses of heavy elements now observed in CEMP-no stars. The ranges covered by the variations of [Na/Fe], [Mg/Fe], and [Al/Fe] are much broader than for the α-elements (with an atomic mass number above 24) and are comparable to the wide ranges covered

Evidence for deterministic chaos in aperiodic oscillations of acute lymphoblastic leukemia cells in long-term culture

Science.gov (United States)

Lambrou, George I.; Chatziioannou, Aristotelis; Vlahopoulos, Spiros; Moschovi, Maria; Chrousos, George P.

Biological systems are dynamic and possess properties that depend on two key elements: initial conditions and the response of the system over time. Conceptualizing this on tumor models will influence conclusions drawn with regard to disease initiation and progression. Alterations in initial conditions dynamically reshape the properties of proliferating tumor cells. The present work aims to test the hypothesis of Wolfrom et al., that proliferation shows evidence for deterministic chaos in a manner such that subtle differences in the initial conditions give rise to non-linear response behavior of the system. Their hypothesis, tested on adherent Fao rat hepatoma cells, provides evidence that these cells manifest aperiodic oscillations in their proliferation rate. We have tested this hypothesis with some modifications to the proposed experimental setup. We have used the acute lymphoblastic leukemia cell line CCRF-CEM, as it provides an excellent substrate for modeling proliferation dynamics. Measurements were taken at time points varying from 24h to 48h, extending the assayed populations beyond that of previous published reports that dealt with the complex dynamic behavior of animal cell populations. We conducted flow cytometry studies to examine the apoptotic and necrotic rate of the system, as well as DNA content changes of the cells over time. The cells exhibited a proliferation rate of nonlinear nature, as this rate presented oscillatory behavior. The obtained data have been fit in known models of growth, such as logistic and Gompertzian growth.

Denmark's National Inventory Report 2010

DEFF Research Database (Denmark)

Nielsen, Ole-Kenneth; Lyck, Erik; Mikkelsen, Mette Hjorth

2010-01-01

This report is Denmark's National Inventory Report 2010. The report contains information on Denmark's emission inventories for all years' from 1990 to 2008 for CO2, CH4, N2O, HFCs, PFCs and SF6, NOx, CO, NMVOC, SO2.......This report is Denmark's National Inventory Report 2010. The report contains information on Denmark's emission inventories for all years' from 1990 to 2008 for CO2, CH4, N2O, HFCs, PFCs and SF6, NOx, CO, NMVOC, SO2....

HHS Enterprise Data Inventory

Data.gov (United States)

U.S. Department of Health & Human Services — The Enterprise Data Inventory (EDI) is the comprehensive inventory listing of agency data resources including public, restricted public, and non-public datasets.

Star Cluster Structure from Hierarchical Star Formation

Science.gov (United States)

Grudic, Michael; Hopkins, Philip; Murray, Norman; Lamberts, Astrid; Guszejnov, David; Schmitz, Denise; Boylan-Kolchin, Michael

2018-01-01

Young massive star clusters (YMCs) spanning 104-108 M⊙ in mass generally have similar radial surface density profiles, with an outer power-law index typically between -2 and -3. This similarity suggests that they are shaped by scale-free physics at formation. Recent multi-physics MHD simulations of YMC formation have also produced populations of YMCs with this type of surface density profile, allowing us to narrow down the physics necessary to form a YMC with properties as observed. We show that the shallow density profiles of YMCs are a natural result of phase-space mixing that occurs as they assemble from the clumpy, hierarchically-clustered configuration imprinted by the star formation process. We develop physical intuition for this process via analytic arguments and collisionless N-body experiments, elucidating the connection between star formation physics and star cluster structure. This has implications for the early-time structure and evolution of proto-globular clusters, and prospects for simulating their formation in the FIRE cosmological zoom-in simulations.

27 CFR 20.170 - Physical inventory.

Science.gov (United States)

2010-04-01

... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Physical inventory. 20.170... Users of Specially Denatured Spirits Inventory and Records § 20.170 Physical inventory. Once in each... physical inventory of each formula of new and recovered specially denatured spirits. (Approved by the...

Motion-blurred star acquisition method of the star tracker under high dynamic conditions.

Science.gov (United States)

Sun, Ting; Xing, Fei; You, Zheng; Wei, Minsong

2013-08-26

The star tracker is one of the most promising attitude measurement devices used in spacecraft due to its extremely high accuracy. However, high dynamic performance is still one of its constraints. Smearing appears, making it more difficult to distinguish the energy dispersive star point from the noise. An effective star acquisition approach for motion-blurred star image is proposed in this work. The correlation filter and mathematical morphology algorithm is combined to enhance the signal energy and evaluate slowly varying background noise. The star point can be separated from most types of noise in this manner, making extraction and recognition easier. Partial image differentiation is then utilized to obtain the motion parameters from only one image of the star tracker based on the above process. Considering the motion model, the reference window is adopted to perform centroid determination. Star acquisition results of real on-orbit star images and laboratory validation experiments demonstrate that the method described in this work is effective and the dynamic performance of the star tracker could be improved along with more identified stars and guaranteed position accuracy of the star point.

Endogenous Business Cycle Dynamics within Metzlers Inventory Model: Adding an Inventory Floor.

Science.gov (United States)

Sushko, Irina; Wegener, Michael; Westerhoff, Frank; Zaklan, Georg

2009-04-01

Metzlers inventory model may produce dampened fluctuations in economic activity, thus contributing to our understanding of business cycle dynamics. For some parameter combinations, however, the model generates oscillations with increasing amplitude, implying that the inventory stock of firms eventually turns negative. Taking this observation into account, we reformulate Metzlers model by simply putting a floor to the inventory level. Within the new piecewise linear model, endogenous business cycle dynamics may now be triggered via a center bifurcation, i.e. for certain parameter combinations production changes are (quasi-)periodic.

Savannah River Plant's Accountability Inventory Management System (AIMS) (Nuclear materials inventory control)

International Nuclear Information System (INIS)

Croom, R.G.

1976-06-01

The Accountability Inventory Management System (AIMS) is a new computer inventory control system for nuclear materials at the Savannah River Plant, Aiken, South Carolina. The system has two major components, inventory files and system parameter files. AIMS, part of the overall safeguards program, maintains an up-to-date record of nuclear material by location, produces reports required by ERDA in addition to onplant reports, and is capable of a wide range of response to changing input/output requirements through use of user-prepared parameter cards, as opposed to basic system reprogramming

27 CFR 40.523 - Inventories.

Science.gov (United States)

2010-04-01

... 27 Alcohol, Tobacco Products and Firearms 2 2010-04-01 2010-04-01 false Inventories. 40.523... PROCESSED TOBACCO Manufacture of Processed Tobacco Operations by Manufacturers of Processed Tobacco § 40.523 Inventories. Every manufacturer of processed tobacco must provide a true and accurate inventory on TTB F 5210...

Hydrogen inventory in gallium

International Nuclear Information System (INIS)

Mazayev, S.N.; Prokofiev, Yu.G.

1994-01-01

Investigations of hydrogen inventory in gallium (99.9%) were carried out after saturation both from molecular phase and from glow discharge plasma at room temperature, 370 and 520 K. Saturation took place during 3000 s under hydrogen pressure of 20 Pa, and ion flux was about 1x10 15 ions/cm 2 s with an energy about 400 eV during discharge. Hydrogen concentration in Ga at room temperature and that for 370 K by the saturation from gaseous phase was (2-3)x10 14 cm -3 Pa -1/2 . Hydrogen concentration at temperature 520 K increased by five times. Inventory at room temperature for irradiation from discharge was 7x10 16 cm -3 at the dose about 3x10 18 ions/cm 2 . It was more than inventory at temperature 520 K by four times and more than maximum inventory from gaseous phase at 520 K by a factor of 10. Inventory increased when temperature decreased. Diffusion coefficient D=0.003 exp(-2300/RT) cm 2 /s, was estimated from temperature dependence. ((orig.))

Nuclear materials inventory plan

International Nuclear Information System (INIS)

Doerr, R.W.; Nichols, D.H.

1982-03-01

In any processing, manufacturing, or active storage facility it is impractical to assume that any physical security system can prevent the diversion of Special Nuclear Material (SNM). It is, therefore, the responsibility of any DOE Contractor, Licensee, or other holder of SNM to provide assurance that loss or diversion of a significant quantity of SNM is detectable. This ability to detect must be accomplishable within a reasonable time interval and can be accomplished only by taking physical inventories. The information gained and decisions resulting from these inventories can be no better than the SNM accounting system and the quality of measurements performed for each receipt, removal and inventory. Inventories interrupt processing or production operations, increase personnel exposures, and can add significantly to the cost of any operation. Therefore, realistic goals for the inventory must be defined and the relationship of the inherent parameters used in its validation be determined. Purpose of this document is to provide a statement of goals and a plan of action to achieve them

Denmark's National Inventory Report 2014

DEFF Research Database (Denmark)

Nielsen, Ole-Kenneth; Plejdrup, Marlene Schmidt; Winther, Morten

This report is Denmark’s National Inventory Report 2014. The report contains information on Denmark’s emission inventories for all years’ from 1990 to 2012 for CO2, CH4, N2O, HFCs, PFCs and SF6, NOx, CO, NMVOC, SO2......This report is Denmark’s National Inventory Report 2014. The report contains information on Denmark’s emission inventories for all years’ from 1990 to 2012 for CO2, CH4, N2O, HFCs, PFCs and SF6, NOx, CO, NMVOC, SO2...

Denmark's National Inventory Report 2013

DEFF Research Database (Denmark)

Nielsen, Ole-Kenneth; Plejdrup, Marlene Schmidt; Winther, Morten

This report is Denmark’s National Inventory Report 2013. The report contains information on Denmark’s emission inventories for all years’ from 1990 to 2011 for CO2, CH4, N2O, HFCs, PFCs and SF6, NOx, CO, NMVOC, SO2.......This report is Denmark’s National Inventory Report 2013. The report contains information on Denmark’s emission inventories for all years’ from 1990 to 2011 for CO2, CH4, N2O, HFCs, PFCs and SF6, NOx, CO, NMVOC, SO2....

Denmark's National Inventory Report 2017

DEFF Research Database (Denmark)

Nielsen, Ole-Kenneth; Plejdrup, Marlene Schmidt; Winther, Morten

This report is Denmark’s National Inventory Report 2017. The report contains information on Denmark’s emission inventories for all years’ from 1990 to 2015 for CO2, CH4, N2O, HFCs, PFCs and SF6, NOx, CO, NMVOC, SO2......This report is Denmark’s National Inventory Report 2017. The report contains information on Denmark’s emission inventories for all years’ from 1990 to 2015 for CO2, CH4, N2O, HFCs, PFCs and SF6, NOx, CO, NMVOC, SO2...

Six ways to reduce inventory.

Science.gov (United States)

Lunn, T

1996-05-01

The purpose of this presentation is to help you reduce the inventory in your operation. We will accomplish that task by discussing six specific methods that companies have used successfully to reduce their inventory. One common attribute of these successes is that they also build teamwork among the people. Every business operation today is concerned with methods to improve customer service. The real trick is to accomplish that task without increasing inventory. We are all concerned with improving our skills at keeping inventory low.

ANALYSIS MODEL FOR INVENTORY MANAGEMENT

Directory of Open Access Journals (Sweden)

CAMELIA BURJA

2010-01-01

Full Text Available The inventory represents an essential component for the assets of the enterprise and the economic analysis gives them special importance because their accurate management determines the achievement of the activity object and the financial results. The efficient management of inventory requires ensuring an optimum level for them, which will guarantee the normal functioning of the activity with minimum inventory expenses and funds which are immobilised. The paper presents an analysis model for inventory management based on their rotation speed and the correlation with the sales volume illustrated in an adequate study. The highlighting of the influence factors on the efficient inventory management ensures the useful information needed to justify managerial decisions, which will lead to a balancedfinancial position and to increased company performance.

National Wetlands Inventory Polygons

Data.gov (United States)

Minnesota Department of Natural Resources — Wetland area features mapped as part of the National Wetlands Inventory (NWI). The National Wetlands Inventory is a national program sponsored by the US Fish and...

10 CFR 39.37 - Physical inventory.

Science.gov (United States)

2010-01-01

... 10 Energy 1 2010-01-01 2010-01-01 false Physical inventory. 39.37 Section 39.37 Energy NUCLEAR... inventory. Each licensee shall conduct a semi-annual physical inventory to account for all licensed material received and possessed under the license. The licensee shall retain records of the inventory for 3 years...

Base-age invariance and inventory projections

Science.gov (United States)

C. J. Cieszewski; R. L. Bailey; B. E. Borders; G. H. Brister; B. D. Shiver

2000-01-01

One of the most important functions of forest inventory is to facilitate management decisions towards forest sustainability based on inventory projections into the future. Therefore, most forest inventories are used for predicting future states of the forests, in modern forestry the most common methods used in inventory projections are based on implicit functions...

Annual Danish emissions inventory report to UNECE. Inventory 1990 - 2002

Energy Technology Data Exchange (ETDEWEB)

Illerup, J B; Nielsen, M; Winther, M; Hjort Mikkelsen, M; Lyck, E; Hoffmann, L; Fauser, P

2004-05-01

This report is a documentation report on the emission inventories for Denmark as reported to the UNECE Secretariat under the Convention on Long Range Transboundary Air Pollution due by 15 February 2004. The report contains information on Denmark's emission inventories regarding emissions of (1) SOx for the years 1980-2002, (2) NOx, CO, NMVOC and NH{sub 3} for the years 1985-2002; (3) Particulate matter: TSP, PM10, PM2.5 for the years 2000-2002, (4) Heavy Metals: Pb, Cd, Hg, As, Cr, Cu, Ni, Se and Zn for the years 1990-2002, and (5) Polyaromatic hydrocarbons (PAH): Benzo(a)pyrene, benzo(b)fluoranthene, benzo(k)fluoranthene and indeno(1,2,3-cd)pyrene for the years 1990-2002. Furthermore, the report contains information on background data for emissions inventory. (au)

Annual Danish emissions inventory report to UNECE. Inventory 1990 - 2002

Energy Technology Data Exchange (ETDEWEB)

Illerup, J.B.; Nielsen, M.; Winther, M.; Hjort Mikkelsen, M.; Lyck, E.; Hoffmann, L.; Fauser, P.

2004-05-01

This report is a documentation report on the emission inventories for Denmark as reported to the UNECE Secretariat under the Convention on Long Range Transboundary Air Pollution due by 15 February 2004. The report contains information on Denmark's emission inventories regarding emissions of (1) SOx for the years 1980-2002, (2) NOx, CO, NMVOC and NH{sub 3} for the years 1985-2002; (3) Particulate matter: TSP, PM10, PM2.5 for the years 2000-2002, (4) Heavy Metals: Pb, Cd, Hg, As, Cr, Cu, Ni, Se and Zn for the years 1990-2002, and (5) Polyaromatic hydrocarbons (PAH): Benzo(a)pyrene, benzo(b)fluoranthene, benzo(k)fluoranthene and indeno(1,2,3-cd)pyrene for the years 1990-2002. Furthermore, the report contains information on background data for emissions inventory. (au)

Energy production in stars

International Nuclear Information System (INIS)

Bethe, Hans.

1977-01-01

Energy in stars is released partly by gravitation, partly by nuclear reactions. For ordinary stars like our sun, nuclear reactions predominate. However, at the end of the life of a star very large amounts of energy are released by gravitational collapse; this can amount to as much as 10 times the total energy released nuclear reactions. The rotational energy of pulsars is a small remnant of the energy of gravitation. The end stage of small stars is generally a white dwarf, of heavy stars a neutron star of possibly a black hole

Recent evidence on the muted inventory cycle

OpenAIRE

Andrew J. Filardo

1995-01-01

Inventories play an important role in business cycles. Inventory build-ups add momentum to the economy during expansions, while inventory liquidations sap economic strength during recessions. In addition, because inventory fluctuations are notoriously difficult to predict, they present considerable uncertainty in assessing the economic outlook.> The role of inventories in shaping the current outlook for the U.S. economy is particularly uncertain. In the early 1990s, inventory swings appeared ...

Integrated inventory information system

Digital Repository Service at National Institute of Oceanography (India)

Sarupria, J.S.; Kunte, P.D.

The nature of oceanographic data and the management of inventory level information are described in Integrated Inventory Information System (IIIS). It is shown how a ROSCOPO (report on observations/samples collected during oceanographic programme...

HIFISTARS Herschel/HIFI observations of VY Canis Majoris. Molecular-line inventory of the envelope around the largest known star

NARCIS (Netherlands)

Alcolea, J.; Bujarrabal, V.; Planesas, P.; Teyssier, D.; Cernicharo, J.; De Beck, E.; Decin, L.; Dominik, C.; Justtanont, K.; de Koter, A.; Marston, A.P.; Melnick, G.; Menten, K.M.; Neufeld, D.A.; Olofsson, H.; Schmidt, M.; Schöier, F.L.; Szczerba, R.; Waters, L.B.F.M.

2013-01-01

Aims. The study of the molecular gas in the circumstellar envelopes of evolved stars is normally undertaken by observing lines of CO (and other species) in the millimetre-wave domain. In general, the excitation requirements of the observed lines are low at these wavelengths, and therefore these

30 CFR 220.032 - Inventories.

Science.gov (United States)

2010-07-01

... operations. The accumulation of surplus stocks shall be avoided by proper materiel control, inventory and... physical inventory that has not been credited to NPSL operations under § 220.015(a)(2) shall be credited to... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Inventories. 220.032 Section 220.032 Mineral...

Stars and Flowers, Flowers and Stars

Science.gov (United States)

Minti, Hari

2012-12-01

The author, a graduated from the Bucharest University (1964), actually living and working in Israel, concerns his book to variable stars and flowers, two domains of his interest. The analogies includes double stars, eclipsing double stars, eclipses, Big Bang. The book contains 34 chapters, each of which concerns various relations between astronomy and other sciences and pseudosciences such as Psychology, Religion, Geology, Computers and Astrology (to which the author is not an adherent). A special part of the book is dedicated to archeoastronomy and ethnoastronomy, as well as to history of astronomy. Between the main points of interest of these parts: ancient sanctuaries in Sarmizegetusa (Dacia), Stone Henge(UK) and other. The last chapter of the book is dedicated to flowers. The book is richly illustrated. It is designed for a wide circle of readers.

How bright planets became dim stars: planetary speculations in John Herschel's double star astronomy.

Science.gov (United States)

Case, Stephen

2014-03-01

Previous research on the origins of double star astronomy in the early nineteenth century emphasized the role mathematical methods and instrumentation played in motivating early observations of these objects. The work of the British astronomer John Herschel, however, shows that questions regarding the physical nature of double stars were also important. In particular, an analysis of John Herschel's early work on double stars illustrates the way in which speculations regarding these objects were shaped by assumptions of the properties of stars themselves. For Herschel, a major consideration in double star astronomy was distinguishing between types of double stars. Optical doubles were useful in determining parallax while binary doubles were not. In practice, classification of a specific double star pair into one of these categories was based on the assumption that stars were of approximately the same luminosity and thus differences in relative brightness between stars were caused by difference in distances. Such assumptions, though ultimately abandoned, would lead Herschel in the 1830s to advance the possibility that the dim companion stars in certain double star pairs were not stars at all but in fact planets. Copyright © 2014 Elsevier Ltd. All rights reserved.

Spectrophotometry of peculiar B and A stars. II. Eleven mercury-manganese stars

International Nuclear Information System (INIS)

Adelman, S.J.; Pyper, D.M.

1979-01-01

Spectrophotometry of eleven HgMn stars is presented for the optical region. As found in Paper I, the HgMn stars have systematically larger Δiota* and Δa values than the normal main sequence stars due to differences with respect to the mean continuum particularly of the lambda4464 values and the lambda5200 region, respectively. The HgMn stars exhibit a continuous range in the behavior of both the lambda4200 and lambda5200 regions between those stars that have index values larger than the appropriate criterion of presence and present definite evidence for the features to those stars with only a slight possibility of such features. The strengths of the lambda4200 and lambda5200 features appear not to be correlated. In the HgMn stars, both features may be due to differential line blocking. In the energy distribution of all eleven stars, the Balmer jump regions best fit the predictions of slightly hotter solar composition, log g=4.0, fully line blanketed model atmospheres than do the corresponding Paschen continua

Discriminating strange star mergers from neutron star mergers by gravitational-wave measurements

International Nuclear Information System (INIS)

Bauswein, A.; Oechslin, R.; Janka, H.-T.

2010-01-01

We perform three-dimensional relativistic hydrodynamical simulations of the coalescence of strange stars and explore the possibility to decide on the strange matter hypothesis by means of gravitational-wave measurements. Self-binding of strange quark matter and the generally more compact stars yield features that clearly distinguish strange star from neutron star mergers, e.g. hampering tidal disruption during the plunge of quark stars. Furthermore, instead of forming dilute halo structures around the remnant as in the case of neutron star mergers, the coalescence of strange stars results in a differentially rotating hypermassive object with a sharp surface layer surrounded by a geometrically thin, clumpy high-density strange quark matter disk. We also investigate the importance of including nonzero temperature equations of state in neutron star and strange star merger simulations. In both cases we find a crucial sensitivity of the dynamics and outcome of the coalescence to thermal effects, e.g. the outer remnant structure and the delay time of the dense remnant core to black hole collapse depend on the inclusion of nonzero temperature effects. For comparing and classifying the gravitational-wave signals, we use a number of characteristic quantities like the maximum frequency during inspiral or the dominant frequency of oscillations of the postmerger remnant. In general, these frequencies are higher for strange star mergers. Only for particular choices of the equation of state the frequencies of neutron star and strange star mergers are similar. In such cases additional features of the gravitational-wave luminosity spectrum like the ratio of energy emitted during the inspiral phase to the energy radiated away in the postmerger stage may help to discriminate coalescence events of the different types. If such characteristic quantities could be extracted from gravitational-wave signals, for instance with the upcoming gravitational-wave detectors, a decision on the

Science Inventory | US EPA

Science.gov (United States)

The Science Inventory is a searchable database of research products primarily from EPA's Office of Research and Development. Science Inventory records provide descriptions of the product, contact information, and links to available printed material or websites.

X-ray sources in regions of star formation. I. The naked T Tauri stars

International Nuclear Information System (INIS)

Walter, F.M.

1986-01-01

Einstein X-ray observations of regions of active star formation in Taurus, Ophiuchus, and Corona Australis show a greatly enhanced surface density of stellar X-ray sources over that seen in other parts of the sky. Many of the X-ray sources are identified with low-mass, pre-main-sequence stars which are not classical T Tauri stars. The X-ray, photometric, and spectroscopic data for these stars are discussed. Seven early K stars in Oph and CrA are likely to be 1-solar-mass post-T Tauri stars with ages of 10-million yr. The late K stars in Taurus are not post-T Tauri, but naked T Tauri stars, which are coeval with the T Tauri stars, differing mainly in the lack of a circumstellar envelope. 72 references

Wave Star

DEFF Research Database (Denmark)

Kramer, Morten; Brorsen, Michael; Frigaard, Peter

Denne rapport beskriver numeriske beregninger af forskellige flydergeometrier for bølgeenergianlæget Wave Star.......Denne rapport beskriver numeriske beregninger af forskellige flydergeometrier for bølgeenergianlæget Wave Star....

42 CFR 35.41 - Inventory.

Science.gov (United States)

2010-10-01

... 42 Public Health 1 2010-10-01 2010-10-01 false Inventory. 35.41 Section 35.41 Public Health PUBLIC... STATION MANAGEMENT Disposal of Money and Effects of Deceased Patients § 35.41 Inventory. Promptly after the death of a patient in a station or hospital of the Service, an inventory of his money and effects...

Descendants of the first stars: the distinct chemical signature of second generation stars

Science.gov (United States)

Hartwig, Tilman; Yoshida, Naoki; Magg, Mattis; Frebel, Anna; Glover, Simon C. O.; Gómez, Facundo A.; Griffen, Brendan; Ishigaki, Miho N.; Ji, Alexander P.; Klessen, Ralf S.; O'Shea, Brian W.; Tominaga, Nozomu

2018-05-01

Extremely metal-poor (EMP) stars in the Milky Way (MW) allow us to infer the properties of their progenitors by comparing their chemical composition to the metal yields of the first supernovae. This method is most powerful when applied to mono-enriched stars, i.e. stars that formed from gas that was enriched by only one previous supernova. We present a novel diagnostic to identify this subclass of EMP stars. We model the first generations of star formation semi-analytically, based on dark matter halo merger trees that yield MW-like halos at the present day. Radiative and chemical feedback are included self-consistently and we trace all elements up to zinc. Mono-enriched stars account for only ˜1% of second generation stars in our fiducial model and we provide an analytical formula for this probability. We also present a novel analytical diagnostic to identify mono-enriched stars, based on the metal yields of the first supernovae. This new diagnostic allows us to derive our main results independently from the specific assumptions made regarding Pop III star formation, and we apply it to a set of observed EMP stars to demonstrate its strengths and limitations. Our results may provide selection criteria for current and future surveys and therefore contribute to a deeper understanding of EMP stars and their progenitors.

Neutron star formation in theoretical supernovae. Low mass stars and white dwarfs

International Nuclear Information System (INIS)

Nomoto, K.

1986-01-01

The presupernova evolution of stars that form semi-degenerate or strongly degenerate O + Ne + Mg cores is discussed. For the 10 to 13 Msub solar stars, behavior of off-center neon flashes is crucial. The 8 to 10 m/sub solar stars do not ignite neon and eventually collapse due to electron captures. Properties of supernova explosions and neutron stars expected from these low mass progenitors are compared with the Crab nebula. The conditions for which neutron stars form from accretion-induced collapse of white dwarfs in clsoe binary systems is also examined

Blood inventory management: hospital best practice.

Science.gov (United States)

Stanger, Sebastian H W; Yates, Nicola; Wilding, Richard; Cotton, Sue

2012-04-01

Blood is a perishable product, and hence good management of inventories is crucial. Blood inventory management is a trade-off between shortage and wastage. The challenge is to keep enough stock to ensure a 100% supply of blood while keeping time expiry losses at a minimum. This article focuses on inventory management of red blood cells in hospital transfusion laboratories to derive principles of best practice and makes recommendations that will ensure losses due to time expiry are kept to a minimum. The literature was reviewed to identify available models for perishable inventory management. Historical data from the UK blood supply chain was analyzed to identify hospitals with good inventory management practice and low wastage levels. Transfusion laboratory managers in the selected hospitals were interviewed in 7 case studies with the aim of identifying drivers for low wastage and good inventory management practice. The findings from the case studies were compared with the literature. The extant literature asserts that the drivers for good inventory performance are the use of complex inventory models and algorithms. This study has found this not to be the case. Instead, good performance is driven by the quality of transfusion laboratory staff, who must be skilled, regularly trained, and experienced. Electronic crossmatching, transparency of the inventory, and simple management procedures also facilitate good performance. Copyright © 2012 Elsevier Inc. All rights reserved.

General Relativity and Compact Stars

International Nuclear Information System (INIS)

Glendenning, Norman K.

2005-01-01

Compact stars--broadly grouped as neutron stars and white dwarfs--are the ashes of luminous stars. One or the other is the fate that awaits the cores of most stars after a lifetime of tens to thousands of millions of years. Whichever of these objects is formed at the end of the life of a particular luminous star, the compact object will live in many respects unchanged from the state in which it was formed. Neutron stars themselves can take several forms--hyperon, hybrid, or strange quark star. Likewise white dwarfs take different forms though only in the dominant nuclear species. A black hole is probably the fate of the most massive stars, an inaccessible region of spacetime into which the entire star, ashes and all, falls at the end of the luminous phase. Neutron stars are the smallest, densest stars known. Like all stars, neutron stars rotate--some as many as a few hundred times a second. A star rotating at such a rate will experience an enormous centrifugal force that must be balanced by gravity or else it will be ripped apart. The balance of the two forces informs us of the lower limit on the stellar density. Neutron stars are 10 14 times denser than Earth. Some neutron stars are in binary orbit with a companion. Application of orbital mechanics allows an assessment of masses in some cases. The mass of a neutron star is typically 1.5 solar masses. They can therefore infer their radii: about ten kilometers. Into such a small object, the entire mass of our sun and more, is compressed

Star formation

International Nuclear Information System (INIS)

Woodward, P.R.

1978-01-01

Theoretical models of star formation are discussed beginning with the earliest stages and ending in the formation of rotating, self-gravitating disks or rings. First a model of the implosion of very diffuse gas clouds is presented which relies upon a shock at the edge of a galactic spiral arm to drive the implosion. Second, models are presented for the formation of a second generation of massive stars in such a cloud once a first generation has formed. These models rely on the ionizing radiation from massive stars or on the supernova shocks produced when these stars explode. Finally, calculations of the gravitational collapse of rotating clouds are discussed with special focus on the question of whether rotating disks or rings are the result of such a collapse. 65 references

Dark stars: a new study of the first stars in the Universe

International Nuclear Information System (INIS)

Freese, Katherine; Bodenheimer, Peter; Gondolo, Paolo; Spolyar, Douglas

2009-01-01

We have proposed that the first phase of stellar evolution in the history of the Universe may be dark stars (DSs), powered by dark matter (DM) heating rather than by nuclear fusion. Weakly interacting massive particles, which may be their own antipartners, collect inside the first stars and annihilate to produce a heat source that can power the stars. A new stellar phase results, a DS, powered by DM annihilation as long as there is DM fuel, with lifetimes from millions to billions of years. We find that the first stars are very bright (∼10 6 L o-dot ) and cool (T surf surf > 50 000 K); hence DS should be observationally distinct from standard Pop III stars. Once the DM fuel is exhausted, the DS becomes a heavy main sequence star; these stars eventually collapse to form massive black holes that may provide seeds for supermassive black holes observed at early times as well as explanations for recent ARCADE data and for intermediate black holes.

Introduction to neutron stars

Energy Technology Data Exchange (ETDEWEB)

Lattimer, James M. [Dept. of Physics and Astronomy, Stony Brook University, Stony Brook, NY 11794-3800 (United States)

2015-02-24

Neutron stars contain the densest form of matter in the present universe. General relativity and causality set important constraints to their compactness. In addition, analytic GR solutions are useful in understanding the relationships that exist among the maximum mass, radii, moments of inertia, and tidal Love numbers of neutron stars, all of which are accessible to observation. Some of these relations are independent of the underlying dense matter equation of state, while others are very sensitive to the equation of state. Recent observations of neutron stars from pulsar timing, quiescent X-ray emission from binaries, and Type I X-ray bursts can set important constraints on the structure of neutron stars and the underlying equation of state. In addition, measurements of thermal radiation from neutron stars has uncovered the possible existence of neutron and proton superfluidity/superconductivity in the core of a neutron star, as well as offering powerful evidence that typical neutron stars have significant crusts. These observations impose constraints on the existence of strange quark matter stars, and limit the possibility that abundant deconfined quark matter or hyperons exist in the cores of neutron stars.

Polarization of Be stars

International Nuclear Information System (INIS)

Johns, M.W.

1975-01-01

Linear polarization of starlight may be produced by electron scattering in the extended atmospheres of early type stars. Techniques are investigated for the measurement and interpretation of this polarization. Polarimetric observations were made of twelve visual double star systems in which at least one member was a B type star as a means of separating the intrinsic stellar polarization from the polarization produced in the interstellar medium. Four of the double stars contained a Be star. Evidence for intrinsic polarization was found in five systems including two of the Be systems, one double star with a short period eclipsing binary, and two systems containing only normal early type stars for which emission lines have not been previously reported. The interpretation of these observations in terms of individual stellar polarizations and their wavelength dependence is discussed. The theoretical basis for the intrinsic polarization of early type stars is explored with a model for the disk-like extended atmospheres of Be stars. Details of a polarimeter for the measurement of the linear polarization of astronomical point sources are also presented with narrow band (Δ lambda = 100A) measurements of the polarization of γ Cas from lambda 4000 to lambda 5800

Rates of star formation

International Nuclear Information System (INIS)

Larson, R.B.

1977-01-01

It is illustrated that a theoretical understanding of the formation and evolution of galaxies depends on an understanding of star formation, and especially of the factors influencing the rate of star formation. Some of the theoretical problems of star formation in galaxies, some approaches that have been considered in models of galaxy evolution, and some possible observational tests that may help to clarify which processes or models are most relevant are reviewed. The material is presented under the following headings: power-law models for star formation, star formation processes (conditions required, ways of achieving these conditions), observational indications and tests, and measures of star formation rates in galaxies. 49 references

Optimization of inventory management in furniture manufacturing

OpenAIRE

Karkauskas, Justinas

2017-01-01

Aim of research - to present inventory management optimization guidelines for furniture manufacturing company, based on analysis of scientific literature and empirical research. Tasks of the Issue: • Disclose problems of inventory management in furniture manufacturing sector; • To analyze theoretical inventory management decisions; • To develop theoretical inventory management optimization model; • Do empirical research of inventory management and present offers for optimizatio...

The Drifting Star

Science.gov (United States)

2008-04-01

By studying in great detail the 'ringing' of a planet-harbouring star, a team of astronomers using ESO's 3.6-m telescope have shown that it must have drifted away from the metal-rich Hyades cluster. This discovery has implications for theories of star and planet formation, and for the dynamics of our Milky Way. ESO PR Photo 09a/08 ESO PR Photo 09a/08 Iota Horologii The yellow-orange star Iota Horologii, located 56 light-years away towards the southern Horologium ("The Clock") constellation, belongs to the so-called "Hyades stream", a large number of stars that move in the same direction. Previously, astronomers using an ESO telescope had shown that the star harbours a planet, more than 2 times as large as Jupiter and orbiting in 320 days (ESO 12/99). But until now, all studies were unable to pinpoint the exact characteristics of the star, and hence to understand its origin. A team of astronomers, led by Sylvie Vauclair from the University of Toulouse, France, therefore decided to use the technique of 'asteroseismology' to unlock the star's secrets. "In the same way as geologists monitor how seismic waves generated by earthquakes propagate through the Earth and learn about the inner structure of our planet, it is possible to study sound waves running through a star, which forms a sort of large, spherical bell," says Vauclair. The 'ringing' from this giant musical instrument provides astronomers with plenty of information about the physical conditions in the star's interior. And to 'listen to the music', the astronomers used one of the best instruments available. The observations were conducted in November 2006 during 8 consecutive nights with the state-of-the-art HARPS spectrograph mounted on the ESO 3.6-m telescope at La Silla. Up to 25 'notes' could be identified in the unique dataset, most of them corresponding to waves having a period of about 6.5 minutes. These observations allowed the astronomers to obtain a very precise portrait of Iota Horologii: its

INFRARED TWO-COLOR DIAGRAMS FOR AGB STARS, POST-AGB STARS, AND PLANETARY NEBULAE

Energy Technology Data Exchange (ETDEWEB)

Suh, Kyung-Won, E-mail: kwsuh@chungbuk.ac.kr [Department of Astronomy and Space Science, Chungbuk National University, Cheongju-City, 362-763 (Korea, Republic of)

2015-08-01

We present various infrared two-color diagrams (2CDs) for asymptotic giant branch (AGB) stars, post-AGB stars, and Planetary Nebulae (PNe) and investigate possible evolutionary tracks. We use catalogs from the available literature for the sample of 4903 AGB stars (3373 O-rich; 1168 C-rich; 362 S-type), 660 post-AGB stars (326 post-AGB; 334 pre-PN), and 1510 PNe in our Galaxy. For each object in the catalog, we cross-identify the IRAS, AKARI, Midcourse Space Experiment, and 2MASS counterparts. The IR 2CDs can provide useful information about the structure and evolution of the dust envelopes as well as the central stars. To find possible evolutionary tracks from AGB stars to PNe on the 2CDs, we investigate spectral evolution of post-AGB stars by making simple but reasonable assumptions on the evolution of the central star and dust shell. We perform radiative transfer model calculations for the detached dust shells around evolving central stars in the post-AGB phase. We find that the theoretical dust shell model tracks using dust opacity functions of amorphous silicate and amorphous carbon roughly coincide with the densely populated observed points of AGB stars, post-AGB stars, and PNe on various IR 2CDs. Even though some discrepancies are inevitable, the end points of the theoretical post-AGB model tracks generally converge in the region of the observed points of PNe on most 2CDs.

Interacting binary stars

CERN Document Server

Sahade, Jorge; Ter Haar, D

1978-01-01

Interacting Binary Stars deals with the development, ideas, and problems in the study of interacting binary stars. The book consolidates the information that is scattered over many publications and papers and gives an account of important discoveries with relevant historical background. Chapters are devoted to the presentation and discussion of the different facets of the field, such as historical account of the development in the field of study of binary stars; the Roche equipotential surfaces; methods and techniques in space astronomy; and enumeration of binary star systems that are studied

Wolf-Rayet stars and O-star runaways with HIPPARCOS - I. Kinematics

NARCIS (Netherlands)

Moffat, AFJ; Marchenko, SV; Seggewiss, W; van der Hucht, KA; Schrijver, H; Stenholm, B; Lundstrom, [No Value; Gunawan, DYAS; Sutantyo, W; van den Heuvel, EPJ; De Cuyper, JP; Gomez, AE

Reliable systemic radial velocities are almost impossible to secure for Wolf-Rayet stars, difficult for O stars. Therefore, to study the motions - both systematic in the Galaxy and peculiar - of these two related types of hot, luminous star, we have examined the Hipparcos proper motions of some 70

Evolution of variable stars

International Nuclear Information System (INIS)

Becker, S.A.

1986-08-01

Throughout the domain of the H R diagram lie groupings of stars whose luminosity varies with time. These variable stars can be classified based on their observed properties into distinct types such as β Cephei stars, δ Cephei stars, and Miras, as well as many other categories. The underlying mechanism for the variability is generally felt to be due to four different causes: geometric effects, rotation, eruptive processes, and pulsation. In this review the focus will be on pulsation variables and how the theory of stellar evolution can be used to explain how the various regions of variability on the H R diagram are populated. To this end a generalized discussion of the evolutionary behavior of a massive star, an intermediate mass star, and a low mass star will be presented. 19 refs., 1 fig., 1 tab

A new method for determining which stars are near a star sensor field-of-view

Science.gov (United States)

Yates, Russell E., Jr.; Vedder, John D.

1991-01-01

A new method is described for determining which stars in a navigation star catalog are near a star sensor field of view (FOV). This method assumes that an estimate of spacecraft inertial attitude is known. Vector component ranges for the star sensor FOV are computed, so that stars whose vector components lie within these ranges are near the star sensor FOV. This method requires no presorting of the navigation star catalog, and is more efficient than tradition methods.

Star identification methods, techniques and algorithms

CERN Document Server

Zhang, Guangjun

2017-01-01

This book summarizes the research advances in star identification that the author’s team has made over the past 10 years, systematically introducing the principles of star identification, general methods, key techniques and practicable algorithms. It also offers examples of hardware implementation and performance evaluation for the star identification algorithms. Star identification is the key step for celestial navigation and greatly improves the performance of star sensors, and as such the book include the fundamentals of star sensors and celestial navigation, the processing of the star catalog and star images, star identification using modified triangle algorithms, star identification using star patterns and using neural networks, rapid star tracking using star matching between adjacent frames, as well as implementation hardware and using performance tests for star identification. It is not only valuable as a reference book for star sensor designers and researchers working in pattern recognition and othe...

Hanford inventory program user's manual

International Nuclear Information System (INIS)

Hinkelman, K.C.

1994-01-01

Provides users with instructions and information about accessing and operating the Hanford Inventory Program (HIP) system. The Hanford Inventory Program is an integrated control system that provides a single source for the management and control of equipment, parts, and material warehoused by Westinghouse Hanford Company in various site-wide locations. The inventory is comprised of spare parts and equipment, shop stock, special tools, essential materials, and convenience storage items. The HIP replaced the following systems; ACA, ASP, PICS, FSP, WSR, STP, and RBO. In addition, HIP manages the catalog maintenance function for the General Supplies inventory stocked in the 1164 building and managed by WIMS

On the evolution of stars

International Nuclear Information System (INIS)

Kippenhahn, R.

1989-01-01

A popular survey is given of the present knowledge on evolution and ageing of stars. Main sequence stars, white dwarf stars, and red giant stars are classified in the Hertzsprung-Russell (HR)-diagram by measurable quantities: surface temperature and luminosity. From the HR-diagram it can be concluded to star mass and age. Star-forming processes in interstellar clouds as well as stellar burning processes are illustrated. The changes occurring in a star due to the depletion of the nuclear energy reserve are described. In this frame the phenomena of planetary nebulae, supernovae, pulsars, neutron stars as well as of black holes are explained

MAGNETIC FIELDS OF STARS

OpenAIRE

Bychkov, V. D.; Bychkova, L. V.; Madej, J.

2008-01-01

Now it is known about 1212 stars of the main sequence and giants (from them 610 stars - it is chemically peculiarity (CP) stars) for which direct measurements of magnetic fields were spent (Bychkov et al.,2008). Let's consider, what representations were generated about magnetic fields (MT) of stars on the basis of available observations data.

Which of Kepler's Stars Flare?

Science.gov (United States)

Kohler, Susanna

2017-12-01

The habitability of distant exoplanets is dependent upon many factors one of which is the activity of their host stars. To learn about which stars are most likely to flare, a recent study examines tens of thousands of stellar flares observed by Kepler.Need for a Broader SampleArtists rendering of a flaring dwarf star. [NASAs Goddard Space Flight Center/S. Wiessinger]Most of our understanding of what causes a star to flare is based on observations of the only star near enough to examine in detail the Sun. But in learning from a sample size of one, a challenge arises: we must determine which conclusions are unique to the Sun (or Sun-like stars), and which apply to other stellar types as well.Based on observations and modeling, astronomers think that stellar flares result from the reconnection of magnetic field lines in a stars outer atmosphere, the corona. The magnetic activity is thought to be driven by a dynamo caused by motions in the stars convective zone.HR diagram of the Kepler stars, with flaring main-sequence (yellow), giant (red) and A-star (green) stars in the authors sample indicated. [Van Doorsselaere et al. 2017]To test whether these ideas are true generally, we need to understand what types of stars exhibit flares, and what stellar properties correlate with flaring activity. A team of scientists led by Tom Van Doorsselaere (KU Leuven, Belgium) has now used an enormous sample of flares observed by Kepler to explore these statistics.Intriguing TrendsVan Doorsselaere and collaborators used a new automated flare detection and characterization algorithm to search through the raw light curves from Quarter 15 of the Kepler mission, building a sample of 16,850 flares on 6,662 stars. They then used these to study the dependence of the flare occurrence rate, duration, energy, and amplitude on the stellar spectral type and rotation period.This large statistical study led the authors to several interesting conclusions, including:Flare star incidence rate as a a

Symbiotic stars

Science.gov (United States)

Kafatos, M.; Michalitsianos, A. G.

1984-01-01

The physical characteristics of symbiotic star systems are discussed, based on a review of recent observational data. A model of a symbiotic star system is presented which illustrates how a cool red-giant star is embedded in a nebula whose atoms are ionized by the energetic radiation from its hot compact companion. UV outbursts from symbiotic systems are explained by two principal models: an accretion-disk-outburst model which describes how material expelled from the tenuous envelope of the red giant forms an inwardly-spiralling disk around the hot companion, and a thermonuclear-outburst model in which the companion is specifically a white dwarf which superheats the material expelled from the red giant to the point where thermonuclear reactions occur and radiation is emitted. It is suspected that the evolutionary course of binary systems is predetermined by the initial mass and angular momentum of the gas cloud within which binary stars are born. Since red giants and Mira variables are thought to be stars with a mass of one or two solar mass, it is believed that the original cloud from which a symbiotic system is formed can consist of no more than a few solar masses of gas.

Massive stars in galaxies

International Nuclear Information System (INIS)

Humphreys, R.M.

1987-01-01

The relationship between the morphologic type of a galaxy and the evolution of its massive stars is explored, reviewing observational results for nearby galaxies. The data are presented in diagrams, and it is found that the massive-star populations of most Sc spiral galaxies and irregular galaxies are similar, while those of Sb spirals such as M 31 and M 81 may be affected by morphology (via differences in the initial mass function or star-formation rate). Consideration is also given to the stability-related upper luminosity limit in the H-R diagram of hypergiant stars (attributed to radiation pressure in hot stars and turbulence in cool stars) and the goals of future observation campaigns. 88 references

GMC Collisions as Triggers of Star Formation. III. Density and Magnetically Regulated Star Formation

Energy Technology Data Exchange (ETDEWEB)

Wu, Benjamin [National Astronomical Observatory of Japan, Mitaka, Tokyo 181-8588 (Japan); Tan, Jonathan C. [Department of Physics, University of Florida, Gainesville, FL 32611 (United States); Christie, Duncan [Department of Astronomy, University of Florida, Gainesville, FL 32611 (United States); Nakamura, Fumitaka [National Astronomical Observatory, Mitaka, Tokyo 181-8588 (Japan); Van Loo, Sven [School of Physics and Astronomy, University of Leeds, Leeds LS2 9JT (United Kingdom); Collins, David, E-mail: ben.wu@nao.ac.jp [Department of Physics, Florida State University, Tallahassee, FL 32306-4350 (United States)

2017-06-01

We study giant molecular cloud (GMC) collisions and their ability to trigger star cluster formation. We further develop our three-dimensional magnetized, turbulent, colliding GMC simulations by implementing star formation subgrid models. Two such models are explored: (1) “Density-Regulated,” i.e., fixed efficiency per free-fall time above a set density threshold and (2) “Magnetically Regulated,” i.e., fixed efficiency per free-fall time in regions that are magnetically supercritical. Variations of parameters associated with these models are also explored. In the non-colliding simulations, the overall level of star formation is sensitive to model parameter choices that relate to effective density thresholds. In the GMC collision simulations, the final star formation rates and efficiencies are relatively independent of these parameters. Between the non-colliding and colliding cases, we compare the morphologies of the resulting star clusters, properties of star-forming gas, time evolution of the star formation rate (SFR), spatial clustering of the stars, and resulting kinematics of the stars in comparison to the natal gas. We find that typical collisions, by creating larger amounts of dense gas, trigger earlier and enhanced star formation, resulting in 10 times higher SFRs and efficiencies. The star clusters formed from GMC collisions show greater spatial substructure and more disturbed kinematics.

An Autonomous Star Identification Algorithm Based on One-Dimensional Vector Pattern for Star Sensors.

Science.gov (United States)

Luo, Liyan; Xu, Luping; Zhang, Hua

2015-07-07

In order to enhance the robustness and accelerate the recognition speed of star identification, an autonomous star identification algorithm for star sensors is proposed based on the one-dimensional vector pattern (one_DVP). In the proposed algorithm, the space geometry information of the observed stars is used to form the one-dimensional vector pattern of the observed star. The one-dimensional vector pattern of the same observed star remains unchanged when the stellar image rotates, so the problem of star identification is simplified as the comparison of the two feature vectors. The one-dimensional vector pattern is adopted to build the feature vector of the star pattern, which makes it possible to identify the observed stars robustly. The characteristics of the feature vector and the proposed search strategy for the matching pattern make it possible to achieve the recognition result as quickly as possible. The simulation results demonstrate that the proposed algorithm can effectively accelerate the star identification. Moreover, the recognition accuracy and robustness by the proposed algorithm are better than those by the pyramid algorithm, the modified grid algorithm, and the LPT algorithm. The theoretical analysis and experimental results show that the proposed algorithm outperforms the other three star identification algorithms.

Subluminous Wolf-Rayet stars: Observations

International Nuclear Information System (INIS)

Heap, S.R.

1982-01-01

The author has used the fact that some central stars are WR stars and others are say, O stars, as a focal point for his presentation. In attempting to answer this question he has considered how the properties of WR-type central stars differ from those of O-type stars. The study begins with the classification and calibration of WR spectra, then goes on to the physical properties of WR-type central stars, and at the end returns to the question of what distinguishes a Wolf-Rayet star. The observational data for central stars are neither complete nor precise. Nevertheless, they suggest that what distinguishes a WR central star is not so much its present physical properties (e.g. temperature, gravity), but rather, its fundamental properties (initial and evolutionary history). (Auth.)

Optimal ABC inventory classification using interval programming

NARCIS (Netherlands)

Rezaei, J.; Salimi, N.

2015-01-01

Inventory classification is one of the most important activities in inventory management, whereby inventories are classified into three or more classes. Several inventory classifications have been proposed in the literature, almost all of which have two main shortcomings in common. That is, the

An Analysis of the Optimal Multiobjective Inventory Clustering Decision with Small Quantity and Great Variety Inventory by Applying a DPSO

Science.gov (United States)

Li, Meng-Hua

2014-01-01

When an enterprise has thousands of varieties in its inventory, the use of a single management method could not be a feasible approach. A better way to manage this problem would be to categorise inventory items into several clusters according to inventory decisions and to use different management methods for managing different clusters. The present study applies DPSO (dynamic particle swarm optimisation) to a problem of clustering of inventory items. Without the requirement of prior inventory knowledge, inventory items are automatically clustered into near optimal clustering number. The obtained clustering results should satisfy the inventory objective equation, which consists of different objectives such as total cost, backorder rate, demand relevance, and inventory turnover rate. This study integrates the above four objectives into a multiobjective equation, and inputs the actual inventory items of the enterprise into DPSO. In comparison with other clustering methods, the proposed method can consider different objectives and obtain an overall better solution to obtain better convergence results and inventory decisions. PMID:25197713

America's Star Libraries

Science.gov (United States)

Lyons, Ray; Lance, Keith Curry

2009-01-01

"Library Journal"'s new national rating of public libraries, the "LJ" Index of Public Library Service, identifies 256 "star" libraries. It rates 7,115 public libraries. The top libraries in each group get five, four, or three Michelin guide-like stars. All included libraries, stars or not, can use their scores to learn from their peers and improve…

Observing Double Stars

Science.gov (United States)

Genet, Russell M.; Fulton, B. J.; Bianco, Federica B.; Martinez, John; Baxter, John; Brewer, Mark; Carro, Joseph; Collins, Sarah; Estrada, Chris; Johnson, Jolyon; Salam, Akash; Wallen, Vera; Warren, Naomi; Smith, Thomas C.; Armstrong, James D.; McGaughey, Steve; Pye, John; Mohanan, Kakkala; Church, Rebecca

2012-05-01

Double stars have been systematically observed since William Herschel initiated his program in 1779. In 1803 he reported that, to his surprise, many of the systems he had been observing for a quarter century were gravitationally bound binary stars. In 1830 the first binary orbital solution was obtained, leading eventually to the determination of stellar masses. Double star observations have been a prolific field, with observations and discoveries - often made by students and amateurs - routinely published in a number of specialized journals such as the Journal of Double Star Observations. All published double star observations from Herschel's to the present have been incorporated in the Washington Double Star Catalog. In addition to reviewing the history of visual double stars, we discuss four observational technologies and illustrate these with our own observational results from both California and Hawaii on telescopes ranging from small SCTs to the 2-meter Faulkes Telescope North on Haleakala. Two of these technologies are visual observations aimed primarily at published "hands-on" student science education, and CCD observations of both bright and very faint doubles. The other two are recent technologies that have launched a double star renaissance. These are lucky imaging and speckle interferometry, both of which can use electron-multiplying CCD cameras to allow short (30 ms or less) exposures that are read out at high speed with very low noise. Analysis of thousands of high speed exposures allows normal seeing limitations to be overcome so very close doubles can be accurately measured.

Neutron star natal kicks and the long-term survival of star clusters

Science.gov (United States)

Contenta, Filippo; Varri, Anna Lisa; Heggie, Douglas C.

2015-04-01

We investigate the dynamical evolution of a star cluster in an external tidal field by using N-body simulations, with focus on the effects of the presence or absence of neutron star natal velocity kicks. We show that, even if neutron stars typically represent less than 2 per cent of the total bound mass of a star cluster, their primordial kinematic properties may affect the lifetime of the system by up to almost a factor of 4. We interpret this result in the light of two known modes of star cluster dissolution, dominated by either early stellar evolution mass-loss or two-body relaxation. The competition between these effects shapes the mass-loss profile of star clusters, which may either dissolve abruptly (`jumping'), in the pre-core-collapse phase, or gradually (`skiing'), after having reached core collapse.

Hyperfast pulsars as the remnants of massive stars ejected from young star clusters

Science.gov (United States)

Gvaramadze, Vasilii V.; Gualandris, Alessia; Portegies Zwart, Simon

2008-04-01

Recent proper motion and parallax measurements for the pulsar PSR B1508+55 indicate a transverse velocity of ~1100kms-1, which exceeds earlier measurements for any neutron star. The spin-down characteristics of PSR B1508+55 are typical for a non-recycled pulsar, which implies that the velocity of the pulsar cannot have originated from the second supernova disruption of a massive binary system. The high velocity of PSR B1508+55 can be accounted for by assuming that it received a kick at birth or that the neutron star was accelerated after its formation in the supernova explosion. We propose an explanation for the origin of hyperfast neutron stars based on the hypothesis that they could be the remnants of a symmetric supernova explosion of a high-velocity massive star which attained its peculiar velocity (similar to that of the pulsar) in the course of a strong dynamical three- or four-body encounter in the core of dense young star cluster. To check this hypothesis, we investigated three dynamical processes involving close encounters between: (i) two hard massive binaries, (ii) a hard binary and an intermediate-mass black hole (IMBH) and (iii) a single stars and a hard binary IMBH. We find that main-sequence O-type stars cannot be ejected from young massive star clusters with peculiar velocities high enough to explain the origin of hyperfast neutron stars, but lower mass main-sequence stars or the stripped helium cores of massive stars could be accelerated to hypervelocities. Our explanation for the origin of hyperfast pulsars requires a very dense stellar environment of the order of 106- 107starspc-3. Although such high densities may exist during the core collapse of young massive star clusters, we caution that they have never been observed.

Heavy Metal Stars

Science.gov (United States)

2001-08-01

La Silla Telescope Detects Lots of Lead in Three Distant Binaries Summary Very high abundances of the heavy element Lead have been discovered in three distant stars in the Milky Way Galaxy . This finding strongly supports the long-held view that roughly half of the stable elements heavier than Iron are produced in common stars during a phase towards the end of their life when they burn their Helium - the other half results from supernova explosions. All the Lead contained in each of the three stars weighs about as much as our Moon. The observations show that these "Lead stars" - all members of binary stellar systems - have been more enriched with Lead than with any other chemical element heavier than Iron. This new result is in excellent agreement with predictions by current stellar models about the build-up of heavy elements in stellar interiors. The new observations are reported by a team of Belgian and French astronomers [1] who used the Coude Echelle Spectrometer on the ESO 3.6-m telescope at the La Silla Observatory (Chile). PR Photo 26a/01 : A photo of HD 196944 , one of the "Lead stars". PR Photo 26b/01 : A CES spectrum of HD 196944 . The build-up of heavy elements Astronomers and physicists denote the build-up of heavier elements from lighter ones as " nucleosynthesis ". Only the very lightest elements (Hydrogen, Helium and Lithium [2]) were created at the time of the Big Bang and therefore present in the early universe. All the other heavier elements we now see around us were produced at a later time by nucleosynthesis inside stars. In those "element factories", nuclei of the lighter elements are smashed together whereby they become the nuclei of heavier ones - this process is known as nuclear fusion . In our Sun and similar stars, Hydrogen is being fused into Helium. At some stage, Helium is fused into Carbon, then Oxygen, etc. The fusion process requires positively charged nuclei to move very close to each other before they can unite. But with increasing

INCAP - Applying short-term flexibility to control inventories

OpenAIRE

Lödding , Hermann; Lohmann , Steffen

2011-01-01

Abstract Inventory Based Capacity Control (INCAP) is a very simple method that allows inventory levels to be effectively controlled by using short-term capacity flexibility in make-to-stock settings. Moreover, INCAP can be used for finished goods inventories as well as for semi-finished goods inventories. The basic idea is to define upper and lower inventory limits and to adjust capacities if the inventory level reaches either limit. Should the inventory fall below the lower limit,...

Strategic Inventories in Vertical Contracts

OpenAIRE

Krishnan Anand; Ravi Anupindi; Yehuda Bassok

2008-01-01

Classical reasons for carrying inventory include fixed (nonlinear) production or procurement costs, lead times, nonstationary or uncertain supply/demand, and capacity constraints. The last decade has seen active research in supply chain coordination focusing on the role of incentive contracts to achieve first-best levels of inventory. An extensive literature in industrial organization that studies incentives for vertical controls largely ignores the effect of inventories. Does the ability to ...

Inventories and sales uncertainty\\ud

OpenAIRE

Caglayan, M.; Maioli, S.; Mateut, S.

2011-01-01

We investigate the empirical linkages between sales uncertainty and firms´ inventory investment behavior while controlling for firms´ financial strength. Using large panels of manufacturing firms from several European countries we find that higher sales uncertainty leads to larger stocks of inventories. We also identify an indirect effect of sales uncertainty on inventory accumulation through the financial strength of firms. Our results provide evidence that financial strength mitigates the a...

77 FR 5280 - Service Contracts Inventory

Science.gov (United States)

2012-02-02

... NUCLEAR REGULATORY COMMISSION [NRC-2012-0023] Service Contracts Inventory AGENCY: Nuclear...) is providing for public information its Inventory of Contracts for Services for Fiscal Year (FY) 2011. The inventory includes service contract actions over $25,000 that were awarded in FY 2011. ADDRESSES...

78 FR 10642 - Service Contracts Inventory

Science.gov (United States)

2013-02-14

... NUCLEAR REGULATORY COMMISSION [NRC-2013-0029] Service Contracts Inventory AGENCY: Nuclear...) is providing for public information its Inventory of Contracts for Services for Fiscal Year (FY) 2012. The inventory includes service contract actions over $25,000 that were awarded in FY 2012. ADDRESSES...

Ultracompact X-ray binary stars

NARCIS (Netherlands)

Haaften, L.M. van

2013-01-01

Ultracompact X-ray binary stars usually consist of a neutron star and a white dwarf, two stars bound together by their strong gravity and orbiting each other very rapidly, completing one orbit in less than one hour. Neutron stars are extremely compact remnants of the collapsed cores of massive stars

SBA Network Components & Software Inventory

Data.gov (United States)

Small Business Administration — SBA’s Network Components & Software Inventory contains a complete inventory of all devices connected to SBA’s network including workstations, servers, routers,...

48 CFR 49.602-2 - Inventory forms.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Inventory forms. 49.602-2... TERMINATION OF CONTRACTS Contract Termination Forms and Formats 49.602-2 Inventory forms. Standard Form (SF) 1428, Inventory Disposal Schedule, and SF 1429, Inventory Disposal Schedule—Continuation Sheet, shall...

10 CFR 850.20 - Baseline beryllium inventory.

Science.gov (United States)

2010-01-01

... 10 Energy 4 2010-01-01 2010-01-01 false Baseline beryllium inventory. 850.20 Section 850.20 Energy... Baseline beryllium inventory. (a) The responsible employer must develop a baseline inventory of the... inventory, the responsible employer must: (1) Review current and historical records; (2) Interview workers...

Star Masses and Star-Planet Distances for Earth-like Habitability.

Science.gov (United States)

Waltham, David

2017-01-01

This paper presents statistical estimates for the location and duration of habitable zones (HZs) around stars of different mass. The approach is based upon the assumption that Earth's location, and the Sun's mass, should not be highly atypical of inhabited planets. The results support climate-model-based estimates for the location of the Sun's HZ except models giving a present-day outer-edge beyond 1.64 AU. The statistical approach also demonstrates that there is a habitability issue for stars smaller than 0.65 solar masses since, otherwise, Earth would be an extremely atypical inhabited world. It is difficult to remove this anomaly using the assumption that poor habitability of planets orbiting low-mass stars results from unfavorable radiation regimes either before, or after, their stars enter the main sequence. However, the anomaly is well explained if poor habitability results from tidal locking of planets in the HZs of small stars. The expected host-star mass for planets with intelligent life then has a 95% confidence range of 0.78 M ⊙ planets with at least simple life is 0.57 M ⊙  < M < 1.64 M ⊙ . Key Words: Habitability-Habitable zone-Anthropic-Red dwarfs-Initial mass function. Astrobiology 17, 61-77.

X-ray sources in stars formation areas: T Tauri stars and proto-stars in the rho Ophiuchi dark cloud

International Nuclear Information System (INIS)

Grosso, Nicolas

1999-01-01

This thesis studies from large to small scales, X-ray sources in the rho Ophiuchi dark cloud. After some background on the formation of the low-mass young stars (Chapter 1), Chapter 2 takes an interest in the T Tauri star population. Chapter 3 tackles the search of the magnetic activity at the younger stage of protostar, presenting a powerful X-ray emission from an IR protostar, called YLW15, during a flare, and a quasi-periodic flare of the same source; as well as a new detection of another IR protostar in the ROSAT archives. It ends with a review of protostar detections. Some IR protostar flares show a very long increasing phase. Chapter 4 links this behaviour with a modulation by the central star rotation. The standard model of jet emission assumes that the central star rotates at the same speed that the inner edge of its accretion disk. This chapter shows that the observation of the YLW15 quasi-periodic flare suggests rather that the forming star rotates faster than its accretion disk, at the break up limit. The synchronism with the accretion disk, observed on T Tauri stars, must be reach progressively by magnetic breaking during the IR protostar stage, and more or less rapidly depending on the forming star mass. Recent studies have shown that T Tauri star X-ray emission could ionize the circumstellar disk, and play a role in the instability development, as well as stimulate the accretion. The protostar X-ray emission might be higher than the T Tauri star one, Chapter 5 presents a millimetric interferometric observation dedicated to measure this effect on YLW15. Finally, Chapter 6 reassembles conclusions and perspectives of this work. (author) [fr

SISTEM INVENTORI BARANG DENGAN TEKNOLOGI AJAX

Directory of Open Access Journals (Sweden)

Anna Fitriya

2015-11-01

Full Text Available ABSTRAK Sistem inventori barang pada pertokoan telah banyak dikembangkan untuk meningkatkan efektivitas dan efisiensi. Pada Toko Karya Indah, kegiatan yang berkaitan dengan inventori barang masih dilakukan secara manual sehingga pihak toko kesulitan untuk mengetahui data barang yang masih tersedia, habis, atau hampir habis. Selain itu, proses yang dilakukan membutuhkan waktu yang relatif lama. Oleh karena itu, diperlukan sistem inventori barang. Sistem dibangun dengan bahasa pemrograman PHP dan database MySQL. Sistem disertai teknologi AJAX (Asynchronous JavaScript And XML, khususnya AJAX autocomplete dan AJAX validasi. Hasil yang diperoleh adalah pengolahan data pada sistem inventori barang dengan menggunakan AJAX dapat dilakukan dengan lebih cepat dari pada tanpa AJAX. Kata kunci: sistem inventori, AJAX.

Double shell tanks plutonium inventory assessment

International Nuclear Information System (INIS)

Tusler, L.A.

1995-01-01

This report provides an evaluation that establishes plutonium inventory estimates for all DSTs based on known tank history information, the DST plutonium inventory tracking system, tank characterization measurements, tank transfer records, and estimated average concentration values for the various types of waste. These estimates use data through December 31, 1994, and give plutonium estimates as of January 1, 1995. The plutonium inventory values for the DSTs are given in Section 31. The plutonium inventory estimate is 224 kg for the DSTs and 854 kg for the SSTs for a total of 1078 kg. This value compares favorably with the total plutonium inventory value of 981 kg obtained from the total plutonium production minus plutonium recovery analysis estimates

THE GALACTIC O-STAR SPECTROSCOPIC SURVEY (GOSSS). II. BRIGHT SOUTHERN STARS

International Nuclear Information System (INIS)

Sota, A.; Apellániz, J. Maíz; Alfaro, E. J.; Morrell, N. I.; Barbá, R. H.; Arias, J. I.; Walborn, N. R.; Gamen, R. C.

2014-01-01

We present the second installment of GOSSS, a massive spectroscopic survey of Galactic O stars, based on new homogeneous, high signal-to-noise ratio, R ∼ 2500 digital observations from both hemispheres selected from the Galactic O-Star Catalog (GOSC). In this paper we include bright stars and other objects drawn mostly from the first version of GOSC, all of them south of δ = –20°, for a total number of 258 O stars. We also revise the northern sample of Paper I to provide the full list of spectroscopically classified Galactic O stars complete to B = 8, bringing the total number of published GOSSS stars to 448. Extensive sequences of exceptional objects are given, including the early Of/WN, O Iafpe, Ofc, ON/OC, Onfp, Of?p, and Oe types, as well as double/triple-lined spectroscopic binaries. The new spectral subtype O9.2 is also discussed. The magnitude and spatial distributions of the observed sample are analyzed. We also present new results from OWN, a multi-epoch high-resolution spectroscopic survey coordinated with GOSSS that is assembling the largest sample of Galactic spectroscopic massive binaries ever attained. The OWN data combined with additional information on spectroscopic and visual binaries from the literature indicate that only a very small fraction (if any) of the stars with masses above 15-20 M ☉ are born as single systems. In the future we will publish the rest of the GOSSS survey, which is expected to include over 1000 Galactic O stars

Lithium in the barium stars

International Nuclear Information System (INIS)

Pinsonneault, M.H.; Sneden, C.

1984-01-01

New high-resolution spectra of the lithium resonance doublet have provided lithium abundances or upper limits for 26 classical and mild barium stars. The lithium lines always are present in the classical barium stars. Lithium abundances in these stars obey a trend with stellar masses consistent with that previously derived for ordinary K giants. This supports the notion that classical barium stars are post-core-He-flash or core-He-burning stars. Lithium contents in the mild barium stars, however, often are much smaller than those of the classical barium stars sometimes only upper limits may be determined. The cause for this difference is not easily understood, but may be related to more extensive mass loss by the mild barium stars. 45 references

75 FR 82095 - Service Contracts Inventory

Science.gov (United States)

2010-12-29

... NUCLEAR REGULATORY COMMISSION [NRC-2010-0394] Service Contracts Inventory AGENCY: U.S. Nuclear...) is providing for public information its Inventory of Contracts for Services for Fiscal Year (FY) 2010. The inventory includes service contract actions over $25,000 that were awarded in FY 2010. ADDRESSES...

7 CFR 930.57 - Secondary inventory reserve.

Science.gov (United States)

2010-01-01

... shall retain control over the release of any cherries from the secondary inventory reserve. No cherries... 7 Agriculture 8 2010-01-01 2010-01-01 false Secondary inventory reserve. 930.57 Section 930.57... Handling Regulations § 930.57 Secondary inventory reserve. (a) In the event the inventory reserve...

Student-Life Stress Inventory.

Science.gov (United States)

Gadzella, Bernadette M.; And Others

The reliability of the Student-Life Stress Inventory of B. M. Gadzella (1991) was studied. The inventory consists of 51 items listed in 9 sections indicating different types of stressors (frustrations, conflicts, pressures, changes, and self-imposed stressors) and reactions to the stressors (physiological, emotional, behavioral, and cognitive) as…

Uncertainties in emission inventories

NARCIS (Netherlands)

Aardenne, van J.A.

2002-01-01

Emission inventories provide information about the amount of a pollutant that is emitted to the atmosphere as a result of a specific anthropogenic or natural process at a given time or place. Emission inventories can be used for either policy or scientific purposes. For