WorldWideScience

Sample records for star inventory aperiodic

  1. Aperiodic order

    CERN Document Server

    Grimm, Uwe

    2017-01-01

    Quasicrystals are non-periodic solids that were discovered in 1982 by Dan Shechtman, Nobel Prize Laureate in Chemistry 2011. The mathematics that underlies this discovery or that proceeded from it, known as the theory of Aperiodic Order, is the subject of this comprehensive multi-volume series. This second volume begins to develop the theory in more depth. A collection of leading experts, among them Robert V. Moody, cover various aspects of crystallography, generalising appropriately from the classical case to the setting of aperiodically ordered structures. A strong focus is placed upon almost periodicity, a central concept of crystallography that captures the coherent repetition of local motifs or patterns, and its close links to Fourier analysis. The book opens with a foreword by Jeffrey C. Lagarias on the wider mathematical perspective and closes with an epilogue on the emergence of quasicrystals, written by Peter Kramer, one of the founders of the field.

  2. Mathematics of aperiodic order

    CERN Document Server

    Lenz, Daniel; Savinien, Jean

    2015-01-01

    What is order that is not based on simple repetition, that is, periodicity? How must atoms be arranged in a material so that it diffracts like a quasicrystal? How can we describe aperiodically ordered systems mathematically? Originally triggered by the – later Nobel prize-winning – discovery of quasicrystals, the investigation of aperiodic order has since become a well-established and rapidly evolving field of mathematical research with close ties to a surprising variety of branches of mathematics and physics. This book offers an overview of the state of the art in the field of aperiodic order, presented in carefully selected authoritative surveys. It is intended for non-experts with a general background in mathematics, theoretical physics or computer science, and offers a highly accessible source of first-hand information for all those interested in this rich and exciting field. Topics covered include the mathematical theory of diffraction, the dynamical systems of tilings or Delone sets, their cohomolog...

  3. Aperiodic Volume Optics

    Science.gov (United States)

    Gerke, Tim D.

    Presented in this thesis is an investigation into aperiodic volume optical devices. The three main topics of research and discussion are the aperiodic volume optical devices that we call computer-generated volume holograms (CGVH), defects within periodic 3D photonic crystals, and non-periodic, but ordered 3D quasicrystals. The first of these devices, CGVHs, are designed and investigated numerically and experimentally. We study the performance of multi-layered amplitude computer-generated volume holograms in terms of efficiency and angular/frequency selectivity. Simulation results show that such aperiodic devices can increase diffraction efficiency relative to periodic amplitude volume holograms while maintaining angular and wavelength selectivity. CGVHs are also designed as voxelated volumes using a new projection optimization algorithm. They are investigated using a volumetric diffraction simulation and a standard 3D beam propagation technique as well as experimentally. Both simulation and experiment verify that the structures function according to their design. These represent the first diffractive structures that have the capacity for generating arbitrary transmission and reflection wave fronts and that provide the ability for multiplexing arbitrary functionality given different illumination conditions. Also investigated and discussed in this thesis are 3D photonic crystals and quasicrystals. We demonstrate that these devices can be fabricated using a femtosecond laser direct writing system that is particularly appropriate for fabrication of such arbitrary 3D structures. We also show that these devices can provide 3D partial bandgaps which could become complete bandgaps if fabricated using high index materials or by coating lower index materials with high index metals. Our fabrication method is particularly suited to the fabrication of engineered defects within the periodic or quasi-periodic systems. We demonstrate the potential for fabricating defects within

  4. Aperiodic-metamaterial-based absorber

    Directory of Open Access Journals (Sweden)

    Quanlong Yang

    2017-09-01

    Full Text Available The periodic-metamaterial-based perfect absorber has been studied broadly. Conversely, if the unit cell in the metamaterial-based absorber is arranged aperiodically (aperiodic-metamaterial-based absorber, how does it perform? Inspired by this, here we present a systematic study of the aperiodic-metamaterial-based absorber. By investigating the response of metamaterial absorbers based on periodic, Fibonacci, Thue-Morse, and quasicrystal lattices, we found that aperiodic-metamaterial-based absorbers could display similar absorption behaviors as the periodic one in one hand. However, their absorption behaviors show different tendency depending on the thicknesses of the spacer. Further studies on the angle and polarization dependence of the absorption behavior are also presented.

  5. Integrated Strategic Tracking and Recruiting Database (iSTAR) Data Inventory

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Integrated Strategic Tracking and Recruiting Database (iSTAR) Data Inventory contains measured and modeled partnership and contact data. It is comprised of basic...

  6. PREFACE: 6th International Conference on Aperiodic Crystals (APERIODIC'09)

    Science.gov (United States)

    Grimm, Uwe; McGrath, Rónán; Degtyareva, Olga; Sharma, Hem Raj

    2010-04-01

    Aperiodic Logo Aperiodic'09, the sixth International Conference on Aperiodic Crystals, took place in Liverpool 13-18 September 2009. It was the first major conference in this interdisciplinary research field held in the UK. The conference, which was organised under the auspices of the Commission on Aperiodic Crystals of the International Union of Crystallography (IUCr), followed on from Aperiodic'94 (Les Diablerets, Switzerland), Aperiodic'97 (Alpe d'Huez, France), Aperiodic'2000 (Nijmegen, The Netherlands), Aperiodic'03 (Belo Horizonte, Brazil) and Aperiodic'06 (Zao, Japan). The next conference in the series will take place in Australia in 2012. The Aperiodic conference series is itself the successor to a series of Conferences on Modulated Structures, Polytypes and Quasicrystals (MOSPOQ), which were held in Marseilles (France) in 1984, Wroclaw (Poland) in 1986, Varanasi (India) in 1988 and Balatonszeplak (Hungary) in 1991. The remit of the conference covers two broad areas of research on aperiodic crystals, incommensurately modulated and composite crystals on the one hand, and quasicrystals on the other hand, sharing the property that they are aperiodically ordered solids. In addition, the conference also featured recent research on complex metal alloys, which are in fact periodically ordered solids. However, the term complex refers to their large unit cells, which may contain thousands of atoms, and as a consequence complex metal alloys share some of the properties of quasicrystalline solids. Aperiodic'09 attracted about 110 participants from across the world, including 20 UK-based scientists (the second largest group after Japan who sent 21 delegates). A particular feature of the conference series is its interdisciplinary character, and once again the range of disciplines of participants included mathematics, physics, crystallography and materials science. The programme started with three tutorial lectures on Sunday afternoon, presenting introductory overviews

  7. SIMULATED PERFORMANCE OF TIMESCALE METRICS FOR APERIODIC LIGHT CURVES

    Energy Technology Data Exchange (ETDEWEB)

    Findeisen, Krzysztof; Hillenbrand, Lynne [Cahill Center for Astronomy and Astrophysics, California Institute of Technology, MC 249-17, Pasadena, CA 91125 (United States); Cody, Ann Marie, E-mail: krzys@astro.caltech.edu [Spitzer Science Center, California Institute of Technology, MC 314-6, Pasadena, CA 91125 (United States)

    2015-01-10

    Aperiodic variability is a characteristic feature of young stars, massive stars, and active galactic nuclei. With the recent proliferation of time-domain surveys, it is increasingly essential to develop methods to quantify and analyze aperiodic variability. We develop three timescale metrics that have been little used in astronomy—Δm-Δt plots, peak-finding, and Gaussian process regression—and present simulations comparing their effectiveness across a range of aperiodic light curve shapes, characteristic timescales, observing cadences, and signal to noise ratios. We find that Gaussian process regression is easily confused by noise and by irregular sampling, even when the model being fit reflects the process underlying the light curve, but that Δm-Δt plots and peak-finding can coarsely characterize timescales across a broad region of parameter space. We make public the software we used for our simulations, both in the spirit of open research and to allow others to carry out analogous simulations for their own observing programs.

  8. SIMULATED PERFORMANCE OF TIMESCALE METRICS FOR APERIODIC LIGHT CURVES

    International Nuclear Information System (INIS)

    Findeisen, Krzysztof; Hillenbrand, Lynne; Cody, Ann Marie

    2015-01-01

    Aperiodic variability is a characteristic feature of young stars, massive stars, and active galactic nuclei. With the recent proliferation of time-domain surveys, it is increasingly essential to develop methods to quantify and analyze aperiodic variability. We develop three timescale metrics that have been little used in astronomy—Δm-Δt plots, peak-finding, and Gaussian process regression—and present simulations comparing their effectiveness across a range of aperiodic light curve shapes, characteristic timescales, observing cadences, and signal to noise ratios. We find that Gaussian process regression is easily confused by noise and by irregular sampling, even when the model being fit reflects the process underlying the light curve, but that Δm-Δt plots and peak-finding can coarsely characterize timescales across a broad region of parameter space. We make public the software we used for our simulations, both in the spirit of open research and to allow others to carry out analogous simulations for their own observing programs

  9. Simulation of aperiodic bipedal sprinting.

    Science.gov (United States)

    Celik, Huseyin; Piazza, Stephen J

    2013-08-01

    Synthesis of legged locomotion through dynamic simulation is useful for exploration of the mechanical and control variables that contribute to efficient gait. Most previous simulations have made use of periodicity constraints, a sensible choice for investigations of steady-state walking or running. Sprinting from rest, however, is aperiodic by nature and this aperiodicity is central to the goal of the movement, as performance is determined in large part by a rapid acceleration phase early in the race. The purpose of this study was to create a novel simulation of aperiodic sprinting using a modified spring-loaded inverted pendulum (SLIP) biped model. The optimal control problem was to find the set of controls that minimized the time for the model to run 20 m, and this problem was solved using a direct multiple shooting algorithm that converts the original continuous time problem into piecewise discrete subproblems. The resulting nonlinear programming problem was solved iteratively using a sequential quadratic programming method. The starting point for the optimizer was an initial guess simulation that was a slow alternating-gait "jogging" simulation developed using proportional-derivative feedback to control trunk attitude, swing leg angle, and leg retraction and extension. The optimized aperiodic sprint simulation solution yielded a substantial improvement in locomotion time over the initial guess (2.79 s versus 6.64 s). Following optimization, the model produced forward impulses at the start of the sprint that were four times greater than those of the initial guess simulation, producing more rapid acceleration. Several gait features demonstrated in the optimized sprint simulation correspond to behaviors of human sprinters: forward trunk lean at the start; straightening of the trunk during acceleration; and a dive at the finish. Optimization resulted in reduced foot contact times (0.065 s versus 0.210 s), but contact times early in the optimized

  10. PERIODIC AND APERIODIC VARIABILITY IN THE MOLECULAR CLOUD ρ OPHIUCHUS

    International Nuclear Information System (INIS)

    Parks, J. Robert; Plavchan, Peter; Gee, Alan H.; White, Russel J.

    2014-01-01

    Presented are the results of a near-IR photometric survey of 1678 stars in the direction of the ρ Ophiuchus (ρ Oph) star forming region using data from the 2MASS Calibration Database. For each target in this sample, up to 1584 individual J-, H-, and K s -band photometric measurements with a cadence of ∼1 day are obtained over three observing seasons spanning ∼2.5 yr; it is the most intensive survey of stars in this region to date. This survey identifies 101 variable stars with ΔK s -band amplitudes from 0.044 to 2.31 mag and Δ(J – K s ) color amplitudes ranging from 0.053 to 1.47 mag. Of the 72 young ρ Oph star cluster members included in this survey, 79% are variable; in addition, 22 variable stars are identified as candidate members. Based on the temporal behavior of the K s time-series, the variability is distinguished as either periodic, long time-scale or irregular. This temporal behavior coupled with the behavior of stellar colors is used to assign a dominant variability mechanism. A new period-searching algorithm finds periodic signals in 32 variable stars with periods between 0.49 to 92 days. The chief mechanism driving the periodic variability for 18 stars is rotational modulation of cool starspots while 3 periodically vary due to accretion-induced hot spots. The time-series for six variable stars contains discrete periodic ''eclipse-like'' features with periods ranging from 3 to 8 days. These features may be asymmetries in the circumstellar disk, potentially sustained or driven by a proto-planet at or near the co-rotation radius. Aperiodic, long time-scale variations in stellar flux are identified in the time-series for 31 variable stars with time-scales ranging from 64 to 790 days. The chief mechanism driving long time-scale variability is variable extinction or mass accretion rates. The majority of the variable stars (40) exhibit sporadic, aperiodic variability over no discernable time-scale. No chief variability mechanism

  11. PERIODIC AND APERIODIC VARIABILITY IN THE MOLECULAR CLOUD ρ OPHIUCHUS

    Energy Technology Data Exchange (ETDEWEB)

    Parks, J. Robert; Plavchan, Peter; Gee, Alan H. [Infrared Processing and Analysis Center, California Institute of Technology, Mail Code 100-22, 770 South Wilson Avenue, Pasadena, CA 91125 (United States); White, Russel J., E-mail: parksj@chara.gsu.edu [Georgia State University, Department of Physics and Astronomy, 25 Park Place, Room 605, Atlanta, GA 30303 (United States)

    2014-03-01

    Presented are the results of a near-IR photometric survey of 1678 stars in the direction of the ρ Ophiuchus (ρ Oph) star forming region using data from the 2MASS Calibration Database. For each target in this sample, up to 1584 individual J-, H-, and K{sub s} -band photometric measurements with a cadence of ∼1 day are obtained over three observing seasons spanning ∼2.5 yr; it is the most intensive survey of stars in this region to date. This survey identifies 101 variable stars with ΔK{sub s} -band amplitudes from 0.044 to 2.31 mag and Δ(J – K{sub s} ) color amplitudes ranging from 0.053 to 1.47 mag. Of the 72 young ρ Oph star cluster members included in this survey, 79% are variable; in addition, 22 variable stars are identified as candidate members. Based on the temporal behavior of the K{sub s} time-series, the variability is distinguished as either periodic, long time-scale or irregular. This temporal behavior coupled with the behavior of stellar colors is used to assign a dominant variability mechanism. A new period-searching algorithm finds periodic signals in 32 variable stars with periods between 0.49 to 92 days. The chief mechanism driving the periodic variability for 18 stars is rotational modulation of cool starspots while 3 periodically vary due to accretion-induced hot spots. The time-series for six variable stars contains discrete periodic ''eclipse-like'' features with periods ranging from 3 to 8 days. These features may be asymmetries in the circumstellar disk, potentially sustained or driven by a proto-planet at or near the co-rotation radius. Aperiodic, long time-scale variations in stellar flux are identified in the time-series for 31 variable stars with time-scales ranging from 64 to 790 days. The chief mechanism driving long time-scale variability is variable extinction or mass accretion rates. The majority of the variable stars (40) exhibit sporadic, aperiodic variability over no discernable time-scale. No chief

  12. Optimal design of aperiodic, vertical silicon nanowire structures for photovoltaics.

    Science.gov (United States)

    Lin, Chenxi; Povinelli, Michelle L

    2011-09-12

    We design a partially aperiodic, vertically-aligned silicon nanowire array that maximizes photovoltaic absorption. The optimal structure is obtained using a random walk algorithm with transfer matrix method based electromagnetic forward solver. The optimal, aperiodic structure exhibits a 2.35 times enhancement in ultimate efficiency compared to its periodic counterpart. The spectral behavior mimics that of a periodic array with larger lattice constant. For our system, we find that randomly-selected, aperiodic structures invariably outperform the periodic array.

  13. Diffuse scattering from periodic and aperiodic crystals

    International Nuclear Information System (INIS)

    Frey, F.

    1997-01-01

    A (selective) review on diffuse scattering from periodic and aperiodic crystalline solids is given to demonstrate the wide field of applications in basic and applied research. After a general introduction in this field each topic is exemplified by one or two examples. Main emphasis is laid on recent work. More established work, e.g., on diffuse scattering from metals and alloys, polytypes, stacking disorder from layered structures, etc. is omitted due to the availability of excellent textbooks and reviews. Finally a short summary of recent developments of experimental methods and evaluation techniques is presented. (orig.)

  14. Creating aperiodic photonic structures by synthesized Mathieu-Gauss beams

    Science.gov (United States)

    Vasiljević, Jadranka M.; Zannotti, Alessandro; Timotijević, Dejan V.; Denz, Cornelia; Savić, Dragana M. Jović

    2017-08-01

    We demonstrate a kind of aperiodic photonic structure realized using the interference of multiple Mathieu-Gauss beams. Depending on the beam configurations, their mutual distances, angles of rotation, or phase relations we are able to observe different classes of such aperiodic optically induced refractive index structures. Our experimental approach is based on the optical induction in a single parallel writing process.

  15. Aperiodicity Correction for Rotor Tip Vortex Measurements

    Science.gov (United States)

    Ramasamy, Manikandan; Paetzel, Ryan; Bhagwat, Mahendra J.

    2011-01-01

    The initial roll-up of a tip vortex trailing from a model-scale, hovering rotor was measured using particle image velocimetry. The unique feature of the measurements was that a microscope was attached to the camera to allow much higher spatial resolution than hitherto possible. This also posed some unique challenges. In particular, the existing methodologies to correct for aperiodicity in the tip vortex locations could not be easily extended to the present measurements. The difficulty stemmed from the inability to accurately determine the vortex center, which is a prerequisite for the correction procedure. A new method is proposed for determining the vortex center, as well as the vortex core properties, using a least-squares fit approach. This approach has the obvious advantage that the properties are derived from not just a few points near the vortex core, but from a much larger area of flow measurements. Results clearly demonstrate the advantage in the form of reduced variation in the estimated core properties, and also the self-consistent results obtained using three different aperiodicity correction methods.

  16. Joint Optimization of Star P-hub Median Problem and Seat Inventory Control Decisions Considering a Hybrid Routing Transportation System

    Directory of Open Access Journals (Sweden)

    Hamid Tikani

    2016-11-01

    Full Text Available In this paper, we study the problem of integrated capacitated hub location problem and seat inventory control considering concept and techniques of revenue management. We consider an airline company maximizes its revenue by utilizing the best network topology and providing proper booking limits for all itineraries and fare classes. The transportation system arises in the form of a star/star network and includes both hub-stop and non-stop flights. This problem is formulated as a two-stage stochastic integer program with mixed-integer recourse. We solve various instances carried out from the Turkish network data set. Due to the NP-hardness of the problem, we propose a hybrid optimization method, consisting of an evolutionary algorithm based on genetic algorithm and exact solution. The quality of the solutions found by the proposed meta-heuristic is compared with the original version of GA and the mathematical programming model. The results obtained by the proposed model imply that integrating hub location and seat inventory control problem would help to increase the total revenue of airline companies. Also, in the case of serving non-stop flights, the model can provide more profit by employing less number of hubs.

  17. Band structures and localization properties of aperiodic layered phononic crystals

    Energy Technology Data Exchange (ETDEWEB)

    Yan Zhizhong, E-mail: zzyan@bit.edu.cn [Department of Applied Mathematics, Beijing Institute of Technology, Beijing 100081 (China); Zhang Chuanzeng [Department of Civil Engineering, University of Siegen, D-57078 Siegen (Germany)

    2012-03-15

    The band structures and localization properties of in-plane elastic waves with coupling of longitudinal and transverse modes oblique propagating in aperiodic phononic crystals based on Thue-Morse and Rudin-Shapiro sequences are studied. Using transfer matrix method, the concept of the localization factor is introduced and the correctness is testified through the Rytov dispersion relation. For comparison, the perfect periodic structure and the quasi-periodic Fibonacci system are also considered. In addition, the influences of the random disorder, local resonance, translational and/or mirror symmetries on the band structures of the aperiodic phononic crystals are analyzed in this paper.

  18. Simulation of photonic waveguides with deterministic aperiodic nanostructures for biosensing

    DEFF Research Database (Denmark)

    Neustock, Lars Thorben; Paulsen, Moritz; Jahns, Sabrina

    2016-01-01

    Photonic waveguides with deterministic aperiodic corrugations offer rich spectral characteristics under surface-normal illumination. The finite-element method (FEM), the finite-difference time-domain (FDTD) method and a rigorous coupled wave algorithm (RCWA) are compared for computing the near...

  19. A method to identify aperiodic disturbances in the ionosphere

    Science.gov (United States)

    Wang, J.-S.; Chen, Z.; Huang, C.-M.

    2014-05-01

    In this paper, variations in the ionospheric F2 layer's critical frequency are decomposed into their periodic and aperiodic components. The latter include disturbances caused both by geophysical impacts on the ionosphere and random noise. The spectral whitening method (SWM), a signal-processing technique used in statistical estimation and/or detection, was used to identify aperiodic components in the ionosphere. The whitening algorithm adopted herein is used to divide the Fourier transform of the observed data series by a real envelope function. As a result, periodic components are suppressed and aperiodic components emerge as the dominant contributors. Application to a synthetic data set based on significant simulated periodic features of ionospheric observations containing artificial (and, hence, controllable) disturbances was used to validate the SWM for identification of aperiodic components. Although the random noise was somewhat enhanced by post-processing, the artificial disturbances could still be clearly identified. The SWM was then applied to real ionospheric observations. It was found to be more sensitive than the often-used monthly median method to identify geomagnetic effects. In addition, disturbances detected by the SWM were characterized by a Gaussian-type probability density function over all timescales, which further simplifies statistical analysis and suggests that the disturbances thus identified can be compared regardless of timescale.

  20. Topological aperiodicity for product systems over semigroups of Ore type

    DEFF Research Database (Denmark)

    Kwasniewski, Bartosz; Szymanski, Wojciech

    2016-01-01

    aperiodicity condition on the latter, we obtain the uniqueness theorem and a simplicity criterion for the algebras in question. These results generalize the corresponding ones for crossed products by discrete groups, due to Archbold and Spielberg, and for Exel's crossed products, due to Exel and Vershik...

  1. Effect of aperiodicity on the broadband reflection of silicon nanorod structures for photovoltaics.

    Science.gov (United States)

    Lin, Chenxi; Huang, Ningfeng; Povinelli, Michelle L

    2012-01-02

    We carry out a systematic numerical study of the effects of aperiodicity on silicon nanorod anti-reflection structures. We use the scattering matrix method to calculate the average reflection loss over the solar spectrum for periodic and aperiodic arrangements of nanorods. We find that aperiodicity can either improve or deteriorate the anti-reflection performance, depending on the nanorod diameter. We use a guided random-walk algorithm to design optimal aperiodic structures that exhibit lower reflection loss than both optimal periodic and random aperiodic structures.

  2. Intrinsic periodic and aperiodic stochastic resonance in an electrochemical cell

    Science.gov (United States)

    Tiwari, Ishant; Phogat, Richa; Parmananda, P.; Ocampo-Espindola, J. L.; Rivera, M.

    2016-08-01

    In this paper we show the interaction of a composite of a periodic or aperiodic signal and intrinsic electrochemical noise with the nonlinear dynamics of an electrochemical cell configured to study the corrosion of iron in an acidic media. The anodic voltage setpoint (V0) in the cell is chosen such that the anodic current (I ) exhibits excitable fixed point behavior in the absence of noise. The subthreshold periodic (aperiodic) signal consists of a train of rectangular pulses with a fixed amplitude and width, separated by regular (irregular) time intervals. The irregular time intervals chosen are of deterministic and stochastic origins. The amplitude of the intrinsic internal noise, regulated by the concentration of chloride ions, is then monotonically increased, and the provoked dynamics are analyzed. The signal to noise ratio and the cross-correlation coefficient versus the chloride ions' concentration curves have a unimodal shape indicating the emergence of an intrinsic periodic or aperiodic stochastic resonance. The abscissa for the maxima of these unimodal curves correspond to the optimum value of intrinsic noise where maximum regularity of the invoked dynamics is observed. In the particular case of the intrinsic periodic stochastic resonance, the scanning electron microscope images for the electrode metal surfaces are shown for certain values of chloride ions' concentrations. These images, qualitatively, corroborate the emergence of order as a result of the interaction between the nonlinear dynamics and the composite signal.

  3. Control, synchronization, and enhanced reliability of aperiodic oscillations in the Mercury Beating Heart system

    Science.gov (United States)

    Kumar, Pawan; Parmananda, P.

    2018-04-01

    Experiments involving the Mercury Beating Heart (MBH) oscillator, exhibiting irregular (aperiodic) dynamics, are performed. In the first set of experiments, control over irregular dynamics of the MBH oscillator was obtained via a superimposed periodic voltage signal. These irregular (aperiodic) dynamics were recovered once the control was switched off. Subsequently, two MBH oscillators were coupled to attain synchronization of their aperiodic oscillations. Finally, two uncoupled MBH oscillators were subjected, repeatedly, to a common stochastic forcing, resulting in an enhancement of their mutual phase correlation.

  4. The WFCAM multiwavelength Variable Star Catalog

    Science.gov (United States)

    Ferreira Lopes, C. E.; Dékány, I.; Catelan, M.; Cross, N. J. G.; Angeloni, R.; Leão, I. C.; De Medeiros, J. R.

    2015-01-01

    Context. Stellar variability in the near-infrared (NIR) remains largely unexplored. The exploitation of public science archives with data-mining methods offers a perspective for a time-domain exploration of the NIR sky. Aims: We perform a comprehensive search for stellar variability using the optical-NIR multiband photometric data in the public Calibration Database of the WFCAM Science Archive (WSA), with the aim of contributing to the general census of variable stars and of extending the current scarce inventory of accurate NIR light curves for a number of variable star classes. Methods: Standard data-mining methods were applied to extract and fine-tune time-series data from the WSA. We introduced new variability indices designed for multiband data with correlated sampling, and applied them for preselecting variable star candidates, i.e., light curves that are dominated by correlated variations, from noise-dominated ones. Preselection criteria were established by robust numerical tests for evaluating the response of variability indices to the colored noise characteristic of the data. We performed a period search using the string-length minimization method on an initial catalog of 6551 variable star candidates preselected by variability indices. Further frequency analysis was performed on positive candidates using three additional methods in combination, in order to cope with aliasing. Results: We find 275 periodic variable stars and an additional 44 objects with suspected variability with uncertain periods or apparently aperiodic variation. Only 44 of these objects had been previously known, including 11 RR Lyrae stars on the outskirts of the globular cluster M 3 (NGC 5272). We provide a preliminary classification of the new variable stars that have well-measured light curves, but the variability types of a large number of objects remain ambiguous. We classify most of the new variables as contact binary stars, but we also find several pulsating stars, among which

  5. Shape control in wafer-based aperiodic 3D nanostructures

    International Nuclear Information System (INIS)

    Jeong, Hyeon-Ho; Mark, Andrew G; Gibbs, John G; Fischer, Peer; Reindl, Thomas; Waizmann, Ulrike; Weis, Jürgen

    2014-01-01

    Controlled local fabrication of three-dimensional (3D) nanostructures is important to explore and enhance the function of single nanodevices, but is experimentally challenging. We present a scheme based on e-beam lithography (EBL) written seeds, and glancing angle deposition (GLAD) grown structures to create nanoscale objects with defined shapes but in aperiodic arrangements. By using a continuous sacrificial corral surrounding the features of interest we grow isolated 3D nanostructures that have complex cross-sections and sidewall morphology that are surrounded by zones of clean substrate. (papers)

  6. The MACHO Project LMC Variable Star Inventory. VIII. The Recent Star Formation History of the Large Magellanic Cloud from the Cepheid Period Distribution

    International Nuclear Information System (INIS)

    Alcock, C.; Allsman, R.A.; Alves, D.R.; Axelrod, T.S.; Becker, A.C.; Bennett, D.P.; Bersier, D.F.; Cook, K.H.; Freeman, K.C.; Griest, K.; Guern, J.A.; Lehner, M.; Marshall, S.L.; Minniti, D.; Peterson, B.A.; Pratt, M.R.; Quinn, P.J.; Rodgers, A.W.; Stubbs, C.W.

    1999-01-01

    We present an analysis of the period distribution of about 1800 Cepheids in the LMC, based on data obtained by the MACHO microlensing experiment and on a previous catalog by C. H. Payne Gaposchkin. Using stellar evolution and pulsation models, we construct theoretical period-frequency distributions that are compared with the observations. These models reveal that a significant burst of star formation has occurred recently in the LMC (∼1.15x10 8 yr). We also show that during the last ∼10 8 yr, the main center of star formation has been propagating from southeast to northwest along the bar. We find that the evolutionary masses of Cepheids are still smaller than pulsation masses by ∼7% and that the red edge of the Cepheid instability strip could be slightly bluer than indicated by theory. There are approximately 600 Cepheids with periods below ∼2.5 days that cannot be explained by evolution theory. We suggest that they are anomalous Cepheids and that a number of these stars are double-mode Cepheids. copyright copyright 1999. The American Astronomical Society

  7. Non-commutative Chern numbers for generic aperiodic discrete systems

    Science.gov (United States)

    Bourne, Chris; Prodan, Emil

    2018-06-01

    The search for strong topological phases in generic aperiodic materials and meta-materials is now vigorously pursued by the condensed matter physics community. In this work, we first introduce the concept of patterned resonators as a unifying theoretical framework for topological electronic, photonic, phononic etc (aperiodic) systems. We then discuss, in physical terms, the philosophy behind an operator theoretic analysis used to systematize such systems. A model calculation of the Hall conductance of a 2-dimensional amorphous lattice is given, where we present numerical evidence of its quantization in the mobility gap regime. Motivated by such facts, we then present the main result of our work, which is the extension of the Chern number formulas to Hamiltonians associated to lattices without a canonical labeling of the sites, together with index theorems that assure the quantization and stability of these Chern numbers in the mobility gap regime. Our results cover a broad range of applications, in particular, those involving quasi-crystalline, amorphous as well as synthetic (i.e. algorithmically generated) lattices.

  8. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  9. Aperiodic nanoplasmonic devices for directional colour filtering and sensing.

    Science.gov (United States)

    Davis, Matthew S; Zhu, Wenqi; Xu, Ting; Lee, Jay K; Lezec, Henri J; Agrawal, Amit

    2017-11-07

    Exploiting the wave-nature of light in its simplest form, periodic architectures have enabled a panoply of tunable optical devices with the ability to perform useful functions such as filtering, spectroscopy, and multiplexing. Here, we remove the constraint of structural periodicity to enhance, simultaneously, the performance and functionality of passive plasmonic devices operating at optical frequencies. By using a physically intuitive, first-order interference model of plasmon-light interactions, we demonstrate a simple and efficient route towards designing devices with flexible, multi-spectral optical response, fundamentally not achievable using periodic architectures. Leveraging this approach, we experimentally implement ultra-compact directional light-filters and colour-sorters exhibiting angle- or spectrally-tunable optical responses with high contrast, and low spectral or spatial crosstalk. Expanding the potential of aperiodic systems to implement tailored spectral and angular responses, these results hint at promising applications in solar-energy harvesting, optical signal multiplexing, and integrated sensing.

  10. Thermal Emission Control via Bandgap Engineering in Aperiodically Designed Nanophotonic Devices

    Directory of Open Access Journals (Sweden)

    Enrique Maciá

    2015-05-01

    Full Text Available Aperiodic photonic crystals can open up novel routes for more efficient photon management due to increased degrees of freedom in their design along with the unique properties brought about by the long-range aperiodic order as compared to their periodic counterparts. In this work we first describe the fundamental notions underlying the idea of thermal emission/absorption control on the basis of the systematic use of aperiodic multilayer designs in photonic quasicrystals. Then, we illustrate the potential applications of this approach in order to enhance the performance of daytime radiative coolers and solar thermoelectric energy generators.

  11. Dynamical mechanisms for sensitive response of aperiodic firing cells to external stimulation

    International Nuclear Information System (INIS)

    Xie Yong; Xu Jianxue; Hu Sanjue; Kang Yanmei; Yang Hongjun; Duan Yubin

    2004-01-01

    An interesting phenomenon that aperiodic firing neurons have a higher sensitivity to drugs than periodic firing neurons have been reported for the chronically compressed dorsal root ganglion neurons in rats. In this study, the dynamical mechanisms for such a phenomenon are uncovered from the viewpoint of dynamical systems theory. We use the Rose-Hindmarsh neuron model to illustrate our opinions. Periodic orbit theory is introduced to characterize the dynamical behavior of aperiodic firing neurons. It is considered that bifurcations, crises and sensitive dependence of chaotic motions on control parameters can be the underlying mechanisms. And then, a similar analysis is applied to the modified Chay model describing the firing behavior of pancreatic beta cells. The same dynamical mechanisms can be obtained underlying that aperiodic firing cells are more sensitive to external stimulation than periodic firing ones. As a result, we conjecture that sensitive response of aperiodic firing cells to external stimulation is a universal property of excitable cells

  12. Radiation-disorder and aperiodicity in irradiated ceramics

    International Nuclear Information System (INIS)

    Hobbs, L.W.

    1992-01-01

    This final technical report documents the accomplishments of the program of research entitled ''Radiation Disorder and Aperiodicity in Irradiated Ceramics'' for the period June 22, 1989--June 21, 1992. This research forms the latest part on an on-going program, begun at MIT in 1983 under DOE support, which has had as its objectives investigation of the responses in radiation environments of ceramics heavily-irradiated with electrons, neutrons and ions, with potential applications to fusion energy technology and high-level nuclear waste storage. Materials investigated have included SiO 2 , MgAl 2 O 4 , Al 23 O 27 N 5 , SiC, BeO, LiAlO 2 , Li 2 ZrO 3 , CaTiO 3 KTaO 3 and Ca(Zr, Pu)Ti 2 O 7 . The program initially proposed for 1989 had as its major objectives two main thrusts: (1) research on defect aggregation in irradiated non-oxide ceramics, and (2) research on irradiation-induced amorphization of network silicas and phosphates

  13. Reclaiming Spare Capacity and Improving Aperiodic Response Times in Real-Time Environments

    Directory of Open Access Journals (Sweden)

    Liu Xue

    2011-01-01

    Full Text Available Abstract Scheduling recurring task sets that allow some instances of the tasks to be skipped produces holes in the schedule which are nonuniformly distributed. Similarly, when the recurring tasks are not strictly periodic but are sporadic, there is extra processor bandwidth arising because of irregular job arrivals. The additional computation capacity that results from skips or sporadic tasks can be reclaimed to service aperiodic task requests efficiently and quickly. We present techniques for improving the response times of aperiodic tasks by identifying nonuniformly distributed spare capacity—because of skips or sporadic tasks—in the schedule and adding such extra capacity to the capacity queue of a BASH server. These gaps can account for a significant portion of aperiodic capacity, and their reclamation results in considerable improvement to aperiodic response times. We present two schemes: NCLB-CBS, which performs well in periodic real-time environments with firm tasks, and NCLB-CUS, which can be deployed when the basic task set to schedule is sporadic. Evaluation via simulations and implementation suggests that performance improvements for aperiodic tasks can be obtained with limited additional overhead.

  14. Outer synchronization of complex networks with internal delay and coupling delay via aperiodically intermittent pinning control

    Science.gov (United States)

    Zhang, Chuan; Wang, Xingyuan; Wang, Chunpeng; Xia, Zhiqiu

    This paper concerns the outer synchronization problem between two complex delayed networks via the method of aperiodically intermittent pinning control. Apart from previous works, internal delay and coupling delay are both involved in this model, and the designed intermittent controllers can be aperiodic. The main work in this paper can be summarized as follows: First, two cases of aperiodically intermittent control with constant gain and adaptive gain are implemented, respectively. The intermittent control and pinning control are combined to reduce consumptions further. Then, based on the Lyapunov stability theory, synchronization protocols are given by strict derivation. Especially, the designed controllers are indeed simple and valid in application of theory to practice. Finally, numerical examples put the proposed control methods to the test.

  15. Structural color of a lycaenid butterfly: analysis of an aperiodic multilayer structure

    International Nuclear Information System (INIS)

    Yoshioka, S; Shimizu, Y; Kinoshita, S; Matsuhana, B

    2013-01-01

    We investigated the structural color of the green wing of the lycaenid butterfly Chrysozephyrus brillantinus. Electron microscopy revealed that the bottom plate of the cover scale on the wing consists of an alternating air–cuticle multilayer structure. However, the thicknesses of the layers were not constant but greatly differed depending on the layer, unlike the periodic multilayer designs often adopted for artificial laser-reflecting mirrors. The agreement between the experimentally determined and theoretically calculated reflectance spectra led us to conclude that the multilayer interference in the aperiodic system is the primary origin of the structural color. We analyzed optical interference in this aperiodic system using a simple analytical model and found that two spectral peaks arise from constructive interference among different parts of the multilayer structure. We discuss the advantages and disadvantages of the aperiodic system over a periodic one. (paper)

  16. An aperiodic phenomenon of the unscented Kalman filter in filtering noisy chaotic signals

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    A non-periodic oscillatory behavior of the unscented Kalman filter (UKF) when used to filter noisy contaminated chaotic signals is reported. We show both theoretically and experimentally that the gain of the UKF may not converge or diverge but oscillate aperiodically. More precisely, when a nonlinear system is periodic, the Kalman gain and error covariance of the UKF converge to zero. However, when the system being considered is chaotic, the Kalman gain either converges to a fixed point with a magnitude larger than zero or oscillates aperiodically.

  17. Wide Area Prosumption Control and Sensitivities of Aperiodic Small Signal Stability Indicators

    DEFF Research Database (Denmark)

    Wittrock, Martin Lindholm; Jóhannsson, Hjörtur; Nielsen, Arne Hejde

    2014-01-01

    and patterns, stability indicators for aperiodic small signal angular stability (ASSA) are examined, while the concept of prosumption is described. The methodology presented is shown to be able to assess the margin to instability and to predict how this margin can be affected if a load is changed in the grid...

  18. Wide-Area Assessment of Aperiodic Small Signal Rotor Angle Stability in Real-Time

    DEFF Research Database (Denmark)

    Jóhannsson, Hjörtur; Nielsen, Arne Hejde; Østergaard, Jacob

    2014-01-01

    in rotor angle and a loss of synchronism, referred to as aperiodic small signal instability. The paper provides the theoretical background of the method and an analytical assessment criterion. Furthermore, a mathematical mapping of the generators' operating points that enables informative visualization...

  19. Influences of Fundamental Frequency, Formant Frequencies, Aperiodicity, and Spectrum Level on the Perception of Voice Gender

    Science.gov (United States)

    Skuk, Verena G.; Schweinberger, Stefan R.

    2014-01-01

    Purpose: To determine the relative importance of acoustic parameters (fundamental frequency [F0], formant frequencies [FFs], aperiodicity, and spectrum level [SL]) on voice gender perception, the authors used a novel parameter-morphing approach that, unlike spectral envelope shifting, allows the application of nonuniform scale factors to transform…

  20. Aperiodic spin state ordering of bistable molecules and its photoinducede erasing

    Czech Academy of Sciences Publication Activity Database

    Collet, E.; Watanabe, H.; Bréfuel, N.; Palatinus, Lukáš; Roudaut, L.; Toupet, L.; Tanaka, K.; Tuchagues, J.-P.; Fertey, P.; Ravy, S.; Toudic, B.; Cailleau, H.

    2012-01-01

    Roč. 109, č. 25 (2012), "257206-1"-"257206-5" ISSN 0031-9007 Institutional research plan: CEZ:AV0Z10100521 Keywords : photocrystallography * aperiodic structure * spin-state ordering Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 7.943, year: 2012

  1. Near-to far-field transformation in the aperiodic Fourier modal method

    NARCIS (Netherlands)

    Rook, R.; Pisarenco, M.; Setija, I.D.

    2013-01-01

    This paper addresses the task of obtaining the far-field spectrum for a finite structure given the near-field calculated by the aperiodic Fourier modal method in contrast-field formulation (AFMM-CFF). The AFMM-CFF efficiently calculates the solution to Maxwell's equations for a finite structure by

  2. Improving emission uniformity and linearizing band dispersion in nanowire arrays using quasi-aperiodicity

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, P. Duke [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States); Univ. of Southern California, Los Angeles, CA (United States). Ming Hsieh Dept. of Electrical Engineering; Koleske, Daniel D. [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States); Povinelli, Michelle L. [Univ. of Southern California, Los Angeles, CA (United States). Ming Hsieh Dept. of Electrical Engineering; Subramania, Ganapathi [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States)

    2017-10-01

    For this study, we experimentally investigate a new class of quasi-aperiodic structures for improving the emission pattern in nanowire arrays. Efficient normal emission, as well as lasing, can be obtained from III-nitride photonic crystal (PhC) nanowire arrays that utilize slow group velocity modes near the Γ-point in reciprocal space. However, due to symmetry considerations, the emitted far-field pattern of such modes are often ‘donut’-like. Many applications, including lighting for displays or lasers, require a more uniform beam profile in the far-field. Previous work has improved far-field beam uniformity of uncoupled modes by changing the shape of the emitting structure. However, in nanowire systems, the shape of nanowires cannot always be arbitrarily changed due to growth or etch considerations. Here, we investigate breaking symmetry by instead changing the position of emitters. Using a quasi-aperiodic geometry, which changes the emitter position within a photonic crystal supercell (2x2), we are able to linearize the photonic bandstructure near the Γ-point and greatly improve emitted far-field uniformity. We realize the III-nitride nanowires structures using a top-down fabrication procedure that produces nanowires with smooth, vertical sidewalls. Comparison of room-temperature micro-photoluminescence (µ-PL) measurements between periodic and quasi-aperiodic nanowire arrays reveal resonances in each structure, with the simple periodic structure producing a donut beam in the emitted far-field and the quasi-aperiodic structure producing a uniform Gaussian-like beam. We investigate the input pump power vs. output intensity in both systems and observe the simple periodic array exhibiting a non-linear relationship, indicative of lasing. We believe that the quasi-aperiodic approach studied here provides an alternate and promising strategy for shaping the emission pattern of nanoemitter systems.

  3. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  4. Wide-Area Assessment of Aperiodic Small Signal Rotor Angle Stability in Real-Time

    DEFF Research Database (Denmark)

    Jóhannsson, Hjörtur; Nielsen, Arne Hejde; Østergaard, Jacob

    2013-01-01

    This paper presents the details of a new real-time stability assessment method. The method assesses a particular mechanism of stability: each generator’s capability to generate sufficient steady state electromechanical torque. The lack of sufficient steady state torque causes aperiodic increase...... of multiple operating points is derived in the paper. Finally, results from time-domain simulation of instability scenarios in the Nordic32 test system are presented and results used for testing the assessment method. The results illustrate the method’s capability to efficiently identify the location...... in rotor angle and a loss of synchronism, referred to as aperiodic small signal instability. The paper provides the theoretical background of the method and an analytical assessment criterion. Furthermore, a mathematical mapping of the generators’ operating points that enables informative visualization...

  5. Aperiodic signals processing via parameter-tuning stochastic resonance in a photorefractive ring cavity

    Directory of Open Access Journals (Sweden)

    Xuefeng Li

    2014-04-01

    Full Text Available Based on solving numerically the generalized nonlinear Langevin equation describing the nonlinear dynamics of stochastic resonance by Fourth-order Runge-Kutta method, an aperiodic stochastic resonance based on an optical bistable system is numerically investigated. The numerical results show that a parameter-tuning stochastic resonance system can be realized by choosing the appropriate optical bistable parameters, which performs well in reconstructing aperiodic signals from a very high level of noise background. The influences of optical bistable parameters on the stochastic resonance effect are numerically analyzed via cross-correlation, and a maximum cross-correlation gain of 8 is obtained by optimizing optical bistable parameters. This provides a prospective method for reconstructing noise-hidden weak signals in all-optical signal processing systems.

  6. HIFISTARS Herschel/HIFI observations of VY Canis Majoris. Molecular-line inventory of the envelope around the largest known star

    NARCIS (Netherlands)

    Alcolea, J.; Bujarrabal, V.; Planesas, P.; Teyssier, D.; Cernicharo, J.; De Beck, E.; Decin, L.; Dominik, C.; Justtanont, K.; de Koter, A.; Marston, A.P.; Melnick, G.; Menten, K.M.; Neufeld, D.A.; Olofsson, H.; Schmidt, M.; Schöier, F.L.; Szczerba, R.; Waters, L.B.F.M.

    2013-01-01

    Aims. The study of the molecular gas in the circumstellar envelopes of evolved stars is normally undertaken by observing lines of CO (and other species) in the millimetre-wave domain. In general, the excitation requirements of the observed lines are low at these wavelengths, and therefore these

  7. Neutron stars

    International Nuclear Information System (INIS)

    Irvine, J.M.

    1978-01-01

    The subject is covered in chapters entitled: introduction (resume of stellar evolution, gross characteristics of neutron stars); pulsars (pulsar characteristics, pulsars as neutron stars); neutron star temperatures (neutron star cooling, superfluidity and superconductivity in neutron stars); the exterior of neutron stars (the magnetosphere, the neutron star 'atmosphere', pulses); neutron star structure; neutron star equations of state. (U.K.)

  8. Analysis of Nonlinear Periodic and Aperiodic Media: Application to Optical Logic Gates

    Science.gov (United States)

    Yu, Yisheng

    This dissertation is about the analysis of nonlinear periodic and aperiodic media and their application to the design of intensity controlled all optical logic gates: AND, OR, and NOT. A coupled nonlinear differential equation that characterizes the electromagnetic wave propagation in a nonlinear periodic (and aperiodic) medium has been derived from the first principle. The equations are general enough that it reflects the effect of transverse modal fields and can be used to analyze both co-propagating and counter propagating waves. A numerical technique based on the finite differences method and absorbing boundary condition has been developed to solve the coupled differential equations here. The numerical method is simple and accurate. Unlike the method based on characteristics that has been reported in the literature, this method does not involve integration and step sizes of time and space coordinates are decoupled. The decoupling provides independent choice for time and space step sizes. The concept of "gap soliton" has also been re-examined. The dissertation consists of four manuscripts. Manuscript I reports on the design of all optical logic gates: AND, OR, and NOT based on the bistability property of nonlinear periodic and aperiodic waveguiding structures. The functioning of the logic gates has been shown by analysis. The numerical technique that has been developed to solve the nonlinear differential equations are addressed in manuscript II. The effect of transverse modal fields on the bistable property of nonlinear periodic medium is reported in manuscript III. The concept of "gap soliton" that are generated in a nonlinear periodic medium has been re-examined. The details on the finding of the re-examination are discussed in manuscript IV.

  9. Periodic and aperiodic flow patterns around an airfoil with leading-edge protuberances

    Science.gov (United States)

    Cai, Chang; Zuo, Zhigang; Maeda, Takao; Kamada, Yasunari; Li, Qing'an; Shimamoto, Kensei; Liu, Shuhong

    2017-11-01

    Recently leading-edge protuberances have attracted great attention as a passive method for separation control. In this paper, the effect of multiple leading-edge protuberances on the performance of a two-dimensional airfoil is investigated through experimental measurement of aerodynamic forces, surface tuft visualization, and numerical simulation. In contrast to the sharp stall of the baseline airfoil with large hysteresis effect during AOA (angle of attack) increasing and decreasing, the stall process of the modified airfoil with leading-edge protuberances is gentle and stable. Flow visualization revealed that the flow past each protuberance is periodic and symmetric at small AOAs. Streamwise vortices are generated on the shoulders of the protuberance, leading to a larger separation around the valley sections and a longer attachment along the peak sections. When some critical AOA is exceeded, aperiodic and asymmetric flow patterns occur on the protuberances at different spanwise positions, with leading-edge separation on some of the valley sections and non-stalled condition elsewhere. A combined mechanism, involving both the compartmentalization effect of the slender momentum-enhanced attached flows on the protuberance peaks and the downwash effect of the local stalled region with low circulation, is proposed to explain the generation of the aperiodic flow patterns. The influence of the number of protuberances is also investigated, which shows similar aperiodic flow patterns. The distance between the neighboring local stalled valley sections is found to be in the range of 4-7 times the protuberance wavelength. According to the proposed mechanism, it is speculated that the distance between the neighboring local stalled valley sections is inclined to increase with a smaller protuberance amplitude or at a larger AOA.

  10. Energy band and transport properties in magnetic aperiodic graphene superlattices of Thue-Morse sequence

    Science.gov (United States)

    Yin, Yiheng; Niu, Yanxiong; Zhang, Huiyun; Zhang, Yuping; Liu, Haiyue

    2016-02-01

    Utilizing the transfer matrix method, we develop the electronic band structure and transport properties in Thue-Morse aperiodic graphene superlattices with magnetic barriers. It is found that the normal transmission is blocked and the position of the Dirac point can be shifted along the wavevector axis by changing the height and width ratio of magnetic barriers, which is intrinsic different from electronic field modulated superlattices. In addition, the angular threshold property of the transmission spectra and the oscillatory property of the conductance have been studied.

  11. Optimized emission in nanorod arrays through quasi-aperiodic inverse design.

    Science.gov (United States)

    Anderson, P Duke; Povinelli, Michelle L

    2015-06-01

    We investigate a new class of quasi-aperiodic nanorod structures for the enhancement of incoherent light emission. We identify one optimized structure using an inverse design algorithm and the finite-difference time-domain method. We carry out emission calculations on both the optimized structure as well as a simple periodic array. The optimized structure achieves nearly perfect light extraction while maintaining a high spontaneous emission rate. Overall, the optimized structure can achieve a 20%-42% increase in external quantum efficiency relative to a simple periodic design, depending on material quality.

  12. Combinations of response-reinforcer relations in periodic and aperiodic schedules.

    Science.gov (United States)

    Kuroda, Toshikazu; Cançado, Carlos R X; Lattal, Kennon A; Elcoro, Mirari; Dickson, Chata A; Cook, James E

    2013-03-01

    Key pecking of 4 pigeons was studied under a two-component multiple schedule in which food deliveries were arranged according to a fixed and a variable interfood interval. The percentage of response-dependent food in each component was varied, first in ascending (0, 10, 30, 70 and 100%) and then in descending orders, in successive conditions. The change in response rates was positively related to the percentage of response-dependent food in each schedule component. Across conditions, positively accelerated and linear patterns of responding occurred consistently in the fixed and variable components, respectively. These results suggest that the response-food dependency determines response rates in periodic and aperiodic schedules, and that the temporal distribution of food determines response patterns independently of the response-food dependency. Running rates, but not postfood pauses, also were positively related to the percentage of dependent food in each condition, in both fixed and variable components. Thus, the relation between overall response rate and the percentage of dependent food was mediated by responding that occurred after postfood pausing. The findings together extend previous studies wherein the dependency was either always present or absent, and increase the generality of the effects of variations in the response-food dependency from aperiodic to periodic schedules. © Society for the Experimental Analysis of Behavior.

  13. Investigation of aperiodic W/C multi-layer mirror for X-ray optics

    International Nuclear Information System (INIS)

    Wang Zhanshan; Cheng Xinbin; Zhu Jingtao; Huang Qiushi; Zhang Zhong; Chen Lingyan

    2011-01-01

    Design, fabrication and characterization of aperiodic tungsten/carbon (W/C) multi-layer mirror were studied. W/C multi-layer was designed as a broad-angle reflective supermirror for Cu-Kα line (λ = 0.154 nm) in the grazing incident angular range (0.9-1.1 deg.) using simulated annealing algorithm. To deposit the W/C depth-graded multi-layer mirror accurately, we introduce an effective layer growth rate as a function of layer thickness. This method greatly improves the reflectivity curve compared to the conventional multi-layer mirror prepared with constant growth rate. The deposited multi-layer mirror exhibits an average reflectivity of 19% over the grazing incident angle range of 0.88-1.08 deg. which mainly coincides with the designed value. Furthermore, the physical mechanisms were discussed and the re-sputtering process of light-atom layers is accounted for the modification of layer thicknesses which leads to the effective growth rates. Using this calibration method, the aperiodic multi-layer mirrors can be better fabricated for X-ray optics.

  14. Aperiodic linear networked control considering variable channel delays: application to robots coordination.

    Science.gov (United States)

    Santos, Carlos; Espinosa, Felipe; Santiso, Enrique; Mazo, Manuel

    2015-05-27

    One of the main challenges in wireless cyber-physical systems is to reduce the load of the communication channel while preserving the control performance. In this way, communication resources are liberated for other applications sharing the channel bandwidth. The main contribution of this work is the design of a remote control solution based on an aperiodic and adaptive triggering mechanism considering the current network delay of multiple robotics units. Working with the actual network delay instead of the maximum one leads to abandoning this conservative assumption, since the triggering condition is fixed depending on the current state of the network. This way, the controller manages the usage of the wireless channel in order to reduce the channel delay and to improve the availability of the communication resources. The communication standard under study is the widespread IEEE 802.11g, whose channel delay is clearly uncertain. First, the adaptive self-triggered control is validated through the TrueTime simulation tool configured for the mentioned WiFi standard. Implementation results applying the aperiodic linear control laws on four P3-DX robots are also included. Both of them demonstrate the advantage of this solution in terms of network accessing and control performance with respect to periodic and non-adaptive self-triggered alternatives.

  15. Aperiodic Linear Networked Control Considering Variable Channel Delays: Application to Robots Coordination

    Directory of Open Access Journals (Sweden)

    Carlos Santos

    2015-05-01

    Full Text Available One of the main challenges in wireless cyber-physical systems is to reduce the load of the communication channel while preserving the control performance. In this way, communication resources are liberated for other applications sharing the channel bandwidth. The main contribution of this work is the design of a remote control solution based on an aperiodic and adaptive triggering mechanism considering the current network delay of multiple robotics units. Working with the actual network delay instead of the maximum one leads to abandoning this conservative assumption, since the triggering condition is fixed depending on the current state of the network. This way, the controller manages the usage of the wireless channel in order to reduce the channel delay and to improve the availability of the communication resources. The communication standard under study is the widespread IEEE 802.11g, whose channel delay is clearly uncertain. First, the adaptive self-triggered control is validated through the TrueTime simulation tool configured for the mentioned WiFi standard. Implementation results applying the aperiodic linear control laws on four P3-DX robots are also included. Both of them demonstrate the advantage of this solution in terms of network accessing and control performance with respect to periodic and non-adaptive self-triggered alternatives.

  16. STAR facility tritium accountancy

    International Nuclear Information System (INIS)

    Pawelko, R. J.; Sharpe, J. P.; Denny, B. J.

    2008-01-01

    The Safety and Tritium Applied Research (STAR) facility has been established to provide a laboratory infrastructure for the fusion community to study tritium science associated with the development of safe fusion energy and other technologies. STAR is a radiological facility with an administrative total tritium inventory limit of 1.5 g (14,429 Ci) [1]. Research studies with moderate tritium quantities and various radionuclides are performed in STAR. Successful operation of the STAR facility requires the ability to receive, inventory, store, dispense tritium to experiments, and to dispose of tritiated waste while accurately monitoring the tritium inventory in the facility. This paper describes tritium accountancy in the STAR facility. A primary accountancy instrument is the tritium Storage and Assay System (SAS): a system designed to receive, assay, store, and dispense tritium to experiments. Presented are the methods used to calibrate and operate the SAS. Accountancy processes utilizing the Tritium Cleanup System (TCS), and the Stack Tritium Monitoring System (STMS) are also discussed. Also presented are the equations used to quantify the amount of tritium being received into the facility, transferred to experiments, and removed from the facility. Finally, the STAR tritium accountability database is discussed. (authors)

  17. Science versus the stars: a double-blind test of the validity of the NEO Five-Factor Inventory and computer-generated astrological natal charts.

    Science.gov (United States)

    Wyman, Alyssa Jayne; Vyse, Stuart

    2008-07-01

    The authors asked 52 college students (38 women, 14 men, M age = 19.3 years, SD = 1.3 years) to identify their personality summaries by using a computer-generated astrological natal chart when presented with 1 true summary and 1 bogus one. Similarly, the authors asked participants to identify their true personality profile from real and bogus summaries that the authors derived from the NEO Five-Factor Inventory (NEO-FFI; P. T. Costa Jr. & R. R. McCrae, 1985). Participants identified their real NEO-FFI profiles at a greater-than-chance level but were unable to identify their real astrological summaries. The authors observed a P. T. Barnum effect in the accuracy ratings of both psychological and astrological measures but did not find differences between the odd-numbered (i.e., favorable) signs and the even-numbered (i.e., unfavorable) signs.

  18. HIFISTARS Herschel/HIFI observations of VY Canis Majoris. Molecular-line inventory of the envelope around the largest known star

    Science.gov (United States)

    Alcolea, J.; Bujarrabal, V.; Planesas, P.; Teyssier, D.; Cernicharo, J.; De Beck, E.; Decin, L.; Dominik, C.; Justtanont, K.; de Koter, A.; Marston, A. P.; Melnick, G.; Menten, K. M.; Neufeld, D. A.; Olofsson, H.; Schmidt, M.; Schöier, F. L.; Szczerba, R.; Waters, L. B. F. M.

    2013-11-01

    Aims: The study of the molecular gas in the circumstellar envelopes of evolved stars is normally undertaken by observing lines of CO (and other species) in the millimetre-wave domain. In general, the excitation requirements of the observed lines are low at these wavelengths, and therefore these observations predominantly probe the cold outer envelope while studying the warm inner regions of the envelopes normally requires sub-millimetre (sub-mm) and far-infrared (FIR) observational data. Methods: To gain insight into the physical conditions and kinematics of the warm (100-1000 K) gas around the red hyper-giant VY CMa, we performed sensitive high spectral resolution observations of molecular lines in the sub-mm/FIR using the HIFI instrument of the Herschel Space Observatory. We observed CO, H2O, and other molecular species, sampling excitation energies from a few tens to a few thousand K. These observations are part of the Herschel guaranteed time key program HIFISTARS. Results: We detected the J = 6-5, J = 10-9, and J = 16-15 lines of 12CO and 13CO at ~100, 300, and 750 K above the ground state (and the 13CO J = 9-8 line). These lines are crucial for improving the modelling of the internal layers of the envelope around VY CMa. We also detected 27 lines of H2O and its isotopomers, and 96 lines of species such as NH3, SiO, SO, SO2 HCN, OH and others, some of them originating from vibrationally excited levels. Three lines were not unambiguously assigned. Conclusions: Our observations confirm that VY CMa's envelope must consist of two or more detached components. The molecular excitation in the outer layers is significantly lower than in the inner ones, resulting in strong self-absorbed profiles in molecular lines that are optically thick in this outer envelope, for instance, low-lying lines of H2O. Except for the most abundant species, CO and H2O, most of the molecular emission detected at these sub-mm/FIR wavelengths arise from the central parts of the envelope. The

  19. Inventory parameters

    CERN Document Server

    Sharma, Sanjay

    2017-01-01

    This book provides a detailed overview of various parameters/factors involved in inventory analysis. It especially focuses on the assessment and modeling of basic inventory parameters, namely demand, procurement cost, cycle time, ordering cost, inventory carrying cost, inventory stock, stock out level, and stock out cost. In the context of economic lot size, it provides equations related to the optimum values. It also discusses why the optimum lot size and optimum total relevant cost are considered to be key decision variables, and uses numerous examples to explain each of these inventory parameters separately. Lastly, it provides detailed information on parameter estimation for different sectors/products. Written in a simple and lucid style, it offers a valuable resource for a broad readership, especially Master of Business Administration (MBA) students.

  20. Application of the three-dimensional aperiodic Fourier modal method using arc elements in curvilinear coordinates.

    Science.gov (United States)

    Bucci, Davide; Martin, Bruno; Morand, Alain

    2012-03-01

    This paper deals with a full vectorial generalization of the aperiodic Fourier modal method (AFMM) in cylindrical coordinates. The goal is to predict some key characteristics such as the bending losses of waveguides having an arbitrary distribution of the transverse refractive index. After a description of the method, we compare the results of the cylindrical coordinates AFMM with simulations by the finite-difference time-domain (FDTD) method performed on an S-bend structure made by a 500 nm × 200 nm silicon core (n=3.48) in silica (n=1.44) at a wavelength λ=1550 nm, the bending radius varying from 0.5 up to 2 μm. The FDTD and AFMM results show differences comparable to the variations obtained by changing the parameters of the FDTD simulations.

  1. Self-similar transmission properties of aperiodic Cantor potentials in gapped graphene

    Science.gov (United States)

    Rodríguez-González, Rogelio; Rodríguez-Vargas, Isaac; Díaz-Guerrero, Dan Sidney; Gaggero-Sager, Luis Manuel

    2016-01-01

    We investigate the transmission properties of quasiperiodic or aperiodic structures based on graphene arranged according to the Cantor sequence. In particular, we have found self-similar behaviour in the transmission spectra, and most importantly, we have calculated the scalability of the spectra. To do this, we implement and propose scaling rules for each one of the fundamental parameters: generation number, height of the barriers and length of the system. With this in mind we have been able to reproduce the reference transmission spectrum, applying the appropriate scaling rule, by means of the scaled transmission spectrum. These scaling rules are valid for both normal and oblique incidence, and as far as we can see the basic ingredients to obtain self-similar characteristics are: relativistic Dirac electrons, a self-similar structure and the non-conservation of the pseudo-spin.

  2. Real-time remedial action against aperiodic small signal rotor angle instability

    DEFF Research Database (Denmark)

    Weckesser, Johannes Tilman Gabriel; Jóhannsson, Hjörtur; Østergaard, Jacob

    2016-01-01

    This paper presents a method that in real-time determines remedial actions, which restore stable operation with respect to aperiodic small signal rotor angle stability (ASSRAS) when insecure or unstable operation has been detected. An ASSRAS assessment method is used to monitor the stability...... impedance plane to determine an active power redispatch among selected generators to restore stable and secure operation. Since the method is purely based on analytically derived expression, the computation of the remedial actions is fast and well suited for real-time operation. The method was tested...... boundary for each generator in real-time. The ASSRAS boundary represents the condition when a generator reaches the maximum steady state active power injection. The proposed control method exploits analytically derived expressions for the ASSRAS boundary and other characteristic curves in the injection...

  3. Stochastic resonance in a bistable system subject to multi-time-delayed feedback and aperiodic signal

    International Nuclear Information System (INIS)

    Li Jianlong; Zeng Lingzao

    2010-01-01

    We discuss in detail the effects of the multi-time-delayed feedback driven by an aperiodic signal on the output of a stochastic resonance (SR) system. The effective potential function and dynamical probability density function (PDF) are derived. To measure the performance of the SR system in the presence of a binary random signal, the bit error rate (BER) defined by the dynamical PDF is employed, as is commonly used in digital communications. We find that the delay time, strength of the feedback, and number of time-delayed terms can change the effective potential function and the effective amplitude of the signal, and then affect the BER of the SR system. The numerical simulations strongly support the theoretical results. The goal of this investigation is to explore the effects of the multi-time-delayed feedback on SR and give a guidance to nonlinear systems in the application of information processing.

  4. Multispectral selective near-perfect light absorption by graphene monolayer using aperiodic multilayer microstructures

    Science.gov (United States)

    Zand, Iman; Dalir, Hamed; Chen, Ray T.; Dowling, Jonathan P.

    2018-03-01

    We investigate one-dimensional aperiodic multilayer microstructures in order to achieve near-total absorptions at preselected wavelengths in a graphene monolayer. The proposed structures are designed using a genetic optimization algorithm coupled to a transfer matrix code. Coupled-mode-theory analysis, consistent with transfer matrix method results, indicates the existence of a critical coupling in the graphene monolayer for perfect absorptions. Our findings show that the near-total-absorption peaks are highly tunable and can be controlled simultaneously or independently in a wide range of wavelengths in the near-infrared and visible ranges. The proposed approach is metal-free, does not require surface texturing or patterning, and can be also applied for other two-dimensional materials.

  5. Aperiodic pressure pulsation under non optimal hydraulic turbine regimes at low swirl number

    Science.gov (United States)

    Skripkin, S. G.; Tsoy, M. A.; Kuibin, P. A.; Shtork, S. I.

    2017-09-01

    Off-design operating conditions of hydraulic turbines is hindered by pressure fluctuations in the draft tube of the turbine. A precessing helical vortex rope develops, which imperils the mechanical structure and limits the operation flexibility of hydropower station. Understanding of the underlying instabilities of precessing vortex rope at low swirl number is incomplete. In this paper flow regimes with different residual swirl is analysed, particular attention is paid to the regime with a small swirl parameter. Study defines upper and low boundaries of regime where aperiodic pressure surge is observed. Flow field at the runner exit is investigated by Laser Doppler Velocimetry and high-speed visualizations, which are complemented draft tube wall pressure measurements.

  6. Design of an amplifier model accounting for thermal effect in fully aperiodic large pitch fibers

    Science.gov (United States)

    Tragni, K.; Molardi, C.; Poli, F.; Dauliat, R.; Leconte, B.; Darwich, D.; du Jeu, R.; Malleville, M. A.; Jamier, R.; Selleri, S.; Roy, P.; Cucinotta, A.

    2018-02-01

    Yb-doped Photonic Crystal Fibers (PCFs) have triggered a significant power scaling into fiber-based lasers. However thermally-induced effects, like mode instability, can compromise the output beam quality. PCF design with improved Higher Order Mode (HOM) delocalization and effective thermal resilience can contain the problem. In particular, Fully- Aperiodic Large-Pitch Fibers (FA-LPFs) have shown interesting properties in terms of resilience to thermal effects. In this paper the performances of a Yb-doped FA-LPF amplifier are experimentally and numerically investigated. Modal properties and gain competition between Fundamental Mode (FM) and first HOM have been calculated, in presence of thermal effects. The main doped fiber characteristics have been derived by comparison between experimental and numerical results.

  7. Applied optics. Gain modulation by graphene plasmons in aperiodic lattice lasers.

    Science.gov (United States)

    Chakraborty, S; Marshall, O P; Folland, T G; Kim, Y-J; Grigorenko, A N; Novoselov, K S

    2016-01-15

    Two-dimensional graphene plasmon-based technologies will enable the development of fast, compact, and inexpensive active photonic elements because, unlike plasmons in other materials, graphene plasmons can be tuned via the doping level. Such tuning is harnessed within terahertz quantum cascade lasers to reversibly alter their emission. This is achieved in two key steps: first, by exciting graphene plasmons within an aperiodic lattice laser and, second, by engineering photon lifetimes, linking graphene's Fermi energy with the round-trip gain. Modal gain and hence laser spectra are highly sensitive to the doping of an integrated, electrically controllable, graphene layer. Demonstration of the integrated graphene plasmon laser principle lays the foundation for a new generation of active, programmable plasmonic metamaterials with major implications across photonics, material sciences, and nanotechnology. Copyright © 2016, American Association for the Advancement of Science.

  8. On the algebraic characterization of aperiodic tilings related to ADE-root systems

    International Nuclear Information System (INIS)

    Kellendonk, J.

    1992-09-01

    The algebraic characterization of sets of locally equivalent aperiodic tilings, being examples of quantum spaces, is conducted for a certain type of tilings in a manner proposed by A. Connes. These 2-dimensional tilings are obtained by application of the strip method to the root lattice of an ADE-Coxeter group. The plane along which the strip is constructed is determined by the canonical Coxeter element leading to the result that a 2- dimensional tiling decomposes into a cartesian product of two 1- dimensional tilings. The properties of the tilings are investigated, including selfsimilarity, and the determination of the relevant algebraic is considered, namely the ordered K 0 -group of an algebra naturaly assigned to the quantum space. The result also yields an application of the 2-dimensional abstract gap labelling theorem. (orig.)

  9. The Time Is Up: Compression of Visual Time Interval Estimations of Bimodal Aperiodic Patterns

    Science.gov (United States)

    Duarte, Fabiola; Lemus, Luis

    2017-01-01

    The ability to estimate time intervals subserves many of our behaviors and perceptual experiences. However, it is not clear how aperiodic (AP) stimuli affect our perception of time intervals across sensory modalities. To address this question, we evaluated the human capacity to discriminate between two acoustic (A), visual (V) or audiovisual (AV) time intervals of trains of scattered pulses. We first measured the periodicity of those stimuli and then sought for correlations with the accuracy and reaction times (RTs) of the subjects. We found that, for all time intervals tested in our experiment, the visual system consistently perceived AP stimuli as being shorter than the periodic (P) ones. In contrast, such a compression phenomenon was not apparent during auditory trials. Our conclusions are: first, the subjects exposed to P stimuli are more likely to measure their durations accurately. Second, perceptual time compression occurs for AP visual stimuli. Lastly, AV discriminations are determined by A dominance rather than by AV enhancement. PMID:28848406

  10. Wave propagation in one-dimensional solid-fluid quasi-periodic and aperiodic phononic crystals

    Energy Technology Data Exchange (ETDEWEB)

    Chen Ali, E-mail: alchen@bjtu.edu.cn [Institute of Engineering Mechanics, Beijing Jiaotong University, Beijing 100044 (China); Wang Yuesheng [Institute of Engineering Mechanics, Beijing Jiaotong University, Beijing 100044 (China); Zhang Chuanzeng [Department of Civil Engineering, University of Siegen, D-57068 Siegen (Germany)

    2012-02-01

    The propagation of the elastic waves in one-dimensional (1D) solid-fluid quasi-periodic phononic crystals is studied by employing the concept of the localization factor, which is calculated by the transfer matrix method. The solid-fluid interaction effect at the interfaces between the solid and the fluid components is considered. For comparison, the periodic systems and aperiodic Thue-Morse sequence are also analyzed in this paper. The splitting phenomenon of the pass bands and bandgaps are discussed for these 1D solid-fluid systems. At last the influences of the material impedance ratios on the band structures of the 1D solid-fluid quasi-periodic phononic crystals arranged as Fibonacci sequence are discussed.

  11. The DNA electronic specific heat at low temperature: The role of aperiodicity

    Energy Technology Data Exchange (ETDEWEB)

    Sarmento, R.G. [Departamento de Física, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Mendes, G.A. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Vasconcelos, M.S. [Escola de Ciências e Tecnologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Ujsághy, O. [Department of Theoretical Physics and Condensed Matter Research Group of the Hungarian Academy of Sciences, Budapest University of Technology and Economics, Budafoki út 8, H-1521 Budapest (Hungary); Freire, V.N. [Departamento de Física, Universidade Federal do Ceará, 60455-760, Fortaleza, CE (Brazil); Caetano, E.W.S. [Instituto Federal de Educação, Ciência e Tecnologia do Ceará, 60040-531, Fortaleza, CE (Brazil)

    2012-07-16

    The electronic specific heat spectra at constant volume (C{sub V}) of a long-range correlated extended ladder model, mimicking a DNA molecule, is theoretically analyzed for a stacked array of a double-stranded structure made up from the nucleotides guanine G, adenine A, cytosine C and thymine T. The role of the aperiodicity on C{sub V} is discussed, considering two different nucleotide arrangements with increasing disorder, namely the Fibonacci and the Rudin–Shapiro quasiperiodic structures. Comparisons are made for different values of the band fillings, considering also a finite segment of natural DNA, as part of the human chromosome Ch22. -- Highlights: ► Quasiperiodic sequence to mimic the DNA nucleotides arrangement. ► Electronic tight-binding Hamiltonian model. ► Electronic density of states. ► Electronic specific heat spectra.

  12. Symbiotic stars

    International Nuclear Information System (INIS)

    Boyarchuk, A.A.

    1975-01-01

    There are some arguments that the symbiotic stars are binary, where one component is a red giant and the other component is a small hot star which is exciting a nebula. The symbiotic stars belong to the old disc population. Probably, symbiotic stars are just such an evolutionary stage for double stars as planetary nebulae for single stars. (Auth.)

  13. Riparian Inventory

    Data.gov (United States)

    Kansas Data Access and Support Center — This dataset is a digital representation of the 1:24,000 Land Use Riparian Areas Inventory for the state of Kansas. The dataset includes a 100 foot buffer around all...

  14. Dual-wavelength green laser with a 4.5 THz frequency difference based on self-frequency- doubling in Nd3+ -doped aperiodically poled lithium niobate.

    Science.gov (United States)

    Maestre, H; Torregrosa, A J; Fernández-Pousa, C R; Rico, M L; Capmany, J

    2008-05-01

    We report a dual-wavelength continuous-wave laser at 542.4 and 546.8 nm based on an Nd(3+)-doped aperiodically poled lithium niobate crystal. Two fundamental infrared (IR) wavelengths at 1084.8 and 1093.6 nm are simultaneously oscillated and self-frequency-doubled to green. The aperiodic domain distribution patterned in the crystal allows for quasi-phase matched self-frequency-doubling of both IR fundamentals while avoiding their sum-frequency mixing.

  15. The Pagoda Sequence: a Ramble through Linear Complexity, Number Walls, D0L Sequences, Finite State Automata, and Aperiodic Tilings

    Directory of Open Access Journals (Sweden)

    Fred Lunnon

    2009-06-01

    Full Text Available We review the concept of the number wall as an alternative to the traditional linear complexity profile (LCP, and sketch the relationship to other topics such as linear feedback shift-register (LFSR and context-free Lindenmayer (D0L sequences. A remarkable ternary analogue of the Thue-Morse sequence is introduced having deficiency 2 modulo 3, and this property verified via the re-interpretation of the number wall as an aperiodic plane tiling.

  16. Aperiodic dynamics in a deterministic adaptive network model of attitude formation in social groups

    Science.gov (United States)

    Ward, Jonathan A.; Grindrod, Peter

    2014-07-01

    Adaptive network models, in which node states and network topology coevolve, arise naturally in models of social dynamics that incorporate homophily and social influence. Homophily relates the similarity between pairs of nodes' states to their network coupling strength, whilst social influence causes coupled nodes' states to convergence. In this paper we propose a deterministic adaptive network model of attitude formation in social groups that includes these effects, and in which the attitudinal dynamics are represented by an activato-inhibitor process. We illustrate that consensus, corresponding to all nodes adopting the same attitudinal state and being fully connected, may destabilise via Turing instability, giving rise to aperiodic dynamics with sensitive dependence on initial conditions. These aperiodic dynamics correspond to the formation and dissolution of sub-groups that adopt contrasting attitudes. We discuss our findings in the context of cultural polarisation phenomena. Social influence. This reflects the fact that people tend to modify their behaviour and attitudes in response to the opinions of others [22-26]. We model social influence via diffusion: agents adjust their state according to a weighted sum (dictated by the evolving network) of the differences between their state and the states of their neighbours. Homophily. This relates the similarity of individuals' states to their frequency and strength of interaction [27]. Thus in our model, homophily drives the evolution of the weighted ‘social' network. A precise formulation of our model is given in Section 2. Social influence and homophily underpin models of social dynamics [21], which cover a wide range of sociological phenomena, including the diffusion of innovations [28-32], complex contagions [33-36], collective action [37-39], opinion dynamics [19,20,40,10,11,13,15,41,16], the emergence of social norms [42-44], group stability [45], social differentiation [46] and, of particular relevance

  17. Elastic wave localization in two-dimensional phononic crystals with one-dimensional random disorder and aperiodicity

    International Nuclear Information System (INIS)

    Yan Zhizhong; Zhang Chuanzeng; Wang Yuesheng

    2011-01-01

    The band structures of in-plane elastic waves propagating in two-dimensional phononic crystals with one-dimensional random disorder and aperiodicity are analyzed in this paper. The localization of wave propagation is discussed by introducing the concept of the localization factor, which is calculated by the plane-wave-based transfer-matrix method. By treating the random disorder and aperiodicity as the deviation from the periodicity in a special way, three kinds of aperiodic phononic crystals that have normally distributed random disorder, Thue-Morse and Rudin-Shapiro sequence in one direction and translational symmetry in the other direction are considered and the band structures are characterized using localization factors. Besides, as a special case, we analyze the band gap properties of a periodic planar layered composite containing a periodic array of square inclusions. The transmission coefficients based on eigen-mode matching theory are also calculated and the results show the same behaviors as the localization factor does. In the case of random disorders, the localization degree of the normally distributed random disorder is larger than that of the uniformly distributed random disorder although the eigenstates are both localized no matter what types of random disorders, whereas, for the case of Thue-Morse and Rudin-Shapiro structures, the band structures of Thue-Morse sequence exhibit similarities with the quasi-periodic (Fibonacci) sequence not present in the results of the Rudin-Shapiro sequence.

  18. Synchronization of coupled stochastic complex-valued dynamical networks with time-varying delays via aperiodically intermittent adaptive control

    Science.gov (United States)

    Wang, Pengfei; Jin, Wei; Su, Huan

    2018-04-01

    This paper deals with the synchronization problem of a class of coupled stochastic complex-valued drive-response networks with time-varying delays via aperiodically intermittent adaptive control. Different from the previous works, the intermittent control is aperiodic and adaptive, and the restrictions on the control width and time delay are removed, which lead to a larger application scope for this control strategy. Then, based on the Lyapunov method and Kirchhoff's Matrix Tree Theorem as well as differential inequality techniques, several novel synchronization conditions are derived for the considered model. Specially, impulsive control is also considered, which can be seen as a special case of the aperiodically intermittent control when the control width tends to zero. And the corresponding synchronization criteria are given as well. As an application of the theoretical results, a class of stochastic complex-valued coupled oscillators with time-varying delays is studied, and the numerical simulations are also given to demonstrate the effectiveness of the control strategies.

  19. Competition model for aperiodic stochastic resonance in a Fitzhugh-Nagumo model of cardiac sensory neurons.

    Science.gov (United States)

    Kember, G C; Fenton, G A; Armour, J A; Kalyaniwalla, N

    2001-04-01

    Regional cardiac control depends upon feedback of the status of the heart from afferent neurons responding to chemical and mechanical stimuli as transduced by an array of sensory neurites. Emerging experimental evidence shows that neural control in the heart may be partially exerted using subthreshold inputs that are amplified by noisy mechanical fluctuations. This amplification is known as aperiodic stochastic resonance (ASR). Neural control in the noisy, subthreshold regime is difficult to see since there is a near absence of any correlation between input and the output, the latter being the average firing (spiking) rate of the neuron. This lack of correlation is unresolved by traditional energy models of ASR since these models are unsuitable for identifying "cause and effect" between such inputs and outputs. In this paper, the "competition between averages" model is used to determine what portion of a noisy, subthreshold input is responsible, on average, for the output of sensory neurons as represented by the Fitzhugh-Nagumo equations. A physiologically relevant conclusion of this analysis is that a nearly constant amount of input is responsible for a spike, on average, and this amount is approximately independent of the firing rate. Hence, correlation measures are generally reduced as the firing rate is lowered even though neural control under this model is actually unaffected.

  20. Computational Modeling of Bloch Surface Waves in One-Dimensional Periodic and Aperiodic Multilayer Structures

    Science.gov (United States)

    Koju, Vijay

    Photonic crystals and their use in exciting Bloch surface waves have received immense attention over the past few decades. This interest is mainly due to their applications in bio-sensing, wave-guiding, and other optical phenomena such as surface field enhanced Raman spectroscopy. Improvement in numerical modeling techniques, state of the art computing resources, and advances in fabrication techniques have also assisted in growing interest in this field. The ability to model photonic crystals computationally has benefited both the theoretical as well as experimental communities. It helps the theoretical physicists in solving complex problems which cannot be solved analytically and helps to acquire useful insights that cannot be obtained otherwise. Experimentalists, on the other hand, can test different variants of their devices by changing device parameters to optimize performance before fabrication. In this dissertation, we develop two commonly used numerical techniques, namely transfer matrix method, and rigorous coupled wave analysis, in C++ and MATLAB, and use two additional software packages, one open-source and another commercial, to model one-dimensional photonic crystals. Different variants of one-dimensional multilayered structures such as perfectly periodic dielectric multilayers, quasicrystals, aperiodic multilayer are modeled, along with one-dimensional photonic crystals with gratings on the top layer. Applications of Bloch surface waves, along with new and novel aperiodic dielectric multilayer structures that support Bloch surface waves are explored in this dissertation. We demonstrate a slow light configuration that makes use of Bloch Surface Waves as an intermediate excitation in a double-prism tunneling configuration. This method is simple compared to the more usual techniques for slowing light using the phenomenon of electromagnetically induced transparency in atomic gases or doped ionic crystals operated at temperatures below 4K. Using a semi

  1. A novel scenario of aperiodical impacts appearance in the turbine draft tube

    Science.gov (United States)

    Alekseenko, S. V.; Kuibin, P. A.; Shtork, S. I.; Skripkin, S. G.; Sonin, V. I.; Tsoy, M. A.; Ustimenko, A. S.

    2016-11-01

    The swirling flow in the discharge cone of hydroturbine is characterized by various self-induced instabilities and associated low frequency phenomena when the turbine is operated far from the best efficiency point. In particular, the precessing vortex rope develops at part-load regimes in the draft tube. This rope can serve a reason of the periodical low- frequency pressure oscillations in the whole hydrodynamical system. During the experimental research of flow structure in the discharge cone in a regime of free runner new interesting phenomenon was discovered. Due to instability some coils of helical vortex close to each other and reconnection appears with generation of a vortex ring. The experiments were fulfilled at the cavitational conditions when a cavity arises in the vortex core. So the phenomenon was registered with help of visualization by the high speed video recording. The vortex ring after the reconnection moves apart from the main vortex rope toward the wall and downstream. When it reaches the area with high pressure the cavity collapses with generation of pressure impact. The mechanism of cavitational vortex rings generation and their further collapse can serve as a prototype of the aperiodical pressure impacts inside the turbine draft tube.

  2. Variable Stars Observed in the Galactic Disk by AST3-1 from Dome A, Antarctica

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Lingzhi; Ma, Bin; Hu, Yi; Liu, Qiang; Shang, Zhaohui [Key Laboratory of Optical Astronomy, National Astronomical Observatories, Chinese Academy of Sciences, Beijing 100012 (China); Li, Gang; Fu, Jianning [Department of Astronomy, Beijing Normal University, Beijing, 100875 (China); Wang, Lifan; Cui, Xiangqun; Du, Fujia; Gong, Xuefei; Li, Xiaoyan; Li, Zhengyang; Yuan, Xiangyan; Zhou, Jilin [Chinese Center for Antarctic Astronomy, Nanjing 210008 (China); Ashley, Michael C. B. [School of Physics, University of New South Wales, NSW 2052 (Australia); Pennypacker, Carl R. [Center for Astrophysics, Lawrence Berkeley National Laboratory, Berkeley, CA (United States); York, Donald G., E-mail: wanglingzhi@bao.ac.cn [Department of Astronomy and Astrophysics and Enrico Fermi Institute, University of Chicago, Chicago, IL 60637 (United States)

    2017-03-01

    AST3-1 is the second-generation wide-field optical photometric telescope dedicated to time-domain astronomy at Dome A, Antarctica. Here, we present the results of an i -band images survey from AST3-1 toward one Galactic disk field. Based on time-series photometry of 92,583 stars, 560 variable stars were detected with i magnitude ≤16.5 mag during eight days of observations; 339 of these are previously unknown variables. We tentatively classify the 560 variables as 285 eclipsing binaries (EW, EB, and EA), 27 pulsating variable stars ( δ Scuti, γ Doradus, δ Cephei variable, and RR Lyrae stars), and 248 other types of variables (unclassified periodic, multiperiodic, and aperiodic variable stars). Of the eclipsing binaries, 34 show O’Connell effects. One of the aperiodic variables shows a plateau light curve and another variable shows a secondary maximum after peak brightness. We also detected a complex binary system with an RS CVn-like light-curve morphology; this object is being followed-up spectroscopically using the Gemini South telescope.

  3. Stars and Star Myths.

    Science.gov (United States)

    Eason, Oliver

    Myths and tales from around the world about constellations and facts about stars in the constellations are presented. Most of the stories are from Greek and Roman mythology; however, a few Chinese, Japanese, Polynesian, Arabian, Jewish, and American Indian tales are also included. Following an introduction, myths are presented for the following 32…

  4. Optimization of Inventory

    OpenAIRE

    PROKOPOVÁ, Nikola

    2017-01-01

    The subject of this thesis is optimization of inventory in selected organization. Inventory optimization is a very important topic in each organization because it reduces storage costs. At the beginning the inventory theory is presented. It shows the meaning and types of inventory, inventory control and also different methods and models of inventory control. Inventory optimization in the enterprise can be reached by using models of inventory control. In the second part the company on which is...

  5. Storage and Assay of Tritium in STAR

    International Nuclear Information System (INIS)

    Longhurst, Glen R.; Anderl, Robert A.; Pawelko, Robert J.; Stoots, Carl J.

    2005-01-01

    The Safety and Tritium Applied Research (STAR) facility at the Idaho National Engineering and Environmental Laboratory (INEEL) is currently being commissioned to investigate tritium-related safety questions for fusion and other technologies. The tritium inventory for the STAR facility will be maintained below 1.5 g to avoid the need for STAR to be classified as a Category 3 nuclear facility. A key capability in successful operation of the STAR facility is the ability to receive, inventory, and dispense tritium to the various experiments underway there. The system central to that function is the Tritium Storage and Assay System (SAS).The SAS has four major functions: (1) receiving and holding tritium, (2) assaying, (3) dispensing, and (4) purifying hydrogen isotopes from non-hydrogen species.This paper describes the design and operation of the STAR SAS and the procedures used for tritium accountancy in the STAR facility

  6. Theoretical and experimental study of bent fully aperiodic large-pitch fibers for enhancing the high-order modes delocalization

    Science.gov (United States)

    du Jeu, Rémi; Dauliat, Romain; Darwich, Dia; Auguste, Jean-Louis; Benoît, Aurélien; Leconte, Baptiste; Malleville, Marie-Alicia; Jamier, Raphaël.; Schuster, Kay; Roy, Philippe

    2018-02-01

    The power scaling of fiber lasers and amplifiers has triggered an extensive development of large-mode area fibers among which the most promising are the distributed mode filtering fibers and the large-pitch fibers. These structures enable for an effective higher-order modes delocalization and subsequently a singlemode emission. An interesting alternative consists in using the fully-aperiodic large-pitch fibers, into which the standard air-silica photonic crystal cladding is replaced by an aperiodic pattern made of solid low-index inclusions cladding. However, in such a structure, the core and the background cladding material surrounding it must have rigorously the same refractive index. Current synthesis processes and measurement techniques offer respectively a maximum resolution of 5×10-4 and 1×10-4 while the indexmatching must be as precise as 1×10-5 . Lately a gain material with a refractive index 1.5×10-4 higher than that of the background cladding material was fabricated, thus re-confining the first higher-order modes in the core. A numerical study is carried out on the benefit of bending such fully-aperiodic fiber to counteract this phenomenon. Optimized bending axis and radius have been determined. Experiments are done in a laser cavity operating at 1030 nm using an 88cm-long 51μm core diameter ytterbium-doped fiber. Results demonstrate an improvement of the M2 from 1.7 when the fiber is kept straight to 1.2 when it is bent with a 100 to 60 cm bend radius. These primary results are promising for future power scaling.

  7. Spectral characterisation of aperiodic normal-incidence Sb/B4C multilayer mirrors for the λ < 124 Å range

    Science.gov (United States)

    Vishnyakov, E. A.; Kopylets, I. A.; Kondratenko, V. V.; Kolesnikov, A. O.; Pirozhkov, A. S.; Ragozin, E. N.; Shatokhin, A. N.

    2018-03-01

    Three broadband aperiodic Sb/B4C multilayer mirrors were synthesised for the purposes of soft X-ray optics and spectroscopy in the wavelength range beyond the L-edge of Si (λ plasma radiation source and an electronic detector with a 2D spatial resolution (a CCD matrix with 13 × 13 μm sized pixels). The experimental spectra are compared with theoretical calculations. The effect of lower antimony and B4C layer densities on the reflection spectra is discussed.

  8. Inventory Abstraction

    International Nuclear Information System (INIS)

    Leigh, C.

    2000-01-01

    The purpose of the inventory abstraction as directed by the development plan (CRWMS M and O 1999b) is to: (1) Interpret the results of a series of relative dose calculations (CRWMS M and O 1999c, 1999d). (2) Recommend, including a basis thereof, a set of radionuclides that should be modeled in the Total System Performance Assessment in Support of the Site Recommendation (TSPA-SR) and the Total System Performance Assessment in Support of the Final Environmental Impact Statement (TSPA-FEIS). (3) Provide initial radionuclide inventories for the TSPA-SR and TSPA-FEIS models. (4) Answer the U.S. Nuclear Regulatory Commission (NRC)'s Issue Resolution Status Report ''Key Technical Issue: Container Life and Source Term'' (CLST IRSR) (NRC 1999) key technical issue (KTI): ''The rate at which radionuclides in SNF [Spent Nuclear Fuel] are released from the EBS [Engineered Barrier System] through the oxidation and dissolution of spent fuel'' (Subissue 3). The scope of the radionuclide screening analysis encompasses the period from 100 years to 10,000 years after the potential repository at Yucca Mountain is sealed for scenarios involving the breach of a waste package and subsequent degradation of the waste form as required for the TSPA-SR calculations. By extending the time period considered to one million years after repository closure, recommendations are made for the TSPA-FEIS. The waste forms included in the inventory abstraction are Commercial Spent Nuclear Fuel (CSNF), DOE Spent Nuclear Fuel (DSNF), High-Level Waste (HLW), naval Spent Nuclear Fuel (SNF), and U.S. Department of Energy (DOE) plutonium waste. The intended use of this analysis is in TSPA-SR and TSPA-FEIS. Based on the recommendations made here, models for release, transport, and possibly exposure will be developed for the isotopes that would be the highest contributors to the dose given a release to the accessible environment. The inventory abstraction is important in assessing system performance because

  9. INVENTORY ABSTRACTION

    International Nuclear Information System (INIS)

    Ragan, G.

    2001-01-01

    The purpose of the inventory abstraction, which has been prepared in accordance with a technical work plan (CRWMS M andO 2000e for/ICN--02 of the present analysis, and BSC 2001e for ICN 03 of the present analysis), is to: (1) Interpret the results of a series of relative dose calculations (CRWMS M andO 2000c, 2000f). (2) Recommend, including a basis thereof, a set of radionuclides that should be modeled in the Total System Performance Assessment in Support of the Site Recommendation (TSPA-SR) and the Total System Performance Assessment in Support of the Final Environmental Impact Statement (TSPA-FEIS). (3) Provide initial radionuclide inventories for the TSPA-SR and TSPA-FEIS models. (4) Answer the U.S. Nuclear Regulatory Commission (NRC)'s Issue Resolution Status Report ''Key Technical Issue: Container Life and Source Term'' (CLST IRSR) key technical issue (KTI): ''The rate at which radionuclides in SNF [spent nuclear fuel] are released from the EBS [engineered barrier system] through the oxidation and dissolution of spent fuel'' (NRC 1999, Subissue 3). The scope of the radionuclide screening analysis encompasses the period from 100 years to 10,000 years after the potential repository at Yucca Mountain is sealed for scenarios involving the breach of a waste package and subsequent degradation of the waste form as required for the TSPA-SR calculations. By extending the time period considered to one million years after repository closure, recommendations are made for the TSPA-FEIS. The waste forms included in the inventory abstraction are Commercial Spent Nuclear Fuel (CSNF), DOE Spent Nuclear Fuel (DSNF), High-Level Waste (HLW), naval Spent Nuclear Fuel (SNF), and U.S. Department of Energy (DOE) plutonium waste. The intended use of this analysis is in TSPA-SR and TSPA-FEIS. Based on the recommendations made here, models for release, transport, and possibly exposure will be developed for the isotopes that would be the highest contributors to the dose given a release

  10. Wave Star

    DEFF Research Database (Denmark)

    Kramer, Morten; Brorsen, Michael; Frigaard, Peter

    Denne rapport beskriver numeriske beregninger af forskellige flydergeometrier for bølgeenergianlæget Wave Star.......Denne rapport beskriver numeriske beregninger af forskellige flydergeometrier for bølgeenergianlæget Wave Star....

  11. Achieving sub-50 nm controlled diameter of aperiodic Si nanowire arrays by ultrasonic catalyst removal for photonic applications

    Science.gov (United States)

    Chaliyawala, Harsh A.; Purohit, Zeel; Khanna, Sakshum; Ray, Abhijit; Pati, Ranjan K.; Mukhopadhyay, Indrajit

    2018-05-01

    We report an alternative approach to fabricate the vertically aligned aperiodic Si nanowire arrays by controlling the diameter of the Ag nanoparticles and tuneable ultrasonic removal. The process begins by sputtering the Ag thin film (t=5 nm) on the Si/SiO2 substrates. Followed by Ag thin film, annealed for various temperature (T=300°C, 400°C, 500°C and 600°C) to selectively achieve a high density, well-spaced and diameter controlled Ag nanoparticles (AgNPs) on the Si/SiO2 substrates. The sacrificial layer of AgNPs size indicates the controlled diameter of the Si nanowire arrays. Image J analysis for various annealed samples gives an indication of the high density, uniformity and equal distribution of closely packed AgNPs. Furthermore, the AgNPs covered with Au/Pd mesh (5 nm) as a template, was removed by ultrasonication in the etchant solution for several times in different intervals of preparation. The conventional and facile metal assisted electroless etching approach was finally employed to fabricate the vertically aperiodic sub-50 nm SiNWAs, can be applicable to various nanoscale opto-electronic applications.

  12. The evolution of the Gutenberg-Richter, b-value, throughout periodic and aperiodic stick-slip cycles

    Science.gov (United States)

    Bolton, D. C.; Riviere, J.; Marone, C.; Johnson, P. A.

    2017-12-01

    The Gutenberg-Richter earthquake size statistic, b value, is a useful proxy for documenting the state of stress on a fault and understanding precursory phenomena preceding dynamic failure. It has been shown that the b value varies systematically as a function of position within the seismic cycle. Frictional studies on intact rock samples with saw-cut faults have shown that b value decreases continuously preceding failure. For intact rock samples, the spatiotemporal changes in b value are thought to be related to the evolution of asperities and micro-cracks. However, few studies have shown how b value evolves spatially and temporally for fault zones containing gouge and wear materials. We hypothesize that the micromechanical mechanisms acting within fault gouge, such as creation and destruction of force chains, grain rolling, sliding, jamming and fracturing play an important role in the evolution of b value and that they may have distinct signatures during periodic and aperiodic cycles of stick-slip frictional motion. We report results from experiments conducted on simulated fault gouge using a biaxial deformation apparatus in a double-direct shear configuration. Acoustic emissions (AEs) are recorded at 4 MHz from 36 P-polarized piezoelectric transducers, which are embedded in steel blocks located adjacent to the fault zone. We compute the frequency-magnitude distribution of detected AEs using a moving window in events where each window is overlapped by 75%. We report on the evolution of b value as a function of normal stress and gouge layer thickness. For periodic slip events, b value reaches a maximum value immediately after a slip event and decreases continuously until the next failure. Aperiodic slip events show similar trends in b-value initially, however unlike periodic slip events, b value reaches a steady state value before failure occurs. In addition, for periodic slip events the magnitude of the change in b value scales inversely with gouge layer thickness

  13. Characteristics of aperiodic sequence of slip events caused by interaction between seismic patches and that caused be self-organized stress heterogeneity

    Science.gov (United States)

    Kato, N.

    2017-12-01

    Numerical simulations of earthquake cycles are conducted to investigate the origin of complexity of earthquake recurrence. There are two main causes of the complexity. One is self-organized stress heterogeneity due to dynamical effect. The other is the effect of interaction between some fault patches. In the model, friction on the fault is assumed to obey a rate- and state-dependent friction law. Circular patches of velocity-weakening frictional property are assumed on the fault. On the remaining areas of the fault, velocity-strengthening friction is assumed. We consider three models: Single patch model, two-patch model, and three-patch model. In the first model, the dynamical effect is mainly examined. The latter two models take into consideration the effect of interaction as well as the dynamical effect. Complex multiperiodic or aperiodic sequences of slip events occur when slip behavior changes from the seismic to aseismic, and when the degree of interaction between seismic patches is intermediate. The former is observed in all the models, and the latter is observed in the two-patch model and the three-patch model. Evolution of spatial distribution of shear stress on the fault suggests that aperiodicity at the transition from seismic to aseismic slip is caused by self-organized stress heterogeneity. The iteration maps of recurrence intervals of slip events in aperiodic sequences are examined, and they are approximately expressed by simple curves for aperiodicity at the transition from seismic to aseismic slip. In contrast, the iteration maps for aperiodic sequences caused by interaction between seismic patches are scattered and they are not expressed by simple curves. This result suggests that complex sequences caused by different mechanisms may be distinguished.

  14. Radio stars

    International Nuclear Information System (INIS)

    Hjellming, R.M.

    1976-01-01

    Any discussion of the radio emission from stars should begin by emphasizing certain unique problems. First of all, one must clarify a semantic confusion introduced into radio astronomy in the late 1950's when most new radio sources were described as radio stars. All of these early 'radio stars' were eventually identified with other galactic and extra-galactic objects. The study of true radio stars, where the radio emission is produced in the atmosphere of a star, began only in the 1960's. Most of the work on the subject has, in fact, been carried out in only the last few years. Because the real information about radio stars is quite new, it is not surprising that major aspects of the subject are not at all understood. For this reason this paper is organized mainly around three questions: what is the available observational information; what physical processes seem to be involved; and what working hypotheses look potentially fruitful. (Auth.)

  15. Shooting stars

    International Nuclear Information System (INIS)

    Maurette, M.; Hammer, C.

    1985-01-01

    A shooting star passage -even a star shower- can be sometimes easily seen during moonless black night. They represent the partial volatilization in earth atmosphere of meteorites or micrometeorites reduced in cosmic dusts. Everywhere on earth, these star dusts are searched to be gathered. This research made one year ago on the Greenland ice-cap is this article object; orbit gathering projects are also presented [fr

  16. Forest inventory in Myanmar

    Energy Technology Data Exchange (ETDEWEB)

    Bo, Sit [Forest Resource Div., Forest Department (Myanmar)

    1993-10-01

    Forest inventory in Myanmar started in 1850s. Up till 1975, Myanmar Forest Department conducted forest inventories covering approximately one forest division every year. The National Forest Survey and Inventory Project funded by UNDP and assisted by FAO commenced in 1981 and the National Forest Management and Inventory project followed in 1986. Up till end March 1993, pre-investment inventory has covered 26.7 million acres, reconnaissance inventory 5.4 million acres and management inventory has carried out in 12 townships

  17. Forest inventory in Myanmar

    International Nuclear Information System (INIS)

    Sit Bo

    1993-01-01

    Forest inventory in Myanmar started in 1850s. Up till 1975, Myanmar Forest Department conducted forest inventories covering approximately one forest division every year. The National Forest Survey and Inventory Project funded by UNDP and assisted by FAO commenced in 1981 and the National Forest Management and Inventory project followed in 1986. Up till end March 1993, pre-investment inventory has covered 26.7 million acres, reconnaissance inventory 5.4 million acres and management inventory has carried out in 12 townships

  18. Star Polymers.

    Science.gov (United States)

    Ren, Jing M; McKenzie, Thomas G; Fu, Qiang; Wong, Edgar H H; Xu, Jiangtao; An, Zesheng; Shanmugam, Sivaprakash; Davis, Thomas P; Boyer, Cyrille; Qiao, Greg G

    2016-06-22

    Recent advances in controlled/living polymerization techniques and highly efficient coupling chemistries have enabled the facile synthesis of complex polymer architectures with controlled dimensions and functionality. As an example, star polymers consist of many linear polymers fused at a central point with a large number of chain end functionalities. Owing to this exclusive structure, star polymers exhibit some remarkable characteristics and properties unattainable by simple linear polymers. Hence, they constitute a unique class of technologically important nanomaterials that have been utilized or are currently under audition for many applications in life sciences and nanotechnologies. This article first provides a comprehensive summary of synthetic strategies towards star polymers, then reviews the latest developments in the synthesis and characterization methods of star macromolecules, and lastly outlines emerging applications and current commercial use of star-shaped polymers. The aim of this work is to promote star polymer research, generate new avenues of scientific investigation, and provide contemporary perspectives on chemical innovation that may expedite the commercialization of new star nanomaterials. We envision in the not-too-distant future star polymers will play an increasingly important role in materials science and nanotechnology in both academic and industrial settings.

  19. Wave Star

    DEFF Research Database (Denmark)

    Kramer, Morten; Brorsen, Michael; Frigaard, Peter

    Nærværende rapport beskriver numeriske beregninger af den hydrodynamiske interaktion mellem 5 flydere i bølgeenergianlægget Wave Star.......Nærværende rapport beskriver numeriske beregninger af den hydrodynamiske interaktion mellem 5 flydere i bølgeenergianlægget Wave Star....

  20. Star Imager

    DEFF Research Database (Denmark)

    Madsen, Peter Buch; Jørgensen, John Leif; Thuesen, Gøsta

    1997-01-01

    The version of the star imager developed for Astrid II is described. All functions and features are described as well as the operations and the software protocol.......The version of the star imager developed for Astrid II is described. All functions and features are described as well as the operations and the software protocol....

  1. Radio stars

    International Nuclear Information System (INIS)

    Hjellming, R.M.; Gibson, D.M.

    1985-01-01

    Studies of stellar radio emission became an important field of research in the 1970's and have now expanded to become a major area of radio astronomy with the advent of new instruments such as the Very Large Array in New Mexico and transcontinental telescope arrays. This volume contains papers from the workshop on stellar continuum radio astronomy held in Boulder, Colorado, and is the first book on the rapidly expanding field of radio emission from stars and stellar systems. Subjects covered include the observational and theoretical aspects of stellar winds from both hot and cool stars, radio flares from active double star systems and red dwarf stars, bipolar flows from star-forming regions, and the radio emission from X-ray binaries. (orig.)

  2. Symbiotic stars

    International Nuclear Information System (INIS)

    Kafatos, M.; Michalitsianos, A.G.

    1984-01-01

    Among the several hundred million binary systems estimated to lie within 3000 light years of the solar system, a tiny fraction, no more than a few hundred, belong to a curious subclass whose radiation has a wavelength distribution so peculiar that it long defied explanation. Such systems radiate strongly in the visible region of the spectrum, but some of them do so even more strongly at both shorter and longer wavelengths: in the ultraviolet region and in the infrared and radio regions. This odd distribution of radiation is best explained by the pairing of a cool red giant star and an intensely hot small star that is virtually in contact with its larger companion. Such objects have become known as symbiotic stars. On photographic plate only the giant star can be discerned, but evidence for the existence of the hot companion has been supplied by satellite-born instruments capable of detecting ultraviolet radiation. The spectra of symbiotic stars indicate that the cool red giant is surrounded by a very hot ionized gas. Symbiotic stars also flared up in outbursts indicating the ejection of material in the form of a shell or a ring. Symbiotic stars may therefore represent a transitory phase in the evolution of certain types of binary systems in which there is substantial transfer of matter from the larger partner to the smaller

  3. Star formation

    International Nuclear Information System (INIS)

    Woodward, P.R.

    1978-01-01

    Theoretical models of star formation are discussed beginning with the earliest stages and ending in the formation of rotating, self-gravitating disks or rings. First a model of the implosion of very diffuse gas clouds is presented which relies upon a shock at the edge of a galactic spiral arm to drive the implosion. Second, models are presented for the formation of a second generation of massive stars in such a cloud once a first generation has formed. These models rely on the ionizing radiation from massive stars or on the supernova shocks produced when these stars explode. Finally, calculations of the gravitational collapse of rotating clouds are discussed with special focus on the question of whether rotating disks or rings are the result of such a collapse. 65 references

  4. Wave Star

    DEFF Research Database (Denmark)

    Kramer, Morten; Frigaard, Peter

    Nærværende rapport beskriver modelforsøg udført på Aalborg Universitet, Institut for Byggeri og Anlæg med bølgeenergianlæget Wave Star.......Nærværende rapport beskriver modelforsøg udført på Aalborg Universitet, Institut for Byggeri og Anlæg med bølgeenergianlæget Wave Star....

  5. Wave Star

    DEFF Research Database (Denmark)

    Kramer, Morten; Andersen, Thomas Lykke

    Nærværende rapport beskriver modelforsøg udført på Aalborg Universitet, Institut for Vand, Jord og Miljøteknik med bølgeenergianlægget Wave Star.......Nærværende rapport beskriver modelforsøg udført på Aalborg Universitet, Institut for Vand, Jord og Miljøteknik med bølgeenergianlægget Wave Star....

  6. STARS no star on Kauai

    International Nuclear Information System (INIS)

    Jones, M.

    1993-01-01

    The island of Kuai, home to the Pacific Missile Range Facility, is preparing for the first of a series of Star Wars rocket launches expected to begin early this year. The Strategic Defense Initiative plans 40 launches of the Stategic Target System (STARS) over a 10-year period. The focus of the tests appears to be weapons and sensors designed to combat multiple-warhead ICBMs, which will be banned under the START II Treaty that was signed in January. The focus of this article is to express the dubious value of testing the STARS at a time when their application will not be an anticipated problem

  7. Flare stars

    International Nuclear Information System (INIS)

    Nicastro, A.J.

    1981-01-01

    The least massive, but possibly most numerous, stars in a galaxy are the dwarf M stars. It has been observed that some of these dwarfs are characterized by a short increase in brightness. These stars are called flare stars. These flare stars release a lot of energy in a short amount of time. The process producing the eruption must be energetic. The increase in light intensity can be explained by a small area rising to a much higher temperature. Solar flares are looked at to help understand the phenomenon of stellar flares. Dwarfs that flare are observed to have strong magnetic fields. Those dwarf without the strong magnetic field do not seem to flare. It is believed that these regions of strong magnetic fields are associated with star spots. Theories on the energy that power the flares are given. Astrophysicists theorize that the driving force of a stellar flare is the detachment and collapse of a loop of magnetic flux. The mass loss due to stellar flares is discussed. It is believed that stellar flares are a significant contributor to the mass of interstellar medium in the Milky Way

  8. Housing Inventory Count

    Data.gov (United States)

    Department of Housing and Urban Development — This report displays the data communities reported to HUD about the nature of their dedicated homeless inventory, referred to as their Housing Inventory Count (HIC)....

  9. Integrated inventory information system

    Digital Repository Service at National Institute of Oceanography (India)

    Sarupria, J.S.; Kunte, P.D.

    The nature of oceanographic data and the management of inventory level information are described in Integrated Inventory Information System (IIIS). It is shown how a ROSCOPO (report on observations/samples collected during oceanographic programme...

  10. World Glacier Inventory

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The World Glacier Inventory (WGI) contains information for over 130,000 glaciers. Inventory parameters include geographic location, area, length, orientation,...

  11. HHS Enterprise Data Inventory

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Enterprise Data Inventory (EDI) is the comprehensive inventory listing of agency data resources including public, restricted public, and non-public datasets.

  12. Science Inventory | US EPA

    Science.gov (United States)

    The Science Inventory is a searchable database of research products primarily from EPA's Office of Research and Development. Science Inventory records provide descriptions of the product, contact information, and links to available printed material or websites.

  13. National Wetlands Inventory Polygons

    Data.gov (United States)

    Minnesota Department of Natural Resources — Wetland area features mapped as part of the National Wetlands Inventory (NWI). The National Wetlands Inventory is a national program sponsored by the US Fish and...

  14. Functional Assessment Inventory Manual.

    Science.gov (United States)

    Crewe, Nancy M.; Athelstan, Gary T.

    This manual, which provides extensive new instructions for administering the Functional Assessment Inventory (FAI), is intended to enable counselors to begin using the inventory without undergoing any special training. The first two sections deal with the need for functional assessment and issues in the development and use of the inventory. The…

  15. Evidence for deterministic chaos in aperiodic oscillations of acute lymphoblastic leukemia cells in long-term culture

    Science.gov (United States)

    Lambrou, George I.; Chatziioannou, Aristotelis; Vlahopoulos, Spiros; Moschovi, Maria; Chrousos, George P.

    Biological systems are dynamic and possess properties that depend on two key elements: initial conditions and the response of the system over time. Conceptualizing this on tumor models will influence conclusions drawn with regard to disease initiation and progression. Alterations in initial conditions dynamically reshape the properties of proliferating tumor cells. The present work aims to test the hypothesis of Wolfrom et al., that proliferation shows evidence for deterministic chaos in a manner such that subtle differences in the initial conditions give rise to non-linear response behavior of the system. Their hypothesis, tested on adherent Fao rat hepatoma cells, provides evidence that these cells manifest aperiodic oscillations in their proliferation rate. We have tested this hypothesis with some modifications to the proposed experimental setup. We have used the acute lymphoblastic leukemia cell line CCRF-CEM, as it provides an excellent substrate for modeling proliferation dynamics. Measurements were taken at time points varying from 24h to 48h, extending the assayed populations beyond that of previous published reports that dealt with the complex dynamic behavior of animal cell populations. We conducted flow cytometry studies to examine the apoptotic and necrotic rate of the system, as well as DNA content changes of the cells over time. The cells exhibited a proliferation rate of nonlinear nature, as this rate presented oscillatory behavior. The obtained data have been fit in known models of growth, such as logistic and Gompertzian growth.

  16. Quantum discord and classical correlation signatures of mobility edges in one-dimensional aperiodic single-electron systems

    International Nuclear Information System (INIS)

    Gong, Longyan; Zhu, Hao; Zhao, Shengmei; Cheng, Weiwen; Sheng, Yubo

    2012-01-01

    We investigate numerically the quantum discord and the classical correlation in a one-dimensional slowly varying potential model and a one-dimensional Soukoulis–Economou ones, respectively. There are well-defined mobility edges in the slowly varying potential model, while there are discrepancies on mobility edges in the Soukoulis–Economou ones. In the slowly varying potential model, we find that extended and localized states can be distinguished by both the quantum discord and the classical correlation. There are sharp transitions in the quantum discord and the classical correlation at mobility edges. Based on these, we study “mobility edges” in the Soukoulis–Economou model using the quantum discord and the classical correlation, which gives another perspectives for these “mobility edges”. All these provide us good quantities, i.e., the quantum discord and the classical correlation, to reflect mobility edges in these one-dimensional aperiodic single-electron systems. Moreover, our studies propose a consistent interpretation of the discrepancies between previous numerical results about the Soukoulis–Economou model. -- Highlights: ► Quantum discord and classical correlation can signal mobility edges in two models. ► An interpretation for mobility edges in the Soukoulis–Economou model is proposed. ► Quantum discord and classical correlation can reflect well localization properties.

  17. Symbiotic stars

    Science.gov (United States)

    Kafatos, M.; Michalitsianos, A. G.

    1984-01-01

    The physical characteristics of symbiotic star systems are discussed, based on a review of recent observational data. A model of a symbiotic star system is presented which illustrates how a cool red-giant star is embedded in a nebula whose atoms are ionized by the energetic radiation from its hot compact companion. UV outbursts from symbiotic systems are explained by two principal models: an accretion-disk-outburst model which describes how material expelled from the tenuous envelope of the red giant forms an inwardly-spiralling disk around the hot companion, and a thermonuclear-outburst model in which the companion is specifically a white dwarf which superheats the material expelled from the red giant to the point where thermonuclear reactions occur and radiation is emitted. It is suspected that the evolutionary course of binary systems is predetermined by the initial mass and angular momentum of the gas cloud within which binary stars are born. Since red giants and Mira variables are thought to be stars with a mass of one or two solar mass, it is believed that the original cloud from which a symbiotic system is formed can consist of no more than a few solar masses of gas.

  18. Inventory - Dollars and sense

    International Nuclear Information System (INIS)

    Samson, J.R.

    1992-01-01

    Nuclear utilities are becoming more aware of the importance of having an inventory investment that supports two opposing philosophies. The business philosophy wants a minimal inventory investment to support a better return on invested dollars. This increase in return comes from having the dollars available to invest versus having the money tied up in inventory sitting on the shelf. The opposing viewpoint is taken by maintenance/operations organizations, which desire the maximum inventory available on-site to repair any component at any time to keep the units on-line at all times. Financial managers also want to maintain cash flow throughout operations so that plants run without interruptions. Inventory management is therefore a mixture of financial logistics with an operation perspective in mind. A small amount of common sense and accurate perception also help. The challenge to the materials/inventory manager is to optimize effectiveness of the inventory by having high material availability at the lowest possible cost

  19. Dark stars

    DEFF Research Database (Denmark)

    Maselli, Andrea; Pnigouras, Pantelis; Nielsen, Niklas Grønlund

    2017-01-01

    to the formation of compact objects predominantly made of dark matter. Considering both fermionic and bosonic (scalar φ4) equations of state, we construct the equilibrium structure of rotating dark stars, focusing on their bulk properties and comparing them with baryonic neutron stars. We also show that these dark......Theoretical models of self-interacting dark matter represent a promising answer to a series of open problems within the so-called collisionless cold dark matter paradigm. In case of asymmetric dark matter, self-interactions might facilitate gravitational collapse and potentially lead...... objects admit the I-Love-Q universal relations, which link their moments of inertia, tidal deformabilities, and quadrupole moments. Finally, we prove that stars built with a dark matter equation of state are not compact enough to mimic black holes in general relativity, thus making them distinguishable...

  20. Hybrid stars

    Indian Academy of Sciences (India)

    Hybrid stars. AsHOK GOYAL. Department of Physics and Astrophysics, University of Delhi, Delhi 110 007, India. Abstract. Recently there have been important developments in the determination of neutron ... number and the electric charge. ... available to the system to rearrange concentration of charges for a given fraction of.

  1. Pulsating stars

    CERN Document Server

    Catelan, M?rcio

    2014-01-01

    The most recent and comprehensive book on pulsating stars which ties the observations to our present understanding of stellar pulsation and evolution theory.  Written by experienced researchers and authors in the field, this book includes the latest observational results and is valuable reading for astronomers, graduate students, nuclear physicists and high energy physicists.

  2. Variable stars

    International Nuclear Information System (INIS)

    Feast, M.W.; Wenzel, W.; Fernie, J.D.; Percy, J.R.; Smak, J.; Gascoigne, S.C.B.; Grindley, J.E.; Lovell, B.; Sawyer Hogg, H.B.; Baker, N.; Fitch, W.S.; Rosino, L.; Gursky, H.

    1976-01-01

    A critical review of variable stars is presented. A fairly complete summary of major developments and discoveries during the period 1973-1975 is given. The broad developments and new trends are outlined. Essential problems for future research are identified. (B.R.H. )

  3. DISK-RELATED BURSTS AND FADES IN YOUNG STARS

    International Nuclear Information System (INIS)

    Findeisen, Krzysztof; Hillenbrand, Lynne; Levitan, David; Sesar, Branimir; Ofek, Eran; Laher, Russ; Surace, Jason

    2013-01-01

    We present first results from a new, multiyear, time domain survey of young stars in the North America Nebula complex using the Palomar Transient Factory. Our survey is providing an unprecedented view of aperiodic variability in young stars on timescales of days to years. The analyzed sample covers R PTF ≈ 13.5-18 and spans a range of mid-infrared color, with larger-amplitude optical variables (exceeding 0.4 mag root mean squared) more likely to have mid-infrared evidence for circumstellar material. This paper characterizes infrared excess stars with distinct bursts above or fades below a baseline of lower-level variability, identifying 41 examples. The light curves exhibit a remarkable diversity of amplitudes, timescales, and morphologies, with a continuum of behaviors that cannot be classified into distinct groups. Among the bursters, we identify three particularly promising sources that may represent theoretically predicted short-timescale accretion instabilities. Finally, we find that fading behavior is approximately twice as common as bursting behavior on timescales of days to years, although the bursting and fading duty cycle for individual objects often varies from year to year.

  4. Star Products and Applications

    OpenAIRE

    Iida, Mari; Yoshioka, Akira

    2010-01-01

    Star products parametrized by complex matrices are defined. Especially commutative associative star products are treated, and star exponentials with respect to these star products are considered. Jacobi's theta functions are given as infinite sums of star exponentials. As application, several concrete identities are obtained by properties of the star exponentials.

  5. Experimental investigation of the transverse modal instabilities onset in high power fully-aperiodic-large-pitch fiber lasers

    Science.gov (United States)

    Malleville, Marie-Alicia; Benoît, Aurélien; Dauliat, Romain; Leconte, Baptiste; Darwich, Dia; du Jeu, Rémi; Jamier, Raphaël.; Schwuchow, Anka; Schuster, Kay; Roy, Philippe

    2018-02-01

    Over the last decade, significant work has been carried out in order to increase the energy/peak power provided by fiber lasers. Indeed, new microstructured fibers with large (or very large) mode area cores (LMA) such as Distributed Mode Filtering (DMF) fibers and Large-Pitch Fibers (LPF) have been developed to address this concern. These technologies have allowed diffraction-limited emission with core diameters higher than 80 μm, and have state-of-the-art performances in terms of pulse energy or peak power while keeping an excellent spatial beam quality. Although these fibers were designed to reach high power levels while maintaining a single transverse mode propagation, power scaling becomes quickly limited by the onset of transverse modal instabilities (TMI). This effect suddenly arises when a certain average power threshold is exceeded, drastically degrading the emitted beam quality. In this work, we investigate the influence of the core dimensions and the refractive index mismatch between the active core and the background cladding material, on the TMI power threshold in rod-type Fully-Aperiodic-LPF. This fiber structure was specifically designed to enhance the higher-order modes (HOMs) delocalization out of the gain region and thus push further the onset of modal instabilities. Using a 400W pump diode at 976 nm, the power scaling, as well as the spatial beam quality and its temporal behavior were investigated in laser configuration, which theoretically provides a lower TMI power threshold than the amplifier one due to the lack of selective excitation of the fundamental mode.

  6. Short-term variability and mass loss in Be stars. II. Physical taxonomy of photometric variability observed by the Kepler spacecraft

    Science.gov (United States)

    Rivinius, Th.; Baade, D.; Carciofi, A. C.

    2016-09-01

    Context. Classical Be stars have been established as pulsating stars. Space-based photometric monitoring missions contributed significantly to that result. However, whether Be stars are just rapidly rotating SPB or β Cep stars, or whether they have to be understood differently, remains debated in the view of their highly complex power spectra. Aims: Kepler data of three known Be stars are re-visited to establish their pulsational nature and assess the properties of additional, non-pulsational variations. The three program stars turned out to be one inactive Be star, one active, continuously outbursting Be star, and one Be star transiting from a non-outbursting into an outbursting phase, thus forming an excellent sample to distill properties of Be stars in the various phases of their life-cycle. Methods: The Kepler data was first cleaned from any long-term variability with Lomb-Scargle based pre-whitening. Then a Lomb-Scargle analysis of the remaining short-term variations was compared to a wavelet analysis of the cleaned data. This offers a new view on the variability, as it enables us to see the temporal evolution of the variability and phase relations between supposed beating phenomena, which are typically not visualized in a Lomb-Scargle analysis. Results: The short-term photometric variability of Be stars must be disentangled into a stellar and a circumstellar part. The stellar part is on the whole not different from what is seen in non-Be stars. However, some of the observed phenomena might be to be due to resonant mode coupling, a mechanism not typically considered for B-type stars. Short-term circumstellar variability comes in the form of either a group of relatively well-defined, short-lived frequencies during outbursts, which are called Štefl frequencies, and broad bumps in the power spectra, indicating aperiodic variability on a time scale similar to typical low-order g-mode pulsation frequencies, rather than true periodicity. Conclusions: From a

  7. Vendor-managed inventory

    DEFF Research Database (Denmark)

    Govindan, Kannan

    2013-01-01

    Vendor-managed inventory (VMI) represents the methodology through which the upstream stage of a supply chain (vendor) takes responsibility for managing the inventories at the downstream stage (customer) based on previously agreed limits. VMI is another method by which supply chains can be managed...... review, we have identified six dimensions of VMI: namely, inventory, transportation, manufacturing, general benefits, coordination/collaboration, and information sharing. In addition, there are, three methodological classifications: modelling, simulation, and case studies. Finally, we will consider...

  8. National Wetlands Inventory Lines

    Data.gov (United States)

    Minnesota Department of Natural Resources — Linear wetland features (including selected streams, ditches, and narrow wetland bodies) mapped as part of the National Wetlands Inventory (NWI). The National...

  9. Wave Star

    DEFF Research Database (Denmark)

    Kramer, Morten; Frigaard, Peter; Brorsen, Michael

    Nærværende rapport beskriver foreløbige hovedkonklusioner på modelforsøg udført på Aalborg Universitet, Institut for Vand, Jord og Miljøteknik med bølgeenergianlægget Wave Star i perioden 13/9 2004 til 12/11 2004.......Nærværende rapport beskriver foreløbige hovedkonklusioner på modelforsøg udført på Aalborg Universitet, Institut for Vand, Jord og Miljøteknik med bølgeenergianlægget Wave Star i perioden 13/9 2004 til 12/11 2004....

  10. Denmark's National Inventory Report

    DEFF Research Database (Denmark)

    Illerup, J. B.; Lyck, E.; Winther, M.

    This report is Denmark's National Inventory Report reported to the Conference of the Parties under the United Nations Framework Convention on Climate Change (UNFCCC) due by 15 April 2001. The report contains information on Denmark's inventories for all years' from 1990 to 1999 for CO2, CH4, N2O, CO...

  11. Uncertainties in emission inventories

    NARCIS (Netherlands)

    Aardenne, van J.A.

    2002-01-01

    Emission inventories provide information about the amount of a pollutant that is emitted to the atmosphere as a result of a specific anthropogenic or natural process at a given time or place. Emission inventories can be used for either policy or scientific purposes. For

  12. Denmark's National Inventory Report

    DEFF Research Database (Denmark)

    Illerup, J. B.; Lyck, E.; Winther, M.

    This report is Denmark's National Inventory Report reported to the Conference of the Parties under the United Nations Framework Convention on Climate Change (UNFCCC) due by 15 April 2001. The report contains information on Denmark's inventories for all years' from 1990 to 1999 for CO2, CH4, N2O, ......, NMVOC, SO2, HFCs, PFCs and SF6....

  13. Inventory control strategies

    International Nuclear Information System (INIS)

    Primrose, D.

    1998-01-01

    Finning International Inc. is in the business of selling, financing and servicing Caterpillar and complementary equipment. Its main markets are in western Canada, Britain and Chile. This paper discusses the parts inventory strategies system for Finning (Canada). The company's territory covers British Columbia, Alberta, the Yukon and the Northwest Territories. Finning's parts inventory consists of 80,000 component units valued at more than $150 M. Distribution centres are located in Langley, British Columbia and Edmonton, Alberta. To make inventory and orders easier to control, Finning has designed a computer-based system, with software written exclusively for Caterpillar dealers. The system makes use of a real time electronic interface with all Finning locations, plus all Caterpillar facilities and other dealers in North America. Details of the system are discussed, including territorial stocking procedures, addition to stock, exhaustion of stock, automatic/suggest order controls, surplus inventory management, and procedures for jointly managed inventory. 3 tabs., 1 fig

  14. Optimal fuel inventory strategies

    International Nuclear Information System (INIS)

    Caspary, P.J.; Hollibaugh, J.B.; Licklider, P.L.; Patel, K.P.

    1990-01-01

    In an effort to maintain their competitive edge, most utilities are reevaluating many of their conventional practices and policies in an effort to further minimize customer revenue requirements without sacrificing system reliability. Over the past several years, Illinois Power has been rethinking its traditional fuel inventory strategies, recognizing that coal supplies are competitive and plentiful and that carrying charges on inventory are expensive. To help the Company achieve one of its strategic corporate goals, an optimal fuel inventory study was performed for its five major coal-fired generating stations. The purpose of this paper is to briefly describe Illinois Power's system and past practices concerning coal inventories, highlight the analytical process behind the optimal fuel inventory study, and discuss some of the recent experiences affecting coal deliveries and economic dispatch

  15. Inventory Control System by Using Vendor Managed Inventory (VMI)

    OpenAIRE

    Dona Sabila Alzena; Mustafid Mustafid; Suryono Suryono

    2018-01-01

    The inventory control system has a strategic role for the business in managing inventory operations. Management of conventional inventory creates problems in the stock of goods that often runs into vacancies and excess goods at the retail level. This study aims to build inventory control system that can maintain the stability of goods availability at the retail level. The implementation of Vendor Managed Inventory (VMI) method on inventory control system provides transparency of sales data an...

  16. Interactive Inventory Monitoring

    Science.gov (United States)

    Garud, Sumedha

    2013-01-01

    Method and system for monitoring present location and/or present status of a target inventory item, where the inventory items are located on one or more inventory shelves or other inventory receptacles that communicate with an inventory base station through use of responders such as RFIDs. A user operates a hand held interrogation and display (lAD) module that communicates with, or is part of the base station to provide an initial inquiry. lnformation on location(s) of the larget invenlory item is also indicated visibly and/or audibly on the receptacle(s) for the user. Status information includes an assessment of operation readiness and a time, if known, that the specified inventory item or class was last removed or examined or modified. Presentation of a user access level may be required for access to the target inventgory item. Another embodiment provides inventory informatin for a stack as a sight-impaired or hearing-impaired person adjacent to that stack.

  17. SBA Network Components & Software Inventory

    Data.gov (United States)

    Small Business Administration — SBA’s Network Components & Software Inventory contains a complete inventory of all devices connected to SBA’s network including workstations, servers, routers,...

  18. Visuo-manual tracking: does intermittent control with aperiodic sampling explain linear power and non-linear remnant without sensorimotor noise?

    Science.gov (United States)

    Gollee, Henrik; Gawthrop, Peter J; Lakie, Martin; Loram, Ian D

    2017-11-01

    A human controlling an external system is described most easily and conventionally as linearly and continuously translating sensory input to motor output, with the inevitable output remnant, non-linearly related to the input, attributed to sensorimotor noise. Recent experiments show sustained manual tracking involves repeated refractoriness (insensitivity to sensory information for a certain duration), with the temporary 200-500 ms periods of irresponsiveness to sensory input making the control process intrinsically non-linear. This evidence calls for re-examination of the extent to which random sensorimotor noise is required to explain the non-linear remnant. This investigation of manual tracking shows how the full motor output (linear component and remnant) can be explained mechanistically by aperiodic sampling triggered by prediction error thresholds. Whereas broadband physiological noise is general to all processes, aperiodic sampling is associated with sensorimotor decision making within specific frontal, striatal and parietal networks; we conclude that manual tracking utilises such slow serial decision making pathways up to several times per second. The human operator is described adequately by linear translation of sensory input to motor output. Motor output also always includes a non-linear remnant resulting from random sensorimotor noise from multiple sources, and non-linear input transformations, for example thresholds or refractory periods. Recent evidence showed that manual tracking incurs substantial, serial, refractoriness (insensitivity to sensory information of 350 and 550 ms for 1st and 2nd order systems respectively). Our two questions are: (i) What are the comparative merits of explaining the non-linear remnant using noise or non-linear transformations? (ii) Can non-linear transformations represent serial motor decision making within the sensorimotor feedback loop intrinsic to tracking? Twelve participants (instructed to act in three prescribed

  19. National Emission Inventory (NEI)

    Data.gov (United States)

    U.S. Environmental Protection Agency — This data exchange allows states to submit data to the US Environmental Protection Agency's National Emissions Inventory (NEI). NEI is a national database of air...

  20. National Emission Inventory

    Data.gov (United States)

    U.S. Environmental Protection Agency — The National Emission Inventory contains measured, modeled, and estimated data for emissions of all known source categories in the US (stationary sources, fires,...

  1. Toxics Release Inventory (TRI)

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Toxics Release Inventory (TRI) is a dataset compiled by the U.S. Environmental Protection Agency (EPA). It contains information on the release and waste...

  2. Business Process Inventory

    Data.gov (United States)

    Office of Personnel Management — Inventory of maps and descriptions of the business processes of the U.S. Office of Personnel Management (OPM), with an emphasis on the processes of the Office of the...

  3. National Wetlands Inventory Points

    Data.gov (United States)

    Minnesota Department of Natural Resources — Wetland point features (typically wetlands that are too small to be as area features at the data scale) mapped as part of the National Wetlands Inventory (NWI). The...

  4. Asset Inventory Database

    Data.gov (United States)

    US Agency for International Development — AIDM is used to track USAID assets such as furniture, computers, and equipment. Using portable bar code readers, receiving and inventory personnel can capture...

  5. NCRN Hemlock Inventory Data

    Data.gov (United States)

    Department of the Interior — ​Data associated with the 2015 hemlock inventory project in NCR. Eastern hemlock (Tsuga canadensis) is a coniferous tree native to the NE and Appalachian regions of...

  6. Logistics and Inventory System -

    Data.gov (United States)

    Department of Transportation — The Logistics and Inventory System (LIS) is the agencys primary supply/support automation tool. The LIS encompasses everything from order entry by field specialists...

  7. Public Waters Inventory Maps

    Data.gov (United States)

    Minnesota Department of Natural Resources — This theme is a scanned and rectified version of the Minnesota DNR - Division of Waters "Public Waters Inventory" (PWI) maps. DNR Waters utilizes a small scale...

  8. VA Enterprise Data Inventory

    Data.gov (United States)

    Department of Veterans Affairs — The Department of Veterans Affairs Enterprise Data Inventory accounts for all of the datasets used in the agency's information systems. This entry was approved for...

  9. Life of a star

    International Nuclear Information System (INIS)

    Henbest, Nigel.

    1988-01-01

    The paper concerns the theory of stellar evolution. A description is given of:- how a star is born, main sequence stars, red giants, white dwarfs, supernovae, neutron stars and black holes. A brief explanation is given of how the death of a star as a supernova can trigger off the birth of a new generation of stars. Classification of stars and the fate of our sun, are also described. (U.K.)

  10. General Services Administration. STAR-PBS' New Program for Tracking and Managing Real Property

    National Research Council Canada - National Science Library

    King, Ron

    1999-01-01

    STAR is a real estate inventory management software application that maintains data on projects, leases, buildings, and space assignments that is, who is in what space-in an integrated database environment...

  11. O stars and Wolf-Rayet stars

    International Nuclear Information System (INIS)

    Conti, P.S.; Underhill, A.B.; Jordan, S.; Thomas, R.

    1988-01-01

    Basic information is given about O and Wolf-Rayet stars indicating how these stars are defined and what their chief observable properties are. Part 2 of the volume discussed four related themes pertaining to the hottest and most luminous stars. Presented are: an observational overview of the spectroscopic classification and extrinsic properties of O and Wolf-Rayet stars; the intrinsic parameters of luminosity, effective temperature, mass, and composition of the stars, and a discussion of their viability; stellar wind properties; and the related issues concerning the efforts of stellar radiation and wind on the immediate interstellar environment are presented

  12. O stars and Wolf-Rayet stars

    Science.gov (United States)

    Conti, Peter S.; Underhill, Anne B.; Jordan, Stuart (Editor); Thomas, Richard (Editor)

    1988-01-01

    Basic information is given about O and Wolf-Rayet stars indicating how these stars are defined and what their chief observable properties are. Part 2 of the volume discussed four related themes pertaining to the hottest and most luminous stars. Presented are: an observational overview of the spectroscopic classification and extrinsic properties of O and Wolf-Rayet stars; the intrinsic parameters of luminosity, effective temperature, mass, and composition of the stars, and a discussion of their viability; stellar wind properties; and the related issues concerning the efforts of stellar radiation and wind on the immediate interstellar environment are presented.

  13. Hydrogen inventory in gallium

    International Nuclear Information System (INIS)

    Mazayev, S.N.; Prokofiev, Yu.G.

    1994-01-01

    Investigations of hydrogen inventory in gallium (99.9%) were carried out after saturation both from molecular phase and from glow discharge plasma at room temperature, 370 and 520 K. Saturation took place during 3000 s under hydrogen pressure of 20 Pa, and ion flux was about 1x10 15 ions/cm 2 s with an energy about 400 eV during discharge. Hydrogen concentration in Ga at room temperature and that for 370 K by the saturation from gaseous phase was (2-3)x10 14 cm -3 Pa -1/2 . Hydrogen concentration at temperature 520 K increased by five times. Inventory at room temperature for irradiation from discharge was 7x10 16 cm -3 at the dose about 3x10 18 ions/cm 2 . It was more than inventory at temperature 520 K by four times and more than maximum inventory from gaseous phase at 520 K by a factor of 10. Inventory increased when temperature decreased. Diffusion coefficient D=0.003 exp(-2300/RT) cm 2 /s, was estimated from temperature dependence. ((orig.))

  14. Nuclear materials inventory plan

    International Nuclear Information System (INIS)

    Doerr, R.W.; Nichols, D.H.

    1982-03-01

    In any processing, manufacturing, or active storage facility it is impractical to assume that any physical security system can prevent the diversion of Special Nuclear Material (SNM). It is, therefore, the responsibility of any DOE Contractor, Licensee, or other holder of SNM to provide assurance that loss or diversion of a significant quantity of SNM is detectable. This ability to detect must be accomplishable within a reasonable time interval and can be accomplished only by taking physical inventories. The information gained and decisions resulting from these inventories can be no better than the SNM accounting system and the quality of measurements performed for each receipt, removal and inventory. Inventories interrupt processing or production operations, increase personnel exposures, and can add significantly to the cost of any operation. Therefore, realistic goals for the inventory must be defined and the relationship of the inherent parameters used in its validation be determined. Purpose of this document is to provide a statement of goals and a plan of action to achieve them

  15. Egyptian "Star Clocks"

    Science.gov (United States)

    Symons, Sarah

    Diagonal, transit, and Ramesside star clocks are tables of astronomical information occasionally found in ancient Egyptian temples, tombs, and papyri. The tables represent the motions of selected stars (decans and hour stars) throughout the Egyptian civil year. Analysis of star clocks leads to greater understanding of ancient Egyptian constellations, ritual astronomical activities, observational practices, and pharaonic chronology.

  16. MAGNETIC FIELDS OF STARS

    OpenAIRE

    Bychkov, V. D.; Bychkova, L. V.; Madej, J.

    2008-01-01

    Now it is known about 1212 stars of the main sequence and giants (from them 610 stars - it is chemically peculiarity (CP) stars) for which direct measurements of magnetic fields were spent (Bychkov et al.,2008). Let's consider, what representations were generated about magnetic fields (MT) of stars on the basis of available observations data.

  17. Fukushima Daiichi Radionuclide Inventories

    Energy Technology Data Exchange (ETDEWEB)

    Cardoni, Jeffrey N. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Jankovsky, Zachary Kyle [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2016-09-01

    Radionuclide inventories are generated to permit detailed analyses of the Fukushima Daiichi meltdowns. This is necessary information for severe accident calculations, dose calculations, and source term and consequence analyses. Inventories are calculated using SCALE6 and compared to values predicted by international researchers supporting the OECD/NEA's Benchmark Study on the Accident at Fukushima Daiichi Nuclear Power Station (BSAF). Both sets of inventory information are acceptable for best-estimate analyses of the Fukushima reactors. Consistent nuclear information for severe accident codes, including radionuclide class masses and core decay powers, are also derived from the SCALE6 analyses. Key nuclide activity ratios are calculated as functions of burnup and nuclear data in order to explore the utility for nuclear forensics and support future decommissioning efforts.

  18. Shortening the Xerostomia Inventory

    Science.gov (United States)

    Thomson, William Murray; van der Putten, Gert-Jan; de Baat, Cees; Ikebe, Kazunori; Matsuda, Ken-ichi; Enoki, Kaori; Hopcraft, Matthew; Ling, Guo Y

    2011-01-01

    Objectives To determine the validity and properties of the Summated Xerostomia Inventory-Dutch Version in samples from Australia, The Netherlands, Japan and New Zealand. Study design Six cross-sectional samples of older people from The Netherlands (N = 50), Australia (N = 637 and N = 245), Japan (N = 401) and New Zealand (N = 167 and N = 86). Data were analysed using the Summated Xerostomia Inventory-Dutch Version. Results Almost all data-sets revealed a single extracted factor which explained about half of the variance, with Cronbach’s alpha values of at least 0.70. When mean scale scores were plotted against a “gold standard” xerostomia question, statistically significant gradients were observed, with the highest score seen in those who always had dry mouth, and the lowest in those who never had it. Conclusion The Summated Xerostomia Inventory-Dutch Version is valid for measuring xerostomia symptoms in clinical and epidemiological research. PMID:21684773

  19. Compact stars

    Science.gov (United States)

    Estevez-Delgado, Gabino; Estevez-Delgado, Joaquin

    2018-05-01

    An analysis and construction is presented for a stellar model characterized by two parameters (w, n) associated with the compactness ratio and anisotropy, respectively. The reliability range for the parameter w ≤ 1.97981225149 corresponds with a compactness ratio u ≤ 0.2644959374, the density and pressures are positive, regular and monotonic decrescent functions, the radial and tangential speed of sound are lower than the light speed, moreover, than the plausible stability. The behavior of the speeds of sound are determinate for the anisotropy parameter n, admitting a subinterval where the speeds are monotonic crescent functions and other where we have monotonic decrescent functions for the same speeds, both cases describing a compact object that is also potentially stable. In the bigger value for the observational mass M = 2.05 M⊙ and radii R = 12.957 Km for the star PSR J0348+0432, the model indicates that the maximum central density ρc = 1.283820319 × 1018 Kg/m3 corresponds to the maximum value of the anisotropy parameter and the radial and tangential speed of the sound are monotonic decrescent functions.

  20. Neutron Stars and NuSTAR

    Science.gov (United States)

    Bhalerao, Varun

    2012-05-01

    My thesis centers around the study of neutron stars, especially those in massive binary systems. To this end, it has two distinct components: the observational study of neutron stars in massive binaries with a goal of measuring neutron star masses and participation in NuSTAR, the first imaging hard X-ray mission, one that is extremely well suited to the study of massive binaries and compact objects in our Galaxy. The Nuclear Spectroscopic Telescope Array (NuSTAR) is a NASA Small Explorer mission that will carry the first focusing high energy X-ray telescope to orbit. NuSTAR has an order-of-magnitude better angular resolution and has two orders of magnitude higher sensitivity than any currently orbiting hard X-ray telescope. I worked to develop, calibrate, and test CdZnTe detectors for NuSTAR. I describe the CdZnTe detectors in comprehensive detail here - from readout procedures to data analysis. Detailed calibration of detectors is necessary for analyzing astrophysical source data obtained by the NuSTAR. I discuss the design and implementation of an automated setup for calibrating flight detectors, followed by calibration procedures and results. Neutron stars are an excellent probe of fundamental physics. The maximum mass of a neutron star can put stringent constraints on the equation of state of matter at extreme pressures and densities. From an astrophysical perspective, there are several open questions in our understanding of neutron stars. What are the birth masses of neutron stars? How do they change in binary evolution? Are there multiple mechanisms for the formation of neutron stars? Measuring masses of neutron stars helps answer these questions. Neutron stars in high-mass X-ray binaries have masses close to their birth mass, providing an opportunity to disentangle the role of "nature" and "nurture" in the observed mass distributions. In 2006, masses had been measured for only six such objects, but this small sample showed the greatest diversity in masses

  1. Purchasing and inventory management techniques for optimizing inventory investment

    International Nuclear Information System (INIS)

    McFarlane, I.; Gehshan, T.

    1993-01-01

    In an effort to reduce operations and maintenance costs among nuclear plants, many utilities are taking a closer look at their inventory investment. Various approaches for inventory reduction have been used and discussed, but these approaches are often limited to an inventory management perspective. Interaction with purchasing and planning personnel to reduce inventory investment is a necessity in utility efforts to become more cost competitive. This paper addresses the activities that purchasing and inventory management personnel should conduct in an effort to optimize inventory investment while maintaining service-level goals. Other functions within a materials management organization, such as the warehousing and investment recovery functions, can contribute to optimizing inventory investment. However, these are not addressed in this paper because their contributions often come after inventory management and purchasing decisions have been made

  2. Rapid inventory taking system

    International Nuclear Information System (INIS)

    Marsden, P.S.S.F.

    1980-01-01

    A data processing system designed to facilitate inventory taking is described. The process depends upon the earliest possible application of computer techniques and the elimination of manual operations. Data is recorded in optical character recognition (OCR) 'A' form and read by a hand held wand reader. Limited validation checks are applied before recording on mini-tape cassettes. 5 refs

  3. Experimental inventory verification system

    International Nuclear Information System (INIS)

    Steverson, C.A.; Angerman, M.I.

    1991-01-01

    As Low As Reasonably Achievable (ALARA) goals and Department of Energy (DOE) inventory requirements are frequently in conflict at facilities across the DOE complex. The authors wish, on one hand, to verify the presence of correct amounts of nuclear materials that are in storage or in process; yet on the other hand, we wish to achieve ALARA goals by keeping individual and collective exposures as low as social, technical, economic, practical, and public policy considerations permit. The Experimental Inventory Verification System (EIVSystem) is a computer-based, camera-driven system that utilizes image processing technology to detect change in vault areas. Currently in the test and evaluation phase at Idaho National Engineering Laboratory, this system guards personnel. The EIVSystem continually monitors the vault, providing proof of changed status for objects sorted within the vault. This paper reports that these data could provide the basis for reducing inventory requirements when no change has occurred, thus helping implement ALARA policy; the data will also help describe there target area of an inventory when change has been shown to occur

  4. Marine Education Knowledge Inventory.

    Science.gov (United States)

    Hounshell, Paul B.; Hampton, Carolyn

    This 35-item, multiple-choice Marine Education Knowledge Inventory was developed for use in upper elementary/middle schools to measure a student's knowledge of marine science. Content of test items is drawn from oceanography, ecology, earth science, navigation, and the biological sciences (focusing on marine animals). Steps in the construction of…

  5. Calculating Optimal Inventory Size

    Directory of Open Access Journals (Sweden)

    Ruby Perez

    2010-01-01

    Full Text Available The purpose of the project is to find the optimal value for the Economic Order Quantity Model and then use a lean manufacturing Kanban equation to find a numeric value that will minimize the total cost and the inventory size.

  6. Life Cycle Inventory Analysis

    DEFF Research Database (Denmark)

    Bjørn, Anders; Moltesen, Andreas; Laurent, Alexis

    2018-01-01

    of different sources. The output is a compiled inventory of elementary flows that is used as basis of the subsequent life cycle impact assessment phase. This chapter teaches how to carry out this task through six steps: (1) identifying processes for the LCI model of the product system; (2) planning...

  7. The Danish CORINAIR Inventories

    DEFF Research Database (Denmark)

    Winther, M.; Illerup, J. B.; Fenhann, J.

    CORINAIR is the most comprehensive European air emission inventory programme. It consists of a defined emission calculation methodology and software for storing and further data processing. In CORINAIR 28 different emission species are estimated in 11 main sectors which are further sub-divided, a...

  8. Shortening the xerostomia inventory

    NARCIS (Netherlands)

    Thomson, W.M.; Putten, G.J. van der; Baat, C. de; Ikebe, K.; Matsuda, K.; Enoki, K.; Hopcraft, M.S.; Ling, G.Y.

    2011-01-01

    OBJECTIVES: The aim of this study was to determine the validity and properties of the Summated Xerostomia Inventory-Dutch Version in samples from Australia, The Netherlands, Japan, and New Zealand. STUDY DESIGN: Six cross-sectional samples of older people from The Netherlands (n = 50), Australia (n

  9. Student Attitude Inventory - 1971.

    Science.gov (United States)

    Gillmore, Gerald M.; Aleamoni, Lawrence M.

    This 42-item Student Attitude Inventory (SAI) was administered to entering college freshmen at the University of Illinois (see TM 001 015). The SAI items are divided into nine categories on the basis of content as follows: voting behavior, drug usage, financial, Viet Nam war, education, religious behavior, pollution, housing, and alienation. A…

  10. Initial Radionuclide Inventories

    Energy Technology Data Exchange (ETDEWEB)

    H. Miller

    2004-09-19

    The purpose of this analysis is to provide an initial radionuclide inventory (in grams per waste package) and associated uncertainty distributions for use in the Total System Performance Assessment for the License Application (TSPA-LA) in support of the license application for the repository at Yucca Mountain, Nevada. This document is intended for use in postclosure analysis only. Bounding waste stream information and data were collected that capture probable limits. For commercially generated waste, this analysis considers alternative waste stream projections to bound the characteristics of wastes likely to be encountered using arrival scenarios that potentially impact the commercial spent nuclear fuel (CSNF) waste stream. For TSPA-LA, this radionuclide inventory analysis considers U.S. Department of Energy (DOE) high-level radioactive waste (DHLW) glass and two types of spent nuclear fuel (SNF): CSNF and DOE-owned (DSNF). These wastes are placed in two groups of waste packages: the CSNF waste package and the codisposal waste package (CDSP), which are designated to contain DHLW glass and DSNF, or DHLW glass only. The radionuclide inventory for naval SNF is provided separately in the classified ''Naval Nuclear Propulsion Program Technical Support Document'' for the License Application. As noted previously, the radionuclide inventory data presented here is intended only for TSPA-LA postclosure calculations. It is not applicable to preclosure safety calculations. Safe storage, transportation, and ultimate disposal of these wastes require safety analyses to support the design and licensing of repository equipment and facilities. These analyses will require radionuclide inventories to represent the radioactive source term that must be accommodated during handling, storage and disposition of these wastes. This analysis uses the best available information to identify the radionuclide inventory that is expected at the last year of last emplacement

  11. Giant CP stars

    International Nuclear Information System (INIS)

    Loden, L.O.; Sundman, A.

    1989-01-01

    This study is part of an investigation of the possibility of using chemically peculiar (CP) stars to map local galactic structure. Correct luminosities of these stars are therefore crucial. CP stars are generally regarded as main-sequence or near-main-sequence objects. However, some CP stars have been classified as giants. A selection of stars, classified in literature as CP giants, are compared to normal stars in the same effective temperature interval and to ordinary 'non giant' CP stars. There is no clear confirmation of a higher luminosity for 'CP giants', than for CP stars in general. In addition, CP characteristics seem to be individual properties not repeated in a component star or other cluster members. (author). 50 refs., 5 tabs., 3 figs

  12. Rates of star formation

    International Nuclear Information System (INIS)

    Larson, R.B.

    1977-01-01

    It is illustrated that a theoretical understanding of the formation and evolution of galaxies depends on an understanding of star formation, and especially of the factors influencing the rate of star formation. Some of the theoretical problems of star formation in galaxies, some approaches that have been considered in models of galaxy evolution, and some possible observational tests that may help to clarify which processes or models are most relevant are reviewed. The material is presented under the following headings: power-law models for star formation, star formation processes (conditions required, ways of achieving these conditions), observational indications and tests, and measures of star formation rates in galaxies. 49 references

  13. Energy production in stars

    International Nuclear Information System (INIS)

    Bethe, Hans.

    1977-01-01

    Energy in stars is released partly by gravitation, partly by nuclear reactions. For ordinary stars like our sun, nuclear reactions predominate. However, at the end of the life of a star very large amounts of energy are released by gravitational collapse; this can amount to as much as 10 times the total energy released nuclear reactions. The rotational energy of pulsars is a small remnant of the energy of gravitation. The end stage of small stars is generally a white dwarf, of heavy stars a neutron star of possibly a black hole

  14. Denmark's National Inventory Report 2010

    DEFF Research Database (Denmark)

    Nielsen, Ole-Kenneth; Lyck, Erik; Mikkelsen, Mette Hjorth

    2010-01-01

    This report is Denmark's National Inventory Report 2010. The report contains information on Denmark's emission inventories for all years' from 1990 to 2008 for CO2, CH4, N2O, HFCs, PFCs and SF6, NOx, CO, NMVOC, SO2.......This report is Denmark's National Inventory Report 2010. The report contains information on Denmark's emission inventories for all years' from 1990 to 2008 for CO2, CH4, N2O, HFCs, PFCs and SF6, NOx, CO, NMVOC, SO2....

  15. Regular Generalized Star Star closed sets in Bitopological Spaces

    OpenAIRE

    K. Kannan; D. Narasimhan; K. Chandrasekhara Rao; R. Ravikumar

    2011-01-01

    The aim of this paper is to introduce the concepts of τ1τ2-regular generalized star star closed sets , τ1τ2-regular generalized star star open sets and study their basic properties in bitopological spaces.

  16. Procedure for taking physical inventories

    International Nuclear Information System (INIS)

    Anon.

    1981-01-01

    This session is intended to apprise one of the various aspects of procedures and routines that Exxon Nuclear uses with respect to its nuclear materials physical inventory program. The presentation describes how plant physical inventories are planned and taken. The description includes the planning and preparation for taking the inventory, the clean-out procedures for converting in-process material to measurable items, the administrative procedures for establishing independent inventory teams and for inventorying each inventory area, the verification procedures used to include previously measured tamper-safed items in the inventory, and lastly, procedures used to reconcile the inventory and calculate MUF (materials unaccounted for). The purpose of the session is to enable participants to: (1) understand the planning and pre-inventorty procedures and their importance; (2) understand the need for and the required intensity of clean-out procedures; (3) understand how inventory teams are formed, and how the inventory is conducted; (4) understand the distinction between inventory previously measured tamper-safed items and other materials not so characterized; (5) understand the reconciliation procedures; and (6) calculate a MUF given the book and inventory results

  17. Inventory Control System by Using Vendor Managed Inventory (VMI

    Directory of Open Access Journals (Sweden)

    Dona Sabila Alzena

    2018-01-01

    Full Text Available The inventory control system has a strategic role for the business in managing inventory operations. Management of conventional inventory creates problems in the stock of goods that often runs into vacancies and excess goods at the retail level. This study aims to build inventory control system that can maintain the stability of goods availability at the retail level. The implementation of Vendor Managed Inventory (VMI method on inventory control system provides transparency of sales data and inventory of goods at retailer level to supplier. Inventory control is performed by calculating safety stock and reorder point of goods based on sales data received by the system. Rule-based reasoning is provided on the system to facilitate the monitoring of inventory status information, thereby helping the process of inventory updates appropriately. Utilization of SMS technology is also considered as a medium of collecting sales data in real-time due to the ease of use. The results of this study indicate that inventory control using VMI ensures the availability of goods ± 70% and can reduce the accumulation of goods ± 30% at the retail level.

  18. Inventory Control System by Using Vendor Managed Inventory (VMI)

    Science.gov (United States)

    Sabila, Alzena Dona; Mustafid; Suryono

    2018-02-01

    The inventory control system has a strategic role for the business in managing inventory operations. Management of conventional inventory creates problems in the stock of goods that often runs into vacancies and excess goods at the retail level. This study aims to build inventory control system that can maintain the stability of goods availability at the retail level. The implementation of Vendor Managed Inventory (VMI) method on inventory control system provides transparency of sales data and inventory of goods at retailer level to supplier. Inventory control is performed by calculating safety stock and reorder point of goods based on sales data received by the system. Rule-based reasoning is provided on the system to facilitate the monitoring of inventory status information, thereby helping the process of inventory updates appropriately. Utilization of SMS technology is also considered as a medium of collecting sales data in real-time due to the ease of use. The results of this study indicate that inventory control using VMI ensures the availability of goods ± 70% and can reduce the accumulation of goods ± 30% at the retail level.

  19. STARDUST FROM ASYMPTOTIC GIANT BRANCH STARS

    International Nuclear Information System (INIS)

    Gail, H.-P.; Zhukovska, S. V.; Hoppe, P.; Trieloff, M.

    2009-01-01

    The formation of dust in the outflows of low- and intermediate-mass stars on the first giant branch and asymptotic giant branch (AGB) is studied and the relative contributions of stars of different initial masses and metallicities to the interstellar medium (ISM) at the instant of solar system formation are derived. These predictions are compared with the characteristics of the parent stars of presolar dust grains found in primitive meteorites and interplanetary dust particles (IDPs) inferred from their isotopic compositions. For this purpose, model calculations for dust condensation in stellar outflows are combined with synthetic models of stellar evolution on the first giant branch and AGB and an evolution model of the Milky Way for the solar neighborhood. The dust components considered are olivine, pyroxene, carbon, SiC, and iron. The corresponding dust production rates are derived for the solar vicinity. From these rates and taking into account dust destruction by supernova shocks in the ISM, the contributions to the inventory of presolar dust grains in the solar system are derived for stars of different initial masses and metallicities. It is shown that stars on the first giant branch and the early AGB are not expected to form dust, in accord with astronomical observations. Dust formation is concentrated in the last phase of evolution, the thermally pulsing AGB. Due to the limited lifetime of dust grains in the ISM only parent stars from a narrow range of metallicities are expected to contribute to the population of presolar dust grains. Silicate and silicon carbide dust grains are predicted to come from parent stars with metallicities not less than about Z ∼ 0.008 (0.6 x solar). This metallicity limit is higher than that inferred from presolar SiC grain isotope data. The population of presolar carbon dust grains is predicted to originate from a wider range of metallicities, down to Z ∼ 0.004. Masses of AGB stars that produce C-rich dust are in the range

  20. Quark core stars, quark stars and strange stars

    International Nuclear Information System (INIS)

    Grassi, F.

    1988-01-01

    A recent one flavor quark matter equation of state is generalized to several flavors. It is shown that quarks undergo a first order phase transition. In addition, this equation of state depends on just one parameter in the two flavor case, two parameters in the three flavor case, and these parameters are constrained by phenomenology. This equation of state is then applied to the hadron-quark transition in neutron stars and the determination of quark star stability, the investigation of strange matter stability and possible strange star existence. 43 refs., 6 figs

  1. National Biological Monitoring Inventory

    International Nuclear Information System (INIS)

    Burgess, R.L.

    1979-01-01

    The National Biological Monitoring Inventory, initiated in 1975, currently consists of four computerized data bases and voluminous manual files. MAIN BIOMON contains detailed information on 1,021 projects, while MINI BIOMON provides skeletal data for over 3,000 projects in the 50 states, Puerto Rico, the Virgin Islands, plus a few in Canada and Mexico. BIBLIO BIOMON and DIRECTORY BIOMON complete the computerized data bases. The structure of the system provides for on-line search capabilities to generate details of agency sponsorship, indications of funding levels, taxonomic and geographic coverage, length of program life, managerial focus or emphasis, and condition of the data. Examples of each of these are discussed and illustrated, and potential use of the Inventory in a variety of situations is emphasized

  2. ENERGY STAR Certified Displays

    Data.gov (United States)

    U.S. Environmental Protection Agency — Certified models meet all ENERGY STAR requirements as listed in the Version 7.0 ENERGY STAR Program Requirements for Displays that are effective as of July 1, 2016....

  3. ENERGY STAR Certified Boilers

    Data.gov (United States)

    U.S. Environmental Protection Agency — Certified models meet all ENERGY STAR requirements as listed in the Version 3.0 ENERGY STAR Program Requirements for Boilers that are effective as of October 1,...

  4. ENERGY STAR Certified Televisions

    Data.gov (United States)

    U.S. Environmental Protection Agency — Certified models meet all ENERGY STAR requirements as listed in the Version 7.0 ENERGY STAR Program Requirements for Televisions that are effective as of October 30,...

  5. ENERGY STAR Certified Dehumidifiers

    Data.gov (United States)

    U.S. Environmental Protection Agency — Certified models meet all ENERGY STAR requirements as listed in the Version 4.0 ENERGY STAR Program Requirements for Dehumidifiers that are effective as of October...

  6. Observations of central stars

    International Nuclear Information System (INIS)

    Lutz, J.H.

    1978-01-01

    Difficulties occurring in the observation of central stars of planetary nebulae are reviewed with emphasis on spectral classifications and population types, and temperature determination. Binary and peculiar central stars are discussed. (U.M.G.)

  7. ENERGY STAR Certified Telephones

    Data.gov (United States)

    U.S. Environmental Protection Agency — Certified models meet all ENERGY STAR requirements as listed in the Version 3.0 ENERGY STAR Program Requirements for Telephony (cordless telephones and VoIP...

  8. Wolf-Rayet stars

    Energy Technology Data Exchange (ETDEWEB)

    Sahade, J

    1981-12-01

    Aspects of the problems of the Wolf-Rayet stars related to their chemical composition, their evolutionary status, and their apparent dichotomy in two spectral sequences are discussed. Dogmas concerning WR stars are critically discussed, including the belief that WR stars lack hydrogen, that they are helium stars evolved from massive close binaries, and the existence of a second WR stage in which the star is a short-period single-lined binary. The relationship of WR stars with planetary nebulae is addressed, as is the membership of these stars in clusters and associations. The division of WR stars into WN and WC sequences is considered, questioning the reasonability of accounting for WR line formation in terms of abundance differences.

  9. Star formation: Cosmic feast

    Science.gov (United States)

    Scaringi, Simone

    2017-03-01

    Low-mass stars form through a process known as disk accretion, eating up material that orbits in a disk around them. It turns out that the same mechanism also describes the formation of more massive stars.

  10. Resolving inventory differences

    International Nuclear Information System (INIS)

    Weber, J.H.; Clark, J.P.

    1991-01-01

    Determining the cause of an inventory difference (ID) that exceeds warning or alarm limits should not only involve investigation into measurement methods and reexamination of the model assumptions used in the calculation of the limits, but also result in corrective actions that improve the quality of the accountability measurements. An example illustrating methods used by Savannah River Site (SRS) personnel to resolve an ID is presented that may be useful to other facilities faced with a similar problem. After first determining that no theft or diversion of material occurred and correcting any accountability calculation errors, investigation into the IDs focused on volume and analytical measurements, limit of error of inventory difference (LEID) modeling assumptions, and changes in the measurement procedures and methods prior to the alarm. There had been a gradual gain trend in IDs prior to the alarm which was reversed by the alarm inventory. The majority of the NM in the facility was stored in four large tanks which helped identify causes for the alarm. The investigation, while indicating no diversion or theft, resulted in changes in the analytical method and in improvements in the measurement and accountability that produced a 67% improvement in the LEID

  11. Procedure for taking physical inventories

    International Nuclear Information System (INIS)

    Boston, R.A.

    1984-01-01

    Physical inventories are taken periodically to meet Company, State and IAEA requirements. Those physical inventories may be verified by IAEA and/or State inspectors. This presentation describes in an introductory but detailed manner the approaches and procedures used in planning, preparing, conducting, reconciling and reporting physical inventories for the Model Plant. Physical inventories are taken for plant accounting purposes to provide an accurate basis for starting and closing the plant material balance. Physical inventories are also taken for safeguards purposes to provide positive assurance that the nuclear materials of concern are indeed present and accounted for

  12. Autonomous Star Tracker Algorithms

    DEFF Research Database (Denmark)

    Betto, Maurizio; Jørgensen, John Leif; Kilsgaard, Søren

    1998-01-01

    Proposal, in response to an ESA R.f.P., to design algorithms for autonomous star tracker operations.The proposal also included the development of a star tracker breadboard to test the algorithms performances.......Proposal, in response to an ESA R.f.P., to design algorithms for autonomous star tracker operations.The proposal also included the development of a star tracker breadboard to test the algorithms performances....

  13. Covering tree with stars

    DEFF Research Database (Denmark)

    Baumbach, Jan; Guo, Jian-Ying; Ibragimov, Rashid

    2013-01-01

    We study the tree edit distance problem with edge deletions and edge insertions as edit operations. We reformulate a special case of this problem as Covering Tree with Stars (CTS): given a tree T and a set of stars, can we connect the stars in by adding edges between them such that the resulting ...

  14. America's Star Libraries

    Science.gov (United States)

    Lyons, Ray; Lance, Keith Curry

    2009-01-01

    "Library Journal"'s new national rating of public libraries, the "LJ" Index of Public Library Service, identifies 256 "star" libraries. It rates 7,115 public libraries. The top libraries in each group get five, four, or three Michelin guide-like stars. All included libraries, stars or not, can use their scores to learn from their peers and improve…

  15. White Dwarf Stars

    OpenAIRE

    Kepler, S. O.; Romero, Alejandra Daniela; Pelisoli, Ingrid; Ourique, Gustavo

    2017-01-01

    White dwarf stars are the final stage of most stars, born single or in multiple systems. We discuss the identification, magnetic fields, and mass distribution for white dwarfs detected from spectra obtained by the Sloan Digital Sky Survey up to Data Release 13 in 2016, which lead to the increase in the number of spectroscopically identified white dwarf stars from 5000 to 39000. This number includes only white dwarf stars with log g >= 6.5 stars, i.e., excluding the Extremely Low Mass white dw...

  16. Rotating Stars in Relativity

    Directory of Open Access Journals (Sweden)

    Stergioulas Nikolaos

    2003-01-01

    Full Text Available Rotating relativistic stars have been studied extensively in recent years, both theoretically and observationally, because of the information they might yield about the equation of state of matter at extremely high densities and because they are considered to be promising sources of gravitational waves. The latest theoretical understanding of rotating stars in relativity is reviewed in this updated article. The sections on the equilibrium properties and on the nonaxisymmetric instabilities in f-modes and r-modes have been updated and several new sections have been added on analytic solutions for the exterior spacetime, rotating stars in LMXBs, rotating strange stars, and on rotating stars in numerical relativity.

  17. Nuclear physics of stars

    CERN Document Server

    Iliadis, Christian

    2015-01-01

    Most elements are synthesized, or ""cooked"", by thermonuclear reactions in stars. The newly formed elements are released into the interstellar medium during a star's lifetime, and are subsequently incorporated into a new generation of stars, into the planets that form around the stars, and into the life forms that originate on the planets. Moreover, the energy we depend on for life originates from nuclear reactions that occur at the center of the Sun. Synthesis of the elements and nuclear energy production in stars are the topics of nuclear astrophysics, which is the subject of this book

  18. Evolution of variable stars

    International Nuclear Information System (INIS)

    Becker, S.A.

    1986-08-01

    Throughout the domain of the H R diagram lie groupings of stars whose luminosity varies with time. These variable stars can be classified based on their observed properties into distinct types such as β Cephei stars, δ Cephei stars, and Miras, as well as many other categories. The underlying mechanism for the variability is generally felt to be due to four different causes: geometric effects, rotation, eruptive processes, and pulsation. In this review the focus will be on pulsation variables and how the theory of stellar evolution can be used to explain how the various regions of variability on the H R diagram are populated. To this end a generalized discussion of the evolutionary behavior of a massive star, an intermediate mass star, and a low mass star will be presented. 19 refs., 1 fig., 1 tab

  19. Inventory of armourstone

    Directory of Open Access Journals (Sweden)

    Le Turdu Valéry

    2016-01-01

    Full Text Available Natural armourstone is widely used for hydraulic works, both in the coastal domain and in border of rivers and torrents, especially to protect against flood and the effects of waves and currents. To meet the expectations associated with this resource, an inventory of armourstone quarries was realized on a national scale in France. This inventory informs not only about the localization of quarries but also about the quality and the availability of materials. To fully optimize this inventory in a dynamic format, the association of all actors of the sector was preferred to archival research. This partnership approach led to project deliverables that can constitute durably a shared reference. The database can indeed be updated regularly thanks to the contacts established with the professionals of quarries. The access to this database is offered to a wide public: maritime and fluvial ports, local authorities in charge of planning and managing structures that protect against flood and other hydraulic hazards. This new database was organized considering its importance on the operational plan. This led to a hierarchical organization at two levels for each quarry face: first level, a synthesis sheet brings the essential information to realize choices upstream to the operational phases. Second level, a detailed specification sheet presents the technical characteristics observed in the past on the considered face. The atlas has two information broadcasting formats: a pdf file with browsing functions and a geographical information system that allows remote request of the database. These two media have their own updating rhythms, annual for the first and continue for the second.

  20. Perishable Inventory Challenges

    DEFF Research Database (Denmark)

    Damgaard, Cecilie Maria; Nguyen, Vivi Thuy; Hvolby, Hans-Henrik

    2012-01-01

    in the retail supply chains. The goal is to find and evaluate the parameters which affect the decision making process, when finding the optimal order quantity and order time. The paper takes a starting point in the retail industry but links to other industries.......The paper investigates how inventory control of perishable items is managed and line up some possible options of improvement. This includes a review of relevant literature dealing with the challenges of determining ordering policies for perishable products and a study of how the current procedures...

  1. Star-Branched Polymers (Star Polymers)

    KAUST Repository

    Hirao, Akira; Hayashi, Mayumi; Ito, Shotaro; Goseki, Raita; Higashihara, Tomoya; Hadjichristidis, Nikolaos

    2015-01-01

    The synthesis of well-defined regular and asymmetric mixed arm (hereinafter miktoarm) star-branched polymers by the living anionic polymerization is reviewed in this chapter. In particular, much attention is being devoted to the synthetic

  2. Energy Education Materials Inventory

    Energy Technology Data Exchange (ETDEWEB)

    1979-08-01

    The two volumes of the Energy Education Materials Inventory (EEMI) comprise an annotated bibliography of widely available energy education materials and reference sources. This systematic listing is designed to provide a source book which will facilitate access to these educational resources and hasten the inclusion of energy-focused learning experiences in kindergarten through grade twelve. EEMI Volume II expands Volume I and contains items that have become available since its completion in May, 1976. The inventory consists of three major parts. A core section entitled Media contains titles and descriptive information on educational materials, categorized according to medium. The other two major sections - Grade Level and Subject - are cross indexes of the items for which citations appear in the Media Section. These contain titles categorized according to grade level and subject and show the page numbers of the full citations. The general subject area covered includes the following: alternative energy sources (wood, fuel from organic wastes, geothermal energy, nuclear power, solar energy, tidal power, wind energy); energy conservation, consumption, and utilization; energy policy and legislation, environmental/social aspects of energy technology; and fossil fuels (coal, natural gas, petroleum). (RWR)

  3. NRC inventory of dams

    International Nuclear Information System (INIS)

    Lear, G.E.; Thompson, O.O.

    1983-01-01

    The NRC Inventory of Dams has been prepared as required by the charter of the NRC Dam Safety Officer. The inventory lists 51 dams associated with nuclear power plant sites and 14 uranium mill tailings dams (licensed by NRC) in the US as of February 1, 1982. Of the 85 listed nuclear power plants (148 units), 26 plants obtain cooling water from impoundments formed by dams. The 51 dams associated with the plants are: located on a plant site (29 dams at 15 plant sites); located off site but provide plant cooling water (18 dams at 11 additional plant sites); and located upstream from a plant (4 dams) - they have been identified as dams whose failure, and ensuing plant flooding, could result in a radiological risk to the public health and safety. The dams that might be considered NRC's responsibility in terms of the federal dam safety program are identified. This group of dams (20 on nuclear power plant sites and 14 uranium mill tailings dams) was obtained by eliminating dams that do not pose a flooding hazard (e.g., submerged dams) and dams that are regulated by another federal agency. The report includes the principal design features of all dams and related useful information

  4. Strategic Inventories in Vertical Contracts

    OpenAIRE

    Krishnan Anand; Ravi Anupindi; Yehuda Bassok

    2008-01-01

    Classical reasons for carrying inventory include fixed (nonlinear) production or procurement costs, lead times, nonstationary or uncertain supply/demand, and capacity constraints. The last decade has seen active research in supply chain coordination focusing on the role of incentive contracts to achieve first-best levels of inventory. An extensive literature in industrial organization that studies incentives for vertical controls largely ignores the effect of inventories. Does the ability to ...

  5. Star-Branched Polymers (Star Polymers)

    KAUST Repository

    Hirao, Akira

    2015-09-01

    The synthesis of well-defined regular and asymmetric mixed arm (hereinafter miktoarm) star-branched polymers by the living anionic polymerization is reviewed in this chapter. In particular, much attention is being devoted to the synthetic development of miktoarm star polymers since 2000. At the present time, the almost all types of multiarmed and multicomponent miktoarm star polymers have become feasible by using recently developed iterative strategy. For example, the following well-defined stars have been successfully synthesized: 3-arm ABC, 4-arm ABCD, 5-arm ABCDE, 6-arm ABCDEF, 7-arm ABCDEFG, 6-arm ABC, 9-arm ABC, 12-arm ABC, 13-arm ABCD, 9-arm AB, 17-arm AB, 33-arm AB, 7-arm ABC, 15-arm ABCD, and 31-arm ABCDE miktoarm star polymers, most of which are quite new and difficult to synthesize by the end of the 1990s. Several new specialty functional star polymers composed of vinyl polymer segments and rigid rodlike poly(acetylene) arms, helical polypeptide, or helical poly(hexyl isocyanate) arms are introduced.

  6. Denmark's National Inventory Report 2013

    DEFF Research Database (Denmark)

    Nielsen, Ole-Kenneth; Plejdrup, Marlene Schmidt; Winther, Morten

    This report is Denmark’s National Inventory Report 2013. The report contains information on Denmark’s emission inventories for all years’ from 1990 to 2011 for CO2, CH4, N2O, HFCs, PFCs and SF6, NOx, CO, NMVOC, SO2.......This report is Denmark’s National Inventory Report 2013. The report contains information on Denmark’s emission inventories for all years’ from 1990 to 2011 for CO2, CH4, N2O, HFCs, PFCs and SF6, NOx, CO, NMVOC, SO2....

  7. Denmark's National Inventory Report 2017

    DEFF Research Database (Denmark)

    Nielsen, Ole-Kenneth; Plejdrup, Marlene Schmidt; Winther, Morten

    This report is Denmark’s National Inventory Report 2017. The report contains information on Denmark’s emission inventories for all years’ from 1990 to 2015 for CO2, CH4, N2O, HFCs, PFCs and SF6, NOx, CO, NMVOC, SO2......This report is Denmark’s National Inventory Report 2017. The report contains information on Denmark’s emission inventories for all years’ from 1990 to 2015 for CO2, CH4, N2O, HFCs, PFCs and SF6, NOx, CO, NMVOC, SO2...

  8. Denmark's National Inventory Report 2014

    DEFF Research Database (Denmark)

    Nielsen, Ole-Kenneth; Plejdrup, Marlene Schmidt; Winther, Morten

    This report is Denmark’s National Inventory Report 2014. The report contains information on Denmark’s emission inventories for all years’ from 1990 to 2012 for CO2, CH4, N2O, HFCs, PFCs and SF6, NOx, CO, NMVOC, SO2......This report is Denmark’s National Inventory Report 2014. The report contains information on Denmark’s emission inventories for all years’ from 1990 to 2012 for CO2, CH4, N2O, HFCs, PFCs and SF6, NOx, CO, NMVOC, SO2...

  9. Six ways to reduce inventory.

    Science.gov (United States)

    Lunn, T

    1996-05-01

    The purpose of this presentation is to help you reduce the inventory in your operation. We will accomplish that task by discussing six specific methods that companies have used successfully to reduce their inventory. One common attribute of these successes is that they also build teamwork among the people. Every business operation today is concerned with methods to improve customer service. The real trick is to accomplish that task without increasing inventory. We are all concerned with improving our skills at keeping inventory low.

  10. VTrans Small Culvert Inventory - Culverts

    Data.gov (United States)

    Vermont Center for Geographic Information — Vermont Agency of Transportation Small Culvert Inventory: Culverts. This data contains small culverts locations along VTrans maintained roadways. The data was...

  11. Hanford inventory program user's manual

    International Nuclear Information System (INIS)

    Hinkelman, K.C.

    1994-01-01

    Provides users with instructions and information about accessing and operating the Hanford Inventory Program (HIP) system. The Hanford Inventory Program is an integrated control system that provides a single source for the management and control of equipment, parts, and material warehoused by Westinghouse Hanford Company in various site-wide locations. The inventory is comprised of spare parts and equipment, shop stock, special tools, essential materials, and convenience storage items. The HIP replaced the following systems; ACA, ASP, PICS, FSP, WSR, STP, and RBO. In addition, HIP manages the catalog maintenance function for the General Supplies inventory stocked in the 1164 building and managed by WIMS

  12. Massive stars in galaxies

    International Nuclear Information System (INIS)

    Humphreys, R.M.

    1987-01-01

    The relationship between the morphologic type of a galaxy and the evolution of its massive stars is explored, reviewing observational results for nearby galaxies. The data are presented in diagrams, and it is found that the massive-star populations of most Sc spiral galaxies and irregular galaxies are similar, while those of Sb spirals such as M 31 and M 81 may be affected by morphology (via differences in the initial mass function or star-formation rate). Consideration is also given to the stability-related upper luminosity limit in the H-R diagram of hypergiant stars (attributed to radiation pressure in hot stars and turbulence in cool stars) and the goals of future observation campaigns. 88 references

  13. Applying inventory classification to a large inventory management system

    Directory of Open Access Journals (Sweden)

    Benjamin Isaac May

    2017-06-01

    Full Text Available Inventory classification aims to ensure that business-driving inventory items are efficiently managed in spite of constrained resources. There are numerous single- and multiple-criteria approaches to it. Our objective is to improve resource allocation to focus on items that can lead to high equipment availability. This concern is typical of many service industries such as military logistics, airlines, amusement parks and public works. Our study tests several inventory prioritization techniques and finds that a modified multi-criterion weighted non-linear optimization (WNO technique is a powerful approach for classifying inventory, outperforming traditional techniques of inventory prioritization such as ABC analysis in a variety of performance objectives.

  14. Evolution of massive stars

    International Nuclear Information System (INIS)

    Loore, C. de

    1984-01-01

    The evolution of stars with masses larger than 15 sun masses is reviewed. These stars have large convective cores and lose a substantial fraction of their matter by stellar wind. The treatment of convection and the parameterisation of the stellar wind mass loss are analysed within the context of existing disagreements between theory and observation. The evolution of massive close binaries and the origin of Wolf-Rayet Stars and X-ray binaries is also sketched. (author)

  15. Fast pulsars, strange stars

    International Nuclear Information System (INIS)

    Glendenning, N.K.

    1990-02-01

    The initial motivation for this work was the reported discovery in January 1989 of a 1/2 millisecond pulsar in the remnant of the spectacular supernova, 1987A. The status of this discovery has come into grave doubt as of data taken by the same group in February, 1990. At this time we must consider that the millisecond signal does not belong to the pulsar. The existence of a neutron star in remnant of the supernova is suspected because of recent observations on the light curve of the remnant, and of course by the neutrino burst that announced the supernova. However its frequency is unknown. I can make a strong case that a pulsar rotation period of about 1 ms divides those that can be understood quite comfortably as neutron stars, and those that cannot. What we will soon learn is whether there is an invisible boundary below which pulsar periods do not fall, in which case, all are presumable neutron stars, or whether there exist sub- millisecond pulsars, which almost certainly cannot be neutron stars. Their most plausible structure is that of a self-bound star, a strange-quark-matter star. The existence of such stars would imply that the ground state of the strong interaction is not, as we usually assume, hadronic matter, but rather strange quark matter. Let us look respectively at stars that are bound only by gravity, and hypothetical stars that are self-bound, for which gravity is so to speak, icing on the cake

  16. Covering tree with stars

    DEFF Research Database (Denmark)

    Baumbach, Jan; Guo, Jiong; Ibragimov, Rashid

    2015-01-01

    We study the tree edit distance problem with edge deletions and edge insertions as edit operations. We reformulate a special case of this problem as Covering Tree with Stars (CTS): given a tree T and a set of stars, can we connect the stars in by adding edges between them such that the resulting...... tree is isomorphic to T? We prove that in the general setting, CST is NP-complete, which implies that the tree edit distance considered here is also NP-hard, even when both input trees having diameters bounded by 10. We also show that, when the number of distinct stars is bounded by a constant k, CTS...

  17. Introduction to neutron stars

    Energy Technology Data Exchange (ETDEWEB)

    Lattimer, James M. [Dept. of Physics and Astronomy, Stony Brook University, Stony Brook, NY 11794-3800 (United States)

    2015-02-24

    Neutron stars contain the densest form of matter in the present universe. General relativity and causality set important constraints to their compactness. In addition, analytic GR solutions are useful in understanding the relationships that exist among the maximum mass, radii, moments of inertia, and tidal Love numbers of neutron stars, all of which are accessible to observation. Some of these relations are independent of the underlying dense matter equation of state, while others are very sensitive to the equation of state. Recent observations of neutron stars from pulsar timing, quiescent X-ray emission from binaries, and Type I X-ray bursts can set important constraints on the structure of neutron stars and the underlying equation of state. In addition, measurements of thermal radiation from neutron stars has uncovered the possible existence of neutron and proton superfluidity/superconductivity in the core of a neutron star, as well as offering powerful evidence that typical neutron stars have significant crusts. These observations impose constraints on the existence of strange quark matter stars, and limit the possibility that abundant deconfined quark matter or hyperons exist in the cores of neutron stars.

  18. Strangeon and Strangeon Star

    Science.gov (United States)

    Xiaoyu, Lai; Renxin, Xu

    2017-06-01

    The nature of pulsar-like compact stars is essentially a central question of the fundamental strong interaction (explained in quantum chromo-dynamics) at low energy scale, the solution of which still remains a challenge though tremendous efforts have been tried. This kind of compact objects could actually be strange quark stars if strange quark matter in bulk may constitute the true ground state of the strong-interaction matter rather than 56Fe (the so-called Witten’s conjecture). From astrophysical points of view, however, it is proposed that strange cluster matter could be absolutely stable and thus those compact stars could be strange cluster stars in fact. This proposal could be regarded as a general Witten’s conjecture: strange matter in bulk could be absolutely stable, in which quarks are either free (for strange quark matter) or localized (for strange cluster matter). Strange cluster with three-light-flavor symmetry is renamed strangeon, being coined by combining “strange nucleon” for the sake of simplicity. A strangeon star can then be thought as a 3-flavored gigantic nucleus, and strangeons are its constituent as an analogy of nucleons which are the constituent of a normal (micro) nucleus. The observational consequences of strangeon stars show that different manifestations of pulsarlike compact stars could be understood in the regime of strangeon stars, and we are expecting more evidence for strangeon star by advanced facilities (e.g., FAST, SKA, and eXTP).

  19. Interacting binary stars

    CERN Document Server

    Sahade, Jorge; Ter Haar, D

    1978-01-01

    Interacting Binary Stars deals with the development, ideas, and problems in the study of interacting binary stars. The book consolidates the information that is scattered over many publications and papers and gives an account of important discoveries with relevant historical background. Chapters are devoted to the presentation and discussion of the different facets of the field, such as historical account of the development in the field of study of binary stars; the Roche equipotential surfaces; methods and techniques in space astronomy; and enumeration of binary star systems that are studied

  20. Polarization of Be stars

    International Nuclear Information System (INIS)

    Johns, M.W.

    1975-01-01

    Linear polarization of starlight may be produced by electron scattering in the extended atmospheres of early type stars. Techniques are investigated for the measurement and interpretation of this polarization. Polarimetric observations were made of twelve visual double star systems in which at least one member was a B type star as a means of separating the intrinsic stellar polarization from the polarization produced in the interstellar medium. Four of the double stars contained a Be star. Evidence for intrinsic polarization was found in five systems including two of the Be systems, one double star with a short period eclipsing binary, and two systems containing only normal early type stars for which emission lines have not been previously reported. The interpretation of these observations in terms of individual stellar polarizations and their wavelength dependence is discussed. The theoretical basis for the intrinsic polarization of early type stars is explored with a model for the disk-like extended atmospheres of Be stars. Details of a polarimeter for the measurement of the linear polarization of astronomical point sources are also presented with narrow band (Δ lambda = 100A) measurements of the polarization of γ Cas from lambda 4000 to lambda 5800

  1. ENERGY STAR Unit Reports

    Data.gov (United States)

    Department of Housing and Urban Development — These quarterly Federal Fiscal Year performance reports track the ENERGY STAR qualified HOME units that Participating Jurisdictions record in HUD's Integrated...

  2. 21 CFR 1304.11 - Inventory requirements.

    Science.gov (United States)

    2010-04-01

    ... the inventory of the registered location to which they are subject to control or to which the person... 21 Food and Drugs 9 2010-04-01 2010-04-01 false Inventory requirements. 1304.11 Section 1304.11... REGISTRANTS Inventory Requirements § 1304.11 Inventory requirements. (a) General requirements. Each inventory...

  3. Optimization of inventory management in furniture manufacturing

    OpenAIRE

    Karkauskas, Justinas

    2017-01-01

    Aim of research - to present inventory management optimization guidelines for furniture manufacturing company, based on analysis of scientific literature and empirical research. Tasks of the Issue: • Disclose problems of inventory management in furniture manufacturing sector; • To analyze theoretical inventory management decisions; • To develop theoretical inventory management optimization model; • Do empirical research of inventory management and present offers for optimizatio...

  4. Controlling Inventory: Real-World Mathematical Modeling

    Science.gov (United States)

    Edwards, Thomas G.; Özgün-Koca, S. Asli; Chelst, Kenneth R.

    2013-01-01

    Amazon, Walmart, and other large-scale retailers owe their success partly to efficient inventory management. For such firms, holding too little inventory risks losing sales, whereas holding idle inventory wastes money. Therefore profits hinge on the inventory level chosen. In this activity, students investigate a simplified inventory-control…

  5. Denmark's national inventory report 2006

    DEFF Research Database (Denmark)

    Illerup, Jytte Boll; Lyck, Erik; Nielsen, Ole-Kenneth

    This report is Denmark's National Inventory Report reported to the Conference of the Parties under the United Nations Framework Convention on Climate Change (UNFCCC) due by April 2006. The report contains information on Denmark's inventories for all years' from 1990 to 2004 for CO....

  6. Demand differentiation in inventory systems

    NARCIS (Netherlands)

    Kleijn, M.J.

    1998-01-01

    This book deals with inventory systems where customer demand is categorised into different classes. Most inventory systems do not take into account individual customer preferences for a given product, and therefore handle all demand in a similar way. Nowadays, market segmentation has become a

  7. Student-Life Stress Inventory.

    Science.gov (United States)

    Gadzella, Bernadette M.; And Others

    The reliability of the Student-Life Stress Inventory of B. M. Gadzella (1991) was studied. The inventory consists of 51 items listed in 9 sections indicating different types of stressors (frustrations, conflicts, pressures, changes, and self-imposed stressors) and reactions to the stressors (physiological, emotional, behavioral, and cognitive) as…

  8. Automation of Space Inventory Management

    Science.gov (United States)

    Fink, Patrick W.; Ngo, Phong; Wagner, Raymond; Barton, Richard; Gifford, Kevin

    2009-01-01

    This viewgraph presentation describes the utilization of automated space-based inventory management through handheld RFID readers and BioNet Middleware. The contents include: 1) Space-Based INventory Management; 2) Real-Time RFID Location and Tracking; 3) Surface Acoustic Wave (SAW) RFID; and 4) BioNet Middleware.

  9. ANALYSIS MODEL FOR INVENTORY MANAGEMENT

    Directory of Open Access Journals (Sweden)

    CAMELIA BURJA

    2010-01-01

    Full Text Available The inventory represents an essential component for the assets of the enterprise and the economic analysis gives them special importance because their accurate management determines the achievement of the activity object and the financial results. The efficient management of inventory requires ensuring an optimum level for them, which will guarantee the normal functioning of the activity with minimum inventory expenses and funds which are immobilised. The paper presents an analysis model for inventory management based on their rotation speed and the correlation with the sales volume illustrated in an adequate study. The highlighting of the influence factors on the efficient inventory management ensures the useful information needed to justify managerial decisions, which will lead to a balancedfinancial position and to increased company performance.

  10. Stars and Flowers, Flowers and Stars

    Science.gov (United States)

    Minti, Hari

    2012-12-01

    The author, a graduated from the Bucharest University (1964), actually living and working in Israel, concerns his book to variable stars and flowers, two domains of his interest. The analogies includes double stars, eclipsing double stars, eclipses, Big Bang. The book contains 34 chapters, each of which concerns various relations between astronomy and other sciences and pseudosciences such as Psychology, Religion, Geology, Computers and Astrology (to which the author is not an adherent). A special part of the book is dedicated to archeoastronomy and ethnoastronomy, as well as to history of astronomy. Between the main points of interest of these parts: ancient sanctuaries in Sarmizegetusa (Dacia), Stone Henge(UK) and other. The last chapter of the book is dedicated to flowers. The book is richly illustrated. It is designed for a wide circle of readers.

  11. Science Through ARts (STAR)

    Science.gov (United States)

    Kolecki, Joseph; Petersen, Ruth; Williams, Lawrence

    2002-01-01

    Science Through ARts (STAR) is an educational initiative designed to teach students through a multidisciplinary approach to learning. This presentation describes the STAR pilot project, which will use Mars exploration as the topic to be integrated. Schools from the United Kingdom, Japan, the United States, and possibly eastern Europe are expected to participate in the pilot project.

  12. European Stars and Stripes

    National Research Council Canada - National Science Library

    Hendricks, Nancy

    1994-01-01

    The European Stars and Stripes (ES&S) organization publishes a daily newspaper, The Stars and Stripes, for DoD personnel stationed in Germany, Italy, the United Kingdom, and other DoD activities in the U.S. European Command...

  13. Nebraska STARS: Achieving Results

    Science.gov (United States)

    Roschewski, Pat; Isernhagen, Jody; Dappen, Leon

    2006-01-01

    In 2000, the state of Nebraska passed legislation requiring the assessment of student performance on content standards, but its requirements were very different from those of any other state. Nebraska created what has come to be known as STARS (School-based Teacher-led Assessment and Reporting System). Under STARS, each of Nebraska's nearly 500…

  14. Convective overshooting in stars

    NARCIS (Netherlands)

    Andrássy, R.

    2015-01-01

    Numerous observations provide evidence that the standard picture, in which convective mixing is limited to the unstable layers of a star, is incomplete. The mixing layers in real stars are significantly more extended than what the standard models predict. Some of the observations require changing

  15. By Draconis Stars

    Science.gov (United States)

    Bopp, Bernard W.

    An optical spectroscopic survey of dK-M stars has resulted in the discovery of several new H-alpha emission objects. Available optical data suggest these stars have a level of chromospheric activity midway between active BY Dra stars and quiet dM's. These "marginal" BY Dra stars are single objects that have rotation velocities slightly higher than that of quiet field stars but below that of active flare/BY Dra objects. The marginal BY Dra stars provide us with a class of objects rotating very near a "trigger velocity" (believed to be 5 km/s) which appears to divide active flare/BY Dra stars from quiet dM's. UV data on Mg II emission fluxes and strength of transition region features such as C IV will serve to fix activity levels in the marginal objects and determine chromosphere and transition-region heating rates. Simultaneous optical magnetic field measures will be used to explore the connection between fieldstrength/filling-factor and atmospheric heating. Comparison of these data with published information on active and quiet dM stars will yield information on the character of the stellar dynamo as it makes a transition from "low" to "high" activity.

  16. Observing Double Stars

    Science.gov (United States)

    Genet, Russell M.; Fulton, B. J.; Bianco, Federica B.; Martinez, John; Baxter, John; Brewer, Mark; Carro, Joseph; Collins, Sarah; Estrada, Chris; Johnson, Jolyon; Salam, Akash; Wallen, Vera; Warren, Naomi; Smith, Thomas C.; Armstrong, James D.; McGaughey, Steve; Pye, John; Mohanan, Kakkala; Church, Rebecca

    2012-05-01

    Double stars have been systematically observed since William Herschel initiated his program in 1779. In 1803 he reported that, to his surprise, many of the systems he had been observing for a quarter century were gravitationally bound binary stars. In 1830 the first binary orbital solution was obtained, leading eventually to the determination of stellar masses. Double star observations have been a prolific field, with observations and discoveries - often made by students and amateurs - routinely published in a number of specialized journals such as the Journal of Double Star Observations. All published double star observations from Herschel's to the present have been incorporated in the Washington Double Star Catalog. In addition to reviewing the history of visual double stars, we discuss four observational technologies and illustrate these with our own observational results from both California and Hawaii on telescopes ranging from small SCTs to the 2-meter Faulkes Telescope North on Haleakala. Two of these technologies are visual observations aimed primarily at published "hands-on" student science education, and CCD observations of both bright and very faint doubles. The other two are recent technologies that have launched a double star renaissance. These are lucky imaging and speckle interferometry, both of which can use electron-multiplying CCD cameras to allow short (30 ms or less) exposures that are read out at high speed with very low noise. Analysis of thousands of high speed exposures allows normal seeing limitations to be overcome so very close doubles can be accurately measured.

  17. THE DUSTIEST POST-MAIN SEQUENCE STARS IN THE MAGELLANIC CLOUDS

    Energy Technology Data Exchange (ETDEWEB)

    Jones, Olivia C.; Meixner, Margaret; Roman-Duval, Julia [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Sargent, Benjamin A. [Center for Imaging Science and Laboratory for Multiwavelength Astrophysics, Rochester Institute of Technology, 54 Lomb Memorial Drive, Rochester, NY 14623 (United States); Boyer, Martha L. [Observational Cosmology Lab, Code 665, NASA Goddard Space Flight Center, Greenbelt, MD 20771 (United States); Sewiło, Marta [The Johns Hopkins University, Department of Physics and Astronomy, 366 Bloomberg Center, 3400 N. Charles Street, Baltimore, MD 21218 (United States); Hony, Sacha [Institut für Theoretische Astrophysik, Zentrum für Astronomie, Universitt Heidelberg, Albert-Ueberle-Str. 2, D-69120 Heidelberg (Germany)

    2015-10-01

    Using observations from the Herschel Inventory of The Agents of Galaxy Evolution (HERITAGE) survey of the Magellanic Clouds (MC), we have found 35 evolved stars and stellar end products that are bright in the far-infrared. These 28 (LMC) and 7 (SMC) sources were selected from the 529 evolved star candidates in the HERITAGE far-infrared point source catalogs. Our source identification method is based on spectral confirmation, spectral energy distribution characteristics, careful examination of the multiwavelength images and includes constraints on the luminosity, resulting in a thoroughly vetted list of evolved stars. These sources span a wide range in luminosity and hence initial mass. We found 13 low- to intermediate-mass evolved stars, including asymptotic giant branch (AGB) stars, post-AGB stars, planetary nebulae, and a symbiotic star. We also identify 10 high mass stars, including 4 of the 15 known B[e] stars in the MC, 3 extreme red supergiants that are highly enshrouded by dust, a Luminous Blue Variable, a Wolf–Rayet star, and two supernova remnants. Further, we report the detection of 9 probable evolved objects which were previously undescribed in the literature. These sources are likely to be among the dustiest evolved objects in the MC. The Herschel emission may either be due to dust produced by the evolved star or it may arise from swept-up interstellar medium material.

  18. DETECTION OF X-RAYS FROM THE SYMBIOTIC STAR V1329 Cyg

    International Nuclear Information System (INIS)

    Stute, Matthias; Luna, Gerardo J. M.; Sokoloski, Jennifer L.

    2011-01-01

    We report the detection of X-ray emission from the symbiotic star V1329 Cyg with XMM-Newton. The spectrum from the EPIC pn, MOS1, and MOS2 instruments consists of a two-temperature plasma with k T 1 = 0.11 +0.02 -0.02 keV and k T 2 = 0.93 +0.12 -0.14 keV. Unlike the vast majority of symbiotic stars detected in X-rays, the soft component of the spectrum seems to be absorbed only by interstellar material. The shock velocities corresponding to the observed temperatures are about 300 km s -1 and about 900 km s -1 . We did not find either periodic or aperiodic X-ray variability, with upper limits on the amplitudes of such variations being 46% and 16% (rms), respectively. We also did not find any ultraviolet variability with an rms amplitude of more than approximately 1%. The derived velocities and the unabsorbed nature of the soft component of the X-ray spectrum suggest that some portion of the high energy emission could originate in shocks within a jet and beyond the symbiotic nebula. The lower velocity is consistent with the expansion velocity of the extended structure present in Hubble Space Telescope observations. The higher velocity could be associated with an internal shock at the base of the jet or with shocks in the accretion region.

  19. Neutron Stars and Pulsars

    CERN Document Server

    Becker, Werner

    2009-01-01

    Neutron stars are the most compact astronomical objects in the universe which are accessible by direct observation. Studying neutron stars means studying physics in regimes unattainable in any terrestrial laboratory. Understanding their observed complex phenomena requires a wide range of scientific disciplines, including the nuclear and condensed matter physics of very dense matter in neutron star interiors, plasma physics and quantum electrodynamics of magnetospheres, and the relativistic magneto-hydrodynamics of electron-positron pulsar winds interacting with some ambient medium. Not to mention the test bed neutron stars provide for general relativity theories, and their importance as potential sources of gravitational waves. It is this variety of disciplines which, among others, makes neutron star research so fascinating, not only for those who have been working in the field for many years but also for students and young scientists. The aim of this book is to serve as a reference work which not only review...

  20. Spectrophotometry of carbon stars

    Energy Technology Data Exchange (ETDEWEB)

    Oganesyan, R.K.; Karapetyan, M.S.; Nersisyan, S.E.

    1986-01-01

    The results are given of the spectrophotometric investigation of 56 carbon stars in the spectral range from 4000 to 6800 A with resolution 3 A. The observed energy distributions of these stars are determined relative to the flux at the wavelength /sub 0/ = 5556; they are presented in the form of graphs. The energy distributions have been obtained for the first time for 35 stars. Variation in the line Ba II 4554 A has been found in the spectra of St Cam, UU Aur, and RV Mon. Large changes have taken place in the spectra of RT UMa and SS Vir. It is noted that the spectra of carbon stars have a depression, this being situated in different spectral regions for individual groups of stars.

  1. Rotating stars in relativity.

    Science.gov (United States)

    Paschalidis, Vasileios; Stergioulas, Nikolaos

    2017-01-01

    Rotating relativistic stars have been studied extensively in recent years, both theoretically and observationally, because of the information they might yield about the equation of state of matter at extremely high densities and because they are considered to be promising sources of gravitational waves. The latest theoretical understanding of rotating stars in relativity is reviewed in this updated article. The sections on equilibrium properties and on nonaxisymmetric oscillations and instabilities in f -modes and r -modes have been updated. Several new sections have been added on equilibria in modified theories of gravity, approximate universal relationships, the one-arm spiral instability, on analytic solutions for the exterior spacetime, rotating stars in LMXBs, rotating strange stars, and on rotating stars in numerical relativity including both hydrodynamic and magnetohydrodynamic studies of these objects.

  2. On the evolution of stars

    International Nuclear Information System (INIS)

    Kippenhahn, R.

    1989-01-01

    A popular survey is given of the present knowledge on evolution and ageing of stars. Main sequence stars, white dwarf stars, and red giant stars are classified in the Hertzsprung-Russell (HR)-diagram by measurable quantities: surface temperature and luminosity. From the HR-diagram it can be concluded to star mass and age. Star-forming processes in interstellar clouds as well as stellar burning processes are illustrated. The changes occurring in a star due to the depletion of the nuclear energy reserve are described. In this frame the phenomena of planetary nebulae, supernovae, pulsars, neutron stars as well as of black holes are explained

  3. Recent evidence on the muted inventory cycle

    OpenAIRE

    Andrew J. Filardo

    1995-01-01

    Inventories play an important role in business cycles. Inventory build-ups add momentum to the economy during expansions, while inventory liquidations sap economic strength during recessions. In addition, because inventory fluctuations are notoriously difficult to predict, they present considerable uncertainty in assessing the economic outlook.> The role of inventories in shaping the current outlook for the U.S. economy is particularly uncertain. In the early 1990s, inventory swings appeared ...

  4. INEEL Liquid Effluent Inventory

    Energy Technology Data Exchange (ETDEWEB)

    Major, C.A.

    1997-06-01

    The INEEL contractors and their associated facilities are required to identify all liquid effluent discharges that may impact the environment at the INEEL. This liquid effluent information is then placed in the Liquid Effluent Inventory (LEI) database, which is maintained by the INEEL prime contractor. The purpose of the LEI is to identify and maintain a current listing of all liquid effluent discharge points and to identify which discharges are subject to federal, state, or local permitting or reporting requirements and DOE order requirements. Initial characterization, which represents most of the INEEL liquid effluents, has been performed, and additional characterization may be required in the future to meet regulations. LEI information is made available to persons responsible for or concerned with INEEL compliance with liquid effluent permitting or reporting requirements, such as the National Pollutant Discharge Elimination System, Wastewater Land Application, Storm Water Pollution Prevention, Spill Prevention Control and Countermeasures, and Industrial Wastewater Pretreatment. The State of Idaho Environmental Oversight and Monitoring Program also needs the information for tracking liquid effluent discharges at the INEEL. The information provides a baseline from which future liquid discharges can be identified, characterized, and regulated, if appropriate. The review covered new and removed buildings/structures, buildings/structures which most likely had new, relocated, or removed LEI discharge points, and at least 10% of the remaining discharge points.

  5. Inventory of miscellaneous streams

    International Nuclear Information System (INIS)

    Lueck, K.J.

    1995-09-01

    On December 23, 1991, the US Department of Energy, Richland Operations Office (RL) and the Washington State Department of Ecology (Ecology) agreed to adhere to the provisions of the Department of Ecology Consent Order. The Consent Order lists the regulatory milestones for liquid effluent streams at the Hanford Site to comply with the permitting requirements of Washington Administrative Code. The RL provided the US Congress a Plan and Schedule to discontinue disposal of contaminated liquid effluent into the soil column on the Hanford Site. The plan and schedule document contained a strategy for the implementation of alternative treatment and disposal systems. This strategy included prioritizing the streams into two phases. The Phase 1 streams were considered to be higher priority than the Phase 2 streams. The actions recommended for the Phase 1 and 2 streams in the two reports were incorporated in the Hanford Federal Facility Agreement and Consent Order. Miscellaneous Streams are those liquid effluents streams identified within the Consent Order that are discharged to the ground but are not categorized as Phase 1 or Phase 2 Streams. This document consists of an inventory of the liquid effluent streams being discharged into the Hanford soil column

  6. Monte Carlo simulation of star/linear and star/star blends with chemically identical monomers

    Energy Technology Data Exchange (ETDEWEB)

    Theodorakis, P E [Department of Materials Science and Engineering, University of Ioannina, 45110 Ioannina (Greece); Avgeropoulos, A [Department of Materials Science and Engineering, University of Ioannina, 45110 Ioannina (Greece); Freire, J J [Departamento de Ciencias y Tecnicas FisicoquImicas, Universidad Nacional de Educacion a Distancia, Facultad de Ciencias, Senda del Rey 9, 28040 Madrid (Spain); Kosmas, M [Department of Chemistry, University of Ioannina, 45110 Ioannina (Greece); Vlahos, C [Department of Chemistry, University of Ioannina, 45110 Ioannina (Greece)

    2007-11-21

    The effects of chain size and architectural asymmetry on the miscibility of blends with chemically identical monomers, differing only in their molecular weight and architecture, are studied via Monte Carlo simulation by using the bond fluctuation model. Namely, we consider blends composed of linear/linear, star/linear and star/star chains. We found that linear/linear blends are more miscible than the corresponding star/star mixtures. In star/linear blends, the increase in the volume fraction of the star chains increases the miscibility. For both star/linear and star/star blends, the miscibility decreases with the increase in star functionality. When we increase the molecular weight of linear chains of star/linear mixtures the miscibility decreases. Our findings are compared with recent analytical and experimental results.

  7. Monte Carlo simulation of star/linear and star/star blends with chemically identical monomers

    Science.gov (United States)

    Theodorakis, P. E.; Avgeropoulos, A.; Freire, J. J.; Kosmas, M.; Vlahos, C.

    2007-11-01

    The effects of chain size and architectural asymmetry on the miscibility of blends with chemically identical monomers, differing only in their molecular weight and architecture, are studied via Monte Carlo simulation by using the bond fluctuation model. Namely, we consider blends composed of linear/linear, star/linear and star/star chains. We found that linear/linear blends are more miscible than the corresponding star/star mixtures. In star/linear blends, the increase in the volume fraction of the star chains increases the miscibility. For both star/linear and star/star blends, the miscibility decreases with the increase in star functionality. When we increase the molecular weight of linear chains of star/linear mixtures the miscibility decreases. Our findings are compared with recent analytical and experimental results.

  8. Monte Carlo simulation of star/linear and star/star blends with chemically identical monomers

    International Nuclear Information System (INIS)

    Theodorakis, P E; Avgeropoulos, A; Freire, J J; Kosmas, M; Vlahos, C

    2007-01-01

    The effects of chain size and architectural asymmetry on the miscibility of blends with chemically identical monomers, differing only in their molecular weight and architecture, are studied via Monte Carlo simulation by using the bond fluctuation model. Namely, we consider blends composed of linear/linear, star/linear and star/star chains. We found that linear/linear blends are more miscible than the corresponding star/star mixtures. In star/linear blends, the increase in the volume fraction of the star chains increases the miscibility. For both star/linear and star/star blends, the miscibility decreases with the increase in star functionality. When we increase the molecular weight of linear chains of star/linear mixtures the miscibility decreases. Our findings are compared with recent analytical and experimental results

  9. Fusion program research materials inventory

    International Nuclear Information System (INIS)

    Roche, T.K.; Wiffen, F.W.; Davis, J.W.; Lechtenberg, T.A.

    1984-01-01

    Oak Ridge National Laboratory maintains a central inventory of research materials to provide a common supply of materials for the Fusion Reactor Materials Program. This will minimize unintended material variations and provide for economy in procurement and for centralized record keeping. Initially this inventory is to focus on materials related to first-wall and structural applications and related research, but various special purpose materials may be added in the future. The use of materials from this inventory for research that is coordinated with or otherwise related technically to the Fusion Reactor Materials Program of DOE is encouraged

  10. Star Cluster Structure from Hierarchical Star Formation

    Science.gov (United States)

    Grudic, Michael; Hopkins, Philip; Murray, Norman; Lamberts, Astrid; Guszejnov, David; Schmitz, Denise; Boylan-Kolchin, Michael

    2018-01-01

    Young massive star clusters (YMCs) spanning 104-108 M⊙ in mass generally have similar radial surface density profiles, with an outer power-law index typically between -2 and -3. This similarity suggests that they are shaped by scale-free physics at formation. Recent multi-physics MHD simulations of YMC formation have also produced populations of YMCs with this type of surface density profile, allowing us to narrow down the physics necessary to form a YMC with properties as observed. We show that the shallow density profiles of YMCs are a natural result of phase-space mixing that occurs as they assemble from the clumpy, hierarchically-clustered configuration imprinted by the star formation process. We develop physical intuition for this process via analytic arguments and collisionless N-body experiments, elucidating the connection between star formation physics and star cluster structure. This has implications for the early-time structure and evolution of proto-globular clusters, and prospects for simulating their formation in the FIRE cosmological zoom-in simulations.

  11. Making star teams out of star players.

    Science.gov (United States)

    Mankins, Michael; Bird, Alan; Root, James

    2013-01-01

    Top talent is an invaluable asset: In highly specialized or creative work, for instance, "A" players are likely to be six times as productive as "B" players. So when your company has a crucial strategic project, why not multiply all that firepower and have a team of your best performers tackle it? Yet many companies hesitate to do this, believing that all-star teams don't work: Big egos will get in the way. The stars won't be able to work with one another. They'll drive the team Leader crazy. Mankins, Bird, and Root of Bain & Company believe it's time to set aside that thinking. They have seen all-star teams do extraordinary work. But there is a right way and a wrong way to organize them. Before you can even begin to assemble such a team, you need to have the right talent management practices, so you hire and develop the best people and know what they're capable of. You have to give the team appropriate incentives and leaders and support staffers who are stars in their own right. And projects that are ill-defined or small scale are not for all-star teams. Use them only for critical missions, and make sure their objectives are clear. Even with the right setup, things can still go wrong. The wise executive will take steps to manage egos, prune non-team-players, and prevent average coworkers from feeling completely undervalued. She will also invest a lot of time in choosing the right team Leader and will ask members for lots of feedback to monitor how that leader is doing.

  12. AN AROMATIC INVENTORY OF THE LOCAL VOLUME

    International Nuclear Information System (INIS)

    Marble, A. R.; Engelbracht, C. W.; Block, M.; Van Zee, L.; Dale, D. A.; Cohen, S. A.; Schuster, M. D.; Smith, J. D. T.; Gordon, K. D.; Wu, Y.; Lee, J. C.; Kennicutt, R. C.; Skillman, E. D.; Johnson, L. C.; Calzetti, D.; Lee, H.

    2010-01-01

    Using infrared photometry from the Spitzer Space Telescope, we perform the first inventory of aromatic feature emission (also commonly referred to as polycyclic aromatic hydrocarbon emission) for a statistically complete sample of star-forming galaxies in the local volume. The photometric methodology involved is calibrated and demonstrated to recover the aromatic fraction of the Infrared Array Camera 8 μm flux with a standard deviation of 6% for a training set of 40 SINGS galaxies (ranging from stellar to dust dominated) with both suitable mid-infrared Spitzer Infrared Spectrograph spectra and equivalent photometry. A potential factor of 2 improvement could be realized with suitable 5.5 μm and 10 μm photometry, such as what may be provided in the future by the James Webb Space Telescope. The resulting technique is then applied to mid-infrared photometry for the 258 galaxies from the Local Volume Legacy (LVL) survey, a large sample dominated in number by low-luminosity dwarf galaxies for which obtaining comparable mid-infrared spectroscopy is not feasible. We find the total LVL luminosity due to five strong aromatic features in the 8 μm complex to be 2.47 x 10 10 L sun with a mean volume density of 8.8 x 10 6 L sun Mpc -3 . Twenty-four of the LVL galaxies, corresponding to a luminosity cut at M B = -18.22, account for 90% of the aromatic luminosity. Using oxygen abundances compiled from the literature for 129 of the 258 LVL galaxies, we find a correlation between metallicity and the aromatic-to-total infrared emission ratio but not the aromatic-to-total 8 μm dust emission ratio. A possible explanation is that metallicity plays a role in the abundance of aromatic molecules relative to the total dust content, but other factors, such as star formation and/or the local radiation field, affect the excitation of those molecules.

  13. Stability of boson stars

    International Nuclear Information System (INIS)

    Gleiser, M.

    1988-01-01

    Boson stars are gravitationally bound, spherically symmetric equilibrium configurations of cold, free, or interacting complex scalar fields phi. As these equilibrium configurations naturally present local anisotropy, it is sensible to expect departures from the well-known stability criteria for fluid stars. With this in mind, I investigate the dynamical instability of boson stars against charge-conserving, small radial perturbations. Following the method developed by Chandrasekhar, a variational base for determining the eigenfrequencies of the perturbations is found. This approach allows one to find numerically an upper bound for the central density where dynamical instability occurs. As applications of the formalism, I study the stability of equilibrium configurations obtained both for the free and for the self-interacting [with V(phi) = (λ/4)chemical bondphichemical bond 4 ] massive scalar field phi. Instabilities are found to occur not for the critical central density as in fluid stars but for central densities considerably higher. The departure from the results for fluid stars is sensitive to the coupling λ; the higher the value of λ, the more the stability properties of boson stars approach those of a fluid star. These results are linked to the fractional anisotropy at the radius of the configuration

  14. From clouds to stars

    International Nuclear Information System (INIS)

    Elmegreen, B.G.

    1982-01-01

    At the present time, the theory of star formation must be limited to what we know about the lowest density gas, or about the pre-main sequence stars themselves. We would like to understand two basic processes: 1) how star-forming clouds are created from the ambient interstellar gas in the first place, and 2) how small parts of these clouds condense to form individual stars. We are interested also in knowing what pre-main sequence stars are like, and how they can interact with their environment. These topics are reviewed in what follows. In this series of lectures, what we know about the formation of stars is tentatively described. The lectures begin with a description of the interstellar medium, and then they proceed along the same direction that a young star would follow during its creation, namely from clouds through the collapse phase and onto the proto-stellar phase. The evolution of viscous disks and two models for the formation of the solar system are described in the last lectures. The longest lectures, and the topics that are covered in most detail, are not necessarily the ones for which we have the most information. Physically intuitive explanations for the various processes are emphasized, rather then mathematical explanations. In some cases, the mathematical aspects are developed as well, but only when the equations can be used to give important numerical values for comparison with the observations

  15. Biogenic Emission Inventory System (BEIS)

    Science.gov (United States)

    Biogenic Emission Inventory System (BEIS) estimates volatile organic compound (VOC) emissions from vegetation and nitric oxide (NO) emission from soils. Recent BEIS development has been restricted to the SMOKE system

  16. Severe Weather Data Inventory (SWDI)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Severe Weather Data Inventory (SWDI) is an integrated database of severe weather records for the United States. SWDI enables a user to search through a variety...

  17. FEMA Flood Insurance Studies Inventory

    Data.gov (United States)

    Kansas Data Access and Support Center — This digital data set provides an inventory of Federal Emergency Management Agency (FEMA) Flood Insurance Studies (FIS) that have been conducted for communities and...

  18. Clinical Decision Support (CDS) Inventory

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Clinical Decision Support (CDS) Inventory contains descriptions of past and present CDS projects across the Federal Government. It includes Federal projects,...

  19. COMPUTER ASSISTED INVENTORY CONTROL SYSTEM ...

    African Journals Online (AJOL)

    issue in supply chain inventory manugement is to coordinate .... A supply chain is a network of organizations that are involved in the ... make decisions, which result in sub-optimization. ... same time reduce the ultimate cost of finished goods.

  20. Allegheny County Toxics Release Inventory

    Data.gov (United States)

    Allegheny County / City of Pittsburgh / Western PA Regional Data Center — The Toxics Release Inventory (TRI) data provides information about toxic substances released into the environment or managed through recycling, energy recovery, and...

  1. Inventory differences: An evaluation methodology

    International Nuclear Information System (INIS)

    Heinberg, C.L.; Roberts, N.J.

    1987-01-01

    This paper discusses an evaluation methodology which is used for inventory differences at the Los Alamos National Laboratory. It is recognized that there are various methods which can be, and are being, used to evaluate process inventory differences at DOE facilities. The purpose of this paper is to share our thoughts on the subject and our techniques with those who are responsible for the evaluation of inventory differences at their facility. One of the most dangerous aspects of any evaluation technique, especially one as complex as most inventory difference evaluations tend to be, is to fail to look at the tools being used as indicators. There is a tendency to look at the results of an evaluation by one technique as an absolute. At the Los Alamos National Laboratory, several tools are used and the final evaluation is based on a combination of the observed results of a many-faceted evaluation. The tools used and some examples are presented

  2. National Greenhouse Gas Emission Inventory

    Data.gov (United States)

    U.S. Environmental Protection Agency — The National Greenhouse Gas Emission Inventory contains information on direct emissions of greenhouse gases as well as indirect or potential emissions of greenhouse...

  3. Title V Permitting Statistics Inventory

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Title V Permitting Statistics Inventory contains measured and estimated nationwide statistical data, consisting of counts of permitted sources, types of permits...

  4. Travel reliability inventory for Chicago.

    Science.gov (United States)

    2013-04-01

    The overarching goal of this research project is to enable state DOTs to document and monitor the reliability performance : of their highway networks. To this end, a computer tool, TRIC, was developed to produce travel reliability inventories from : ...

  5. An investigation of Inventory Differences

    International Nuclear Information System (INIS)

    Harvel, C.

    1993-01-01

    The derivation of applicable Limits of Error for Inventory Differences (LEIDs) has been a long-term challenge for some material storage tanks at the Savannah River Site. Several investigations have been unsuccessful in producing usable estimates of the LEIDs. An investigation conducted in November of 1991 revealed some significant inventory characteristics. The corrective action involved the implementation of a multi-case LEID based on historical information and a correction in the use of the tank calibration charts for two storage tanks

  6. Denmark's National Inventory Report 2009

    DEFF Research Database (Denmark)

    Nielsen, Ole-Kenneth; Lyck, Erik; Mikkelsen, Mette Hjorth

    This report is Denmark's National Inventory Report 2009. The report contains information on Denmark's emission inventories for all years' from 1990 to 2007 for CO2, CH4, N2O, HFCs, PFCs and SF6, NOx, CO, NMVOC, SO2. The report documents the methodology as well as presents activity data and emissi...... factors for energy, industrial processes, sovent and other product use, agriculture, LULUCF (Land-Use, Land-Use Change and Forestry) and waste....

  7. Nuclear physics of stars

    CERN Document Server

    Iliadis, Christian

    2007-01-01

    Thermonuclear reactions in stars is a major topic in the field of nuclear astrophysics, and deals with the topics of how precisely stars generate their energy through nuclear reactions, and how these nuclear reactions create the elements the stars, planets and - ultimately - we humans consist of. The present book treats these topics in detail. It also presents the nuclear reaction and structure theory, thermonuclear reaction rate formalism and stellar nucleosynthesis. The topics are discussed in a coherent way, enabling the reader to grasp their interconnections intuitively. The book serves bo

  8. Entropy Production of Stars

    Directory of Open Access Journals (Sweden)

    Leonid M. Martyushev

    2015-06-01

    Full Text Available The entropy production (inside the volume bounded by a photosphere of main-sequence stars, subgiants, giants, and supergiants is calculated based on B–V photometry data. A non-linear inverse relationship of thermodynamic fluxes and forces as well as an almost constant specific (per volume entropy production of main-sequence stars (for 95% of stars, this quantity lies within 0.5 to 2.2 of the corresponding solar magnitude is found. The obtained results are discussed from the perspective of known extreme principles related to entropy production.

  9. Carbon Stars T. Lloyd Evans

    Indian Academy of Sciences (India)

    that the features used in estimating luminosities of ordinary giant stars are just those whose abundance ... This difference between the spectral energy distributions (SEDs) of CH stars and the. J stars, which belong to .... that the first group was binaries, as for the CH stars of the solar vicinity, while those of the second group ...

  10. AgSTAR

    Science.gov (United States)

    AgSTAR promotes biogas recovery projects, which generate renewable energy and other beneficial products from the anaerobic digestion of livestock manure and organic wastes while decreasing greenhouse gas emissions from the agriculture sector.

  11. Orbiting radiation stars

    International Nuclear Information System (INIS)

    Foster, Dean P; Langford, John; Perez-Giz, Gabe

    2016-01-01

    We study a spherically symmetric solution to the Einstein equations in which the source, which we call an orbiting radiation star (OR-star), is a compact object consisting of freely falling null particles. The solution avoids quantum scale regimes and hence neither relies upon nor ignores the interaction of quantum mechanics and gravitation. The OR-star spacetime exhibits a deep gravitational well yet remains singularity free. In fact, it is geometrically flat in the vicinity of the origin, with the flat region being of any desirable scale. The solution is observationally distinct from a black hole because a photon from infinity aimed at an OR-star escapes to infinity with a time delay. (paper)

  12. Cataclysmic Variable Stars

    Science.gov (United States)

    Hellier, Coel

    2001-01-01

    Cataclysmic variable stars are the most variable stars in the night sky, fluctuating in brightness continually on timescales from seconds to hours to weeks to years. The changes can be recorded using amateur telescopes, yet are also the subject of intensive study by professional astronomers. That study has led to an understanding of cataclysmic variables as binary stars, orbiting so closely that material transfers from one star to the other. The resulting process of accretion is one of the most important in astrophysics. This book presents the first account of cataclysmic variables at an introductory level. Assuming no previous knowledge of the field, it explains the basic principles underlying the variability, while providing an extensive compilation of cataclysmic variable light curves. Aimed at amateur astronomers, undergraduates, and researchers, the main text is accessible to those with no mathematical background, while supplementary boxes present technical details and equations.

  13. SX Phoenicis stars

    International Nuclear Information System (INIS)

    Nemec, J.; Mateo, M.

    1990-01-01

    The purpose of this paper is to review the basic observational information concerning SX Phe stars, including recent findings such as the discovery of about 40 low-luminosity variable stars in the Carina dwarf galaxy and identification of at least one SX Phe star in the metal-rich globular cluster M71. Direct evidence supporting the hypothesis that at least some BSs are binary systems comes from the discovery of two contact binaries and a semidetached binary among the 50 BSs in the globular cluster NGC 5466. Since these systems will coalesce on a time scale 500 Myr, it stands to reason that many (if not most) BSs are coalesced binaries. The merger hypothesis also explains the relatively-large masses (1.0-1.2 solar masses) that have been derived for SX Phe stars and halo BSs, and may also account for the nonvariable BSs in the 'SX Phe instability strip'. 132 refs

  14. Sounds of a Star

    Science.gov (United States)

    2001-06-01

    Acoustic Oscillations in Solar-Twin "Alpha Cen A" Observed from La Silla by Swiss Team Summary Sound waves running through a star can help astronomers reveal its inner properties. This particular branch of modern astrophysics is known as "asteroseismology" . In the case of our Sun, the brightest star in the sky, such waves have been observed since some time, and have greatly improved our knowledge about what is going on inside. However, because they are much fainter, it has turned out to be very difficult to detect similar waves in other stars. Nevertheless, tiny oscillations in a solar-twin star have now been unambiguously detected by Swiss astronomers François Bouchy and Fabien Carrier from the Geneva Observatory, using the CORALIE spectrometer on the Swiss 1.2-m Leonard Euler telescope at the ESO La Silla Observatory. This telescope is mostly used for discovering exoplanets (see ESO PR 07/01 ). The star Alpha Centauri A is the nearest star visible to the naked eye, at a distance of a little more than 4 light-years. The new measurements show that it pulsates with a 7-minute cycle, very similar to what is observed in the Sun . Asteroseismology for Sun-like stars is likely to become an important probe of stellar theory in the near future. The state-of-the-art HARPS spectrograph , to be mounted on the ESO 3.6-m telescope at La Silla, will be able to search for oscillations in stars that are 100 times fainter than those for which such demanding observations are possible with CORALIE. PR Photo 23a/01 : Oscillations in a solar-like star (schematic picture). PR Photo 23b/01 : Acoustic spectrum of Alpha Centauri A , as observed with CORALIE. Asteroseismology: listening to the stars ESO PR Photo 23a/01 ESO PR Photo 23a/01 [Preview - JPEG: 357 x 400 pix - 96k] [Normal - JPEG: 713 x 800 pix - 256k] [HiRes - JPEG: 2673 x 3000 pix - 2.1Mb Caption : PR Photo 23a/01 is a graphical representation of resonating acoustic waves in the interior of a solar-like star. Red and blue

  15. 10 CFR 39.37 - Physical inventory.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false Physical inventory. 39.37 Section 39.37 Energy NUCLEAR... inventory. Each licensee shall conduct a semi-annual physical inventory to account for all licensed material received and possessed under the license. The licensee shall retain records of the inventory for 3 years...

  16. 27 CFR 20.170 - Physical inventory.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Physical inventory. 20.170... Users of Specially Denatured Spirits Inventory and Records § 20.170 Physical inventory. Once in each... physical inventory of each formula of new and recovered specially denatured spirits. (Approved by the...

  17. Projecting Timber Inventory at the Product Level

    Science.gov (United States)

    Lawrence Teeter; Xiaoping Zhou

    1999-01-01

    Current timber inventory projections generally lack information on inventory by product classes. Most models available for inventory projection and linked to supply analyses are limited to projecting aggregate softwood and hardwood. The research presented describes a methodology for distributing the volume on each FIA (USDA Forest Service Forest Inventory and Analysis...

  18. Base-age invariance and inventory projections

    Science.gov (United States)

    C. J. Cieszewski; R. L. Bailey; B. E. Borders; G. H. Brister; B. D. Shiver

    2000-01-01

    One of the most important functions of forest inventory is to facilitate management decisions towards forest sustainability based on inventory projections into the future. Therefore, most forest inventories are used for predicting future states of the forests, in modern forestry the most common methods used in inventory projections are based on implicit functions...

  19. 27 CFR 40.201 - Inventories.

    Science.gov (United States)

    2010-04-01

    ... PROCESSED TOBACCO Operations by Manufacturers of Tobacco Products Inventories and Reports § 40.201 Inventories. Every manufacturer of tobacco products shall make true and accurate inventories on Form 5210.9... 27 Alcohol, Tobacco Products and Firearms 2 2010-04-01 2010-04-01 false Inventories. 40.201...

  20. Optimal ABC inventory classification using interval programming

    NARCIS (Netherlands)

    Rezaei, J.; Salimi, N.

    2015-01-01

    Inventory classification is one of the most important activities in inventory management, whereby inventories are classified into three or more classes. Several inventory classifications have been proposed in the literature, almost all of which have two main shortcomings in common. That is, the

  1. Spectrophotometry of carbon stars

    International Nuclear Information System (INIS)

    Gow, C.E.

    1975-01-01

    Observations of over one hundred carbon stars have been made with the Indiana rapid spectral scanner in the red and, when possible, in the visual and blue regions of the spectrum. Five distinct subtypes of carbon stars (Barium, CH, R, N, and hydrogen deficient) are represented in the list of observed stars, although the emphasis was placed on the N stars when the observations were made. The rapid scanner was operated in the continuous sweep mode with the exit slit set at twenty angstroms, however, seeing fluctuations and guiding errors smear the spectrum to an effective resolution of approximately thirty angstroms. Nightly observations of Hayes standard stars yielded corrections for atmospheric extinction and instrumental response. The reduction scheme rests on two assumptions, that thin clouds are gray absorbers and the wavelength dependence of the sky transparency does not change during the course of the night. Several stars have been observed in the blue region of the spectrum with the Indiana SIT vidicon spectrometer at two angstroms resolution. It is possible to derive a color temperature for the yellow--red spectral region by fitting a black-body curve through two chosen continuum points. Photometric indices were calculated relative to the blackbody curve to measure the C 2 Swan band strength, the shape of the CN red (6,1) band to provide a measure of the 12 C/ 13 C isotope ratio, and in the hot carbon stars (Barium, CH, and R stars) the strength of an unidentified feature centered at 400 angstroms. An extensive abundance grid of model atmospheres was calculated using a modified version of the computer code ATLAS

  2. Young Stars with SALT

    Energy Technology Data Exchange (ETDEWEB)

    Riedel, Adric R. [Department of Astronomy, California Institute of Technology, Pasadena, CA 91125 (United States); Alam, Munazza K.; Rice, Emily L.; Cruz, Kelle L. [Department of Astrophysics, The American Museum of Natural History, New York, NY 10024 (United States); Henry, Todd J., E-mail: arr@caltech.edu [RECONS Institute, Chambersburg, PA (United States)

    2017-05-10

    We present a spectroscopic and kinematic analysis of 79 nearby M dwarfs in 77 systems. All of these dwarfs are low-proper-motion southern hemisphere objects and were identified in a nearby star survey with a demonstrated sensitivity to young stars. Using low-resolution optical spectroscopy from the Red Side Spectrograph on the South African Large Telescope, we have determined radial velocities, H-alpha, lithium 6708 Å, and potassium 7699 Å equivalent widths linked to age and activity, and spectral types for all of our targets. Combined with astrometric information from literature sources, we identify 44 young stars. Eighteen are previously known members of moving groups within 100 pc of the Sun. Twelve are new members, including one member of the TW Hydra moving group, one member of the 32 Orionis moving group, 9 members of Tucana-Horologium, one member of Argus, and two new members of AB Doradus. We also find 14 young star systems that are not members of any known groups. The remaining 33 star systems do not appear to be young. This appears to be evidence of a new population of nearby young stars not related to the known nearby young moving groups.

  3. Asteroseismology of white dwarf stars

    OpenAIRE

    Córsico, A. H.

    2014-01-01

    Most of low- and intermediate-mass stars that populate the Universe will end their lives as white dwarf stars. These ancient stellar remnants have encrypted inside a precious record of the evolutionary history of the progenitor stars, providing a wealth of information about the evolution of stars, star formation, and the age of a variety of stellar populations, such as our Galaxy and open and globular clusters. While some information like surface chemical composition, temperature and gravity ...

  4. Annual Danish emissions inventory report to UNECE. Inventory 1990 - 2002

    Energy Technology Data Exchange (ETDEWEB)

    Illerup, J.B.; Nielsen, M.; Winther, M.; Hjort Mikkelsen, M.; Lyck, E.; Hoffmann, L.; Fauser, P.

    2004-05-01

    This report is a documentation report on the emission inventories for Denmark as reported to the UNECE Secretariat under the Convention on Long Range Transboundary Air Pollution due by 15 February 2004. The report contains information on Denmark's emission inventories regarding emissions of (1) SOx for the years 1980-2002, (2) NOx, CO, NMVOC and NH{sub 3} for the years 1985-2002; (3) Particulate matter: TSP, PM10, PM2.5 for the years 2000-2002, (4) Heavy Metals: Pb, Cd, Hg, As, Cr, Cu, Ni, Se and Zn for the years 1990-2002, and (5) Polyaromatic hydrocarbons (PAH): Benzo(a)pyrene, benzo(b)fluoranthene, benzo(k)fluoranthene and indeno(1,2,3-cd)pyrene for the years 1990-2002. Furthermore, the report contains information on background data for emissions inventory. (au)

  5. Annual Danish emissions inventory report to UNECE. Inventory 1990 - 2002

    Energy Technology Data Exchange (ETDEWEB)

    Illerup, J B; Nielsen, M; Winther, M; Hjort Mikkelsen, M; Lyck, E; Hoffmann, L; Fauser, P

    2004-05-01

    This report is a documentation report on the emission inventories for Denmark as reported to the UNECE Secretariat under the Convention on Long Range Transboundary Air Pollution due by 15 February 2004. The report contains information on Denmark's emission inventories regarding emissions of (1) SOx for the years 1980-2002, (2) NOx, CO, NMVOC and NH{sub 3} for the years 1985-2002; (3) Particulate matter: TSP, PM10, PM2.5 for the years 2000-2002, (4) Heavy Metals: Pb, Cd, Hg, As, Cr, Cu, Ni, Se and Zn for the years 1990-2002, and (5) Polyaromatic hydrocarbons (PAH): Benzo(a)pyrene, benzo(b)fluoranthene, benzo(k)fluoranthene and indeno(1,2,3-cd)pyrene for the years 1990-2002. Furthermore, the report contains information on background data for emissions inventory. (au)

  6. A robust star identification algorithm with star shortlisting

    Science.gov (United States)

    Mehta, Deval Samirbhai; Chen, Shoushun; Low, Kay Soon

    2018-05-01

    A star tracker provides the most accurate attitude solution in terms of arc seconds compared to the other existing attitude sensors. When no prior attitude information is available, it operates in "Lost-In-Space (LIS)" mode. Star pattern recognition, also known as star identification algorithm, forms the most crucial part of a star tracker in the LIS mode. Recognition reliability and speed are the two most important parameters of a star pattern recognition technique. In this paper, a novel star identification algorithm with star ID shortlisting is proposed. Firstly, the star IDs are shortlisted based on worst-case patch mismatch, and later stars are identified in the image by an initial match confirmed with a running sequential angular match technique. The proposed idea is tested on 16,200 simulated star images having magnitude uncertainty, noise stars, positional deviation, and varying size of the field of view. The proposed idea is also benchmarked with the state-of-the-art star pattern recognition techniques. Finally, the real-time performance of the proposed technique is tested on the 3104 real star images captured by a star tracker SST-20S currently mounted on a satellite. The proposed technique can achieve an identification accuracy of 98% and takes only 8.2 ms for identification on real images. Simulation and real-time results depict that the proposed technique is highly robust and achieves a high speed of identification suitable for actual space applications.

  7. Wolf-Rayet Stars

    Science.gov (United States)

    Hamann, Wolf-Rainer; Sander, Andreas; Todt, Helge

    Nearly 150 years ago, the French astronomers Charles Wolf and Georges Rayet described stars with very conspicuous spectra that are dominated by bright and broad emission lines. Meanwhile termed Wolf-Rayet Stars after their discoverers, those objects turned out to represent important stages in the life of massive stars. As the first conference in a long time that was specifically dedicated to Wolf-Rayet stars, an international workshop was held in Potsdam, Germany, from 1.-5. June 2015. About 100 participants, comprising most of the leading experts in the field as well as as many young scientists, gathered for one week of extensive scientific exchange and discussions. Considerable progress has been reported throughout, e.g. on finding such stars, modeling and analyzing their spectra, understanding their evolutionary context, and studying their circumstellar nebulae. While some major questions regarding Wolf-Rayet stars still remain open 150 years after their discovery, it is clear today that these objects are not just interesting stars as such, but also keystones in the evolution of galaxies. These proceedings summarize the talks and posters presented at the Potsdam Wolf-Rayet workshop. Moreover, they also include the questions, comments, and discussions emerging after each talk, thereby giving a rare overview not only about the research, but also about the current debates and unknowns in the field. The Scientific Organizing Committee (SOC) included Alceste Bonanos (Athens), Paul Crowther (Sheffield), John Eldridge (Auckland), Wolf-Rainer Hamann (Potsdam, Chair), John Hillier (Pittsburgh), Claus Leitherer (Baltimore), Philip Massey (Flagstaff), George Meynet (Geneva), Tony Moffat (Montreal), Nicole St-Louis (Montreal), and Dany Vanbeveren (Brussels).

  8. Models of symbiotic stars

    Science.gov (United States)

    Friedjung, Michael

    1993-01-01

    One of the most important features of symbiotic stars is the coexistence of a cool spectral component that is apparently very similar to the spectrum of a cool giant, with at least one hot continuum, and emission lines from very different stages of ionization. The cool component dominates the infrared spectrum of S-type symbiotics; it tends to be veiled in this wavelength range by what appears to be excess emission in D-type symbiotics, this excess usually being attributed to circumstellar dust. The hot continuum (or continua) dominates the ultraviolet. X-rays have sometimes also been observed. Another important feature of symbiotic stars that needs to be explained is the variability. Different forms occur, some variability being periodic. This type of variability can, in a few cases, strongly suggest the presence of eclipses of a binary system. One of the most characteristic forms of variability is that characterizing the active phases. This basic form of variation is traditionally associated in the optical with the veiling of the cool spectrum and the disappearance of high-ionization emission lines, the latter progressively appearing (in classical cases, reappearing) later. Such spectral changes recall those of novae, but spectroscopic signatures of the high-ejection velocities observed for novae are not usually detected in symbiotic stars. However, the light curves of the 'symbiotic nova' subclass recall those of novae. We may also mention in this connection that radio observations (or, in a few cases, optical observations) of nebulae indicate ejection from symbiotic stars, with deviations from spherical symmetry. We shall give a historical overview of the proposed models for symbiotic stars and make a critical analysis in the light of the observations of symbiotic stars. We describe the empirical approach to models and use the observational data to diagnose the physical conditions in the symbiotics stars. Finally, we compare the results of this empirical

  9. Circulation of Stars

    Science.gov (United States)

    Boitani, P.

    2016-01-01

    Since the dawn of man, contemplation of the stars has been a primary impulse in human beings, who proliferated their knowledge of the stars all over the world. Aristotle sees this as the product of primeval and perennial “wonder” which gives rise to what we call science, philosophy, and poetry. Astronomy, astrology, and star art (painting, architecture, literature, and music) go hand in hand through millennia in all cultures of the planet (and all use catasterisms to explain certain phenomena). Some of these developments are independent of each other, i.e., they take place in one culture independently of others. Some, on the other hand, are the product of the “circulation of stars.” There are two ways of looking at this. One seeks out forms, the other concentrates on the passing of specific lore from one area to another through time. The former relies on archetypes (for instance, with catasterism), the latter constitutes a historical process. In this paper I present some of the surprising ways in which the circulation of stars has occurred—from East to West, from East to the Far East, and from West to East, at times simultaneously.

  10. Balancing flexibility and inventory in repair inventory systems

    NARCIS (Netherlands)

    Haas, de H.F.M.; Martin, H.H.

    1995-01-01

    In repair inventory systems, failed units are exchanged for serviceable units upon failure. The probability that serviceable units are available to support the exchange process can be used as a measure for the performance of the system. This measure is commonly called the expected fill rate. The

  11. Four new Delta Scuti stars

    Science.gov (United States)

    Schutt, R. L.

    1991-01-01

    Four new Delta Scuti stars are reported. Power, modified into amplitude, spectra, and light curves are used to determine periodicities. A complete frequency analysis is not performed due to the lack of a sufficient time base in the data. These new variables help verify the many predictions that Delta Scuti stars probably exist in prolific numbers as small amplitude variables. Two of these stars, HR 4344 and HD 107513, are possibly Am stars. If so, they are among the minority of variable stars which are also Am stars.

  12. Neutron star/red giant encounters in globular clusters

    International Nuclear Information System (INIS)

    Bailyn, C.D.

    1988-01-01

    The author presents a simple expression for the amount by which xsub(crit) is diminished as a star evolves xsub(crit) Rsub(crit)/R*, where Rsub(crit) is the maximum distance of closest approach between two stars for which the tidal energy is sufficient to bind the system, and R* is the radius of the star on which tides are being raised. Also it is concluded that tidal capture of giants by neutron stars resulting in binary systems is unlikely in globular clusters. However, collisions between neutron stars and red giants, or an alternative process involving tidal capture of a main-sequence star into an initially detached binary system, may result either in rapidly rotating neutron stars or in white dwarf/neutron star binaries. (author)

  13. Heavy Metal Stars

    Science.gov (United States)

    2001-08-01

    La Silla Telescope Detects Lots of Lead in Three Distant Binaries Summary Very high abundances of the heavy element Lead have been discovered in three distant stars in the Milky Way Galaxy . This finding strongly supports the long-held view that roughly half of the stable elements heavier than Iron are produced in common stars during a phase towards the end of their life when they burn their Helium - the other half results from supernova explosions. All the Lead contained in each of the three stars weighs about as much as our Moon. The observations show that these "Lead stars" - all members of binary stellar systems - have been more enriched with Lead than with any other chemical element heavier than Iron. This new result is in excellent agreement with predictions by current stellar models about the build-up of heavy elements in stellar interiors. The new observations are reported by a team of Belgian and French astronomers [1] who used the Coude Echelle Spectrometer on the ESO 3.6-m telescope at the La Silla Observatory (Chile). PR Photo 26a/01 : A photo of HD 196944 , one of the "Lead stars". PR Photo 26b/01 : A CES spectrum of HD 196944 . The build-up of heavy elements Astronomers and physicists denote the build-up of heavier elements from lighter ones as " nucleosynthesis ". Only the very lightest elements (Hydrogen, Helium and Lithium [2]) were created at the time of the Big Bang and therefore present in the early universe. All the other heavier elements we now see around us were produced at a later time by nucleosynthesis inside stars. In those "element factories", nuclei of the lighter elements are smashed together whereby they become the nuclei of heavier ones - this process is known as nuclear fusion . In our Sun and similar stars, Hydrogen is being fused into Helium. At some stage, Helium is fused into Carbon, then Oxygen, etc. The fusion process requires positively charged nuclei to move very close to each other before they can unite. But with increasing

  14. Atomic diffusion in stars

    CERN Document Server

    Michaud, Georges; Richer, Jacques

    2015-01-01

    This book gives an overview of atomic diffusion, a fundamental physical process, as applied to all types of stars, from the main sequence to neutron stars. The superficial abundances of stars as well as their evolution can be significantly affected. The authors show where atomic diffusion plays an essential role and how it can be implemented in modelling.  In Part I, the authors describe the tools that are required to include atomic diffusion in models of stellar interiors and atmospheres. An important role is played by the gradient of partial radiative pressure, or radiative acceleration, which is usually neglected in stellar evolution. In Part II, the authors systematically review the contribution of atomic diffusion to each evolutionary step. The dominant effects of atomic diffusion are accompanied by more subtle effects on a large number of structural properties throughout evolution. One of the goals of this book is to provide the means for the astrophysicist or graduate student to evaluate the importanc...

  15. Dynamical Boson Stars

    Directory of Open Access Journals (Sweden)

    Steven L. Liebling

    2012-05-01

    Full Text Available The idea of stable, localized bundles of energy has strong appeal as a model for particles. In the 1950s, John Wheeler envisioned such bundles as smooth configurations of electromagnetic energy that he called geons, but none were found. Instead, particle-like solutions were found in the late 1960s with the addition of a scalar field, and these were given the name boson stars. Since then, boson stars find use in a wide variety of models as sources of dark matter, as black hole mimickers, in simple models of binary systems, and as a tool in finding black holes in higher dimensions with only a single Killing vector. We discuss important varieties of boson stars, their dynamic properties, and some of their uses, concentrating on recent efforts.

  16. GRACE star camera noise

    Science.gov (United States)

    Harvey, Nate

    2016-08-01

    Extending results from previous work by Bandikova et al. (2012) and Inacio et al. (2015), this paper analyzes Gravity Recovery and Climate Experiment (GRACE) star camera attitude measurement noise by processing inter-camera quaternions from 2003 to 2015. We describe a correction to star camera data, which will eliminate a several-arcsec twice-per-rev error with daily modulation, currently visible in the auto-covariance function of the inter-camera quaternion, from future GRACE Level-1B product releases. We also present evidence supporting the argument that thermal conditions/settings affect long-term inter-camera attitude biases by at least tens-of-arcsecs, and that several-to-tens-of-arcsecs per-rev star camera errors depend largely on field-of-view.

  17. Molecules in stars

    International Nuclear Information System (INIS)

    Tsuji, T.

    1986-01-01

    Recently, research related to molecules in stars has rapidly expanded because of progress in related fields. For this reason, it is almost impossible to cover all the topics related to molecules in stars. Thus, here the authors focus their attention on molecules in the atmospheres of cool stars and do not cover in any detail topics related to circumstellar molecules originating from expanding envelopes located far from the stellar surface. However, the authors do discuss molecules in quasi-static circumstellar envelopes (a recently discovered new component of circumstellar envelopes) located near the stellar surface, since molecular lines originating from such envelopes show little velocity shift relative to photospheric lines, and hence they directly affect the interpretation and analysis of stellar spectra

  18. CARBON NEUTRON STAR ATMOSPHERES

    International Nuclear Information System (INIS)

    Suleimanov, V. F.; Klochkov, D.; Werner, K.; Pavlov, G. G.

    2014-01-01

    The accuracy of measuring the basic parameters of neutron stars is limited in particular by uncertainties in the chemical composition of their atmospheres. For example, the atmospheres of thermally emitting neutron stars in supernova remnants might have exotic chemical compositions, and for one of them, the neutron star in Cas A, a pure carbon atmosphere has recently been suggested by Ho and Heinke. To test this composition for other similar sources, a publicly available detailed grid of the carbon model atmosphere spectra is needed. We have computed this grid using the standard local thermodynamic equilibrium approximation and assuming that the magnetic field does not exceed 10 8  G. The opacities and pressure ionization effects are calculated using the Opacity Project approach. We describe the properties of our models and investigate the impact of the adopted assumptions and approximations on the emergent spectra

  19. Instability and star evolution

    International Nuclear Information System (INIS)

    Mirzoyan, L.V.

    1981-01-01

    The observational data are discussed which testify that the phenomena of dynamical instability of stars and stellar systems are definite manifestations of their evolution. The study of these phenomena has shown that the instability is a regular phase of stellar evolution. It has resulted in the recognition of the most important regularities of the process of star formation concerning its nature. This became possible due to the discovery in 1947 of stellar associations in our Galaxy. The results of the study of the dynamical instability of stellar associations contradict the predictions of classical hypothesis of stellar condensation. These data supplied a basis for a new hypothesis on the formation of stars and nebulae by the decay of superdense protostars [ru

  20. The twinkling of stars

    International Nuclear Information System (INIS)

    Jakeman, E.; Parry, G.; Pike, E.R.; Pusey, P.N.

    1978-01-01

    This article collects together some of the main ideas and experimental results on the twinkling of stars. Statistical methods are used to characterise the features of the scintillation and to investigate the ways in which these depend on the zenith angle of the star, the bandwidth of the light and various other parameters. Some new results are included which demonstrate the advantages of using photon counting methods in experiments on stellar scintillation. Since the twinkling of stars is a consequence of the turbulence in the Earth's magnetic atmosphere then measurements can be used to deduce some features of the structure of the turbulence. Some of the experiments designed to do this are discussed and the results reported. (author)

  1. Weighing the Smallest Stars

    Science.gov (United States)

    2005-01-01

    VLT Finds Young, Very Low Mass Objects Are Twice As Heavy As Predicted Summary Thanks to the powerful new high-contrast camera installed at the Very Large Telescope, photos have been obtained of a low-mass companion very close to a star. This has allowed astronomers to measure directly the mass of a young, very low mass object for the first time. The object, more than 100 times fainter than its host star, is still 93 times as massive as Jupiter. And it appears to be almost twice as heavy as theory predicts it to be. This discovery therefore suggests that, due to errors in the models, astronomers may have overestimated the number of young "brown dwarfs" and "free floating" extrasolar planets. PR Photo 03/05: Near-infrared image of AB Doradus A and its companion (NACO SDI/VLT) A winning combination A star can be characterised by many parameters. But one is of uttermost importance: its mass. It is the mass of a star that will decide its fate. It is thus no surprise that astronomers are keen to obtain a precise measure of this parameter. This is however not an easy task, especially for the least massive ones, those at the border between stars and brown dwarf objects. Brown dwarfs, or "failed stars", are objects which are up to 75 times more massive than Jupiter, too small for major nuclear fusion processes to have ignited in its interior. To determine the mass of a star, astronomers generally look at the motion of stars in a binary system. And then apply the same method that allows determining the mass of the Earth, knowing the distance of the Moon and the time it takes for its satellite to complete one full orbit (the so-called "Kepler's Third Law"). In the same way, they have also measured the mass of the Sun by knowing the Earth-Sun distance and the time - one year - it takes our planet to make a tour around the Sun. The problem with low-mass objects is that they are very faint and will often be hidden in the glare of the brighter star they orbit, also when viewed

  2. General Relativity and Compact Stars

    International Nuclear Information System (INIS)

    Glendenning, Norman K.

    2005-01-01

    Compact stars--broadly grouped as neutron stars and white dwarfs--are the ashes of luminous stars. One or the other is the fate that awaits the cores of most stars after a lifetime of tens to thousands of millions of years. Whichever of these objects is formed at the end of the life of a particular luminous star, the compact object will live in many respects unchanged from the state in which it was formed. Neutron stars themselves can take several forms--hyperon, hybrid, or strange quark star. Likewise white dwarfs take different forms though only in the dominant nuclear species. A black hole is probably the fate of the most massive stars, an inaccessible region of spacetime into which the entire star, ashes and all, falls at the end of the luminous phase. Neutron stars are the smallest, densest stars known. Like all stars, neutron stars rotate--some as many as a few hundred times a second. A star rotating at such a rate will experience an enormous centrifugal force that must be balanced by gravity or else it will be ripped apart. The balance of the two forces informs us of the lower limit on the stellar density. Neutron stars are 10 14 times denser than Earth. Some neutron stars are in binary orbit with a companion. Application of orbital mechanics allows an assessment of masses in some cases. The mass of a neutron star is typically 1.5 solar masses. They can therefore infer their radii: about ten kilometers. Into such a small object, the entire mass of our sun and more, is compressed

  3. Atmospheres of central stars

    International Nuclear Information System (INIS)

    Hummer, D.G.

    1978-01-01

    The author presents a brief summary of atmospheric models that are of possible relevance to the central stars of planetary nebulae, and then discusses the extent to which these models accord with the observations of both nebulae and central stars. Particular attention is given to the significance of the very high Zanstra temperature implied by the nebulae He II lambda 4686 A line, and to the discrepancy between the Zanstra He II temperature and the considerably lower temperatures suggested by the appearance of the visual spectrum for some of these objects. (Auth.)

  4. The Drifting Star

    Science.gov (United States)

    2008-04-01

    By studying in great detail the 'ringing' of a planet-harbouring star, a team of astronomers using ESO's 3.6-m telescope have shown that it must have drifted away from the metal-rich Hyades cluster. This discovery has implications for theories of star and planet formation, and for the dynamics of our Milky Way. ESO PR Photo 09a/08 ESO PR Photo 09a/08 Iota Horologii The yellow-orange star Iota Horologii, located 56 light-years away towards the southern Horologium ("The Clock") constellation, belongs to the so-called "Hyades stream", a large number of stars that move in the same direction. Previously, astronomers using an ESO telescope had shown that the star harbours a planet, more than 2 times as large as Jupiter and orbiting in 320 days (ESO 12/99). But until now, all studies were unable to pinpoint the exact characteristics of the star, and hence to understand its origin. A team of astronomers, led by Sylvie Vauclair from the University of Toulouse, France, therefore decided to use the technique of 'asteroseismology' to unlock the star's secrets. "In the same way as geologists monitor how seismic waves generated by earthquakes propagate through the Earth and learn about the inner structure of our planet, it is possible to study sound waves running through a star, which forms a sort of large, spherical bell," says Vauclair. The 'ringing' from this giant musical instrument provides astronomers with plenty of information about the physical conditions in the star's interior. And to 'listen to the music', the astronomers used one of the best instruments available. The observations were conducted in November 2006 during 8 consecutive nights with the state-of-the-art HARPS spectrograph mounted on the ESO 3.6-m telescope at La Silla. Up to 25 'notes' could be identified in the unique dataset, most of them corresponding to waves having a period of about 6.5 minutes. These observations allowed the astronomers to obtain a very precise portrait of Iota Horologii: its

  5. The star of Bethlehem

    International Nuclear Information System (INIS)

    Hughes, D.W.

    1976-01-01

    It is stated that the cause and form of the star are still uncertain. The astrologically significant triple conjunction of Saturn and Jupiter in the constellation of Pisces appears to be the most likely explanation, although the two comets of March 5 BC and April 4 BC cannot be dismissed, nor can the possibility that the 'star' was simply legendary. The conjunction occurred in 7 BC and there are indications that Jesus Christ was probably born in the Autumn of that year, around October 7 BC. (U.K.)

  6. The formation of stars

    CERN Document Server

    Stahler, Steven W

    2008-01-01

    This book is a comprehensive treatment of star formation, one of the most active fields of modern astronomy. The reader is guided through the subject in a logically compelling manner. Starting from a general description of stars and interstellar clouds, the authors delineate the earliest phases of stellar evolution. They discuss formation activity not only in the Milky Way, but also in other galaxies, both now and in the remote past. Theory and observation are thoroughly integrated, with the aid of numerous figures and images. In summary, this volume is an invaluable resource, both as a text f

  7. Chaplygin dark star

    International Nuclear Information System (INIS)

    Bertolami, O.; Paramos, J.

    2005-01-01

    We study the general properties of a spherically symmetric body described through the generalized Chaplygin equation of state. We conclude that such an object, dubbed generalized Chaplygin dark star, should exist within the context of the generalized Chaplygin gas (GCG) model of unification of dark energy and dark matter, and derive expressions for its size and expansion velocity. A criteria for the survival of the perturbations in the GCG background that give origin to the dark star are developed, and its main features are analyzed

  8. Sourcing Life Cycle Inventory Data

    Science.gov (United States)

    The collection and validation of quality lifecycle inventory (LCI) data can be the most difficult and time-consuming aspect of developing a life cycle assessment (LCA). Large amounts of process and production data are needed to complete the LCI. For many studies, the LCA analyst ...

  9. Distribution method optimization : inventory flexibility

    NARCIS (Netherlands)

    Asipko, D.

    2010-01-01

    This report presents the outcome of the Logistics Design Project carried out for Nike Inc. This project has two goals: create a model to measure a flexibility aspect of the inventory usage in different Nike distribution channels, and analyze opportunities of changing the decision model of splitting

  10. Wisconsin's fourth forest inventory, 1983.

    Science.gov (United States)

    John S. Jr. Spencer; W. Brad Smith; Jerold T. Hahn; Gerhard K. Raile

    1988-01-01

    The fourth inventory of the timber resource of Wisconsin shows that growing-stock volume increased from 11.2 to 15.5 billion cubic feet between 1968 and 1983, and area of timberland increased from 14.5 to 14.8 million acres. Presented are analysis and statistics on forest area and timber volume, growth, mortality, removals, and projections.

  11. Stable isotope research pool inventory

    International Nuclear Information System (INIS)

    1980-12-01

    This report contains a listing of electromagnetically separated stable isotopes which are available for distribution within the United States for non-destructive research use from the Oak Ridge National Laboratory on a loan basis. This inventory includes all samples of stable isotopes in the Materials Research Collection and does not designate whether a sample is out on loan or in reprocessing

  12. Automated Interactive Storeroom Inventory System.

    Science.gov (United States)

    Sapp, Albert L.; Hess, Larry G.

    1989-01-01

    The inventory system designed for six storerooms in three buildings at the University of Illinois at Urbana-Champaign's School of Chemical Sciences replaced an issue-slip and transactions record system with barcode technology. Data collection error reductions have been significant, making it easier to determine stock levels and plan purchases.…

  13. ENERGY STAR Certified Commercial Dishwashers

    Data.gov (United States)

    U.S. Environmental Protection Agency — Certified models meet all ENERGY STAR requirements as listed in the Version 2.0 ENERGY STAR Program Requirements for Commercial Dishwashers that are effective as of...

  14. ENERGY STAR Certified Commercial Ovens

    Data.gov (United States)

    U.S. Environmental Protection Agency — Certified models meet all ENERGY STAR requirements as listed in the Version 2.2 ENERGY STAR Program Requirements for Commercial Ovens that are effective as of...

  15. Star Formation in Irregular Galaxies.

    Science.gov (United States)

    Hunter, Deidre; Wolff, Sidney

    1985-01-01

    Examines mechanisms of how stars are formed in irregular galaxies. Formation in giant irregular galaxies, formation in dwarf irregular galaxies, and comparisons with larger star-forming regions found in spiral galaxies are considered separately. (JN)

  16. ENERGY STAR Certified Commercial Boilers

    Data.gov (United States)

    U.S. Environmental Protection Agency — Certified models meet all ENERGY STAR requirements as listed in the Version 1.0 ENERGY STAR Program Requirements for Commercial Boilers that are effective as of...

  17. Photometry of faint blue stars

    International Nuclear Information System (INIS)

    Kilkenny, D.; Hill, P.W.; Brown, A.

    1977-01-01

    Photometry on the uvby system is given for 61 faint blue stars. The stars are classified by means of the Stromgren indices, using criteria described in a previous paper (Kilkenny and Hill (1975)). (author)

  18. ENERGY STAR Certified Commercial Griddles

    Data.gov (United States)

    U.S. Environmental Protection Agency — Certified models meet all ENERGY STAR requirements as listed in the Version 1.2 ENERGY STAR Program Requirements for Commercial Griddles that are effective as of May...

  19. ENERGY STAR Certified Smart Thermostats

    Data.gov (United States)

    U.S. Environmental Protection Agency — Certified models meet all ENERGY STAR requirements as listed in the Version 1.0 ENERGY STAR Program Requirements for Connected Thermostats that are effective as of...

  20. ENERGY STAR Certified Residential Dishwashers

    Data.gov (United States)

    U.S. Environmental Protection Agency — Certified models meet all ENERGY STAR requirements as listed in the Version 6.0 ENERGY STAR Program Requirements for Residential Dishwashers that are effective as of...

  1. ENERGY STAR Certified Roof Products

    Data.gov (United States)

    U.S. Environmental Protection Agency — Certified models meet all ENERGY STAR requirements as listed in the Version 3.0 ENERGY STAR Program Requirements for Roof Products that are effective as of July 1,...

  2. ENERGY STAR Certified Pool Pumps

    Data.gov (United States)

    U.S. Environmental Protection Agency — Certified models meet all ENERGY STAR requirements as listed in the Version 1.1 ENERGY STAR Program Requirements for Pool Pumps that are effective as of February 15,...

  3. Understand B-type stars

    Science.gov (United States)

    1982-01-01

    When observations of B stars made from space are added to observations made from the ground and the total body of observational information is confronted with theoretical expectations about B stars, it is clear that nonthermal phenomena occur in the atmospheres of B stars. The nature of these phenomena and what they imply about the physical state of a B star and how a B star evolves are examined using knowledge of the spectrum of a B star as a key to obtaining an understanding of what a B star is like. Three approaches to modeling stellar structure (atmospheres) are considered, the characteristic properties of a mantle, and B stars and evolution are discussed.

  4. ENERGY STAR Certified Imaging Equipment

    Data.gov (United States)

    U.S. Environmental Protection Agency — Certified models meet all ENERGY STAR requirements as listed in the Version 2.0 ENERGY STAR Program Requirements for Imaging Equipment that are effective as of...

  5. ENERGY STAR Certified Vending Machines

    Data.gov (United States)

    U.S. Environmental Protection Agency — Certified models meet all ENERGY STAR requirements as listed in the Version 3.1 ENERGY STAR Program Requirements for Refrigerated Beverage Vending Machines that are...

  6. ENERGY STAR Certified Water Coolers

    Data.gov (United States)

    U.S. Environmental Protection Agency — Certified models meet all ENERGY STAR requirements as listed in the Version 2.0 ENERGY STAR Program Requirements for Water Coolers that are effective as of February...

  7. ENERGY STAR Certified Audio Video

    Data.gov (United States)

    U.S. Environmental Protection Agency — Certified models meet all ENERGY STAR requirements as listed in the Version 3.0 ENERGY STAR Program Requirements for Audio Video Equipment that are effective as of...

  8. ENERGY STAR Certified Ceiling Fans

    Data.gov (United States)

    U.S. Environmental Protection Agency — Certified models meet all ENERGY STAR requirements as listed in the Version 3.1 ENERGY STAR Program Requirements for Ceiling Fans that are effective as of April 1,...

  9. ENERGY STAR Certified Ventilating Fans

    Data.gov (United States)

    U.S. Environmental Protection Agency — Certified models meet all ENERGY STAR requirements as listed in the Version 4.0 ENERGY STAR Program Requirements for Ventilating Fans that are effective as of...

  10. ENERGY STAR Certified Commercial Fryers

    Data.gov (United States)

    U.S. Environmental Protection Agency — Certified models meet all ENERGY STAR requirements as listed in the Version 3.0 ENERGY STAR Program Requirements for Commercial Fryers that are effective as of...

  11. Lithium in the barium stars

    International Nuclear Information System (INIS)

    Pinsonneault, M.H.; Sneden, C.

    1984-01-01

    New high-resolution spectra of the lithium resonance doublet have provided lithium abundances or upper limits for 26 classical and mild barium stars. The lithium lines always are present in the classical barium stars. Lithium abundances in these stars obey a trend with stellar masses consistent with that previously derived for ordinary K giants. This supports the notion that classical barium stars are post-core-He-flash or core-He-burning stars. Lithium contents in the mild barium stars, however, often are much smaller than those of the classical barium stars sometimes only upper limits may be determined. The cause for this difference is not easily understood, but may be related to more extensive mass loss by the mild barium stars. 45 references

  12. Which of Kepler's Stars Flare?

    Science.gov (United States)

    Kohler, Susanna

    2017-12-01

    The habitability of distant exoplanets is dependent upon many factors one of which is the activity of their host stars. To learn about which stars are most likely to flare, a recent study examines tens of thousands of stellar flares observed by Kepler.Need for a Broader SampleArtists rendering of a flaring dwarf star. [NASAs Goddard Space Flight Center/S. Wiessinger]Most of our understanding of what causes a star to flare is based on observations of the only star near enough to examine in detail the Sun. But in learning from a sample size of one, a challenge arises: we must determine which conclusions are unique to the Sun (or Sun-like stars), and which apply to other stellar types as well.Based on observations and modeling, astronomers think that stellar flares result from the reconnection of magnetic field lines in a stars outer atmosphere, the corona. The magnetic activity is thought to be driven by a dynamo caused by motions in the stars convective zone.HR diagram of the Kepler stars, with flaring main-sequence (yellow), giant (red) and A-star (green) stars in the authors sample indicated. [Van Doorsselaere et al. 2017]To test whether these ideas are true generally, we need to understand what types of stars exhibit flares, and what stellar properties correlate with flaring activity. A team of scientists led by Tom Van Doorsselaere (KU Leuven, Belgium) has now used an enormous sample of flares observed by Kepler to explore these statistics.Intriguing TrendsVan Doorsselaere and collaborators used a new automated flare detection and characterization algorithm to search through the raw light curves from Quarter 15 of the Kepler mission, building a sample of 16,850 flares on 6,662 stars. They then used these to study the dependence of the flare occurrence rate, duration, energy, and amplitude on the stellar spectral type and rotation period.This large statistical study led the authors to several interesting conclusions, including:Flare star incidence rate as a a

  13. ENERGY STAR Certified Residential Freezers

    Data.gov (United States)

    U.S. Environmental Protection Agency — Certified models meet all ENERGY STAR requirements as listed in the Version 5.0 ENERGY STAR Program Requirements for Residential Refrigerators and Freezers that are...

  14. ENERGY STAR Certified Residential Refrigerators

    Data.gov (United States)

    U.S. Environmental Protection Agency — Certified models meet all ENERGY STAR requirements as listed in the Version 5.0 ENERGY STAR Program Requirements for Residential Refrigerators and Freezers that are...

  15. Distances of Dwarf Carbon Stars

    Science.gov (United States)

    Harris, Hugh C.; Dahn, Conard C.; Subasavage, John P.; Munn, Jeffrey A.; Canzian, Blaise J.; Levine, Stephen E.; Monet, Alice B.; Pier, Jeffrey R.; Stone, Ronald C.; Tilleman, Trudy M.; Hartkopf, William I.

    2018-06-01

    Parallaxes are presented for a sample of 20 nearby dwarf carbon stars. The inferred luminosities cover almost two orders of magnitude. Their absolute magnitudes and tangential velocities confirm prior expectations that some originate in the Galactic disk, although more than half of this sample are halo stars. Three stars are found to be astrometric binaries, and orbital elements are determined; their semimajor axes are 1–3 au, consistent with the size of an AGB mass-transfer donor star.

  16. RADIAL STABILITY IN STRATIFIED STARS

    International Nuclear Information System (INIS)

    Pereira, Jonas P.; Rueda, Jorge A.

    2015-01-01

    We formulate within a generalized distributional approach the treatment of the stability against radial perturbations for both neutral and charged stratified stars in Newtonian and Einstein's gravity. We obtain from this approach the boundary conditions connecting any two phases within a star and underline its relevance for realistic models of compact stars with phase transitions, owing to the modification of the star's set of eigenmodes with respect to the continuous case

  17. Inventory on cleaner production education and training

    DEFF Research Database (Denmark)

    Jørgensen, Michael Søgaard; Pöyry, Sirkka; Huisingh, Donald

    Analysis and presentation of the data from an international inventory on cleaner production education and training......Analysis and presentation of the data from an international inventory on cleaner production education and training...

  18. Ottawa National Wildlife Refuge : Wildlife Inventory Plan

    Data.gov (United States)

    Department of the Interior — This Wildlife Inventory Plan for Ottawa NWR describes the inventory program’s relation to Refuge objectives and outlines the program’s policies and administration....

  19. CoC Housing Inventory Count Reports

    Data.gov (United States)

    Department of Housing and Urban Development — Continuum of Care (CoC) Homeless Assistance Programs Housing Inventory Count Reports are a snapshot of a CoC’s housing inventory, available at the national and state...

  20. New stars for old

    International Nuclear Information System (INIS)

    Henbest, N.

    1980-01-01

    Observations of novas made through the ages, the identity of the close double stars which make up these cataclysmic variables and the physics of nova explosions, are discussed. A picture is outlined which explains novas, dwarf novas and recurrent novas and provides a basis for interpreting the latest so called x-ray novas. (U.K.)

  1. Hadrons in compact stars

    Indian Academy of Sciences (India)

    At normal nuclear matter density, neutron star matter mainly consists of neutrons, protons and electrons. The particle population is so arranged as to attain a min- imum energy configuration maintaining electrical charge neutrality and chemical equilibrium. At higher baryon density, hyperon formation becomes energetically.

  2. Millet's Shooting Stars

    Science.gov (United States)

    Beech, M.

    1988-12-01

    In this essay two paintings by the French artist Jean-Francois Millet are described. These paintings, Les Etoiles Filantes and Nuit Etoilée are particularly interesting since they demonstrate the rare artistic employment of the shooting-star image and metaphor.

  3. Asteroseismology of Scuti Stars

    Indian Academy of Sciences (India)

    Abstract. We briefly outline the state-of-the-art seismology of Scuti stars from a theoretical point of view: why is it so difficult a task? The recent theoretical advances in the field that these difficulties have influenced are also discussed.

  4. The STAR trigger

    International Nuclear Information System (INIS)

    Bieser, F.S.; Crawford, H.J.; Engelage, J.; Eppley, G.; Greiner, L.C.; Judd, E.G.; Klein, S.R.; Meissner, F.; Minor, R.; Milosevich, Z.; Mutchler, G.; Nelson, J.M.; Schambach, J.; VanderMolen, A.S.; Ward, H.; Yepes, P.

    2003-01-01

    We describe the trigger system that we designed and implemented for the STAR detector at RHIC. This is a 10 MHz pipelined system based on fast detector output that controls the event selection for the much slower tracking detectors. Results from the first run are presented and new detectors for the 2001 run are discussed

  5. Sleeping under the stars

    Science.gov (United States)

    Zirkel, Jack

    Sherlock Holmes and Dr. Watson went on a camping trip. As they lay down for the night, Holmes said, “Watson, look up at the sky and tell me what you see.”Watson:“! see millions and millions of stars.”

  6. Insight into star death

    International Nuclear Information System (INIS)

    Talcott, R.

    1988-01-01

    Nineteen neutrinos, formed in the center of a supernova, became a theorist's dream. They came straight from the heart of supernova 1987A and landed in two big underground tanks of water. Suddenly a new chapter in observational astronomy opened as these two neutrino telescopes gave astronomers their first look ever into the core of a supernova explosion. But the theorists' dream almost turned into a nightmare. Observations of the presupernova star showed conclusively that the star was a blue supergiant, but theorists have long believed only red supergiant stars could explode as supernovae. Do astronomers understand supernovae better now than when supernova 1987A exploded in the Large Magellanic Cloud (LMC) one year ago? Yes. The observations of neutrinos spectacularly confirmed a vital aspect of supernova theory. But the observed differences between 1987A and other supernovae have illuminated and advanced our perception of how supernovae form. By working together, observers and theorists are continuing to hone their ideas about how massive stars die and how the subsequent supernovae behave

  7. StarLogo TNG

    Science.gov (United States)

    Klopfer, Eric; Scheintaub, Hal; Huang, Wendy; Wendel, Daniel

    Computational approaches to science are radically altering the nature of scientific investigatiogn. Yet these computer programs and simulations are sparsely used in science education, and when they are used, they are typically “canned” simulations which are black boxes to students. StarLogo The Next Generation (TNG) was developed to make programming of simulations more accessible for students and teachers. StarLogo TNG builds on the StarLogo tradition of agent-based modeling for students and teachers, with the added features of a graphical programming environment and a three-dimensional (3D) world. The graphical programming environment reduces the learning curve of programming, especially syntax. The 3D graphics make for a more immersive and engaging experience for students, including making it easy to design and program their own video games. Another change to StarLogo TNG is a fundamental restructuring of the virtual machine to make it more transparent. As a result of these changes, classroom use of TNG is expanding to new areas. This chapter is concluded with a description of field tests conducted in middle and high school science classes.

  8. THE STAR OFFLINE FRAMEWORK

    International Nuclear Information System (INIS)

    FINE, V.; FISYAK, Y.; PEREVOZTCHIKOV, V.; WENAUS, T.

    2000-01-01

    The Solenoidal Tracker At RHIC (STAR) is a-large acceptance collider detector, commissioned at Brookhaven National Laboratory in 1999. STAR has developed a software framework supporting simulation, reconstruction and analysis in offline production, interactive physics analysis and online monitoring environments that is well matched both to STAR's present status of transition between Fortran and C++ based software and to STAR's evolution to a fully OO software base. This paper presents the results of two years effort developing a modular C++ framework based on the ROOT package that encompasses both wrapped Fortran components (legacy simulation and reconstruction code) served by IDL-defined data structures, and fully OO components (all physics analysis code) served by a recently developed object model for event data. The framework supports chained components, which can themselves be composite subchains, with components (''makers'') managing ''data sets'' they have created and are responsible for. An St-DataSet class from which data sets and makers inherit allows the construction of hierarchical organizations of components and data, and centralizes almost all system tasks such as data set navigation, I/O, database access, and inter-component communication. This paper will present an overview of this system, now deployed and well exercised in production environments with real and simulated data, and in an active physics analysis development program

  9. Triggered star formation

    Czech Academy of Sciences Publication Activity Database

    Palouš, Jan; Ehlerová, Soňa

    2002-01-01

    Roč. 12, - (2002), s. 35-36 ISSN 1405-2059 R&D Projects: GA AV ČR IAA3003705; GA AV ČR KSK1048102 Institutional research plan: CEZ:AV0Z1003909 Keywords : interstellar medium * star formation * HI shells Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics

  10. Highlights from STAR

    International Nuclear Information System (INIS)

    Schweda, Kai

    2004-01-01

    Selected results from the STAR collaboration are presented. We focus on recent results on jet-like correlations, nuclear modification factors of identified hadrons, elliptic flow of multi-strange baryons Ξ and Ω, and resonance yields. First measurements of open charm production at RHIC are presented

  11. Supernovae from massive AGB stars

    NARCIS (Netherlands)

    Poelarends, A.J.T.; Izzard, R.G.; Herwig, F.; Langer, N.; Heger, A.

    2006-01-01

    We present new computations of the final fate of massive AGB-stars. These stars form ONeMg cores after a phase of carbon burning and are called Super AGB stars (SAGB). Detailed stellar evolutionary models until the thermally pulsing AGB were computed using three di erent stellar evolution codes. The

  12. Do All O Stars Form in Star Clusters?

    Science.gov (United States)

    Weidner, C.; Gvaramadze, V. V.; Kroupa, P.; Pflamm-Altenburg, J.

    The question whether or not massive stars can form in isolation or only in star clusters is of great importance for the theory of (massive) star formation as well as for the stellar initial mass function of whole galaxies (IGIMF-theory). While a seemingly easy question it is rather difficult to answer. Several physical processes (e.g. star-loss due to stellar dynamics or gas expulsion) and observational limitations (e.g. dust obscuration of young clusters, resolution) pose severe challenges to answer this question. In this contribution we will present the current arguments in favour and against the idea that all O stars form in clusters.

  13. Halo Star Lithium Depletion

    International Nuclear Information System (INIS)

    Pinsonneault, M. H.; Walker, T. P.; Steigman, G.; Narayanan, Vijay K.

    1999-01-01

    The depletion of lithium during the pre-main-sequence and main-sequence phases of stellar evolution plays a crucial role in the comparison of the predictions of big bang nucleosynthesis with the abundances observed in halo stars. Previous work has indicated a wide range of possible depletion factors, ranging from minimal in standard (nonrotating) stellar models to as much as an order of magnitude in models that include rotational mixing. Recent progress in the study of the angular momentum evolution of low-mass stars permits the construction of theoretical models capable of reproducing the angular momentum evolution of low-mass open cluster stars. The distribution of initial angular momenta can be inferred from stellar rotation data in young open clusters. In this paper we report on the application of these models to the study of lithium depletion in main-sequence halo stars. A range of initial angular momenta produces a range of lithium depletion factors on the main sequence. Using the distribution of initial conditions inferred from young open clusters leads to a well-defined halo lithium plateau with modest scatter and a small population of outliers. The mass-dependent angular momentum loss law inferred from open cluster studies produces a nearly flat plateau, unlike previous models that exhibited a downward curvature for hotter temperatures in the 7Li-Teff plane. The overall depletion factor for the plateau stars is sensitive primarily to the solar initial angular momentum used in the calibration for the mixing diffusion coefficients. Uncertainties remain in the treatment of the internal angular momentum transport in the models, and the potential impact of these uncertainties on our results is discussed. The 6Li/7Li depletion ratio is also examined. We find that the dispersion in the plateau and the 6Li/7Li depletion ratio scale with the absolute 7Li depletion in the plateau, and we use observational data to set bounds on the 7Li depletion in main-sequence halo

  14. Inventory Investment and the Real Interest Rate

    OpenAIRE

    Junayed, Sadaquat; Khan, Hashmat

    2009-01-01

    The relationship between inventory investment and the real interest rate has been difficult to assess empirically. Recent work has proposed a linear-quadratic inventory model with time-varying discount factor to identify the effects of the real interest rate on inventory investment. The authors show that this framework does not separately identify the effects of real interest rate on inventory investment from variables that determine the expected marginal cost of production. In other words, t...

  15. Kinematic and spatial distributions of barium stars - are the barium stars and Am stars related?

    International Nuclear Information System (INIS)

    Hakkila, J.

    1989-01-01

    The possibility of an evolutionary link between Am stars and barium stars is considered, and an examination of previous data suggests that barium star precursors are main-sequence stars of intermediate mass, are most likely A and/or F dwarfs, and are intermediate-mass binaries with close to intermediate orbital separations. The possible role of mass transfer in the later development of Am systems is explored. Mass transfer and loss from systems with a range of masses and orbital separations may explain such statistical peculiarities of barium stars as the large dispersion in absolute magnitude, the large range of elemental abundances from star to star, and the small number of stars with large peculiar velocities. 93 refs

  16. 42 CFR 35.41 - Inventory.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Inventory. 35.41 Section 35.41 Public Health PUBLIC... STATION MANAGEMENT Disposal of Money and Effects of Deceased Patients § 35.41 Inventory. Promptly after the death of a patient in a station or hospital of the Service, an inventory of his money and effects...

  17. 7 CFR 984.21 - Handler inventory.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Handler inventory. 984.21 Section 984.21 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... Regulating Handling Definitions § 984.21 Handler inventory. Handler inventory as of any date means all...

  18. 26 CFR 1.1374-7 - Inventory.

    Science.gov (United States)

    2010-04-01

    ... 26 Internal Revenue 11 2010-04-01 2010-04-01 true Inventory. 1.1374-7 Section 1.1374-7 Internal... TAXES Small Business Corporations and Their Shareholders § 1.1374-7 Inventory. (a) Valuation. The fair market value of the inventory of an S corporation on the first day of the recognition period equals the...

  19. 10 CFR 34.29 - Quarterly inventory.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false Quarterly inventory. 34.29 Section 34.29 Energy NUCLEAR... RADIOGRAPHIC OPERATIONS Equipment § 34.29 Quarterly inventory. (a) Each licensee shall conduct a quarterly physical inventory to account for all sealed sources and for devices containing depleted uranium received...

  20. 77 FR 5280 - Service Contracts Inventory

    Science.gov (United States)

    2012-02-02

    ... NUCLEAR REGULATORY COMMISSION [NRC-2012-0023] Service Contracts Inventory AGENCY: Nuclear...) is providing for public information its Inventory of Contracts for Services for Fiscal Year (FY) 2011. The inventory includes service contract actions over $25,000 that were awarded in FY 2011. ADDRESSES...

  1. 75 FR 82095 - Service Contracts Inventory

    Science.gov (United States)

    2010-12-29

    ... NUCLEAR REGULATORY COMMISSION [NRC-2010-0394] Service Contracts Inventory AGENCY: U.S. Nuclear...) is providing for public information its Inventory of Contracts for Services for Fiscal Year (FY) 2010. The inventory includes service contract actions over $25,000 that were awarded in FY 2010. ADDRESSES...

  2. 78 FR 10642 - Service Contracts Inventory

    Science.gov (United States)

    2013-02-14

    ... NUCLEAR REGULATORY COMMISSION [NRC-2013-0029] Service Contracts Inventory AGENCY: Nuclear...) is providing for public information its Inventory of Contracts for Services for Fiscal Year (FY) 2012. The inventory includes service contract actions over $25,000 that were awarded in FY 2012. ADDRESSES...

  3. 27 CFR 24.266 - Inventory losses.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Inventory losses. 24.266... OF THE TREASURY LIQUORS WINE Losses of Wine § 24.266 Inventory losses. (a) General. The proprietor... reported as required by § 24.313. (b) Bulk wine losses. The physical inventory of bulk wine will determine...

  4. 27 CFR 40.523 - Inventories.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 2 2010-04-01 2010-04-01 false Inventories. 40.523... PROCESSED TOBACCO Manufacture of Processed Tobacco Operations by Manufacturers of Processed Tobacco § 40.523 Inventories. Every manufacturer of processed tobacco must provide a true and accurate inventory on TTB F 5210...

  5. 30 CFR 220.032 - Inventories.

    Science.gov (United States)

    2010-07-01

    ... operations. The accumulation of surplus stocks shall be avoided by proper materiel control, inventory and... physical inventory that has not been credited to NPSL operations under § 220.015(a)(2) shall be credited to... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Inventories. 220.032 Section 220.032 Mineral...

  6. EXPERIMENTAL RESEARCHES OF ELECTRO-THERMAL RESISTIBILITY OF SEND-OFFS AND CABLES TO ACTION RATIONED ON THE INTERNATIONAL STANDARD OF IEC 62305-1-2010 OF APERIODIC IMPULSE OF CURRENT OF ARTIFICIAL LIGHTNING

    Directory of Open Access Journals (Sweden)

    M.I. Baranov

    2016-03-01

    Full Text Available Purpose. Experimental researches of electro-thermal resistibility of cable-explorer products, applied in the power electric circuits of objects of electric-power industry, to action on its copper and aluminum parts bearings a current rationed on the International Standard of IEC 62305-1-2010 aperiodic impulse 10/350 μs of current of artificial lightning. Methodology. Electrophysics bases of technique of high tensions and high pulsed currents (HPC, and also scientific and technical bases of planning of devices of high-voltage impulsive technique and measuring HPC in them. Results. Experimental a way the quantitative levels of maximal values maximum of possible and critical closenesses of aperiodic impulse 10/350 μs of current of artificial lightning with rationed on the international standard of IEC 62305-1-2010 peak-temporal parameters and admittances on them in copper (aluminum parts bearings a current of send-offs and cables with a polyethylene (PET and polyvinylchloride (PVCH isolation. Originality. First in world practice on the unique powerful high-voltage generator of HPC of artificial lightning experimental researches of resistibility to lightning of pre-production models of send-offs (cables are conducted with copper (aluminum tendons, PET and PVCH by an isolation, in-use in power electric circuits of electric-power industry objects. Practical value. The use in practice of protecting from lightning of the got results will allow substantially to promote functional and fire-prevention safety of engineering communications of objects of industrial electroenergy in the conditions of action on them of short shots of linear lightning.

  7. Star identification methods, techniques and algorithms

    CERN Document Server

    Zhang, Guangjun

    2017-01-01

    This book summarizes the research advances in star identification that the author’s team has made over the past 10 years, systematically introducing the principles of star identification, general methods, key techniques and practicable algorithms. It also offers examples of hardware implementation and performance evaluation for the star identification algorithms. Star identification is the key step for celestial navigation and greatly improves the performance of star sensors, and as such the book include the fundamentals of star sensors and celestial navigation, the processing of the star catalog and star images, star identification using modified triangle algorithms, star identification using star patterns and using neural networks, rapid star tracking using star matching between adjacent frames, as well as implementation hardware and using performance tests for star identification. It is not only valuable as a reference book for star sensor designers and researchers working in pattern recognition and othe...

  8. TFTR tritium inventory accountability system

    International Nuclear Information System (INIS)

    Saville, C.; Ascione, G.; Elwood, S.; Nagy, A.; Raftopoulos, S.; Rossmassler, R.; Stencel, J.; Voorhees, D.; Tilson, C.

    1995-01-01

    This paper discusses the program, PPPL (Princeton Plasma Physics Laboratory) Material Control and Accountability Plan, that has been implemented to track US Department of Energy's tritium and all other accountable source material. Specifically, this paper details the methods used to measure tritium in various systems at the Tokamak Fusion Test Reactor; resolve inventory differences; perform inventory by difference inside the Tokamak; process and measure plasma exhaust and other effluent gas streams; process, measure and ship scrap or waste tritium on molecular sieve beds; and detail organizational structure of the Material Control and Accountability group. In addition, this paper describes a Unix-based computerized software system developed at PPPL to account for all tritium movements throughout the facility. 5 refs., 2 figs

  9. Stable isotope research pool inventory

    International Nuclear Information System (INIS)

    1984-03-01

    This report contains a listing of electromagnetically separated stable isotopes which are available at the Oak Ridge National Laboratory for distribution for nondestructive research use on a loan basis. This inventory includes all samples of stable isotopes in the Research Materials Collection and does not designate whether a sample is out on loan or is in reprocessing. For some of the high abundance naturally occurring isotopes, larger amounts can be made available; for example, Ca-40 and Fe-56

  10. Waste management and chemical inventories

    Energy Technology Data Exchange (ETDEWEB)

    Gleckler, B.P.

    1995-06-01

    This section of the 1994 Hanford Site Environmental Report summarizes the classification and handling of waste at the Hanford Site. Waste produced at the Hanford Site is classified as either radioactive, nonradioactive, or mixed waste. Radioactive wastes are further categorized as transuranic, high-level, and low-level. Mixed waste may contain both radioactive and hazardous nonradioactive substances. This section describes waste management practices and chemical inventories at the site.

  11. Radioactive wastes - inventories and classification

    International Nuclear Information System (INIS)

    Brennecke, P.; Hollmann, A.

    1992-01-01

    A survey is given of the origins, types, conditioning, inventories, and expected abundance of radioactive wastes in the future in the Federal Republic of Germany. The Federal Government's radioactive waste disposal scheme provides that radioactive wastes be buried in deep geological formations which are expected to ensure a maintenance-free, unlimited and safe disposal without intentional excavation of the wastes at a later date. (orig./BBR) [de

  12. Waste management and chemical inventories

    International Nuclear Information System (INIS)

    Gleckler, B.P.

    1995-01-01

    This section of the 1994 Hanford Site Environmental Report summarizes the classification and handling of waste at the Hanford Site. Waste produced at the Hanford Site is classified as either radioactive, nonradioactive, or mixed waste. Radioactive wastes are further categorized as transuranic, high-level, and low-level. Mixed waste may contain both radioactive and hazardous nonradioactive substances. This section describes waste management practices and chemical inventories at the site

  13. Radioactive waste inventories and projections

    International Nuclear Information System (INIS)

    McLaren, L.H.

    1982-11-01

    This bibliography contains information on radioactive waste inventories and projections included in the Department of Energy's Energy Data Base from January 1981 through September 1982. The arrangement is by report number for reports, followed by nonreports in reverse chronological order. These citations are to research reports, journal articles, books, patents, theses, and conference papers from worldwide sources. Five indexes, each preceded by a brief description, are provided: Corporate Author, Personal Author, Subject, Contract Number, and Report Number. (25 abstracts)

  14. Stable isotope research pool inventory

    International Nuclear Information System (INIS)

    1982-01-01

    This report contains a listing of electromagnetically separated stable isotopes which are available for distribution within the United States for nondestructive research use from the Oak Ridge National Laboratory on a loan basis. This inventory includes all samples of stable isotopes in the Material Research Collection and does not designate whether a sample is out on loan or in reprocessing. For some of the high abundance naturally occurring isotopes, larger amounts can be made available; for example, Ca-40 and Fe-56

  15. National inventory of radioactive wastes

    International Nuclear Information System (INIS)

    1997-01-01

    There are in France 1064 sites corresponding to radioactive waste holders that appear in this radioactive waste inventory. We find the eighteen sites of E.D.F. nuclear power plants, The Cogema mine sites, the Cogema reprocessing plants, The Cea storages, the different factories and enterprises of nuclear industry, the sites of non nuclear industry, the Andra centers, decommissioned installations, disposals with low level radioactive wastes, sealed sources distributors, national defence. (N.C.)

  16. Ecology of blue straggler stars

    CERN Document Server

    Carraro, Giovanni; Beccari, Giacomo

    2015-01-01

    The existence of blue straggler stars, which appear younger, hotter, and more massive than their siblings, is at odds with a simple picture of stellar evolution. Such stars should have exhausted their nuclear fuel and evolved long ago to become cooling white dwarfs. They are found to exist in globular clusters, open clusters, dwarf spheroidal galaxies of the Local Group, OB associations and as field stars. This book summarises the many advances in observational and theoretical work dedicated to blue straggler stars. Carefully edited extended contributions by well-known experts in the field cover all the relevant aspects of blue straggler stars research: Observations of blue straggler stars in their various environments; Binary stars and formation channels; Dynamics of globular clusters; Interpretation of observational data and comparison with models. The book also offers an introductory chapter on stellar evolution written by the editors of the book.

  17. What Determines Star Formation Rates?

    Science.gov (United States)

    Evans, Neal John

    2017-06-01

    The relations between star formation and gas have received renewed attention. We combine studies on scales ranging from local (within 0.5 kpc) to distant galaxies to assess what factors contribute to star formation. These include studies of star forming regions in the Milky Way, the LMC, nearby galaxies with spatially resolved star formation, and integrated galaxy studies. We test whether total molecular gas or dense gas provides the best predictor of star formation rate. The star formation ``efficiency," defined as star formation rate divided by mass, spreads over a large range when the mass refers to molecular gas; the standard deviation of the log of the efficiency decreases by a factor of three when the mass of relatively dense molecular gas is used rather than the mass of all the molecular gas. We suggest ways to further develop the concept of "dense gas" to incorporate other factors, such as turbulence.

  18. Spectrophotometry of Symbiotic Stars (Abstract)

    Science.gov (United States)

    Boyd, D.

    2017-12-01

    (Abstract only) Symbiotic stars are fascinating objects - complex binary systems comprising a cool red giant star and a small hot object, often a white dwarf, both embedded in a nebula formed by a wind from the giant star. UV radiation from the hot star ionizes the nebula, producing a range of emission lines. These objects have composite spectra with contributions from both stars plus the nebula and these spectra can change on many timescales. Being moderately bright, they lend themselves well to amateur spectroscopy. This paper describes the symbiotic star phenomenon, shows how spectrophotometry can be used to extract astrophysically useful information about the nature of these systems, and gives results for three symbiotic stars based on the author's observations.

  19. Mass loss from S stars

    International Nuclear Information System (INIS)

    Jura, M.

    1988-01-01

    The mass-loss process in S stars is studied using 65 S stars from the listing of Wing and Yorka (1977). The role of pulsations in the mass-loss process is examined. It is detected that stars with larger mass-loss rates have a greater amplitude of pulsations. The dust-to-gas ratio for the S stars is estimated as 0.002 and the average mass-loss rate is about 6 x 10 to the -8th solar masses/yr. Some of the properties of the S stars, such as scale height, surface density, and lifetime, are measured. It is determined that scale height is 200 pc; the total duration of the S star phase is greater than or equal to 30,000 yr; and the stars inject 3 x 10 to the -6th solar masses/sq kpc yr into the interstellar medium. 46 references

  20. 78 FR 17205 - Notice of Availability of Service Contract Inventories

    Science.gov (United States)

    2013-03-20

    ... FEDERAL MARITIME COMMISSION Notice of Availability of Service Contract Inventories AGENCY: Federal Maritime Commission. ACTION: Notice of availability of service contract inventories. FOR FURTHER... Service Contract Inventory Analysis, the FY 2012 Service Contract Inventory, and the FY 2012 Service...

  1. Danish emission inventory for particular matter (PM)

    Energy Technology Data Exchange (ETDEWEB)

    Nielsen, M; Winther, M; Illerup, J B; Hjort Mikkelsen, M

    2003-11-01

    The first Danish emission inventory that was reported in 2002 was a provisional-estimate based on data presently available. This report documents methodology, emission factors and references used for an improved Danish emission inventory for particulate matter. Further results of the improved emission inventory for the year 2000 are shown. The particulate matter emission inventory includes TSP, PM,, and PM, The report covers emission inventories for transport and stationary combustion. An appendix covering emissions from agriculture is also included. For the transport sector, both exhaust and non-exhaust emission such as tyre and break wear and road abrasion are included. (au)

  2. Neutron Star Science with the NuSTAR

    Energy Technology Data Exchange (ETDEWEB)

    Vogel, J. K. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2015-10-16

    The Nuclear Spectroscopic Telescope Array (NuSTAR), launched in June 2012, helped scientists obtain for the first time a sensitive high-­energy X-­ray map of the sky with extraordinary resolution. This pioneering telescope has aided in the understanding of how stars explode and neutron stars are born. LLNL is a founding member of the NuSTAR project, with key personnel on its optics and science team. We used NuSTAR to observe and analyze the observations of different neutron star classes identified in the last decade that are still poorly understood. These studies not only help to comprehend newly discovered astrophysical phenomena and emission processes for members of the neutron star family, but also expand the utility of such observations for addressing broader questions in astrophysics and other physics disciplines. For example, neutron stars provide an excellent laboratory to study exotic and extreme phenomena, such as the equation of state of the densest matter known, the behavior of matter in extreme magnetic fields, and the effects of general relativity. At the same time, knowing their accurate populations has profound implications for understanding the life cycle of massive stars, star collapse, and overall galactic evolution.

  3. White Dwarf Stars

    Science.gov (United States)

    1999-01-01

    Peering deep inside a cluster of several hundred thousand stars, NASA's Hubble Space Telescope has uncovered the oldest burned-out stars in our Milky Way Galaxy, giving astronomers a fresh reading on the age of the universe. Located in the globular cluster M4, these small, burned-out stars -- called white dwarfs -- are about 12 to 13 billion years old. By adding the one billion years it took the cluster to form after the Big Bang, astronomers found that the age of the white dwarfs agrees with previous estimates that the universe is 13 to 14 billion years old. The images, including some taken by Hubble's Wide Field and Planetary Camera 2, are available online at http://oposite.stsci.edu/pubinfo/pr/2002/10/ or http://www.jpl.nasa.gov/images/wfpc . The camera was designed and built by NASA's Jet Propulsion Laboratory, Pasadena, Calif. In the top panel, a ground-based observatory snapped a panoramic view of the entire cluster, which contains several hundred thousand stars within a volume of 10 to 30 light-years across. The Kitt Peak National Observatory's .9-meter telescope took this picture in March 1995. The box at left indicates the region observed by the Hubble telescope. The Hubble telescope studied a small region of the cluster. A section of that region is seen in the picture at bottom left. A sampling of an even smaller region is shown at bottom right. This region is only about one light-year across. In this smaller region, Hubble pinpointed a number of faint white dwarfs. The blue circles indicate the dwarfs. It took nearly eight days of exposure time over a 67-day period to find these extremely faint stars. Globular clusters are among the oldest clusters of stars in the universe. The faintest and coolest white dwarfs within globular clusters can yield a globular cluster's age. Earlier Hubble observations showed that the first stars formed less than 1 billion years after the universe's birth in the big bang. So, finding the oldest stars puts astronomers within

  4. Alchemy of stars

    Energy Technology Data Exchange (ETDEWEB)

    Parashar, D [A.R.S.D. Coll., New Delhi (India); Bhatia, V B [Delhi Univ. (India). Dept. of Physics and Astrophysics

    1976-05-01

    Developments in studies on stellar evolution during this century are reviewed. Recent considerations indicate that almost all elements between helium and zinc (a range which comprises more than 99 percent by mass of elements heavier than helium) can be synthesised in nuclear processes occurring during the late violent stages of an exploding star or supernova and a vigorous study in the new field of explosive nucleosynthesis is in progress. The process of nucleosynthesis has been classified into 8 sets of nuclear reactions, namely, (1) hydrogen burning, (2) helium burning, (3) ..cap alpha..-process, (4) e-process, (5) s-process, (6) r-process, (7) p-process and (8) x-process. The abundance of helium and heavier elements are explained and the formation of various elements during supernova explosions is discussed. The questions regarding the appropriate astrophysical conditions for the formation of massive stars (3 to 8 times solar mass) is still unanswered.

  5. Very low mass stars

    International Nuclear Information System (INIS)

    Liebert, J.; Probst, R.G.

    1987-01-01

    This paper discusses several theoretical and observational topics involved in discovering and analyzing very low mass stellar objects below about 0.3 M circle, as well as their likely extension into the substellar range. The authors hereafter refer to these two classes of objects as VLM stars and brown dwarfs, respectively; collectively, they are called VLM objects. The authors outline recent theoretical work on low-mass stellar interiors and atmospheres, the determination of the hydrogen-burning mass limit, important dynamical evidence bearing on the expected numbers of such objects, and the expectations for such objects from star-formation theory. They focus on the properties of substellar objects near the stellar mass limit. Observational techniques used to discover and analyze VLM objects are summarized

  6. Pulsating stars harbouring planets

    Directory of Open Access Journals (Sweden)

    Moya A.

    2013-04-01

    Full Text Available Why bother with asteroseismology while studying exoplanets? There are several answers to this question. Asteroseismology and exoplanetary sciences have much in common and the synergy between the two opens up new aspects in both fields. These fields and stellar activity, when taken together, allow maximum extraction of information from exoplanet space missions. Asteroseismology of the host star has already proved its value in a number of exoplanet systems by its unprecedented precision in determining stellar parameters. In addition, asteroseismology allows the possibility of discovering new exoplanets through time delay studies. The study of the interaction between exoplanets and their host stars opens new windows on various physical processes. In this review I will summarize past and current research in exoplanet asteroseismology and explore some guidelines for the future.

  7. Shells around stars

    International Nuclear Information System (INIS)

    Olnon, F.M.

    1977-01-01

    This thesis deals with optically visible stars surrounded by gas and dust and hot enough to ionize the hydrogen atoms in their envelopes. The ionized gas emits radio continuum radiation by the thermal Bremsstrahlung mechanism. Cool giant stars that show radio line emission from molecules in their circumstellar envelopes are discussed. Under favourable conditions the so-called maser effect gives rise to very intense emission lines. Up till now seven different maser transitions have been found in the envelopes of cool giants. Four of these lines from OH, H 2 O and SiO are studied here. Each of them originates in a different layer so that these lines can be used to probe the envelope. The profile of a maser line gives information about the velocity structure of the region where it is formed

  8. Structure of neutron stars

    International Nuclear Information System (INIS)

    Cheong, C.K.

    1974-01-01

    Structure of neutron stars consisting of a cold and catalyzed superdense matter were investigated by integrating the equations for hydrostatic equilibrium based on the General Relativity theory. The equations of state were obtained with the help of semiempirical nuclear mass formulae. A large phase transition was found between the nuclear and subnuclear density regions. The density phase transition points were calculated as 6.2 x 10 11 and 3.8 x 10 13 g/cm 3 . Due to such a large phase transition, the equation of state practically consists of two parts: The nuclear and subnuclear phases wich are in contact under the thermodynamical equilibrium at the corresponding pressure. Some macroscopic properties of neutron stars are discussed. (Author) [pt

  9. What stars become supernovae

    International Nuclear Information System (INIS)

    Tinsley, B.M.

    1975-01-01

    A variety of empirical lines of evidence is assembled on the masses and stellar population types of stars that trigger supernova (SN) explosions. The main theoretical motivations are to determine whether type I supernovae (SN I) can have massive precursors, and whether there is an interval of stellar mass, between the masses of precursors of pulsars and white dwarfs, that is disrupted by carbon detonation. Statistical and other uncertainties in the empirical arguments are given particular attention, and are found to be more important than generally realized. Relatively secure conclusions include the following. Statistics of stellar birthrates, SN, pulsars, and SN remnants in the Galaxy show that SN II (or all SN) could arise from stars with masses greater than M/sub s/ where M/sub s/ approximately 49 to 12 M solar mass; the precursor mass range cannot be more closely defined from present data; nor can it be said whether all SN leave pulsars and/or extended radio remnants. Several methods of estimating the masses of stars that become white dwarfs are consistent with a lower limit, M/sub s/ greater than or equal to 5 M solar mass, so carbon detonation may indeed be avoided, although this conclusion is not secure. Studies of the properties of galaxies in which SN occur, and their distributions within galaxies, support the usual views that SN I have low-mass precursors (less than or equal to 5 M solar mass and typically less than or equal to 1 M solar mass) and SN II have massive precursors (greater than or equal to 5 M solar mass); the restriction of known SN II to Sc and Sb galaxies, to date, is shown to be consistent, statistically, with massive stars in other galaxies also dying as SN II. Possible implications of the peculiarities of some SN-producing galaxies are discussed. Suggestions are made for observational and theoretical studies that would help answer important remaining questions on the nature of SN precursors

  10. Detector limitations, STAR

    Energy Technology Data Exchange (ETDEWEB)

    Underwood, D. G.

    1998-07-13

    Every detector has limitations in terms of solid angle, particular technologies chosen, cracks due to mechanical structure, etc. If all of the presently planned parts of STAR [Solenoidal Tracker At RHIC] were in place, these factors would not seriously limit our ability to exploit the spin physics possible in RHIC. What is of greater concern at the moment is the construction schedule for components such as the Electromagnetic Calorimeters, and the limited funding for various levels of triggers.

  11. Oscillations in neutron stars

    International Nuclear Information System (INIS)

    Hoeye, Gudrun Kristine

    1999-01-01

    We have studied radial and nonradial oscillations in neutron stars, both in a general relativistic and non-relativistic frame, for several different equilibrium models. Different equations of state were combined, and our results show that it is possible to distinguish between the models based on their oscillation periods. We have particularly focused on the p-, f-, and g-modes. We find oscillation periods of II approx. 0.1 ms for the p-modes, II approx. 0.1 - 0.8 ms for the f-modes and II approx. 10 - 400 ms for the g-modes. For high-order (l → 4) f-modes we were also able to derive a formula that determines II l+1 from II l and II l-1 to an accuracy of 0.1%. Further, for the radial f-mode we find that the oscillation period goes to infinity as the maximum mass of the star is approached. Both p-, f-, and g-modes are sensitive to changes in the central baryon number density n c , while the g-modes are also sensitive to variations in the surface temperature. The g-modes are concentrated in the surface layer, while p- and f-modes can be found in all parts of the star. The effects of general relativity were studied, and we find that these are important at high central baryon number densities, especially for the p- and f-modes. General relativistic effects can therefore not be neglected when studying oscillations in neutron stars. We have further developed an improved Cowling approximation in the non-relativistic frame, which eliminates about half of the gap in the oscillation periods that results from use of the ordinary Cowling approximation. We suggest to develop an improved Cowling approximation also in the general relativistic frame. (Author)

  12. Oscillations in neutron stars

    Energy Technology Data Exchange (ETDEWEB)

    Hoeye, Gudrun Kristine

    1999-07-01

    We have studied radial and nonradial oscillations in neutron stars, both in a general relativistic and non-relativistic frame, for several different equilibrium models. Different equations of state were combined, and our results show that it is possible to distinguish between the models based on their oscillation periods. We have particularly focused on the p-, f-, and g-modes. We find oscillation periods of II approx. 0.1 ms for the p-modes, II approx. 0.1 - 0.8 ms for the f-modes and II approx. 10 - 400 ms for the g-modes. For high-order (l (>{sub )} 4) f-modes we were also able to derive a formula that determines II{sub l+1} from II{sub l} and II{sub l-1} to an accuracy of 0.1%. Further, for the radial f-mode we find that the oscillation period goes to infinity as the maximum mass of the star is approached. Both p-, f-, and g-modes are sensitive to changes in the central baryon number density n{sub c}, while the g-modes are also sensitive to variations in the surface temperature. The g-modes are concentrated in the surface layer, while p- and f-modes can be found in all parts of the star. The effects of general relativity were studied, and we find that these are important at high central baryon number densities, especially for the p- and f-modes. General relativistic effects can therefore not be neglected when studying oscillations in neutron stars. We have further developed an improved Cowling approximation in the non-relativistic frame, which eliminates about half of the gap in the oscillation periods that results from use of the ordinary Cowling approximation. We suggest to develop an improved Cowling approximation also in the general relativistic frame. (Author)

  13. AN INCREASE IN THE MASS OF PLANETARY SYSTEMS AROUND LOWER-MASS STARS

    Energy Technology Data Exchange (ETDEWEB)

    Mulders, Gijs D.; Pascucci, Ilaria; Apai, Dániel, E-mail: mulders@lpl.arizona.edu [Lunar and Planetary Laboratory, The University of Arizona, Tucson, AZ 85721 (United States)

    2015-12-01

    Trends in the planet population with host star mass provide an avenue to constrain planet formation theories. We derive the planet radius distribution function for Kepler stars of different spectral types, sampling a range in host star masses. We find that M dwarf stars have 3.5 times more small planets (1.0–2.8 R{sub ⨁}) than main-sequence FGK stars, but two times fewer Neptune-sized and larger (>2.8 R{sub ⨁}) planets. We find no systematic trend in the planet size distribution between spectral types F, G, and K to explain the increasing occurrence rates. Taking into account the mass–radius relationship and heavy-element mass of observed exoplanets, and assuming those are independent of spectral type, we derive the inventory of the heavy-element mass locked up in exoplanets at short orbits. The overall higher planet occurrence rates around M stars are not consistent with the redistribution of the same mass into more, smaller planets. At the orbital periods and planet radii where Kepler observations are complete for all spectral types, the average heavy-element mass locked up in exoplanets increases roughly inversely with stellar mass from 4 M{sub ⨁} in F stars to 5 M{sub ⨁} in G and K stars to 7 M{sub ⨁} in M stars. This trend stands in stark contrast with observed protoplanetary disk masses that decrease toward lower mass stars, and provides a challenge for current planet formation models. Neither models of in situ formation nor migration of fully formed planets are consistent with these results. Instead, these results are indicative of large-scale inward migration of planetary building blocks—either through type-I migration or radial drift of dust grains—that is more efficient for lower mass stars, but does not result in significantly larger or smaller planets.

  14. AN INCREASE IN THE MASS OF PLANETARY SYSTEMS AROUND LOWER-MASS STARS

    International Nuclear Information System (INIS)

    Mulders, Gijs D.; Pascucci, Ilaria; Apai, Dániel

    2015-01-01

    Trends in the planet population with host star mass provide an avenue to constrain planet formation theories. We derive the planet radius distribution function for Kepler stars of different spectral types, sampling a range in host star masses. We find that M dwarf stars have 3.5 times more small planets (1.0–2.8 R ⨁ ) than main-sequence FGK stars, but two times fewer Neptune-sized and larger (>2.8 R ⨁ ) planets. We find no systematic trend in the planet size distribution between spectral types F, G, and K to explain the increasing occurrence rates. Taking into account the mass–radius relationship and heavy-element mass of observed exoplanets, and assuming those are independent of spectral type, we derive the inventory of the heavy-element mass locked up in exoplanets at short orbits. The overall higher planet occurrence rates around M stars are not consistent with the redistribution of the same mass into more, smaller planets. At the orbital periods and planet radii where Kepler observations are complete for all spectral types, the average heavy-element mass locked up in exoplanets increases roughly inversely with stellar mass from 4 M ⨁ in F stars to 5 M ⨁ in G and K stars to 7 M ⨁ in M stars. This trend stands in stark contrast with observed protoplanetary disk masses that decrease toward lower mass stars, and provides a challenge for current planet formation models. Neither models of in situ formation nor migration of fully formed planets are consistent with these results. Instead, these results are indicative of large-scale inward migration of planetary building blocks—either through type-I migration or radial drift of dust grains—that is more efficient for lower mass stars, but does not result in significantly larger or smaller planets

  15. Star clouds of Magellan

    International Nuclear Information System (INIS)

    Tucker, W.

    1981-01-01

    The Magellanic Clouds are two irregular galaxies belonging to the local group which the Milky Way belongs to. By studying the Clouds, astronomers hope to gain insight into the origin and composition of the Milky Way. The overall structure and dynamics of the Clouds are clearest when studied in radio region of the spectrum. One benefit of directly observing stellar luminosities in the Clouds has been the discovery of the period-luminosity relation. Also, the Clouds are a splendid laboratory for studying stellar evolution. It is believed that both Clouds may be in the very early stage in the development of a regular, symmetric galaxy. This raises a paradox because some of the stars in the star clusters of the Clouds are as old as the oldest stars in our galaxy. An explanation for this is given. The low velocity of the Clouds with respect to the center of the Milky Way shows they must be bound to it by gravity. Theories are given on how the Magellanic Clouds became associated with the galaxy. According to current ideas the Clouds orbits will decay and they will spiral into the Galaxy

  16. Stars of strange matter

    International Nuclear Information System (INIS)

    Bethe, H.A.; Brown, G.E.; Cooperstein, J.

    1987-01-01

    We investigate suggestions that quark matter with strangeness per baryon of order unity may be stable. We model this matter at nuclear matter densities as a gas of close packed Λ-particles. From the known mass of the Λ-particle we obtain an estimate of the energy and chemical potential of strange matter at nuclear densities. These are sufficiently high to preclude any phase transition from neutron matter to strange matter in the region near nucleon matter density. Including effects from gluon exchange phenomenologically, we investigate higher densities, consistently making approximations which underestimate the density of transition. In this way we find a transition density ρ tr > or approx.7ρ 0 , where ρ 0 is nuclear matter density. This is not far from the maximum density in the center of the most massive neutron stars that can be constructed. Since we have underestimated ρ tr and still find it to be ∝7ρ 0 , we do not believe that the transition from neutron to quark matter is likely in neutron stars. Moreover, measured masses of observed neutron stars are ≅1.4 M sun , where M sun is the solar mass. For such masses, the central (maximum) density is ρ c 0 . Transition to quark matter is certainly excluded for these densities. (orig.)

  17. Stable dark energy stars

    International Nuclear Information System (INIS)

    Lobo, Francisco S N

    2006-01-01

    The gravastar picture is an alternative model to the concept of a black hole, where there is an effective phase transition at or near where the event horizon is expected to form, and the interior is replaced by a de Sitter condensate. In this work a generalization of the gravastar picture is explored by considering matching of an interior solution governed by the dark energy equation of state, ω ≡ p/ρ < -1/3, to an exterior Schwarzschild vacuum solution at a junction interface. The motivation for implementing this generalization arises from the fact that recent observations have confirmed an accelerated cosmic expansion, for which dark energy is a possible candidate. Several relativistic dark energy stellar configurations are analysed by imposing specific choices for the mass function. The first case considered is that of a constant energy density, and the second choice that of a monotonic decreasing energy density in the star's interior. The dynamical stability of the transition layer of these dark energy stars to linearized spherically symmetric radial perturbations about static equilibrium solutions is also explored. It is found that large stability regions exist that are sufficiently close to where the event horizon is expected to form, so that it would be difficult to distinguish the exterior geometry of the dark energy stars, analysed in this work, from an astrophysical black hole

  18. Spheroidal Populated Star Systems

    Science.gov (United States)

    Angeletti, Lucio; Giannone, Pietro

    2008-10-01

    Globular clusters and low-ellipticity early-type galaxies can be treated as systems populated by a large number of stars and whose structures can be schematized as spherically symmetric. Their studies profit from the synthesis of stellar populations. The computation of synthetic models makes use of various contributions from star evolution and stellar dynamics. In the first sections of the paper we present a short review of our results on the occurrence of galactic winds in star systems ranging from globular clusters to elliptical galaxies, and the dynamical evolution of a typical massive globular cluster. In the subsequent sections we describe our approach to the problem of the stellar populations in elliptical galaxies. The projected radial behaviours of spectro-photometric indices for a sample of eleven galaxies are compared with preliminary model results. The best agreement between observation and theory shows that our galaxies share a certain degree of heterogeneity. The gas energy dissipation varies from moderate to large, the metal yield ranges from solar to significantly oversolar, the dispersion of velocities is isotropic in most of the cases and anisotropic in the remaining instances.

  19. What are the stars?

    CERN Document Server

    Srinivasan, Ganesan

    2014-01-01

    The outstanding question in astronomy at the turn of the twentieth century was: What are the stars and why are they as they are? In this volume, the story of how the answer to this fundamental question was unravelled is narrated in an informal style, with emphasis on the underlying physics. Although the foundations of astrophysics were laid down by 1870, and the edifice was sufficiently built up by 1920, the definitive proof of many of the prescient conjectures made in the 1920s and 1930s came to be established less than ten years ago. This book discusses these recent developments in the context of discussing the nature of the stars, their stability and the source of the energy they radiate.  Reading this book will get young students excited about the presently unfolding revolution in astronomy and the challenges that await them in the world of physics, engineering and technology. General readers will also find the book appealing for its highly accessible narrative of the physics of stars.  “... The reade...

  20. Polarimetry of symbiotic stars

    International Nuclear Information System (INIS)

    Piirola, V.

    1983-01-01

    Five symbiotic stars have been observed for linear polarization (UBVRI) in September 1981. Three systems, CH Cyg, CI Cyg and AG Peg show intrinsic polarization while in the case of Z And and AX Per the observed polarization seems to be mostly of interstellar origin. The position angle of polarization of CI Cyg and AG Peg rotates strongly vs. wavelength, as observed also for CH Cyg in 1977-80. The polarization of CH Cyg has decreased since May 1980, especially in the I, R and U bands, so that the maximum polarization is now in the blue (Psub(B) approx. 0.3%). Probably one is monitoring the formation, growth and disappearance of dust particles in the atmosphere of this star. Two related systems, PU Vul (Nova Vul 1979) and R Aql (Mira) have polarization behaviour rather similar to that of symbiotic stars which suggests that the M type giant present in these systems is responsible for most of the intrinsic polarization. (Auth.)

  1. 2009 National inventory of radioactive material and wastes. Geographical inventory

    International Nuclear Information System (INIS)

    2009-01-01

    A geographical inventory of the radioactive wastes present on the French territory (as recorded until the 31 of december, 2007) is presented, region by region. The various types of waste sites (production, processing, conditioning and storage sites, Uranium mines, ANDRA storage centers, historical storage sites and polluted sites where wastes are stored) are listed and located on maps. Details are given on the nature and origin of these wastes (nuclear industry, medical domain, scientific research, conventional industry, Defense...). A total of 1121 sites have been recorded, among which 163 are presented with details and charts

  2. Improved autonomous star identification algorithm

    International Nuclear Information System (INIS)

    Luo Li-Yan; Xu Lu-Ping; Zhang Hua; Sun Jing-Rong

    2015-01-01

    The log–polar transform (LPT) is introduced into the star identification because of its rotation invariance. An improved autonomous star identification algorithm is proposed in this paper to avoid the circular shift of the feature vector and to reduce the time consumed in the star identification algorithm using LPT. In the proposed algorithm, the star pattern of the same navigation star remains unchanged when the stellar image is rotated, which makes it able to reduce the star identification time. The logarithmic values of the plane distances between the navigation and its neighbor stars are adopted to structure the feature vector of the navigation star, which enhances the robustness of star identification. In addition, some efforts are made to make it able to find the identification result with fewer comparisons, instead of searching the whole feature database. The simulation results demonstrate that the proposed algorithm can effectively accelerate the star identification. Moreover, the recognition rate and robustness by the proposed algorithm are better than those by the LPT algorithm and the modified grid algorithm. (paper)

  3. ON THE STAR FORMATION RATES IN MOLECULAR CLOUDS

    International Nuclear Information System (INIS)

    Lada, Charles J.; Lombardi, Marco; Alves, Joao F.

    2010-01-01

    In this paper, we investigate the level of star formation activity within nearby molecular clouds. We employ a uniform set of infrared extinction maps to provide accurate assessments of cloud mass and structure and compare these with inventories of young stellar objects within the clouds. We present evidence indicating that both the yield and rate of star formation can vary considerably in local clouds, independent of their mass and size. We find that the surface density structure of such clouds appears to be important in controlling both these factors. In particular, we find that the star formation rate (SFR) in molecular clouds is linearly proportional to the cloud mass (M 0.8 ) above an extinction threshold of A K ∼ 0.8 mag, corresponding to a gas surface density threshold of Σ gas ∼ 116 M sun pc 2 . We argue that this surface density threshold corresponds to a gas volume density threshold which we estimate to be n(H 2 ) ∼ 10 4 cm -3 . Specifically, we find SFR (M sun yr -1 ) = 4.6 ± 2.6 x 10 -8 M 0.8 (M sun ) for the clouds in our sample. This relation between the rate of star formation and the amount of dense gas in molecular clouds appears to be in excellent agreement with previous observations of both galactic and extragalactic star-forming activity. It is likely the underlying physical relationship or empirical law that most directly connects star formation activity with interstellar gas over many spatial scales within and between individual galaxies. These results suggest that the key to obtaining a predictive understanding of the SFRs in molecular clouds and galaxies is to understand those physical factors which give rise to the dense components of these clouds.

  4. International Space Station Aeromedical Support in Star City, Russia

    Science.gov (United States)

    Cole, Richard; Chamberlin, Blake; Dowell, Gene; Castleberry, Tarah; Savage, Scott

    2010-01-01

    The Space Medicine Division at Johnson Space Center works with the International Space Station s international partners (IP) to accomplish assigned health care tasks. Each IP may assign a flight surgeon to support their assigned crewmembers during all phases of training, in-flight operations, and postflight activities. Because of the extensive amount of astronaut training conducted in Star City; NASA, in collaboration with its IPs, has elected to keep a flight surgeon assigned to NASA s Star City office to provide support to the U.S., Canadian, Japanese, and European astronauts during hazardous training activities and provide support for any contingency landings of Soyuz spacecraft in Kazakhstan. The physician also provides support as necessary to the Mission Control Center in Moscow for non-Russian crew-related activities. In addition, the physician in Star City provides ambulatory medical care to the non-Russian-assigned personnel in Star City and visiting dependents. Additional work involves all medical supplies, administration, and inventory. The Star City physician assists in medical evacuation and/or in obtaining support from western clinics in Moscow when required care exceeds local resources. Overall, the Russians are responsible for operations and the medical care of the entire crew when training in Star City and during launch/landing operations. However, they allow international partner flight surgeons to care for their crewmembers as agreed to in the ISS Medical Operations Requirements Document. Medical support focuses on pressurized, monitored, and other hazardous training activities. One of the most important jobs is to act as a medical advocate for the astronauts and to reduce the threat that these hazardous activities pose. Although the Russians have a robust medical system, evacuation may be needed to facilitate ongoing medical care. There are several international medical evacuation companies that provide this care.

  5. First stars X. The nature of three unevolved carbon-enhanced metal-poor stars

    DEFF Research Database (Denmark)

    Sivarani, T.; Beers, T.C.; Bonifacio, P.

    2006-01-01

    Stars: abundances, stars: population II, Galaxy: abundances, stars: AGB and post-AGB Udgivelsesdato: Nov.......Stars: abundances, stars: population II, Galaxy: abundances, stars: AGB and post-AGB Udgivelsesdato: Nov....

  6. Joint inventory control and pricing in a service-inventory system

    DEFF Research Database (Denmark)

    Marand, Ata Jalili; Li, Hongyan Jenny; Thorstenson, Anders

    2017-01-01

    This study addresses joint inventory control and pricing decisions for a service-inventory system. In such a system both an on-hand inventory item and a positive service time are required to fulfill customer demands. The service-inventory system also captures main features of the classical...... inventory systems with a positive processing time, e.g., make-to-order systems. In this study, the service-inventory system is modeled as an M/M/1 queue in which the customer arrival rate is price dependent. The inventory of an individual item is continuously reviewed under an (r,Q) policy....... The replenishment lead times of the inventory are exponentially distributed. Furthermore, customers arriving during stock-out periods are lost. The stochastic customer inter-arrival times, service times, and inventory replenishment lead times cause the high complexity of the problem and the difficulty in solving it...

  7. StarDOM: From STAR format to XML

    International Nuclear Information System (INIS)

    Linge, Jens P.; Nilges, Michael; Ehrlich, Lutz

    1999-01-01

    StarDOM is a software package for the representation of STAR files as document object models and the conversion of STAR files into XML. This allows interactive navigation by using the Document Object Model representation of the data as well as easy access by XML query languages. As an example application, the entire BioMagResBank has been transformed into XML format. Using an XML query language, statistical queries on the collected NMR data sets can be constructed with very little effort. The BioMagResBank/XML data and the software can be obtained at http://www.nmr.embl-heidelberg.de/nmr/StarDOM/

  8. Considering inventory distributions in a stochastic periodic inventory routing system

    Science.gov (United States)

    Yadollahi, Ehsan; Aghezzaf, El-Houssaine

    2017-07-01

    Dealing with the stochasticity of parameters is one of the critical issues in business and industry nowadays. Supply chain planners have difficulties in forecasting stochastic parameters of a distribution system. Demand rates of customers during their lead time are one of these parameters. In addition, holding a huge level of inventory at the retailers is costly and inefficient. To cover the uncertainty of forecasting demand rates, researchers have proposed the usage of safety stock to avoid stock-out. However, finding the precise level of safety stock depends on forecasting the statistical distribution of demand rates and their variations in different settings among the planning horizon. In this paper the demand rate distributions and its parameters are taken into account for each time period in a stochastic periodic IRP. An analysis of the achieved statistical distribution of the inventory and safety stock level is provided to measure the effects of input parameters on the output indicators. Different values for coefficient of variation are applied to the customers' demand rate in the optimization model. The outcome of the deterministic equivalent model of SPIRP is simulated in form of an illustrative case.

  9. Tritium inventory tracking and management

    International Nuclear Information System (INIS)

    Eichenberg, T.W.; Klein, A.C.

    1990-01-01

    This investigation has identified a number of useful applications of the analysis of the tracking and management of the tritium inventory in the various subsystems and components in a DT fusion reactor system. Due to the large amounts of tritium that will need to be circulated within such a plant, and the hazards of dealing with the tritium an electricity generating utility may not wish to also be in the tritium production and supply business on a full time basis. Possible scenarios for system operation have been presented, including options with zero net increase in tritium inventory, annual maintenance and blanket replacement, rapid increases in tritium creation for the production of additional tritium supplies for new plant startup, and failures in certain system components. It has been found that the value of the tritium breeding ratio required to stabilize the storage inventory depends strongly on the value and nature of other system characteristics. The real operation of a DT fusion reactor power plant will include maintenance and blanket replacement shutdowns which will affect the operation of the tritium handling system. It was also found that only modest increases in the tritium breeding ratio are needed in order to produce sufficient extra tritium for the startup of new reactors in less than two years. Thus, the continuous operation of a reactor system with a high tritium breeding ratio in order to have sufficient supplies for other plants is not necessary. Lastly, the overall operation and reliability of the power plant is greatly affected by failures in the fuel cleanup and plasma exhaust systems

  10. Ultracompact X-ray binary stars

    NARCIS (Netherlands)

    Haaften, L.M. van

    2013-01-01

    Ultracompact X-ray binary stars usually consist of a neutron star and a white dwarf, two stars bound together by their strong gravity and orbiting each other very rapidly, completing one orbit in less than one hour. Neutron stars are extremely compact remnants of the collapsed cores of massive stars

  11. Numerical study of rotating relativistic stars

    International Nuclear Information System (INIS)

    Wilson, J.R.

    1975-01-01

    The equations of structure for rotating stars in general relativity are presented and put in a form suitable for computer calculations. The results of equilibrium calculations for supermassive stars, neutron stars, and magnetically supported stars are reported, as are calculations of collapsing, rotating, and magnetized stars in the slowly changing gravitational field approximation. (auth)

  12. The Spacelab IPS Star Simulator

    Science.gov (United States)

    Wessling, Francis C., III

    The cost of doing business in space is very high. If errors occur while in orbit the costs grow and desired scientific data may be corrupted or even lost. The Spacelab Instrument Pointing System (IPS) Star Simulator is a unique test bed that allows star trackers to interface with simulated stars in a laboratory before going into orbit. This hardware-in-the loop testing of equipment on earth increases the probability of success while in space. The IPS Star Simulator provides three fields of view 2.55 x 2.55 degrees each for input into star trackers. The fields of view are produced on three separate monitors. Each monitor has 4096 x 4096 addressable points and can display 50 stars (pixels) maximum at a given time. The pixel refresh rate is 1000 Hz. The spectral output is approximately 550 nm. The available relative visual magnitude range is 2 to 8 visual magnitudes. The star size is less than 100 arc seconds. The minimum star movement is less than 5 arc seconds and the relative position accuracy is approximately 40 arc seconds. The purpose of this paper is to describe the LPS Star Simulator design and to provide an operational scenario so others may gain from the approach and possible use of the system.

  13. Origin of faint blue stars

    International Nuclear Information System (INIS)

    Tutukov, A.; Iungelson, L.

    1987-01-01

    The origin of field faint blue stars that are placed in the HR diagram to the left of the main sequence is discussed. These include degenerate dwarfs and O and B subdwarfs. Degenerate dwarfs belong to two main populations with helium and carbon-oxygen cores. The majority of the hot subdwarfs most possibly are helium nondegenerate stars that are produced by mass exchange close binaries of moderate mass cores (3-15 solar masses). The theoretical estimates of the numbers of faint blue stars of different types brighter than certain stellar magnitudes agree with star counts based on the Palomar Green Survey. 28 references

  14. Statistical properties of barium stars

    International Nuclear Information System (INIS)

    Hakkila, J.E.

    1986-01-01

    Barium stars are G- and K-giant stars with atmospheric excesses of s-process elements, and a broadband spectral depression in the blue portion of the spectrum. The strength of the λ4554 Ball line is used as a classification parameter known as the Barium Intensity. They have a mean absolute magnitude of 1.0 and a dispersion of 1.2 magnitudes (assuming a Gaussian distribution in absolute magnitude) as measured from secular and statistical parallaxes. These stars apparently belong to a young-disk population from analyses of both the solar reflex motion and their residual velocity distribution, which implies that they have an upper mass limit of around three solar masses. There is no apparent correlation of barium intensity with either luminosity or kinematic properties. The barium stars appear to be preferentially distributed in the direction of the local spiral arm, but show no preference to associate with or avoid the direction of the galactic center. They do not appear related to either the carbon or S-stars because of these tendencies and because of the stellar population to which each type of star belongs. The distribution in absolute magnitude combined with star count analyses implies that these stars are slightly less numerous than previously believed. Barium stars show infrared excesses that correlate with their barium intensities

  15. The birth of star clusters

    CERN Document Server

    2018-01-01

    All stars are born in groups. The origin of these groups has long been a key question in astronomy, one that interests researchers in star formation, the interstellar medium, and cosmology. This volume summarizes current progress in the field, and includes contributions from both theorists and observers. Star clusters appear with a wide range of properties, and are born in a variety of physical conditions. Yet the key question remains: How do diffuse clouds of gas condense into the collections of luminous objects we call stars? This book will benefit graduate students, newcomers to the field, and also experienced scientists seeking a convenient reference.

  16. A Genetic Algorithm on Inventory Routing Problem

    Directory of Open Access Journals (Sweden)

    Nevin Aydın

    2014-03-01

    Full Text Available Inventory routing problem can be defined as forming the routes to serve to the retailers from the manufacturer, deciding on the quantity of the shipment to the retailers and deciding on the timing of the replenishments. The difference of inventory routing problems from vehicle routing problems is the consideration of the inventory positions of retailers and supplier, and making the decision accordingly. Inventory routing problems are complex in nature and they can be solved either theoretically or using a heuristics method. Metaheuristics is an emerging class of heuristics that can be applied to combinatorial optimization problems. In this paper, we provide the relationship between vendor-managed inventory and inventory routing problem. The proposed genetic for solving vehicle routing problem is described in detail.

  17. Inventory Centralization Decision Framework for Spare Parts

    DEFF Research Database (Denmark)

    Gregersen, Nicklas; Herbert-Hansen, Zaza Nadja Lee

    2018-01-01

    Within the current literature, there is a lack of a holistic and multidisciplinary approach to managing spare parts and their inventory configuration. This paper addresses this research gap by examining the key contextual factors which influence the degree of inventory centralization and proposes...... a novel holistic theoretical framework, the Inventory Centralization Decision Framework (ICDF), useful for practitioners. Through an extensive review of inventory management literature, six contextual factors influencing the degree of inventory centralization have been identified. Using the ICDF...... practitioners can assess the most advantageous inventory configuration of spare parts. The framework is tested on a large global company which, as a result, today actively uses the ICDF; thus showing its practical applicability....

  18. Inventory estimation for nuclear fuel reprocessing systems

    International Nuclear Information System (INIS)

    Beyerlein, A.L.; Geldard, J.F.

    1987-01-01

    The accuracy of nuclear material accounting methods for nuclear fuel reprocessing facilities is limited by nuclear material inventory variations in the solvent extraction contactors, which affect the separation and purification of uranium and plutonium. Since in-line methods for measuring contactor inventory are not available, simple inventory estimation models are being developed for mixer-settler contactors operating at steady state with a view toward improving the accuracy of nuclear material accounting methods for reprocessing facilities. The authors investigated the following items: (1) improvements in the utility of the inventory estimation models, (2) extension of improvements to inventory estimation for transient nonsteady-state conditions during, for example, process upset or throughput variations, and (3) development of simple inventory estimation models for reprocessing systems using pulsed columns

  19. The Double Star mission

    Directory of Open Access Journals (Sweden)

    Liu

    2005-11-01

    Full Text Available The Double Star Programme (DSP was first proposed by China in March, 1997 at the Fragrant Hill Workshop on Space Science, Beijing, organized by the Chinese Academy of Science. It is the first mission in collaboration between China and ESA. The mission is made of two spacecraft to investigate the magnetospheric global processes and their response to the interplanetary disturbances in conjunction with the Cluster mission. The first spacecraft, TC-1 (Tan Ce means "Explorer", was launched on 29 December 2003, and the second one, TC-2, on 25 July 2004 on board two Chinese Long March 2C rockets. TC-1 was injected in an equatorial orbit of 570x79000 km altitude with a 28° inclination and TC-2 in a polar orbit of 560x38000 km altitude. The orbits have been designed to complement the Cluster mission by maximizing the time when both Cluster and Double Star are in the same scientific regions. The two missions allow simultaneous observations of the Earth magnetosphere from six points in space. To facilitate the comparison of data, half of the Double Star payload is made of spare or duplicates of the Cluster instruments; the other half is made of Chinese instruments. The science operations are coordinated by the Chinese DSP Scientific Operations Centre (DSOC in Beijing and the European Payload Operations Service (EPOS at RAL, UK. The spacecraft and ground segment operations are performed by the DSP Operations and Management Centre (DOMC and DSOC in China, using three ground station, in Beijing, Shanghai and Villafranca.

  20. Symbiotic star AG Dra

    International Nuclear Information System (INIS)

    Ipatov, A.P.; Yudin, B.F.; Moskovskij Gosudarstvennyj Univ.

    1986-01-01

    The results obtained from photometric (in the UBVRJHKLM system) and spectrophotometric (in the range 0.33-0.75 μm) observations of symbiotic star AG Dra are presented. The cool component of this star is a red giant with approximately constant brightness (ΔJ ≤ 0 m .3) classified as K4-K5. This red giant fills it's Roche loble and probably is on the assymptotic giant branch of the HR diagramm. The presence of IR excess in 5 μm associated with radiation of the gaseous envelope with the mass of M≅ 10 -6 M sun have been detected. Observations of AG Dra indicate that growing of the bolometric flux of a hot component is accompanied with decreasing effective temperature. The hot component of the system is probably an accerting red dwarf with the mass M≅ 0.4 M sun and disk accretion of matter of cool star with the rate M >or ∼ 10 -4 M sun year in equatorial region. Increase of accretion rate during the outburst of AG Dra leads to the increase of stellar wind from the red dwarf surface and the decrease of it's effective temperature. The hot component of AG Dra may also be considered as a white Dwarf with luminosity L 3 L sun and R eff >or approx. 0.2 R sun . In this case gravitational energy of accreting matter M > or ∼ 10 -6 M sun / year would be the source of the hot component outbursts. The luminosity between outbursts is determined by energy generation from the burning hydrogen layer source

  1. Hidden inventory and safety considerations

    International Nuclear Information System (INIS)

    Anderson, A.R.; James, R.H.; Morgan, F.

    1976-01-01

    Preliminary results are described of the evaluation of residual plutonium in a process line used for the production of experimental fast reactor fuel. Initial attention has been focussed on a selection of work boxes used for processing powders and solutions. Amounts of material measured as ''hidden inventory'' are generally less than 0.1 percent of throughput but in one box containing very complex equipment the amount was exceptionally about 0.5 percent. The total surface area of the box and the installed equipment appears to be the most significant factor in determining the amount of plutonium held-up as ''hidden inventory,'' representing an average of about 4 x 10 -4 g cm -2 . Present results are based on gamma spectrometer measurements but neutron techniques are being developed to overcome some of the inherent uncertainties in the gamma method. It is suggested that the routine use of sample plates of known surface area would be valuable in monitoring the deposition of plutonium in work boxes

  2. Estimating dead wood during national forest inventories: a review of inventory methodologies and suggestions for harmonization.

    Science.gov (United States)

    Woodall, Christopher W; Rondeux, Jacques; Verkerk, Pieter J; Ståhl, Göran

    2009-10-01

    Efforts to assess forest ecosystem carbon stocks, biodiversity, and fire hazards have spurred the need for comprehensive assessments of forest ecosystem dead wood (DW) components around the world. Currently, information regarding the prevalence, status, and methods of DW inventories occurring in the world's forested landscapes is scattered. The goal of this study is to describe the status, DW components measured, sample methods employed, and DW component thresholds used by national forest inventories that currently inventory DW around the world. Study results indicate that most countries do not inventory forest DW. Globally, we estimate that about 13% of countries inventory DW using a diversity of sample methods and DW component definitions. A common feature among DW inventories was that most countries had only just begun DW inventories and employ very low sample intensities. There are major hurdles to harmonizing national forest inventories of DW: differences in population definitions, lack of clarity on sample protocols/estimation procedures, and sparse availability of inventory data/reports. Increasing database/estimation flexibility, developing common dimensional thresholds of DW components, publishing inventory procedures/protocols, releasing inventory data/reports to international peer review, and increasing communication (e.g., workshops) among countries inventorying DW are suggestions forwarded by this study to increase DW inventory harmonization.

  3. Stars of heaven

    CERN Document Server

    Pickover, Clifford A

    2004-01-01

    Do a little armchair space travel, rub elbows with alien life forms, and stretch your mind to the furthest corners of our uncharted universe. With this astonishing guidebook, you don't have to be an astronomer to explore the mysteries of stars and their profound meaning for human existence. Clifford A. Pickover tackles a range of topics from stellar evolution to the fundamental reasons why the universe permits life to flourish. He alternates sections that explain the mysteries of the cosmos with sections that dramatize mind-expanding concepts through a fictional dialog between futuristic human

  4. Elemental diffusion in stars

    International Nuclear Information System (INIS)

    Michaud, Georges; Montmerle, Thierry

    1977-01-01

    This paper is dealing with the origin of the elements in the universe. The scheme of nucleosynthesis is kept to explain the stellar generation of helium, carbon, etc... from the initial hydrogen; but a nonlinear theory is then elaborated to account for the anomalous abundances which were observed. The chemical elements would diffuse throughout the outer layers of a star under the action of the opposite forces of gravitation and radiation. This theory, with completing the nucleosynthesis, would contribute to give a consistent scheme of the elemental origin and abundances [fr

  5. Hadronic Resonances from STAR

    Directory of Open Access Journals (Sweden)

    Wada Masayuki

    2012-11-01

    Full Text Available The results of resonance particle productions (ρ0, ω, K*, ϕ, Σ*, and Λ* measured by the STAR collaboration at RHIC from various colliding systems and energies are presented. Measured mass, width, 〈pT〉, and yield of those resonances are reviewed. No significant mass shifts or width broadening beyond the experiment uncertainties are observed. New measurements of ϕ and ω from leptonic decay channels are presented. The yields from leptonic decay channels are compared with the measurements from hadronic decay channels and the two results are consistent with each other.

  6. O3 stars

    International Nuclear Information System (INIS)

    Walborn, N.R.

    1982-01-01

    A brief review of the 10 known objects in this earliest spectral class is presented. Two new members are included: HD 64568 in NGC 2467 (Puppis OB2), which provides the first example of an O3 V((f*)) spectrum; and Sk -67 0 22 in the Large Magellanic Cloud, which is intermediate between types O3 If* and WN6-A. In addition, the spectrum of HDE 269810 in the LMC is reclassified as the first of type O3 III (f*). The absolute visual magnitudes of these stars are rediscussed

  7. Inventories in the Australian business cycle

    OpenAIRE

    Chindamo, Phillip

    2010-01-01

    This Economics Research Note examines inventories in the business cycle for Australia covering the period since the mid 1980s. The Australian Bureau of Statistics (ABS) defines inventories as all materials etc., work in progress and finished goods owned by a business, whether held at locations of the business or elsewhere. These items are usually held by businesses in anticipation of a product’s sale. Inventory investment is counted as an additional contribution to gross domestic product (...

  8. Data Driven Tuning of Inventory Controllers

    DEFF Research Database (Denmark)

    Huusom, Jakob Kjøbsted; Santacoloma, Paloma Andrade; Poulsen, Niels Kjølstad

    2007-01-01

    A systematic method for criterion based tuning of inventory controllers based on data-driven iterative feedback tuning is presented. This tuning method circumvent problems with modeling bias. The process model used for the design of the inventory control is utilized in the tuning...... as an approximation to reduce time required on experiments. The method is illustrated in an application with a multivariable inventory control implementation on a four tank system....

  9. Annual Danish Informative Inventory Report to UNECE

    DEFF Research Database (Denmark)

    Nielsen, Ole-Kenneth; Winther, Morten; Mikkelsen, Mette Hjorth

    The report is a documentation report on the emission inventories for Denmark as reported to the UNECE Secretariat under the Convention on Long Range Transboundary Air Pollution due by 15 February 2013. The report contains information on Denmark’s emission inventories regarding emissions of (1) SOX......(k)fluoranthene and indeno(1,2,3-cd)pyrene, PCDD/F and HCB for the years 1990-2011. Further, the report contains information on background data for emissions inventory....

  10. Annual Danish Informative Inventory Report to UNECE

    DEFF Research Database (Denmark)

    Nielsen, Ole-Kenneth; Winther, Morten; Mikkelsen, Mette Hjorth

    2012-01-01

    This report is a documentation report on the emission inventories for Denmark as reported to the UNECE Secretariat under the Convention on Long Range Transboundary Air Pollution due by 15 February 2012. The report contains information on Denmark’s emission inventories regarding emissions of (1) SOX......(k)fluoranthene and indeno(1,2,3-cd)pyrene, PCDD/F and HCB for the years 1990-2010. Further, the report contains information on background data for emissions inventory....

  11. Inventories and sales uncertainty\\ud

    OpenAIRE

    Caglayan, M.; Maioli, S.; Mateut, S.

    2011-01-01

    We investigate the empirical linkages between sales uncertainty and firms´ inventory investment behavior while controlling for firms´ financial strength. Using large panels of manufacturing firms from several European countries we find that higher sales uncertainty leads to larger stocks of inventories. We also identify an indirect effect of sales uncertainty on inventory accumulation through the financial strength of firms. Our results provide evidence that financial strength mitigates the a...

  12. Deteriorating Inventory Model for Chilled Food

    OpenAIRE

    Yang, Ming-Feng; Tseng, Wei-Chung

    2015-01-01

    With many aspects that affect inventory policy, product perishability is a critical aspect of inventory policy. Most goods will deteriorate during storage and their original value will decline or be lost. Therefore, deterioration should be taken into account in inventory practice. Chilled food products are very common consumer goods that are, in fact, perishable. If the chilled food quality declines over time customers are less likely to buy it. The value the chilled food retains is, however,...

  13. Star-forming galaxy models: Blending star formation into TREESPH

    Science.gov (United States)

    Mihos, J. Christopher; Hernquist, Lars

    1994-01-01

    We have incorporated star-formation algorithms into a hybrid N-body/smoothed particle hydrodynamics code (TREESPH) in order to describe the star forming properties of disk galaxies over timescales of a few billion years. The models employ a Schmidt law of index n approximately 1.5 to calculate star-formation rates, and explicitly include the energy and metallicity feedback into the Interstellar Medium (ISM). Modeling the newly formed stellar population is achieved through the use of hybrid SPH/young star particles which gradually convert from gaseous to collisionless particles, avoiding the computational difficulties involved in creating new particles. The models are shown to reproduce well the star-forming properties of disk galaxies, such as the morphology, rate of star formation, and evolution of the global star-formation rate and disk gas content. As an example of the technique, we model an encounter between a disk galaxy and a small companion which gives rise to a ring galaxy reminiscent of the Cartwheel (AM 0035-35). The primary galaxy in this encounter experiences two phases of star forming activity: an initial period during the expansion of the ring, and a delayed phase as shocked material in the ring falls back into the central regions.

  14. I-Love relations for incompressible stars and realistic stars

    Science.gov (United States)

    Chan, T. K.; Chan, AtMa P. O.; Leung, P. T.

    2015-02-01

    In spite of the diversity in the equations of state of nuclear matter, the recently discovered I-Love-Q relations [Yagi and Yunes, Science 341, 365 (2013), 10.1126/science.1236462], which relate the moment of inertia, tidal Love number (deformability), and the spin-induced quadrupole moment of compact stars, hold for various kinds of realistic neutron stars and quark stars. While the physical origin of such universality is still a current issue, the observation that the I-Love-Q relations of incompressible stars can well approximate those of realistic compact stars hints at a new direction to approach the problem. In this paper, by establishing recursive post-Minkowskian expansion for the moment of inertia and the tidal deformability of incompressible stars, we analytically derive the I-Love relation for incompressible stars and show that the so-obtained formula can be used to accurately predict the behavior of realistic compact stars from the Newtonian limit to the maximum mass limit.

  15. TRIGGERED STAR FORMATION SURROUNDING WOLF-RAYET STAR HD 211853

    Energy Technology Data Exchange (ETDEWEB)

    Liu Tie; Wu Yuefang; Zhang Huawei [Department of Astronomy, Peking University, 100871 Beijing (China); Qin Shengli, E-mail: liutiepku@gmail.com [I. Physikalisches Institut, Universitaet zu Koeln, Zuelpicher Str. 77, 50937 Koeln (Germany)

    2012-05-20

    The environment surrounding Wolf-Rayet (W-R) star HD 211853 is studied in molecular, infrared, as well as radio, and H I emission. The molecular ring consists of well-separated cores, which have a volume density of 10{sup 3} cm{sup -3} and kinematic temperature {approx}20 K. Most of the cores are under gravitational collapse due to external pressure from the surrounding ionized gas. From the spectral energy distribution modeling toward the young stellar objects, the sequential star formation is revealed on a large scale in space spreading from the W-R star to the molecular ring. A small-scale sequential star formation is revealed toward core 'A', which harbors a very young star cluster. Triggered star formations are thus suggested. The presence of the photodissociation region, the fragmentation of the molecular ring, the collapse of the cores, and the large-scale sequential star formation indicate that the 'collect and collapse' process functions in this region. The star-forming activities in core 'A' seem to be affected by the 'radiation-driven implosion' process.

  16. TRIGGERED STAR FORMATION SURROUNDING WOLF-RAYET STAR HD 211853

    International Nuclear Information System (INIS)

    Liu Tie; Wu Yuefang; Zhang Huawei; Qin Shengli

    2012-01-01

    The environment surrounding Wolf-Rayet (W-R) star HD 211853 is studied in molecular, infrared, as well as radio, and H I emission. The molecular ring consists of well-separated cores, which have a volume density of 10 3 cm –3 and kinematic temperature ∼20 K. Most of the cores are under gravitational collapse due to external pressure from the surrounding ionized gas. From the spectral energy distribution modeling toward the young stellar objects, the sequential star formation is revealed on a large scale in space spreading from the W-R star to the molecular ring. A small-scale sequential star formation is revealed toward core 'A', which harbors a very young star cluster. Triggered star formations are thus suggested. The presence of the photodissociation region, the fragmentation of the molecular ring, the collapse of the cores, and the large-scale sequential star formation indicate that the 'collect and collapse' process functions in this region. The star-forming activities in core 'A' seem to be affected by the 'radiation-driven implosion' process.

  17. Denmark’s National Inventory Report 2012

    DEFF Research Database (Denmark)

    Nielsen, Ole-Kenneth; Mikkelsen, Mette Hjorth; Hoffmann, Leif

    This report is Denmark’s National Inventory Report 2012. The report contains information on Denmark’s emission inventories for all years’ from 1990 to 2010 for CO2, CH4, N2O, HFCs, PFCs and SF6, NOx, CO, NMVOC, SO2......This report is Denmark’s National Inventory Report 2012. The report contains information on Denmark’s emission inventories for all years’ from 1990 to 2010 for CO2, CH4, N2O, HFCs, PFCs and SF6, NOx, CO, NMVOC, SO2...

  18. Defense Business Operations Fund Inventory Record Accuracy

    National Research Council Canada - National Science Library

    1998-01-01

    .... The overall objective of the audit was to determine whether inventory amounts on the FY 1996 Defense Business Operations Fund Consolidated Financial Statements were presented fairly in accordance...

  19. Blood inventory management: hospital best practice.

    Science.gov (United States)

    Stanger, Sebastian H W; Yates, Nicola; Wilding, Richard; Cotton, Sue

    2012-04-01

    Blood is a perishable product, and hence good management of inventories is crucial. Blood inventory management is a trade-off between shortage and wastage. The challenge is to keep enough stock to ensure a 100% supply of blood while keeping time expiry losses at a minimum. This article focuses on inventory management of red blood cells in hospital transfusion laboratories to derive principles of best practice and makes recommendations that will ensure losses due to time expiry are kept to a minimum. The literature was reviewed to identify available models for perishable inventory management. Historical data from the UK blood supply chain was analyzed to identify hospitals with good inventory management practice and low wastage levels. Transfusion laboratory managers in the selected hospitals were interviewed in 7 case studies with the aim of identifying drivers for low wastage and good inventory management practice. The findings from the case studies were compared with the literature. The extant literature asserts that the drivers for good inventory performance are the use of complex inventory models and algorithms. This study has found this not to be the case. Instead, good performance is driven by the quality of transfusion laboratory staff, who must be skilled, regularly trained, and experienced. Electronic crossmatching, transparency of the inventory, and simple management procedures also facilitate good performance. Copyright © 2012 Elsevier Inc. All rights reserved.

  20. Danish emission inventories for stationary combustion plants. Inventories until 2008

    Energy Technology Data Exchange (ETDEWEB)

    Nielsen, Malene; Nielsen, Ole-Kenneth; Plejdrup, M.; Hjelgaard, K.

    2010-10-15

    Emission inventories for stationary combustion plants are presented and the methodologies and assumptions used for the inventories are described. The pollutants considered are SO{sub 2}, NO{sub x}, NMVOC, CH{sub 4}, CO, CO{sub 2}, N{sub 2}O, NH{sub 3}, particulate matter, heavy metals, dioxins, HCB and PAH. The CO{sub 2} emission in 2008 was 16 % lower than in 1990. However, fluctuations in the emission level are large as a result of electricity import/export. The emission of CH{sub 4} has increased due to increased use of lean-burn gas engines in combined heating and power (CHP) plants. However, the emission has decreased in recent years due to structural changes in the Danish electricity market. The N{sub 2}O emission was higher in 2008 than in 1990 but the fluctuations in the time-series are significant. A considerable decrease of the SO{sub 2}, NO{sub x} and heavy metal emissions is mainly a result of decreased emissions from large power plants and waste incineration plants. The combustion of wood in residential plants has increased considerably in recent years resulting in increased emission of PAH, particulate matter and CO. The emission of NMVOC has increased since 1990 as a result of both the increased combustion of wood in residential plants and the increased emission from lean-burn gas engines. The dioxin emission decreased since 1990 due to flue gas cleaning on waste incineration plants. However in recent years the emission has increased as a result of the increased combustion of wood in residential plants. (Author)

  1. INCAP - Applying short-term flexibility to control inventories

    OpenAIRE

    Lödding , Hermann; Lohmann , Steffen

    2011-01-01

    Abstract Inventory Based Capacity Control (INCAP) is a very simple method that allows inventory levels to be effectively controlled by using short-term capacity flexibility in make-to-stock settings. Moreover, INCAP can be used for finished goods inventories as well as for semi-finished goods inventories. The basic idea is to define upper and lower inventory limits and to adjust capacities if the inventory level reaches either limit. Should the inventory fall below the lower limit,...

  2. Statistical investigation of flare stars. III. Flare stars in the general galactic star field

    International Nuclear Information System (INIS)

    Mirzoyan, L.V.; Ambaryan, V.V.; Garibdzhanyan, A.T.; Mirzoyan, A.L.

    1989-01-01

    Some questions relating to the existence of a large number of flare stars in the general star field of the Galaxy are discussed. It is shown that only a small proportion of them can be found by photographic observations, and the fraction of field flare stars among such stars found in the regions of star clusters and associations does not exceed 10%. The ratio of the numbers of flare stars of the foreground and the background for a particular system depends on its distance, reaching zero at a distance of about 500 pc. The spatial density of flare stars in the Pleiades is at least two orders of magnitude greater than in the general galactic field. A lower limit for the number of flare stars in the Galaxy is estimated at 4.2 ·10 9 , and the number of nonflare red dwarfs at 2.1·10 10 . There are grounds for believing that they were all formed in star clusters and associations

  3. The Stars of Heaven

    Science.gov (United States)

    Pickover, Clifford A.

    2004-05-01

    Do a little armchair space travel, rub elbows with alien life forms, and stretch your mind to the furthest corners of our uncharted universe. With this astonishing guidebook, you don't have to be an astronomer to explore the mysteries of stars and their profound meaning for human existence. Clifford A. Pickover tackles a range of topics from stellar evolution to the fundamental reasons why the universe permits life to flourish. He alternates sections that explain the mysteries of the cosmos with sections that dramatize mind-expanding concepts through a fictional dialog between futuristic humans and their alien peers (who embark on a journey beyond the reader's wildest imagination). This highly accessible and entertaining approach turns an intimidating subject into a scientific game open to all dreamers. Told in Pickover's inimitable blend of fascinating state-of-the-art science and whimsical science fiction, and packed with numerous diagrams and illustrations, The Stars of Heaven unfolds a world of paradox and mystery, one that will intrigue anyone who has ever pondered the night sky with wonder.

  4. Stars and Planets

    Science.gov (United States)

    Neta, Miguel

    2014-05-01

    'Estrelas e Planetas' (Stars and Planets) project was developed during the academic year 2009/2010 and was tested on three 3rd grade classes of one school in Quarteira, Portugal. The aim was to encourage the learning of science and the natural and physical phenomena through the construction and manipulation of materials that promote these themes - in this case astronomy. Throughout the project the students built a small book containing three themes of astronomy: differences between stars and planets, the solar system and the phases of the Moon. To each topic was devoted two sessions of about an hour each: the first to teach the theoretical aspects of the theme and the second session to assembly two pages of the book. All materials used (for theoretical sessions and for the construction of the book) and videos of the finished book are available for free use in www.miguelneta.pt/estrelaseplanetas. So far there is only a Portuguese version but soon will be published in English as well. This project won the Excellency Prize 2011 of Casa das Ciências, a portuguese site for teachers supported by the Calouste Gulbenkian Fundation (www.casadasciencias.org).

  5. Chemistry between the stars

    International Nuclear Information System (INIS)

    Kroto, H.W.

    1986-01-01

    During the past 15 years the techniques used by chemists to determine accurate molecular structures have combined with those of radio astronomers to probe the space between the stars. Together they paint a new picture of interstellar space, a picture which shows that vast clouds of gas and dust are continually collapsing to form stars and planets and that the main constituents of these clouds are molecules, some of which are quite complex organic species. It is now known that many of the organic building blocks, useful in the evolution of biologically significant macromolecules, existed long before the Earth was formed. These findings present a challenge to previous widely-accepted theories that such molecules were first generated in the Earth's primaeval atmosphere. In this paper certain aspects of these discoveries are considered with particular emphasis on the contributions made by techniques of use in general chemistry. After a brief astronomical introduction to the Interstellar Medium (ISM) the interaction between chemistry and radioastronomy is discussed. This is followed by details of some exciting, new and quite unexpected advances in our understanding of carbon chemistry, discovered during experiments aimed at understanding some of the more perplexing radioastronomy results. Finally an overview is given of the present knowledge of the molecular composition of the ISM and the resulting implications in so far as the origins of life are concerned. (author)

  6. Chemistry between the stars

    Energy Technology Data Exchange (ETDEWEB)

    Kroto, H W

    1986-01-01

    During the past 15 years the techniques used by chemists to determine accurate molecular structures have combined with those of radio astronomers to probe the space between the stars. Together they paint a new picture of interstellar space, a picture which shows that vast clouds of gas and dust are continually collapsing to form stars and planets and that the main constituents of these clouds are molecules, some of which are quite complex organic species. It is now known that many of the organic building blocks, useful in the evolution of biologically significant macromolecules, existed long before the Earth was formed. These findings present a challenge to previous widely-accepted theories that such molecules were first generated in the Earth's primaeval atmosphere. In this paper certain aspects of these discoveries are considered with particular emphasis on the contributions made by techniques of use in general chemistry. After a brief astronomical introduction to the Interstellar Medium (ISM) the interaction between chemistry and radioastronomy is discussed. This is followed by details of some exciting, new and quite unexpected advances in our understanding of carbon chemistry, discovered during experiments aimed at understanding some of the more perplexing radioastronomy results. Finally an overview is given of the present knowledge of the molecular composition of the ISM and the resulting implications in so far as the origins of life are concerned.

  7. Stars Just Got Bigger - A 300 Solar Mass Star Uncovered

    Science.gov (United States)

    2010-07-01

    Using a combination of instruments on ESO's Very Large Telescope, astronomers have discovered the most massive stars to date, one weighing at birth more than 300 times the mass of the Sun, or twice as much as the currently accepted limit of 150 solar masses. The existence of these monsters - millions of times more luminous than the Sun, losing weight through very powerful winds - may provide an answer to the question "how massive can stars be?" A team of astronomers led by Paul Crowther, Professor of Astrophysics at the University of Sheffield, has used ESO's Very Large Telescope (VLT), as well as archival data from the NASA/ESA Hubble Space Telescope, to study two young clusters of stars, NGC 3603 and RMC 136a in detail. NGC 3603 is a cosmic factory where stars form frantically from the nebula's extended clouds of gas and dust, located 22 000 light-years away from the Sun (eso1005). RMC 136a (more often known as R136) is another cluster of young, massive and hot stars, which is located inside the Tarantula Nebula, in one of our neighbouring galaxies, the Large Magellanic Cloud, 165 000 light-years away (eso0613). The team found several stars with surface temperatures over 40 000 degrees, more than seven times hotter than our Sun, and a few tens of times larger and several million times brighter. Comparisons with models imply that several of these stars were born with masses in excess of 150 solar masses. The star R136a1, found in the R136 cluster, is the most massive star ever found, with a current mass of about 265 solar masses and with a birthweight of as much as 320 times that of the Sun. In NGC 3603, the astronomers could also directly measure the masses of two stars that belong to a double star system [1], as a validation of the models used. The stars A1, B and C in this cluster have estimated masses at birth above or close to 150 solar masses. Very massive stars produce very powerful outflows. "Unlike humans, these stars are born heavy and lose weight as

  8. The spectrophotometric investigation of 4 parent stars

    International Nuclear Information System (INIS)

    Tereshchenko, V.M.

    2005-01-01

    The absolute energy distribution in spectra of four parent stars was obtained. The synthetic color indexes for the investigated stars were calculated. They were used for determination of the fundamental parameters of the parent stars: effective temperatures and metallicities. (author)

  9. Rotation of White Dwarf Stars

    OpenAIRE

    Kawaler, Steven D.

    2014-01-01

    I discuss and consider the status of observational determinations of the rotation velocities of white dwarf stars via asteroseismology and spectroscopy. While these observations have important implications on our understanding of the angular momentum evolution of stars in their late stages of evolution, more direct methods are sorely needed to disentangle ambiguities.

  10. The STAR-RICH Detector

    CERN Document Server

    Lasiuk, B; Braem, André; Cozza, D; Davenport, M; De Cataldo, G; Dell'Olio, L; Di Bari, D; Di Mauro, A; Dunlop, J C; Finch, E; Fraissard, Daniel; Franco, A; Gans, J; Ghidini, B; Harris, J W; Horsley, M; Kunde, G J; Lasiuk, B; Lesenechal, Y; Majka, R D; Martinengo, P; Morsch, Andreas; Nappi, E; Paic, G; Piuz, François; Posa, F; Raynaud, J; Salur, S; Sandweiss, J; Santiard, Jean-Claude; Satinover, J; Schyns, E M; Smirnov, N; Van Beelen, J; Williams, T D; Xu, Z

    2002-01-01

    The STAR-RICH detector extends the particle idenfication capabilities of the STAR spectrometer for charged hadrons at mid-rapidity. It allows identification of pions and kaons up to ~3 GeV/c and protons up to ~5 GeV/c. The characteristics and performance of the device in the inaugural RHIC run are described.

  11. Physics of Neutron Star Crusts

    Directory of Open Access Journals (Sweden)

    Chamel Nicolas

    2008-12-01

    Full Text Available The physics of neutron star crusts is vast, involving many different research fields, from nuclear and condensed matter physics to general relativity. This review summarizes the progress, which has been achieved over the last few years, in modeling neutron star crusts, both at the microscopic and macroscopic levels. The confrontation of these theoretical models with observations is also briefly discussed.

  12. Stars get dizzy after lunch

    International Nuclear Information System (INIS)

    Zhang, Michael; Penev, Kaloyan

    2014-01-01

    Exoplanet searches have discovered a large number of h ot Jupiters — high-mass planets orbiting very close to their parent stars in nearly circular orbits. A number of these planets are sufficiently massive and close-in to be significantly affected by tidal dissipation in the parent star, to a degree parameterized by the tidal quality factor Q * . This process speeds up their star's rotation rate while reducing the planet's semimajor axis. In this paper, we investigate the tidal destruction of hot Jupiters. Because the orbital angular momenta of these planets are a significant fraction of their star's rotational angular momenta, they spin up their stars significantly while spiraling to their deaths. Using the Monte Carlo simulation, we predict that for Q * = 10 6 , 3.9 × 10 –6 of stars with the Kepler Target Catalog's mass distribution should have a rotation period shorter than 1/3 day (8 hr) due to accreting a planet. Exoplanet surveys such as SuperWASP, HATnet, HATsouth, and KELT have already produced light curves of millions of stars. These two facts suggest that it may be possible to search for tidally destroyed planets by looking for stars with extremely short rotational periods, then looking for remnant planet cores around those candidates, anomalies in the metal distribution, or other signatures of the recent accretion of the planet.

  13. ENERGY STAR Certified Vending Machines

    Science.gov (United States)

    Certified models meet all ENERGY STAR requirements as listed in the Version 3.0 ENERGY STAR Program Requirements for Refrigerated Beverage Vending Machines that are effective as of March 1, 2013. A detailed listing of key efficiency criteria are available at

  14. Star formation in the multiverse

    International Nuclear Information System (INIS)

    Bousso, Raphael; Leichenauer, Stefan

    2009-01-01

    We develop a simple semianalytic model of the star formation rate as a function of time. We estimate the star formation rate for a wide range of values of the cosmological constant, spatial curvature, and primordial density contrast. Our model can predict such parameters in the multiverse, if the underlying theory landscape and the cosmological measure are known.

  15. Measuring the Sizes of Stars

    Indian Academy of Sciences (India)

    The nearest star to our solar system, called Proxima Centauri, is about 260,000 ..... We can choose the origin of x to be the maximum of the fringe pattern of one of the stars .... ating day and night, round the year, to explore the universe with.

  16. When a major star dies

    International Nuclear Information System (INIS)

    Joubert, G.

    1988-01-01

    Astrologers are slowly learning what happens when a star dies. On the night of 23-24 February 1987, the light of an exploding star - a supernova with the name SN 1987A - reached the earth. In this article this astrological event of the century are discussed, and its importance for astrologers

  17. KAON CONDENSATION IN NEUTRON STARS

    International Nuclear Information System (INIS)

    RAMOS, A.; SCHAFFNER-BIELICH, J.; WAMBACH, J.

    2001-01-01

    We discuss the kaon-nucleon interaction and its consequences for the change of the properties of the kaon in the medium. The onset of kaon condensation in neutron stars under various scenarios as well its effects for neutron star properties are reviewed

  18. ENERGY STAR Certified Ceiling Fans

    Science.gov (United States)

    Certified models meet all ENERGY STAR requirements as listed in the Version 3.0 ENERGY STAR Program Requirements for Ceiling Fans that are effective as of April 1, 2012. A detailed listing of key efficiency criteria are available at http://www.energystar.gov/index.cfm?c=ceiling_fans.pr_crit_ceiling_fans

  19. ENERGY STAR Certified Ventilating Fans

    Science.gov (United States)

    Certified models meet all ENERGY STAR requirements as listed in the Version 4.0 ENERGY STAR Program Requirements for Ventilating Fans that are effective as of October 1, 2015. A detailed listing of key efficiency criteria are available at http://www.energystar.gov/index.cfm?c=vent_fans.pr_crit_vent_fans

  20. Possibility of stable quark stars

    International Nuclear Information System (INIS)

    Bowers, R.L.; Gleeson, A.M.; Pedigo, R.D.

    1976-08-01

    A recent zero temperature equation of state which contains quark-partons separated from conventional baryons by a phase transition is used to investigate the stability of quark stars. The sensitivity to the input physics is also considered. The conclusions, which are found to be relatively model independent, indicate that a separately identifiable class of stable objects called quark stars does not exist

  1. Stars the size of planets

    International Nuclear Information System (INIS)

    Whitehouse, D.

    1984-01-01

    Red dwarf stars, the faintest and smallest stars that can be seen, sometimes host flares of immense violence. The article discusses the energy of these flares in terms of mass, x-rays, brightness, variation in light output, the sun and magnetic phenomena. (U.K.)

  2. Opdriftsbaserede modeller for Wave Star

    DEFF Research Database (Denmark)

    Kramer, Morten

    Formålet med dette skrift er at få en forhåndsvurdering af mulige effektforøgelser for Wave Star ved anvendelse af aktiv akkumulatordrift. Disse vurderinger baseres på simuleringsmodeller for driften af Wave Star i uregelmæssige bølger. Modellen er udarbejdet i programmeringssproget Delphi og er en...

  3. Stable isotope research pool inventory

    International Nuclear Information System (INIS)

    1986-08-01

    This report contains a listing of electromagnetically separated stable isotopes which are available at the Oak Ridge National Laboratory for distribution for nondestructive research use on a loan basis. This inventory includes all samples of stable isotopes in the Research Materials Collection and does not designate whether a sample is out on loan or is in reprocessing. For some of the high-abundance, naturally occurring isotopes, larger amounts can be made available; for example, Ca-40 and Fe-56. All requests for the loan of samples should be submitted with a summary of the purpose of the loan to: Iotope Distribution Office, Oak Ridge National Laboratory, P.O. Box X, Oak Ridge, Tennessee 37831. Requests from non-DOE contractors and from foreign institutions require DOE approval

  4. Tritium inventory measurements using calorimetry

    International Nuclear Information System (INIS)

    Kapulla, H.; Kraemer, R.; Heine, R.

    1992-01-01

    In the past calorimetry has been developed as a powerful tool in radiometrology. Calorimetric methods have been applied for the determination of activities, half lives and mean energies released during the disintegration of radioactive isotopes. The fundamental factors and relations which determine the power output of radioactive samples are presented and some basic calorimeter principles are discussed in this paper. At the Kernforschungszentrum Karlsruhe (KfK) a family of 3 calorimeters has been developed to measure the energy release from radiative waste products arising from reprocessing operations. With these calorimeters, radiative samples with sizes from a few cm 3 to 2 ·10 5 cm 3 and heat ratings ranging from a few nW to kW can be measured. After modifications of tits inner part the most sensitive calorimeter among the three calorimeters mentioned above would be best suited for measuring the tritium inventory in T-getters of the Amersham-type

  5. Pacer processing: cavity inventory relationships

    International Nuclear Information System (INIS)

    Dietz, R.J.; Gritzo, L.A.

    1975-09-01

    The pacer cavity and its associated primary power loop comprise a recirculating system in which materials are introduced by a series of thermonuclear explosions while debris is continuously removed by radioactive decay, sorption phenomena, and deliberate processing. Safe, reliable, and economical realization of the Pacer concept depends on the removal and control of both noxious and valuable by-products of the fusion reaction. Mathematical relationships are developed that describe the quantities of materials that are introduced into the Pacer cavity by a series of discrete events and are removed continuously by processing and decay. An iterative computer program based on these relationships is developed that allows both the total cavity inventory and the amounts of important individual species to be determined at any time during the lifetime of the cavity in order to establish the effects of the thermonuclear event, the cavity, the flow, and various processing parameters on Pacer design requirements

  6. The Cambridge Behavioural Inventory revised.

    Science.gov (United States)

    Wear, Helen J; Wedderburn, Catherine J; Mioshi, Eneida; Williams-Gray, Caroline H; Mason, Sarah L; Barker, Roger A; Hodges, John R

    2008-01-01

    Neurobehavioural and psychiatric symptoms are common in a range of neurodegenerative disorders with distinct profiles which are helpful in the diagnosis and monitoring of these disorders. The Cambridge Behavioural Inventory (CBI) has been shown to distinguish frontotemporal dementia (FTD), Alzheimer's disease (AD), Huntington's disease (HD) and Parkinson's disease (PD), but it is lengthy. To develop a shorter version of the 81 item CBI. CBI data from 450 participants with behavioural variant frontotemporal dementia (bv-FTD) (64), AD (96), PD (215) and HD (75) were analysed using Principal Components Analysis and measures of internal consistency (Cronbach alpha). A reduced 45-item questionnaire was developed. The instrument identified distinct behavioural profiles and performed as well as the original version. A shorter (45 item) version of the CBI is capable of differentiating bv-FTD and AD from PD and HD. It may be useful in delineating the type and extent of problems in these disorders as well as monitoring therapeutic interventions.

  7. Formation of stars and star clusters in colliding galaxies

    International Nuclear Information System (INIS)

    Belles, Pierre-Emmanuel

    2012-01-01

    Mergers are known to be essential in the formation of large-scale structures and to have a significant role in the history of galaxy formation and evolution. Besides a morphological transformation, mergers induce important bursts of star formation. These starburst are characterised by high Star Formation Efficiencies (SFEs) and Specific Star Formation Rates, i.e., high Star Formation Rates (SFR) per unit of gas mass and high SFR per unit of stellar mass, respectively, compared to spiral galaxies. At all redshifts, starburst galaxies are outliers of the sequence of star-forming galaxies defined by spiral galaxies. We have investigated the origin of the starburst-mode of star formation, in three local interacting systems: Arp 245, Arp 105 and NGC 7252. We combined high-resolution JVLA observations of the 21-cm line, tracing the HI diffuse gas, with UV GALEX observations, tracing the young star-forming regions. We probe the local physical conditions of the Inter-Stellar Medium (ISM) for independent star-forming regions and explore the atomic-to-dense gas transformation in different environments. The SFR/HI ratio is found to be much higher in central regions, compared to outer regions, showing a higher dense gas fraction (or lower HI gas fraction) in these regions. In the outer regions of the systems, i.e., the tidal tails, where the gas phase is mostly atomic, we find SFR/HI ratios higher than in standard HI-dominated environments, i.e., outer discs of spiral galaxies and dwarf galaxies. Thus, our analysis reveals that the outer regions of mergers are characterised by high SFEs, compared to the standard mode of star formation. The observation of high dense gas fractions in interacting systems is consistent with the predictions of numerical simulations; it results from the increase of the gas turbulence during a merger. The merger is likely to affect the star-forming properties of the system at all spatial scales, from large scales, with a globally enhanced turbulence

  8. Dark stars in Starobinsky's model

    Science.gov (United States)

    Panotopoulos, Grigoris; Lopes, Ilídio

    2018-01-01

    In the present work we study non-rotating dark stars in f (R ) modified theory of gravity. In particular, we have considered bosonic self-interacting dark matter modeled inside the star as a Bose-Einstein condensate, while as far as the modified theory of gravity is concerned we have assumed Starobinsky's model R +a R2. We solve the generalized structure equations numerically, and we obtain the mass-to-ratio relation for several different values of the parameter a , and for two different dark matter equation-of-states. Our results show that the dark matter stars become more compact in the R-squared gravity compared to general relativity, while at the same time the highest star mass is slightly increased in the modified gravitational theory. The numerical value of the highest star mass for each case has been reported.

  9. Delta isobars in neutron stars

    Directory of Open Access Journals (Sweden)

    Pagliara Giuseppe

    2015-01-01

    Full Text Available The appearance of delta isobars in beta-stable matter is regulated by the behavior of the symmetry energy at densities larger than saturation density. We show that by taking into account recent constraints on the density derivative of the symmetry energy and the theoretical and experimental results on the excitations of delta isobars in nuclei, delta isobars are necessary ingredients for the equations of state used for studying neutron stars. We analyze the effect of the appearance of deltas on the structure of neutron stars: as in the case of hyperons, matter containing delta is too soft for allowing the existence of 2M⊙ neutron stars. Quark stars on the other hand, could reach very massive configurations and they could form from a process of conversion of hadronic stars in which an initial seed of strangeness appears through hyperons.

  10. Numerical evidence for 'multiscalar stars'

    International Nuclear Information System (INIS)

    Hawley, Scott H.; Choptuik, Matthew W.

    2003-01-01

    We present a class of general relativistic solitonlike solutions composed of multiple minimally coupled, massive, real scalar fields which interact only through the gravitational field. We describe a two-parameter family of solutions we call ''phase-shifted boson stars'' (parametrized by central density ρ 0 and phase δ), which are obtained by solving the ordinary differential equations associated with boson stars and then altering the phase between the real and imaginary parts of the field. These solutions are similar to boson stars as well as the oscillating soliton stars found by Seidel and Suen [E. Seidel and W. M. Suen, Phys. Rev. Lett. 66, 1659 (1991)]; in particular, long-time numerical evolutions suggest that phase-shifted boson stars are stable. Our results indicate that scalar solitonlike solutions are perhaps more generic than has been previously thought

  11. Flares on a Bp Star

    Science.gov (United States)

    Mullan, D. J.

    2009-09-01

    Two large X-ray flares have been reported from the direction of a magnetic B2p star (σ Ori E). Sanz-Forcada et al. have suggested that the flares did not occur on the B2p star but on a companion of late spectral type. A star which is a candidate for a late-type flare star near σ Ori E has recently been identified by Bouy et al. However, based on the properties of the flares, and based on a recent model of rotating magnetospheres, we argue that, rather than attributing the two flares to a late-type dwarf, it is a viable hypothesis that the flares were magnetic phenomena associated with the rotating magnetosphere of the B2p star itself.

  12. FLARES ON A Bp STAR

    International Nuclear Information System (INIS)

    Mullan, D. J.

    2009-01-01

    Two large X-ray flares have been reported from the direction of a magnetic B2p star (σ Ori E). Sanz-Forcada et al. have suggested that the flares did not occur on the B2p star but on a companion of late spectral type. A star which is a candidate for a late-type flare star near σ Ori E has recently been identified by Bouy et al. However, based on the properties of the flares, and based on a recent model of rotating magnetospheres, we argue that, rather than attributing the two flares to a late-type dwarf, it is a viable hypothesis that the flares were magnetic phenomena associated with the rotating magnetosphere of the B2p star itself.

  13. Star trackers for attitude determination

    DEFF Research Database (Denmark)

    Liebe, Carl Christian

    1995-01-01

    One problem comes to all spacecrafts using vector information. That is the problem of determining the attitude. This paper describes how the area of attitude determination instruments has evolved from simple pointing devices into the latest technology, which determines the attitude by utilizing...... a CCD camera and a powerful microcomputer. The instruments are called star trackers and they are capable of determining the attitude with an accuracy better than 1 arcsecond. The concept of the star tracker is explained. The obtainable accuracy is calculated, the numbers of stars to be included...... in the star catalogue are discussed and the acquisition of the initial attitude is explained. Finally the commercial market for star trackers is discussed...

  14. The Diversity of Neutron Stars

    Science.gov (United States)

    Kaplan, David L.

    2004-12-01

    Neutron stars are invaluable tools for exploring stellar death, the physics of ultra-dense matter, and the effects of extremely strong magnetic fields. The observed population of neutron stars is dominated by the >1000 radio pulsars, but there are distinct sub-populations that, while fewer in number, can have significant impact on our understanding of the issues mentioned above. These populations are the nearby, isolated neutron stars discovered by ROSAT, and the central compact objects in supernova remnants. The studies of both of these populations have been greatly accelerated in recent years through observations with the Chandra X-ray Observatory and the XMM-Newton telescope. First, we discuss radio, optical, and X-ray observations of the nearby neutron stars aimed at determining their relation to the Galactic neutron star population and at unraveling their complex physical processes by determining the basic astronomical parameters that define the population---distances, ages, and magnetic fields---the uncertainties in which limit any attempt to derive basic physical parameters for these objects. We conclude that these sources are 1e6 year-old cooling neutron stars with magnetic fields above 1e13 Gauss. Second, we describe the hollow supernova remnant problem: why many of the supernova remnants in the Galaxy have no indication of central neutron stars. We have undertaken an X-ray census of neutron stars in a volume-limited sample of Galactic supernova remnants, and from it conclude that either many supernovae do not produce neutron stars contrary to expectation, or that neutron stars can have a wide range in cooling behavior that makes many sources disappear from the X-ray sky.

  15. StarGuides Plus

    Science.gov (United States)

    Heck, A.

    StarGuides Plus represents the most comprehensive and accurately validated collection of practical data on organizations involved in astronomy, related space sciences and other related fields. This invaluable reference source (and its companion volume, StarBriefs Plus) should be on the reference shelf of every library, organization or individual with any interest in these areas. The coverage includes relevant universities, scientific committees, institutions, associations, societies, agencies, companies, bibliographic services, data centers, museums, dealers, distributors, funding organizations, journals, manufacturers, meteorological services, national norms & standard institutes, parent associations & societies, publishers, software producers & distributors, and so on. Besides astronomy and associated space sciences, related fields such as aeronautics, aeronomy, astronautics, atmospheric sciences, chemistry, communications, computer sciences, data processing, education, electronics, engineering, energetics, environment, geodesy, geophysics, information handling, management, mathematics, meteorology, optics, physics, remote sensing, and so on, are also covered where appropriate. After some thirty years in continuous compilation, verification and updating, StarGuides Plus currently gathers together some 6,000 entries from 100 countries. The information is presented in a clear, uncluttered manner for direct and easy use. For each entry, all practical data are listed: city, postal and electronic-mail addresses, telephone and fax numbers, URLs for WWW access, foundation years, numbers of members and/or numbers of staff, main activities, publications titles (with frequencies, ISS-Numbers and circulations), names and geographical coordinates of observing sites, names of planetariums, awards (prizes and/or distinctions) granted, etc. The entries are listed alphabetically in each country. An exhaustive index gives a breakdown not only by different designations and

  16. 26 CFR 1.1013-1 - Property included in inventory.

    Science.gov (United States)

    2010-04-01

    ... 26 Internal Revenue 11 2010-04-01 2010-04-01 true Property included in inventory. 1.1013-1 Section... inventory. The basis of property required to be included in inventory is the last inventory value of such property in the hands of the taxpayer. The requirements with respect to the valuation of an inventory are...

  17. Emission Inventory for Fugitive Emissions in Denmark

    DEFF Research Database (Denmark)

    Plejdrup, Marlene Schmidt; Nielsen, Ole-Kenneth; Nielsen, Malene

    This report presents the methodology and data used in the Danish inventory of fugitive emissions from fuels for the years until 2007. The inventory of fugitive emissions includes CO2, CH4, N2O, NOx, CO, NMVOC, SO2, dioxin, PAH and particulate matter. In 2007 the total Danish emission of greenhouse...

  18. Inventory management systems : Control and information issues

    NARCIS (Netherlands)

    Janssen, F.B.S.L.P.

    1998-01-01

    This dissertation addresses the management of inventory systems. The thesis starts with an exposition on mathematical models that can be used in inventory theory. Then we deal with some information issues related to the demand process. Namely, how to control products that have intermittent demand.

  19. Lost-sales inventory theory : A review

    NARCIS (Netherlands)

    Bijvank, Marco; Vis, Iris F. A.

    2011-01-01

    In classic inventory models it is common to assume that excess demand is backordered. However, studies analyzing customer behavior in practice show that most unfulfilled demand is lost or an alternative item/location is looked for in many retail environments. Inventory systems that include this

  20. Wisconsin's forest statistics, 1987: an inventory update.

    Science.gov (United States)

    W. Brad Smith; Jerold T. Hahn

    1989-01-01

    The Wisconsin 1987 inventory update, derived by using tree growth models, reports 14.7 million acres of timberland, a decline of less than 1% since 1983. This bulletin presents findings from the inventory update in tables detailing timberland area, volume, and biomass.

  1. Validation of the Classroom Behavior Inventory

    Science.gov (United States)

    Blunden, Dale; And Others

    1974-01-01

    Factor-analytic methods were used toassess contruct validity of the Classroom Behavior Inventory, a scale for rating behaviors associated with hyperactivity. The Classroom Behavior Inventory measures three dimensions of behavior: Hyperactivity, Hostility, and Sociability. Significant concurrent validity was obtained for only one Classroom Behavior…

  2. Retail inventory management with lost sales

    NARCIS (Netherlands)

    Curseu - Stefanut, A.

    2012-01-01

    The inventory control problem of traditional store-based grocery retailers has several challenging features. Demand for products is stochastic, and is typically lost when no inventory is available on the shelves. As the consumer behavior studies reveal, only a small percentage of customers are

  3. B Plant exhaust filter inventory analysis

    International Nuclear Information System (INIS)

    Lan, J.S.; Wootan, D.W.; Carter, L.L.; Bunch, W.L.; Covey, L.I.; Greenborg, J.

    1994-10-01

    This paper describes a method for determining radionuclide inventories in filters using measurements of radiation fields that determine photon dose rates and photon-plus-electron dose rates between filter banks. The mathematical approach quantifies the curie inventories of filter banks by using the measured dose rates and the calculated Green's functions involving detector responses per unit source

  4. Minnesota's forest statistics, 1987: an inventory update.

    Science.gov (United States)

    Jerold T. Hahn; W. Brad Smith

    1987-01-01

    The Minnesota 1987 inventory update, derived by using tree growth models, reports 13.5 million acres of timberland, a decline of less than 1% since 1977. This bulletin presents findings from the inventory update in tables detailing timer land area, volume, and biomass.

  5. Dynamic pricing and learning with finite inventories

    NARCIS (Netherlands)

    den Boer, A.V.; Zwart, Bert

    2013-01-01

    We study a dynamic pricing problem with finite inventory and parametric uncertainty on the demand distribution. Products are sold during selling seasons of finite length, and inventory that is unsold at the end of a selling season, perishes. The goal of the seller is to determine a pricing strategy

  6. Dynamic pricing and learning with finite inventories

    NARCIS (Netherlands)

    den Boer, A.V.; Zwart, Bert

    We study a dynamic pricing problem with finite inventory and parametric uncertainty on the demand distribution. Products are sold during selling seasons of finite length, and inventory that is unsold at the end of a selling season perishes. The goal of the seller is to determine a pricing strategy

  7. Dynamic Pricing and Learning with Finite Inventories

    NARCIS (Netherlands)

    A.P. Zwart (Bert); A.V. den Boer (Arnoud)

    2015-01-01

    htmlabstractWe study a dynamic pricing problem with finite inventory and parametric uncertainty on the demand distribution. Products are sold during selling seasons of finite length, and inventory that is unsold at the end of a selling season perishes. The goal of the seller is to determine a

  8. Dynamic pricing and learning with finite inventories

    NARCIS (Netherlands)

    Boer, den A.V.; Zwart, B.

    2015-01-01

    We study a dynamic pricing problem with finite inventory and parametric uncertainty on the demand distribution. Products are sold during selling seasons of finite length, and inventory that is unsold at the end of a selling season perishes. The goal of the seller is to determine a pricing strategy

  9. 76 FR 62327 - Retail Inventory Method

    Science.gov (United States)

    2011-10-07

    ... accounting. The regulations restate and clarify the computation of ending inventory values under the retail... method of accounting for inventories must clearly reflect income. Section 1.471-2(c) provides that the...-retail ratio, or cost complement. The numerator of the cost complement is the value of beginning...

  10. Texas, 2008 forest inventory and analysis factsheet

    Science.gov (United States)

    James Bentley

    2011-01-01

    This science update summarizes the findings of the first statewide annual inventory conducted by the Southern Forest Inventory and Analysis (FIA) Program in cooperation with the Texas Forest Service of the forest resource attributes in Texas. The 254 counties of Texas are consolidated into seven FIA survey units—southeast (unit 1), the northeast (unit 2), the north...

  11. Texas, 2010 forest inventory and analysis factsheet

    Science.gov (United States)

    James W. Bentley

    2012-01-01

    This science update summarizes the findings of the statewide annual inventory conducted by the Southern Forest Inventory and Analysis (FIA) Program in cooperation with the Texas Forest Service of the forest resource attributes in Texas. The 254 counties of Texas are consolidated into seven FIA survey units – southeast (unit 1), northeast (unit 2), north central (unit 3...

  12. Handbook for inventorying downed woody material

    Science.gov (United States)

    James K. Brown

    1974-01-01

    To facilitate debris management, procedures for inventorying downed woody material are presented. Instructions show how to estimate weights and volumes of downed woody material, fuel depth, and duff depth. Using the planar intersect technique, downed material is inventoried by 0- to 0.25-inch, 0.25- to 1-inch, and 1- to 3-inch diameter classes; and by 1-inch classes...

  13. Improving the Greenlandic Greenhouse Gas Inventory

    DEFF Research Database (Denmark)

    Nielsen, Ole-Kenneth; Baunbæk, Lene; Gyldenkærne, Steen

    The project to improve the Greenlandic greenhouse gas (GHG) inventory was undertaken due to the recommendations made by the UNFCCC review team in connection with the 2008 and 2009 submissions by the Kingdom of Denmark. The improvements made to the Greenlandic GHG emission inventory were substantial...

  14. 40 CFR 52.2086 - Emission inventories.

    Science.gov (United States)

    2010-07-01

    ... area is classified as serious and includes the entire state of Rhode Island. (d) Minor revisions to the... inventory for the Providence ozone nonattainment area on January 12, 1993 as a revision to the State... 40 Protection of Environment 4 2010-07-01 2010-07-01 false Emission inventories. 52.2086 Section...

  15. Inventory Management Practices and Business Performance for ...

    African Journals Online (AJOL)

    Inventory constitutes much of the working capital held by SSEs and poor working capital management has been identified as one of the major causes of SSE failures. With this backdrop, this study investigated the relationship between inventory management practices and the business performance of SSEs in Kisii ...

  16. Relativity Concept Inventory: Development, Analysis, and Results

    Science.gov (United States)

    Aslanides, J. S.; Savage, C. M.

    2013-01-01

    We report on a concept inventory for special relativity: the development process, data analysis methods, and results from an introductory relativity class. The Relativity Concept Inventory tests understanding of relativistic concepts. An unusual feature is confidence testing for each question. This can provide additional information; for example,…

  17. Clean Lead Facility Inventory System user's manual

    International Nuclear Information System (INIS)

    Garcia, J.F.

    1994-12-01

    The purpose of this user's manual is to provide instruction and guidance needed to enter and maintain inventory information for the Clean Lead Facility (CLF), PER-612. Individuals responsible for maintaining and using the system should study and understand the information provided. The user's manual describes how to properly use and maintain the CLF Inventory System. Annual, quarterly, monthly, and current inventory reports may be printed from the Inventory System for reporting purposes. Profile reports of each shipment of lead may also be printed for verification and documentation of lead transactions. The CLF Inventory System was designed on Microsoft Access version 2.0. Similar inventory systems are in use at the Idaho National Engineering Laboratory (INEL) to facilitate site-wide compilations of mixed waste data. The CLF Inventory System was designed for inventorying the clean or non-radioactive contaminated lead stored at the CLF. This data, along with the mixed waste data, will be compiled into the Idaho Mixed Waste Information (IMWI) system for reporting to the Department of Energy Idaho Office, Department of Energy Headquarters, and/or the State of Idaho

  18. Double Degenerate Stars

    International Nuclear Information System (INIS)

    Xin-Lian, Luo; Hua, Bai; Lei, Zhao

    2008-01-01

    Regardless of the formation mechanism, an exotic object, the double degenerate star (DDS), is introduced and investigated, which is composed of baryonic matter and some unknown fermion dark matter. Different from the simple white dwarfs (WDs), there is additional gravitational force provided by the unknown fermion component inside DDSs, which may strongly affect the structure and the stability of such kind of objects. Many possible and strange observational phenomena connecting with them are concisely discussed. Similar to the normal WD, this object can also experience thermonuclear explosion as type Ia supernova explosion when DDS's mass exceeds the maximum mass that can be supported by electron degeneracy pressure. However, since the total mass of baryonic matter can be much lower than that of WD at Chandrasekhar mass limit, the peak luminosity should be much dimmer than what we expect before, which may throw a slight shadow on the standard candle of SN Ia in the research of cosmology. (general)

  19. Star spotting at CERN

    CERN Multimedia

    2008-01-01

    This June, two American celebrities (and physics enthusiasts!) came to CERN. Brian Cox gave Mike Einziger (right), lead guitarist with the rock band Incubus, the star treatment in the ATLAS cavern. Jesse Dylan embraces the spirit of ATLAS! Mike Einziger, lead guitarist with the rock band Incubus, visited CERN on Friday 13 June between concerts in Finland and England. Einziger, a lifelong science enthusiast descended into the ATLAS and CMS caverns and visited the SM18 test magnet facility during his brief tour of CERN. Einziger learned about the LHC through watching online lectures from University of Manchester and ATLAS physicist Brian Cox, and was thrilled to have the chance to see the detectors in person. The musician has created an orchestral piece, inspired in part by the work being done at CERN for the LHC, which will have its debut in Los Angeles on 23 August. Just over a week earlier, Jesse Dylan, Hollywood film director a...

  20. Close binary stars

    International Nuclear Information System (INIS)

    Larsson-Leander, G.

    1979-01-01

    Studies of close binary stars are being persued more vigorously than ever, with about 3000 research papers and notes pertaining to the field being published during the triennium 1976-1978. Many major advances and spectacular discoveries were made, mostly due to increased observational efficiency and precision, especially in the X-ray, radio, and ultraviolet domains. Progress reports are presented in the following areas: observational techniques, methods of analyzing light curves, observational data, physical data, structure and models of close binaries, statistical investigations, and origin and evolution of close binaries. Reports from the Coordinates Programs Committee, the Committee for Extra-Terrestrial Observations and the Working Group on RS CVn binaries are included. (Auth./C.F.)