
Sample records for spotted dolphins bottlenose

  1. Synchronous and Rhythmic Vocalizations and Correlated Underwater Behavior of Free-ranging Atlantic Spotted Dolphins (Stenella frontalis and Bottlenose Dolphins (Tursiops truncatus in the Bahamas

    Directory of Open Access Journals (Sweden)

    Denise L. Herzing


    Full Text Available Since 1985 a resident community of Atlantic spotted dolphins (Stenella frontalis, and bottlenose dolphins (Tursiops truncatus, have been studied underwater in the Bahamas. Over 200 individuals of both species have been identified and observed over the years. Basic correlations with sound patterns and behavior such as whistles during contact/reunions and squawks during aggression have been reported. This paper describes a small subset of their vocal repertoire that involves synchronous/rhythmic sound production. Dolphin behavior was recorded underwater using underwater video cameras with hydrophone input. Vocalizations were correlated with basic underwater behavioral activity and analyzed using Raven 1.3. Spotted dolphins were observed using two types of synchronized vocalizations including synchronized squawks (burst pulsed vocalizations and screams- (overlapping FM whistles during intraspecific and interspecific aggression. Bottlenose dolphins used three types of synchronized vocalizations; whistles/buzz bouts, bray/buzz bouts, and buzz bouts during intraspecific aggression. Body postures were synchronous with physical movements and often mirrored the rhythm of the vocalizations. The intervals between highly synchronized vocalizations had small variance and created a rhythmic quality and cadence to the acoustic sequences. Three types of vocalizations had similar ratios of sound duration to the spacing between sounds (Screams, whistle/buzz bouts, and bray/buzz bouts. Temporal aspects of sequences of sound and postures may be important aspects of individual and group coordination and behavior in delphinids.

  2. Biscayne Bay Florida Bottlenose Dolphin Studies (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — These data sets include a compilation of small vessel based studies of bottlenose dolphins that reside within Biscayne Bay, Florida, adjacent estuaries and nearshore...

  3. Quantitative examination of the bottlenose dolphin cerebellum. (United States)

    Hanson, Alicia; Grisham, William; Sheh, Colleen; Annese, Jacopo; Ridgway, Sam


    Neuroanatomical research into the brain of the bottlenose dolphin (Tursiops truncatus) has revealed striking similarities with the human brain in terms of size and complexity. However, the dolphin brain also contains unique allometric relationships. When compared to the human brain, the dolphin cerebellum is noticeably larger. Upon closer examination, the lobule composition of the cerebellum is distinct between the two species. In this study, we used magnetic resonance imaging to analyze cerebellar anatomy in the bottlenose dolphin and measure the volume of the separate cerebellar lobules in the bottlenose dolphin and human. Lobule identification was assisted by three-dimensional modeling. We find that lobules VI, VIIb, VIII, and IX are the largest lobules of the bottlenose dolphin cerebellum, while the anterior lobe (I-V), crus I, crus II, and the flocculonodular lobe are smaller. Different lobule sizes may have functional implications. Auditory-associated lobules VIIb, VIII, IX are likely large in the bottlenose dolphin due to echolocation abilities. Our study provides quantitative information on cerebellar anatomy that substantiates previous reports based on gross observation and subjective analysis. This study is part of a continuing effort toward providing explicit descriptions of cetacean neuroanatomy to support the interpretation of behavioral studies on cetacean cognition. Copyright © 2013 Wiley Periodicals, Inc.

  4. 50 CFR 229.35 - Bottlenose Dolphin Take Reduction Plan. (United States)


    ... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Bottlenose Dolphin Take Reduction Plan... § 229.35 Bottlenose Dolphin Take Reduction Plan. (a) Purpose and scope. The purpose of this section is to implement the Bottlenose Dolphin Take Reduction Plan to reduce incidental mortality and serious...

  5. Iron Indices in Bottlenose Dolphins (Tursiops truncatus) (United States)

    Mazzaro, Lisa M; Johnson, Shawn P; Fair, Patricia A; Bossart, Greg; Carlin, Kevin P; Jensen, Eric D; Smith, Cynthia R; Andrews, Gordon A; Chavey, Patricia S; Venn-Watson, Stephanie


    Bottlenose dolphins can have iron overload (that is, hemochromatosis), and managed populations of dolphins may be more susceptible to this disease than are wild dolphins. Serum iron, total iron-binding capacity (TIBC), transferrin saturation, and ferritin were measured in 181 samples from 141 dolphins in 2 managed collections and 2 free-ranging populations. Although no iron indices increased with age among free-ranging dolphins, ferritin increased with age in managed collections. Dolphins from managed collections had higher iron, ferritin, and transferrin saturation values than did free-ranging dolphins. Dolphins with high serum iron (exceeding 300 μg/dL) were more likely to have elevated ferritin but not ceruloplasmin or haptoglobin, demonstrating that high serum levels of iron are due to a true increase in total body iron. A time-series study of 4 dolphins with hemochromatosis that were treated with phlebotomy demonstrated significant decreases in serum ferritin, iron, and TIBC between pre- and posttreatment samples; transferrin saturation initially fell but returned to prephlebotomy levels by 6 mo after treatment. Compared with those in managed collections, wild dolphins were 15 times more likely to have low serum iron (100 μg/dL or less), and this measure was associated with lower haptoglobin. In conclusion, bottlenose dolphins in managed collections are more likely to have greater iron stores than are free-ranging dolphins. Determining why this situation occurs among some dolphin populations and not others may improve the treatment of hemochromatosis in dolphins and provide clues to causes of nonhereditary hemochromatosis in humans. PMID:23561885

  6. 77 FR 21946 - Taking of Marine Mammals Incidental to Commercial Fishing Operations; Bottlenose Dolphin Take... (United States)


    ...; Bottlenose Dolphin Take Reduction Plan AGENCY: National Marine Fisheries Service (NMFS), National Oceanic and... National Marine Fisheries Service (NMFS) proposes to amend the Bottlenose Dolphin Take Reduction Plan... Bottlenose Dolphin Take Reduction Team (BDTRT) recommended these regulations be continued permanently...

  7. Observations of NC stop nets for bottlenose dolphin takes (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — To observe the NC stop net fishery to document the entanglement of bottlenose dolphins and movement of dolphins around the nets.

  8. Cognitive skills in bottlenose dolphin communication. (United States)

    Janik, Vincent M


    Bottlenose dolphins display a behavioural skill set that makes them an interesting model system for the study of complexity in communication and cognition. They are capable of vocal learning, referential labelling, syntax comprehension, and joint attention. In their own communication system, these skills are used in individual recognition, group cohesion, and coordination, which suggests that social challenges are a universal selection pressure for complexity in communication and cognition independent of the physical environment. Copyright © 2013. Published by Elsevier Ltd.

  9. Unihemispheric sleep deprivation in bottlenose dolphins. (United States)

    Oleksenko; Mukhametov; Polyakova; Supin; Kovalzon


    Unihemispheric and bihemispheric sleep deprivation were performed in bottlenose dolphins. One brain hemisphere was capable of being deprived of delta (0.5-3.0 Hz) sleep in the former condition. Here, an increase in sleep pressure was observed during sleep deprivation in the deprived hemisphere. In the recovery sleep, following unihemispheric sleep deprivation, there was a rebound of delta sleep only in the deprived hemisphere. Following bihemispheric sleep deprivation the animals exhibited an increase in delta sleep in both hemispheres.

  10. The Metabolic Cost of Click Production in Bottlenose Dolphins (United States)


    of the previous work was on communicative sound production in bottlenose dolphins (Holt et al. 2011 a, b; Noren et al. 2011, 2013). There is... dolphin per day. Dissimilar to the previous study to determine the metabolic cost of communicative sound in which sound production occurred at the...rates from oxygen consumption values is similar to those used previously on bottlenose dolphins producing communicative sounds (Noren et al. 2011

  11. GoM Estuarine Bottlenose Dolphin Photo-identification studies (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — These data sets include a compilation of small vessel based studies of bottlenose dolphins that reside within Mississippi Sound and nearshore coastal waters. The...

  12. Shark predation on Indian Ocean bottlenose dolphins Tursiops ...

    African Journals Online (AJOL)

    The incidence of shark induced scars on Indian Ocean bottlenose dolphins caught in gill nets off Natal, on the south-east coast of southern Africa, was monitored between January 1983 and June 1987. The occurrence of dolphin remains in sharks caught in these nets between January 1980 and December 1985 was also ...

  13. Measuring and Validating Levels of Steroid Hormones in the Skin of Bottlenose Dolphins (Tursiops Truncatus) (United States)


    the Skin of Bottlenose Dolphins (Tursiops Truncatus) Thea Bechshoft Aarhus University Bioscience Roskilde Frederiksborgvej 399, P.O. Box 358...of, in skin from bottlenose dolphins (Tursiops truncatus), a) the influence of age and sex on progestagens, estrogens, and androgens, b) by use of an ACTH challenge in bottlenose dolphins ” (Award Number: N000141310771). The dolphins will be sampled as part of an ongoing out- of water

  14. Conceptive Estrus Behavior in Three Bottlenose Dolphins (Tursiops truncatus)


    Holley Muraco; Stan A. Kuczaj II


    Bottlenose dolphins (Tursiops truncatus) are a highly promiscuous species that routinely engage in socio-sexual interactions, yet relatively little has been reported about actual estrus behavior. For this study of three female dolphins located at two aquarium facilities, 20 reproductive behaviors were investigated during three conceptive estrous cycles with known endocrinology. Reproductive behaviors increased with estradiol levels and peak occurrences of behaviors were observed during the lu...

  15. Development of specific cytokine and Chemokine ELISAs for Bottlenose Dolphins (United States)

    Earlier detection of changes in the health status of bottlenose dolphins (Tursiops truncatus) is expected to further improve their medical care. Cytokines and chemokines are critical mediators of the cellular immune response, and studies have suggested that these molecules may serve as important bio...

  16. Movement patterns of coastal bottlenose dolphins in the presence of ...

    African Journals Online (AJOL)

    The presence and movement of Indo-Pacific bottlenose dolphins Tursiops aduncus were investigated using shore-based observations made during a humpback whale Megaptera novaeangliae migration survey at Cape Vidal, South Africa, undertaken between June and October 1988–1991. Occurrence was analysed as ...

  17. Bottlenose dolphin Tursiops truncatus group dynamics, site fidelity ...

    African Journals Online (AJOL)

    ... ecology in these waters. Photo-identification undertaken during systematic, non-systematic and opportunistic surveys conducted between 2001 and 2012 was used to assess group dynamics, site fidelity, residency and movement patterns of bottlenose dolphins in the archipelago. Three different patterns of residency were ...

  18. 77 FR 45268 - Taking of Marine Mammals Incidental to Commercial Fishing Operations; Bottlenose Dolphin Take... (United States)


    ...; Bottlenose Dolphin Take Reduction Plan AGENCY: National Marine Fisheries Service, National Oceanic and... Service (NMFS) issues this final rule amending the Bottlenose Dolphin Take Reduction Plan (BDTRP) and its... Dolphin Take Reduction Team (Team) recommended these regulations be continued permanently, without...

  19. Stable isotopes differentiate bottlenose dolphins off west-central Florida (United States)

    Barros, Nélio B.; Ostrom, P. H.; Stricker, Craig A.; Wells, R.S.


    Distinguishing discrete population units among continuously distributed coastal small cetaceans is challenging and crucial to conservation. We evaluated the utility of stable isotopes in assessing group membership in bottlenose dolphins (Tursiops truncatus) off west-central Florida by analyzing carbon, nitrogen, and sulfur isotope values (δ13C, δ15N, and δ34S) of tooth collagen from stranded dolphins. Individuals derived from three putative general population units: Sarasota Bay (SB), nearshore Gulf of Mexico (GULF), and offshore waters (OFF). Animals of known history (SB) served to ground truth the approach against animals of unknown history from the Gulf of Mexico (GULF, OFF). Dolphin groups differed significantly for each isotope. Average δ13C values from SB dolphins (−10.6‰) utilizing sea grass ecosystems differed from those of GULF (−11.9‰) and OFF (−11.9‰). Average δ15N values of GULF (12.7‰) and OFF (13.2‰) were higher than those of SB dolphins (11.9‰), consistent with differences in prey trophic levels. δ34S values showed definitive differences among SB (7.1‰), GULF (11.3‰), and OFF (16.5‰) dolphins. This is the first application of isotopes to population assignment of bottlenose dolphins in the Gulf of Mexico and results suggest that isotopes may provide a powerful tool in the conservation of small cetaceans.

  20. The uncertain response in the bottlenosed dolphin (Tursiops truncatus). (United States)

    Smith, J D; Schull, J; Strote, J; McGee, K; Egnor, R; Erb, L


    Humans respond adaptively to uncertainty by escaping or seeking additional information. To foster a comparative study of uncertainty processes, we asked whether humans and a bottlenosed dolphin (Tursiops truncatus) would use similarly a psychophysical uncertain response. Human observers and the dolphin were given 2 primary discrimination responses and a way to escape chosen trials into easier ones. Humans escaped sparingly from the most difficult trials near threshold that left them demonstrably uncertain of the stimulus. The dolphin performed nearly identically. The behavior of both species is considered from the perspectives of signal detection theory and optimality theory, and its appropriate interpretation is discussed. Human and dolphin uncertain responses seem to be interesting cognitive analogs and may depend on cognitive or controlled decisional mechanisms. The capacity to monitor ongoing cognition, and use uncertainty appropriately, would be a valuable adaptation for animal minds. This recommends uncertainty processes as an important but neglected area for future comparative research.

  1. Whistle Matching in Wild Bottlenose Dolphins (Tursiops truncatus) (United States)

    Janik, Vincent M.


    Dolphin communication is suspected to be complex, on the basis of their call repertoires, cognitive abilities, and ability to modify signals through vocal learning. Because of the difficulties involved in observing and recording individual cetaceans, very little is known about how they use their calls. This report shows that wild, unrestrained bottlenose dolphins use their learned whistles in matching interactions, in which an individual responds to a whistle of a conspecific by emitting the same whistle type. Vocal matching occurred over distances of up to 580 meters and is indicative of animals addressing each other individually.

  2. Training Atlantic Bottlenose Dolphins (Tursiops truncatus) for Artificial Insemination (United States)


    TURSIOPS TRUNCATUS) FOR ARTIFICIAL INSEMINATION 12. PERSONAL AUTHOR(S) K. V. Keller, Jr. 1a. TYPE OF REPORT 13b. TIME COVERED 14. DATE OF REPORT IlYai. WMt...ATLANTIC BOTTLENOSE DOLPHINS (Tursiops truncatus) FOR ARTIFICIAL INSEMINATION Karl V. Keller Naval Ocean Systems Center, Hawaii Laboratory Kailua, HI 96734...INTRODUCTION The Naval Ocean Systems Center, Hawaii Laboratory, for the past eight years has maintained an artificial insemination (AI) program for

  3. Rhythm perception and production by the bottlenose dolphin (United States)

    Harley, Heidi E.; Crowell, Sara E.; Fellner, Wendi; Odell, Kim; Larsen-Plott, Leslie


    Rhythm is an important component of many natural communication systems, but it has rarely been the focus of laboratory studies of nonhuman species. Recent cognitive studies with a bottlenose dolphin confirm that a dolphin can discriminate among six different 14-kHz 4-s acoustic rhythms at 94% accuracy, and can transfer that discrimination across multiple frequency (93%) and tempo (16%-93%) shifts. In addition, a dolphin has learned to produce six different rhythms in an object-labeling paradigm. Original training required the dolphin to produce the rhythms using a pneumatic switch that led to the in-air projection of computer-generated tones. However, the dolphin spontaneously began to produce the rhythms vocally as well. To date, the dolphin has accurately labeled five objects with unique rhythms at 87% accuracy using the switch and at 83% accuracy using his own vocalizations. Confusions at the various tempos in the perception study and the variability of some characteristics and stability of others in the production study provide insight into how dolphins represent rhythm and have implications for natural communication in this species.

  4. A kinematic study on (unintentional imitation in bottlenose dolphins

    Directory of Open Access Journals (Sweden)

    Luisa eSartori


    Full Text Available The aim of the present study was to investigate the effect of observing other’s movements on subsequent performance in bottlenose dolphins. The imitative ability of non-human animals has intrigued a number of researchers. So far, however, studies in dolphins have been confined to intentional imitation concerned with the explicit request to imitate other agents. In the absence of instruction to imitate, do dolphins (unintentionally replicate other’s movement features? To test this, dolphins were filmed while reaching and touching a stimulus before and after observing another dolphin (i.e., model performing the same action. All videos were reviewed and segmented in order to extract the relevant movements. A marker was inserted post-hoc via software on the videos upon the anatomical landmark of interest (i.e. rostrum and was tracked throughout the time course of the movement sequence. The movement was analyzed using an in-house software developed to perform two-dimensional (2D post-hoc kinematic analysis. The results indicate that dolphins’ kinematics is sensitive to other’s movement features. Movements performed for the ‘visuomotor priming’ condition were characterized by a kinematic pattern similar to that performed by the observed dolphin (i.e., model. Addressing the issue of spontaneous imitation in bottlenose dolphins might allow ascertaining whether the potential or impulse to produce an imitative action is generated, not just when they intend to imitate, but whenever they watch another conspecific’s behavior. In closing, this will clarify whether motor representational capacity is a by-product of factors specific to humans or whether more general characteristics such as processes of associative learning prompted by high level of encephalization could help to explain the evolution of this ability.

  5. Bottlenose dolphin Tursiops truncatus at São Tomé Island (São ...

    African Journals Online (AJOL)

    Although the bottlenose dolphin Tursiops truncatus is one of the most common cetacean species around São Tomé Island, Gulf of Guinea, little research has focused on this species in this region. This study investigated the population of bottlenose dolphins around São Tomé Island by estimating the minimum population ...

  6. Longitudinal monitoring of bottlenose dolphin leukocyte cytokine mRNA responsiveness by qPCR (United States)

    Both veterinarians caring for bottlenose dolphins (Tursiops truncatus) in managed populations and researchers monitoring wild populations use blood-based diagnostics to monitor bottlenose dolphin health. Quantitative PCR (qPCR) can be used to assess cytokine expression patterns of peripheral blood m...

  7. Sex Difference in Bottlenose Dolphin Sightings during a Long-term Bridge Construction Project


    Ann Weaver


    Almost nothing is known about the effect of long-term bridge construction on free-ranging bottlenose dolphins (Tursiops truncatus). The species’ natural history predicts that there should be sex differences in reaction to construction because bottlenose dolphins show sex differences in most of their behaviors. A 5-year bridge construction project over a narrow but important dolphin corridor at John’s Pass tidal inlet, St. Petersburg FL, brought chronic environmental changes. The purpose of th...

  8. Cognitive adaptation of sonar gain control in the bottlenose dolphin. (United States)

    Kloepper, Laura N; Smith, Adam B; Nachtigall, Paul E; Buck, John R; Simmons, James A; Pacini, Aude F


    Echolocating animals adjust the transmit intensity and receive sensitivity of their sonar in order to regulate the sensation level of their echoes; this process is often termed automatic gain control. Gain control is considered not to be under the animal's cognitive control, but previous investigations studied animals ensonifying targets or hydrophone arrays at predictable distances. To test whether animals maintain gain control at a fixed level in uncertain conditions, we measured changes in signal intensity for a bottlenose dolphin (Tursiops truncatus) detecting a target at three target distances (2.5, 4 and 7 m) in two types of sessions: predictable and unpredictable. Predictable sessions presented the target at a constant distance; unpredictable sessions moved the target randomly between the three target positions. In the predictable sessions the dolphin demonstrated intensity distance compensation, increasing the emitted click intensity as the target distance increased. Additionally, as trials within sessions progressed, the animal adjusted its click intensity even from the first click in a click train, which is consistent with the animal expecting a target at a certain range. In the unpredictable sessions there was no significant difference of intensity with target distance until after the 7th click in a click train. Together, these results demonstrate that the bottlenose dolphin uses learning and expectation for sonar gain control.

  9. Nocturnal Vocal Activity in Captive Bottlenose Dolphins (Tursiops truncatus: Could Dolphins have Presleep Choruses?

    Directory of Open Access Journals (Sweden)

    Dorothee Kremers


    Full Text Available Nocturnal vocal activity in dolphins is often thought to be associated with feeding activity. However, when no food resources are available dolphins spend their time for the most part resting/sleeping. While unihemispherically sleeping, dolphins mostly swim slowly and synchronously in close proximity with one or more other individuals. Although vocal activity is lower during resting/sleeping, dolphins are not entirely silent the entire night. However, nothing is known about the temporal patterning of vocal activity at night and its potential relation with activity in dolphins. Here we recorded the vocal activity of a group of five captive bottlenose dolphins at night while having no feeding opportunity, examined whether there was any temporal pattern and/or a relation with breathing activity, used here as an index of overall activity. The temporal pattern revealed two peaks of intense whistle activity (8 p.m. and midnight, which were followed by a strong decrease of whistle rate and a slight decrease of respiration rate. We suggest that the high vocal activity at the peak periods might indicate socializing periods and that dolphins, like many other species, show periods of increased social and vocal interactions (chorusing? before starting to rest/sleep, maybe to ensure the synchrony of slow swimming observed in this species. These findings contribute to a better understanding of nocturnal vocal activity in cetaceans and suggest new lines of research on vocal/social activity of dolphins in relation to presleep and resting behavior.

  10. Epidermal growth in the bottlenose dolphin, Tursiops truncatus

    International Nuclear Information System (INIS)

    Hicks, B.D.; St Aubin, D.J.; Geraci, J.R.; Brown, W.R.


    Epidermal growth in two mature female bottlenose dolphins, Tursiops truncatus, was investigated by following the movement of a cohort of tritiated thymidine-labeled epidermal cells for 59 days. The majority of the cells migrated in a cluster which was estimated to reach the skin surface in 73 days. The authors calculate that the outermost cell layer is sloughed 12 times per day. Turnover time and sloughing rate are estimated to be 1.7 times longer and 8.5 times faster than the respective values for epidermal cell kinetics in humans. This apparent inconsistency of slow transit time and rapid sloughing rate is reconciled by the convoluted structure of the stratum germinativum in the dolphin which results in a ratio of germinatival to superficial cells of 876:1. The stratum germinativum of dolphin epidermis appears to lack morphologically distinct, spatially segregated subpopulations of anchoring and stem cells. Dolphin epidermis has a large capacity for cell population, relatively long turnover time, and rapid sloughing rate. The adaptive advantages of these characteristics are discussed

  11. The Development of Social Play in Bottlenose Dolphins (Tursiops truncatus

    Directory of Open Access Journals (Sweden)

    Angela D. Mackey


    Full Text Available For the young of many species, social play is an important aspect of development. Previous research has shown that bottlenose dolphin calves engage in social play early in life. Despite these observations, little is known about the development of social play in this species. The present study examined the social play behavior of three aquarium-housed bottlenose dolphin calves during their first year of life. We were particularly interested in the partner with whom each calf played as well as the initiator of social play bouts. Each calf was observed from birth until the end of its first year and all bouts of social and solitary play were recorded during observation sessions. While the calves engaged in both social and solitary play throughout their first year, play became increasingly social as they aged. The calves also became more likely to initiate social play interactions with increasing age. A calf’s first social play partner was typically its mother, but other calves quickly replaced the mother as the most common play partner. When it came to play partner preferences, we found that calves of similar age were preferred as play partners, but age similarity became less characteristic of play partners as the calves grew older. These findings likely reflect changes in the developmental competence of each of the calves individually, and support the notion that calves use social play to challenge themselves.

  12. Captive-born intergeneric hybrid of a Guiana and bottlenose dolphin: Sotalia guianensis x Tursiops truncatus. (United States)

    Caballero, S; Baker, C S


    Bottlenose dolphins (Tursiops truncatus) and Guiana dolphin (Sotalia guianensis) live in sympatry along the Caribbean Coast of Central and South America and social interactions between these species have been described in the Caribbean Coast of Costa Rica, including sexual encounters. Here we examine and document the only known hybridization event between a male Guiana dolphin and a female bottlenose dolphin, in captivity at Oceanario Islas del Rosario (Colombian Caribbean), using photographic and genetic evidence from mitochondrial DNA markers and nuclear autosomal introns. © 2009 Wiley-Liss, Inc.

  13. Bottlenose dolphin age structure and growth in the Mississippi Sound region of the Gulf of Mexico (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Teeth were collected from bottlenose dolphins that stranded within the north-central Gulf of Mexico between 1986-2003. These teeth were sectioned and growth rings...

  14. Development and application of specific cytokine assays in tissue samples from a bottlenose dolphin with hyperinsulinemia (United States)

    Chronic inflammation has been associated with insulin resistance and type 2 diabetes in humans. Postmortem hepatic and splenic tissue from a 46-year old geriatric male bottlenose dolphin (Tursiops truncatus) with insulin resistance (chronic hyperinsulinemia with hyperglycemia) , chronic = inflamma...

  15. GoM Estuarine Bottlenose Dolphin Photo-identification studies - NRDA (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — These data sets include a compilation of small vessel based studies of bottlenose dolphins that reside within Barataria Bay, LA, Mississippi Sound, MS and nearshore...

  16. 77 FR 22759 - Proposed Information Collection; Comment Request; Southeast Region Bottlenose Dolphin... (United States)


    ... DEPARTMENT OF COMMERCE National Oceanic and Atmospheric Administration Proposed Information Collection; Comment Request; Southeast Region Bottlenose Dolphin Conservation Outreach Survey AGENCY.... Revision: The intent is to use this survey in one to two other geographic areas of the southeast region...

  17. PFOS and PFOSA in Bottlenose Dolphins: An Investigation into Two Unusually High Mortality Epizootics (United States)

    Along the Atlantic coast of the United States during 1987 and 1988, bottlenose dolphins (Tursiops truncatus) suffered one of this country's largest marine mammal mass mortality events. An estimated 50% of all near-shore bottlenose died during this short period. Two years later a ...

  18. PFOS and PFOSA in Bottlenose Dolphins: An Investigation into Two Unusual Mortality Epizootics (WDA) (United States)

    Along the Atlantic coast of the United States during 1987 and 1988, bottlenose dolphins (Tursiops truncatus) suffered one of this country's largest marine mammal mass mortality events. An estimated 50% of all near-shore bottlenose died during this short period. Two years later a ...

  19. PFOS and PFOSA in Bottlenose Dolphins: An Investigation into Two High Mortality Epizootics (NRMMSTSN2009) (United States)

    Along the Atlantic coast of the United States during 1987 and 1988, bottlenose dolphins (Tursiops truncatus) suffered one of this country's largest marine mammal mass mortality events. An estimated 50% of all near-shore bottlenose died during this short period. Two years later a ...

  20. PFOS and PFOSA in Bottlenose Dolphins: An Investigation into Two Unusually High Mortality Events (United States)

    Along the Atlantic coast of the United States during 1987 and 1988, bottlenose dolphins (Tursiops truncatus) suffered one of this country's largest marine mammal mass mortality events. An estimated 50% of all near-shore bottlenose died during this short period. Two years later a ...

  1. Conceptive Estrus Behavior in Three Bottlenose Dolphins (Tursiops truncatus

    Directory of Open Access Journals (Sweden)

    Holley Muraco


    Full Text Available Bottlenose dolphins (Tursiops truncatus are a highly promiscuous species that routinely engage in socio-sexual interactions, yet relatively little has been reported about actual estrus behavior. For this study of three female dolphins located at two aquarium facilities, 20 reproductive behaviors were investigated during three conceptive estrous cycles with known endocrinology. Reproductive behaviors increased with estradiol levels and peak occurrences of behaviors were observed during the luteinizing hormone (LH surge. Two novel behaviors were observed: (1 genital tracking, an investigatory-type behavior, and (2 immobility, a novel form of standing heat estrus. These behaviors appeared to communicate reproductive readiness and increased copulation success. A total of 314 occurrences of estrus behavior were recorded in 10 hours of footage from the three focal females, and copulation spanned from day -9 to day 0 in one dominant female. Sexual interactions during estrus included female-to-female, immature male-to-female, mature male-to-immature male and masturbation with toys. During estrus, focal females received more behavioral attention than they initiated, and passive and active dorsal fin mounting between females was the most frequent behavior. These dolphins showed behavioral patterns similar to those reported in estrus cows where genitals are nuzzled, females mount and are mounted by other females, and standing heat intensity increases as LH levels rise.

  2. Genetic diversity of coastal bottlenose dolphins revealed by structurally and functionally diverse hemoglobins. (United States)

    Remington, Nicole; Stevens, Robert D; Wells, Randall S; Holn, Aleta; Dhungana, Suraj; Taboy, Celine H; Crumbliss, Alvin L; Henkens, Robert; Bonaventura, Celia


    Studies of structure-function relationships in the respiratory proteins of marine mammals revealed unexpected variations in the number and types of hemoglobins (Hbs) present in coastal bottlenose dolphins, Tursiops truncatus. We obtained blood samples from free-ranging coastal bottlenose dolphins as a component of capture-release studies. We found that the oxygen-binding functions of bottlenose dolphin blood are poised between effector-saturated and unsaturated levels, enabling exercise-dependent shifts in oxygen transfer functions. Isolated bottlenose dolphin Hbs showed elevated pH sensitivities (Bohr effects) and appreciably lower oxygen affinities than adult human Hb in the absence of allosteric effectors. These properties may be an adaptive modification that enhances oxygen delivery during diving episodes when oxygen tensions and effector levels are low. The Hbs of individual dolphins showed similar oxygen affinities, responses to effectors, and expression of heme-heme interaction in oxygen binding, but differed in their redox potentials and rates of autoxidation. The heterogeneity suggested by these functional variations in Hbs of individual dolphins was born out by variations in the molecular weights and numbers of their alpha and beta globin chains. Although coastal bottlenose dolphins were expected to have a single type of Hb, the mass differences observed revealed considerable genetic diversity. There were multiple Hb forms in some individuals and differences in Hb patterns among individuals within the same community.

  3. Resting behaviors of captive bottlenose dolphins (Tursiops truncatus). (United States)

    Sekiguchi, Yuske; Kohshima, Shiro


    In order to specify the resting behaviors in captive bottlenose dolphin, we quantitatively analyzed behavior of 16 dolphins in three aquariums in Japan. We observed their behaviors in the low-activity time (0 a.m.-3 a.m.), assuming that the resting behaviors would be most prominent and abundant at this time. We analyzed these behaviors based on the data of their diurnal activity rhythm that we have clarified by measuring swimming speed and breath frequency. The behavior patterns characteristic to the low-activity time could be categorized into the following three types: "bottom-rest" characterized by long immobile stay on the tank bottom, "surface-rest" characterized by long immobile stay at the water surface, and "swim-rest" characterized by slow circle-swim near the bottom along a fixed trajectory. During these behaviors, breath frequency was significantly lower than the daily mean and at least one eye tended to be closed. These three behaviors accounted for 86.6% of the total observation time in the low-activity time. The resting behaviors were often observed even in the high-activity time (0 p.m.-4 p.m.); these three behaviors accounted for 38.5% of the total observation time in the high-activity time. In swim-rest, frequency of sound emission was significantly lower than that of other behaviors with high-speed swimming, and both eyes or one eye, especially the eye facing the inner side of the swimming circle tended to be closed. The eye condition and the periodical change of circle-swim direction or position-exchange observed during swim-rest suggest a relation between this behavior and unihemispheric sleep. The change in the resting behavior observed in the dolphins under nervous situations suggests that the dolphins flexibly change the type and the quantity of the resting behaviors according to the situation.

  4. Early social networks predict survival in wild bottlenose dolphins.

    Directory of Open Access Journals (Sweden)

    Margaret A Stanton

    Full Text Available A fundamental question concerning group-living species is what factors influence the evolution of sociality. Although several studies link adult social bonds to fitness, social patterns and relationships are often formed early in life and are also likely to have fitness consequences, particularly in species with lengthy developmental periods, extensive social learning, and early social bond-formation. In a longitudinal study of bottlenose dolphins (Tursiops sp., calf social network structure, specifically the metric eigenvector centrality, predicted juvenile survival in males. Additionally, male calves that died post-weaning had stronger ties to juvenile males than surviving male calves, suggesting that juvenile males impose fitness costs on their younger counterparts. Our study indicates that selection is acting on social traits early in life and highlights the need to examine the costs and benefits of social bonds during formative life history stages.

  5. Acoustic Behaviour of Bottlenose Dolphins and Pilot Whales

    DEFF Research Database (Denmark)

    Jensen, Frants Havmand


    of sight of surface observers. These species differ in the acoustic habitats they dwell in, as well as in group structure and foraging ecology. The overall aim of this thesis has been to address, in a comparative fashion, how these two species behave acoustically in the wild, and how they have adapted...... be an active, cognitive process rather than a biophysical consequence of faster clicking rates. I carried out similar studies on the larger short-finned pilot whales using the same array deployed at the surface. My results here appeared to reveal similar source levels than found for the bottlenose dolphins......, on the other hand, use signals that can be detected at longer distances, primarily due to lower background noise levels in the more open habitat but also because they seem to be able to produce calls at higher amplitudes. However, their deep-diving ecology appears to impose special constraints...

  6. Validating the Novel Method of Measuring Cortisol Levels in Cetacean Skin by use of an ACTH Challenge in Bottlenose Dolphins (United States)


    in Cetacean Skin by use of an ACTH Challenge in Bottlenose Dolphins Thea Bechshoft Aarhus University Bioscience Roskilde Frederiksborgvej...using skin samples collected from bottlenose dolphins (Tursiops truncatus). The dolphins will be sampled as part of an ongoing out-of water stress test...N000141110436. The stress test in brief: Each dolphin is asked to perform a routine, voluntary beach into a padded beaching tray. Immediately following

  7. The Bottlenose Dolphin (Tursiops truncatus) as a Model to Understand Variation in Stress and Reproductive Hormone Measures in Relation to Sampling Matrix, Demographics, and Environmental Factors (United States)


    1 DISTRIBUTION STATEMENT A. Approved for public release; distribution is unlimited. FINAL REPORT The Bottlenose Dolphin (Tursiops truncatus...indicators and methods to quantify chronic stress in bottlenose dolphins . Much research had focused on the stimuli which induce stress in marine mammals, as...mammals was essential for understanding risks and long- term consequences for populations. OBJECTIVES Using the bottlenose dolphin as a model

  8. Secretory patterns of catecholamines in Indo-Pacific bottlenose dolphins. (United States)

    Suzuki, Miwa; Nozawa, Aoi; Ueda, Keiichi; Bungo, Takashi; Terao, Hiromi; Asahina, Kiyoshi


    Catecholamines (CAs), namely adrenaline (A), noradrenaline (NA), and dopamine (DA), are secreted by the sympathoadrenal system and participate in a diverse array of functions, e.g., heat production, cardiovascular regulation, stress response and so on. However, little is known regarding peripheral CA fluctuations in cetaceans; nevertheless aquatic animals like them have needed to modify their physiological response especially for thermoregulation in water and oxygen economy during diving. To understand CA dynamism in cetaceans, diurnal changes in serum A, NA, and DA concentrations were measured during the winter and summer solstices in four Indo-Pacific bottlenose dolphins (Tursiops aduncus). The average serum NA concentration was much higher than the average A and DA concentrations, and all concentrations were higher than those reported in other cetacean species. No distinct diurnal fluctuations were observed in CA concentrations in either solstice, suggesting inhibition of the decrease in CA concentrations during nocturnal periods by the unique sleep pattern of dolphins. All the serum CA concentrations were negatively correlated with water temperature as body temperatures were, indicating that the sympathoadrenal system might be more active during winter than in summer season, suggesting a role of CA in thermoregulation. Copyright © 2012 Elsevier Inc. All rights reserved.

  9. Postmortem evidence of interactions of bottlenose dolphins (Tursiops truncatus) with other dolphin species in south-west England. (United States)

    Barnett, J; Davison, N; Deaville, R; Monies, R; Loveridge, J; Tregenza, N; Jepson, P D


    Reports of violent interactions between bottlenose dolphins (Tursiops truncatus) and harbour porpoises (Phocoena phocoena) in the coastal waters of the UK are well documented. Examination of stranded cetaceans by the Cornwall Wildlife Trust Marine Strandings Network and the UK Cetacean Strandings Investigation Programme has indicated that seven animals, of four other species, found stranded in south-west England, had pathology consistent with bottlenose dolphin interaction, including two juvenile and two adult common dolphins (Delphinus delphis), one juvenile pilot whale (Globicephala melas), one juvenile Risso's dolphin (Grampus griseus) and one adult striped dolphin (Stenella coeruleoalba). Although recorded traumatic lesions were often not as severe as those found in harbour porpoises, it is probable that the interactions did contribute to stranding and/or death in all four of the juvenile animals examined. Furthermore, analysis of photographs taken before establishment of the Marine Strandings Network revealed rake (teeth) marks consistent with bottlenose dolphin interaction on one stranded common dolphin in 1992. A number of causes have been suggested for these interactions in harbour porpoises stranded in the UK and it is possible that any combination of these factors may also be implicated in the cases described in this report.

  10. Dietary cation-anion difference may explain why ammonium urate nephrolithiasis occurs more frequently in common bottlenose dolphins () under human care than in free-ranging common bottlenose dolphins. (United States)

    Ardente, A J; Wells, R S; Smith, C R; Walsh, M T; Jensen, E D; Schmitt, T L; Colee, J; Vagt, B J; Hill, R C


    Ammonium urate nephrolithiasis frequently develops in common bottlenose dolphins () managed under human care but is rare in free-ranging common bottlenose dolphins. In other species, the dietary cation-anion difference (DCAD) can affect ammonium urate urolith formation by increasing proton excretion as ammonium ions. Therefore, differences in diet between the 2 dolphin populations could affect urolith formation, but the DCAD of most species consumed by free-ranging and managed dolphins is unknown. To compare the nutrient composition of diets consumed by free-ranging and managed bottlenose dolphins, samples ( = 5) of the 8 species of fish commonly consumed by free-ranging bottlenose dolphins in Sarasota Bay, FL, and the 7 species of fish and squid commonly fed to managed bottlenose dolphins were analyzed for nutrient content. Metabolizable energy was calculated using Atwater factors; the DCAD was calculated using 4 equations commonly used in people and animals that use different absorption coefficients. The nutrient composition of individual species was used to predict the DCAD of 2 model diets typically fed to managed common bottlenose dolphins and a model diet typically consumed by common bottlenose dolphins in Sarasota Bay. To mimic differences in postmortem handling of fish for the 2 populations of bottlenose dolphins, "free-ranging" samples were immediately frozen at -80°C and minimally thawed before analysis, whereas "managed" samples were frozen for 6 to 9 mo at -18°C and completely thawed. "Free-ranging" species contained more Ca and P and less Na and Cl than "managed" fish and squid species. As a consequence, the DCAD of both model managed dolphin diets obtained using 3 of the 4 equations was much more negative than the DCAD of the model free-ranging bottlenose dolphin diet ( dolphins must excrete more protons in urine than free-ranging bottlenose dolphins, which will promote nephrolith formation. The nutrient composition of the free-ranging bottlenose

  11. Serologic response in bottlenose dolphins Tursiops truncatus infected with Brucella sp. using a dolphin-specific indirect ELISA. (United States)

    Meegan, Jenny; Dunn, J Lawrence; Venn-Watson, Stephanie K; Smith, Cynthia R; Sidor, Inga; Jensen, Eric D; Van Bonn, William G; Pugh, Roberta; Ficht, Thomas; Adams, L Garry; Nielsen, Klaus; Romano, Tracy A


    Marine-origin Brucella infections and serologic evidence of exposure have been documented in multiple cetacean species. A dolphin-specific indirect enzyme-linked immunosorbent assay (ELISA) was developed to screen bottlenose dolphin sera for anti-Brucella antibodies. A total of 131 serum samples collected over a 2 to 18 yr period from 6 bottlenose dolphins Tursiops truncatus with confirmed Brucella infections were analyzed for the presence and magnitude of antibody titers against marine-origin Brucella to compare individual antibody responses to various disease manifestations. Additionally, an epidemiologic serologic survey of a managed population of 64 bottlenose dolphins was performed to evaluate for the presence of antibodies and to determine whether there were any clinical pathology predictors for exposure or infection. The serologic results revealed that the dolphins with Brucella-associated abortions were seronegative for 7 to 18 yr until after the abortion and maintained positive titers for several years, with 2 of 3 animals returning to seronegative status. In contrast, the dolphins with Brucella-associated pulmonary or bone lesions maintained persistent positive titers for 2 to 18 yr. The population serosurvey revealed no significant differences in antibody levels among males and females, and dolphins between the ages of 17 and 25 yr were 6.8 times more likely to be Brucella antibody positive compared to those that were younger or older. Seropositive dolphins did not have significant inflammation compared to seronegative dolphins but were more likely to have higher levels of aspartate aminotransferase and gamma-glutamyl transpeptidase. Among 16 dolphins that tested seropositive, 13 (81.3%) had previously been seropositive for at least 3 to 5 yr.

  12. Dolphin hearing during echolocation: evoked potential responses in an Atlantic bottlenose dolphin (Tursiops truncatus). (United States)

    Li, Songhai; Nachtigall, Paul E; Breese, Marlee


    Auditory evoked potential (AEP) responses were recorded during echolocation in an Atlantic bottlenose dolphin (Tursiops truncatus) trained to accept suction-cup EEG electrodes and detect targets by echolocation. AEP recording was triggered by the echolocation clicks of the animal. Three targets with target strengths of -34, -28 and -22 dB were used at a target distance of 2 to 6.5 m for each target. The results demonstrated that the AEP appeared to both outgoing echolocation clicks and echoes during echolocation, with AEP complexes consisting of alternative positive and negative waves. The echo-related AEP amplitudes were obviously lower than the outgoing click-related AEP amplitudes for all the targets at the investigated target distances. However, for targets with target strengths of -22 and -28 dB, the peak-to-peak amplitudes of the echo-related AEPs were dependent on the target distances. The echo-related AEP response amplitudes increased at further target distances, demonstrating an overcompensation of echo attenuation with target distance in the echo-perception system of the dolphin biosonar. Measurement and analysis of outgoing click intensities showed that the click levels increased with target distance (R) by a factor of approximately 10 to 17.5 logR depending on target strength. The results demonstrated that a dual-component biosonar control system formed by intensity compensation behavior in both the transmission and receiving phases of a biosonar cycle exists synchronously in the dolphin biosonar system.

  13. Biosonar adjustments to target range of echolocating bottlenose dolphins (Tursiops sp.) in the wild

    DEFF Research Database (Denmark)

    Frants, Jensen; Lars, Bejder; Wahlberg, Magnus


    intervals, and source levels of wild bottlenose dolphins (Tursiops sp.) by recording regular (non-buzz) echolocation clicks with a linear hydrophone array. Dolphins clicked faster with decreasing distance to the array, reflecting a decreasing delay between the outgoing echolocation click and the returning...... longer than a few body lengths of the dolphin. Source level estimates drop with reducing range between the echolocating dolphins and the target as a function of 17 log(R). This may indicate either (1) an active form of time-varying gain in the biosonar independent of click intervals or (2) a bias...

  14. A common bottlenose dolphin (Tursiops truncatus) prey handling technique for marine catfish (Ariidae) in the northern Gulf of Mexico


    Ronje, Errol I.; Barry, Kevin P.; Sinclair, Carrie; Grace, Mark A.; Barros, N?lio; Allen, Jason; Balmer, Brian; Panike, Anna; Toms, Christina; Mullin, Keith D.; Wells, Randall S.


    Few accounts describe predator-prey interactions between common bottlenose dolphins (Tursiops truncatus Montagu 1821) and marine catfish (Ariopsis felis Linnaeus 1766, Bagre marinus Mitchill 1815). Over the course of 50,167 sightings of bottlenose dolphin groups in Mississippi Sound and along the Florida coast of the Gulf of Mexico, severed catfish heads were found floating and exhibiting movements at the surface in close proximity to 13 dolphin groups that demonstrated feeding behavior. Thes...

  15. The orexin system in the enteric nervous system of the bottlenose dolphin (Tursiops truncatus.

    Directory of Open Access Journals (Sweden)

    Claudia Gatta

    Full Text Available This study provides a general approach to the presence and possible role of orexins and their receptors in the gut (three gastric chambers and intestine of confined environment bottlenose dolphin. The expression of prepro-orexin, orexin A and B and orexin 1 and 2 receptors were investigated by single immunostaining and western blot analysis. The co-localization of vasoactive intestinal peptide and orexin 1 receptor in the enteric nervous system was examined by double immunostaining. Also, orexin A concentration were measured in plasma samples to assess the possible diurnal variation of the plasma level of peptide in this species. Our results showed that the orexin system is widely distributed in bottlenose dolphin enteric nervous system of the all gastrointestinal tract examined. They are very peculiar and partially differs from that of terrestrial mammals. Orexin peptides and prepro-orexin were expressed in the main stomach, pyloric stomach and proximal intestine; while orexin receptors were expressed in the all examined tracts, with the exception of main stomach where found no evidence of orexin 2 receptor. Co-localization of vasoactive intestinal peptide and orexin 1 receptor were more evident in the pyloric stomach and proximal intestine. These data could suggest a possible role of orexin system on the contractility of bottlenose dolphin gastrointestinal districts. Finally, in agreement with several reports, bottlenose dolphin orexin A plasma level was higher in the morning during fasting. Our results emphasize some common features between bottlenose dolphin and terrestrial mammals. Certainly, further functional investigations may help to better explain the role of the orexin system in the energy balance of bottlenose dolphin and the complex interaction between feeding and digestive physiology.

  16. The orexin system in the enteric nervous system of the bottlenose dolphin (Tursiops truncatus). (United States)

    Gatta, Claudia; Russo, Finizia; Russolillo, Maria Grazia; Varricchio, Ettore; Paolucci, Marina; Castaldo, Luciana; Lucini, Carla; de Girolamo, Paolo; Cozzi, Bruno; Maruccio, Lucianna


    This study provides a general approach to the presence and possible role of orexins and their receptors in the gut (three gastric chambers and intestine) of confined environment bottlenose dolphin. The expression of prepro-orexin, orexin A and B and orexin 1 and 2 receptors were investigated by single immunostaining and western blot analysis. The co-localization of vasoactive intestinal peptide and orexin 1 receptor in the enteric nervous system was examined by double immunostaining. Also, orexin A concentration were measured in plasma samples to assess the possible diurnal variation of the plasma level of peptide in this species. Our results showed that the orexin system is widely distributed in bottlenose dolphin enteric nervous system of the all gastrointestinal tract examined. They are very peculiar and partially differs from that of terrestrial mammals. Orexin peptides and prepro-orexin were expressed in the main stomach, pyloric stomach and proximal intestine; while orexin receptors were expressed in the all examined tracts, with the exception of main stomach where found no evidence of orexin 2 receptor. Co-localization of vasoactive intestinal peptide and orexin 1 receptor were more evident in the pyloric stomach and proximal intestine. These data could suggest a possible role of orexin system on the contractility of bottlenose dolphin gastrointestinal districts. Finally, in agreement with several reports, bottlenose dolphin orexin A plasma level was higher in the morning during fasting. Our results emphasize some common features between bottlenose dolphin and terrestrial mammals. Certainly, further functional investigations may help to better explain the role of the orexin system in the energy balance of bottlenose dolphin and the complex interaction between feeding and digestive physiology.

  17. Vocal copying of individually distinctive signature whistles in bottlenose dolphins (United States)

    King, Stephanie L.; Sayigh, Laela S.; Wells, Randall S.; Fellner, Wendi; Janik, Vincent M.


    Vocal learning is relatively common in birds but less so in mammals. Sexual selection and individual or group recognition have been identified as major forces in its evolution. While important in the development of vocal displays, vocal learning also allows signal copying in social interactions. Such copying can function in addressing or labelling selected conspecifics. Most examples of addressing in non-humans come from bird song, where matching occurs in an aggressive context. However, in other animals, addressing with learned signals is very much an affiliative signal. We studied the function of vocal copying in a mammal that shows vocal learning as well as complex cognitive and social behaviour, the bottlenose dolphin (Tursiops truncatus). Copying occurred almost exclusively between close associates such as mother–calf pairs and male alliances during separation and was not followed by aggression. All copies were clearly recognizable as such because copiers consistently modified some acoustic parameters of a signal when copying it. We found no evidence for the use of copying in aggression or deception. This use of vocal copying is similar to its use in human language, where the maintenance of social bonds appears to be more important than the immediate defence of resources. PMID:23427174

  18. Stable isotopes of captive cetaceans (killer whales and bottlenose dolphins). (United States)

    Caut, Stéphane; Laran, Sophie; Garcia-Hartmann, Emmanuel; Das, Krishna


    There is currently a great deal of interest in using stable isotope methods to investigate diet, trophic level and migration in wild cetaceans. In order to correctly interpret the results stemming from these methods, it is crucial to understand how diet isotopic values are reflected in consumer tissues. In this study, we investigated patterns of isotopic discrimination between diet and blood constituents of two species of cetaceans (killer whale, Orcinus orca, and bottlenose dolphin, Tursiops truncatus) fed controlled diets over 308 and 312 days, respectively. Diet discrimination factors (Δ; mean ± s.d.) for plasma were estimated to Δ(13)C=2.3±0.6‰ and Δ(15)N=1.8±0.3‰, respectively, for both species and to Δ(13)C=2.7±0.3‰ and Δ(15)N=0.5±0.1‰ for red blood cells. Delipidation did not have a significant effect on carbon and nitrogen isotopic values of blood constituents, confirming that cetacean blood does not serve as a reservoir of lipids. In contrast, carbon isotopic values were higher in delipidated samples of blubber, liver and muscle from killer whales. The potential for conflict between fisheries and cetaceans has heightened the need for trophic information about these taxa. These results provide the first published stable isotope incorporation data for cetaceans, which are essential if conclusions are to be drawn on issues concerning trophic structures, carbon sources and diet reconstruction.

  19. Modified Endoscopic Removal of Foreign Objects from the Forestomach of a Common Bottlenose Dolphin (Tursiops truncatus

    Directory of Open Access Journals (Sweden)

    Kyung-Yeon Eo, Yong-Gu Yeo and Oh-Deog Kwon*


    Full Text Available We report on the removal of foreign objects from the forestomach of a 200 kg adult male common bottlenose dolphin (Tursiops truncatus in the Seoul zoo using a modified stainless steel hook and flexible wire snare attached to a gastrointestinal fiberoptic endoscope. The foreign bodies included a 10 × 3.5 cm plastic tube, 4 × 2.0 cm stainless steel pipe, brush, and concrete debris. Our technique using a stainless steel wire hook and snare attached to a gastroscope can be used to remove foreign objects from the forestomach of common bottlenose dolphins.

  20. Bottlenose dolphins can use learned vocal labels to address each other. (United States)

    King, Stephanie L; Janik, Vincent M


    In animal communication research, vocal labeling refers to incidents in which an animal consistently uses a specific acoustic signal when presented with a specific object or class of objects. Labeling with learned signals is a foundation of human language but is notably rare in nonhuman communication systems. In natural animal systems, labeling often occurs with signals that are not influenced by learning, such as in alarm and food calling. There is a suggestion, however, that some species use learned signals to label conspecific individuals in their own communication system when mimicking individually distinctive calls. Bottlenose dolphins (Tursiops truncatus) are a promising animal for exploration in this area because they are capable of vocal production learning and can learn to use arbitrary signals to report the presence or absence of objects. Bottlenose dolphins develop their own unique identity signal, the signature whistle. This whistle encodes individual identity independently of voice features. The copying of signature whistles may therefore allow animals to label or address one another. Here, we show that wild bottlenose dolphins respond to hearing a copy of their own signature whistle by calling back. Animals did not respond to whistles that were not their own signature. This study provides compelling evidence that a dolphin's learned identity signal is used as a label when addressing conspecifics. Bottlenose dolphins therefore appear to be unique as nonhuman mammals to use learned signals as individually specific labels for different social companions in their own natural communication system.

  1. The acoustic repertoire of bottlenose dolphins (Tursiops truncatus) from the southern Gulf of Mexico (United States)

    Bazua-Duran, Carmen


    Bottlenose dolphins live in a variety of habitats of the world's oceans using their acoustic repertoire to communicate and inspect their environment. This work investigates the acoustic repertoire of bottlenose dolphins that inhabit a coastal lagoon of the southern Gulf of Mexico, the Laguna de Terminos and how it may relate to the dolphins' general behavioral state and herd size, and to the general characteristics of the habitat, such as visibility, depth, and sea state. Preliminary results show that bottlenose dolphins produce by far more clicks than whistles in all behavioral states (feeding, resting, social, and travel) and herd sizes, which may correlate with the decreased visibility and shallow depth of the Laguna de Terminos. Additionally, silence was found during all behavioral states, but very seldom in herds of large size. These preliminary results suggest that bottlenose dolphins are choosing when and where to produce their phonations. Therefore, more detailed studies are needed to understand how these animals are using their acoustic sense to communicate and inspect their environment. [Work supported by CONACyT-Gobierno Edo. de Campeche and PAPIIT, UNAM.

  2. Ovarian Follicular Dynamics During the Luteinizing Hormone Surge in the Bottlenose Dolphin (Tursiops truncatus)


    Muraco, Holley; Clough, Pat; Teets, Valerie; Arn, Dennis; Muraco, Mike


    Characterizing the relationship between ovarian follicular dynamics and the luteinizing hormone (LH) surge in the bottlenose dolphin (Tursiops truncatus) requires detailed daily monitoring due to the transitory nature of LH and ovulation. Utilizing conditioned dolphins and non-invasive sampling techniques, such as urine collection and trans-abdominal ultrasound exams, provides the means to accurately monitor these fleeting processes. Urine samples and ultrasound exams used in this study were ...

  3. The bottlenose dolphin Tursiops truncatus foraging around a fish farm: Effects of prey abundance on dolphins’ behavior

    Directory of Open Access Journals (Sweden)

    Bruno Díaz LÓPEZ


    Full Text Available The extent to which prey abundance influences both bottlenose dolphin foraging behavior and group size in the presence of human activities has not previously been studied. The primary aim of this study was to identify and quantify how wild bottlenose dolphins respond, individually and as groups, to the relative abundance of prey around a fish farm. Detailed views of dolphins’ behavior were obtained by focal following individual animals whilst simultaneously collecting surface and underwater behavioral data. A total of 2150 dive intervals were analyzed, corresponding to 342 focal samples, lasting over 34 hours. Bottlenose dolphins remained submerged for a mean duration of 46.4 seconds and a maximum of 249 seconds. This study provides the first quantified data on bottlenose dolphin diving behavior in a marine fin-fish farm area. This study’s results indicate that within a fish farm area used intensively by bottlenose dolphins for feeding, dolphins did not modify dive duration. Additionally, underwater observations confirmed that dolphins find it easier to exploit a concentrated food source and it appears that hunting tactic and not group size plays an important role during feeding activities. Thus, bottlenose dolphins appear capable of modifying their hunting tactics according to the abundance of prey. When top predators display behavioral responses to activities not directed at them, the task of studying all possible effects of human activities can become even more challenging [Current Zoology 55(4: 243–248, 2009].

  4. Comparison of nephrolithiasis prevalence in two bottlenose dolphin (Tursiops truncatus populations

    Directory of Open Access Journals (Sweden)

    Cynthia Rowe Smith


    Full Text Available In humans, ammonium urate nephrolithiasis is rare in the Western hemisphere and more common in Japan and developing countries. Among a variety of risk factors, insulin resistance has been associated with urate nephrolithiasis in people. Bottlenose dolphins (Tursiops truncatus are susceptible to ammonium urate nephrolithiasis, and it is believed that some populations are more likely to develop nephrolithiasis compared to others. In an effort to better understand population-based risk factors for ammonium urate nephrolithiasis in dolphins and their comparative value to humans, sonographic evaluation was performed on dolphins from a managed collection in San Diego Bay, California (n=40 and dolphins from a free-ranging, nearshore population in Sarasota Bay, Florida (n=39 to look for evidence of nephrolithiasis. While 14 (35% of San Diego Bay dolphins evaluated for the study had sonographic evidence of nephrolithiasis, none of the Sarasota Bay dolphins had evidence of disease. Presence or absence of stones was confirmed by computed tomography in a subset of the San Diego collection (n=10; 4 dolphins with stones, 6 without stones. Age was identified as a risk factor, as dolphins with stones in the San Diego collection were significantly older than dolphins without stones (25.4 vs. 19.1 yrs, respectively; p=0.04. Additionally, San Diego dolphins included in the study were significantly older than Sarasota Bay dolphins (21.3 vs. 13.8 yrs, respectively; p=0.008. In addition to the previously reported risk factors of hypocitraturia and hyperinsulinemia in bottlenose dolphins, other potential factors include geographic location, managed versus free-ranging status, prey species, and feeding schedules.

  5. Genetic isolation between coastal and fishery-impacted, offshore bottlenose dolphin (Tursiops spp.) populations. (United States)

    Allen, Simon J; Bryant, Kate A; Kraus, Robert H S; Loneragan, Neil R; Kopps, Anna M; Brown, Alexander M; Gerber, Livia; Krützen, Michael


    The identification of species and population boundaries is important in both evolutionary and conservation biology. In recent years, new population genetic and computational methods for estimating population parameters and testing hypotheses in a quantitative manner have emerged. Using a Bayesian framework and a quantitative model-testing approach, we evaluated the species status and genetic connectedness of bottlenose dolphin (Tursiops spp.) populations off remote northwestern Australia, with a focus on pelagic 'offshore' dolphins subject to incidental capture in a trawl fishery. We analysed 71 dolphin samples from three sites beyond the 50 m depth contour (the inshore boundary of the fishery) and up to 170 km offshore, including incidentally caught and free-ranging individuals associating with trawl vessels, and 273 dolphins sampled at 12 coastal sites inshore of the 50 m depth contour and within 10 km of the coast. Results from 19 nuclear microsatellite markers showed significant population structure between dolphins from within the fishery and coastal sites, but also among dolphins from coastal sites, identifying three coastal populations. Moreover, we found no current or historic gene flow into the offshore population in the region of the fishery, indicating a complete lack of recruitment from coastal sites. Mitochondrial DNA corroborated our findings of genetic isolation between dolphins from the offshore population and coastal sites. Most offshore individuals formed a monophyletic clade with common bottlenose dolphins (T. truncatus), while all 273 individuals sampled coastally formed a well-supported clade of Indo-Pacific bottlenose dolphins (T. aduncus). By including a quantitative modelling approach, our study explicitly took evolutionary processes into account for informing the conservation and management of protected species. As such, it may serve as a template for other, similarly inaccessible study populations. © 2016 John Wiley & Sons Ltd.

  6. New polymorphic tetranucleotide microsatellites improve scoring accuracy in the bottlenose dolphin Tursiops aduncus

    NARCIS (Netherlands)

    Nater, Alexander; Kopps, Anna M.; Kruetzen, Michael

    We isolated and characterized 19 novel tetranucleotide microsatellite markers in the Indo-Pacific bottlenose dolphin (Tursiops aduncus) in order to improve genotyping accuracy in applications like large-scale population-wide paternity and relatedness assessments. One hundred T. aduncus from Shark

  7. Feeding and growth in a captive-born bottlenose dolphin Tursiops ...

    African Journals Online (AJOL)

    The feeding and growth of a captive-born bottlenose dolphin Tursiops trunatus calf were studied for 30 months post partum. Changes in the behaviours associated with suckling were monitored and suggested that the mammary glands need tactile stimulation before the calf can feed. The calf exhibited no teat preference ...

  8. Whistle rates of wild bottlenose dolphins (Tursiops truncatus): influences of group size and behavior. (United States)

    Quick, Nicola J; Janik, Vincent M


    In large social groups acoustic communication signals are prone to signal masking by conspecific sounds. Bottlenose dolphins (Tursiops truncatus) use highly distinctive signature whistles that counter masking effects. However, they can be found in very large groups where masking by conspecific sounds may become unavoidable. In this study we used passive acoustic localization to investigate how whistle rates of wild bottlenose dolphins change in relation to group size and behavioral context. We found that individual whistle rates decreased when group sizes got larger. Dolphins displayed higher whistle rates in contexts when group members were more dispersed as in socializing and in nonpolarized movement than during coordinated surface travel. Using acoustic localization showed that many whistles were produced by groups nearby and not by our focal group. Thus, previous studies based on single hydrophone recordings may have been overestimating whistle rates. Our results show that although bottlenose dolphins whistle more in social situations they also decrease vocal output in large groups where the potential for signal masking by other dolphin whistles increases.

  9. Discriminating features of echolocation clicks of melon-headed whales (Peponocephala electra), bottlenose dolphins (Tursiops truncatus), and Gray's spinner dolphins (Stenella longirostris longirostris). (United States)

    Baumann-Pickering, Simone; Wiggins, Sean M; Hildebrand, John A; Roch, Marie A; Schnitzler, Hans-Ulrich


    Spectral parameters were used to discriminate between echolocation clicks produced by three dolphin species at Palmyra Atoll: melon-headed whales (Peponocephala electra), bottlenose dolphins (Tursiops truncatus) and Gray's spinner dolphins (Stenella longirostris longirostris). Single species acoustic behavior during daytime observations was recorded with a towed hydrophone array sampling at 192 and 480 kHz. Additionally, an autonomous, bottom moored High-frequency Acoustic Recording Package (HARP) collected acoustic data with a sampling rate of 200 kHz. Melon-headed whale echolocation clicks had the lowest peak and center frequencies, spinner dolphins had the highest frequencies and bottlenose dolphins were nested in between these two species. Frequency differences were significant. Temporal parameters were not well suited for classification. Feature differences were enhanced by reducing variability within a set of single clicks by calculating mean spectra for groups of clicks. Median peak frequencies of averaged clicks (group size 50) of melon-headed whales ranged between 24.4 and 29.7 kHz, of bottlenose dolphins between 26.7 and 36.7 kHz, and of spinner dolphins between 33.8 and 36.0 kHz. Discriminant function analysis showed the ability to correctly discriminate between 93% of melon-headed whales, 75% of spinner dolphins and 54% of bottlenose dolphins.

  10. Morbillivirus-associated unusual mortality event in South Australian bottlenose dolphins is largest reported for the Southern Hemisphere (United States)

    Tomo, I.; Bingham, J.; Bastianello, S. S.; Wang, J.; Gibbs, S. E.; Woolford, L.; Dickason, C.; Kelly, D.


    Cases of morbillivirus have been recorded in the Southern Hemisphere but have not been linked to significant marine mammal mortality. Post-mortems were conducted on 58 carcasses (44 Indo-Pacific bottlenose dolphins, two common bottlenose dolphins, 12 short-beaked common dolphins) from South Australia during 2005–2013, including an unusual mortality event (UME) in St Vincent Gulf Bioregion (SVG) during 2013. Diagnostic pathology, circumstance of death, body condition, age and stomach contents were documented for Indo-Pacific bottlenose dolphins. At least 50 dolphins died during the UME, 41 were Indo-Pacific bottlenose dolphins and most were young. The UME lasted about seven months and had two peaks, the first being the largest. Effect on the population is unknown. Diagnostic testing for morbillivirus was conducted on 57 carcasses, with evidence for infection in all species during 2011–2013. All tested UME bottlenose dolphins were positive for cetacean morbillivirus (CeMV), and the pathology included interstitial pneumonia, lymphoid depletion and syncytia. Concurrent pathologies, including lung parasite and fungal infections, and severe cutaneous bruising were observed in many dolphins. The event coincided with elevated water temperatures, a diatom bloom and significant fish die-offs. We conclude that the cause for the UME was multifactorial and that CeMV was a major contributor. PMID:28083115

  11. Abundance of the Indo-Pacific bottlenose dolphin Tursiops aduncus ...

    African Journals Online (AJOL)

    Identification photographs were collected between April 2008 and June 2010 from dolphins occurring along a 30 km length of coast where a dolphin tourism industry is concentrated. A total of 137 groups were ... Keywords: dolphin watching, photo-identification, population estimate, residency. African Journal of Marine ...

  12. Sex Difference in Bottlenose Dolphin Sightings during a Long-term Bridge Construction Project

    Directory of Open Access Journals (Sweden)

    Ann Weaver


    Full Text Available Almost nothing is known about the effect of long-term bridge construction on free-ranging bottlenose dolphins (Tursiops truncatus. The species’ natural history predicts that there should be sex differences in reaction to construction because bottlenose dolphins show sex differences in most of their behaviors. A 5-year bridge construction project over a narrow but important dolphin corridor at John’s Pass tidal inlet, St. Petersburg FL, brought chronic environmental changes. The purpose of this 8-year study was to determine if bridge construction was associated with changes in dolphin sightings. The sex difference hypothesis was tested with a comparison of sighting probabilities before, during and after bridge construction. Sighting probabilities were generated for 68 adults seen n = 6504 times during N = 951 small-boat surveys of the 6.5-mile estuarine study area, documented with photo identification June 2005-December 2012. The sex difference hypothesis was supported with a significant interaction between construction and gender. Female sightings showed a significant linear decline across construction. Male sightings did not change across construction. The main conclusion is that adult males and females may react differently to habitat changes associated with anthropogenic activities. Sex differences in environmental monitoring and vigilance associated with maternal behavior may have played a role. This is the first report on John’s Pass dolphins that evaluates changes in their behavior during a major construction project across a narrow but important dolphin corridor.

  13. Whistle repertoire of bottlenose dolphins (Tursiops truncatus) in the Mississippi Sound (United States)

    Hernandez, Erica N.; Kuczaj, Stan; Solangi, Moby


    The whistle repertoire of wild bottlenose dolphins (Tursiops truncatus) in the Mississippi Sound, part of the northern Gulf of Mexico, was investigated. There is a large population of dolphins in this area, and many dolphins that are now housed in zoos and aquariums were captured in the Mississippi Sound. This paper reports the types of whistles that are predominant in this area, and how these whistles are used in the context of concurrent surface behavior. Over the course of 1 year (April 2004-March 2005), dolphin whistles were recorded as part of an ongoing study of the effects of human activity on wild bottlenose dolphins. The surface behavior of the focal group was categorized at 1-min intervals as follows: mill, travel, mill/travel, feed, social, with boat, or with shrimp boat. Whistles were then categorized as one of the following: upsweep, downsweep, convex, concave, sine, or constant frequency. Preliminary analysis of the data suggests that both the rate of whistling and the types of whistles produced vary as a function of dolphin behavior. Further analysis of the data will reveal if different types of whistles are associated with specific surface behavior categories. [Research supported by Department of Commerce.

  14. Identification of Lactobacillus strains with probiotic features from the bottlenose dolphin (Tursiops truncatus) (United States)

    Diaz, MA; Bik, EM; Carlin, KP; Venn-Watson, SK; Jensen, ED; Jones, SE; Gaston, EP; Relman, DA; Versalovic, J


    Aims In order to develop complementary health management strategies for marine mammals, we used culture-based and culture-independent approaches to identify gastrointestinal lactobacilli of the common bottlenose dolphin, Tursiops truncatus. Methods and Results We screened 307 bacterial isolates from oral and rectal swabs, milk and gastric fluid, collected from 38 dolphins in the U.S. Navy Marine Mammal Program, for potentially beneficial features. We focused our search on lactobacilli and evaluated their ability to modulate TNF secretion by host cells and inhibit growth of pathogens. We recovered Lactobacillus salivarius strains which secreted factors that stimulated TNF production by human monocytoid cells. These Lact. salivarius isolates inhibited growth of selected marine mammal and human bacterial pathogens. In addition, we identified a novel Lactobacillus species by culture and direct sequencing with 96·3% 16S rDNA sequence similarity to Lactobacillus ceti. Conclusions Dolphin-derived Lact. salivarius isolates possess features making them candidate probiotics for clinical studies in marine mammals. Significance and Impact of the Study This is the first study to isolate lactobacilli from dolphins, including a novel Lactobacillus species and a new strain of Lact. salivarius, with potential for veterinary probiotic applications. The isolation and identification of novel Lactobacillus spp. and other indigenous microbes from bottlenose dolphins will enable the study of the biology of symbiotic members of the dolphin microbiota and facilitate the understanding of the microbiomes of these unique animals. PMID:23855505

  15. A case of meconium aspiration syndrome in a bottlenose dolphin (Tursiops truncatus) calf. (United States)

    Tanaka, Miyuu; Izawa, Takeshi; Kuwamura, Mitsuru; Ozaki, Miki; Nakao, Tatsuko; Ito, Shu; Yamate, Jyoji


    Stillbirth and neonatal mortality are significant problems in captive breeding of dolphins, however, the causes of these problems are not fully understood. Here, we report a case of meconium aspiration syndrome (MAS) in a male neonate of bottlenose dolphin (Tursiops truncates) who died immediately after birth. At necropsy, a true knot was found in the umbilical cord. The lungs showed diffuse intraalveolar edema, hyperemic congestion and atelectasis due to meconium aspiration with mild inflammatory cell infiltration. Although the exact cause of MAS in this case was unknown, fetal hypoxia due possibly to the umbilical knot might have been associated with MAS, which is the first report in dolphins. MAS due to perinatal asphyxia should be taken into account as a possible cause of neonatal mortality and stillbirth of dolphin calves.

  16. High Frequency Components in Bottlenose Dolphin Echolocation Signals

    National Research Council Canada - National Science Library

    Toland, Ronald


    .... To assess the importance of these high frequencies in dolphin echolocation and target identification, experiments were performed in which an acoustic filter, used to suppress the high frequencies...

  17. Monitoring bottlenose dolphin leukocyte cytokine mRNA responsiveness by qPCR (United States)

    Eberle, Kirsten C.; Venn-Watson, Stephanie K.; Jensen, Eric D.; Porter, Tracy J.; Waters, Theresa E.; Sacco, Randy E.


    Both veterinarians caring for dolphins in managed populations and researchers monitoring wild populations use blood-based diagnostics to monitor bottlenose dolphin (Tursiops truncatus) health. Quantitative PCR (qPCR) can be used to assess cytokine transcription patterns of peripheral blood mononuclear cells (PBMC). This can supplement currently available blood tests with information on immune status. Full realization of this potential requires establishment of normal ranges of cytokine gene transcription levels in bottlenose dolphins. We surveyed four dolphins over the span of seven months by serial bleeds. PBMC were stimulated with phytohaemagglutinin (1, 5, and 10 μg/mL) and concanavalin A (1 μg/mL) for 48 H in vitro. RNA from these cultures was probed by qPCR using Tursiops truncatus-specific primers (IL-1α, IL-1β, IL-1RA, IL-2, IL-4, IL-6, IL-8, IL-10, IL-12p40, IL-13, IL-18, IFN-γ and TNF-α). Two blood samples from an additional bottlenose dolphin diagnosed with acute pulmonary disease add further perspective to the data. We observed that mitogen choice made a significant difference in the magnitude of gene transcription observed. On the other hand, most cytokines tested exhibited limited intra-animal variation. However, IL-6 and IL-12p40 differed between older and younger dolphins. Furthermore, the magnitude of mitogenic response clusters the tested cytokines into three groups. The data provide a reference for the selection of target cytokine mRNAs and their expected range of mitogen-stimulated cytokine gene transcription for future studies. PMID:29272269

  18. Monitoring bottlenose dolphin leukocyte cytokine mRNA responsiveness by qPCR.

    Directory of Open Access Journals (Sweden)

    Amelia Ruth Hofstetter

    Full Text Available Both veterinarians caring for dolphins in managed populations and researchers monitoring wild populations use blood-based diagnostics to monitor bottlenose dolphin (Tursiops truncatus health. Quantitative PCR (qPCR can be used to assess cytokine transcription patterns of peripheral blood mononuclear cells (PBMC. This can supplement currently available blood tests with information on immune status. Full realization of this potential requires establishment of normal ranges of cytokine gene transcription levels in bottlenose dolphins. We surveyed four dolphins over the span of seven months by serial bleeds. PBMC were stimulated with phytohaemagglutinin (1, 5, and 10 μg/mL and concanavalin A (1 μg/mL for 48 H in vitro. RNA from these cultures was probed by qPCR using Tursiops truncatus-specific primers (IL-1α, IL-1β, IL-1RA, IL-2, IL-4, IL-6, IL-8, IL-10, IL-12p40, IL-13, IL-18, IFN-γ and TNF-α. Two blood samples from an additional bottlenose dolphin diagnosed with acute pulmonary disease add further perspective to the data. We observed that mitogen choice made a significant difference in the magnitude of gene transcription observed. On the other hand, most cytokines tested exhibited limited intra-animal variation. However, IL-6 and IL-12p40 differed between older and younger dolphins. Furthermore, the magnitude of mitogenic response clusters the tested cytokines into three groups. The data provide a reference for the selection of target cytokine mRNAs and their expected range of mitogen-stimulated cytokine gene transcription for future studies.

  19. Social Differentiation in Common Bottlenose Dolphins (Tursiops truncatus) that Engage in Human-Related Foraging Behaviors (United States)


    Both natural and human-related foraging strategies by the common bottlenose dolphin (Tursiops truncatus) have resulted in social segregation in several areas of the world. Bottlenose dolphins near Savannah, Georgia beg at an unprecedented rate and also forage behind commercial shrimp trawlers, providing an opportunity to study the social ramifications of two human-related foraging behaviors within the same group of animals. Dolphins were photo-identified via surveys conducted throughout estuarine waterways around Savannah in the summers of 2009–2011. Mean half-weight indices (HWI) were calculated for each foraging class, and community division by modularity was used to cluster animals based on association indices. Pairs of trawler dolphins had a higher mean HWI (0.20 ± 0.07) than pairs of non-trawler dolphins (0.04 ± 0.02) or mixed pairs (0.02 ± 0.02). In contrast, pairs of beggars, non-beggars, and mixed pairs all had similar means, with HWI between 0.05–0.07. Community division by modularity produced a useful division (0.307) with 6 clusters. Clusters were predominately divided according to trawler status; however, beggars and non-beggars were mixed throughout clusters. Both the mean HWI and social clusters revealed that the social structure of common bottlenose dolphins near Savannah, Georgia was differentiated based on trawler status but not beg status. This finding may indicate that foraging in association with trawlers is a socially learned behavior, while the mechanisms for the propagation of begging are less clear. This study highlights the importance of taking into account the social parameters of a foraging behavior, such as how group size or competition for resources may affect how the behavior spreads. The positive or negative ramifications of homophily may influence whether the behaviors are exhibited by individuals within the same social clusters and should be considered in future studies examining social relationships and foraging behaviors

  20. Comparative analysis of three brevetoxin-associated bottlenose dolphin (Tursiops truncatus mortality events in the Florida Panhandle region (USA.

    Directory of Open Access Journals (Sweden)

    Michael J Twiner

    Full Text Available In the Florida Panhandle region, bottlenose dolphins (Tursiops truncatus have been highly susceptible to large-scale unusual mortality events (UMEs that may have been the result of exposure to blooms of the dinoflagellate Karenia brevis and its neurotoxin, brevetoxin (PbTx. Between 1999 and 2006, three bottlenose dolphin UMEs occurred in the Florida Panhandle region. The primary objective of this study was to determine if these mortality events were due to brevetoxicosis. Analysis of over 850 samples from 105 bottlenose dolphins and associated prey items were analyzed for algal toxins and have provided details on tissue distribution, pathways of trophic transfer, and spatial-temporal trends for each mortality event. In 1999/2000, 152 dolphins died following extensive K. brevis blooms and brevetoxin was detected in 52% of animals tested at concentrations up to 500 ng/g. In 2004, 105 bottlenose dolphins died in the absence of an identifiable K. brevis bloom; however, 100% of the tested animals were positive for brevetoxin at concentrations up to 29,126 ng/mL. Dolphin stomach contents frequently consisted of brevetoxin-contaminated menhaden. In addition, another potentially toxigenic algal species, Pseudo-nitzschia, was present and low levels of the neurotoxin domoic acid (DA were detected in nearly all tested animals (89%. In 2005/2006, 90 bottlenose dolphins died that were initially coincident with high densities of K. brevis. Most (93% of the tested animals were positive for brevetoxin at concentrations up to 2,724 ng/mL. No DA was detected in these animals despite the presence of an intense DA-producing Pseudo-nitzschia bloom. In contrast to the absence or very low levels of brevetoxins measured in live dolphins, and those stranding in the absence of a K. brevis bloom, these data, taken together with the absence of any other obvious pathology, provide strong evidence that brevetoxin was the causative agent involved in these bottlenose dolphin

  1. Comparative Analysis of Three Brevetoxin-Associated Bottlenose Dolphin (Tursiops truncatus) Mortality Events in the Florida Panhandle Region (USA) (United States)

    Twiner, Michael J.; Flewelling, Leanne J.; Fire, Spencer E.; Bowen-Stevens, Sabrina R.; Gaydos, Joseph K.; Johnson, Christine K.; Landsberg, Jan H.; Leighfield, Tod A.; Mase-Guthrie, Blair; Schwacke, Lori; Van Dolah, Frances M.; Wang, Zhihong; Rowles, Teresa K.


    In the Florida Panhandle region, bottlenose dolphins (Tursiops truncatus) have been highly susceptible to large-scale unusual mortality events (UMEs) that may have been the result of exposure to blooms of the dinoflagellate Karenia brevis and its neurotoxin, brevetoxin (PbTx). Between 1999 and 2006, three bottlenose dolphin UMEs occurred in the Florida Panhandle region. The primary objective of this study was to determine if these mortality events were due to brevetoxicosis. Analysis of over 850 samples from 105 bottlenose dolphins and associated prey items were analyzed for algal toxins and have provided details on tissue distribution, pathways of trophic transfer, and spatial-temporal trends for each mortality event. In 1999/2000, 152 dolphins died following extensive K. brevis blooms and brevetoxin was detected in 52% of animals tested at concentrations up to 500 ng/g. In 2004, 105 bottlenose dolphins died in the absence of an identifiable K. brevis bloom; however, 100% of the tested animals were positive for brevetoxin at concentrations up to 29,126 ng/mL. Dolphin stomach contents frequently consisted of brevetoxin-contaminated menhaden. In addition, another potentially toxigenic algal species, Pseudo-nitzschia, was present and low levels of the neurotoxin domoic acid (DA) were detected in nearly all tested animals (89%). In 2005/2006, 90 bottlenose dolphins died that were initially coincident with high densities of K. brevis. Most (93%) of the tested animals were positive for brevetoxin at concentrations up to 2,724 ng/mL. No DA was detected in these animals despite the presence of an intense DA-producing Pseudo-nitzschia bloom. In contrast to the absence or very low levels of brevetoxins measured in live dolphins, and those stranding in the absence of a K. brevis bloom, these data, taken together with the absence of any other obvious pathology, provide strong evidence that brevetoxin was the causative agent involved in these bottlenose dolphin mortality

  2. Captive bottlenose dolphins (Tursiops truncatus spontaneously using water flow to manipulate objects.

    Directory of Open Access Journals (Sweden)

    Chisato Yamamoto

    Full Text Available Several terrestrial animals and delphinids manipulate objects in a tactile manner, using parts of their bodies, such as their mouths or hands. In this paper, we report that bottlenose dolphins (Tursiops truncatus manipulate objects not by direct bodily contact, but by spontaneous water flow. Three of four dolphins at Suma Aqualife Park performed object manipulation with food. The typical sequence of object manipulation consisted of a three step procedure. First, the dolphins released the object from the sides of their mouths while assuming a head-down posture near the floor. They then manipulated the object around their mouths and caught it. Finally, they ceased to engage in their head-down posture and started to swim. When the dolphins moved the object, they used the water current in the pool or moved their head. These results showed that dolphins manipulate objects using movements that do not directly involve contact between a body part and the object. In the event the dolphins dropped the object on the floor, they lifted it by making water flow in one of three methods: opening and closing their mouths repeatedly, moving their heads lengthwise, or making circular head motions. This result suggests that bottlenose dolphins spontaneously change their environment to manipulate objects. The reason why aquatic animals like dolphins do object manipulation by changing their environment but terrestrial animals do not may be that the viscosity of the aquatic environment is much higher than it is in terrestrial environments. This is the first report thus far of any non-human mammal engaging in object manipulation using several methods to change their environment.

  3. Vocalizations associated with pectoral fin contact in bottlenose dolphins (Tursiops truncatus). (United States)

    Evans-Wilent, J; Dudzinski, K M


    Pectoral fin contact in bottlenose dolphins represents one form of tactile communication. Acoustic communication associated with pectoral fin contact is an additional level of communication that may change or enhance the tactile message between two individuals. In this study, we examine vocalization types associated with pectoral fin contact in a group of captive bottlenose dolphins (Tursiops truncatus). From 2006 to 2009, vocalizations potentially associated with 748 pectoral fin contacts were examined: whistles, click trains and overlap of whistles and click trains were documented when associated with fin contact. Dolphins were also documented not vocalizing when exchanging pectoral fin contacts. Call type associated with pectoral fin contact was compared for the proportion of the type of pectoral fin contact, vocalizer sex, initiator and receiver roles, and gender pair. Overall, vocalizations differed significantly by vocalizer role as rubber or rubbee, initiator, and sex. Receivers and rubbees clicked and used overlap vocalizations more frequently, and males produced overlap vocalizations more frequently. These results suggest that whistles may be used to initiate pectoral fin contact or show preference for a particular partner, while click trains may be used to show disinterest in pectoral fin contact or to signal the end of a contact. Examining vocalizations produced in conjunction with tactile contact is a relatively new approach in the study of individual dolphin behavior and may be useful for understanding dolphin social alliances and social preferences for various individuals within a population. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. Postnatal development of echolocation abilities in a bottlenose dolphin (Tursiops truncatus): temporal organization. (United States)

    Favaro, Livio; Gnone, Guido; Pessani, Daniela


    In spite of all the information available on adult bottlenose dolphin (Tursiops truncatus) biosonar, the ontogeny of its echolocation abilities has been investigated very little. Earlier studies have reported that neonatal dolphins can produce both whistles and burst-pulsed sounds just after birth and that early-pulsed sounds are probably a precursor of echolocation click trains. The aim of this research is to investigate the development of echolocation signals in a captive calf, born in the facilities of the Acquario di Genova. A set of 81 impulsive sounds were collected from birth to the seventh postnatal week and six additional echolocation click trains were recorded when the dolphin was 1 year old. Moreover, behavioral observations, concurring with sound production, were carried out by means of a video camera. For each sound we measured five acoustic parameters: click train duration (CTD), number of clicks per train, minimum, maximum, and mean click repetition rate (CRR). CTD and number of clicks per train were found to increase with age. Maximum and mean CRR followed a decreasing trend with dolphin growth starting from the second postnatal week. The calf's first head scanning movement was recorded 21 days after birth. Our data suggest that in the bottlenose dolphin the early postnatal weeks are essential for the development of echolocation abilities and that the temporal features of the echolocation click trains remain relatively stable from the seventh postnatal week up to the first year of life. © 2013 Wiley Periodicals, Inc.

  5. Fatal Asphyxiation in Bottlenose Dolphins (Tursiops truncatus from the Indian River Lagoon.

    Directory of Open Access Journals (Sweden)

    Megan Stolen

    Full Text Available Multiple single case reports of asphyxiation in dolphins caused by fish lodged in the esophagus exist. However, the significance of this cause of mortality in a single population has not been documented. We performed a retrospective evaluation of pathology records from stranded bottlenose dolphins (Tursiops truncatus from the Indian River Lagoon to evaluate the impact of this cause of death on this population. From 1997 to 2011, asphyxiation due to choking was identified as the cause of death in 14 of 350 cases (4%. Sampling of an unrelated but adjacent population over this same period yielded 186 necropsy cases of bottlenose dolphins with no cases of asphyxiation. Asphyxiated animals presented with a fish lodged in the cranial esophagus associated with a dislocated and obstructed or compressed larynx. There was no clear sex predilection. Affected animals included 12 adults and two juveniles. The fish species involved included sheepshead, black chin tilapia and striped mojarra. In five cases, recreational fishing gear was also present. Cetacean choking is related to selection of prey fish species with strong dorsal spines and may be secondarily associated with fish attached to fishing gear. Prey abundance and dolphin behavior may influence these selections. Environmental alterations leading to changes in prey availability or increased interactions with fishing gear may change the significance of fatal choking in dolphin populations.

  6. Relaxin as a hormonal aid to evaluate pregnancy and pregnancy loss in bottlenose dolphins (Tursiops truncatus). (United States)

    Bergfelt, Don R; Blum, Jason L; Steinetz, Bernard G; Steinman, Karen J; O'Brien, Justin K; Robeck, Todd R


    This study was conducted to critically evaluate weekly and monthly circulating concentrations of immunoreactive relaxin throughout pregnancies that resulted in live births, stillbirths, and abortions in aquarium-based bottlenose dolphins. A relaxin RIA was used to analyze serum collected during 74 pregnancies involving 41 dolphins and 8 estrous cycles as well as 8 non-pregnant dolphins. Pregnancies resulted in live births (n=60), stillbirths (n=7), or abortions (n=7). Relative to parturition (Month 0), monthly changes (Pdolphins (status-by-week interaction, P=0.59). Status-by-month interaction (Pdolphins with live births, stillbirths, and abortions except concentrations were lower (Pdolphins with stillbirths but not in dolphins with abortions. In conclusion, this study provided new information on the pregnancy-specific nature of relaxin, critical evaluation of the fundamental characteristics of relaxin during pregnancy and pregnancy loss, and clarification on the strengths and limitations of relaxin as a diagnostic aid to determine pregnancy status and assess maternal-fetal health in bottlenose dolphins. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Development and application of specific cytokine assays in tissue samples from a bottlenose dolphin with hyperinsulinemia

    Directory of Open Access Journals (Sweden)

    Kirsten eEberle


    Full Text Available Chronic inflammation has been associated with insulin resistance and type 2 diabetes (T2D in humans. Postmortem hepatic and splenic tissue from a 46-year-old geriatric male bottlenose dolphin (Tursiops truncatus with insulin resistance (chronic hyperinsulinemia with hyperglycemia, chronic inflammation (white blood cell count greater than 12,000 cells/μL, and mild fatty liver disease was evaluated for elevated pro-inflammatory mediators. Cytokine mRNA expression in postmortem hepatic and splenic tissue, as determined by real-time PCR, included an array of cytokines: TGF-β, TNF-α, IFN-γ, IL-2, IL-4, IL-10, IL-12p40, IL-13, and IL-18. Values from this dolphin were compared to a younger reference dolphin with no known chronic metabolic perturbations or inflammation. Levels of TGF-β, TNF-α, and IL-4 were higher in the case dolphin's liver compared to that of the reference dolphin. In the case dolphin's spleen, IL-10 and IFN-γ mRNA was upregulated while IL-4 was less than reference dolphin. IL-18 and IL-13 were upregulated in both tissues. Fluorescent immunohistochemistry (IHC utilized the following antibodies: anti-porcine IL-6, anti-bovine IFN-γ, IL-4, and IL-10, anti-human TGF-β, anti-ovine IL-1β, and anti-dolphin IL-8. Fluorescent IHC in spleen from the case dolphin revealed staining of IL-4, IL-6, IL-8, and TGF-β throughout the tissue. IL-10 and IFN-γ were seen to predominate in areas surrounding the follicles of splenic tissue. This is the first characterization of cytokine levels in dolphin hepatic and splenic tissue. While there are limitations to a case study, this report of inflammatory biomarkers in tissues of a dolphin with insulin resistance and fatty liver disease are similar to those observed in human patients.

  8. A common bottlenose dolphin (Tursiops truncatus) prey handling technique for marine catfish (Ariidae) in the northern Gulf of Mexico. (United States)

    Ronje, Errol I; Barry, Kevin P; Sinclair, Carrie; Grace, Mark A; Barros, Nélio; Allen, Jason; Balmer, Brian; Panike, Anna; Toms, Christina; Mullin, Keith D; Wells, Randall S


    Few accounts describe predator-prey interactions between common bottlenose dolphins (Tursiops truncatus Montagu 1821) and marine catfish (Ariopsis felis Linnaeus 1766, Bagre marinus Mitchill 1815). Over the course of 50,167 sightings of bottlenose dolphin groups in Mississippi Sound and along the Florida coast of the Gulf of Mexico, severed catfish heads were found floating and exhibiting movements at the surface in close proximity to 13 dolphin groups that demonstrated feeding behavior. These observations prompted a multi-disciplinary approach to study the predator-prey relationship between bottlenose dolphins and marine catfish. A review was conducted of bottlenose dolphin visual survey data and dorsal fin photographs from sightings where severed catfish heads were observed. Recovered severed catfish heads were preserved and studied, whole marine catfish were collected and examined, and stranding network pathology reports were reviewed for references to injuries related to fish spines. Photographic identification analysis confirms eight dolphins associated with severed catfish heads were present in three such sightings across an approximately 350 km expanse of coast between the Mississippi Sound and Saint Joseph Bay, FL. An examination of the severed catfish heads indicated interaction with dolphins, and fresh-caught whole hardhead catfish (A. felis) were examined to estimate the presumed total length of the catfish before decapitation. Thirty-eight instances of significant trauma or death in dolphins attributed to ingesting whole marine catfish were documented in stranding records collected from the southeastern United States of America. Bottlenose dolphins typically adhere to a ram-feeding strategy for prey capture followed by whole prey ingestion; however, marine catfish skull morphology may pose a consumption hazard due to rigid spines that can puncture and migrate through soft tissue, prompting a prey handling technique for certain dolphins, facilitating

  9. A common bottlenose dolphin (Tursiops truncatus prey handling technique for marine catfish (Ariidae in the northern Gulf of Mexico.

    Directory of Open Access Journals (Sweden)

    Errol I Ronje

    Full Text Available Few accounts describe predator-prey interactions between common bottlenose dolphins (Tursiops truncatus Montagu 1821 and marine catfish (Ariopsis felis Linnaeus 1766, Bagre marinus Mitchill 1815. Over the course of 50,167 sightings of bottlenose dolphin groups in Mississippi Sound and along the Florida coast of the Gulf of Mexico, severed catfish heads were found floating and exhibiting movements at the surface in close proximity to 13 dolphin groups that demonstrated feeding behavior. These observations prompted a multi-disciplinary approach to study the predator-prey relationship between bottlenose dolphins and marine catfish. A review was conducted of bottlenose dolphin visual survey data and dorsal fin photographs from sightings where severed catfish heads were observed. Recovered severed catfish heads were preserved and studied, whole marine catfish were collected and examined, and stranding network pathology reports were reviewed for references to injuries related to fish spines. Photographic identification analysis confirms eight dolphins associated with severed catfish heads were present in three such sightings across an approximately 350 km expanse of coast between the Mississippi Sound and Saint Joseph Bay, FL. An examination of the severed catfish heads indicated interaction with dolphins, and fresh-caught whole hardhead catfish (A. felis were examined to estimate the presumed total length of the catfish before decapitation. Thirty-eight instances of significant trauma or death in dolphins attributed to ingesting whole marine catfish were documented in stranding records collected from the southeastern United States of America. Bottlenose dolphins typically adhere to a ram-feeding strategy for prey capture followed by whole prey ingestion; however, marine catfish skull morphology may pose a consumption hazard due to rigid spines that can puncture and migrate through soft tissue, prompting a prey handling technique for certain dolphins

  10. Sex, Age, and Individual Differences in Bottlenose Dolphins (Tursiops truncatus) in Response to Environmental Enrichment


    Holli C. Eskelinen; Kelley A. Winship; Jill L. Borger-Turner


    Application of environmental enrichment, as a means to successfully decrease undesired behaviors (e.g., stereotypic) and improve animal welfare, has been documented in a variety of zoological species. However, a dearth of empirical evidence exists concerning age, sex, and individual differences in response to various types of enrichment tools and activities in Atlantic bottlenose dolphins (Tursiops truncatus). This study involved a comparative assessment of enrichment participation of three r...

  11. Effects of vessel noise on underwater vocalizations of bottlenose dolphins, Tursiops truncatus, in the Sado Estuary


    Sobreira, Filipa Alexandra Veiga


    Maritime traffic is an important source of disturbance for coastal cetaceans, especially for local and resident populations, like the bottlenose dolphins (Tursiops truncatus) population in the Sado estuary. Vessel noise might mask important signals such as communication calls. To compensate masking effects, animals may change their vocal behavior by shifting vocal rate, call intensity, call type, call frequency and duration. To evaluate the potential impacts on the acoustic behavior of this p...

  12. Analysis and Modeling of Echolocation Signals Emitted by Mediterranean Bottlenose Dolphins

    Directory of Open Access Journals (Sweden)

    Greco Maria


    Full Text Available We analyzed the echolocation sounds emitted by Mediterranean bottlenose dolphins. We extracted the click trains by visual inspection of the data files recorded along the coast of the Tuscany with the collaboration of the CETUS Research Center. We modeled the extracted sonar clicks as Gaussian or exponential multicomponent signals, we estimated the characteristic parameters and compared the data with the reconstructed signals based on the estimates. Results about the estimation and the data fitting are largely shown in the paper.

  13. Sex, Age, and Individual Differences in Bottlenose Dolphins (Tursiops truncatus in Response to Environmental Enrichment

    Directory of Open Access Journals (Sweden)

    Holli C. Eskelinen


    Full Text Available Application of environmental enrichment, as a means to successfully decrease undesired behaviors (e.g., stereotypic and improve animal welfare, has been documented in a variety of zoological species. However, a dearth of empirical evidence exists concerning age, sex, and individual differences in response to various types of enrichment tools and activities in Atlantic bottlenose dolphins (Tursiops truncatus. This study involved a comparative assessment of enrichment participation of three resident, bottlenose dolphin populations, over the course of 17 months, with respect to sex and age class (calf, sub-adult, adult. Enrichment sessions were randomly assigned, conducted, and categorically assessed based on participation during seven, broad based enrichment classes (Object, Ingestible, Human, or a combination of the three. Overall, the proportion of participation in enrichment sessions was high (≥ 0.74, with individual differences in participation noted among the three populations. Sessions involving Humans and/or Ingestible items resulted in a significantly higher mean proportion of participation. Sub-adult and adult males were significantly more likely to participate in enrichment sessions, as well as engage in Human Interaction/Object sessions. Calves participated significantly more than adults or sub-adults across all enrichment classes with no noted differences between males and females. These data can serve as a tool to better understand the intricacies of bottlenose dolphin responses to enrichment in an effort to develop strategic enrichment plans with the goal of improving animal well-being and welfare.

  14. The social structure of Golfo Dulce bottlenose dolphins (Tursiops truncatus) and the influence of behavioural state. (United States)

    Moreno, Kelsey; Acevedo-Gutiérrez, Alejandro


    Ecological factors such as habitat and food availability affect the social structure of bottlenose dolphins ( Tursiops spp.). Here, we describe the social structure of bottlenose dolphins ( T. truncatus ) in Golfo Dulce, Costa Rica, a semi-enclosed, fjord-like tropical embayment resembling a pelagic system. We also examine behaviour-linked social strategies by comparing social structure relative to behavioural state: feeding versus non-feeding. We analysed 333 sightings over 210 days from boat-based surveys. Despite the uniqueness of the area, the 47 analysed adults had a social structure similar to other populations: a well-differentiated fission-fusion society with sex-specific patterns of associations and aggression. These results indicate that differences in social structure relative to other populations were a matter of degree. Association strength of dyads was highly correlated across behavioural states, indicating constraints on social fluidity. Males displayed a marked difference in lagged association rate and females displayed a small difference in association homogeneity between states. We suggest this difference in population-wide social connections between behavioural states, particularly for males, was due to mating strategies, a pressure which is strongest during non-feeding behaviour and relaxed during feeding. This finding highlights the importance of considering behavioural state when examining individual bonds and the behavioural plasticity for which the bottlenose dolphin is well known.

  15. Organohalogen compounds in blubber of Indo-Pacific bottlenose dolphin (Tursiops aduncus) and spinner dolphin (Stenella longirostris) from Zanzibar, Tanzania

    International Nuclear Information System (INIS)

    Mwevura, Haji; Amir, Omar A.; Kishimba, Michael; Berggren, Per; Kylin, Henrik


    Blubber samples of Indo-Pacific bottlenose (Tursiops aduncus) and spinner (Stenella longirostris) dolphins from Zanzibar, East Africa, were analyzed for a wide range of organohalogen compounds. Methoxylated polybrominated diphenyl ethers (MeO-BDEs), presumably biogenic, were found at higher concentrations than anthropogenic organochlorine pesticides (OCPs). Only traces of industrial pollutants, such as polychlorinated biphenyls, were detected. The OCP levels found off Zanzibar were lower than those reported from other regions while MeO-BDE levels were higher. The relative composition of the OCPs indicated recent use of lindane (γ-hexachlorocyclohexane) and aged residues of DDT and technical HCH. Placental transfer was estimated to 2.5% and 0.5% of the total burden of OCPs and MeO-BDEs, respectively. Overall transfer from mother to calf in Indo-Pacific bottlenose dolphins was estimated to 72% and 85% for the OCPs and MeO-BDEs burdens, respectively. Health effects of MeO-BDEs are not known, but structural similarities with well-known environmental toxins are cause for concern. - Biogenic brominated organic compounds were found at higher concentrations than anthropogenic organochlorine pesticides in dolphins off Zanzibar.

  16. Organohalogen compounds in blubber of Indo-Pacific bottlenose dolphin (Tursiops aduncus) and spinner dolphin (Stenella longirostris) from Zanzibar, Tanzania

    Energy Technology Data Exchange (ETDEWEB)

    Mwevura, Haji, E-mail: [Department of Chemistry, University of Dar es Salaam, Dar es Salaam (Tanzania, United Republic of); Amir, Omar A., E-mail: [Institute of Marine Sciences, University of Dar es Salaam, P O Box 668, Zanzibar (Tanzania, United Republic of); Department of Zoology, Stockholm University, SE-106 91 Stockholm (Sweden); Kishimba, Michael, E-mail: [Department of Chemistry, University of Dar es Salaam, Dar es Salaam (Tanzania, United Republic of); Berggren, Per, E-mail: [Department of Zoology, Stockholm University, SE-106 91 Stockholm (Sweden); School of Marine Science and Technology, University of Newcastle upon Tyne, NE1 7RU (United Kingdom); Kylin, Henrik, E-mail: henrik.kylin@vatten.slu.s [Department of Aquatic Sciences and Assessment, Swedish University of Agricultural Sciences, P O Box 7050, SE-750 07 Uppsala (Sweden); Norwegian Institute of Air Research, Polar Environmental Centre, NO-9296 Tromso (Norway)


    Blubber samples of Indo-Pacific bottlenose (Tursiops aduncus) and spinner (Stenella longirostris) dolphins from Zanzibar, East Africa, were analyzed for a wide range of organohalogen compounds. Methoxylated polybrominated diphenyl ethers (MeO-BDEs), presumably biogenic, were found at higher concentrations than anthropogenic organochlorine pesticides (OCPs). Only traces of industrial pollutants, such as polychlorinated biphenyls, were detected. The OCP levels found off Zanzibar were lower than those reported from other regions while MeO-BDE levels were higher. The relative composition of the OCPs indicated recent use of lindane (gamma-hexachlorocyclohexane) and aged residues of DDT and technical HCH. Placental transfer was estimated to 2.5% and 0.5% of the total burden of OCPs and MeO-BDEs, respectively. Overall transfer from mother to calf in Indo-Pacific bottlenose dolphins was estimated to 72% and 85% for the OCPs and MeO-BDEs burdens, respectively. Health effects of MeO-BDEs are not known, but structural similarities with well-known environmental toxins are cause for concern. - Biogenic brominated organic compounds were found at higher concentrations than anthropogenic organochlorine pesticides in dolphins off Zanzibar.

  17. A kinematic study on (un)intentional imitation in bottlenose dolphins (United States)

    Sartori, Luisa; Bulgheroni, Maria; Tizzi, Raffaella; Castiello, Umberto


    The aim of the present study was to investigate the effect of observing other’s movements on subsequent performance in bottlenose dolphins. The imitative ability of non-human animals has intrigued a number of researchers. So far, however, studies in dolphins have been confined to intentional imitation concerned with the explicit request to imitate other agents. In the absence of instruction to imitate, do dolphins (un)intentionally replicate other’s movement features? To test this, dolphins were filmed while reaching and touching a stimulus before and after observing another dolphin (i.e., model) performing the same action. All videos were reviewed and segmented in order to extract the relevant movements. A marker was inserted post hoc via software on the videos upon the anatomical landmark of interest (i.e., rostrum) and was tracked throughout the time course of the movement sequence. The movement was analyzed using an in-house software developed to perform two-dimensional (2D) post hoc kinematic analysis. The results indicate that dolphins’ kinematics is sensitive to other’s movement features. Movements performed for the “visuomotor priming” condition were characterized by a kinematic pattern similar to that performed by the observed dolphin (i.e., model). Addressing the issue of spontaneous imitation in bottlenose dolphins might allow ascertaining whether the potential or impulse to produce an imitative action is generated, not just when they intend to imitate, but whenever they watch another conspecific’s behavior. In closing, this will clarify whether motor representational capacity is a by-product of factors specific to humans or whether more general characteristics such as processes of associative learning prompted by high level of encephalization could help to explain the evolution of this ability. PMID:26300764

  18. Spatial distribution of bottlenose dolphins (Tursiops truncatus) inferred from stable isotopes and priority organic pollutants

    International Nuclear Information System (INIS)

    Wilson, Rachel Marie; Kucklick, John R.; Balmer, Brian C.; Wells, Randall S.; Chanton, Jeffrey P.; Nowacek, Douglas P.


    Differences in priority organic pollutants (POPs), analyzed by gas chromatography-mass spectrometry, and stable isotope ratios (δ 13 C, δ 34 S, and δ 15 N; analyzed by isotope ratio-mass spectrometry), divide 77 bottlenose dolphins (Tursiops truncatus) from the Florida Gulf Coast into three distinct groups. POP levels reflect human population and historical contamination along the coast. In the least disturbed site, concentrations of ΣPOP in male dolphins were 18,000 ng g −1 ± 6000 (95% confidence interval here and throughout); in the intermediate bay, males had ΣPOP concentrations of 19,000 ng g −1 ± 10,000. St Andrews Bay was home to dolphins with the highest ΣPOP concentrations: 44,000 ng g −1 ± 10,300. δ 34 S and δ 15 N, differed significantly between St. George Sound dolphins and those frequenting each of the other two bays, but not between St. Andrews and St. Joseph Bays. ΣPOP concentrations were statistically higher in dolphins frequenting St. Andrews Bay, but were not significantly different between dolphins occupying St. Joseph Bay and St. George Sound. Thus, using either POP or isotope values alone, we would only be able to identify two dolphin groups, but when POP and isotope data are viewed cumulatively, the results clearly define three distinct communities occupying this region. - Highlights: ► We compare isotopes and POP levels in dolphins occupying three embayments. ► POP levels varied significantly among two embayments separated by < 50 km. ► Differentiation correlated with historical contamination from a SuperFund site. ► Cumulatively, isotopes and POP levels indicate 3 distinct dolphin communities. ► This data provides the first assessment of dolphin POP contamination in the region.

  19. Spatial distribution of bottlenose dolphins (Tursiops truncatus) inferred from stable isotopes and priority organic pollutants

    Energy Technology Data Exchange (ETDEWEB)

    Wilson, Rachel Marie, E-mail: [Department of EOAS-Oceanography, Florida State University, 117 North Woodward Avenue, Tallahassee, Florida, 32306 (United States); Kucklick, John R. [National Institute of Standards and Technology, Hollings Marine Laboratory, Charleston, 331 Fort Johnson Road, Charleston, South Carolina 29412 (United States); Balmer, Brian C.; Wells, Randall S. [Chicago Zoological Society c/o Mote Marine Laboratory, 1600 Ken Thompson Parkway Sarasota, FL, 34236 (United States); Chanton, Jeffrey P. [Department of EOAS-Oceanography, Florida State University, 117 North Woodward Avenue, Tallahassee, Florida, 32306 (United States); Nowacek, Douglas P. [Nicholas School of the Environment and Pratt School of Engineering, Duke University - Marine Laboratory, 135 Duke Marine Lab Rd., Beaufort, NC 28516 (United States)


    Differences in priority organic pollutants (POPs), analyzed by gas chromatography-mass spectrometry, and stable isotope ratios ({delta}{sup 13}C, {delta}{sup 34}S, and {delta}{sup 15}N; analyzed by isotope ratio-mass spectrometry), divide 77 bottlenose dolphins (Tursiops truncatus) from the Florida Gulf Coast into three distinct groups. POP levels reflect human population and historical contamination along the coast. In the least disturbed site, concentrations of {Sigma}POP in male dolphins were 18,000 ng g{sup -1} {+-} 6000 (95% confidence interval here and throughout); in the intermediate bay, males had {Sigma}POP concentrations of 19,000 ng g{sup -1} {+-} 10,000. St Andrews Bay was home to dolphins with the highest {Sigma}POP concentrations: 44,000 ng g{sup -1} {+-} 10,300. {delta}{sup 34}S and {delta}{sup 15}N, differed significantly between St. George Sound dolphins and those frequenting each of the other two bays, but not between St. Andrews and St. Joseph Bays. {Sigma}POP concentrations were statistically higher in dolphins frequenting St. Andrews Bay, but were not significantly different between dolphins occupying St. Joseph Bay and St. George Sound. Thus, using either POP or isotope values alone, we would only be able to identify two dolphin groups, but when POP and isotope data are viewed cumulatively, the results clearly define three distinct communities occupying this region. - Highlights: Black-Right-Pointing-Pointer We compare isotopes and POP levels in dolphins occupying three embayments. Black-Right-Pointing-Pointer POP levels varied significantly among two embayments separated by < 50 km. Black-Right-Pointing-Pointer Differentiation correlated with historical contamination from a SuperFund site. Black-Right-Pointing-Pointer Cumulatively, isotopes and POP levels indicate 3 distinct dolphin communities. Black-Right-Pointing-Pointer This data provides the first assessment of dolphin POP contamination in the region.

  20. Blood-Based Indicators of Insulin Resistance and Metabolic Syndrome in Bottlenose Dolphins (Tursiops truncatus) (United States)

    Venn-Watson, Stephanie; Smith, Cynthia Rowe; Stevenson, Sacha; Parry, Celeste; Daniels, Risa; Jensen, Eric; Cendejas, Veronica; Balmer, Brian; Janech, Michael; Neely, Benjamin A.; Wells, Randall


    Similar to people with metabolic syndrome, bottlenose dolphins (Tursiops truncatus) can have a sustained postprandial hyperglycemia and hyperinsulinemia, dyslipidemia, and fatty liver disease. A panel of potential postprandial blood-based indicators of insulin resistance and metabolic syndrome were compared among 34 managed collection dolphins in San Diego Bay, CA, USA (Group A) and 16 wild, free-ranging dolphins in Sarasota Bay, FL, USA (Group B). Compared to Group B, Group A had higher insulin (2.1 ± 2.5 and 13 ± 13 μIU/ml), glucose (87 ± 19 and 108 ± 12 mg/dl), and triglycerides (75 ± 28 and 128 ± 45 mg/dl) as well as higher cholesterol (total, high-density lipoprotein cholesterol, and very low density lipoprotein cholesterol), iron, transferrin saturation, gamma-glutamyl transpeptidase (GGT), alanine transaminase, and uric acid. Group A had higher percent unmodified adiponectin. While Group A dolphins were older, the same blood-based differences remained when controlling for age. There were no differences in body mass index (BMI) between the groups, and comparisons between Group B and Group A dolphins have consistently demonstrated lower stress hormones levels in Group A. Group A dolphins with high insulin (greater than 14 μIU/ml) had higher glucose, iron, GGT, and BMI compared to Group A dolphins with lower insulin. These findings support that some dolphin groups may be more susceptible to insulin resistance compared to others, and primary risk factors are not likely age, BMI, or stress. Lower high-molecular weight adiponectin has been identified as an independent risk factor for type 2 diabetes in humans and may be a target for preventing insulin resistance in dolphins. Future investigations with these two dolphin populations, including dietary and feeding differences, may provide valuable insight for preventing and treating insulin resistance in humans. PMID:24130551

  1. Environmental changes and anthropogenic factors modulate social play in captive bottlenose dolphins (Tursiops truncatus). (United States)

    Serres, Agathe; Delfour, Fabienne


    Social play varies among species and individuals and changes in frequency and duration during ontogeny. This type of play is modulated by environmental changes (e.g., resource availability). In captivity, cetaceans and their environment are managed by humans, and training sessions and/or public presentations punctuate the day as well as other frequent or occasional events. There is a lack of research on the effects of environmental events that occur in captivity and might affect dolphins' behavior. We studied the context in which nine bottlenose dolphins (Tursiops truncatus) played socially and the events that could potentially impact this social interaction. The dolphins' social play behavior was significantly more frequent and lasted longer in the morning than in the afternoon and was present before and after interactions with their trainers with a non-significant tendency to be more frequent before and after a training session than a public presentation. In an experimental paradigm using familiar environmental enrichment, our results demonstrated that environmental enrichment tended to increase social play duration whereas temporary noisy construction work around the pool and display of agonistic behaviors by members of the group significantly decreased it. These results contribute to better understand the social play distribution in captive bottlenose dolphins and the impact of different events within their daily lives. Since play decreases or disappears when animals are facing unfavorable conditions, the evaluation of social play may relate to the animals' current well-being. We suggest that social play has potential to become an indicator of bottlenose dolphins' current welfare state. © 2017 Wiley Periodicals, Inc.

  2. Occurrence of triclosan in plasma of wild Atlantic bottlenose dolphins (Tursiops truncatus) and in their environment

    International Nuclear Information System (INIS)

    Fair, Patricia A.; Lee, H.-B.; Adams, Jeff; Darling, Colin; Pacepavicius, Grazina; Alaee, Mehran; Bossart, Gregory D.; Henry, Natasha; Muir, Derek


    The presence of triclosan, a widely-used antibacterial chemical, is currently unknown in higher trophic-level species such as marine mammals. Blood plasma collected from wild bottlenose dolphins (Tursiops truncatus) in Charleston, SC (CHS) (n = 13) and Indian River Lagoon, FL (IRL) (n = 13) in 2005 was analyzed for triclosan. Plasma concentrations in CHS dolphins ranged from 0.12 to 0.27 ng/g wet weight (mean 0.18 ng/g), with 31% of the sampled individuals having detectable triclosan. The mean IRL dolphin plasma concentrations were 0.072 ng/g wet weight (range 0.025-0.11 ng/g); 23% of the samples having detectable triclosan. In the CHS area, triclosan effluent values from two WWTP were both 190 ng/L and primary influents were 2800 ng/L and 3400 ng/L. Triclosan values in CHS estuarine surface water samples averaged 7.5 ng/L (n = 18) ranging from 4.9 to 14 ng/L. This is the first study to report bioaccumulation of anthropogenic triclosan in a marine mammal highlighting the need for further monitoring and assessment. - Triclosan in bottlenose dolphin plasma and their environment.

  3. Occurrence of triclosan in plasma of wild Atlantic bottlenose dolphins (Tursiops truncatus) and in their environment

    Energy Technology Data Exchange (ETDEWEB)

    Fair, Patricia A., E-mail: pat.fair@noaa.go [National Oceanic and Atmospheric Administration, National Ocean Services, Center for Coastal Environmental Health and Biomolecular Research, 219 Fort Johnson Road, Charleston, SC 29412-9110 (United States); Lee, H.-B. [Aquatic Ecosystem Protection Research Division, Environment Canada, 867 Lakeshore Road, Burlington, ON L7R 4A6 (Canada); Adams, Jeff [National Oceanic and Atmospheric Administration, National Ocean Services, Center for Coastal Environmental Health and Biomolecular Research, 219 Fort Johnson Road, Charleston, SC 29412-9110 (United States); Darling, Colin; Pacepavicius, Grazina; Alaee, Mehran [Aquatic Ecosystem Protection Research Division, Environment Canada, 867 Lakeshore Road, Burlington, ON L7R 4A6 (Canada); Bossart, Gregory D. [Center for Coastal Research, Marine Mammal Research and Conservation Program, Harbor Branch Oceanographic Institute at Florida Atlantic University, 5600 U.S. 1 North, Ft. Pierce, FL 34946 (United States); Henry, Natasha [National Oceanic and Atmospheric Administration, National Ocean Services, Center for Coastal Environmental Health and Biomolecular Research, 219 Fort Johnson Road, Charleston, SC 29412-9110 (United States); Muir, Derek [Aquatic Ecosystem Protection Research Division, Environment Canada, 867 Lakeshore Road, Burlington, ON L7R 4A6 (Canada)


    The presence of triclosan, a widely-used antibacterial chemical, is currently unknown in higher trophic-level species such as marine mammals. Blood plasma collected from wild bottlenose dolphins (Tursiops truncatus) in Charleston, SC (CHS) (n = 13) and Indian River Lagoon, FL (IRL) (n = 13) in 2005 was analyzed for triclosan. Plasma concentrations in CHS dolphins ranged from 0.12 to 0.27 ng/g wet weight (mean 0.18 ng/g), with 31% of the sampled individuals having detectable triclosan. The mean IRL dolphin plasma concentrations were 0.072 ng/g wet weight (range 0.025-0.11 ng/g); 23% of the samples having detectable triclosan. In the CHS area, triclosan effluent values from two WWTP were both 190 ng/L and primary influents were 2800 ng/L and 3400 ng/L. Triclosan values in CHS estuarine surface water samples averaged 7.5 ng/L (n = 18) ranging from 4.9 to 14 ng/L. This is the first study to report bioaccumulation of anthropogenic triclosan in a marine mammal highlighting the need for further monitoring and assessment. - Triclosan in bottlenose dolphin plasma and their environment.

  4. The experience of self in the bottlenose dolphin. (United States)

    Hart, D; Whitlow, J W


    Marten and Psarakos have presented some evidence which suggests that objective self-awareness and possibly representations of self may characterize the dolphins' experience of self. Their research demonstrates the possibility of similarities in the sense of self between primate species and dolphins, although whether dolphins have subjective self-awareness, personal memories, and theories of self--all important facets of the sense of self in humans--was not examined. Clearly, even this limited evidence was difficult to achieve; the difficulties in adapting methods and coding behavior are quite apparent in their report. Future progress, however, may depend upon clarification of what are the necessary components for a sense of self and an explication of how these might be reflected in dolphin behavior. We are mindful of the authors' point (pp. 219 and 220) that the dolphin lives more in an acoustic than a visual environment. Thus, while tasks relying upon vision may reveal the presence or absence of the sense of self in primates, it might well be the case that in dolphins self-related experiences might be better revealed in auditory tasks. But then, what is the nature of human self-awareness in terms of audition? While both conceptual and methodological hurdles remain, Marten and Psarakos have demonstrated that important questions can be asked about the minds and phenomenal worlds of nonanthropoid species.

  5. Bubble ring play of bottlenose dolphins (Tursiops truncatus): implications for cognition. (United States)

    McCowan, B; Marino, L; Vance, E; Walke, L; Reiss, D


    Research on the cognitive capacities of dolphins and other cetaceans (whales and porpoises) has importance for the study of comparative cognition, particularly with other large-brained social mammals, such as primates. One of the areas in which cetaceans can be compared with primates is that of object manipulation and physical causality, for which there is an abundant body of literature in primates. The authors supplemented qualitative observations with statistical methods to examine playful bouts of underwater bubble ring production and manipulation in 4 juvenile male captive bottlenose dolphins (Tursiops truncatus). The results are consistent with the hypothesis that dolphins monitor the quality of their bubble rings and anticipate their actions during bubble ring play.

  6. Cognitive enrichment for bottlenose dolphins (Tursiops truncatus): evaluation of a novel underwater maze device. (United States)

    Clark, Fay E; Davies, Samuel L; Madigan, Andrew W; Warner, Abby J; Kuczaj, Stan A


    Cognitive enrichment is gaining popularity as a tool to enhance captive animal well-being, but research on captive cetaceans is lacking. Dolphin cognition has been studied intensively since the 1950s, and several hundred bottlenose dolphins are housed in major zoos and aquaria worldwide, but most dolphin enrichment consists of simple floating objects. The aim of this study was to investigate whether a novel, underwater maze device (UMD) was cognitively enriching for one group of male and one group of female dolphins at Six Flags Discovery Kingdom, CA. The dolphin's task was to navigate a rubber ball through a maze of pipes, towards an exit pipe. We also tested a modification where an edible gelatine ball fell into the pool once the UMD was solved. The UMD was provided to each group between 8 and 11 times over a 4-week period. Male dolphins used the UMD without prior training, whereas females did not use the UMD at all. Two male dolphins solved the UMD 17 times, using a variety of problem-solving strategies. The UMD had no significant effect on circular (repetitive) swimming patterns, but males spent significantly more time underwater when the UMD was present. Males used the UMD significantly more when it contained the rubber ball, but the gelatine ball stimulated social play. The UMD is a safe and practical device for captive dolphins. It now requires further testing on other dolphins, particularly females, to in order to examine whether the sex differences we observed are a general phenomenon. © 2013 Wiley Periodicals, Inc.

  7. Mucocutaneous lesions in free-ranging Atlantic bottlenose dolphins Tursiops truncatus from the southeastern USA. (United States)

    Bossart, Gregory D; Schaefer, Adam M; McCulloch, Stephen; Goldstein, Juli; Fair, Patricia A; Reif, John S


    Mucocutaneous lesions were biopsied from free-ranging Atlantic bottlenose dolphins Tursiops truncatus inhabiting the Indian River Lagoon (IRL), Florida, and estuarine waters of Charleston (CHS), South Carolina, USA, between 2003 and 2013. A total of 78 incisional biopsies from 58 dolphins (n=43 IRL, n=15 CHS) were examined. Thirteen dolphins had 2 lesions biopsied at the same examination, and 6 dolphins were re-examined and re-biopsied at time intervals varying from 1 to 8 yr. Biopsy sites included the skin (n=47), tongue (n=2), and genital mucosa (n=29). Pathologic diagnoses were: orogenital sessile papilloma (39.7%), cutaneous lobomycosis (16.7%), tattoo skin disease (TSD; 15.4%), nonspecific chronic to chronic-active dermatitis (15.4%), and epidermal hyperplasia (12.8%). Pathologic diagnoses from dolphins with 2 lesions were predominately orogenital sessile papillomas (n=9) with nonspecific chronic to chronic-active dermatitis (n=4), TSD (n=3), lobomycosis (n=1), and epidermal hyperplasia (n=1). Persistent pathologic diagnoses from the same dolphins re-examined and re-biopsied at different times included genital sessile papillomas (n=3), lobomycosis (n=2), and nonspecific dermatitis (n=2). This is the first study documenting the various types, combined prevalence, and progression of mucocutaneous lesions in dolphins from the southeastern USA. The data support other published findings describing the health patterns in dolphins from these geographic regions. Potential health impacts related to the observed suite of lesions are important for the IRL and CHS dolphin populations, since previous studies have indicated that both populations are affected by complex infectious diseases often associated with immunologic disturbances and anthropogenic contaminants.

  8. Adrenal Hormones in Common Bottlenose Dolphins (Tursiops truncatus: Influential Factors and Reference Intervals.

    Directory of Open Access Journals (Sweden)

    Leslie B Hart

    Full Text Available Inshore common bottlenose dolphins (Tursiops truncatus are exposed to a broad spectrum of natural and anthropogenic stressors. In response to these stressors, the mammalian adrenal gland releases hormones such as cortisol and aldosterone to maintain physiological and biochemical homeostasis. Consequently, adrenal gland dysfunction results in disruption of hormone secretion and an inappropriate stress response. Our objective herein was to develop diagnostic reference intervals (RIs for adrenal hormones commonly associated with the stress response (i.e., cortisol, aldosterone that account for the influence of intrinsic (e.g., age, sex and extrinsic (e.g., time factors. Ultimately, these reference intervals will be used to gauge an individual's response to chase-capture stress and could indicate adrenal abnormalities. Linear mixed models (LMMs were used to evaluate demographic and sampling factors contributing to differences in serum cortisol and aldosterone concentrations among bottlenose dolphins sampled in Sarasota Bay, Florida, USA (2000-2012. Serum cortisol concentrations were significantly associated with elapsed time from initial stimulation to sample collection (p<0.05, and RIs were constructed using nonparametric methods based on elapsed sampling time for dolphins sampled in less than 30 minutes following net deployment (95% RI: 0.91-4.21 µg/dL and following biological sampling aboard a research vessel (95% RI: 2.32-6.68 µg/dL. To examine the applicability of the pre-sampling cortisol RI across multiple estuarine stocks, data from three additional southeast U.S. sites were compared, revealing that all of the dolphins sampled from the other sites (N = 34 had cortisol concentrations within the 95th percentile RI. Significant associations between serum concentrations of aldosterone and variables reported in previous studies (i.e., age, elapsed sampling time were not observed in the current project (p<0.05. Also, approximately 16% of

  9. Hepatitis E virus in bottlenose dolphins Tursiops truncatus. (United States)

    Montalvo Villalba, María Caridad; Cruz Martínez, Danilo; Ahmad, Imran; Rodriguez Lay, Licel A; Bello Corredor, Marite; Guevara March, Celia; Martínez, Liena Sánchez; Martínez-Campo, Laima Sánchez; Jameel, Shahid


    Hepatitis E virus (HEV) infects several animal species that act as zoonotic reservoirs for viral transmission. Solid and liquid residues from infected animals could lead to HEV contamination of food and surface waters. Evidence of human HEV infection through ingestion of seafood (shellfish, mussels) has been reported. Dolphins generally feed on fish and squid but are able to adapt to an environment and consume whatever prey is available. Clinical signs of infected dolphins include lethargy, inappetence, behavioral aberrations and increased serum alanine aminotransferase (ALT). The dolphins examined in this study were maintained at the National Aquarium, Havana, Cuba. A total of 31 dolphins were evaluated for HEV markers. Sera were collected and screened for total immunoglobin (Ig) anti-HEV. Sera and liver homogenate were tested for HEV RNA by nested RT-PCR using primers targeting the open reading frame 1. Phylogenetic analysis was performed using partial nucleotide sequences at the amplified RNA-dependent RNA polymerase gene. Total anti-HEV Ig was detected in 32.2% (10 of 31), and 16.1% (5 of 31) of these dolphins were positive by both serology and HEV RNA testing. Nucleotide sequence analyses revealed that HEV strains identified in dolphins were genotype 3. This virus may represent an environmental contamination of food or wastewater as a source of HEV exposure and infection. Our findings provide evidence that HEV is associated with liver disorders in cetaceans and that it is advisable to screen for exposure of this virus in captive dolphins, particularly animals with elevated serum ALT or compromised liver function test results of undetermined cause.

  10. Travel at low energetic cost by swimming and wave-riding bottlenose dolphins. (United States)

    Williams, T M; Friedl, W A; Fong, M L; Yamada, R M; Sedivy, P; Haun, J E


    Over the past 50 years there has been much speculation about the energetic cost of swimming and wave-riding by dolphins. When aligned properly in front of the bow of moving ships in the stern wake of small boats, on wind waves, and even in the wake of larger cetaceans, the animals appear to move effortlessly through the water without the benefit of propulsive strokes by the flukes. Theoretically, body streamlining as well as other anatomical and behavioural adaptations contribute to low transport costs in these animals. The economy of movement permitted by wave-riding has been perceived as an energetic advantage for the swimming dolphin, but has been hard to prove in the absence of physiological data for exercising cetaceans. Here we determine the aerobic and anaerobic costs of swimming and wave-riding in bottlenose dolphins and find that the minimum cost of transport for swimming dolphins is 1.29 +/- 0.05 J kg-1 m-1 at a cruising speed of 2.1 m s-1. Aerobic costs are nearly twice as high for swimming seals and sea lions, and 8-12 times higher for human swimmers. Wave-riding by dolphins provides additional benefits in terms of speed. The results indicate that behavioural, physiological and morphological factors make swimming an economical form of high-speed travel for dolphins.

  11. Behavioral aspects of sleep in bottlenose dolphin mothers and their calves. (United States)

    Lyamin, Oleg; Pryaslova, Julia; Kosenko, Peter; Siegel, Jerome


    Adult dolphins are capable of sleeping with one eye open and exhibiting slow wave activity in the electroencephalogram (EEG) of one hemisphere at a time. The aim of this study was to examine the postpartum sleep behavior of bottlenose dolphin calves and their mothers. The behavior of three dolphin mother-calf pairs was monitored from birth to 13 months postpartum. Dolphin mothers and their calves exhibited a complete disappearance of rest at the surface for a minimum of 2 months postpartum, swimming in echelon formation on average in 97-100% of the observation time. Calves surfaced to breathe more often than their mothers between the postpartum age of 2 and 8 weeks. During the first postpartum month two dolphin mothers surfaced with both eyes open on average in 93 and 98% of the time while in their calves both eyes were open in 90 and 60% of the cases. In calves, the eye directed toward the mother was open more often (on average in 95% of all observations in calf 1 and 99% in calf 2) than the eye directed to the opposite side (82% in calf 1 and 60% in calf 2). Our data indicate that dolphin mothers and calves are highly active and vigilant during the initial period of the calf's life, continuously monitoring their position relative to each other by sight during wakefulness and sleep. We hypothesize that episodes of EEG slow wave activity at this time are likely to be brief, fragmenting EEG defined sleep into short episodes.


    Seitz, Kelsey E; Smith, Cynthia R; Marks, Stanley L; Venn-Watson, Stephanie K; Ivančić, Marina


    The objective of this study was to establish a comprehensive technique for ultrasound examination of the dolphin hepatobiliary system and apply this technique to 30 dolphins to determine what, if any, sonographic changes are associated with blood-based indicators of metabolic syndrome (insulin greater than 14 μIU/ml or glucose greater than 112 mg/dl) and iron overload (transferrin saturation greater than 65%). A prospective study of individuals in a cross-sectional population with and without elevated postprandial insulin levels was performed. Twenty-nine bottlenose dolphins ( Tursiops truncatus ) in a managed collection were included in the final data analysis. An in-water ultrasound technique was developed that included detailed analysis of the liver and pancreas. Dolphins with hyperinsulinemia concentrations had larger livers compared with dolphins with nonelevated concentrations. Using stepwise, multivariate regression including blood-based indicators of metabolic syndrome in dolphins, glucose was the best predictor of and had a positive linear association with liver size (P = 0.007, R 2 = 0.24). Bottlenose dolphins are susceptible to metabolic syndrome and associated complications that affect the liver, including fatty liver disease and iron overload. This study facilitated the establishment of a technique for a rapid, diagnostic, and noninvasive ultrasonographic evaluation of the dolphin liver. In addition, the study identified ultrasound-detectable hepatic changes associated primarily with elevated glucose concentration in dolphins. Future investigations will strive to detail the pathophysiological mechanisms for these changes.

  13. Nocturnal Vocal Activity in Captive Bottlenose Dolphins (Tursiops truncatus): Could Dolphins have Presleep Choruses?


    Kremers, Dorothee; Briseño Jaramillo, Margarita; Böye, Martin; Lemasson, Alban; Hausberger, Martine


    Lemasson & Hausberger : Equal contribution; International audience; Nocturnal vocal activity in dolphins is often thought to be associated with feeding activity. However, when no food resources are available dolphins spend their time for the most part resting/sleeping. While unihemispherically sleeping, dolphins mostly swim slowly and synchronously in close proximity with one or more other individuals. Although vocal activity is lower during resting/sleeping, dolphins are not entirely silent ...

  14. Altrenogest and progesterone therapy during pregnancy in bottlenose dolphins (Tursiops truncatus) with progesterone insufficiency. (United States)

    Robeck, Todd R; Gill, Claudia; Doescher, Bethany M; Sweeney, Jay; De Laender, Piet; Van Elk, Cornelis E; O'Brien, Justine K


    Progesterone production is essential for growth and development of the conceptus during pregnancy. Abnormal development of the corpus luteum (CL) after conception can result in early embryonic loss or fetal abortion. Routine monitoring of bottlenose dolphin (Tursiops truncatus) pregnancy after artificial insemination or natural conception with ultrasonography and serum progesterone determination has allowed for the establishment of expected fetal growth rates and hormone concentrations. Using these monitoring techniques, we revealed four pregnant dolphins (12-24 yr old) with abnormally low progesterone production indicative of luteal insufficiency. Once diagnosed, animals were placed on altrenogest (0.044-0.088 mg/kg once daily) alone or with oral progesterone (50-200 mg twice daily). Doses of hormone were increased or decreased in each animal based on how fetal skull biparietal and thoracic growth rates compared with published normal values. Hormones were withdrawn starting from day 358 of gestation in animals 1 and 2, with labor occurring 6 and 7 days after withdrawal and at 376 and 373 days of gestation, respectively. Both deliveries were dystocic, with each calf requiring manual extraction and fetotomy for calf 1. The fetuses in animals 3 and 4 died at 348 and 390 days of gestation, respectively. Induction of labor was attempted in both animals, after fetal death, by using a combination of rapid progesterone withdrawal and steroid and prostaglandin F2alpha administration. The calf of animal 4 had to be removed with manual cervical dilation and fetotomy All adult females survived the procedures. These data provide the first in vivo evidence that the CL is the primary source of progesterone throughout pregnancy in the bottlenose dolphin. Until further characterization of hormones required during pregnancy and at parturition has been accomplished, the exogenous progestagen supplementation protocol described here cannot be recommended for treatment of progesterone

  15. The diving physiology of bottlenose dolphins (Tursiops truncatus). II. Biomechanics and changes in buoyancy at depth. (United States)

    Skrovan, R C; Williams, T M; Berry, P S; Moore, P W; Davis, R W


    During diving, marine mammals must balance the conservation of limited oxygen reserves with the metabolic costs of swimming exercise. As a result, energetically efficient modes of locomotion provide an advantage during periods of submergence and will presumably increase in importance as the animals perform progressively longer dives. To determine the effect of a limited oxygen supply on locomotor performance, we compared the kinematics and behavior of swimming and diving bottlenose dolphins. Adult bottlenose dolphins (Tursiops truncatus) were trained to swim horizontally near the water surface or submerged at 5 m and to dive to depths ranging from 12 to 112 m. Swimming kinematics (preferred swimming mode, stroke frequency and duration of glides) were monitored using submersible video cameras (Sony Hi-8) held by SCUBA divers or attached to a pack on the dorsal fin of the animal. Drag and buoyant forces were calculated from patterns of deceleration for horizontally swimming and vertically diving animals. The results showed that dolphins used a variety of swimming gaits that correlated with acceleration. The percentage of time spent gliding during the descent phase of dives increased with depth. Glide distances ranged from 7.1+/-1.9 m for 16 m dives to 43.6+/-7.0 m (means +/- s.e.m.) for 100 m dives. These gliding patterns were attributed to changes in buoyancy associated with lung compression at depth. By incorporating prolonged glide periods, the bottlenose dolphin realized a theoretical 10-21 % energetic savings in the cost of a 100 m dive in comparison with dives based on neutral buoyancy models. Thus, modifying locomotor patterns to account for physical changes with depth appears to be one mechanism that enables diving mammals with limited oxygen stores to extend the duration of a dive.

  16. Organohalogen compounds in blubber of Indo-Pacific bottlenose dolphin (Tursiops aduncus) and spinner dolphin (Stenella longirostris) from Zanzibar, Tanzania. (United States)

    Mwevura, Haji; Amir, Omar A; Kishimba, Michael; Berggren, Per; Kylin, Henrik


    Blubber samples of Indo-Pacific bottlenose (Tursiops aduncus) and spinner (Stenella longirostris) dolphins from Zanzibar, East Africa, were analyzed for a wide range of organohalogen compounds. Methoxylated polybrominated diphenyl ethers (MeO-BDEs), presumably biogenic, were found at higher concentrations than anthropogenic organochlorine pesticides (OCPs). Only traces of industrial pollutants, such as polychlorinated biphenyls, were detected. The OCP levels found off Zanzibar were lower than those reported from other regions while MeO-BDE levels were higher. The relative composition of the OCPs indicated recent use of lindane (gamma-hexachlorocyclohexane) and aged residues of DDT and technical HCH. Placental transfer was estimated to 2.5% and 0.5% of the total burden of OCPs and MeO-BDEs, respectively. Overall transfer from mother to calf in Indo-Pacific bottlenose dolphins was estimated to 72% and 85% for the OCPs and MeO-BDEs burdens, respectively. Health effects of MeO-BDEs are not known, but structural similarities with well-known environmental toxins are cause for concern. Copyright 2010 Elsevier Ltd. All rights reserved.

  17. Shark predation on Indian Ocean bottlenose dolphins TUTSiops ...

    African Journals Online (AJOL)


    Oct 24, 1988 ... Of the dolphins caught, 10,3% exhibited scars or wounds consistent with shark bites. Only 1,2% of over 6000 sharks caught contained cetacean remains. Four species of shark, the Zambesi (Carcharhinus leucas), the tiger (Galeocerdo cuvieri), the great white (Carcharodon carcharias) and the dusky shark ( ...

  18. Decades-long social memory in bottlenose dolphins. (United States)

    Bruck, Jason N


    Long-term social memory is important, because it is an ecologically relevant test of cognitive capacity, it helps us understand which social relationships are remembered and it relates two seemingly disparate disciplines: cognition and sociality. For dolphins, long-term memory for conspecifics could help assess social threats as well as potential social or hunting alliances in a very fluid and complex fission-fusion social system, yet we have no idea how long dolphins can remember each other. Through a playback study conducted within a multi-institution dolphin breeding consortium (where animals are moved between different facilities), recognition of unfamiliar versus familiar signature whistles of former tank mates was assessed. This research shows that dolphins have the potential for lifelong memory for each other regardless of relatedness, sex or duration of association. This is, to my knowledge, the first study to show that social recognition can last for at least 20 years in a non-human species and the first large-scale study to address long-term memory in a cetacean. These results, paired with evidence from elephants and humans, provide suggestive evidence that sociality and cognition could be related, as a good memory is necessary in a fluid social system.

  19. Health and Environmental Risk Assessment Project for bottlenose dolphins Tursiops truncatus from the southeastern USA. II. Environmental aspects. (United States)

    Reif, John S; Schaefer, Adam M; Bossart, Gregory D; Fair, Patricia A


    Bottlenose dolphins Tursiops truncatus are the most common apex predators found in coastal and estuarine ecosystems along the southeastern coast of the USA, where these animals are exposed to multiple chemical pollutants and microbial agents. In this review, we summarize the results of investigations of environmental exposures evaluated in 360 free-ranging dolphins between 2003 and 2015. Bottlenose dolphins inhabiting the Indian River Lagoon, Florida (IRL, n = 246), and coastal waters of Charleston, South Carolina (CHS, n = 114), were captured, given comprehensive health examinations, and released as part of a multidisciplinary and multi-institutional study of individual and population health. High concentrations of persistent organic pollutants including legacy contaminants (DDT and other pesticides, polychlorinated biphenyl compounds) as well as 'emerging' contaminants (polybrominated diphenyl ethers, perfluorinated compounds) were detected in dolphins from CHS, with lower concentrations in the IRL. Conversely, the concentrations of mercury in the blood and skin of IRL dolphins were among the highest reported worldwide and approximately 5 times as high as those found in CHS dolphins. A high prevalence of resistance to antibiotics commonly used in humans and animals was detected in bacteria isolated from fecal, blowhole, and/or gastric samples at both sites, including methicillin-resistant Staphylococcus aureus (MRSA) at CHS. Collectively, these studies illustrate the importance of long-term surveillance of estuarine populations of bottlenose dolphins and reaffirm their important role as sentinels for marine ecosystems and public health.

  20. Modulation of whistle production related to training sessions in bottlenose dolphins (Tursiops truncatus) under human care. (United States)

    Lopez Marulanda, Juliana; Adam, Olivier; Delfour, Fabienne


    Bottlenose dolphins are highly social cetaceans with an extensive sound production including clicks, burst-pulsed sounds, and whistles. Some whistles, known as signature whistles, are individually specific. These acoustic signatures are commonly described as being emitted in contexts of stress during forced isolation and as group cohesion calls. Interactions between humans and captive dolphins is largely based on positive reinforcement conditioning within several training/feeding sessions per day. Vocal behavior of dolphins during these interactions might vary. To investigate this, we recorded 10 bottlenose dolphins of Parc Asterix dolphinarium (France) before, during and after 10 training sessions for a total duration of 7 hr and 32 min. We detected 3,272 whistles with 2,884 presenting a quality good enough to be categorized. We created a catalog of whistle types by visual categorization verified by five naive judges (Fleiss' Kappa Test). We then applied the SIGID method to identify the signatures whistles present in our recordings. We found 279 whistles belonging to one of the four identified signature whistle types. The remaining 2,605 were classified as non-signature whistles. The non-signature whistles emission rate was higher during and after the training sessions than before. Emission rate of three signature whistles types significantly increased afterwards as compared to before the training sessions. We suggest that dolphins use their signature whistles when they return to their intraspecific social interactions succeeding scheduled and human-organized training sessions. More observations are needed to make conclusions about the function of signature whistles in relation to training sessions. Zoo Biol. 35:495-504, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  1. Food-related bray calls in wild bottlenose dolphins (Tursiops truncatus). (United States)

    Janik, V M


    Because cetaceans are difficult to study in the wild, little is known about how they use their sounds in their natural environment. Only the recent development of passive acoustic localization systems has enabled observations of the communication behaviour of individuals for correlation with their surface behaviour. Using such a system, I show that bottlenose dolphins in the Moray Firth, Scotland, produce low-frequency bray calls which are clearly correlated with feeding on salmonids. The production of these calls is followed by fast approaches by conspecifics in the area. In animals which use sound as a foraging tool, it is difficult to distinguish between food calls which have evolved because of their role in attracting conspecifics, and food manipulation or searching calls which may attract conspecifics as a by-product. However, the low-frequency structure of the bottlenose dolphin bray suggests that it evolved because of a role in manipulating prey rather than in attracting conspecifics. This conclusion suggests that dolphins exploit the perceptual systems of their prey to facilitate capture.

  2. Bottlenose dolphins engaging in more social affiliative behaviour judge ambiguous cues more optimistically. (United States)

    Clegg, Isabella L K; Rödel, Heiko G; Delfour, Fabienne


    Cognitive bias tests measure variation in emotional appraisal and are validated methods to assess animals' affective states. However, the link between social behaviours and cognitive bias has not yet been investigated. Bottlenose dolphins are a gregarious species for whom welfare research is increasing in importance, and thus are a good model to test such an association. We adapted a spatial location judgement bias test for eight captive bottlenose dolphins to investigate the link between cognitive bias and social behaviour, where we conducted behavioural observations outside of training sessions and did not experimentally induce an affective state. Subjects showed stable individual differences in cognitive biases across the three test days. Furthermore, dolphins showing more synchronous swimming, a fundamental affiliative behaviour, judged ambiguous cues significantly more optimistically. Our longer-term data showed cognitive bias and synchronous swimming frequency were significantly associated for up to two months preceding the test, but disappeared prior to that, suggesting that here cognitive bias differences were reflected by transitory affective states rather than longer-term traits. We hypothesise that the frequency of synchronous swimming may induce affective states and/or be induced by them; either way, it has strong potential as an indicator of affective state in this species and beyond. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Evidence of Brucella strain ST27 in bottlenose dolphin (Tursiops truncatus) in Europe. (United States)

    Cvetnić, Željko; Duvnjak, Sanja; Đuras, Martina; Gomerčić, Tomislav; Reil, Irena; Zdelar-Tuk, Maja; Špičić, Silvio


    Marine mammal brucellosis has been known for more than 20 years, but recent work suggests it is more widespread than originally thought. Brucella (B.) pinnipedialis has been isolated from pinnipeds, while B. ceti strains have been associated with cetaceans. Here we report a Brucella strain isolated from multiple lymph nodes of one bottlenose dolphin (Tursiops truncatus) during routine examination of dolphin carcasses found in the Croatian part of the northern Adriatic Sea during the summer of 2015. Classical bacteriological biotyping, PCR-based techniques (single, multiplex, PCR-RFLP) and 16S rRNA DNA sequencing were used to identify Brucella spp. Multiple-locus variable number tandem repeat analysis of 16 loci and multilocus sequence typing of 9 loci were used for genotyping and species determination. The combination of bacteriological, molecular and genotyping techniques identified our strain as ST27, previously identified as a human pathogen. This report provides, to our knowledge, the first evidence of ST27 in the Adriatic Sea in particular and in European waters in general. The zoonotic nature of the strain and its presence in the Adriatic, which is inhabited by bottlenose dolphins, suggest that the strain may pose a significant threat to human health. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Hearing sensation levels of emitted biosonar clicks in an echolocating Atlantic bottlenose dolphin.

    Directory of Open Access Journals (Sweden)

    Songhai Li

    Full Text Available Emitted biosonar clicks and auditory evoked potential (AEP responses triggered by the clicks were synchronously recorded during echolocation in an Atlantic bottlenose dolphin (Tursiops truncatus trained to wear suction-cup EEG electrodes and to detect targets by echolocation. Three targets with target strengths of -34, -28, and -22 dB were used at distances of 2 to 6.5 m for each target. The AEP responses were sorted according to the corresponding emitted click source levels in 5-dB bins and averaged within each bin to extract biosonar click-related AEPs from noise. The AEP amplitudes were measured peak-to-peak and plotted as a function of click source levels for each target type, distance, and target-present or target-absent condition. Hearing sensation levels of the biosonar clicks were evaluated by comparing the functions of the biosonar click-related AEP amplitude-versus-click source level to a function of external (in free field click-related AEP amplitude-versus-click sound pressure level. The results indicated that the dolphin's hearing sensation levels to her own biosonar clicks were equal to that of external clicks with sound pressure levels 16 to 36 dB lower than the biosonar click source levels, varying with target type, distance, and condition. These data may be assumed to indicate that the bottlenose dolphin possesses effective protection mechanisms to isolate the self-produced intense biosonar beam from the animal's ears during echolocation.

  5. Two Cases of Lacaziosis in Bottlenose Dolphins (Tursiops truncatus in Japan

    Directory of Open Access Journals (Sweden)

    Keiichi Ueda


    Full Text Available Lacaziosis, formerly called lobomycosis, caused by Lacazia loboi, is a zoonotic mycosis found in humans and dolphins and is endemic in the countries on the Atlantic Ocean. Although the Japanese coast is not considered an endemic area, photographic records of lacaziosis-like skin lesions were found in bottlenose dolphins (Tursiops truncatus that were migrating in the Goto Islands (Nagasaki Prefecture, Japan. We diagnosed 2 cases of lacaziosis in bottlenose dolphins captured simultaneously at the same coast within Japanese territory on the basis of clinical characteristics, cytology, histopathology, immunological tests, and detection of partial sequences of a 43 kDa glycoprotein coding gene (gp43 with a nested-PCR system. The granulomatous skin lesions from the present cases were similar to those found in animals from endemic areas, containing multiple budding and chains of round yeast cells and positive in the immune-staining with anti-Paracoccidioides brasiliensis serum which is a fungal species related to L. loboi; however, the gp43 gene sequences derived from the present cases showed 94.1% homology to P. brasiliensis and 84.1% to L. loboi. We confirmed that the causative agent at the present cases was different genotype of L. loboi from Amazon area.

  6. Food-related bray calls in wild bottlenose dolphins (Tursiops truncatus). (United States)

    Janik, V M


    Because cetaceans are difficult to study in the wild, little is known about how they use their sounds in their natural environment. Only the recent development of passive acoustic localization systems has enabled observations of the communication behaviour of individuals for correlation with their surface behaviour. Using such a system, I show that bottlenose dolphins in the Moray Firth, Scotland, produce low-frequency bray calls which are clearly correlated with feeding on salmonids. The production of these calls is followed by fast approaches by conspecifics in the area. In animals which use sound as a foraging tool, it is difficult to distinguish between food calls which have evolved because of their role in attracting conspecifics, and food manipulation or searching calls which may attract conspecifics as a by-product. However, the low-frequency structure of the bottlenose dolphin bray suggests that it evolved because of a role in manipulating prey rather than in attracting conspecifics. This conclusion suggests that dolphins exploit the perceptual systems of their prey to facilitate capture. PMID:10853736

  7. Exposure to novel parainfluenza virus and clinical relevance in 2 bottlenose dolphin (Tursiops truncatus) populations. (United States)

    Venn-Watson, Stephanie; Rivera, Rebecca; Smith, Cynthia R; Saliki, Jeremiah T; Caseltine, Shannon; St Leger, Judy; Yochem, Pam; Wells, Randall S; Nollens, Hendrik


    Parainfluenza virus (PIV) is a leading cause of respiratory infections in humans. A novel virus closely related to human and bovine parainfluenza viruses types 3 (HPIV-3 and BPIV-3), named Tursiops truncatus parainfluenza virus type 1 (TtPIV-1), was isolated from a dolphin with respiratory disease. We developed a dolphin-specific ELISA to measure acute- and convalescent-phase PIV antibodies in dolphins during 1999-2006 with hemograms similar to that of the positive control. PIV seroconversion occurred concurrently with an abnormal hemogram in 22 animals, of which 7 (31.8%) had respiratory signs. Seroprevalence surveys were conducted on 114 healthy bottlenose dolphins in Florida and California. When the most conservative interpretation of positive was used, 11.4% of healthy dolphins were antibody positive, 29.8% were negative, and 58.8% were inconclusive. PIV appears to be a common marine mammal virus that may be of human health interest because of the similarity of TtPIV-1 to BPIV-3 and HPIV-3.

  8. Underwater recordings of the whistles of bottlenose dolphins in Fremantle Inner Harbour, Western Australia (United States)

    Marley, Sarah A.; Erbe, Christine; Kent, Chandra P. Salgado


    Dolphins use frequency-modulated whistles for a variety of social functions. Whistles vary in their characteristics according to context, such as activity state, group size, group composition, geographic location, and ambient noise levels. Therefore, comparison of whistle characteristics can be used to address numerous research questions regarding dolphin populations and behaviour. However, logistical and economic constraints on dolphin research have resulted in data collection biases, inconsistent analytical approaches, and knowledge gaps. This Data Descriptor presents an acoustic dataset of bottlenose dolphin (Tursiops aduncus) whistles recorded in the Fremantle Inner Harbour, Western Australia. Data were collected using an autonomous recorder and analysed using a range of acoustic measurements. Acoustic data review identified 336 whistles, which were subsequently measured for six key characteristics using Raven Pro software. Of these, 164 'high-quality' whistles were manually measured to provide an additional five acoustic characteristics. Digital files of individual whistles and corresponding measurements make this dataset available to researchers to address future questions regarding variations within and between dolphin communities.

  9. Skin Lesions on Common Bottlenose Dolphins (Tursiops truncatus) from Three Sites in the Northwest Atlantic, USA (United States)

    Hart, Leslie Burdett; Rotstein, Dave S.; Wells, Randall S.; Allen, Jason; Barleycorn, Aaron; Balmer, Brian C.; Lane, Suzanne M.; Speakman, Todd; Zolman, Eric S.; Stolen, Megan; McFee, Wayne; Goldstein, Tracey; Rowles, Teri K.; Schwacke, Lori H.


    Skin disease occurs frequently in many cetacean species across the globe; methods to categorize lesions have relied on photo-identification (photo-id), stranding, and by-catch data. The current study used photo-id data from four sampling months during 2009 to estimate skin lesion prevalence and type occurring on bottlenose dolphins (Tursiops truncatus) from three sites along the southeast United States coast [Sarasota Bay, FL (SSB); near Brunswick and Sapelo Island, GA (BSG); and near Charleston, SC (CHS)]. The prevalence of lesions was highest among BSG dolphins (P = 0.587) and lowest in SSB (P = 0.380), and the overall prevalence was significantly different among all sites (pBSG dolphins (OR = 1.39; 95%CI:1.203–1.614). Approximately one-third of the lesioned dolphins from each site presented with multiple types, and population differences in lesion type occurrence were observed (p<0.05). Lesions on stranded dolphins were sampled to determine the etiology of different lesion types, which included three visually distinct samples positive for herpesvirus. Although generally considered non-fatal, skin disease may be indicative of animal health or exposure to anthropogenic or environmental threats, and photo-id data provide an efficient and cost-effective approach to document the occurrence of skin lesions in free-ranging populations. PMID:22427955

  10. Captive Bottlenose Dolphins Do Discriminate Human-Made Sounds Both Underwater and in the Air (United States)

    Lima, Alice; Sébilleau, Mélissa; Boye, Martin; Durand, Candice; Hausberger, Martine; Lemasson, Alban


    Bottlenose dolphins (Tursiops truncatus) spontaneously emit individual acoustic signals that identify them to group members. We tested whether these cetaceans could learn artificial individual sound cues played underwater and whether they would generalize this learning to airborne sounds. Dolphins are thought to perceive only underwater sounds and their training depends largely on visual signals. We investigated the behavioral responses of seven dolphins in a group to learned human-made individual sound cues, played underwater and in the air. Dolphins recognized their own sound cue after hearing it underwater as they immediately moved toward the source, whereas when it was airborne they gazed more at the source of their own sound cue but did not approach it. We hypothesize that they perhaps detected modifications of the sound induced by air or were confused by the novelty of the situation, but nevertheless recognized they were being “targeted.” They did not respond when hearing another group member’s cue in either situation. This study provides further evidence that dolphins respond to individual-specific sounds and that these marine mammals possess some capacity for processing airborne acoustic signals. PMID:29445350

  11. Individual specialization in the foraging habits of female bottlenose dolphins living in a trophically diverse and habitat rich estuary (United States)

    Rossman, Sam; Ostrom, Peggy H.; Stolen, Megan; Barros, Nélio B.; Gandhi, Hasand; Stricker, Craig A.; Wells, Randall S.


    We examine individual specialization in foraging habits (foraging habitat and trophic level) of female bottlenose dolphins (Tursiops truncatus) resident in Sarasota Bay, Florida, USA, by analyzing time series of stable isotope (δ15N and δ13C) values in sequential growth layer groups within teeth. The isotope data provide a chronology of foraging habits over the lifetime of the individual and allowed us to show that female bottlenose dolphins exhibit a high degree of individual specialization in both foraging habitat and trophic level. The foraging habits used by adult females are similar to those they used as calves and may be passed down from mother to calf through social learning. We also characterized the foraging habits and home range of each individual by constructing standard ellipses from isotope values and dolphin sightings data (latitude and longitude), respectively. These data show that Sarasota Bay bottlenose dolphins forage within a subset of the habitats in which they are observed. Moreover, females with similar observational standard ellipses often possessed different foraging specializations. Female bottlenose dolphins may demonstrate individual specialization in foraging habits because it reduces some of the cost of living in groups, such as competition for prey.

  12. Adrenal Hormones in Common Bottlenose Dolphins (Tursiops truncatus): Influential Factors and Reference Intervals (United States)

    Hart, Leslie B.; Wells, Randall S.; Kellar, Nick; Balmer, Brian C.; Hohn, Aleta A.; Lamb, Stephen V.; Rowles, Teri; Zolman, Eric S.; Schwacke, Lori H.


    Inshore common bottlenose dolphins (Tursiops truncatus) are exposed to a broad spectrum of natural and anthropogenic stressors. In response to these stressors, the mammalian adrenal gland releases hormones such as cortisol and aldosterone to maintain physiological and biochemical homeostasis. Consequently, adrenal gland dysfunction results in disruption of hormone secretion and an inappropriate stress response. Our objective herein was to develop diagnostic reference intervals (RIs) for adrenal hormones commonly associated with the stress response (i.e., cortisol, aldosterone) that account for the influence of intrinsic (e.g., age, sex) and extrinsic (e.g., time) factors. Ultimately, these reference intervals will be used to gauge an individual’s response to chase-capture stress and could indicate adrenal abnormalities. Linear mixed models (LMMs) were used to evaluate demographic and sampling factors contributing to differences in serum cortisol and aldosterone concentrations among bottlenose dolphins sampled in Sarasota Bay, Florida, USA (2000–2012). Serum cortisol concentrations were significantly associated with elapsed time from initial stimulation to sample collection (pserum concentrations of aldosterone and variables reported in previous studies (i.e., age, elapsed sampling time) were not observed in the current project (pSerum aldosterone concentrations from animals sampled at the three additional sites were compared to the detection limit, and the proportion of animals with low aldosterone concentrations was not significantly different than an expected prevalence of 16%. Although this study relied upon long-term, free-ranging bottlenose dolphin health data from a single site, the objective RIs can be used for future evaluation of adrenal function among individuals sampled during capture-release health assessments. PMID:25993341

  13. Bottlenose dolphin (Tursiops truncatus) strandings in South Carolina, 1992-1996


    McFee, Wayne E.; Hopkins-Murphy, Sally R.


    From 1992 to 1996, 153 bottlenose dolphin stranded in South Carolina, accounting for 73% of all marine mammal strandings during this period. The objectives of our study were to evaluate data from these strandings to deter-mine 1) annual trends in strandings, 2) seasonal and spatial distribution trends, 3) life history parameters such as sex ratio and age classes, 3) seasonal trends in reproduction, and 4) the extent to which humans have played a role in causing these strandings (human inter-a...

  14. [Quantitative characteristics of the electrocorticographic sleep stages in bottle-nosed dolphins]. (United States)

    Mukhametov, L M; Oleksenko, A I; Poliakova, I G


    Quantitative analysis of the ECoG stages in four bottle-nosed dolphins has demonstrated that unihemispheric slow-wave sleep is the dominant type of their natural sleep. All the variants of the bilateral and unilateral ECoG synchronization comprise 33.4% of the total recording time, with unilateral slow-wave sleep accounting for 28.8%. A single brain hemisphere is in a state of ECoG synchronization for 19% of the total recording time. The maximal amount of sleep is registered during a night and the second half of the day. Unihemispheric sleep episodes tend to appear alternatively in both hemispheres.

  15. Why do dolphins jump? Interpreting the behavioural repertoire of bottlenose dolphins (Tursiops sp.) in Doubtful Sound, New Zealand. (United States)

    Lusseau, David


    Only a limited number of studies have tried to determine the purpose of surface behavioural events performed by dolphins. To date only one study has attempted to aggregate the behavioural events observed in a population in contextual groups using co-occurrence as the grouping factor. In the present study, I tried to characterise the behavioural repertoire of a bottlenose dolphin population (Tursiops sp.) present in Doubtful Sound, New Zealand. I first looked at the relationship between events performed by individuals depending on the behavioural state of their schools. I then assessed the likelihood for events to co-occur. Four main behavioural categories (orientation, travel, social displays and fights) emerged from this analysis. Aerial events (jumps) did not fall into one category, showing that different aerial behaviours play different roles. Moreover, it appears that dolphins used side-flopping and upside-down lobtailing to communicate motivation. Side-flops occurred when the focal schools finished a behavioural bout and started to travel, while upside-down lobtails occurred when the focal schools instigated a behavioural bout after travelling. This non-vocal communication can take place over a few meters to hundreds of meters. Having signals that are effective over very short ranges avoids unwanted signalling to prey, predators or conspecifics.

  16. Auditory evoked potentials (AEP) methods for population-level assessment of hearing sensitivity in bottlenose dolphins (United States)

    Houser, Dorian; Finneran, James


    A portable system for recording auditory evoked potentials (AEP) was developed to rapidly assess the hearing sensitivity of dolphins in air. The system utilizes a transducer embedded in a silicone suction cup to deliver amplitude modulated tones to the dolphin through the lower jaw. Frequencies tested range from 10-150 kHz and testing of both ears is completed within 90 min. AEP-determined thresholds from one subject were benchmarked against that subject's direct field behavioral audiogram to quantify variation between the two methods. To date, AEP audiograms have been obtained from over 30 bottlenose dolphins. Considerable individual variation in frequency-specific hearing sensitivity was observed. Some high-frequency hearing loss was observed in relatively young (early 20s) and old (35+ years) animals; conversely, age was not necessarily related to hearing loss as several animals greater than 40 years of age had good hearing sensitivity across the range of tested frequencies. Profound hearing loss typically occurred at higher frequencies. Decline in sensitivity was rapid in all cases and began between 50-60 kHz. Increased sample size of hearing sensitivity in dolphins suggest that the use of audiometric functions from single animals as representative of population level audiometry might be misleading.

  17. Evolution and the pathology of deep diving in the Bottlenosed Dolphin, Tursiops truncatus (Montagu, 1821) (Notes on Cetacea, Delphinoidea V)

    NARCIS (Netherlands)

    Purves, P.E.; Bree, van P.J.H.


    Cadenat (1959) and Rancurel (1964) produced strong indirect evidence that off the west coast of Africa, the Bottle-nosed Dolphin, Tursiops truncatus, is in the habit of diving very deeply, possibly down to 600 m. Examination of the skulls of fully adult specimens of Tursiops taken off Dakar and St.

  18. Fatal Sarcocystis canis-like hepatitis in an Indo-Pacific bottlenose dolphin (Tursiops aduncus) in Hong Kong (United States)

    Unlike most species in the genus Sarcocystis, Sarcocystis canis has a broad intermediate host range. Its life cycle is incompletely known and most reports are from the USA. Here we report fatal hepatitis in a 4 year old male Indo-Pacific bottlenose dolphin (Tursiops aduncus) from Hong Kong associate...

  19. Successful treatment of azole-resistant invasive aspergillosis in a bottlenose dolphin with high-dose posaconazole

    NARCIS (Netherlands)

    P.E. Bunskoek (Paulien); S. Seyedmousavi (Seyedmojtaba); S. Gans (Steven); van Vierzen, P.B.J. (Peter B.J.); W.J. Melchers (Willem); C.E. van Elk; J.W. Mouton (Johan); P.E. Verweij (Paul)


    textabstractInvasive aspergillosis due to azole-resistant Aspergillus fumigatus is difficult to manage. We describe a case of azole-resistant invasive aspergillosis in a female bottlenose dolphin, who failed to respond to voriconazole and posaconazole therapy. As intravenous therapy was precluded,

  20. Cultural transmission of tool use combined with habitat specializations leads to fine-scale genetic structure in bottlenose dolphins

    NARCIS (Netherlands)

    Kopps, Anna M.; Ackermann, Corinne Y.; Sherwin, William B.; Allen, Simon J.; Bejder, Lars; Kruetzen, Michael


    Socially learned behaviours leading to genetic population structure have rarely been described outside humans. Here, we provide evidence of fine-scale genetic structure that has probably arisen based on socially transmitted behaviours in bottlenose dolphins (Tursiops sp.) in western Shark Bay,

  1. Fractal scaling in bottlenose dolphin (Tursiops truncatus) echolocation: A case study (United States)

    Perisho, Shaun T.; Kelty-Stephen, Damian G.; Hajnal, Alen; Houser, Dorian; Kuczaj, Stan A., II


    Fractal scaling patterns, which entail a power-law relationship between magnitude of fluctuations in a variable and the scale at which the variable is measured, have been found in many aspects of human behavior. These findings have led to advances in behavioral models (e.g. providing empirical support for cascade-driven theories of cognition) and have had practical medical applications (e.g. providing new methods for early diagnosis of medical conditions). In the present paper, fractal analysis is used to investigate whether similar fractal scaling patterns exist in inter-click interval and peak-peak amplitude measurements of bottlenose dolphin click trains. Several echolocation recordings taken from two male bottlenose dolphins were analyzed using Detrended Fluctuation Analysis and Higuchi's (1988) method for determination of fractal dimension. Both animals were found to exhibit fractal scaling patterns near what is consistent with persistent long range correlations. These findings suggest that recent advances in human cognition and medicine may have important parallel applications to echolocation as well.

  2. Why are male social relationships complex in the Doubtful Sound bottlenose dolphin population?

    Directory of Open Access Journals (Sweden)

    David Lusseau

    Full Text Available BACKGROUND: Access to oestrus females tends to be the main driver of male sociality. This factor can lead to complex behavioural interactions between males and groups of males. Male bottlenose dolphins may form alliances to consort females and to compete with other males. In some populations these alliances may form temporary coalitions when competing for females. I examined the role of dyadic and group interactions in the association patterns of male bottlenose dolphins in Doubtful Sound, New Zealand. There is no apparent mating competition in this population and no consortship has been observed, yet agonistic interactions between males occur regularly. METHODOLOGY/PRINCIPAL FINDINGS: By comparing the network of male interactions in several social dimensions (affiliative, agonistic, and associative I show that while agonistic interactions relate to dyadic association patterns, affiliative interactions seem to relate to group association patterns. Some evidence suggests that groups of males also formed temporary coalitions during agonistic interactions. While different groups of males had similar relationships with non-oestrus females, the time they spent with oestrus females and mothers of newborns differed greatly. CONCLUSIONS/SIGNIFICANCE: After considering several hypotheses, I propose that the evolution of these complex relationships was driven by sexual competition probably to out-compete other males for female choice.

  3. Characterization of a parainfluenza virus isolated from a bottlenose dolphin (Tursiops truncatus). (United States)

    Nollens, Hendrik H; Wellehan, James F X; Saliki, Jeremiah T; Caseltine, Shannon L; Jensen, Eric D; Van Bonn, William; Venn-Watson, Stephanie


    A novel member of the parainfluenza virus family was identified in a bottlenose dolphin with respiratory disease. The case animal was a 19-year old male Atlantic bottlenose dolphin (Tursiops truncatus) that presented with signs of respiratory illness, including raspy, foul-odored breaths and cream-colored exudate from the blowhole. Focally extensive pyogranulomatous bronchointerstitial pneumonia with moderate numbers of intralesional yeast organisms was identified on histopathological examination. Other significant microscopic findings included multifocal erosive and ulcerative tracheitis and laryngitis consisting of active laryngeal lymphatic tissue and dilated glands with eosinophilic fluid. The cause of death was attributed to respiratory disease of unknown etiology. In addition to the postmortem isolation of Candida glabrata and mixed bacteria from lung tissue, a virus was isolated from two antemortem affected lung aspirates collected over a 2-month period and two postmortem samples (mediastinal lymph node and left lung tissue homogenate). The morphology of the virions on negative staining and transmission electron microscopy was consistent with that of paramyxoviruses. Two genomic fragments, comprising 532 and 419 nucleotides from the open reading frames that code for the viral polymerase and fusion protein, respectively, were amplified by polymerase chain reaction using degenerate primers. Phylogenetic analyses of the two viral RNA segments showed that the isolate comprised a novel virus strain, tentatively named T. truncatus parainfluenza virus type 1 (TtPIV-1). The virus is monophyletic with, but genetically distinct from, the various bovine parainfluenza virus type 3 strains.

  4. Could relatedness help explain why individuals lead in bottlenose dolphin groups? (United States)

    Lewis, Jennifer S; Wartzok, Douglas; Heithaus, Michael; Krützen, Michael


    In many species, particular individuals consistently lead group travel. While benefits to followers often are relatively obvious, including access to resources, benefits to leaders are often less obvious. This is especially true for species that feed on patchy mobile resources where all group members may locate prey simultaneously and food intake likely decreases with increasing group size. Leaders in highly complex habitats, however, could provide access to foraging resources for less informed relatives, thereby gaining indirect benefits by helping kin. Recently, leadership has been documented in a population of bottlenose dolphins (Tursiops truncatus) where direct benefits to leaders appear unlikely. To test whether leaders could benefit indirectly we examined relatedness between leader-follower pairs and compared these levels to pairs who associated but did not have leader-follower relationship (neither ever led the other). We found the average relatedness value for leader-follower pairs was greater than expected based on chance. The same was not found when examining non leader-follower pairs. Additionally, relatedness for leader-follower pairs was positively correlated with association index values, but no correlation was found for this measure in non leader-follower pairs. Interestingly, haplotypes were not frequently shared between leader-follower pairs (25%). Together, these results suggest that bottlenose dolphin leaders have the opportunity to gain indirect benefits by leading relatives. These findings provide a potential mechanism for the maintenance of leadership in a highly dynamic fission-fusion population with few obvious direct benefits to leaders.

  5. Could relatedness help explain why individuals lead in bottlenose dolphin groups?

    Directory of Open Access Journals (Sweden)

    Jennifer S Lewis

    Full Text Available In many species, particular individuals consistently lead group travel. While benefits to followers often are relatively obvious, including access to resources, benefits to leaders are often less obvious. This is especially true for species that feed on patchy mobile resources where all group members may locate prey simultaneously and food intake likely decreases with increasing group size. Leaders in highly complex habitats, however, could provide access to foraging resources for less informed relatives, thereby gaining indirect benefits by helping kin. Recently, leadership has been documented in a population of bottlenose dolphins (Tursiops truncatus where direct benefits to leaders appear unlikely. To test whether leaders could benefit indirectly we examined relatedness between leader-follower pairs and compared these levels to pairs who associated but did not have leader-follower relationship (neither ever led the other. We found the average relatedness value for leader-follower pairs was greater than expected based on chance. The same was not found when examining non leader-follower pairs. Additionally, relatedness for leader-follower pairs was positively correlated with association index values, but no correlation was found for this measure in non leader-follower pairs. Interestingly, haplotypes were not frequently shared between leader-follower pairs (25%. Together, these results suggest that bottlenose dolphin leaders have the opportunity to gain indirect benefits by leading relatives. These findings provide a potential mechanism for the maintenance of leadership in a highly dynamic fission-fusion population with few obvious direct benefits to leaders.

  6. Phenotypic variation in dorsal fin morphology of coastal bottlenose dolphins (Tursiops truncatus off Mexico

    Directory of Open Access Journals (Sweden)

    Eduardo Morteo


    Full Text Available Geographic variation in external morphology is thought to reflect an interplay between genotype and the environment. Morphological variation has been well-described for a number of cetacean species, including the bottlenose dolphin (Tursiops truncatus. In this study we analyzed dorsal fin morphometric variation in coastal bottlenose dolphins to search for geographic patterns at different spatial scales. A total of 533 dorsal fin images from 19 available photo-identification catalogs across the three Mexican oceanic regions (Pacific Ocean n = 6, Gulf of California n = 6 and, Gulf of Mexico n = 7 were used in the analysis. Eleven fin shape measurements were analyzed to evaluate fin polymorphism through multivariate tests. Principal Component Analysis on log-transformed standardized ratios explained 94% of the variance. Canonical Discriminant Function Analysis on factor scores showed separation among most study areas (p < 0.05 with exception of the Gulf of Mexico where a strong morphometric cline was found. Possible explanations for the observed differences are related to environmental, biological and evolutionary processes. Shape distinction between dorsal fins from the Pacific and those from the Gulf of California were consistent with previously reported differences in skull morphometrics and genetics. Although the functional advantages of dorsal fin shape remains to be assessed, it is not unlikely that over a wide range of environments, fin shape may represent a trade-off among thermoregulatory capacity, hydrodynamic performance and the swimming/hunting behavior of the species.

  7. Source parameters of echolocation clicks from wild bottlenose dolphins (Tursiops aduncus and Tursiops truncatus). (United States)

    Wahlberg, Magnus; Jensen, Frants H; Soto, Natacha Aguilar; Beedholm, Kristian; Bejder, Lars; Oliveira, Cláudia; Rasmussen, Marianne; Simon, Malene; Villadsgaard, Anne; Madsen, Peter T


    The Indian Ocean and Atlantic bottlenose dolphins (Tursiops aduncus and Tursiops truncatus) are among the best studied echolocating toothed whales. However, almost all echolocation studies on bottlenose dolphins have been made with captive animals, and the echolocation signals of free-ranging animals have not been quantified. Here, biosonar source parameters from wild T. aduncus and T. truncatus were measured with linear three- and four-hydrophone arrays in four geographic locations. The two species had similar source parameters, with source levels of 177-228 dB re 1 μPa peak to peak, click durations of 8-72 μs, centroid frequencies of 33-109 kHz and rms bandwidths between 23 and 54 kHz. T. aduncus clicks had a higher frequency emphasis than T. truncatus. The transmission directionality index was up to 3 dB higher for T. aduncus (29 dB) as compared to T. truncatus (26 dB). The high directionality of T. aduncus does not appear to be only a physical consequence of a higher frequency emphasis in clicks, but may also be caused by differences in the internal properties of the sound production system. © 2011 Acoustical Society of America

  8. Depth dependent variation of the echolocation pulse rate of bottlenose dolphins (Tursiops truncatus). (United States)

    Simard, Peter; Hibbard, Ashley L; McCallister, Kimberly A; Frankel, Adam S; Zeddies, David G; Sisson, Geoffrey M; Gowans, Shannon; Forys, Elizabeth A; Mann, David A


    Trained odontocetes appear to have good control over the timing (pulse rate) of their echolocation clicks; however, there is comparatively little information about how free-ranging odontocetes modify their echolocation in relation to their environment. This study investigates echolocation pulse rate in 14 groups of free-ranging bottlenose dolphins (Tursiops truncatus) at a variety of depths (2.4-30.1 m) in the Gulf of Mexico. Linear regression models indicated a significant decrease in mean pulse rate with mean water depth. Pulse rates for most groups were multi-modal. Distance to target estimates were as high as 91.8 m, assuming that echolocation was produced at a maximal rate for the target distance. A 5.29-ms processing lag time was necessary to explain the pulse rate modes observed. Although echolocation is likely reverberation limited, these results support the hypotheses that free-ranging bottlenose dolphins in this area are adapting their echolocation signals for a variety of target detection and ranging purposes, and that the target distance is a function of water depth.

  9. An Inventory of Peer-reviewed Articles on Killer Whales (Orcinus orca with a Comparison to Bottlenose Dolphins (Tursiops truncatus

    Directory of Open Access Journals (Sweden)

    Heather M. Hill


    Full Text Available The welfare of killer whales (Orcinus orca has received worldwide attention recently. The purpose of this study was to sample the peer-reviewed scientific research on killer whales with a complementary comparison to Atlantic bottlenose dolphins (Tursiops truncatus to ascertain the primary topics of research conducted with these two cetaceans. A second objective of the study was to assess the relationship between the research topic and the setting in which the research was conducted. From a database-driven search of peer-reviewed academic journal articles, 759 unique articles involving killer whales, 2,022 unique articles involving Atlantic bottlenose dolphins, and 38 additional articles that included both species were retained for analysis. Coders categorized each article by topic (Anthropogenic Response, Cognition, Distribution, Echolocation, Foraging/Predation, Health/Physiology, Interactions with Humans, Sociality, and Vocalization and research setting (Natural Habitat, Captivity, or Both. Most studies of killer whales involved animals in their natural habitat (90% and the majority of killer whale studies, regardless of setting, concentrated on health and physiology, such as contaminants and genetic variability (31%, foraging and predation behaviors (26%, and geographic distribution (20%. The majority of the studies (68% involving bottlenose dolphins were also conducted in their natural habitat, but there was significantly more research comparatively with captive animals and with greater diversity. The results suggested that research with killer whales has been dominated by a limited range of topics with relatively little research conducted on topics that directly address issues of welfare. Similar to killer whales, research with Atlantic bottlenose dolphins has been dominated by health and physiology (48.5% and distribution (17.6%. In contrast to killer whales, topics such as sociality (9.5% and cognition (5% were more prominent in research

  10. Evaluation of potential protective factors against metabolic syndrome in bottlenose dolphins:feeding and activity patterns of dolphins in Sarasota Bay, Florida (United States)

    Wells, Randall S.; McHugh, Katherine A.; Douglas, David C.; Shippee, Steve; McCabe, Elizabeth Berens; Barros, Nélio B.; Phillips, Goldie T.


    Free-ranging bottlenose dolphins (Tursiops truncatus) living in Sarasota Bay, Florida appear to have a lower risk of developing insulin resistance and metabolic syndrome compared to a group of dolphins managed under human care. Similar to humans, differences in diet and activity cycles between these groups may explain why Sarasota dolphins have lower insulin, glucose, and lipids. To identify potential protective factors against metabolic syndrome, existing and new data were incorporated to describe feeding and activity patterns of the Sarasota Bay wild dolphin community. Sarasota dolphins eat a wide variety of live fish and spend 10–20% of daylight hours foraging and feeding. Feeding occurs throughout the day, with the dolphins eating small proportions of their total daily intake in brief bouts. The natural pattern of wild dolphins is to feed as necessary and possible at any time of the day or night. Wild dolphins rarely eat dead fish or consume large amounts of prey in concentrated time periods. Wild dolphins are active throughout the day and night; they may engage in bouts of each key activity category at any time during daytime. Dive patterns of radio-tagged dolphins varied only slightly with time of day. Travel rates may be slightly lower at night, suggesting a diurnal rhythm, albeit not one involving complete, extended rest. In comparison, the managed dolphins are older; often fed a smaller variety of frozen-thawed fish types; fed fish species not in their natural diet; feedings and engaged activities are often during the day; and they are fed larger but fewer meals. In summary, potential protective factors against metabolic syndrome in dolphins may include young age, activity, and small meals fed throughout the day and night, and specific fish nutrients. These protective factors against insulin resistance and type 2 diabetes are similar to those reported in humans. Further studies may benefit humans and dolphins.

  11. How does Australia's largest dolphin-watching industry affect the behaviour of a small and resident population of Indo-Pacific bottlenose dolphins? (United States)

    Steckenreuter, Andre; Möller, Luciana; Harcourt, Robert


    The small, genetically distinct population of Indo-Pacific bottlenose dolphins (Tursiops aduncus) in Port Stephens, New South Wales (NSW), is the target of the largest dolphin-watching industry in Australia and is located within the Port Stephens - Great Lakes Marine Park that was created in 2005. The effects of this industry have been identified as of significant management importance by the Marine Parks Authority NSW. Accordingly, the impact of commercial dolphin-watching boats was investigated from boat-based surveys from August 2008 to August 2009. Presence of dolphin-watching boats altered both the dolphins' behavioural states and activity budgets. Dolphins spent 66.5% less time feeding and 44.2% less time socialising, spent four times more milling, and were never observed to rest in the presence of dolphin-watching boats. Moreover, dolphin groups were more cohesive during dolphin-watching boat encounters and dolphins tended to avoid tour boats. These effects were exacerbated as the number of boats increased and the distance from boats decreased. The rate of approach was high with boats approaching each dolphin group three times per day in winter and six times in summer. Moreover, groups of dolphins with newborns were approached closer than state regulated minimum approach distances in nine out of ten encounters. Globally, dolphin-watching industries frequent small resident groups of coastal dolphins and effects are likely to be similar. We suggest that existing controls are inadequate and that these together with additional regulations be enforced by a regular presence of authorities. We suggest no more than one dolphin-watching boat within 50 m of a group of dolphins, or 100 m if calves are present. Operating times of dolphin-watching boats should be restricted in numbers after 1 pm, i.e., during preferred foraging times for dolphins. Additionally, exclusion zones should be considered to reduce pressure on dolphins undertaking critical activities such as

  12. Echolocation parameters of Australian humpback dolphins (Sousa sahulensis) and Indo-Pacific bottlenose dolphins (Tursiops aduncus) in the wild. (United States)

    de Freitas, Mafalda; Jensen, Frants H; Tyne, Julian; Bejder, Lars; Madsen, Peter T


    Echolocation is a key sensory modality for toothed whale orientation, navigation, and foraging. However, a more comparative understanding of the biosonar properties of toothed whales is necessary to understand behavioral and evolutionary adaptions. To address this, two free-ranging sympatric delphinid species, Australian humpback dolphins (Sousa sahulensis) and Indo-Pacific bottlenose dolphins (Tursiops aduncus), were studied. Biosonar clicks from both species were recorded within the same stretch of coastal habitat in Exmouth Gulf, Western Australia, using a vertical seven element hydrophone array. S. sahulensis used biosonar clicks with a mean source level of 199 ± 3 dB re 1 μPa peak-peak (pp), mean centroid frequency of 106 ± 11 kHz, and emitted at interclick intervals (ICIs) of 79 ± 33 ms. These parameters were similar to click parameters of sympatric T. aduncus, characterized by mean source levels of 204 ± 4 dB re 1 μPa pp, centroid frequency of 112 ± 9 kHz, and ICIs of 73 ± 29 ms. These properties are comparable to those of other similar sized delphinids and suggest that biosonar parameters are independent of sympatric delphinids and possibly driven by body size. The dynamic biosonar behavior of these delphinids may have, consequently, allowed for adaptations to local environments through high levels of control over sonar beam properties.

  13. Skin lesions on common bottlenose dolphins (Tursiops truncatus from three sites in the Northwest Atlantic, USA.

    Directory of Open Access Journals (Sweden)

    Leslie Burdett Hart

    Full Text Available Skin disease occurs frequently in many cetacean species across the globe; methods to categorize lesions have relied on photo-identification (photo-id, stranding, and by-catch data. The current study used photo-id data from four sampling months during 2009 to estimate skin lesion prevalence and type occurring on bottlenose dolphins (Tursiops truncatus from three sites along the southeast United States coast [Sarasota Bay, FL (SSB; near Brunswick and Sapelo Island, GA (BSG; and near Charleston, SC (CHS]. The prevalence of lesions was highest among BSG dolphins (P = 0.587 and lowest in SSB (P = 0.380, and the overall prevalence was significantly different among all sites (p<0.0167. Logistic regression modeling revealed a significant reduction in the odds of lesion occurrence for increasing water temperatures (OR = 0.92; 95%CI:0.906-0.938 and a significantly increased odds of lesion occurrence for BSG dolphins (OR = 1.39; 95%CI:1.203-1.614. Approximately one-third of the lesioned dolphins from each site presented with multiple types, and population differences in lesion type occurrence were observed (p<0.05. Lesions on stranded dolphins were sampled to determine the etiology of different lesion types, which included three visually distinct samples positive for herpesvirus. Although generally considered non-fatal, skin disease may be indicative of animal health or exposure to anthropogenic or environmental threats, and photo-id data provide an efficient and cost-effective approach to document the occurrence of skin lesions in free-ranging populations.

  14. Novel adenovirus detected in captive bottlenose dolphins (Tursiops truncatus) suffering from self-limiting gastroenteritis. (United States)

    Rubio-Guerri, Consuelo; García-Párraga, Daniel; Nieto-Pelegrín, Elvira; Melero, Mar; Álvaro, Teresa; Valls, Mónica; Crespo, Jose Luis; Sánchez-Vizcaíno, Jose Manuel


    Adenoviruses are common pathogens in vertebrates, including humans. In marine mammals, adenovirus has been associated with fatal hepatitis in sea lions. However, only in rare cases have adenoviruses been detected in cetaceans, where no clear correlation was found between presence of the virus and disease status. A novel adenovirus was identified in four captive bottlenose dolphins with self-limiting gastroenteritis. Viral detection and identification were achieved by: PCR-amplification from fecal samples; sequencing of partial adenovirus polymerase (pol) and hexon genes; producing the virus in HeLa cells, with PCR and immunofluorescence detection, and with sequencing of the amplified pol and hexon gene fragments. A causative role of this adenovirus for gastroenteritis was suggested by: 1) we failed to identify other potential etiological agents; 2) the exclusive detection of this novel adenovirus and of seropositivity for canine adenoviruses 1 and 2 in the four sick dolphins, but not in 10 healthy individuals of the same captive population; and 3) the virus disappeared from feces after clinical signs receded. The partial sequences of the amplified fragments of the pol and hexon genes were closest to those of adenoviruses identified in sea lions with fatal adenoviral hepatitis, and to a Genbank-deposited sequence obtained from a harbour porpoise. These data suggest that adenovirus can cause self-limiting gastroenteritis in dolphins. This adenoviral infection can be detected by serology and by PCR detection in fecal material. Lack of signs of hepatitis in sick dolphins may reflect restricted tissue tropism or virulence of this adenovirus compared to those of the adenovirus identified in sea lions. Gene sequence-based phylogenetic analysis supports a common origin of adenoviruses that affect sea mammals. Our findings suggest the need for vigilance against adenoviruses in captive and wild dolphin populations.

  15. Communication in bottlenose dolphins: 50 years of signature whistle research. (United States)

    Janik, Vincent M; Sayigh, Laela S


    Bottlenose dolphins (Tursiops truncatus) produce individually distinctive signature whistles that broadcast the identity of the caller. Unlike voice cues that affect all calls of an animal, signature whistles are distinct whistle types carrying identity information in their frequency modulation pattern. Signature whistle development is influenced by vocal production learning. Animals use a whistle from their environment as a model, but modify it, and thus invent a novel signal. Dolphins also copy signature whistles of others, effectively addressing the whistle owner. This copying occurs at low rates and the resulting copies are recognizable as such by parameter variations in the copy. Captive dolphins can learn to associate novel whistles with objects and use these whistles to report on the presence or absence of the object. If applied to signature whistles, this ability would make the signature whistle a rare example of a learned referential signal in animals. Here, we review the history of signature whistle research, covering definitions, acoustic features, information content, contextual use, developmental aspects, and species comparisons with mammals and birds. We show how these signals stand out amongst recognition calls in animals and how they contribute to our understanding of complexity in animal communication.

  16. The structure of a bottlenose dolphin society is coupled to a unique foraging cooperation with artisanal fishermen. (United States)

    Daura-Jorge, F G; Cantor, M; Ingram, S N; Lusseau, D; Simões-Lopes, P C


    Diverse and localized foraging behaviours have been reported in isolated populations of many animal species around the world. In Laguna, southern Brazil, a subset of resident bottlenose dolphins (Tursiops truncatus) uses a foraging tactic involving cooperative interactions with local, beach-casting fishermen. We used individual photo-identification data to assess whether cooperative and non-cooperative dolphins were socially segregated. The social structure of the population was found to be a fission-fusion system with few non-random associations, typical for this species. However, association values were greater among cooperative dolphins than among non-cooperative dolphins or between dolphins from different foraging classes. Furthermore, the dolphin social network was divided into three modules, clustering individuals that shared or lacked the cooperative foraging tactic. Space-use patterns were not sufficient to explain this partitioning, indicating a behavioural factor. The segregation of dolphins using different foraging tactics could result from foraging behaviour driving social structure, while the closer association between dolphins engaged in the cooperation could facilitate the transmission and learning of this behavioural trait from conspecifics. This unique case of a dolphin-human interaction represents a valuable opportunity to explore hypotheses on the role of social learning in wild cetaceans.

  17. Effects of oral megestrol acetate administration on the hypothalamic-pituitary-adrenal axis of male bottlenose dolphins (Tursiops truncatus). (United States)

    Houser, Dorian S; Champagne, Cory D; Jensen, Eric D; Smith, Cynthia R; Cotte, Lara S; Meegan, Jenny M; Booth, Rebecca K; Wasser, Samuel K


    OBJECTIVE To evaluate the impact of oral megestrol acetate (MA) administration on adrenal function in male bottlenose dolphins (Tursiops truncatus). DESIGN Serial cross-sectional study. ANIMALS 8 adult male dolphins, all of which were receiving MA at various daily doses (range, 0 to 60 mg, PO) for the control of reproductive behavior. PROCEDURES Blood samples were collected every 2 weeks for 1 year from dolphins trained to voluntarily provide them. Cortisol, ACTH, and other hormone concentrations were measured in serum or plasma via radioimmunoassay or ELISA. Fecal samples, also provided by dolphins voluntarily, were assayed for glucocorticoid metabolite concentrations. Effects of daily MA dose on hormone concentrations were evaluated. RESULTS Daily MA doses as low as 10 mg strongly suppressed cortisol secretion in nearly all dolphins, and except for a single measurement, no dolphin had measurable serum concentrations at doses ≥ 20 mg. Variations in serum cortisol concentration were unrelated to season but were directly related to ACTH concentrations, suggesting primary effects upstream of the adrenal gland. Cessation of MA administration resulted in almost immediate restoration of measurable serum cortisol concentrations, although concentrations continued to rise in a few dolphins over the following weeks to months. CONCLUSIONS AND CLINICAL RELEVANCE Caution should be exercised when administering MA to control reproductive behavior in male dolphins. Because the hypothalamic-pituitary-adrenal axis appeared to be sensitive to even small doses of MA in dolphins, duration of treatment may be the most critical consideration.

  18. Phenotyping and comparing the immune cell populations of free-ranging Atlantic bottlenose dolphins (Tursiops truncatus) and dolphins under human care. (United States)

    Nouri-Shirazi, Mahyar; Bible, Brittany F; Zeng, Menghua; Tamjidi, Saba; Bossart, Gregory D


    Studies suggest that free-ranging bottlenose dolphins exhibit a suppressed immune system because of exposure to contaminants or microorganisms. However, due to a lack of commercially available antibodies specific to marine mammal immune cell surface markers, the research has been indecisive. The purpose of this study was to identify cross-reactive terrestrial-specific antibodies in order to assess the changes in the immune cell populations of dolphins under human care and free-ranging dolphins. The blood and PBMC fraction of blood samples from human care and free-ranging dolphins were characterized by H&E staining of cytospin slides and flow cytometry using a panel of terrestrial-specific antibodies. In this study, we show that out of 65 terrestrial-specific antibodies tested, 11 were cross-reactive and identified dolphin immune cell populations within their peripheral blood. Using these antibodies, we found significant differences in the absolute number of cells expressing specific markers within their lymphocyte and monocyte fractions. Interestingly, the peripheral blood mononuclear cell profile of free-ranging dolphins retained an additional population of cells that divided them into two groups showing a low (56%) percentage of smaller cells resembling granulocytes. We found that the cross-reactive antibodies not only identified specific changes in the immune cells of free-ranging dolphins, but also opened the possibility to investigate the causal relationship between immunosuppression and mortality seen in free-ranging dolphins.

  19. Health and Environmental Risk Assessment Project for bottlenose dolphins Tursiops truncatus from the southeastern USA. I. Infectious diseases. (United States)

    Bossart, Gregory D; Fair, Patricia; Schaefer, Adam M; Reif, John S


    From 2003 to 2015, 360 free-ranging Atlantic bottlenose dolphins Tursiops truncatus inhabiting the Indian River Lagoon (IRL, n = 246), Florida, and coastal waters of Charleston (CHS, n = 114), South Carolina, USA, were captured, given comprehensive health examinations, and released as part of a multidisciplinary and multi-institutional study of individual and population health. The aim of this review is to summarize the substantial health data generated by this study and to examine morbidity between capture sites and over time. The IRL and CHS dolphin populations are affected by complex infectious and neoplastic diseases often associated with immunologic disturbances. We found evidence of infection with cetacean morbillivirus, dolphin papilloma and herpes viruses, Chlamydiaceae, a novel uncultivated strain of Paracoccidioides brasiliensis (recently identified as the causal agent of dolphin lobomycosis/lacaziasis), and other pathogens. This is the first long-term study documenting the various types, progression, seroprevalence, and pathologic interrelationships of infectious diseases in dolphins from the southeastern USA. Additionally, the study has demonstrated that the bottlenose dolphin is a valuable sentinel animal that may reflect environmental health concerns and parallel emerging public health issues.

  20. Passive acoustic monitoring of bottlenose dolphin and harbour porpoise, in Cardigan Bay, Wales, with implications for habitat use and partitioning

    DEFF Research Database (Denmark)

    Simon, Malene Juul; Nuuttila, Hanna; Reyes-Zamudio, Mercedes M


    Knowledge about harbour porpoise and bottlenose dolphin occurrence in Cardigan Bay Special Area of Conservation (SAC), Wales, is limited to daylight hours during summer, when conditions are suitable for traditional visual surveys. T-PODs are autonomous instruments programmed to log time-cues of s......Knowledge about harbour porpoise and bottlenose dolphin occurrence in Cardigan Bay Special Area of Conservation (SAC), Wales, is limited to daylight hours during summer, when conditions are suitable for traditional visual surveys. T-PODs are autonomous instruments programmed to log time......-cues of species-specific echolocation signals for long periods of time. Here we investigated bottlenose dolphin and harbour porpoise habitat use and partitioning by deploying ten calibrated T-PODs in Cardigan Bay SAC for one year. The T-PODs detected both species all year round with a peak of detections in April......-October for dolphins and in October-March for porpoise, revealing a previously unknown importance of the place to harbour porpoise during winter. Though the two species are sympatric, simultaneous detections of both species were rare and indication of temporal habitat partitioning between the two species in some parts...

  1. The metabolic cost of communicative sound production in bottlenose dolphins (Tursiops truncatus). (United States)

    Noren, Dawn P; Holt, Marla M; Dunkin, Robin C; Williams, Terrie M


    Bottlenose dolphins (Tursiops truncatus) produce various communicative sounds that are important for social behavior, maintaining group cohesion and coordinating foraging. For example, whistle production increases during disturbances, such as separations of mother-calf pairs and vessel approaches. It is clear that acoustic communication is important to the survival of these marine mammals, yet the metabolic cost of producing whistles and other socials sounds and the energetic consequences of modifying these sounds in response to both natural and anthropogenic disturbance are unknown. We used flow-through respirometry to determine whether the metabolic cost of sound production could be quantified in two captive dolphins producing social sounds (whistles and squawks). On average, we found that metabolic rates measured during 2 min periods of sound production were 1.2 times resting values. Up to 7 min were required for metabolism to return to resting values following vocal periods. The total metabolic cost (over resting values) of the 2 min vocal period plus the required recovery period (163.3 to 2995.9 ml O2 or 3279.6 to 60,166.7 J) varied by individual as well as by mean duration of sounds produced within the vocal period. Observed variation in received cumulative sound energy levels of vocalizations was not related to total metabolic costs. Furthermore, our empirical findings did not agree with previous theoretical estimates of the metabolic cost of whistles. This study provides the first empirical data on the metabolic cost of sound production in dolphins, which can be used to estimate metabolic costs of vocal responses to environmental perturbations in wild dolphins.

  2. Epidemiological investigation of tattoo-like skin lesions among bottlenose dolphins in Shark Bay, Australia. (United States)

    Powell, Sarah N; Wallen, Megan M; Bansal, Shweta; Mann, Janet


    Bottlenose dolphins are excellent bioindicators of ocean ecosystem health for three reasons: (a) as long-lived apex predators they accumulate biotoxins and contaminants; (b) they are visible, routinely appearing at the water's surface in coastal areas, often coming into close contact with humans; and, (c) they exhibit a range of pathogenic lesions attributable to environmental degradation. In this study, we analyzed tattoo-like skin lesions in a population of Tursiops aduncus studied for 30+years in Shark Bay, Australia, a UNESCO World Heritage Site. We provide important baseline data by documenting epidemiological patterns of tattoo-like skin lesions in a healthy, free-ranging population that builds on the previous data of tattoo skin disease (TSD) derived from free ranging, stranded, and dead dolphins. Individual dolphins were classified as symptomatic with tattoo-like skin disease if at least one photograph showed a lesion similar to TSD. The average age of infection was 26.6months (±34.8months) with the symptomatic period lasting 137±29.8days. Overall prevalence of tattoo-like skin disease in the population was 19.4%. Age, but not sex, was significant, with yearlings (1-2years) exhibiting tattoo-like lesions more than younger and older calves. Tattoo-like lesions were rare among juvenile and adult dolphins (N=68 calves, 4 juveniles, and 3 adults). We hypothesize that the lower prevalence in youngest calves (2years) have infection-acquired immunity, as reported for other small cetaceans. The low prevalence of tattoo-like lesions in Shark Bay compared to other populations with poxvirus is consistent with reproductive and demographic viability analyses. Furthermore, by documenting the demography of the disease, we can monitor changes in the prevalence of tattoo-like lesions as a sentinel indicator of ecosystem health. Copyright © 2018 Elsevier B.V. All rights reserved.

  3. The locus coeruleus complex of the bottlenose dolphin (Tursiops truncatus) as revealed by tyrosine hydroxylase immunohistochemistry. (United States)

    Manger, Paul R; Ridgway, Sam H; Siegel, Jerome M


    Using tyrosine hydroxylase immunohistochemistry we examined the structure of the pontine, or rostral rhombencephalic, catecholaminergic cells groups, which may be collectively termed the locus coeruleus complex (LC), in the bottlenose dolphin. The present study is the first to describe the LC in a cetacean species and, at 1.3 kg, represents the largest non-human brain to date in which the LC has been investigated. We identified four catecholaminergic cell groups in the dorsal pontine tegementum and peri-aqueductal gray matter: A6 dorsal (locus coeruleus), A6 ventral (locus coeruleus alpha), A7 (subcoeruleus), and A5 (fifth arcuate nucleus). No patterns of cellular distribution, nuclear subdivision, or cellular morphology indicate specialization of the LC, which might have been anticipated because of the large absolute brain size and unihemispheric sleep phenomenology of cetaceans.

  4. Auditory masking patterns in bottlenose dolphins (Tursiops truncatus) with natural, anthropogenic, and synthesized noise. (United States)

    Branstetter, Brian K; Trickey, Jennifer S; Bakhtiari, Kimberly; Black, Amy; Aihara, Hitomi; Finneran, James J


    Auditory masking occurs when one sound (usually called noise) interferes with the detection, discrimination, or recognition of another sound (usually called the signal). This interference can lead to detriments in a listener's ability to communicate, forage, and navigate. Most studies of auditory masking in marine mammals have been limited to detection thresholds of pure tones in Gaussian noise. Environmental noise marine mammals encounter is often more complex. In the current study, detection thresholds were estimated for bottlenose dolphins with a 10 kHz signal masked by natural, anthropogenic, and synthesized noise. Using a band-widening paradigm, detection thresholds exhibited a pattern where signal thresholds increased proportionally to bandwidth for narrow band noise. However, when noise bandwidth was greater than a critical band, masking patterns diverged. Subsequent experiments demonstrated that the auditory mechanisms responsible for the divergent masking patterns were related to across-channel comparison and within-valley listening.

  5. Laryngeal snaring by ingested fishing net in a common bottlenose dolphin (Tursiops truncatus) off the Israeli shoreline. (United States)

    Levy, Alon M; Brenner, Ori; Scheinin, Aviad; Morick, Dan; Ratner, Eliana; Goffman, Oz; Kerem, Dan


    We report an unusual snaring of the larynx in an adult, female common bottlenose dolphin (Tursiops truncatus). The dolphin was observed swimming and diving in Haifa Port, Israel, but was found dead the next day, 60 km south, on the coast. Postmortem examination revealed stranded-cordage, nylon filaments wrapped around the larynx, cutting through the soft tissue, and extending down into the forestomach, where a large mass of netting was found. The cachectic state of the dolphin and the subacute to chronic, hyper-plastic response of soft tissue surrounding the filaments lodged around the larynx, suggest a prolonged period of starvation, which led to the final weakness and wasting of the dolphin.

  6. A Quantitative Analysis of Pulsed Signals Emitted by Wild Bottlenose Dolphins. (United States)

    Luís, Ana Rita; Couchinho, Miguel N; Dos Santos, Manuel E


    Common bottlenose dolphins (Tursiops truncatus), produce a wide variety of vocal emissions for communication and echolocation, of which the pulsed repertoire has been the most difficult to categorize. Packets of high repetition, broadband pulses are still largely reported under a general designation of burst-pulses, and traditional attempts to classify these emissions rely mainly in their aural characteristics and in graphical aspects of spectrograms. Here, we present a quantitative analysis of pulsed signals emitted by wild bottlenose dolphins, in the Sado estuary, Portugal (2011-2014), and test the reliability of a traditional classification approach. Acoustic parameters (minimum frequency, maximum frequency, peak frequency, duration, repetition rate and inter-click-interval) were extracted from 930 pulsed signals, previously categorized using a traditional approach. Discriminant function analysis revealed a high reliability of the traditional classification approach (93.5% of pulsed signals were consistently assigned to their aurally based categories). According to the discriminant function analysis (Wilk's Λ = 0.11, F3, 2.41 = 282.75, P < 0.001), repetition rate is the feature that best enables the discrimination of different pulsed signals (structure coefficient = 0.98). Classification using hierarchical cluster analysis led to a similar categorization pattern: two main signal types with distinct magnitudes of repetition rate were clustered into five groups. The pulsed signals, here described, present significant differences in their time-frequency features, especially repetition rate (P < 0.001), inter-click-interval (P < 0.001) and duration (P < 0.001). We document the occurrence of a distinct signal type-short burst-pulses, and highlight the existence of a diverse repertoire of pulsed vocalizations emitted in graded sequences. The use of quantitative analysis of pulsed signals is essential to improve classifications and to better assess the contexts of

  7. A Quantitative Analysis of Pulsed Signals Emitted by Wild Bottlenose Dolphins.

    Directory of Open Access Journals (Sweden)

    Ana Rita Luís

    Full Text Available Common bottlenose dolphins (Tursiops truncatus, produce a wide variety of vocal emissions for communication and echolocation, of which the pulsed repertoire has been the most difficult to categorize. Packets of high repetition, broadband pulses are still largely reported under a general designation of burst-pulses, and traditional attempts to classify these emissions rely mainly in their aural characteristics and in graphical aspects of spectrograms. Here, we present a quantitative analysis of pulsed signals emitted by wild bottlenose dolphins, in the Sado estuary, Portugal (2011-2014, and test the reliability of a traditional classification approach. Acoustic parameters (minimum frequency, maximum frequency, peak frequency, duration, repetition rate and inter-click-interval were extracted from 930 pulsed signals, previously categorized using a traditional approach. Discriminant function analysis revealed a high reliability of the traditional classification approach (93.5% of pulsed signals were consistently assigned to their aurally based categories. According to the discriminant function analysis (Wilk's Λ = 0.11, F3, 2.41 = 282.75, P < 0.001, repetition rate is the feature that best enables the discrimination of different pulsed signals (structure coefficient = 0.98. Classification using hierarchical cluster analysis led to a similar categorization pattern: two main signal types with distinct magnitudes of repetition rate were clustered into five groups. The pulsed signals, here described, present significant differences in their time-frequency features, especially repetition rate (P < 0.001, inter-click-interval (P < 0.001 and duration (P < 0.001. We document the occurrence of a distinct signal type-short burst-pulses, and highlight the existence of a diverse repertoire of pulsed vocalizations emitted in graded sequences. The use of quantitative analysis of pulsed signals is essential to improve classifications and to better assess the

  8. Acoustic behavior associated with cooperative task success in bottlenose dolphins (Tursiops truncatus). (United States)

    Eskelinen, Holli C; Winship, Kelley A; Jones, Brittany L; Ames, Audra E M; Kuczaj, Stan A


    Although many species have proven capable of cooperating to achieve common goals, the role of communication in cooperation has received relatively little attention. Analysis of communication between partners is vital in determining whether actions are truly cooperative rather than serendipitous or learned via trial and error (Chalmeau and Gallo in Behav Process 35:101-111, 1996a. doi: 10.1016/0376-6357(95)00049-6 , Primates 37:39-47, 1996b. doi: 10.1007/BF02382918 ). Wild cetaceans often produce sounds during cooperative foraging, playing, and mating, but the role of these sounds in cooperative events is largely unknown. Here, we investigated acoustic communication between two male bottlenose dolphins while they cooperatively opened a container (Kuczaj et al. in Anim Cogn 18:543-550, 2015b. doi: 10.1007/s10071-014-0822-4 ). Analyses of whistles, burst pulses, and bi-phonations that occurred during four contexts (i.e., no container, no animals interacting with container, one animal interacting with container, and two animals interacting with container) revealed that overall sound production rate significantly increased during container interactions. Sound production rates were also significantly higher during cooperative successes than solo successes, suggesting that the coordination of efforts rather than the apparatus itself was responsible for the phonation increase. The most common sound type during cooperative successes was burst pulse signals, similar to past recordings of cooperative events in bottlenose dolphins (Bastian in Animal sonar systems. Laboratoire de Physiologie Acoustique, Jouy-en Josas, pp 803-873, 1967; Connor and Smolker 1996).

  9. Whistle emissions of Indo-Pacific bottlenose dolphins (Tursiops aduncus) differ with group composition and surface behaviors. (United States)

    Hawkins, Elizabeth R; Gartside, Donald F


    The intricate and highly developed acoustic communication system of bottlenose dolphins reflects the complexities of their social organization. Indo-Pacific bottlenose dolphins (Tursiops aduncus) produce numerous types of acoustic emissions, including a diverse repertoire of whistles used for communicative purposes. The influence of group composition on whistle production and the function of different whistles produced by dolphins in wild contexts are relatively unknown. Recordings of acoustic emissions and behavior of dolphins were made concurrently during vessel-based surveys along the coast of northern New South Wales, Australia. Whistles were divided into five tonal classes (sine, rise, down-sweep, flat, and concave) and categorized into distinct whistle types. It is shown that while whistle repetition rate and whistle diversity was influenced by group composition, it is not influenced by behavior. Noncalf groups produced a significantly higher whistle repetition rate and whistle diversity than calf groups. In contrast, the types of whistles produced were related to the behavior in which the dolphins were engaged in: some tonal classes and distinct whistle types were related to different behavior states. Findings suggested that some whistle types may be used to communicate specific information on the behavioral context of the individuals involved.

  10. Feeding ecology of the Indo-Pacific bottlenose dolphin ( Tursiops aduncus) incidentally caught in the gillnet fisheries off Zanzibar, Tanzania (United States)

    Amir, Omar A.; Berggren, Per; Ndaro, Simon G. M.; Jiddawi, Narriman S.


    The stomach contents of 26 Indo-Pacific bottlenose dolphins ( Tursiops aduncus) incidentally caught in gillnet fisheries around Unguja Island (Zanzibar) between February 2000 and August 2002 were examined. The relative importance of each prey species was assessed through indices of relative importance. In total, 1403 prey items comprising 50 species of bony fish and three species of squid were identified from food remains. Five species of fish, Uroconger lepturus, Synaphobranchus kaupii, Apogon apogonides, Lethrinus crocineus, Lutjanus fulvus, and three species of squid, Sepioteuthis lessoniana, Sepia latimanus and Loligo duvauceli, were the most important prey species. Based on an index that included frequency of occurrence, percentage by number and by weight, Uroconger lepturus proved to be the most important prey species of mature dolphins whereas Apogon apogonides was the preferred prey of immature dolphins. These results indicate that Indo-Pacific bottlenose dolphins off the coast of Zanzibar forage on a relatively large number of prey species, but that only a few small- and medium-sized neritic fish and cephalopods contribute substantially to the diet. Further, the ecology and behavior of the preferred fish prey species indicate that the dolphins forage over reef or soft bottom substrata and near the shore.

  11. Fine-scale spatial variation of persistent organic pollutants in bottlenose dolphins (Tursiops truncatus) in Biscayne Bay, Florida. (United States)

    Litz, Jenny A; Garrison, Lance P; Fieber, Lynne A; Martinez, Anthony; Contillo, Joseph P; Kucklick, John R


    Bottlenose dolphins (Tursiops truncatus) are long-term residents and apex predators in southeast U.S. estuaries and are vulnerable to bioaccumulation of persistent organic pollutants (POPs). Dart biopsy samples were collected from 45 dolphins in Biscayne Bay (Miami, FL), 34 of which were matched using fin markings to a photo identification catalogue. Blubber samples were analyzed for 73 polychlorinated biphenyl (PCB) congeners, six polybrominated diphenyl ether (PBDE) congeners, and organochlorine pesticides including dichloro-diphenyl-trichloroethane (DDT) and metabolites, chlordanes, and dieldrin. Total PCBs (sigma 73PCBs) were present in the highest concentrations and were 5 times higher in males with sighting histories in the northern, metropolitan area of Biscayne Bay than males with sighting histories in the southern, more rural area [geometric mean: 43.3 (95% confidence interval: 28.0-66.9) vs 8.6 (6.3-11.9) microg/g wet mass, respectively]. All compound classes had higher concentrations in northern animals than southern. The differences in POP concentrations found on this small geographic scale demonstrate that differential habitat use can strongly influence pollutant concentrations and should be considered when interpreting bottlenose dolphin POP data. The PCB concentrations in northern Bay dolphins are high as compared to other studies of estuarine dolphins and may place these animals at risk of reproductive failure and decreased immune function.

  12. Monitoring Dolphins in an Urban Marine System: Total and Effective Population Size Estimates of Indo-Pacific Bottlenose Dolphins in Moreton Bay, Australia (United States)

    Ansmann, Ina C.; Lanyon, Janet M.; Seddon, Jennifer M.; Parra, Guido J.


    Moreton Bay, Queensland, Australia is an area of high biodiversity and conservation value and home to two sympatric sub-populations of Indo-Pacific bottlenose dolphins (Tursiops aduncus). These dolphins live in close proximity to major urban developments. Successful management requires information regarding their abundance. Here, we estimate total and effective population sizes of bottlenose dolphins in Moreton Bay using photo-identification and genetic data collected during boat-based surveys in 2008–2010. Abundance (N) was estimated using open population mark-recapture models based on sighting histories of distinctive individuals. Effective population size (Ne) was estimated using the linkage disequilibrium method based on nuclear genetic data at 20 microsatellite markers in skin samples, and corrected for bias caused by overlapping generations (Nec). A total of 174 sightings of dolphin groups were recorded and 365 different individuals identified. Over the whole of Moreton Bay, a population size N of 554±22.2 (SE) (95% CI: 510–598) was estimated. The southern bay sub-population was small at an estimated N = 193±6.4 (SE) (95% CI: 181–207), while the North sub-population was more numerous, with 446±56 (SE) (95% CI: 336–556) individuals. The small estimated effective population size of the southern sub-population (Nec = 56, 95% CI: 33–128) raises conservation concerns. A power analysis suggested that to reliably detect small (5%) declines in size of this population would require substantial survey effort (>4 years of annual mark-recapture surveys) at the precision levels achieved here. To ensure that ecological as well as genetic diversity within this population of bottlenose dolphins is preserved, we consider that North and South sub-populations should be treated as separate management units. Systematic surveys over smaller areas holding locally-adapted sub-populations are suggested as an alternative method for increasing ability to detect

  13. Monitoring dolphins in an urban marine system: total and effective population size estimates of Indo-Pacific bottlenose dolphins in Moreton Bay, Australia. (United States)

    Ansmann, Ina C; Lanyon, Janet M; Seddon, Jennifer M; Parra, Guido J


    Moreton Bay, Queensland, Australia is an area of high biodiversity and conservation value and home to two sympatric sub-populations of Indo-Pacific bottlenose dolphins (Tursiops aduncus). These dolphins live in close proximity to major urban developments. Successful management requires information regarding their abundance. Here, we estimate total and effective population sizes of bottlenose dolphins in Moreton Bay using photo-identification and genetic data collected during boat-based surveys in 2008-2010. Abundance (N) was estimated using open population mark-recapture models based on sighting histories of distinctive individuals. Effective population size (Ne ) was estimated using the linkage disequilibrium method based on nuclear genetic data at 20 microsatellite markers in skin samples, and corrected for bias caused by overlapping generations (Ne c). A total of 174 sightings of dolphin groups were recorded and 365 different individuals identified. Over the whole of Moreton Bay, a population size N of 554 ± 22.2 (SE) (95% CI: 510-598) was estimated. The southern bay sub-population was small at an estimated N = 193 ± 6.4 (SE) (95% CI: 181-207), while the North sub-population was more numerous, with 446 ± 56 (SE) (95% CI: 336-556) individuals. The small estimated effective population size of the southern sub-population (Ne c = 56, 95% CI: 33-128) raises conservation concerns. A power analysis suggested that to reliably detect small (5%) declines in size of this population would require substantial survey effort (>4 years of annual mark-recapture surveys) at the precision levels achieved here. To ensure that ecological as well as genetic diversity within this population of bottlenose dolphins is preserved, we consider that North and South sub-populations should be treated as separate management units. Systematic surveys over smaller areas holding locally-adapted sub-populations are suggested as an alternative method for increasing ability to detect abundance

  14. A new level of complexity in the male alliance networks of Indian Ocean bottlenose dolphins (Tursiops sp.). (United States)

    Connor, Richard C; Watson-Capps, Jana J; Sherwin, William B; Krützen, Michael


    Male bottlenose dolphins in Shark Bay, Western Australia form two levels of alliances; two to three males cooperate to herd individual females and teams of greater than three males compete with other groups for females. Previous observation suggested two alliance tactics: small four to six member teams of relatives that formed stable pairs or trios and unrelated males in a large 14-member second-order alliance that had labile trio formation. Here, we present evidence for a third level of alliance formation, a continuum of second-order alliance sizes and no relationship between first-order alliance stability and second-order alliance size. These findings challenge the 'two alliance tactics' hypothesis and add to the evidence that Shark Bay male bottlenose dolphins engage in alliance formation that likely places considerable demands on their social cognition. This journal is © 2011 The Royal Society

  15. On the role of periodic structures in the lower jaw of the atlantic bottlenose dolphin (Tursiops truncatus)

    International Nuclear Information System (INIS)

    Dible, S A; Flint, J A; Lepper, P A


    This paper proposes the application of band-gap theory to hearing in the atlantic bottlenose dolphin (Tursiops truncatus). Using the transmission line modelling (TLM) technique and published computed tomography (CT) data of an atlantic bottlenose dolphin (Tursiops truncatus), a series of sound propagation experiments have been carried out. It is shown that the teeth in the lower jaw can be viewed as a periodic array of scattering elements which result in the formation of an acoustic stop band (or band gap) that is angular dependent. It is shown through simple and complex geometry simulations that performance enhancements such as improved gain and isolation between the two receive paths can be achieved. This mechanism has the potential to be exploited in direction-finding sonar

  16. Bottlenose dolphins (Tursiops truncatus do also cast neutrophil extracellular traps against the apicomplexan parasite Neospora caninum

    Directory of Open Access Journals (Sweden)

    R. Villagra-Blanco


    Full Text Available Neutrophil extracellular traps (NETs are web-like structures composed of nuclear DNA decorated with histones and cytoplasmic peptides which antiparasitic properties have not previously been investigated in cetaceans. Polymorphonuclear neutrophils (PMN were isolated from healthy bottlenose dolphins (Tursiops truncatus, and stimulated with Neospora caninum tachyzoites and the NETs-agonist zymosan. In vitro interactions of PMN with the tachyzoites resulted in rapid extrusion of NETs. For the demonstration and quantification of cetacean NETs, extracellular DNA was stained by using either Sytox Orange® or Pico Green®. Scanning electron microscopy (SEM and fluorescence analyses demonstrated PMN-derived release of NETs upon exposure to tachyzoites of N. caninum. Co-localization studies of N. caninum induced cetacean NETs proved the presence of DNA adorned with histones (H1, H2A/H2B, H3, H4, neutrophil elastase (NE, myeloperoxidase (MPO and pentraxin (PTX confirming the molecular properties of mammalian NETosis. Dolphin-derived N. caninum-NETosis were efficiently suppressed by DNase I and diphenyleneiodonium (DPI treatments. Our results indicate that cetacean-derived NETs represent an ancient, conserved and relevant defense effector mechanism of the host innate immune system against N. caninum and probably other related neozoan parasites circulating in the marine environment. Keywords: Tursiops truncatus, cetaceans, Neutrophil extracellular traps, Innate immunity, Neospora caninum.

  17. The ontogenetic changes in the thermal properties of blubber from Atlantic bottlenose dolphin Tursiops truncatus. (United States)

    Dunkin, Robin C; McLellan, William A; Blum, James E; Pabst, D Ann


    In Atlantic bottlenose dolphins Tursiops truncatus, both the thickness and lipid content of blubber vary across ontogeny and across individuals of differing reproductive and nutritional status. This study investigates how these changes in blubber morphology and composition influence its thermal properties. Thermal conductivity (W m(-1) deg.(-1), where deg. is degrees C) and thermal insulation (m(2) deg. W(-1)) of dolphin blubber were measured in individuals across an ontogenetic series (fetus through adult, N=36), pregnant females (N=4) and emaciated animals (N=5). These thermal properties were determined by the simultaneous use of two common experimental approaches, the heat flux disc method and the standard material method. Thickness, lipid and water content were measured for each blubber sample. Thermal conductivity and insulation varied significantly across ontogeny. Blubber from fetuses through sub-adults was less conductive (range=0.11-0.13+/-0.02 W m(-1) deg.(-1)) than that of adults (mean=0.18 W m(-1) deg.(-1)). The conductivity of blubber from pregnant females was similar to non-adult categories, while that of emaciated animals was significantly higher (0.24 +/- 0.04 W m deg.(-1)) than all other categories. Blubber from sub-adults and pregnant females had the highest insulation values while fetuses and emaciated animals had the lowest. In nutritionally dependent life history categories, changes in blubber's thermal insulation were characterized by stable blubber quality (i.e. conductivity) and increased blubber quantity (i.e. thickness). In nutritionally independent animals, blubber quantity remained stable while blubber quality varied. A final, unexpected observation was that heat flux measurements at the deep blubber surface were significantly higher than that at the superficial surface, a pattern not observed in control materials. This apparent ability to absorb heat, coupled with blubber's fatty acid composition, suggest that dolphin integument may

  18. Abundance of bottlenose dolphins, Tursiops truncatus (Cetacea: Delphinidae, inhabiting the Patos Lagoon estuary, southern Brazil: implications for conservation

    Directory of Open Access Journals (Sweden)

    Pedro F Fruet


    Full Text Available A new mark-recapture abundance estimate and a photographic census were carried out to investigate the possible decline in the abundance of the bottlenose dolphins, Tursiops truncatus (Montagu, 1821, in the Patos Lagoon estuary due to the high levels of bycatch mortality which occurred between 2002 and 2006 in oceanic coastal areas close to the estuary. Fourteen systematic boat surveys were conducted between August and early December 2005 to photo-identify the bottlenose dolphins. The estimated number of animals, with long-lasting marks, in the population obtained from Chapman's and Mth models were 51 (95% CI = 49-53 and 52 (95% CI = 51-60, respectively. Taking into account the proportion of dolphins with long-lasting marks in the population, the total estimated population size ranged between 84 (95% CI = 76-93 and 86 (95% CI = 78-95 individuals, respectively, which was very similar to the 84 individuals revealed by the population census. Our results did not differ from the abundance estimate carried out in 1998, prior to the high fishing-related mortality event, suggesting that the population is stable. Plausible argument to explain the stability of the population is that some carcasses found on the oceanic coastal beaches near Patos Lagoon estuary come from animals that do not belong to the estuary community. Future studies should investigate fine-scale habitat partition between estuarine and adjacent coastal dolphins. If the existence of different communities living in close proximity (estuarine and coastal areas near to the estuary is confirmed, a new abundance estimate is needed to access the conservation status of bottlenose dolphins in this region.

  19. Cultural transmission of tool use by Indo-Pacific bottlenose dolphins (Tursiops sp.) provides access to a novel foraging niche. (United States)

    Krützen, Michael; Kreicker, Sina; MacLeod, Colin D; Learmonth, Jennifer; Kopps, Anna M; Walsham, Pamela; Allen, Simon J


    Culturally transmitted tool use has important ecological and evolutionary consequences and has been proposed as a significant driver of human evolution. Such evidence is still scarce in other animals. In cetaceans, tool use has been inferred using indirect evidence in one population of Indo-Pacific bottlenose dolphins (Tursiops sp.), where particular dolphins ('spongers') use marine sponges during foraging. To date, evidence of whether this foraging tactic actually provides access to novel food items is lacking. We used fatty acid (FA) signature analysis to identify dietary differences between spongers and non-spongers, analysing data from 11 spongers and 27 non-spongers from two different study sites. Both univariate and multivariate analyses revealed significant differences in FA profiles between spongers and non-spongers between and within study sites. Moreover, FA profiles differed significantly between spongers and non-spongers foraging within the same deep channel habitat, whereas the profiles of non-spongers from deep channel and shallow habitats at this site could not be distinguished. Our results indicate that sponge use by bottlenose dolphins is linked to significant differences in diet. It appears that cultural transmission of tool use in dolphins, as in humans, allows the exploitation of an otherwise unused niche.

  20. Development of sperm sexing and associated assisted reproductive technology for sex preselection of captive bottlenose dolphins (Tursiops truncatus). (United States)

    O'Brien, J K; Robeck, T R


    Research was conducted to develop sperm sorting and novel sperm preservation methodologies for sex predetermination in the bottlenose dolphin (Tursiops truncatus) using artificial insemination. In Study 1, the effect of seminal plasma (SP), sperm concentration and freezing rate (FR) on in vitro sperm quality of liquid-stored, non-sorted spermatozoa was examined. There was no effect (P > 0.05) of prefreeze SP addition on post-thaw quality (progressive motility, kinetic rating, sperm motility index (SMI), viability and acrosome integrity). Post-thaw motility parameters and viability were higher (P insemination of three dolphins with sorted, frozen-thawed X-bearing spermatozoa resulted in one conception and the birth of a female calf. High-purity sorting of dolphin spermatozoa, derived from liquid-stored semen, can be achieved with minimal loss of in vitro sperm quality and samples are functional in vivo.

  1. Visible and invisible displacement with dynamic visual occlusion in bottlenose dolphins (Tursiops spp). (United States)

    Johnson, Christine M; Sullivan, Jess; Buck, Cara L; Trexel, Julie; Scarpuzzi, Mike


    Anticipating the location of a temporarily obscured target-what Piaget (the construction of reality in the child. Basic Books, New York, 1954) called "object permanence"-is a critical skill, especially in hunters of mobile prey. Previous research with bottlenose dolphins found they could predict the location of a target that had been visibly displaced into an opaque container, but not one that was first placed in an opaque container and then invisibly displaced to another container. We tested whether, by altering the task to involve occlusion rather than containment, these animals could show more advanced object permanence skills. We projected dynamic visual displays at an underwater-viewing window and videotaped the animals' head moves while observing these displays. In Experiment 1, the animals observed a small black disk moving behind occluders that shifted in size, ultimately forming one large occluder. Nine out of ten subjects "tracked" the presumed movement of the disk behind this occluder on their first trial-and in a statistically significant number of subsequent trials-confirming their visible displacement abilities. In Experiment 2, we tested their invisible displacement abilities. The disk first disappeared behind a pair of moving occluders, which then moved behind a stationary occluder. The moving occluders then reappeared and separated, revealing that the disk was no longer behind them. The subjects subsequently looked to the correct stationary occluder on eight of their ten first trials, and in a statistically significant number of subsequent trials. Thus, by altering the stimuli to be more ecologically valid, we were able to show that the dolphins could indeed succeed at an invisible displacement task.

  2. Predicting bottlenose dolphin distribution along Liguria coast (northwestern Mediterranean Sea) through different modeling techniques and indirect predictors. (United States)

    Marini, C; Fossa, F; Paoli, C; Bellingeri, M; Gnone, G; Vassallo, P


    Habitat modeling is an important tool to investigate the quality of the habitat for a species within a certain area, to predict species distribution and to understand the ecological processes behind it. Many species have been investigated by means of habitat modeling techniques mainly to address effective management and protection policies and cetaceans play an important role in this context. The bottlenose dolphin (Tursiops truncatus) has been investigated with habitat modeling techniques since 1997. The objectives of this work were to predict the distribution of bottlenose dolphin in a coastal area through the use of static morphological features and to compare the prediction performances of three different modeling techniques: Generalized Linear Model (GLM), Generalized Additive Model (GAM) and Random Forest (RF). Four static variables were tested: depth, bottom slope, distance from 100 m bathymetric contour and distance from coast. RF revealed itself both the most accurate and the most precise modeling technique with very high distribution probabilities predicted in presence cells (90.4% of mean predicted probabilities) and with 66.7% of presence cells with a predicted probability comprised between 90% and 100%. The bottlenose distribution obtained with RF allowed the identification of specific areas with particularly high presence probability along the coastal zone; the recognition of these core areas may be the starting point to develop effective management practices to improve T. truncatus protection. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. Diffusion tractography reveals pervasive asymmetry of cerebral white matter tracts in the bottlenose dolphin (Tursiops truncatus). (United States)

    Wright, Alexandra K; Theilmann, Rebecca J; Ridgway, Sam H; Scadeng, Miriam


    Brain enlargement is associated with concomitant growth of interneuronal distance, increased conduction time, and reduced neuronal interconnectivity. Recognition of these functional constraints led to the hypothesis that large-brained mammals should exhibit greater structural and functional brain lateralization. As a taxon with the largest brains in the animal kingdom, Cetacea provides a unique opportunity to examine asymmetries of brain structure and function. In the present study, diffusion tensor imaging and tractography were used to investigate cerebral white matter asymmetry in the bottlenose dolphin (Tursiops truncatus). Widespread white matter asymmetries were observed with the preponderance of tracts exhibiting leftward structural asymmetries. Leftward lateralization may reflect differential processing and execution of behaviorally variant sensory and motor functions by the cerebral hemispheres. The arcuate fasciculus, an association tract linked to human language evolution, was isolated and exhibited rightward asymmetry suggesting a right hemisphere bias for conspecific communication unlike that of most mammals. This study represents the first examination of cetacean white matter asymmetry and constitutes an important step toward understanding potential drivers of structural asymmetry and its role in underpinning functional and behavioral lateralization in cetaceans.

  4. Retrospective analysis of bottlenose dolphin foraging: a legacy of anthropogenic ecosystem disturbance (United States)

    Rossman, Sam; Barros, Nélio B.; Ostrom, Peggy H.; Stricker, Craig A.; Hohn, Aleta A.; Gandhi, Hasand; Wells, Randall S.


    We used stable isotope analysis to investigate the foraging ecology of coastal bottlenose dolphins (Tursiops truncatus) in relation to a series of anthropogenic disturbances. We first demonstrated that stable isotopes are a faithful indicator of habitat use by comparing muscle isotope values to behavioral foraging data from the same individuals. δ13C values increased, while δ34S and δ15N values decreased with the percentage of feeding observations in seagrass habitat. We then utilized stable isotope values of muscle to assess temporal variation in foraging habitat from 1991 to 2010 and collagen from tooth crown tips to assess the time period 1944 to 2007. From 1991 to 2010, δ13C values of muscle decreased while δ34S values increased indicating reduced utilization of seagrass habitat. From 1944 to 1989 δ13C values of the crown tip declined significantly, likely due to a reduction in the coverage of seagrass habitat and δ15N values significantly increased, a trend we attribute to nutrient loading from a rapidly increasing human population. Our results demonstrate the utility of using marine mammal foraging habits to retrospectively assess the extent to which anthropogenic disturbance impacts coastal food webs.

  5. Hearing Mechanisms and Noise Metrics Related to Auditory Masking in Bottlenose Dolphins (Tursiops truncatus). (United States)

    Branstetter, Brian K; Bakhtiari, Kimberly L; Trickey, Jennifer S; Finneran, James J


    Odontocete cetaceans are acoustic specialists that depend on sound to hunt, forage, navigate, detect predators, and communicate. Auditory masking from natural and anthropogenic sound sources may adversely affect these fitness-related capabilities. The ability to detect a tone in a broad range of natural, anthropogenic, and synthesized noise was tested with bottlenose dolphins using a psychophysical, band-widening procedure. Diverging masking patterns were found for noise bandwidths greater than the width of an auditory filter. Despite different noise types having equal-pressure spectral-density levels (95 dB re 1 μPa(2)/Hz), masked detection threshold differences were as large as 22 dB. Consecutive experiments indicated that noise types with increased levels of amplitude modulation resulted in comodulation masking release due to within-channel and across-channel auditory mechanisms. The degree to which noise types were comodulated (comodulation index) was assessed by calculating the magnitude-squared coherence between the temporal envelope from an auditory filter centered on the signal and temporal envelopes from flanking filters. Statistical models indicate that masked thresholds in a variety of noise types, at a variety of levels, can be explained with metrics related to the comodulation index in addition to the pressure spectral-density level of noise. This study suggests that predicting auditory masking from ocean noise sources depends on both spectral and temporal properties of the noise.

  6. Vocal activities reflect the temporal distribution of bottlenose dolphin social and non-social activity in a zoological park. (United States)

    Lima, Alice; Lemasson, Alban; Boye, Martin; Hausberger, Martine


    Under natural conditions bottlenose dolphins (Tursiops truncatus) spend their time mostly feeding and then travelling, socializing, or resting. These activities are not randomly distributed, with feeding being higher in early morning and late afternoon. Social activities and vocal behavior seem to be very important in dolphin daily activity. This study aimed to describe the activity time-budget and its relation to vocal behavior for dolphins in a zoological park. We recorded behaviors and vocalizations of six dolphins over 2 months. All subjects performed more non-agonistic social interactions and play in the morning than in the afternoon. The different categories of vocalizations were distributed non-randomly throughout the day, with more chirps in the afternoon, when the animals were "less social." The most striking result was the strong correlation between activities and the categories of vocalizations produced. The results confirm the association between burst pulses and whistles with social activities, but also reveal that both are also associated with solitary play. More chirps were produced when dolphins were engaged in socio-sexual behaviors, emphasizing the need for further questioning about the function of this vocal category. This study reveals that: (i) in a group kept in zoological management, social activities are mostly present in the morning; and (ii) the acoustic signals produced by dolphins may give a reliable representation of their current activities. While more studies on the context of signal production are needed, our findings provide a useful tool for understanding free ranging dolphin behavior when they are not visible. © 2017 Wiley Periodicals, Inc.

  7. Fatal necrotizing fasciitis and myositis in a captive common bottlenose dolphin (Tursiops truncatus) associated with Streptococcus agalactiae. (United States)

    Zappulli, Valentina; Mazzariol, Sandro; Cavicchioli, Laura; Petterino, Claudio; Bargelloni, Luca; Castagnaro, Massimo


    A common bottlenose dolphin (Tursiops truncatus) was presented for necropsy after acute onset of gastrointestinal signs and cutaneous lesions that rapidly progressed to death. Gross and microscopic findings were characterized by locally extensive severe necrohemorrhagic fasciitis and cellulitis, and severe necrotizing myositis in the head and dorsocranial thorax, with numerous disseminated gram-positive cocci. Streptococcus agalactiae was isolated from the lesions and from visceral organs (liver and lung), and it was identified by standard microbiology techniques. This communication is the first report of necrotizing fasciitis in a marine mammal associated with S. agalactiae.

  8. Successful treatment of azole-resistant invasive aspergillosis in a bottlenose dolphin with high-dose posaconazole

    Directory of Open Access Journals (Sweden)

    Paulien E. Bunskoek


    Full Text Available Invasive aspergillosis due to azole-resistant Aspergillus fumigatus is difficult to manage. We describe a case of azole-resistant invasive aspergillosis in a female bottlenose dolphin, who failed to respond to voriconazole and posaconazole therapy. As intravenous therapy was precluded, high dose posaconazole was initiated aimed at achieving trough levels exceeding 3 mg/l. Posaconazole serum levels of 3–9.5 mg/l were achieved without significant side-effects. Follow-up bronchoscopy and computed tomography showed complete resolution of the lesions.

  9. Natural Variation in Stress Hormones, Comparisons Across Matrices, and Impacts Resulting from Induced Stress in the Bottlenose Dolphin. (United States)

    Houser, Dorian S; Champagne, Cory D; Crocker, Daniel E; Kellar, Nicholas M; Cockrem, John; Romano, Tracy; Booth, Rebecca K; Wasser, Samuel K


    Knowledge regarding stress hormones and how they vary in response to seasonality, gender, age, and reproductive status for any marine mammal is limited. Furthermore, stress hormones may be measured in more than one matrix (e.g., feces, blood, blubber), but the relationships between levels of a given hormone across these matrices are unknown, further complicating the interpretations of hormones measured in samples collected from wild animals. A study is underway to address these issues in a population of bottlenose dolphins trained for voluntary participation in sample collections from different matrices and across season and time of day.

  10. Diagnosis and successful treatment of a lung abscess associated with Brucella species infection in a bottlenose dolphin (Tursiops truncatus). (United States)

    Cassle, Stephen E; Jensen, Eric D; Smith, Cynthia R; Meegan, Jennifer M; Johnson, Shawn P; Lutmerding, Betsy; Ridgway, Sam H; Francis-Floyd, Ruth


    This brief communication describes the clinical presentation, antemortem diagnosis, and successful treatment of a pulmonary abscess associated with a Brucella sp. in a 27-yr-old female bottlenose dolphin (Tursiops truncatus). Ultrasound revealed a 3-cm diameter hypoechoic mass deep to the pleural lining in the left lung field. Multiple ultrasound-guided fine-needle aspirates were performed and tested for bacterial and fungal etiology. All cultures were negative, but the infectious agent was identified by MicroSEQ analysis in two samples and confirmed with real-time polymerase chain reaction (PCR) amplification using known Brucella sp. primers. Amikacin was infused into the abscess and was followed by an oral doxycycline and rifampin protocol. Follow-up diagnostic imaging, including radiographs and computed tomography, revealed a resolved lesion with minimal mineralization within the affected lung fields. Brucellosis should be considered for pulmonary disease in dolphins, and personnel who interact with marine animals should use caution to prevent zoonotic brucellosis.

  11. Atlantic Bottlenose Dolphins (Tursiops truncatus) as A Sentinel for Exposure to Mercury in Humans: Closing the Loop (United States)

    Reif, John S.; Schaefer, Adam M.; Bossart, Gregory D.


    Mercury (Hg) is a ubiquitous global contaminant with important public health implications. Mercury is released from a variety of anthropogenic, industrial processes, enters the earth's atmosphere and is re-deposited onto the earth’s surface in rainfall. Much of this Hg enters the oceans which cover the majority of the earth’s surface. In the marine environment, inorganic Hg is converted to the most toxic form of the element, methylmercury, and biomagnified through the trophic levels of the food web. The bottlenose dolphin (Tursiops truncatus) is the apex predator in many estuarine and coastal ecosystems. Due to their long life span and trophic position, bottlenose dolphins bioaccumulate high concentrations of contaminants including Hg, thus making them an important sentinel species for ecosystem and public health. Bottlenose dolphins in Florida bioaccumulate high concentrations of Hg in their blood, skin and internal organs. The concentrations of Hg in blood and skin of bottlenose dolphins of the Indian River Lagoon, FL (IRL) are among the highest reported world-wide. In previous studies, we demonstrated associations between concentrations of total Hg in the blood and skin of IRL dolphins and markers of endocrine, renal, hepatic, hematologic and immune system dysfunction. The predominant manifestation of exposure to mercury in humans is neurotoxicity. During the 1950s and 1960s, residents of Minamata bay, Japan were exposed to high concentrations of methyl mercury as the result of ingestion of fish and shellfish that had become contaminated in this infamous environmental disaster. Affected adults had severe motor and sensory abnormalities often leading to death. Methyl mercury crosses the placenta during pregnancy. Children exposed in utero were born with multiple congenital anomalies and also suffered from neurologic disorders. Significantly, local cats that consumed Hg contaminated fish developed severe signs of neurotoxicity which led to their subsequent

  12. Atlantic Bottlenose Dolphins (Tursiops truncatus as A Sentinel for Exposure to Mercury in Humans: Closing the Loop

    Directory of Open Access Journals (Sweden)

    John S. Reif


    Full Text Available Mercury (Hg is a ubiquitous global contaminant with important public health implications. Mercury is released from a variety of anthropogenic, industrial processes, enters the earth's atmosphere and is re-deposited onto the earth’s surface in rainfall. Much of this Hg enters the oceans which cover the majority of the earth’s surface. In the marine environment, inorganic Hg is converted to the most toxic form of the element, methylmercury, and biomagnified through the trophic levels of the food web. The bottlenose dolphin (Tursiops truncatus is the apex predator in many estuarine and coastal ecosystems. Due to their long life span and trophic position, bottlenose dolphins bioaccumulate high concentrations of contaminants including Hg, thus making them an important sentinel species for ecosystem and public health. Bottlenose dolphins in Florida bioaccumulate high concentrations of Hg in their blood, skin and internal organs. The concentrations of Hg in blood and skin of bottlenose dolphins of the Indian River Lagoon, FL (IRL are among the highest reported world-wide. In previous studies, we demonstrated associations between concentrations of total Hg in the blood and skin of IRL dolphins and markers of endocrine, renal, hepatic, hematologic and immune system dysfunction. The predominant manifestation of exposure to mercury in humans is neurotoxicity. During the 1950s and 1960s, residents of Minamata bay, Japan were exposed to high concentrations of methyl mercury as the result of ingestion of fish and shellfish that had become contaminated in this infamous environmental disaster. Affected adults had severe motor and sensory abnormalities often leading to death. Methyl mercury crosses the placenta during pregnancy. Children exposed in utero were born with multiple congenital anomalies and also suffered from neurologic disorders. Significantly, local cats that consumed Hg contaminated fish developed severe signs of neurotoxicity which led to

  13. A Permanent Automated Real-Time Passive Acoustic Monitoring System for Bottlenose Dolphin Conservation in the Mediterranean Sea.

    Directory of Open Access Journals (Sweden)

    Marco Brunoldi

    Full Text Available Within the framework of the EU Life+ project named LIFE09 NAT/IT/000190 ARION, a permanent automated real-time passive acoustic monitoring system for the improvement of the conservation status of the transient and resident population of bottlenose dolphin (Tursiops truncatus has been implemented and installed in the Portofino Marine Protected Area (MPA, Ligurian Sea. The system is able to detect the simultaneous presence of dolphins and boats in the area and to give their position in real time. This information is used to prevent collisions by diffusing warning messages to all the categories involved (tourists, professional fishermen and so on. The system consists of two gps-synchronized acoustic units, based on a particular type of marine buoy (elastic beacon, deployed about 1 km off the Portofino headland. Each one is equipped with a four-hydrophone array and an onboard acquisition system which can record the typical social communication whistles emitted by the dolphins and the sound emitted by boat engines. Signals are pre-filtered, digitized and then broadcast to the ground station via wi-fi. The raw data are elaborated to get the direction of the acoustic target to each unit, and hence the position of dolphins and boats in real time by triangulation.

  14. A Permanent Automated Real-Time Passive Acoustic Monitoring System for Bottlenose Dolphin Conservation in the Mediterranean Sea. (United States)

    Brunoldi, Marco; Bozzini, Giorgio; Casale, Alessandra; Corvisiero, Pietro; Grosso, Daniele; Magnoli, Nicodemo; Alessi, Jessica; Bianchi, Carlo Nike; Mandich, Alberta; Morri, Carla; Povero, Paolo; Wurtz, Maurizio; Melchiorre, Christian; Viano, Gianni; Cappanera, Valentina; Fanciulli, Giorgio; Bei, Massimiliano; Stasi, Nicola; Taiuti, Mauro


    Within the framework of the EU Life+ project named LIFE09 NAT/IT/000190 ARION, a permanent automated real-time passive acoustic monitoring system for the improvement of the conservation status of the transient and resident population of bottlenose dolphin (Tursiops truncatus) has been implemented and installed in the Portofino Marine Protected Area (MPA), Ligurian Sea. The system is able to detect the simultaneous presence of dolphins and boats in the area and to give their position in real time. This information is used to prevent collisions by diffusing warning messages to all the categories involved (tourists, professional fishermen and so on). The system consists of two gps-synchronized acoustic units, based on a particular type of marine buoy (elastic beacon), deployed about 1 km off the Portofino headland. Each one is equipped with a four-hydrophone array and an onboard acquisition system which can record the typical social communication whistles emitted by the dolphins and the sound emitted by boat engines. Signals are pre-filtered, digitized and then broadcast to the ground station via wi-fi. The raw data are elaborated to get the direction of the acoustic target to each unit, and hence the position of dolphins and boats in real time by triangulation.

  15. A Permanent Automated Real-Time Passive Acoustic Monitoring System for Bottlenose Dolphin Conservation in the Mediterranean Sea (United States)

    Brunoldi, Marco; Bozzini, Giorgio; Casale, Alessandra; Corvisiero, Pietro; Grosso, Daniele; Magnoli, Nicodemo; Alessi, Jessica; Bianchi, Carlo Nike; Mandich, Alberta; Morri, Carla; Povero, Paolo; Wurtz, Maurizio; Melchiorre, Christian; Viano, Gianni; Cappanera, Valentina; Fanciulli, Giorgio; Bei, Massimiliano; Stasi, Nicola; Taiuti, Mauro


    Within the framework of the EU Life+ project named LIFE09 NAT/IT/000190 ARION, a permanent automated real-time passive acoustic monitoring system for the improvement of the conservation status of the transient and resident population of bottlenose dolphin (Tursiops truncatus) has been implemented and installed in the Portofino Marine Protected Area (MPA), Ligurian Sea. The system is able to detect the simultaneous presence of dolphins and boats in the area and to give their position in real time. This information is used to prevent collisions by diffusing warning messages to all the categories involved (tourists, professional fishermen and so on). The system consists of two gps-synchronized acoustic units, based on a particular type of marine buoy (elastic beacon), deployed about 1 km off the Portofino headland. Each one is equipped with a four-hydrophone array and an onboard acquisition system which can record the typical social communication whistles emitted by the dolphins and the sound emitted by boat engines. Signals are pre-filtered, digitized and then broadcast to the ground station via wi-fi. The raw data are elaborated to get the direction of the acoustic target to each unit, and hence the position of dolphins and boats in real time by triangulation. PMID:26789265

  16. Lateralized visual behavior in bottlenose dolphins (Tursiops truncatus) performing audio-visual tasks: the right visual field advantage. (United States)

    Delfour, F; Marten, K


    Analyzing cerebral asymmetries in various species helps in understanding brain organization. The left and right sides of the brain (lateralization) are involved in different cognitive and sensory functions. This study focuses on dolphin visual lateralization as expressed by spontaneous eye preference when performing a complex cognitive task; we examine lateralization when processing different visual stimuli displayed on an underwater touch-screen (two-dimensional figures, three-dimensional figures and dolphin/human video sequences). Three female bottlenose dolphins (Tursiops truncatus) were submitted to a 2-, 3- or 4-, choice visual/auditory discrimination problem, without any food reward: the subjects had to correctly match visual and acoustic stimuli together. In order to visualize and to touch the underwater target, the dolphins had to come close to the touch-screen and to position themselves using monocular vision (left or right eye) and/or binocular naso-ventral vision. The results showed an ability to associate simple visual forms and auditory information using an underwater touch-screen. Moreover, the subjects showed a spontaneous tendency to use monocular vision. Contrary to previous findings, our results did not clearly demonstrate right eye preference in spontaneous choice. However, the individuals' scores of correct answers were correlated with right eye vision, demonstrating the advantage of this visual field in visual information processing and suggesting a left hemispheric dominance. We also demonstrated that the nature of the presented visual stimulus does not seem to have any influence on the animals' monocular vision choice.

  17. Persistent organic pollutants (POPs) in blood and blubber of common bottlenose dolphins (Tursiops truncatus) at three northern Gulf of Mexico sites following the Deepwater Horizon oil spill. (United States)

    Balmer, Jennifer E; Ylitalo, Gina M; Rowles, Teresa K; Mullin, Keith D; Wells, Randall S; Townsend, Forrest I; Pearce, Ronald W; Bolton, Jennie L; Zolman, Eric S; Balmer, Brian C; Schwacke, Lori H


    Common bottlenose dolphins (Tursiops truncatus), including those impacted by the 2010 Deepwater Horizon (DWH) oil spill, inhabit the coastal and estuarine waters of the northern Gulf of Mexico (GoM). In response to the spill, dolphin health assessments conducted in Barataria Bay, Louisiana - a site that experienced heavy and prolonged oiling - uncovered a high prevalence of health abnormalities and individuals in poor body condition. Although the health effects observed were suggestive of petroleum toxicity, a lack of pre-spill information regarding dolphin health raises the possibility that other environmental factors may have contributed to the adverse health of dolphins in this oil-impacted area. To assess how exposure to other environmental pollutants may affect the health of northern GoM dolphin populations impacted by the DWH oil spill, a suite of 69 persistent organic pollutants (POPs), including PCBs, PBDEs and organochlorine pesticides, was determined in blood and a subset of blubber samples collected during health assessments of 145 bottlenose dolphins at three GoM sites: two oil impacted sites - Barataria Bay, LA (BB), and Mississippi Sound, MS (MS) and an unimpacted reference site - Sarasota Bay, FL (SB). Overall, levels of POPs at all three sites appeared comparable or lower than concentrations previously reported for coastal bottlenose dolphin populations outside of the northern GoM. POP levels measured in BB dolphins were also comparable or lower than those measured at the unimpacted reference site (SB) within the northern GoM. Additionally, the relationship between blubber and blood contaminant levels in a smaller subset of BB and SB suggests that BB animals were not experiencing elevated blood-contaminant concentrations as a result of their poor body condition. Cumulatively, these results suggest that background levels of POPs measured are unlikely to produce the health abnormalities previously reported for BB dolphins. Copyright © 2017 Elsevier B

  18. Eosinophilia and biotoxin exposure in bottlenose dolphins (Tursiops truncatus) from a coastal area impacted by repeated mortality events

    International Nuclear Information System (INIS)

    Schwacke, Lori H.; Twiner, Michael J.; De Guise, Sylvain; Balmer, Brian C.; Wells, Randall S.; Townsend, Forrest I.; Rotstein, David C.; Varela, Rene A.; Hansen, Larry J.; Zolman, Eric S.; Spradlin, Trevor R.


    Bottlenose dolphins (Tursiops truncatus) inhabiting coastal waters in the northern Gulf of Mexico have been impacted by recurrent unusual mortality events over the past few decades. Several of these mortality events along the Florida panhandle have been tentatively attributed to poisoning from brevetoxin produced by the dinoflagellate Karenia brevis. While dolphins in other regions of the Florida coast are often exposed to K. brevis blooms, large-scale dolphin mortality events are relatively rare and the frequency and magnitude of die-offs along the Panhandle raise concern for the apparent vulnerability of dolphins in this region. We report results from dolphin health assessments conducted near St. Joseph Bay, Florida, an area impacted by 3 unusual die-offs within a 7-year time span. An eosinophilia syndrome, manifested as an elevated blood eosinophil count without obvious cause, was observed in 23% of sampled dolphins. Elevated eosinophil counts were associated with decreased T-lymphocyte proliferation and increased neutrophil phagocytosis. In addition, indication of chronic low-level exposure to another algal toxin, domoic acid produced by the diatom Pseudo-nitzschia spp., was determined. Previous studies of other marine mammal populations exposed recurrently to Pseudo-nitzschia blooms have suggested a possible link between the eosinophilia and domoic acid exposure. While the chronic eosinophilia syndrome could over the long-term produce organ damage and alter immunological status and thereby increase vulnerability to other challenges, the significance of the high prevalence of the syndrome to the observed mortality events in the St. Joseph Bay area is unclear. Nonetheless, the unusual immunological findings and concurrent evidence of domoic acid exposure in this sentinel marine species suggest a need for further investigation to elucidate potential links between chronic, low-level exposure to algal toxins and immune health.

  19. Eosinophilia and biotoxin exposure in bottlenose dolphins (Tursiops truncatus) from a coastal area impacted by repeated mortality events

    Energy Technology Data Exchange (ETDEWEB)

    Schwacke, Lori H., E-mail: [National Oceanic and Atmospheric Administration, National Ocean Service, Center for Human Health Risks, 331 Fort Johnson Road, Charleston, SC 29412 (United States); Twiner, Michael J. [National Oceanic and Atmospheric Administration, National Ocean Service, Center for Coastal Environmental Health and Biomolecular Research, 219 Fort Johnson Road, Charleston, SC 29412 (United States); De Guise, Sylvain [University of Connecticut, Department of Pathobiology and Veterinary Science, 61 North Eagleville Road, U-89, Storrs, CT 06269 (United States); Balmer, Brian C.; Wells, Randall S. [Chicago Zoological Society, c/o Mote Marine Laboratory, 1600 Ken Thompson Parkway, Sarasota, FL 34236 (United States); Townsend, Forrest I. [Bayside Hospital for Animals, 251 N.E. Racetrack Road, Fort Walton Beach, FL 32547 (United States); Rotstein, David C. [National Oceanic and Atmospheric Administration, National Marine Fisheries Service, Office of Protected Resources, Marine Mammal Health and Stranding Response Program, 1315 East West Highway, Silver Spring, MD 20910 (United States); Varela, Rene A. [Ocean Embassy Inc, 6433 Pinecastle Blvd, Ste 2, Orlando, FL 32809 (United States); Hansen, Larry J. [National Oceanic and Atmospheric Administration, National Marine Fisheries Service Southeast Fisheries Science Center,101 Pivers Island Road, Beaufort, NC 28516 (United States); Zolman, Eric S. [National Oceanic and Atmospheric Administration, National Ocean Service, Center for Coastal Environmental Health and Biomolecular Research, 219 Fort Johnson Road, Charleston, SC 29412 (United States); Spradlin, Trevor R. [National Oceanic and Atmospheric Administration, National Marine Fisheries Service, Office of Protected Resources, Marine Mammal Health and Stranding Response Program, 1315 East West Highway, Silver Spring, MD 20910 (United States); and others


    Bottlenose dolphins (Tursiops truncatus) inhabiting coastal waters in the northern Gulf of Mexico have been impacted by recurrent unusual mortality events over the past few decades. Several of these mortality events along the Florida panhandle have been tentatively attributed to poisoning from brevetoxin produced by the dinoflagellate Karenia brevis. While dolphins in other regions of the Florida coast are often exposed to K. brevis blooms, large-scale dolphin mortality events are relatively rare and the frequency and magnitude of die-offs along the Panhandle raise concern for the apparent vulnerability of dolphins in this region. We report results from dolphin health assessments conducted near St. Joseph Bay, Florida, an area impacted by 3 unusual die-offs within a 7-year time span. An eosinophilia syndrome, manifested as an elevated blood eosinophil count without obvious cause, was observed in 23% of sampled dolphins. Elevated eosinophil counts were associated with decreased T-lymphocyte proliferation and increased neutrophil phagocytosis. In addition, indication of chronic low-level exposure to another algal toxin, domoic acid produced by the diatom Pseudo-nitzschia spp., was determined. Previous studies of other marine mammal populations exposed recurrently to Pseudo-nitzschia blooms have suggested a possible link between the eosinophilia and domoic acid exposure. While the chronic eosinophilia syndrome could over the long-term produce organ damage and alter immunological status and thereby increase vulnerability to other challenges, the significance of the high prevalence of the syndrome to the observed mortality events in the St. Joseph Bay area is unclear. Nonetheless, the unusual immunological findings and concurrent evidence of domoic acid exposure in this sentinel marine species suggest a need for further investigation to elucidate potential links between chronic, low-level exposure to algal toxins and immune health.

  20. Spatial and Temporal Variation in the Acoustic Habitat of Bottlenose Dolphins (Tursiops aduncus within a Highly Urbanized Estuary

    Directory of Open Access Journals (Sweden)

    Sarah A. Marley


    Full Text Available There is growing awareness of underwater noise in a variety of marine habitats, and how such noise may adversely affect marine species. This is of particular concern for acoustically-specialized species, such as dolphins. In order to ascertain the potential impacts of anthropogenic noise on these animals, baseline information is required for defining the soundscape of dolphin habitats. The Swan-Canning River system in Western Australia flows through the city of Perth, and experiences numerous anthropogenic activities. Despite this, the river system is home to a community of Indo-Pacific bottlenose dolphins (Tursiops aduncus. To provide a baseline soundscape description of dolphin habitat, over 11,600 h of acoustic data were analyzed from five sites within the Swan River (from Fremantle Inner Harbor to 20 km upstream across an 8-year period. Multiple sound sources were recorded at these sites, including: snapping shrimp; fishes; dolphins; pile-driving; bridge and road traffic; and vessel traffic. The two most prevalent sound sources, vessel traffic and snapping shrimp, likely have very different effects on dolphin communication with the former expected to be more disruptive. Sites were characteristic in their prominent sound sources, showing clear among-site variations, with some sites being “noisier” than others based on broadband noise levels, octave-band noise levels, and power spectrum density percentiles. Perth Waters had the highest broadband noise (10–11 kHz; median 113 dB re 1 μPa rms, whilst Heirisson Island was quietest (median 100 dB re 1 μPa rms. Generalized estimating equations identified variation in broadband noise levels within sites at a fine temporal scale, although sites differed in the significance of temporal variables. At Mosman Bay, a long-term dataset spanning eight years highlighted inter-annual variation in broadband noise levels, but no overall upwards or downwards trend over time. Acoustic habitats of the Swan

  1. Diet of bottlenose dolphins (Tursiops truncatus from the Gulf of Cadiz: Insights from stomach content and stable isotope analyses.

    Directory of Open Access Journals (Sweden)

    Joan Giménez

    Full Text Available The ecological role of species can vary among populations depending on local and regional differences in diet. This is particularly true for top predators such as the bottlenose dolphin (Tursiops truncatus, which exhibits a highly varied diet throughout its distribution range. Local dietary assessments are therefore critical to fully understand the role of this species within marine ecosystems, as well as its interaction with important ecosystem services such as fisheries. Here, we combined stomach content analyses (SCA and stable isotope analyses (SIA to describe bottlenose dolphins diet in the Gulf of Cadiz (North Atlantic Ocean. Prey items identified using SCA included European conger (Conger conger and European hake (Merluccius merluccius as the most important ingested prey. However, mass-balance isotopic mixing model (MixSIAR, using δ13C and δ15N, indicated that the assimilated diet consisted mainly on Sparidae species (e.g. seabream, Diplodus annularis and D. bellottii, rubberlip grunt, Plectorhinchus mediterraneus, and common pandora, Pagellus erythrinus and a mixture of other species including European hake, mackerels (Scomber colias, S. japonicus and S. scombrus, European conger, red bandfish (Cepola macrophthalma and European pilchard (Sardina pilchardus. These contrasting results highlight differences in the temporal and taxonomic resolution of each approach, but also point to potential differences between ingested (SCA and assimilated (SIA diets. Both approaches provide different insights, e.g. determination of consumed fish biomass for the management of fish stocks (SCA or identification of important assimilated prey species to the consumer (SIA.

  2. Behavioral Responses and Temporary Shift in Masked Hearing Threshold of Bottlenose Dolphins, Tursiops truncatus, to 1-second Tones of 141 to 201 dB re 1 Micron Pa

    National Research Council Canada - National Science Library

    Ridgway, Sam


    ...) as a means of evaluating impacts of those emissions. Existing Navy methods published in the Journal of the Acoustical Society of America were applied to investigate TTS in the hearing sensitivity of bottlenose dolphins (Tursiops truncatus...

  3. Niche Differentiation and Prey Selectivity among Common Bottlenose Dolphins (Tursiops truncatus Sighted in St. George Sound, Gulf of Mexico

    Directory of Open Access Journals (Sweden)

    Rachel M. Wilson


    Full Text Available Two groups of common bottlenose dolphins (Tursiops truncatus have been identified within St. George Sound, Florida, USA: high site-fidelity individuals (HSF which are individuals sighted multiple times in the region (i.e., ≥2 months, ≥2 seasons, and ≥2 years, and low site-fidelity individuals (LSF, which are individuals sighted fewer than 2 months, in 2 different seasons among 2 different years. Our goal was to determine whether differences in foraging behaviors were correlated with differences in sighting frequency and overall usage of St. George Sound by the two groups. We used carbon, nitrogen, and sulfur stable isotopes and niche hypervolume metrics to model the foodweb of St. George Sound. Mixing model results indicated that croaker, mojarra, pigfish, pinfish, and silverperch were the most important prey items for dolphins. The hypervolume metrics demonstrate niche partitioning between HSFs and LSFs, with the HSFs relying more heavily on pinfish, pigfish, and mojarra, while the LSFs relied more on silverperch. Plankton, benthic diatoms, seagrass, and epiphytes all contributed to secondary production within St. George Sound. This diversity of source utilization by seagrass-associated consumers supported by a high rate of total production likely sustains high secondary productivity despite the potential for competition in this system. Zooplankton was the most important basal source to the system, followed by seagrass and benthic primary production (as indicated by a sanddollar proxy. The reliance of dolphins on seagrass-dependent prey indicates that alteration of seagrass habitat would significantly impact the dolphin community foraging in St. George Sound and suggests that preservation of seagrass habitat is an important component of an effective management strategy for dolphin populations in the region.

  4. Estimates of DNA strand breakage in bottlenose dolphin (Tursiops truncatus leukocytes measured with the Comet and DNA diffusion assays

    Directory of Open Access Journals (Sweden)

    Adriana Díaz


    Full Text Available The analysis of DNA damage by mean of Comet or single cell gel electrophoresis (SCGE assay has been commonly used to assess genotoxic impact in aquatic animals being able to detect exposure to low concentrations of contaminants in a wide range of species. The aims of this work were 1 to evaluate the usefulness of the Comet to detect DNA strand breakage in dolphin leukocytes, 2 to use the DNA diffusion assay to determine the amount of DNA strand breakage associated with apoptosis or necrosis, and 3 to determine the proportion of DNA strand breakage that was unrelated to apoptosis and necrosis. Significant intra-individual variation was observed in all of the estimates of DNA damage. DNA strand breakage was overestimated because a considerable amount (~29% of the DNA damage was derived from apoptosis and necrosis. The remaining DNA damage in dolphin leukocytes was caused by factors unrelated to apoptosis and necrosis. These results indicate that the DNA diffusion assay is a complementary tool that can be used together with the Comet assay to assess DNA damage in bottlenose dolphins.

  5. The distribution and morphological characteristics of catecholaminergic cells in the diencephalon and midbrain of the bottlenose dolphin (Tursiops truncatus). (United States)

    Manger, Paul R; Fuxe, Kjell; Ridgway, Sam H; Siegel, Jerome M


    The present study describes the distribution and cellular morphology of catecholaminergic neurons in the diencephalon and midbrain of the bottlenose dolphin (Tursiops truncatus). Tyrosine hydroxylase immunohistochemistry was used to visualize these putatively dopaminergic neurons. The standard A1-A17, C1-C3, nomenclature is used for expediency; however, the neuroanatomical names of the various nuclei have also been given. Dolphins exhibit certain tyrosine hydroxylase immunoreactive (TH-ir) catecholaminergic neuronal groups in the midbrain (A8, A9, A10) and diencephalon (A11, A12, A14), however, no neuronal clusters clearly corresponding to the A13 and A15 groups could be identified. The subdivisions of these neuronal groups are in general agreement with those of other mammals, but there is a high degree of species specificity. First, three TH-ir neuronal groups not identified in other species were found: in the ventral lateral peri-aqueductal gray matter, posterior dorsal hypothalamus, and rostral mesencephalic raphe. Second, the normal components of the substantia nigra (A9 or pars compacta, A9 lateral or pars lateralis, A9 ventral or pars reticulata) were extremely cell sparse, but there was a substantial expansion of the A9 medial and A10 lateral subdivisions forming an impressive 'ventral wing' in the posterior substantia nigra. The findings of this and previous studies suggest a distinct evolutionary trend occurring in the neuromodulatory systems in mammals. The results are discussed in relation to motor control, thermoregulation, unihemispheric sleep, and dolphin cognition. Copyright 2004 S. Karger AG, Basel

  6. Adrenal Gland and Lung Lesions in Gulf of Mexico Common Bottlenose Dolphins (Tursiops truncatus Found Dead following the Deepwater Horizon Oil Spill.

    Directory of Open Access Journals (Sweden)

    Stephanie Venn-Watson

    Full Text Available A northern Gulf of Mexico (GoM cetacean unusual mortality event (UME involving primarily bottlenose dolphins (Tursiops truncatus in Louisiana, Mississippi, and Alabama began in February 2010 and continued into 2014. Overlapping in time and space with this UME was the Deepwater Horizon (DWH oil spill, which was proposed as a contributing cause of adrenal disease, lung disease, and poor health in live dolphins examined during 2011 in Barataria Bay, Louisiana. To assess potential contributing factors and causes of deaths for stranded UME dolphins from June 2010 through December 2012, lung and adrenal gland tissues were histologically evaluated from 46 fresh dead non-perinatal carcasses that stranded in Louisiana (including 22 from Barataria Bay, Mississippi, and Alabama. UME dolphins were tested for evidence of biotoxicosis, morbillivirus infection, and brucellosis. Results were compared to up to 106 fresh dead stranded dolphins from outside the UME area or prior to the DWH spill. UME dolphins were more likely to have primary bacterial pneumonia (22% compared to 2% in non-UME dolphins, P = .003 and thin adrenal cortices (33% compared to 7% in non-UME dolphins, P = .003. In 70% of UME dolphins with primary bacterial pneumonia, the condition either caused or contributed significantly to death. Brucellosis and morbillivirus infections were detected in 7% and 11% of UME dolphins, respectively, and biotoxin levels were low or below the detection limit, indicating that these were not primary causes of the current UME. The rare, life-threatening, and chronic adrenal gland and lung diseases identified in stranded UME dolphins are consistent with exposure to petroleum compounds as seen in other mammals. Exposure of dolphins to elevated petroleum compounds present in coastal GoM waters during and after the DWH oil spill is proposed as a cause of adrenal and lung disease and as a contributor to increased dolphin deaths.

  7. Adrenal Gland and Lung Lesions in Gulf of Mexico Common Bottlenose Dolphins (Tursiops truncatus) Found Dead following the Deepwater Horizon Oil Spill. (United States)

    Venn-Watson, Stephanie; Colegrove, Kathleen M; Litz, Jenny; Kinsel, Michael; Terio, Karen; Saliki, Jeremiah; Fire, Spencer; Carmichael, Ruth; Chevis, Connie; Hatchett, Wendy; Pitchford, Jonathan; Tumlin, Mandy; Field, Cara; Smith, Suzanne; Ewing, Ruth; Fauquier, Deborah; Lovewell, Gretchen; Whitehead, Heidi; Rotstein, David; McFee, Wayne; Fougeres, Erin; Rowles, Teri


    A northern Gulf of Mexico (GoM) cetacean unusual mortality event (UME) involving primarily bottlenose dolphins (Tursiops truncatus) in Louisiana, Mississippi, and Alabama began in February 2010 and continued into 2014. Overlapping in time and space with this UME was the Deepwater Horizon (DWH) oil spill, which was proposed as a contributing cause of adrenal disease, lung disease, and poor health in live dolphins examined during 2011 in Barataria Bay, Louisiana. To assess potential contributing factors and causes of deaths for stranded UME dolphins from June 2010 through December 2012, lung and adrenal gland tissues were histologically evaluated from 46 fresh dead non-perinatal carcasses that stranded in Louisiana (including 22 from Barataria Bay), Mississippi, and Alabama. UME dolphins were tested for evidence of biotoxicosis, morbillivirus infection, and brucellosis. Results were compared to up to 106 fresh dead stranded dolphins from outside the UME area or prior to the DWH spill. UME dolphins were more likely to have primary bacterial pneumonia (22% compared to 2% in non-UME dolphins, P = .003) and thin adrenal cortices (33% compared to 7% in non-UME dolphins, P = .003). In 70% of UME dolphins with primary bacterial pneumonia, the condition either caused or contributed significantly to death. Brucellosis and morbillivirus infections were detected in 7% and 11% of UME dolphins, respectively, and biotoxin levels were low or below the detection limit, indicating that these were not primary causes of the current UME. The rare, life-threatening, and chronic adrenal gland and lung diseases identified in stranded UME dolphins are consistent with exposure to petroleum compounds as seen in other mammals. Exposure of dolphins to elevated petroleum compounds present in coastal GoM waters during and after the DWH oil spill is proposed as a cause of adrenal and lung disease and as a contributor to increased dolphin deaths.

  8. Demographic clusters identified within the northern Gulf of Mexico common bottlenose dolphin (Tursiops truncates unusual mortality event: January 2010-June 2013.

    Directory of Open Access Journals (Sweden)

    Stephanie Venn-Watson

    Full Text Available A multi-year unusual mortality event (UME involving primarily common bottlenose dolphins (Tursiops truncates was declared in the northern Gulf of Mexico (GoM with an initial start date of February 2010 and remains ongoing as of August 2014. To examine potential changing characteristics of the UME over time, we compared the number and demographics of dolphin strandings from January 2010 through June 2013 across the entire GoM as well as against baseline (1990-2009 GoM stranding patterns. Years 2010 and 2011 had the highest annual number of stranded dolphins since Louisiana's record began, and 2011 was one of the years with the highest strandings for both Mississippi and Alabama. Statewide, annual numbers of stranded dolphins were not elevated for GoM coasts of Florida or Texas during the UME period. Demographic, spatial, and temporal clusters identified within this UME included increased strandings in northern coastal Louisiana and Mississippi (March-May 2010; Barataria Bay, Louisiana (August 2010-December 2011; Mississippi and Alabama (2011, including a high prevalence and number of stranded perinates; and multiple GoM states during early 2013. While the causes of the GoM UME have not been determined, the location and magnitude of dolphin strandings during and the year following the 2010 Deepwater Horizon oil spill, including the Barataria Bay cluster from August 2010 to December 2011, overlap in time and space with locations that received heavy and prolonged oiling. There are, however, multiple known causes of previous GoM dolphin UMEs, including brevetoxicosis and dolphin morbillivirus. Additionally, increased dolphin strandings occurred in northern Louisiana and Mississippi before the Deepwater Horizon oil spill. Identification of spatial, temporal, and demographic clusters within the UME suggest that this mortality event may involve different contributing factors varying by location, time, and bottlenose dolphin populations that will be

  9. Complex Social Structure of an Endangered Population of Bottlenose Dolphins (Tursiops truncatus) in the Aeolian Archipelago (Italy) (United States)

    Blasi, Monica F.; Boitani, Luigi


    We investigated social structure and association patterns for a small population of Mediterranean bottlenose dolphins, Tursiops truncatus, inhabiting the Aeolian Archipelago (southern Italy). Specifically we evaluate the role of sex and age composition, residency patterns and interaction with trammel nets on this social organization. Association data for 23 regularly sighted individuals were obtained from summer photoidentification surveys collected from 2005–2012. Using a combined cluster and social network analysis approach, we found associations between dolphins were hierarchically structured, where two mixed-sex social units were subdivided into smaller temporarily dynamic groups. We found non-random and long-term preferred associations in the population; however, the degree of social cohesion, residence pattern and interaction with trammel nets differed considerably between the two social units. Six of eight females occurred in the more resident social unit-1; in addition, social unit-1 individuals had significantly stronger associations, higher preferred associates, lived in larger groups and occurred less frequently with trammel nets. Nine of eleven males were clustered in social unit-2 and five of these males, interacting with trammel nets, formed small groups and preferred associations. We propose that female and male groups associate in the study area during the breeding season and that some males choose to interact with reproductive females forming a distinct but interrelated social unit. Other males may be associating in a larger fission-fusion network, which consists of dolphins that appear to temporarily join the network from the coastal population. We cannot exclude that some males specialized in trammel net foraging, suggesting that this foraging technique may favor a solitary lifestyle. Large group sizes and high degree of social cohesion for females could be an indication of greater protection and more efficiency in detecting, deterring or

  10. High genetic structure and low mitochondrial diversity in bottlenose dolphins of the Archipelago of Bocas del Toro, Panama: A population at risk?

    Directory of Open Access Journals (Sweden)

    Dalia C Barragán-Barrera

    Full Text Available The current conservation status of the bottlenose dolphin (Tursiops truncatus under the IUCN is 'least concern'. However, in the Caribbean, small and localized populations of the 'inshore form' may be at higher risk of extinction than the 'worldwide distributed form' due to a combination of factors including small population size, high site fidelity, genetic isolation, and range overlap with human activities. Here, we study the population genetic structure of bottlenose dolphins from the Archipelago of Bocas del Toro in Panama. This is a small population characterized by high site fidelity and is currently heavily-impacted by the local dolphin-watching industry. We collected skin tissue samples from 25 dolphins to study the genetic diversity and structure of this population. We amplified a portion of the mitochondrial Control Region (mtDNA-CR and nine microsatellite loci. The mtDNA-CR analyses revealed that dolphins in Bocas del Toro belong to the 'inshore form', grouped with the Bahamas-Colombia-Cuba-Mexico population unit. They also possess a unique haplotype new for the Caribbean. The microsatellite data indicated that the Bocas del Toro dolphin population is highly structured, likely due to restricted movement patterns. Previous abundance estimates obtained with mark-recapture methods reported a small population of 80 dolphins (95% CI = 72-87, which is similar to the contemporary effective population size estimated in this study (Ne = 73 individuals; CI = 18.0 - ∞; 0.05. The combination of small population size, high degree of genetic isolation, and intense daily interactions with dolphin-watching boats puts the Bocas del Toro dolphin to at high risk of extinction. Despite national guidelines to regulate the dolphin-watching industry in Bocas del Toro and ongoing educational programs for tour operators, only in 2012 seven animals have died due to boat collisions. Our results suggest that the conservation status of bottlenose dolphins in

  11. High genetic structure and low mitochondrial diversity in bottlenose dolphins of the Archipelago of Bocas del Toro, Panama: A population at risk? (United States)

    Tezanos-Pinto, Gabriela; Islas-Villanueva, Valentina; Correa-Cárdenas, Camilo A.


    The current conservation status of the bottlenose dolphin (Tursiops truncatus) under the IUCN is ‘least concern’. However, in the Caribbean, small and localized populations of the ‘inshore form’ may be at higher risk of extinction than the ‘worldwide distributed form’ due to a combination of factors including small population size, high site fidelity, genetic isolation, and range overlap with human activities. Here, we study the population genetic structure of bottlenose dolphins from the Archipelago of Bocas del Toro in Panama. This is a small population characterized by high site fidelity and is currently heavily-impacted by the local dolphin-watching industry. We collected skin tissue samples from 25 dolphins to study the genetic diversity and structure of this population. We amplified a portion of the mitochondrial Control Region (mtDNA-CR) and nine microsatellite loci. The mtDNA-CR analyses revealed that dolphins in Bocas del Toro belong to the ‘inshore form’, grouped with the Bahamas-Colombia-Cuba-Mexico population unit. They also possess a unique haplotype new for the Caribbean. The microsatellite data indicated that the Bocas del Toro dolphin population is highly structured, likely due to restricted movement patterns. Previous abundance estimates obtained with mark-recapture methods reported a small population of 80 dolphins (95% CI = 72–87), which is similar to the contemporary effective population size estimated in this study (Ne = 73 individuals; CI = 18.0 - ∞; 0.05). The combination of small population size, high degree of genetic isolation, and intense daily interactions with dolphin-watching boats puts the Bocas del Toro dolphin to at high risk of extinction. Despite national guidelines to regulate the dolphin-watching industry in Bocas del Toro and ongoing educational programs for tour operators, only in 2012 seven animals have died due to boat collisions. Our results suggest that the conservation status of bottlenose dolphins in

  12. Captive bottlenose dolphins and killer whales harbor a species-specific skin microbiota that varies among individuals. (United States)

    Chiarello, M; Villéger, S; Bouvier, C; Auguet, J C; Bouvier, T


    Marine animals surfaces host diverse microbial communities, which play major roles for host's health. Most inventories of marine animal surface microbiota have focused on corals and fishes, while cetaceans remain overlooked. The few studies focused on wild cetaceans, making difficult to distinguish intrinsic inter- and/or intraspecific variability in skin microbiota from environmental effects. We used high-throughput sequencing to assess the skin microbiota from 4 body zones of 8 bottlenose dolphins (Tursiops truncatus) and killer whales (Orcinus orca), housed in captivity (Marineland park, France). Overall, cetacean skin microbiota is more diverse than planktonic communities and is dominated by different phylogenetic lineages and functions. In addition, the two cetacean species host different skin microbiotas. Within each species, variability was higher between individuals than between body parts, suggesting a high individuality of cetacean skin microbiota. Overall, the skin microbiota of the assessed cetaceans related more to the humpback whale and fishes' than to microbiotas of terrestrial mammals.

  13. The relationship between heat flow and vasculature in the dorsal fin of wild bottlenose dolphins Tursiops truncatus. (United States)

    Meagher, Erin M; McLellan, William A; Westgate, Andrew J; Wells, Randall S; Frierson, Dargan; Pabst, D Ann


    The dorsal fin of the bottlenose dolphin Tursiops truncatus contains blood vessels that function either to conserve or to dissipate body heat. Prior studies have demonstrated that heat flux, measured from a single position on the dorsal fin, decreases during body cooling and diving bradycardia and increases after exercise and at the termination of the dive response. While prior studies attributed changes in heat flux to changes in the pattern of blood flow, none directly investigated the influence of vascular structures on heat flux across the dorsal fin. In this study we examined whether heat flux is higher directly over a superficial vein, compared to a position away from a vein, and investigated the temporal relationship between heart rate, respiration and heat flux. Simultaneous records of heat flux and skin temperature at three positions on the dorsal fins of 19 wild bottlenose dolphins (with the fin in air and submerged) were collected, together with heart rate and respiration. When the fin was submerged, heat flux values were highest over superficial veins, usually at the distal tip, suggesting convective delivery of heat, via blood, to the skin's surface. Conversely, in air there was no relationship between heat flux and superficial vasculature. The mean difference in heat flux (48 W m(-2)) measured between the three fin positions was often equal to or greater than the heat flux that had been recorded from a single position after exercising and diving in prior studies. Tachycardia at a respiratory event was not temporally related to an increase in heat flux across the dorsal fin. This study suggests that the dorsal fin is a spatially heterogeneous thermal surface and that patterns of heat flux are strongly influenced by underlying vasculature.

  14. Estrous cycle characterisation and artificial insemination using frozen-thawed spermatozoa in the bottlenose dolphin (Tursiops truncatus). (United States)

    Robeck, T R; Steinman, K J; Yoshioka, M; Jensen, E; O'Brien, J K; Katsumata, E; Gili, C; McBain, J F; Sweeney, J; Monfort, S L


    The reproductive endocrinology of the bottlenose dolphin, Tursiops truncatus, was characterized to facilitate the development of artificial insemination using cryopreserved spermatozoa. Specific objectives were: (i) to determine the excretory dynamics of urinary luteinizing hormone (LH) and ovarian steroid metabolites during the estrous cycle; (ii) to evaluate the effect of an exogenously administered synthetic progesterone analog (altrenogest) on reproductive hormone excretion; (iii) to correlate follicular growth and ovulation (as determined by transabdominal ultrasound) to urinary LH and ovarian steroid metabolites; (iv) examine the in vivo fertilisation capacity of cryopreserved semen, and (v) to develop an intrauterine insemination technique. Based on urinary endocrine monitoring of natural estrous cycles (2 consecutive cycles) and nine post altrenogest cycles in ten females, estrous cycles were found to be 36 days long and comprised of an 8 day and 19 day follicular and luteal phase, respectively. Peak estrogen conjugates (EC; 5.4+/-3.8 ng/mg creatinine (Cr)) occurred 8 h prior to the LH surge (70.9+/-115.7 ng/mg Cr). The time of ovulation, as determined by ultrasonography, occurred 32.1+/-8.9 h and 24.3+/-7.0 h after the onset of the LH surge and LH peak, respectively. Mean preovulatory follicular diameter and circumference were 2.1+/-0.5 cm and 6.5+/-1.5 cm, respectively. Of the 27 estrous synchronisation attempts, 13 resulted in an ovulatory cycle, with ovulation occurring 21 days post-altrenogest treatment. Intrauterine (4 of 5) and intracornual (1 of 3) inseminations conducted across eight estrous cycles resulted in five pregnancies (63%), one pregnancy resulted from the use of liquid stored semen, whereas four were achieved using cryopreserved semen. These data provide new information on female bottlenose dolphin reproductive physiology, and demonstrate that the combination of endocrine monitoring and serial ultrasonography contributed to successful AI

  15. Can bottlenose dolphins (Tursiops truncatus) cooperate when solving a novel task? (United States)

    Kuczaj, Stan A; Winship, Kelley A; Eskelinen, Holli C


    Cooperative behavior has been observed in cetacean species in a variety of situations, including foraging, mate acquisition, play, and epimeletic behavior. However, it has proven difficult to demonstrate cooperative behavior among dolphins in more controlled settings. Dolphins (Tursiops truncatus) in this study were exposed to a task that could most easily be solved if dolphins cooperated. Six dolphins were provided opportunities to solve the task and had to learn to do so without human intervention or training. Two adult males consistently and spontaneously jointly interacted in order to most efficiently open a container that contained fish by pulling on ropes at the ends of the container. Their interaction was viewed as cooperative because each dolphin pulled on their respective ropes in the opposite direction, which resulted in one end of the container opening. The dolphins did not show aggression toward one another while solving the task, and both dolphins consumed the food after the container was opened. They also engaged in synchronous non-aggressive behaviors with the container after the food had been consumed. It is possible that some of the remaining four dolphins would have cooperated, but the two successful dolphins were dominant males and their interest in the apparatus appeared to preclude other animals from participating.

  16. Sighting frequency and relative abundance of bottlenose dolphins (Tursiops truncatus) along the northeast coast of Margarita Island and Los Frailes Archipelago, Venezuela. (United States)

    Oviedo, Lenin; Silva, Noemi


    The study of local cetaceans in Venezuela has a very recent history, and few efforts have been made in the assessment of coastal populations based on field research. The occurrence of whales and dolphins along the northeast coast of Venezuela has been documented through sightings and stranding records. Given the underwater topographical features and the influence of upwelling processes, this area is considered a very productive coastal ecosystem. Our objective was to establish the sighting frequency and relative abundance of bottlenose dolphins in the area. Sighting records were gathered on bottlenose dolphins and other cetacean species occurring along the northeast coast of Margarita Island and Los Frailes Archipelago through direct observation during land-based (6 surveys, 48 hours of observation) and boat-based surveys (24 surveys, 121 hours of observation, 1295 km covered). A sighting frequency was calculated using two methodologies and then compared, considering: 1) a mean effective observation time (4.27 hours), and 2) distance covered with cetacean sightings (1108 kin). A third method is proposed relating a mean effective distance covered with cetacean sightings and expressed as a percentage. The abundance index was calculated using the mean effective observation time. The sighting frequency of Tursiops truncattus in the study area was 3 - 4 sightings per day of 4.27 observation hours, or by 185 kilometers covered. The relative abundance was calculated as 35 dolphins in the study area, so a total population of less than 60 dolphins could inhabit the proposed range. Tursiops truncatus is the dominant species in the northeast coast of Margarita Island and Los Frailes Archipelago with 70% of all the sightings, so this locality could be termed as the distribution range of a possible local population of bottlenose dolphins.

  17. Evaluation of motility, membrane status and DNA integrity of frozen-thawed bottlenose dolphin (Tursiops truncatus) spermatozoa after sex-sorting and recryopreservation. (United States)

    Montano, G A; Kraemer, D C; Love, C C; Robeck, T R; O'Brien, J K


    Artificial insemination (AI) with sex-sorted frozen-thawed spermatozoa has led to enhanced management of ex situ bottlenose dolphin populations. Extended distance of animals from the sorting facility can be overcome by the use of frozen-thawed, sorted and recryopreserved spermatozoa. Although one bottlenose dolphin calf had been born using sexed frozen-thawed spermatozoa derived from frozen semen, a critical evaluation of in vitro sperm quality is needed to justify the routine use of such samples in AI programs. Sperm motility parameters and plasma membrane integrity were influenced by stage of the sex-sorting process, sperm type (non-sorted and sorted) and freezing method (straw and directional) (P0.05) at 24 h. The viability of sorted spermatozoa was higher (Pdolphin spermatozoa undergoing cryopreservation, sorting and recryopreservation are of adequate quality for use in AI.

  18. Hematologic and serum biochemical reference intervals for free-ranging common bottlenose dolphins (Tursiops truncatus) and variation in the distributions of clinicopathologic values related to geographic sampling site. (United States)

    Schwacke, Lori H; Hall, Ailsa J; Townsend, Forrest I; Wells, Randall S; Hansen, Larry J; Hohn, Aleta A; Bossart, Gregory D; Fair, Patricia A; Rowles, Teresa K


    To develop robust reference intervals for hematologic and serum biochemical variables by use of data derived from free-ranging bottlenose dolphins (Tursiops truncatus) and examine potential variation in distributions of clinicopathologic values related to sampling sites' geographic locations. 255 free-ranging bottlenose dolphins. Data from samples collected during multiple bottlenose dolphin capture-release projects conducted at 4 southeastern US coastal locations in 2000 through 2006 were combined to determine reference intervals for 52 clinicopathologic variables. A nonparametric bootstrap approach was applied to estimate 95th percentiles and associated 90% confidence intervals; the need for partitioning by length and sex classes was determined by testing for differences in estimated thresholds with a bootstrap method. When appropriate, quantile regression was used to determine continuous functions for 95th percentiles dependent on length. The proportion of out-of-range samples for all clinicopathologic measurements was examined for each geographic site, and multivariate ANOVA was applied to further explore variation in leukocyte subgroups. A need for partitioning by length and sex classes was indicated for many clinicopathologic variables. For each geographic site, few significant deviations from expected number of out-of-range samples were detected. Although mean leukocyte counts did not vary among sites, differences in the mean counts for leukocyte subgroups were identified. Although differences in the centrality of distributions for some variables were detected, the 95th percentiles estimated from the pooled data were robust and applicable across geographic sites. The derived reference intervals provide critical information for conducting bottlenose dolphin population health studies.

  19. Skin Transcriptomes of common bottlenose dolphins (Tursiops truncatus) from the northern Gulf of Mexico and southeastern U.S. Atlantic coasts. (United States)

    Neely, Marion G; Morey, Jeanine S; Anderson, Paul; Balmer, Brian C; Ylitalo, Gina M; Zolman, Eric S; Speakman, Todd R; Sinclair, Carrie; Bachman, Melannie J; Huncik, Kevin; Kucklick, John; Rosel, Patricia E; Mullin, Keith D; Rowles, Teri K; Schwacke, Lori H; Van Dolah, Frances M


    Common bottlenose dolphins serve as sentinels for the health of their coastal environments as they are susceptible to health impacts from anthropogenic inputs through both direct exposure and food web magnification. Remote biopsy samples have been widely used to reveal contaminant burdens in free-ranging bottlenose dolphins, but do not address the health consequences of this exposure. To gain insight into whether remote biopsies can also identify health impacts associated with contaminant burdens, we employed RNA sequencing (RNA-seq) to interrogate the transcriptomes of remote skin biopsies from 116 bottlenose dolphins from the northern Gulf of Mexico and southeastern U.S. Atlantic coasts. Gene expression was analyzed using principal component analysis, differential expression testing, and gene co-expression networks, and the results correlated to season, location, and contaminant burden. Season had a significant impact, with over 60% of genes differentially expressed between spring/summer and winter months. Geographic location exhibited lesser effects on the transcriptome, with 23.5% of genes differentially expressed between the northern Gulf of Mexico and the southeastern U.S. Atlantic locations. Despite a large overlap between the seasonal and geographical gene sets, the pathways altered in the observed gene expression profiles were somewhat distinct. Co-regulated gene modules and differential expression analysis both identified epidermal development and cellular architecture pathways to be expressed at lower levels in animals from the northern Gulf of Mexico. Although contaminant burdens measured were not significantly different between regions, some correlation with contaminant loads in individuals was observed among co-expressed gene modules, but these did not include classical detoxification pathways. Instead, this study identified other, possibly downstream pathways, including those involved in cellular architecture, immune response, and oxidative stress

  20. Evaluation of Serum for Pathophysiological Effects of Prolonged Low Salinity Water Exposure in Displaced Bottlenose Dolphins (Tursiops truncatus) (United States)

    Ewing, Ruth Y.; Mase-Guthrie, Blair; McFee, Wayne; Townsend, Forrest; Manire, Charles A.; Walsh, Michael; Borkowski, Rose; Bossart, Gregory D.; Schaefer, Adam M.


    We conducted a retrospective study of serum biochemistry and hematologic findings from displaced, out-of-habitat bottlenose dolphins (Tursiops truncatus) exposed to various low salinity environments in waters along the southern United States including southeastern Atlantic and northern Gulf of Mexico. Serum sodium, chloride, and calculated osmolality were significantly lower and below reference ranges in displaced animals compared to free-ranging case control animals. This suggests clinical hyponatremia, hypochloremia, and hypo-osmolality due to an uptake of low saline water from the environment. In addition, significant differences were found in other serum chemistry variables, although none were outside of normal reference ranges for non-controlled free-ranging animals. Multiple linear regressions demonstrated the degree of salinity had a greater pathophysiologic response than the duration of fresh water exposure. The Na/Cl ratio and bicarbonate were the only variables that were significantly modulated by exposure duration. These findings suggest that the degree of salinity is a critical factor when assessing and managing care for dolphins chronically exposed to low salinity water. Results from this study indicate that changes in various biochemical parameters can be used to determine fresh water exposure and aid in determining the treatment for animals recovered from low salinity waters. PMID:28642866

  1. Evaluation of Serum for Pathophysiological Effects of Prolonged Low Salinity Water Exposure in Displaced Bottlenose Dolphins (Tursiops truncatus

    Directory of Open Access Journals (Sweden)

    Ruth Y. Ewing


    Full Text Available We conducted a retrospective study of serum biochemistry and hematologic findings from displaced, out-of-habitat bottlenose dolphins (Tursiops truncatus exposed to various low salinity environments in waters along the southern United States including southeastern Atlantic and northern Gulf of Mexico. Serum sodium, chloride, and calculated osmolality were significantly lower and below reference ranges in displaced animals compared to free-ranging case control animals. This suggests clinical hyponatremia, hypochloremia, and hypo-osmolality due to an uptake of low saline water from the environment. In addition, significant differences were found in other serum chemistry variables, although none were outside of normal reference ranges for non-controlled free-ranging animals. Multiple linear regressions demonstrated the degree of salinity had a greater pathophysiologic response than the duration of fresh water exposure. The Na/Cl ratio and bicarbonate were the only variables that were significantly modulated by exposure duration. These findings suggest that the degree of salinity is a critical factor when assessing and managing care for dolphins chronically exposed to low salinity water. Results from this study indicate that changes in various biochemical parameters can be used to determine fresh water exposure and aid in determining the treatment for animals recovered from low salinity waters.

  2. Geographic specificity of Aroclor 1268 in bottlenose dolphins (Tursiops truncatus) frequenting the Turtle/Brunswick River Estuary, Georgia (USA)

    International Nuclear Information System (INIS)

    Pulster, Erin L.; Maruya, Keith A.


    Coastal marine resources are at risk from anthropogenic contaminants, including legacy persistent organic pollutants (POPs) with half-lives of decades or more. To determine if polychlorinated biphenyl (PCB) signatures can be used to distinguish among local populations of inshore bottlenose dolphins (Tursiops truncatus) along the southeastern U.S. coast, blubber from free-ranging and stranded animals were collected along the Georgia coast in 2004 and analyzed for PCB congeners using gas chromatography with electron capture and negative chemical ionization mass spectrometric detection (GC-ECD and GC-NCI-MS). Mean total PCB concentrations (77 ± 34 μg/g lipid) were more than 10 fold higher and congener distributions were highly enriched in Cl 7 -Cl 10 homologs in free-ranging animals from the Turtle/Brunswick River estuary (TBRE) compared with strandings samples from Savannah area estuaries 90 km to the north. Using principal components analysis (PCA), the Aroclor 1268 signature associated with TBRE animals was distinct from that observed in Savannah area animals, and also from those in animals biopsied in other southeastern U.S estuaries. Moreover, PCB signatures in dolphin blubber closely resembled those in local preferred prey fish species, strengthening the hypothesis that inshore T. truncatus populations exhibit long-term fidelity to specific estuaries and making them excellent sentinels for assessing the impact of stressors on coastal ecosystem health

  3. Fishery gear interactions from stranded bottlenose dolphins, Florida manatees and sea turtles in Florida, U.S.A. (United States)

    Adimey, Nicole M; Hudak, Christine A; Powell, Jessica R; Bassos-Hull, Kim; Foley, Allen; Farmer, Nicholas A; White, Linda; Minch, Karrie


    Documenting the extent of fishery gear interactions is critical to wildlife conservation efforts, especially for reducing entanglements and ingestion. This study summarizes fishery gear interactions involving common bottlenose dolphins (Tursiops truncatus truncatus), Florida manatees (Trichechus manatus latirostris) and sea turtles: loggerhead (Caretta caretta), green turtle (Chelonia mydas), leatherback (Dermochelys coriacea), hawksbill (Eretmochelys imbricata), Kemp's ridley (Lepidochelys kempii), and olive ridley (Lepidochelys olivacea) stranding in Florida waters during 1997-2009. Fishery gear interactions for all species combined were 75.3% hook and line, 18.2% trap pot gear, 4.8% fishing nets, and 1.7% in multiple gears. Total reported fishery gear cases increased over time for dolphins (p<0.05), manatees (p<0.01), loggerheads (p<0.05) and green sea turtles (p<0.05). The proportion of net interaction strandings relative to total strandings for loggerhead sea turtles increased (p<0.05). Additionally, life stage and sex patterns were examined, fishery gear interaction hotspots were identified and generalized linear regression modeling was conducted. Published by Elsevier Ltd.

  4. Geographic specificity of Aroclor 1268 in bottlenose dolphins (Tursiops truncatus) frequenting the Turtle/Brunswick River Estuary, Georgia (USA)

    Energy Technology Data Exchange (ETDEWEB)

    Pulster, Erin L. [Marine Sciences Department, Savannah State University, Savannah, Georgia, 31404 (United States); Skidaway Institute of Oceanography, 10 Ocean Science Circle, Savannah, Georgia, 31411 (United States)], E-mail:; Maruya, Keith A. [Skidaway Institute of Oceanography, 10 Ocean Science Circle, Savannah, Georgia, 31411 (United States)


    Coastal marine resources are at risk from anthropogenic contaminants, including legacy persistent organic pollutants (POPs) with half-lives of decades or more. To determine if polychlorinated biphenyl (PCB) signatures can be used to distinguish among local populations of inshore bottlenose dolphins (Tursiops truncatus) along the southeastern U.S. coast, blubber from free-ranging and stranded animals were collected along the Georgia coast in 2004 and analyzed for PCB congeners using gas chromatography with electron capture and negative chemical ionization mass spectrometric detection (GC-ECD and GC-NCI-MS). Mean total PCB concentrations (77 {+-} 34 {mu}g/g lipid) were more than 10 fold higher and congener distributions were highly enriched in Cl{sub 7}-Cl{sub 10} homologs in free-ranging animals from the Turtle/Brunswick River estuary (TBRE) compared with strandings samples from Savannah area estuaries 90 km to the north. Using principal components analysis (PCA), the Aroclor 1268 signature associated with TBRE animals was distinct from that observed in Savannah area animals, and also from those in animals biopsied in other southeastern U.S estuaries. Moreover, PCB signatures in dolphin blubber closely resembled those in local preferred prey fish species, strengthening the hypothesis that inshore T. truncatus populations exhibit long-term fidelity to specific estuaries and making them excellent sentinels for assessing the impact of stressors on coastal ecosystem health.

  5. Increased number of whistles of bottlenose dolphins, Tursiops truncatus, arising from interaction with people. (United States)

    Akiyama, Junko; Ohta, Mitsuaki


    The acoustic mode is the most reasonable means for social animals such as dolphins to maintain contact in the underwater habitat, and has been developed since they moved to the sea. This study investigates variations in dolphin vocalizations under the following conditions in a captive environment: 1) before feeding (Pre-feeding), 2) during feeding (Feeding), 3) during free time without the presence of people (Free), 4) during interaction with people located upon a float (Float), 5) during interaction with people in the water (Water). During the experiments, a total of 2642 whistles were extracted from sonogram data using a spectrogram. About 44% of the total whistles were observed during Pre-feeding (1171/2642), and the number recorded during Free, when people were absent, was the smallest. The acoustic contours of dolphin whistles differed in different situations: convex, wave, and trill whistles were made repeatedly during Pre-feeding, thereby being more common at this time than at other times. The situation of Feeding saw an increased number of Upsweeps, which might be related to the use of echolocation. The lower frequencies were recorded during Pre-feeding, reflecting the emotion related to the dolphin's hunger. The results of this study indicate that dolphins increase their vocalization during interaction with people, suggesting that interactions with dolphins provide an effective treatment for human health problems, which is discussed with a reference article in this study. Vocal data obtained during contact with humans might serve as an important index for the dolphin-assisted therapy.

  6. Concentrations of metallic elements in kidney, liver, and lung tissue of Indo-Pacific bottlenose dolphin Tursiops aduncus from coastal waters of Zanzibar, Tanzania. (United States)

    Mapunda, Edgar C; Othman, Othman C; Akwilapo, Leonard D; Bouwman, Hindrik; Mwevura, Haji


    Concentrations of metallic elements in kidney, liver and lung tissues of Indo-Pacific bottlenose dolphins Tursiops aduncus from coastal waters of Zanzibar were determined using inductively coupled plasma - optical emission spectroscopy. Cadmium, chromium, copper, and zinc were quantifiable in all tissues at concentration ranges of 0.10-150, 0.08-3.2, 1.1-88 and 14-210μg/g dry mass, respectively. Copper and zinc was significantly higher in liver, and females had significantly higher Cd in liver, and chromium in lung. Generally, T. aduncus dolphins from coastal waters around Zanzibar carry low concentrations of metals compared with dolphins from other areas. Cadmium increased significantly with age in kidney and lung. Copper decreased significantly with age in liver, probably due to foetal metallothionein. This study supplied baseline data against which future trends in marine mammals in the Indian Ocean, the world's third largest, can be assessed. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Stereology of the thyroid gland in Indo-Pacific bottlenose dolphin (Tursiops aduncus in comparison with human (Homo sapiens: quantitative and functional implications.

    Directory of Open Access Journals (Sweden)

    Brian Chin Wing Kot

    Full Text Available The mammalian thyroid gland maintains basal metabolism in tissues for optimal function. Determining thyroid volume is important in assessing growth and involution. Volume estimation is also important in stereological studies. Direct measurements of colloid volume and nuclear-to-cytoplasmic ratio of the follicular cells may provide important information about thyroid gland function such as hormone storage and secretion, which helps understand the changes at morphological and functional levels. The present study determined the colloid volume using simple stereological principle and the nuclear-to-cytoplasmic ratio of 4 Indo-Pacific bottlenose dolphins and 2 human thyroid glands. In both dolphin and human thyroid glands, the size of the follicles tended to be quite variable. The distribution of large and small follicles within the thyroid gland was also found to be random in both the dolphin and human thyroid gland; however, the size of follicles appeared to decrease as a function of increasing age in the dolphin thyroid gland. The mean colloid volume of the dolphin thyroid gland and human thyroid gland was 1.22×10(5 µm(3 and 7.02×10(5 µm(3 respectively. The dolphin and human subjects had a significant difference in the mean colloid volume. The mean N/C ratio of the dolphin thyroid follicular epithelia and human follicular epithelia was 0.50 and 0.64 respectively. The dolphin and human subjects had a significant difference in the mean N/C ratio. This information contributes to understanding dolphin thyroid physiology and its structural adaptations to meet the physical demands of the aquatic environment, and aids with ultrasonography and corrective therapy in live subjects.

  8. Stereology of the thyroid gland in Indo-Pacific bottlenose dolphin (Tursiops aduncus) in comparison with human (Homo sapiens): quantitative and functional implications. (United States)

    Kot, Brian Chin Wing; Lau, Thomas Yue Huen; Cheng, Sammy Chi Him


    The mammalian thyroid gland maintains basal metabolism in tissues for optimal function. Determining thyroid volume is important in assessing growth and involution. Volume estimation is also important in stereological studies. Direct measurements of colloid volume and nuclear-to-cytoplasmic ratio of the follicular cells may provide important information about thyroid gland function such as hormone storage and secretion, which helps understand the changes at morphological and functional levels. The present study determined the colloid volume using simple stereological principle and the nuclear-to-cytoplasmic ratio of 4 Indo-Pacific bottlenose dolphins and 2 human thyroid glands. In both dolphin and human thyroid glands, the size of the follicles tended to be quite variable. The distribution of large and small follicles within the thyroid gland was also found to be random in both the dolphin and human thyroid gland; however, the size of follicles appeared to decrease as a function of increasing age in the dolphin thyroid gland. The mean colloid volume of the dolphin thyroid gland and human thyroid gland was 1.22×10(5) µm(3) and 7.02×10(5) µm(3) respectively. The dolphin and human subjects had a significant difference in the mean colloid volume. The mean N/C ratio of the dolphin thyroid follicular epithelia and human follicular epithelia was 0.50 and 0.64 respectively. The dolphin and human subjects had a significant difference in the mean N/C ratio. This information contributes to understanding dolphin thyroid physiology and its structural adaptations to meet the physical demands of the aquatic environment, and aids with ultrasonography and corrective therapy in live subjects.

  9. The broadband social acoustic signaling behavior of spinner and spotted dolphins (United States)

    Lammers, Marc O.; Au, Whitlow W. L.; Herzing, Denise L.


    Efforts to study the social acoustic signaling behavior of delphinids have traditionally been restricted to audio-range (communication signals at ultrasonic frequencies, broadband recordings of whistles and burst pulses were obtained from two commonly studied species of delphinids, the Hawaiian spinner dolphin (Stenella longirostris) and the Atlantic spotted dolphin (Stenella frontalis). Signals were quantitatively analyzed to establish their full bandwidth, to identify distinguishing characteristics between each species, and to determine how often they occur beyond the range of human hearing. Fundamental whistle contours were found to extend beyond 20 kHz only rarely among spotted dolphins, but with some regularity in spinner dolphins. Harmonics were present in the majority of whistles and varied considerably in their number, occurrence, and amplitude. Many whistles had harmonics that extended past 50 kHz and some reached as high as 100 kHz. The relative amplitude of harmonics and the high hearing sensitivity of dolphins to equivalent frequencies suggest that harmonics are biologically relevant spectral features. The burst pulses of both species were found to be predominantly ultrasonic, often with little or no energy below 20 kHz. The findings presented reveal that the social signals produced by spinner and spotted dolphins span the full range of their hearing sensitivity, are spectrally quite varied, and in the case of burst pulses are probably produced more frequently than reported by audio-range analyses.

  10. Functional brain imaging and bioacoustics in the Bottlenose dolphins, Tursiops truncatus (United States)

    Ridgway, Sam; Finneran, James; Carder, Donald; van Bonn, William; Smith, Cynthia; Houser, Dorian; Mattrey, Robert; Hoh, Carl


    The dolphin brain is the central processing computer for a complex and effective underwater echolocation and communication system. Until now, it has not been possible to study or diagnose disorders of the dolphin brain employing modern functional imaging methods like those used in human medicine. Our most recent studies employ established methods such as behavioral tasks, physiological observations, and computed tomography (CT) and, for the first time, single photon emission computed tomography (SPECT), and positron emission tomography (PET). Trained dolphins slide out of their enclosure on to a mat and are transported by trainers and veterinarians to the laboratory for injection of a ligand. Following ligand injection, brief experiments include trained vocal responses to acoustic, visual, or tactile stimuli. We have used the ligand technetium (Tc-99m) biscisate (Neurolite) to image circulatory flow by SPECT. Fluro-deoxy-d-glucose (18-F-FDG) has been employed to image brain metabolism with PET. Veterinarians carefully monitored dolphins during and after the procedure. Through these methods, we have demonstrated that functional imaging can be employed safely and productively with dolphins to obtain valuable information on brain structure and function for medical and research purposes. Hemispheric differences and variations in flow and metabolism in different brain areas will be shown.

  11. Gene expression changes in bottlenose dolphin, Tursiops truncatus, skin cells following exposure to methylmercury (MeHg) or perfluorooctane sulfonate (PFOS)

    International Nuclear Information System (INIS)

    Mollenhauer, Meagan A.M.; Carter, Barbara J.; Peden-Adams, Margie M.; Bossart, Gregory D.; Fair, Patricia A.


    Methylmercury (MeHg) and perfluorooctane sulfonate (PFOS) bioaccumulate and biomagnify in the environment and increasing concentrations of these pollutants have been found in wildlife and humans. Both chemicals are worldwide contaminants with wide ranging biological effects and have been identified in relatively high concentrations in apex level marine mammals such as bottlenose dolphins. The primary objective of this study was to determine if exposure to MeHg or PFOS would alter the gene expression in primary bottlenose dolphin epidermal cell cultures. Primary skin cells were isolated and cultured from skin samples collected from wild bottlenose dolphins. The cells were subsequently exposed to 13 ppm PFOS or 1 ppm MeHg and changes in gene expression were analyzed by suppressive subtractive hybridization (SSH) and quantitative real-time PCR (QPCR). 116 genes were positively identified in the dolphin skin cells by SSH. Of these, 16 total genes were analyzed by QPCR (9 and 11 genes following PFOS or MeHg exposure, respectively, with four overlapping genes). Results indicate MeHg significantly alters gene expression patterns following 24 h exposure, but has no measurable effect after only 1 h. PFOS exposure, however, caused significant alterations following both 1 and 25 h. Overall, the changes in gene expression observed indicate these concentrations of MeHg and PFOS significantly alter normal gene expression patterns. The changes in gene expression following exposure to these contaminants not only indicate a cellular stress response, but also decreased cell cycle progression and cellular proliferation and reduced protein translation. Alterations in normal cellular biology, like those observed, may lead to changes in health in marine mammals exposed to contaminants; however, this warrants further investigation

  12. Purine metabolism in response to hypoxic conditions associated with breath-hold diving and exercise in erythrocytes and plasma from bottlenose dolphins (Tursiops truncatus). (United States)

    Del Castillo Velasco-Martínez, Iris; Hernández-Camacho, Claudia J; Méndez-Rodríguez, Lía C; Zenteno-Savín, Tania


    In mammalian tissues under hypoxic conditions, ATP degradation results in accumulation of purine metabolites. During exercise, muscle energetic demand increases and oxygen consumption can exceed its supply. During breath-hold diving, oxygen supply is reduced and, although oxygen utilization is regulated by bradycardia (low heart rate) and peripheral vasoconstriction, tissues with low blood flow (ischemia) may become hypoxic. The goal of this study was to evaluate potential differences in the circulating levels of purine metabolism components between diving and exercise in bottlenose dolphins (Tursiops truncatus). Blood samples were taken from captive dolphins following a swimming routine (n=8) and after a 2min dive (n=8). Activity of enzymes involved in purine metabolism (hypoxanthine guanine phosphoribosyl transferase (HGPRT), inosine monophosphate deshydrogenase (IMPDH), xanthine oxidase (XO), purine nucleoside phosphorylase (PNP)), and purine metabolite (hypoxanthine (HX), xanthine (X), uric acid (UA), inosine monophosphate (IMP), inosine, nicotinamide adenine dinucleotide (NAD(+)), adenosine, adenosine monophosphate (AMP), adenosine diphosphate (ADP), ATP, guanosine diphosphate (GDP), guanosine triphosphate (GTP)) concentrations were quantified in erythrocyte and plasma samples. Enzymatic activity and purine metabolite concentrations involved in purine synthesis and degradation, were not significantly different between diving and exercise. Plasma adenosine concentration was higher after diving than exercise (p=0.03); this may be related to dive-induced ischemia. In erythrocytes, HGPRT activity was higher after diving than exercise (p=0.007), suggesting an increased capacity for purine recycling and ATP synthesis from IMP in ischemic tissues of bottlenose dolphins during diving. Purine recycling and physiological adaptations may maintain the ATP concentrations in bottlenose dolphins after diving and exercise. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. Gene expression changes in bottlenose dolphin, Tursiops truncatus, skin cells following exposure to methylmercury (MeHg) or perfluorooctane sulfonate (PFOS)

    Energy Technology Data Exchange (ETDEWEB)

    Mollenhauer, Meagan A.M. [Department of Pediatrics, Medical University of South Carolina, Charleston, SC (United States); Department of Molecular and Cellular Biology and Pathobiology, Medical University of South Carolina, Charleston, SC (United States)], E-mail:; Carter, Barbara J. [EcoArray, Inc., Gainesville, FL (United States); Peden-Adams, Margie M. [Department of Pediatrics, Medical University of South Carolina, Charleston, SC (United States); Department of Molecular and Cellular Biology and Pathobiology, Medical University of South Carolina, Charleston, SC (United States); Marine Biomedicine and Environmental Science Center, Medical University of South Carolina, Charleston, SC (United States); Mystic Aquarium and Institute for Exploration, Mystic, CT (United States); Bossart, Gregory D. [Harbor Branch Oceanographic Institution, Fort Pierce, FL (United States); Fair, Patricia A. [National Oceanic and Atmospheric Administration/National Ocean Service/Center for Coastal Environmental Health and Biomolecular Research, Charleston, SC (United States)


    Methylmercury (MeHg) and perfluorooctane sulfonate (PFOS) bioaccumulate and biomagnify in the environment and increasing concentrations of these pollutants have been found in wildlife and humans. Both chemicals are worldwide contaminants with wide ranging biological effects and have been identified in relatively high concentrations in apex level marine mammals such as bottlenose dolphins. The primary objective of this study was to determine if exposure to MeHg or PFOS would alter the gene expression in primary bottlenose dolphin epidermal cell cultures. Primary skin cells were isolated and cultured from skin samples collected from wild bottlenose dolphins. The cells were subsequently exposed to 13 ppm PFOS or 1 ppm MeHg and changes in gene expression were analyzed by suppressive subtractive hybridization (SSH) and quantitative real-time PCR (QPCR). 116 genes were positively identified in the dolphin skin cells by SSH. Of these, 16 total genes were analyzed by QPCR (9 and 11 genes following PFOS or MeHg exposure, respectively, with four overlapping genes). Results indicate MeHg significantly alters gene expression patterns following 24 h exposure, but has no measurable effect after only 1 h. PFOS exposure, however, caused significant alterations following both 1 and 25 h. Overall, the changes in gene expression observed indicate these concentrations of MeHg and PFOS significantly alter normal gene expression patterns. The changes in gene expression following exposure to these contaminants not only indicate a cellular stress response, but also decreased cell cycle progression and cellular proliferation and reduced protein translation. Alterations in normal cellular biology, like those observed, may lead to changes in health in marine mammals exposed to contaminants; however, this warrants further investigation.

  14. Pathophysiology of Stress in Wild and Managed-Care Bottlenose Dolphins (Tursiops truncatus) (United States)


    GGT) and amylase . Fibrinogen concentration was determined by the method of Schalm using heat precipitation. 7 ACTH, Cortisol, Aldosterone and...dolphins. GA dolphins had lower levels of total protein due to lower total alpha globulins, total beta globulins and total gamma globulin protein...bilirubin 0.09 0.03 0.07 0.05 0.10 0.00 Direct bilirubin 0.05 0.04 0.01 0.03 0.10 0.00 Indirect bilirubin 0.04 0.03 0.06 0.05 0.10 0.00 Amylase 2.87 0.28

  15. Foraging habits in a generalist predator: sex and age influence habitat selection and resource use among bottlenose dolphins (Tursiops truncatus) (United States)

    Sam Rossman,; McCabe, Elizabeth Berens; Nelio B. Barros,; Hasand Gandhi,; Peggy H. Ostrom,; Stricker, Craig A.; Randall S. Wells,


    This study examines resource use (diet, habitat use, and trophic level) within and among demographic groups (males, females, and juveniles) of bottlenose dolphins (Tursiops truncatus). We analyzed the δ13C and δ15N values of 15 prey species constituting 84% of the species found in stomach contents. We used these data to establish a trophic enrichment factor (TEF) to inform dietary analysis using a Bayesian isotope mixing model. We document a TEF of 0‰ and 2.0‰ for δ13C and δ15N, respectively. The dietary results showed that all demographic groups relied heavily on low trophic level seagrass-associated prey. Bayesian standard ellipse areas (SEAb) were calculated to assess diversity in resource use. The SEAb of females was nearly four times larger than that of males indicating varied resource use, likely a consequence of small home ranges and habitat specialization. Juveniles possessed an intermediate SEAb, generally feeding at a lower trophic level compared to females, potentially an effect of natal philopatry and immature foraging skills. The small SEAb of males reflects a high degree of specialization on seagrass associated prey. Patterns in resource use by the demographic groups are likely linked to differences in the relative importance of social and ecological factors.

  16. Recognition of Frequency Modulated Whistle-Like Sounds by a Bottlenose Dolphin (Tursiops truncatus) and Humans with Transformations in Amplitude, Duration and Frequency (United States)

    Branstetter, Brian K.; DeLong, Caroline M.; Dziedzic, Brandon; Black, Amy; Bakhtiari, Kimberly


    Bottlenose dolphins (Tursiops truncatus) use the frequency contour of whistles produced by conspecifics for individual recognition. Here we tested a bottlenose dolphin’s (Tursiops truncatus) ability to recognize frequency modulated whistle-like sounds using a three alternative matching-to-sample paradigm. The dolphin was first trained to select a specific object (object A) in response to a specific sound (sound A) for a total of three object-sound associations. The sounds were then transformed by amplitude, duration, or frequency transposition while still preserving the frequency contour of each sound. For comparison purposes, 30 human participants completed an identical task with the same sounds, objects, and training procedure. The dolphin’s ability to correctly match objects to sounds was robust to changes in amplitude with only a minor decrement in performance for short durations. The dolphin failed to recognize sounds that were frequency transposed by plus or minus ½ octaves. Human participants demonstrated robust recognition with all acoustic transformations. The results indicate that this dolphin’s acoustic recognition of whistle-like sounds was constrained by absolute pitch. Unlike human speech, which varies considerably in average frequency, signature whistles are relatively stable in frequency, which may have selected for a whistle recognition system invariant to frequency transposition. PMID:26863519

  17. Abundance and Summer Distribution of a Local Stock of Black Sea Bottlenose Dolphins, Tursiops truncatus (Cetacea, Delphinidae, in Coastal Waters near Sudak (Ukraine, Crimea

    Directory of Open Access Journals (Sweden)

    Gladilina E. V.


    Full Text Available The first assessment of abundance of a local population of bottlenose dolphins in the Black Sea (near the Sudak coast in 2011–2012 has been conducted: the results of a mark-recapture study of photo identified animals were complemented by a vessel line transect survey. The overall abundance of a population was estimated at between 621 ± 198 and 715 ± 267 animals (Chapman and Petersen estimates, and the majority of members of the population were recorded in the surveyed area. The summer range covered the area of a few hundred square kilometers, similar to migrating coastal stocks in other world regions. The greatest density of distribution was observed in August in sea 45–60 m deep; in addition, frequent approaches to the coastline are usual for dolphins of this stock. These trends in distribution may be partly explained by distribution of prey. Interaction with sprat trawling fisheries can be a factor shaping the local population structure. Coastal waters of Sudak and adjoining sea areas are an important habitat for bottlenose dolphins in the northern Black Sea, significant for their conservation.

  18. Mirror self-recognition in the bottlenose dolphin: a case of cognitive convergence. (United States)

    Reiss, D; Marino, L


    The ability to recognize oneself in a mirror is an exceedingly rare capacity in the animal kingdom. To date, only humans and great apes have shown convincing evidence of mirror self-recognition. Two dolphins were exposed to reflective surfaces, and both demonstrated responses consistent with the use of the mirror to investigate marked parts of the body. This ability to use a mirror to inspect parts of the body is a striking example of evolutionary convergence with great apes and humans.

  19. Sound Use, Sequential Behavior and Ecology of Foraging Bottlenose Dolphins, Tursiops Truncatus (United States)


    34... a conglomerate of many elements of very different order, of reflexes, of simple patterns like locomotion , of conditioned reactions, of ’insight...Discrimination of different metallic plates by an echolocating delphinid. In Animal Sonar Systems: Biology and Bionics (ed. R. G. Busnel), pp. 363...costs of flight and echolocation are high for bats. The relative costs of locomotion are likely to be much lower in swimming dolphins than flying bats

  20. Exploration of Horizontal Information Transmission through Social Learning in Juvenile Atlantic Spotted Dolphins (Stenella frontalis

    Directory of Open Access Journals (Sweden)

    Gaïane L. B. De Brabanter


    Full Text Available Although vertical (mother-to-offspring information transfer has been reported in dolphins, it is unclear whether horizontal information transfer takes place between peers of non-parental individuals. We hypothesized that horizontal information transmission takes place within juvenile social play-forage subgroups and within pairs of juveniles in the form of social learning, as a way for older juveniles to contribute to the further development of younger juveniles’ foraging skills. Since 1985, a long-term study in the Bahamas has involved the collection of underwater videos and sound recordings on the social structure of a resident community of free-ranging Atlantic spotted dolphins Stenella frontalis. Foraging behaviors of juvenile dolphins were analyzed in 24 independent foraging events recorded on video from 1994 to 2013. Forty-nine juveniles in total were observed, including eight individually identified juveniles foraging alone, eight individually identified juveniles foraging in pairs, and 33 juveniles foraging in eight subgroups of three or more dolphins. The comparison of older juveniles' behavior against younger juveniles' behavior in juvenile play-forage subgroups suggested the potential for horizontal transmission of information about prey location. However, we found no direct evidence for social learning or of teaching in pairs. This new information about wild Atlantic spotted dolphin social structure is a starting point in horizontal information transmission research and is important in terms of cognitive processes and welfare implications.

  1. Vascularization of air sinuses and fat bodies in the head of the Bottlenose dolphin (Tursiops truncatus: morphological implications on physiology

    Directory of Open Access Journals (Sweden)

    Alex eCostidis


    Full Text Available AbstractCetaceans have long been considered capable of limiting diving-induced nitrogen absorption and subsequent decompression sickness through a series of behavioral, anatomical, and physiological adaptations. Recent studies however suggest that in some situations these adaptive mechanisms might be overcome, resulting in lethal and sublethal injuries. Perhaps most relevant to this discussion is the finding of intravascular gas and fat emboli in mass-stranded beaked whales. Although the source of the gas emboli has as yet to been ascertained, preliminary findings suggest nitrogen is the primary component. Since nitrogen gas embolus formation in divers is linked to nitrogen saturation, it seems premature to dismiss similar pathogenic mechanisms in breath-hold diving cetaceans. Due to the various anatomical adaptations in cetacean lungs, the pulmonary system is thought of as an unlikely site of significant nitrogen absorption. The accessory sinus system on the ventral head of odontocete cetaceans contains a sizeable volume of air that is exposed to the changing hydrostatic pressures during a dive, and is intimately associated with vasculature potentially capable of absorbing nitrogen through its walls. The source of the fat emboli has also remained elusive. Most mammalian fat deposits are considered poorly-vascularized and therefore unlikely sites of intravascular introduction of lipid, although cetacean blubber may not be as poorly vascularized as previously thought. We present new data on the vasculature of air sinuses and acoustic fat bodies in the head of bottlenose dolphins and compare it to published accounts. We show that the mandibular fat bodies and accessory sinus system are associated with extensive venous plexuses and suggest potential physiological and pathological implications.

  2. Development and evaluation of deep intra-uterine artificial insemination using cryopreserved sexed spermatozoa in bottlenose dolphins (Tursiops truncatus). (United States)

    Robeck, Todd R; Montano, G A; Steinman, K J; Smolensky, P; Sweeney, J; Osborn, S; O'Brien, J K


    Since its development in bottlenose dolphins, widespread application of AI with sex-selected, frozen-thawed (FT) spermatozoa has been limited by the significant expense of the sorting process. Reducing the total number of progressively motile sperm (PMS) required for an AI would reduce the sorting cost. As such, this research compared the efficacy of small-dose deep uterine AI with sexed FT spermatozoa (SEXED-SMALL; ~50×10(6)PMS, n=20), to a moderate dose deposited mid-horn (SEXED-STD, ~200×10(6)PMS; n=20), and a large dose of FT non-sexed spermatozoa deposited in the uterine body (NONSEXED-LARGE, 660×10(6)PMS, n=9). Ten of the 11 calves resulting from use of sexed spermatozoa were of the predetermined sex. Similar rates of conception (NONSEXED-LARGE: 78%, SEXED-STD: 60%, SEXED-SMALL: 57%) and total pregnancy loss (TPL: NONSEXED-LARGE: 28.6%; SEXED-STD: 41.0%; SEXED-SMALL: 63.6%) were observed across groups, but early pregnancy loss (EPL,

  3. Identifying key demographic parameters of a small island-associated population of Indo-Pacific bottlenose dolphins (Reunion, Indian Ocean.

    Directory of Open Access Journals (Sweden)

    Violaine Dulau

    Full Text Available Photo-identification surveys of Indo-Pacific bottlenose dolphins were conducted from 2009 to 2014 off Reunion Island (55°E33'/21°S07', in the Indian Ocean. Robust Design models were applied to produce the most reliable estimate of population abundance and survival rate, while accounting for temporary emigration from the survey area (west coast. The sampling scheme consisted of a five-month (June-October sampling period in each year of the study. The overall population size at Reunion was estimated to be 72 individuals (SE = 6.17, 95%CI = 61-85, based on a random temporary emigration (γ" of 0.096 and a proportion of 0.70 (SE = 0.03 distinct individuals. The annual survival rate was 0.93 (±0.018 SE, 95%CI = 0.886-0.958 and was constant over time and between sexes. Models considering gender groups indicated different movement patterns between males and females. Males showed null or quasi-null temporary emigration (γ" = γ' < 0.01, while females showed a random temporary emigration (γ" of 0.10, suggesting that a small proportion of females was outside the survey area during each primary sampling period. Sex-specific temporary migration patterns were consistent with movement and residency patterns observed in other areas. The Robust Design approach provided an appropriate sampling scheme for deriving island-associated population parameters, while allowing to restrict survey effort both spatially (i.e. west coast only and temporally (five months per year. Although abundance and survival were stable over the six years, the small population size of fewer than 100 individuals suggested that this population is highly vulnerable. Priority should be given to reducing any potential impact of human activity on the population and its habitat.

  4. Characterization and phylogenetic analysis of a Cunninghamella bertholletiae isolate from a bottlenose dolphin (Tursiops truncatus). (United States)

    Bragulat, M Rosa; Castellá, Gemma; Isidoro-Ayza, Marcos; Domingo, Mariano; Cabañes, F Javier

    Cunninghamella is a genus of the order Mucorales which includes saprophytic species, rarely causing mycoses. The most frequently reported in human mycoses is the thermophilic species Cunninghamella bertholletiae. However, this species does not appear to cause mucormycosis in animals, so there is scarce information about C. bertholletiae isolates from animals. In this paper we describe the phenotypic and genotypic characterization, and the phylogenetic analysis, of an isolate of C. bertholletiae involved in a central nervous system mucormycosis in a dolphin. The isolate studied in this publication was characterized using the current morphological and physiological identification system for Cunninghamella species. DNA sequencing and analysis of the D1/D2 regions of the 26S rRNA gene and the ITS-5.8S rRNA gene sequences were also performed. Colonies were fast-growing, white at first, although they became tannish-gray, covering the whole plate after 7 days of incubation at 30 and 40°C. Limited growth was observed after 7 days at 45°C. The micromorphology showed characteristic erect sporangiophores. The identification of the isolate was confirmed by DNA sequencing of the D1/D2 regions of the 26S and the ITS-5.8S (ITS) rRNA gene sequencing. In the phylogenetic study, the isolate clustered in the same clade as C. bertholletiae neotype strain although some differences were observed in the ITS sequences. In the cetacean cases, the possible sources of infection are unclear. The reasons why this pathogen has been found only in cetaceans and not in other domestic or wild animals are at the moment unknown and need further study. Copyright © 2017 Asociación Española de Micología. Publicado por Elsevier España, S.L.U. All rights reserved.

  5. Successful amplification of mitochondrial DNA from dentin of the bottlenose dolphin Tursiops truncatus

    Directory of Open Access Journals (Sweden)

    Laura Isabel Weber


    Full Text Available Twenty-four teeth of Tursiops truncatus from the collection of the Marine Mammals Laboratory (FURG-RS were analysed for their potential as DNA source for population genetic and taxonomic studies. All teeth were submitted to decontamination, grinding and demineralisation processes. Dentin powder was weighed for DNA extraction, which was evaluated by the amplification of two mitochondrial genes through PCR using universal primers. Cytochrome-b gene was amplified successfully. PCR products showed concentrations of 3-12 ng/µl for dentin powder, which was positively correlated to the quantity of dentin powder used for DNA extraction. To rule out contamination a SSCP was carried out including positive controls, and samples of humans involved in the analysis. The SSCP patterns for T. truncatus differed from all others, showing also polymorphism for the region. It was concluded that dentin was a good source of mtDNA for genetic studies in dolphins.Vinte e quatro amostras de material dentário de Tursiops truncatus oriundas da coleção do Laboratório de Mamíferos Marinhos (FURG-RS foram avaliadas para determinar seu potencial como fonte de DNA para estudos genético-populacionais e sistemáticos. Todos os dentes foram submetidos a processos de desinfecção, trituração e desmineralização. A dentina obtida foi pesada previamente à extração de DNA, a qual foi avaliada através da amplificação de dois genes mitocondriais, através da técnica de PCR (Reação em Cadeia da Polimerase, utilizando oligonucleotídeos iniciadores universais. Obteve-se sucesso apenas na amplificação do gene Citocromo-b. Destes produtos obtiveram-se concentrações de 3-12 ng/µl para o material dentário, observando-se uma relação linear positiva com a quantidade em gramas utilizada na extração de DNA. Com o objetivo de eliminar a possibilidade de contaminação foi realizada uma análise SSCP (Polimorfismo Conformacional de Fita Simples incluindo os controles

  6. Ratiometric measurements of adiponectin by mass spectrometry in bottlenose dolphins (Tursiops truncatus with iron overload reveal an association with insulin resistance and glucagon

    Directory of Open Access Journals (Sweden)

    Benjamin A Neely


    Full Text Available High molecular weight (HMW adiponectin levels are reduced in humans with type 2 diabetes and insulin resistance. Similar to humans with insulin resistance, managed bottlenose dolphins (Tursiops truncatus diagnosed with hemochromatosis (iron overload have higher levels of 2 h post-prandial plasma insulin than healthy controls. A parallel reaction monitoring assay for dolphin serum adiponectin was developed based on tryptic peptides identified by mass spectrometry. Using identified post-translational modifications, a differential measurement was constructed. Total and unmodified adiponectin levels were measured in sera from dolphins with (n=4 and without (n=5 iron overload. This measurement yielded total adiponectin levels as well as site specific percent unmodified adiponectin that may inversely correlate with HMW adiponectin. Differences in insulin levels between iron overload cases and controls were observed 2 h post-prandial, but not during the fasting state. Thus, post-prandial as well as fasting serum adiponectin levels were measured to determine whether adiponectin and insulin would follow similar patterns. There was no difference in total adiponectin or percent unmodified adiponectin from case or control fasting animals. There was no difference in post-prandial total adiponectin levels between case and control dolphins (mean ± S.D. at 763 ± 298 and 727 ± 291 pmol/ml, respectively (p = 0.91; however, percent unmodified adiponectin was significantly higher in post-prandial cases compared controls (30.0 ± 6.3 versus 17.0 ± 6.6%, respectively; p = 0.016. Interestingly, both total and percent unmodified adiponectin were correlated with glucagon levels in controls (r = 0.999, p < 0.001, but not in cases, which is possibly a reflection of insulin resistance. Although total adiponectin levels were not significantly different, the elevated percent unmodified adiponectin follows a trend similar to HMW adiponectin reported for humans with

  7. Establishing baseline levels of trace elements in blood and skin of bottlenose dolphins in Sarasota Bay, Florida: Implications for non-invasive monitoring

    Energy Technology Data Exchange (ETDEWEB)

    Bryan, Colleen E. [National Institute of Standards and Technology, Hollings Marine Laboratory, 331 Fort Johnson Road, Charleston, South Carolina 29412 (United States); College of Charleston, Grice Marine Laboratory, 205 Fort Johnson Road, Charleston, South Carolina 29412 (United States)], E-mail:; Christopher, Steven J. [National Institute of Standards and Technology, Hollings Marine Laboratory, 331 Fort Johnson Road, Charleston, South Carolina 29412 (United States); Balmer, Brian C.; Wells, Randall S. [Chicago Zoological Society c/o Mote Marine Laboratory, 1600 Ken Thompson Parkway, Sarasota, Florida 34236 (United States)


    Several major unusual mortality events occurring in recent years have increased the level of concern for the health of bottlenose dolphin populations along the United States Atlantic and Gulf of Mexico coasts. Trace element concentrations were examined in a population of free-ranging dolphins in Sarasota Bay, Florida, in order to develop a benchmark for future comparisons within and between populations. Whole blood (n = 51) and skin (n = 40) samples were collected through capture and release health assessment events during 2002-2004. Samples were analyzed for Al, V, Cr, Mn, Cu, Zn, As, Se, Rb, Sr, Mo, Cd, and Pb by inductively coupled plasma mass spectrometry (ICPMS) and Hg via atomic fluorescence spectrometry (AFS). Trace element concentrations (wet mass) in skin were 2 to 45 times greater than blood, except Cu was approximately 1.5 times higher in blood. Statistically strong correlations (p < 0.05) were found for V, As, Se, Rb, Sr, and Hg between blood and skin demonstrating that these tissues can be used as effective non-lethal monitoring tools. The strongest correlation was established for Hg (r = 0.9689) and concentrations in both blood and skin were above the threshold at which detrimental effects are observed in other vertebrate species. Female dolphins had significantly greater Hg concentrations in blood and skin and Pb concentrations in skin, relative to males. Calves exhibited significantly lower V, As, and Hg concentrations in blood and V and Hg concentrations in skin, relative to other age classes. Rubidium and Cu concentrations in skin were greatest in subadults and calves, respectively. In blood, V, Zn, and As concentrations were significantly greater in winter, relative to summer, and the opposite trend was observed for Rb and Sr concentrations. In skin, Cu and Zn concentrations were significantly greater in winter, relative to summer, and the opposite trend was observed for Mn, Rb, Cd, and Pb concentrations. The baseline concentrations and trends

  8. Comparison of potential dietary and urinary risk factors for ammonium urate nephrolithiasis in two bottlenose dolphin (Tursiops truncatus) populations. (United States)

    Le-Bert, Carolina R; Smith, Cynthia R; Poindexter, John; Ardente, Amanda; Meegan, Jenny; Wells, Randall S; Venn-Watson, Stephanie; Jensen, Eric D; Sakhaee, Khashayar


    Dietary and urinary risk factors have been implicated in conditions favoring ammonium urate nephrolithiasis in managed dolphins compared to free-ranging dolphins. In this study, urine samples were collected from 16 dolphins (8 cases, 8 controls) from the U.S. Navy Marine Mammal Program (MMP) for the purposes of assessing changes in urinary biomarkers after a large meal. Urinary biomarkers and nephrolithiasis presence were assessed opportunistically in 15 long-term resident free-ranging dolphins living in Sarasota Bay, Florida (SB). Additionally, the total purine contents of fish commonly consumed by each dolphin population were measured to evaluate potential dietary risk factors. Populations were compared for total dietary purine composition, recently fed status, nephrolithiasis presence, and differences in urinary biochemical, acid-base, and physicochemical parameters via Wilcoxon rank sum analysis and least square means. Managed dolphins had higher urinary pH and ammonium (NH4+) in both pre- and postprandial conditions and higher urinary uric acid and saturation indices of NH4U in the postprandial condition compared to free-ranging dolphins (p dolphins (7 mmol/Mcal ME) than in the free-ranging dolphin diet (4 mmol/Mcal ME). Free-ranging dolphins did not show evidence of nephrolithiasis. Observed differences in urinary biomarkers and dietary purine content in these two dolphin populations suggest a pathophysiologic basis for the role of fish types on risk of NH4U stone formation. Future research should investigate fish type and feeding frequency, inhibitors and promoters, and alkalinizing therapy for reducing NH4U nephrolithiasis in dolphins.

  9. Real-time PCR assays for detection of Brucella spp. and the identification of genotype ST27 in bottlenose dolphins (Tursiops truncatus). (United States)

    Wu, Qingzhong; McFee, Wayne E; Goldstein, Tracey; Tiller, Rebekah V; Schwacke, Lori


    Rapid detection of Brucella spp. in marine mammals is challenging. Microbiologic culture is used for definitive diagnosis of brucellosis, but is time consuming, has low sensitivity and can be hazardous to laboratory personnel. Serological methods can aid in diagnosis, but may not differentiate prior exposure versus current active infection and may cross-react with unrelated Gram-negative bacteria. This study reports a real-time PCR assay for the detection of Brucella spp. and application to screen clinical samples from bottlenose dolphins stranded along the coast of South Carolina, USA. The assay was found to be 100% sensitive for the Brucella strains tested, and the limit of detection was 0.27fg of genomic DNA from Brucella ceti B1/94 per PCR volume. No amplification was detected for the non-Brucella pathogens tested. Brucella DNA was detected in 31% (55/178) of clinical samples tested. These studies indicate that the real-time PCR assay is highly sensitive and specific for the detection of Brucella spp. in bottlenose dolphins. We also developed a second real-time PCR assay for rapid identification of Brucella ST27, a genotype that is associated with human zoonotic infection. Positive results were obtained for Brucella strains which had been identified as ST27 by multilocus sequence typing. No amplification was found for other Brucella strains included in this study. ST27 was identified in 33% (18/54) of Brucella spp. DNA-positive clinical samples. To our knowledge, this is the first report on the use of a real-time PCR assay for identification of Brucella genotype ST27 in marine mammals. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Organochlorine, organobromine, metal, and selenium residues in bottlenose dolphins (Tursiops truncatus) collected during an unusual mortality event in the Gulf of Mexico, 1990. (United States)

    Kuehl, D W; Haebler, R


    Polychlorinated biphenyls (PCBs), cis-chlordane, oxychlordane, heptachlor epoxide, mirex, hexachlorobenzene (HCB), lindane, octachlorostyrene (OCS), p,p'-DDE,p,p'-DDT, dieldrin, triphenylphosphate (TPP), polybrominated biphenyls (PBBs), and polybrominated diphenyl ethers (PB-DPEs) were measured in the blubber, and five metals (mercury, lead, cadmium, chromium, and manganese) and selenium were measured in the liver of bottlenose dolphins (Tursiops truncatus) obtained from the Gulf of Mexico during an unusual mortality event in 1990. The collection of animals included fetuses, sucklings (< 1 year old), immature dolphins (2-5 years old), and adults of both sexes. PCBs, p,p'-DDE, HCB, and PBDPEs were detected in the blubber of each animal. Mean concentrations of organic contaminants were generally highest in adult males. p,p'-DDE was the single component analyte measured at the highest concentration. Immature females had greater concentrations of most chlorinated organics than adult females. Mercury and cadmium concentrations in liver increased with increasing age-class. The correlation between mercury and selenium in all animals was r = 0.96, with a mole ratio of 0.90. Concentrations of lead, manganese, cadmium, and chromium did not follow any particular age-class trend.

  11. A systematic health assessment of indian ocean bottlenose (Tursiops aduncus and indo-pacific humpback (Sousa plumbea dolphins incidentally caught in shark nets off the KwaZulu-Natal Coast, South Africa.

    Directory of Open Access Journals (Sweden)

    Emily P Lane

    Full Text Available Coastal dolphins are regarded as indicators of changes in coastal marine ecosystem health that could impact humans utilizing the marine environment for food or recreation. Necropsy and histology examinations were performed on 35 Indian Ocean bottlenose dolphins (Tursiops aduncus and five Indo-Pacific humpback dolphins (Sousa plumbea incidentally caught in shark nets off the KwaZulu-Natal coast, South Africa, between 2010 and 2012. Parasitic lesions included pneumonia (85%, abdominal and thoracic serositis (75%, gastroenteritis (70%, hepatitis (62%, and endometritis (42%. Parasitic species identified were Halocercus sp. (lung, Crassicauda sp. (skeletal muscle and Xenobalanus globicipitis (skin. Additional findings included bronchiolar epithelial mineralisation (83%, splenic filamentous tags (45%, non-suppurative meningoencephalitis (39%, and myocardial fibrosis (26%. No immunohistochemically positive reaction was present in lesions suggestive of dolphin morbillivirus, Toxoplasma gondii and Brucella spp. The first confirmed cases of lobomycosis and sarcocystosis in South African dolphins were documented. Most lesions were mild, and all animals were considered to be in good nutritional condition, based on blubber thickness and muscle mass. Apparent temporal changes in parasitic disease prevalence may indicate a change in the host/parasite interface. This study provided valuable baseline information on conditions affecting coastal dolphin populations in South Africa and, to our knowledge, constitutes the first reported systematic health assessment in incidentally caught dolphins in the Southern Hemisphere. Further research on temporal disease trends as well as disease pathophysiology and anthropogenic factors affecting these populations is needed.

  12. A systematic health assessment of indian ocean bottlenose (Tursiops aduncus) and indo-pacific humpback (Sousa plumbea) dolphins incidentally caught in shark nets off the KwaZulu-Natal Coast, South Africa. (United States)

    Lane, Emily P; de Wet, Morné; Thompson, Peter; Siebert, Ursula; Wohlsein, Peter; Plön, Stephanie


    Coastal dolphins are regarded as indicators of changes in coastal marine ecosystem health that could impact humans utilizing the marine environment for food or recreation. Necropsy and histology examinations were performed on 35 Indian Ocean bottlenose dolphins (Tursiops aduncus) and five Indo-Pacific humpback dolphins (Sousa plumbea) incidentally caught in shark nets off the KwaZulu-Natal coast, South Africa, between 2010 and 2012. Parasitic lesions included pneumonia (85%), abdominal and thoracic serositis (75%), gastroenteritis (70%), hepatitis (62%), and endometritis (42%). Parasitic species identified were Halocercus sp. (lung), Crassicauda sp. (skeletal muscle) and Xenobalanus globicipitis (skin). Additional findings included bronchiolar epithelial mineralisation (83%), splenic filamentous tags (45%), non-suppurative meningoencephalitis (39%), and myocardial fibrosis (26%). No immunohistochemically positive reaction was present in lesions suggestive of dolphin morbillivirus, Toxoplasma gondii and Brucella spp. The first confirmed cases of lobomycosis and sarcocystosis in South African dolphins were documented. Most lesions were mild, and all animals were considered to be in good nutritional condition, based on blubber thickness and muscle mass. Apparent temporal changes in parasitic disease prevalence may indicate a change in the host/parasite interface. This study provided valuable baseline information on conditions affecting coastal dolphin populations in South Africa and, to our knowledge, constitutes the first reported systematic health assessment in incidentally caught dolphins in the Southern Hemisphere. Further research on temporal disease trends as well as disease pathophysiology and anthropogenic factors affecting these populations is needed.

  13. Dolphins. LC Science Tracer Bullet. (United States)

    Niskern, Diana, Comp.

    The family Delphinidae is the largest family of toothed whales. It includes not only those mammals commonly referred to as dolphins, such as the bottlenosed dolphin often seen in captivity, but also the killer whale. This literature and resources guide is not intended to be a comprehensive bibliography on dolphins; the guide is designed--as the…

  14. Sighting frequency and relative abundance of bottlenose dolphins (Tursiops truncatus along the northeast coast of Margarita Island and Los Frailes Archipelago, Venezuela

    Directory of Open Access Journals (Sweden)

    Lenin Oviedo


    Full Text Available The study of local cetaceans in Venezuela has a very recent history, and few efforts have been made in the assessment of coastal populations based on field research. The occurrence of whales and dolphins along the northeast coast of Venezuela has been documented through sightings and stranding records. Given the underwater topographical features and the influence of upwelling processes, this area is considered a very productive coastal ecosystem. Our objective was to establish the sighting frequency and relative abundance of bottlenose dolphins in the area. Sighting records were gathered on bottlenose dolphins and other cetacean species occurring along the northeast coast of Margarita Island and Los Frailes Archipelago through direct observation during land-based (6 surveys, 48 hours of observation and boat-based surveys (24 surveys, 121 hours of observation, 1295 km covered. A sighting frequency was calculated using two methodologies and then compared, considering: 1 a mean effective observation time (4.27 hours, and 2 distance covered with cetacean sightings (1108 km. A third method is proposed relating a mean effective distance covered with cetacean sightings and expressed as a percentage. The abundance index was calculated using the mean effective observation time. The sighting frequency of Tursiops truncatus in the study area was 3 - 4 sightings per day of 4.27 observation hours, or by 185 kilometers covered. The relative abundance was calculated as 35 dolphins in the study area, so a total population of less than 60 dolphins could inhabit the proposed range. Tursiops truncatus is the dominant species in the northeast coast of Margarita Island and Los Frailes Archipelago with 70% of all the sightings, so this locality could be termed as the distribution range of a possible local population of bottlenose dolphins. Rev. Biol. Trop. 53(3-4: 595-600. Epub 2005 Oct 3.El estudio de cetáceos locales en Venezuela tiene una historia bien reciente

  15. Where's That Dolphin? (United States)

    Kovacs, Carolyn; Curran, Mary Carla; Cox, Tara


    In this article , the authors describe an activity in which students in Savannah, Georgia, use handheld GPS devices to record the sightings of bottlenose dolphins, examine spatial data from five pairs of dolphins in the study, and then form hypotheses about the spatial patterns they observe. In the process, they learn not only about the ecology of…

  16. The Influence of Age, Sex, and Social Affiliation on the Responses of Bottlenose Dolphins (Tursiops truncatus to a Novel Stimulus Over Time

    Directory of Open Access Journals (Sweden)

    Melissa M. Lopes


    Full Text Available Responses to novelty may differ among individuals as a function of age, sex, and/or the presence of offspring, and understanding how marine mammals respond to novel stimuli is critical to management. In this study, 20 captive Atlantic bottlenose dolphins (Tursiops truncatus were exposed to a novel object, consisting of PVC pipes and either a non-reflective or reflective surface. Their responses, broadly defined as either non-social or social, non-aggressive or aggressive interactions with the stimulus, were recorded across 10 exposure trials and compared among age classes and between males and females. Adult females exhibited the highest frequency of interactions, and those with dependent calves participated in more social interactions. Both adults and calves displayed a significantly greater frequency of interactions and aggression when exposed to the reflective versus non-reflective surface, indicating that the characteristics of the stimulus influenced the response. Although the number of interactions did not change across repeated exposures, there were significantly more aggressive interactions during later exposures, suggesting sensitization to the stimulus. There was no evidence of habituation over time for any of the subjects. Thus, when managing marine mammal exposure to anthropogenic stimuli, it is important to consider the demographics of the population, as well as the characteristics of the stimulus that may contribute to habituation, sensitization, and/or tolerance.

  17. Serum antibody levels against select bacterial pathogens in Atlantic bottlenose dolphins, Tursiops truncatus, from Beaufort NC USA and Charleston Harbor, Charleston, SC, USA. (United States)

    Beck, B M; Rice, C D


    Concern over the emergence of zoonotic diseases in marine organisms is growing. In response to this concern, this study set out to measure antibody activities against bacterial pathogens in Atlantic bottlenose dolphins, Tursiops truncatus, from the coastal estuaries of NC and SC, USA. Individuals from Charleston SC harbor, a heavily industrialized shipping harbor estuary, and from Beaufort NC, a non-shipping estuary, were examined. Purified IgG was obtained from pooled sera using ammonium sulfate precipitation steps and protein-G procedures, which was then used to generate a panel of IgG-specific monoclonal antibodies. Two of these antibodies, mAbs BB-10-2 (IgG1) and BB-32-2 (IgG2b), were then used to determine total serum IgG concentrations using a sandwich capture ELISA. Circulating IgG levels were variable between individuals and between the two pods. MAb BB-10-2 was then used in an indirect ELISA to determine serum antibody activities against several common marine bacteria as well as the human pathogens E. coli and E. coli strain 0157:H7, Vibrio parahemolyticus, V. vulnificus, V. cholerae, Mycobacteria marinum, M. fortuitum, and M. chelonae. The highest antibody activities were against mycobacteria, two of which are zoonotic pathogens. Males had the highest antibody activities, thus suggesting low cell-mediated immunity against intracellular pathogens in these individuals. T-cell proliferation in response to Con-A, an indicator of cell-mediated immune function, was then measured in the Beaufort population. Males had the lowest proliferation responses, however a negative correlation between antibody activities and T-cell proliferation in individuals could not be established for either of the Mycobacteria species. Overall, antibody activities against all bacteria, including innocuous species such as V. anguillarum, V. natrigens, and M. xenopi were highly variable between individual dolphins and the two pods, with some animals exhibiting very high activities

  18. Identification of monoclonal antibodies cross-reactive with bottlenose dolphin orthologues of the major histocompatibility complex and leukocyte differentiation molecules. (United States)

    Elnaggar, Mahmoud M; Abdellrazeq, Gaber S; Venn-Watson, Stephanie K; Jensen, Eric D; Hulubei, Victoria; Fry, Lindsay M; Sacco, Randy E; Davis, William C


    The slow progress in understanding immunotoxic effects of environmental contaminants and their influence on disease susceptibility in whales is largely due to the limited information available on the immune systems and immune function of species included in the Cetancodontamorpha clade. Studies in species in the other major clades included in the Artiodactylamorpha, Ruminantiamorpha, Suinamorpha, and Camelidamorpha have revealed the immune systems are similar, but not identical. The present study was undertaken to expand the available monoclonal antibody reagents needed to gain insight into the composition, function, and evolution of the immune system in Cetancodontamorpha, using the dolphin (Tursiops truncatus) as a model cetacean species. Screening of a set of mAbs that recognize highly conserved epitopes expressed on the major histocompatibility complex (MHC) and leukocyte differentiation molecules (LDMs) in cattle by flow cytometry revealed some of the mAbs recognize epitopes conserved on dolphin orthologues of MHC class I, MHC class II, CD11a, CD14, CD16, CD18, CD163 and CD172a. Comparison of the amino acid sequences of dolphin and bovine orthologues revealed limited changes in sequence have occurred during speciation, suggesting an approach for developing cross-reactive mAbs for use in cetacean research. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Isotope turnover rates and diet-tissue discrimination in skin of ex situ bottlenose dolphins (Tursiops truncatus). (United States)

    Browning, Nicole E; Dold, Christopher; I-Fan, Jack; Worthy, Graham A J


    Diet-tissue discrimination factors (Δ(15)N or Δ(13)C) and turnover times are thought to be influenced by a wide range of variables including metabolic rate, age, dietary quality, tissue sampled and the taxon being investigated. In the present study, skin samples were collected from ex situ dolphins that had consumed diets of known isotopic composition for a minimum of 8 weeks. Adult dolphins consuming a diet of low fat (5-6%) and high δ(15)N value had significantly lower Δ(15)N values than animals consuming a diet with high fat (13.9%) and low δ(15)N value. Juvenile dolphins consuming a diet with low fat and an intermediate δ(15)N value had significantly higher Δ(15)N values than adults consuming the same diet. Calculated half-lives for δ(15)N ranged from 14 to 23 days (17.2 ± 1.3 days). Half-lives for δ(13)C ranged from 11 to 23 days with a significant difference between low fat (13.9 ± 4.8 days) and high fat diets (22.0 ± 0.5 days). Overall, our results indicate that while assuming a Δ(13)C value of 1‰ may be appropriate for cetaceans, Δ(15)N values may be closer to 1.5‰ rather than the commonly assumed 3‰. Our data also suggest that understanding seasonal variability in prey composition is another significant consideration when applying discrimination factors or turnover times to field studies focused on feeding habits. Isotope retention times of only a few weeks suggest that, in addition, these isotope data could play an important role in interpreting recent fine-scale habitat utilization and residency patterns.

  20. Novel Atlantic bottlenose dolphin parainfluenza virus TtPIV-1 clusters with bovine PIV-3 genotype B strains. (United States)

    Eberle, Kirsten C; Neill, John D; Venn-Watson, Stephanie K; McGill, Jodi L; Sacco, Randy E


    Parainfluenza virus 3 (PIV-3) is a common viral infection not only in humans, but also in many other species. Serological evidence suggests that nearly 100 % of children in the United States have been infected with PIV-3 by 5 years of age. Similarly, in cattle, PIV-3 is commonly associated with bovine respiratory disease complex. A novel dolphin PIV-3 (TtPIV-1) was described by Nollens et al. in 2008 from a dolphin that was diagnosed with an unknown respiratory illness. At that time, TtPIV-1 was found to be most similar to, but distinct from, bovine PIV-3 (BPIV-3). In the present study, similar viral growth kinetics and pro-inflammatory cytokine (IL-1β, IL-6, and CXCL8) production were seen between BPIV-3 and TtPIV-1 in BEAS-2B, MDBK, and Vero cell lines. Initial nomenclature of TtPIV-1 was based on partial sequence of the fusion and RNA polymerase genes. Based on the similarities we saw with the in vitro work, it was important to examine the TtPIV-1 genome in more detail. Full genome sequencing and subsequent phylogenetic analysis revealed that all six viral genes of TtPIV-1 clustered within the recently described BPIV-3 genotype B strains, and it is proposed that TtPIV-1 be re-classified with BPIV-3 genotype B strains.

  1. Animal behavior. Dolphins whistle a signature tune. (United States)

    Tyack, P L


    Dolphins are remarkably intelligent creatures renowned for their ability to imitate manmade sounds and for producing individual signature whistles that enable them to recognize each other. Now, in his Perspective, Tyack discusses new findings showing that vocal imitation is important for communication among bottlenose dolphins in the wild (Janik). Apparently, bottlenose dolphins, when they are separated in the wild, address each other by matching each other's whistles.

  2. Mercury bio magnification in the Atlantic spotted dolphin (Stenella frontalis) food chain, using nitrogen stable isotope as an ecological tracer

    International Nuclear Information System (INIS)

    Kehrig, Helena A; Baptista, Gilberto; Di Beneditto, Ana Paula M; Almeida, Marcelo G; Rezende, Carlos E; Siciliano, Salvatore; De Moura, Jailson F; Moreira, Isabel


    An assessment of mercury (Hg) concentrations and nitrogen stable isotope (δ 15 N) was conducted in the food chain of the Atlantic spotted dolphin (Stenella frontalis), including phytoplankton, zooplankton, planktivorous fish and its major prey (predatory fish and a single species of cephalopod), that compose a tropical trophic chain of the Brazilian southeastern coast. Tissue concentrations of Hg in a voracious predator fish, the largehead hairtail (Trichiurus lepturus), one of the dolphin's prey, were 9.8 times lower than median concentrations found in dolphin tissues. δ 15 N values in predatory fish were found to be lower to those of its predator the spotted dolphin. Isotopic data suggested significant differences for ? 15N along the trophic chain, with the top predator (dolphin) exhibiting heavier value, followed by the voracious predator fish and the benthonic carnivorous fish, the whitemouth croaker (Micropogonias furnieri). Phytoplankton displayed the lightest δ 15 N, followed by zooplankton and the planktophagous fish, the lebranche mullet (Mugil liza). This fish species and the cephalopod showed the lowest median Hg concentration. All links of the entire trophic chain presented trophic transfer of Hg with a biomagnification factor higher than 1. A significant relationship was found between the log Hg concentration and trophic level (TL) of all evaluated species, with a positive slope (β= 0.87). The calculated trophic magnification factor (TMF7.44) indicates that Hg concentration increased per TL, and also that the entire coastal food chain from the South Atlantic Ocean presented a biomagnification power of Hg within a range previously reported for tropical coastal ecosystems. Key words: Marine mammal, coastal aquatic biota, toxic element, biotransference, ecological tracer

  3. The neocortex of cetartiodactyls: I. A comparative Golgi analysis of neuronal morphology in the bottlenose dolphin (Tursiops truncatus), the minke whale (Balaenoptera acutorostrata), and the humpback whale (Megaptera novaeangliae). (United States)

    Butti, Camilla; Janeway, Caroline M; Townshend, Courtney; Wicinski, Bridget A; Reidenberg, Joy S; Ridgway, Sam H; Sherwood, Chet C; Hof, Patrick R; Jacobs, Bob


    The present study documents the morphology of neurons in several regions of the neocortex from the bottlenose dolphin (Tursiops truncatus), the North Atlantic minke whale (Balaenoptera acutorostrata), and the humpback whale (Megaptera novaeangliae). Golgi-stained neurons (n = 210) were analyzed in the frontal and temporal neocortex as well as in the primary visual and primary motor areas. Qualitatively, all three species exhibited a diversity of neuronal morphologies, with spiny neurons including typical pyramidal types, similar to those observed in primates and rodents, as well as other spiny neuron types that had more variable morphology and/or orientation. Five neuron types, with a vertical apical dendrite, approximated the general pyramidal neuron morphology (i.e., typical pyramidal, extraverted, magnopyramidal, multiapical, and bitufted neurons), with a predominance of typical and extraverted pyramidal neurons. In what may represent a cetacean morphological apomorphy, both typical pyramidal and magnopyramidal neurons frequently exhibited a tri-tufted variant. In the humpback whale, there were also large, star-like neurons with no discernable apical dendrite. Aspiny bipolar and multipolar interneurons were morphologically consistent with those reported previously in other mammals. Quantitative analyses showed that neuronal size and dendritic extent increased in association with body size and brain mass (bottlenose dolphin whale humpback whale). The present data thus suggest that certain spiny neuron morphologies may be apomorphies in the neocortex of cetaceans as compared to other mammals and that neuronal dendritic extent covaries with brain and body size.

  4. Mother-Offspring Signature Whistle Similarity and Patterns of Association in Atlantic Spotted Dolphins (Stenella frontalis

    Directory of Open Access Journals (Sweden)

    Sara E. Bebus


    Full Text Available We assessed the degree of similarity between signature whistles of mother and offspring pairs in free-living Atlantic spotted dolphins (Stenella frontalis. As a means of qualitative evaluation, judges compared the time-frequency contour patterns of signature whistle spectrograms. We also evaluated quantitative measurements of whistle frequency and duration. All five female offspring produced signature whistles that were similar to their mothers’ whistles by a least one means of comparison, whereas two of the four male offspring produced signature whistles that were dissimilar from their mothers’ by both methods of comparison. However, statistically, male offspring were just as likely to produce signature whistles like their mothers’ as female offspring (p = 0.167. We compared whistle similarity between mothers and offspring to the degree of association for each pair. Offspring that most often associated with their mothers when they were four years of age had whistles that were more similar to their mothers’ whistles both qualitatively (r(4 = 0.92, p = 0.009 and quantitatively (r(4 = 0.92, p = 0.004. Because signature whistles are developed within a dolphin’s first year, our finding likely reflects the level of bond between mother and calf.

  5. Abundancia de dos poblaciones de toninas (Tursiops truncatus en el norte de Veracruz, México Abundance of two populations of bottlenose dolphins (Tursiops truncatus in northern Veracruz, Mexico

    Directory of Open Access Journals (Sweden)

    Michelle P. Valdes-Arellanes


    Full Text Available En México no se conoce el tamaño de las poblaciones de la tonina (Tursiops truncatus debido a su gran movilidad y al ocasional intercambio de individuos entre poblaciones. El objetivo de este estudio fue determinar la abundancia de toninas en la zona norte de Veracruz. De marzo de 2005 a diciembre de 2007 se realizaron 50 navegaciones con un esfuerzo total de 236.7 horas. Los resultados obtenidos de la foto-identificación de toninas, se emplearon en el modelo Jolly-Seber y se estimó con este modelo un total de N=302 ±113 organismos para toda el área de estudio. Para Tamiahua, se estimó una población de N=177 ± 10 delfines y para Tuxpan N=161 ± 68 delfines. Estos resultados sugieren que existe un mínimo intercambio de delfines entre zonas y por tanto, las poblaciones no están aisladas; sin embargo, los organismos tienen preferencia por ciertas áreas. La foto-recaptura de algunos individuos en la zona de Tamiahua confirma que la fidelidad al sitio se ha mantenido por 13 años. Es probable que esto se deba a que cada una de las zonas presenta estuarios con alta productividad que son ideales para refugio y crianza de las toninas.In Mexico, the population size of the bottlenose dolphin (Tursiops truncatus is unknown, due to the fact that they are highly mobile, and occasionally there are exchanges of individuals between populations. The objective of this study was to determine the abundance of dolphins in the north of Veracruz. From March 2005 to December 2007 were 50 surveys with a total effort of 236.7 hours. The results of the photo-identification of dolphins were used in the Jolly-Seber model, and with this model we estimated a total of N = 302 ± 113 dolphins throughout the study area. For Tamiahua a population estimate of N = 177 ± 10 dolphins, and for Tuxpan N = 161 ± 68 dolphins. These results suggest that there is minimal exchange of dolphins between areas; therefore it is assumed that populations are not isolated but dolphins

  6. Molecular assessment of mating strategies in a population of Atlantic spotted dolphins.

    Directory of Open Access Journals (Sweden)

    Michelle L Green

    Full Text Available Similar to other small cetacean species, Atlantic spotted dolphins (Stenella frontalis have been the object of concentrated behavioral study. Although mating and courtship behaviors occur often and the social structure of the population is well-studied, the genetic mating system of the species is unknown. To assess the genetic mating system, we genotyped females and their progeny at ten microsatellite loci. Genotype analysis provided estimates of the minimum number of male sires necessary to account for the allelic diversity observed among the progeny. Using the estimates of male sires, we determined whether females mated with the same or different males during independent estrus events. Using Gerud2.0, a minimum of two males was necessary to account for the genetic variation seen among progeny arrays of all tested females. ML-Relate assigned the most likely relationship between offspring pairs; half or full sibling. Relationship analysis supported the conservative male estimates of Gerud2.0 but in some cases, half or full sibling relationships between offspring could not be fully resolved. Integrating the results from Gerud2.0, ML-Relate with previous observational and paternity data, we constructed two-, three-, and four-male pedigree models for each genotyped female. Because increased genetic diversity of offspring may explain multi-male mating, we assessed the internal genetic relatedness of each offspring's genotype to determine whether parent pairs of offspring were closely related. We found varying levels of internal relatedness ranging from unrelated to closely related (range -0.136-0.321. Because there are several hypothesized explanations for multi-male mating, we assessed our data to determine the most plausible explanation for multi-male mating in our study system. Our study indicated females may benefit from mating with multiple males by passing genes for long-term viability to their young.

  7. Platelet-rich plasma and adipose-derived mesenchymal stem cells for regenerative medicine-associated treatments in bottlenose dolphins (Tursiops truncatus.

    Directory of Open Access Journals (Sweden)

    Richard J Griffeth

    Full Text Available Dolphins exhibit an extraordinary capacity to heal deep soft tissue injuries. Nevertheless, accelerated wound healing in wild or captive dolphins would minimize infection and other side effects associated with open wounds in marine animals. Here, we propose the use of a biological-based therapy for wound healing in dolphins by the application of platelet-rich plasma (PRP. Blood samples were collected from 9 different dolphins and a specific and simple protocol which concentrates platelets greater than two times that of whole blood was developed. As opposed to a commonly employed human protocol for PRP preparation, a single centrifugation for 3 minutes at 900 rpm resulted in the best condition for the concentration of dolphin platelets. By FACS analysis, dolphin platelets showed reactivity to platelet cell-surface marker CD41. Analysis by electron microscopy revealed that dolphin platelets were larger in size than human platelets. These findings may explain the need to reduce the duration and speed of centrifugation of whole blood from dolphins to obtain a 2-fold increase and maintain proper morphology of the platelets. For the first time, levels of several growth factors from activated dolphin platelets were quantified. Compared to humans, concentrations of PDGF-BB were not different, while TGFβ and VEGF-A were significantly lower in dolphins. Additionally, adipose tissue was obtained from cadaveric dolphins found along the Spanish Mediterranean coast, and adipose-derived mesenchymal stem cells (ASCs were successfully isolated, amplified, and characterized. When dolphin ASCs were treated with 2.5 or 5% dolphin PRP they exhibited significant increased proliferation and improved phagocytotic activity, indicating that in culture, PRP may improve the regenerative capacity of ASCs. Taken together, we show an effective and well-defined protocol for efficient PRP isolation. This protocol alone or in combination with ASCs, may constitute the basis of a

  8. Feeding habits of the atlantic spotted dolphin, Stenella frontalis, in southeastern Brazil

    Directory of Open Access Journals (Sweden)

    Xênia Moreira Lopes


    Full Text Available This study presents new information on the feeding habits of the Atlantic spotted dolphins, Stenella frontalis, in the Western South Atlantic. Nine stomach contents of S. frontalis incidentally caught in fishing operations conducted by the gillnet fleet based on main harbour of Cananéia (25°00'S; 47°55'W, southeastern Brazil, were analyzed. These specimens were captured between 2005 and 2007. A total of 1 422 cephalopod beaks, 147 otoliths and three crustaceans were recovered from the stomach contents. The dolphins assessed preyed on at least eight different fish species of the families Trichiuridae, Carangidae, Sparidae, Merluccidae, Engraulidae, Sciaenidae, Congridae and Scombridae, five cephalopod species of the families Loliginidae, Sepiolidae, Tremoctopodidae and Thysanoteuthidae, and one shrimp species of the Penaeidae family. Based on the analysis of the Index of Relative Importance (IRI, the Atlantic cutlassfish, Trichiurus lepturus, was the most important fish species represented. Of the cephalopods, the squid Doryteuthis plei was by far the most representative species. Several items were reported for the first time as prey of the S. frontalis: Xiphopenaeus kroyeri, Tremoctopus violaceus, Semirossia tenera, Merluccius hubbsi, Pagrus pagrus and Paralonchurus brasiliensis. S. frontalis presented teuthophagous and ichthyofagous feeding habits, with apparent predominance of the first, and preyed mainly on pelagic and demersal items.O presente estudo apresenta novas informações sobre os hábitos alimentares de golfinhos-pintados-do-Atlântico, Stenella frontalis, no Atlântico Sudoeste. Foram analisados nove conteúdos estomacais de S. frontalis acidentalmente capturados em operações de pesca entre 2005 e 2007 pela frota pesqueira do município de Cananéia (25°00'S; 47°55'W, sudeste do Brasil. Foram recuperados dos conteúdos estomacais 1 422 bicos de cefalópodes, 147 otólitos e três camarões. Dos itens analisados, foram

  9. Hearing Loss in Stranded Odontocete Dolphins and Whales (United States)

    Mann, David; Hill-Cook, Mandy; Manire, Charles; Greenhow, Danielle; Montie, Eric; Powell, Jessica; Wells, Randall; Bauer, Gordon; Cunningham-Smith, Petra; Lingenfelser, Robert; DiGiovanni, Robert; Stone, Abigale; Brodsky, Micah; Stevens, Robert; Kieffer, George; Hoetjes, Paul


    The causes of dolphin and whale stranding can often be difficult to determine. Because toothed whales rely on echolocation for orientation and feeding, hearing deficits could lead to stranding. We report on the results of auditory evoked potential measurements from eight species of odontocete cetaceans that were found stranded or severely entangled in fishing gear during the period 2004 through 2009. Approximately 57% of the bottlenose dolphins and 36% of the rough-toothed dolphins had significant hearing deficits with a reduction in sensitivity equivalent to severe (70–90 dB) or profound (>90 dB) hearing loss in humans. The only stranded short-finned pilot whale examined had profound hearing loss. No impairments were detected in seven Risso's dolphins from three different stranding events, two pygmy killer whales, one Atlantic spotted dolphin, one spinner dolphin, or a juvenile Gervais' beaked whale. Hearing impairment could play a significant role in some cetacean stranding events, and the hearing of all cetaceans in rehabilitation should be tested. PMID:21072206

  10. Hearing loss in stranded odontocete dolphins and whales.

    Directory of Open Access Journals (Sweden)

    David Mann

    Full Text Available The causes of dolphin and whale stranding can often be difficult to determine. Because toothed whales rely on echolocation for orientation and feeding, hearing deficits could lead to stranding. We report on the results of auditory evoked potential measurements from eight species of odontocete cetaceans that were found stranded or severely entangled in fishing gear during the period 2004 through 2009. Approximately 57% of the bottlenose dolphins and 36% of the rough-toothed dolphins had significant hearing deficits with a reduction in sensitivity equivalent to severe (70-90 dB or profound (>90 dB hearing loss in humans. The only stranded short-finned pilot whale examined had profound hearing loss. No impairments were detected in seven Risso's dolphins from three different stranding events, two pygmy killer whales, one Atlantic spotted dolphin, one spinner dolphin, or a juvenile Gervais' beaked whale. Hearing impairment could play a significant role in some cetacean stranding events, and the hearing of all cetaceans in rehabilitation should be tested.

  11. Biscayne Bay Dolphin Photo ID System (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — It has been shown through a variety of photo-identification studies that populations of bottlenose dolphin inhabit the various embayments along the coast of Florida....

  12. Sleep behaviour: activity and sleep in dolphins. (United States)

    Gnone, Guido; Moriconi, Tiziana; Gambini, Giorgia


    According to Lyamin and co-authors, neonate bottlenose dolphins (Tursiops truncatus) almost never sleep, unlike all other mammals that have been studied. Although we agree that young dolphins never stop and float at the surface, we find that they spend a considerable amount of time asleep while swimming. Our findings therefore call into question the conclusions of Lyamin et al..

  13. Dolphin changes in whistle structure with watercraft activity depends on their behavioral state. (United States)

    May-Collado, Laura J; Quiñones-Lebrón, Shakira G


    Dolphins rely on whistles to identify each other and to receive and convey information about their environment. Although capable of adjusting these signals with changing environments, there is little information on how dolphins acoustically respond to different watercraft activities and if this response depends on dolphin behavioral state. Bottlenose dolphin whistles were recorded in the presence of research and dolphin-watching boats. Dolphins emitted lower frequency and longer whistles when interacting with dolphin-watching boats, particularly during foraging activities. This study suggests that dolphin-watching boat traffic significantly hinders dolphin communication during important behavioral states.

  14. The relationship of maternal characteristics and circulating progesterone concentrations with reproductive outcome in the bottlenose dolphin (Tursiops truncatus) after artificial insemination, with and without ovulation induction, and natural breeding. (United States)

    O'Brien, J K; Robeck, T R


    Bottlenose dolphins (Tursiops truncatus) undergoing natural breeding and artificial insemination (AI) were examined to characterize serum progesterone concentrations and determine relationships among age, parity, and reproductive outcome. Progesterone profiles of five cycle types (n = 119 total cycles from 54 animals) were characterized as follows: (i) conception and production of a live term calf (conceptive-term, n = 73); (ii) conception and abortion after Day 60 (conceptive-abortion, n = 12); (iii) unknown conception status with prolonged, elevated progesterone and absence of a fetus (conceptive-unknown, n = 14); (iv) conception failure with normal luteal phase progesterone concentrations (non-conceptive, n = 14, AI cycles only); and (v) conception failure with progesterone insufficiency occuring after spontaneous ovulation or owing to premature ovulation induction using GnRH (non-conceptive-PI, n = 6, AI cycles only). By Day 21 post-insemination (PI), progesterone concentrations were similar (P > 0.05) among conceptive-term, conceptive-abortion and conceptive-unknown, and higher (P 0.05) progesterone concentrations than conceptive-abortion and unknown conception status cycles. Parity was not associated with reproductive outcome based on cycle type (P > 0.05). Age of females in conceptive-unknown (26.5 ± 10.1 yrs) and conceptive-abortion (22.1 ± 9.4 yrs) groups was higher (P < 0.05) than in conceptive-term (15.7 ± 7.2 yrs). The conceptive-unknown cycle type possibly represents undetected early embryonic loss occurring before Day 60 PI. Length of gestation using known conception dates was 376.1 ± 11.0 days and the range of this parameter (355-395 days) has implications for peri-parturient management procedures for the species. Copyright © 2012 Elsevier Inc. All rights reserved.

  15. SETI meets a social intelligence: Dolphins as a model for real-time interaction and communication with a sentient species (United States)

    Herzing, Denise L.


    In the past SETI has focused on the reception and deciphering of radio signals from potential remote civilizations. It is conceivable that real-time contact and interaction with a social intelligence may occur in the future. A serious look at the development of relationship, and deciphering of communication signals within and between a non-terrestrial, non-primate sentient species is relevant. Since 1985 a resident community of free-ranging Atlantic spotted dolphins has been observed regularly in the Bahamas. Life history, relationships, regular interspecific interactions with bottlenose dolphins, and multi-modal underwater communication signals have been documented. Dolphins display social communication signals modified for water, their body types, and sensory systems. Like anthropologists, human researchers engage in benign observation in the water and interact with these dolphins to develop rapport and trust. Many individual dolphins have been known for over 20 years. Learning the culturally appropriate etiquette has been important in the relationship with this alien society. To engage humans in interaction the dolphins often initiate spontaneous displays, mimicry, imitation, and synchrony. These elements may be emergent/universal features of one intelligent species contacting another for the intention of initiating interaction. This should be a consideration for real-time contact and interaction for future SETI work.

  16. Using Genome-Wide SNPs to Detect Structure in High-Diversity and Low-Divergence Populations of Severely Impacted Eastern Tropical Pacific Spinner (Stenella longirostris And Pantropical Spotted Dolphins (S. attenuata

    Directory of Open Access Journals (Sweden)

    Matthew Steven Leslie


    Full Text Available Millions of spinner (Stenella longirostris and pantropical spotted dolphins (Stenella attenuata died since the 1960’s as bycatch in tuna nets in the eastern tropical Pacific Ocean. Despite three decades of protection, they show little-to-no sign of recovery (although recent fisheries-independent abundance estimates are not available. In efforts to establish biologically meaningful management boundaries for recovery, endemic subspecies and multiple stocks have been proposed. However, genetic differentiation among most of these units has been difficult to identify, possibly due to low statistical power stemming from large historical abundances, ongoing gene flow, and recent divergence. We tested for genetic structure at multiple hierarchical levels by analyzing the largest dataset to date brought to bear on these questions. Single nucleotide polymorphisms (SNPs were collected from nuclear DNA regions associated with the restriction enzyme site PstI from 72 spinner dolphins and 58 pantropical spotted dolphins using genotype-by-sequencing (GBS. Our results support the current subspecies for both species and indicate stock-level separation for Tres Marias spinner dolphins and the two offshore pantropical spotted dolphin stocks in this area. Although bycatch has been reduced a small fraction of pre-protection levels, incidental mortality continues to impact these populations. Our results are important for the ongoing management and recovery of these highly-impacted pelagic dolphins in the eastern tropical Pacific Ocean.

  17. A comparison of pectoral fin contact between two different wild dolphin populations (United States)

    Dudzinski, K.M.; Gregg, J.D.; Ribic, C.A.; Kuczaj, S.A.


    Contact behaviour involving the pectoral fin has been documented in a number of dolphin species, and various explanations about its function have been offered. Pectoral fin contact can take a variety of forms, and involves a number of body parts and movements, likely differing depending upon social or ecological context. For this study, we compare the pectoral fin contact behaviour of two species of wild dolphins: Indo-Pacific bottlenose dolphins (Tursiops aduncus) from around Mikura Island, Japan, and Atlantic spotted dolphins (Stenella frontalis) from The Bahamas. The two study populations exhibit surprising similarity in the ways in which pectoral fin contacts are used, despite differences in species and environmental conditions at the two sites. Differences in contact rates for calves between the two sites suggest that calf-focused aggression from adult dolphins is more prevalent at Mikura than in The Bahamas. Our results suggest that pectoral fin contact behaviour seems to be driven primarily by social pressures, and may be similar in function to allogrooming described in primates. ?? 2008 Elsevier B.V.

  18. Preparing the Perfect Cuttlefish Meal: Complex Prey Handling by Dolphins


    Finn, Julian; Tregenza, Tom; Norman, Mark


    Dolphins are well known for their complex social and foraging behaviours. Direct underwater observations of wild dolphin feeding behaviour however are rare. At mass spawning aggregations of giant cuttlefish (Sepia apama) in the Upper Spencer Gulf in South Australia, a wild female Indo-Pacific bottlenose dolphin (Tursiops aduncus) was observed and recorded repeatedly catching, killing and preparing cuttlefish for consumption using a specific and ordered sequence of behaviours. Cuttlefish were ...

  19. Stress Hormones and their Regulation in a Captive Dolphin Population (United States)


    Dolphin Population Cory D Champagne & Dorian S. Houser National Marine Mammal Foundation 2240 Shelter Island Dr, Suite 200 San Diego, CA 92106 phone...understanding of how the stress response operates in marine mammals by evaluating markers of stress in a captive dolphin population. It determines...baseline levels of putative stress hormones and evaluates the functional consequences of increased stress in the bottlenose dolphin (Tursiops

  20. Seven new dolphin mitochondrial genomes and a time-calibrated phylogeny of whales

    Directory of Open Access Journals (Sweden)

    Zhou Kaiya


    Full Text Available Abstract Background The phylogeny of Cetacea (whales is not fully resolved with substantial support. The ambiguous and conflicting results of multiple phylogenetic studies may be the result of the use of too little data, phylogenetic methods that do not adequately capture the complex nature of DNA evolution, or both. In addition, there is also evidence that the generic taxonomy of Delphinidae (dolphins underestimates its diversity. To remedy these problems, we sequenced the complete mitochondrial genomes of seven dolphins and analyzed these data with partitioned Bayesian analyses. Moreover, we incorporate a newly-developed "relaxed" molecular clock to model heterogenous rates of evolution among cetacean lineages. Results The "deep" phylogenetic relationships are well supported including the monophyly of Cetacea and Odontoceti. However, there is ambiguity in the phylogenetic affinities of two of the river dolphin clades Platanistidae (Indian River dolphins and Lipotidae (Yangtze River dolphins. The phylogenetic analyses support a sister relationship between Delphinidae and Monodontidae + Phocoenidae. Additionally, there is statistically significant support for the paraphyly of Tursiops (bottlenose dolphins and Stenella (spotted dolphins. Conclusion Our phylogenetic analysis of complete mitochondrial genomes using recently developed models of rate autocorrelation resolved the phylogenetic relationships of the major Cetacean lineages with a high degree of confidence. Our results indicate that a rapid radiation of lineages explains the lack of support the placement of Platanistidae and Lipotidae. Moreover, our estimation of molecular divergence dates indicates that these radiations occurred in the Middle to Late Oligocene and Middle Miocene, respectively. Furthermore, by collecting and analyzing seven new mitochondrial genomes, we provide strong evidence that the delphinid genera Tursiops and Stenella are not monophyletic, and the current taxonomy

  1. Prion search and cellular prion protein expression in stranded dolphins. (United States)

    Di Guardo, G; Cocumelli, C; Meoli, R; Barbaro, K; Terracciano, G; Di Francesco, C E; Mazzariol, S; Eleni, C


    The recent description of a prion disease (PD) case in a free-ranging bottlenose dolphin (Tursiops truncatus) prompted us to carry out an extensive search for the disease-associated isoform (PrPSc) of the cellular prion protein (PrPC) in the brain and in a range of lymphoid tissues from 23 striped dolphins (Stenella coeruleoalba), 5 bottlenose dolphins and 2 Risso s dolphins (Grampus griseus) found stranded between 2007 and 2012 along the Italian coastline. Three striped dolphins and one bottlenose dolphin showed microscopic lesions of encephalitis, with no evidence of spongiform brain lesions being detected in any of the 30 free-ranging cetaceans investigated herein. Nevertheless, we could still observe a prominent PrPC immunoreactivity in the brain as well as in lymphoid tissues from these dolphins. Although immunohistochemical and Western blot investigations yielded negative results for PrPSc deposition in all tissues from the dolphins under study, the reported occurrence of a spontaneous PD case in a wild dolphin is an intriguing issue and a matter of concern for both prion biology and intra/inter-species transmissibility, as well as for cetacean conservation medicine.

  2. Body and self in dolphins. (United States)

    Herman, Louis M


    In keeping with recent views of consciousness of self as represented in the body in action, empirical studies are reviewed that demonstrate a bottlenose dolphin's (Tursiops truncatus) conscious awareness of its own body and body parts, implying a representational "body image" system. Additional work reviewed demonstrates an advanced capability of dolphins for motor imitation of self-produced behaviors and of behaviors of others, including imitation of human actions, supporting hypotheses that dolphins have a sense of agency and ownership of their actions and may implicitly attribute those levels of self-awareness to others. Possibly, a mirror-neuron system, or its functional equivalent to that described in monkeys and humans, may mediate both self-awareness and awareness of others. Copyright © 2011 Elsevier Inc. All rights reserved.

  3. Eighteen-year study of South Australian dolphins shows variation in lung nematodes by season, year, age class, and location. (United States)

    Tomo, Ikuko; Kemper, Catherine M; Lavery, Trish J


    Between 1990 and 2007, carcasses of opportunistically collected short-beaked common dolphins (Delphinus delphis; n=238), Indo-Pacific bottlenose dolphins (Tursiops aduncus; n=167), and common bottlenose dolphins (Tursiops truncatus; n=15) were examined for parasites and life history data. Three species of lung nematodes (Halocercus lagenorhynchi, Stenurus ovatus, Pharurus alatus) were identified in surface nodules, subsurface lesions, or airways. Nematode burdens were light to heavy and, in many cases, would have compromised the dolphins' health. The number of dolphins infected was related to species, year, season, age class, and geographic region. Nematodes were found in all three species but were more prevalent in short-beaked common dolphins (mean annual prevalence=26%) than in bottlenose dolphins (12%). There was a significant increase in prevalence of nematodes in short-beaked common dolphins in 2005-06 (63%) compared to 1990-2004 (14%), with a peak in April-June. More young short-beaked common dolphins were infected than subadults and adults and, during the unusual infection event, there were more dependent calves (dolphin (Tursiops spp.) calves but no increase in overall prevalence was detected during 2005-06. Because neonates of both short-beaked common dolphins and bottlenose dolphins were infected, mother-to-calf transmission is suspected for these species in South Australia. Numbers of infections in short-beaked common dolphins were higher in Gulf St Vincent than elsewhere in South Australia, particularly in 2005-06. The cause of the unusual infection event in short-beaked common dolphins is unknown. We discuss the influence of dolphin diet, life history, and external factors.

  4. Small-scale estimation of relative abundance for the coastal spotted dolphins (Stenella attenuata in Costa Rica: the effect of habitat and seasonality

    Directory of Open Access Journals (Sweden)

    Laura J May-Collado


    Full Text Available The coastal spotted dolphin (Stenella attenuata graffmani is one of the most common species of dolphin in inshore Pacific waters of Costa Rica. We conducted surveys in protected waters of the Papagayo Gulf, Costa Rica, to determine relative abundance of dolphins in relation to environmental variables. We used Generalized Additive Models to investigate the influence of a particular set of environmental factors and determine inter-annual trends in relative abundance. School sizes ranged from 1 to 50 individuals ( mean 9.95, SD=10.28. The number of dolphins increased linearly with water depth and transparency, and non-linearly with the dissolved oxygen concentration. High variability in the relative abundance occurred during the dry season (January-April. A previous study on this population found that high number of groups are involved in foraging activities during the dry season. Seasonal changes in relative abundance probably are associated with food availability, a variable that we did not measure. Understanding local resident populations may have important implications for conservation and management strategies. Large-scale studies may overlook variables affecting the abundance of local resident populations that may be detected with studies on a smaller scale such as this one.El delfín manchado costero (Stenella attenuata graffmani es una de las especies de delfines mas comunes de las aguas costeras del Pacifico de Costa Rica. En este estudio realizamos muestreos dentro de las aguas protegidas del Golfo de Papagayo para determinar su abundancia relativa en relación a características físico-químicas de su hábitat. Usamos modelos aditivos generalizados para investigar la influencia de un juego de variables ambientales y determinar tendencias inter-anuales en la abundancia relativa. El tamaño de los grupos varió de 1 a 50 individuos (promedio 9.95, SD=10.28. La cantidad de delfines aumentó linealmente con la profundidad y claridad del

  5. Cutaneous Granulomas in Dolphins Caused by Novel Uncultivated Paracoccidioides brasiliensis. (United States)

    Vilela, Raquel; Bossart, Gregory D; St Leger, Judy A; Dalton, Leslie M; Reif, John S; Schaefer, Adam M; McCarthy, Peter J; Fair, Patricia A; Mendoza, Leonel


    Cutaneous granulomas in dolphins were believed to be caused by Lacazia loboi, which also causes a similar disease in humans. This hypothesis was recently challenged by reports that fungal DNA sequences from dolphins grouped this pathogen with Paracoccidioides brasiliensis. We conducted phylogenetic analysis of fungi from 6 bottlenose dolphins (Tursiops truncatus) with cutaneous granulomas and chains of yeast cells in infected tissues. Kex gene sequences of P. brasiliensis from dolphins showed 100% homology with sequences from cultivated P. brasiliensis, 73% with those of L. loboi, and 93% with those of P. lutzii. Parsimony analysis placed DNA sequences from dolphins within a cluster with human P. brasiliensis strains. This cluster was the sister taxon to P. lutzii and L. loboi. Our molecular data support previous findings and suggest that a novel uncultivated strain of P. brasiliensis restricted to cutaneous lesions in dolphins is probably the cause of lacaziosis/lobomycosis, herein referred to as paracoccidioidomycosis ceti.

  6. Sleep behaviour: sleep in continuously active dolphins. (United States)

    Sekiguchi, Yuske; Arai, Kazutoshi; Kohshima, Shiro


    Sleep has been assumed to be necessary for development and to be a vital function in mammals and other animals. However, Lyamin et al. claim that in bottlenose dolphins (Tursiops truncatus) and killer whales (Orcinus orca), neonates and their mothers show almost no sleep behaviour for the first month after birth; this conclusion is based on their observation that the cetaceans keep swimming, avoid obstacles and rarely close their eyes for 24 hours a day throughout that period. Here we analyse the behaviour and eye closure of three neonate-mother pairs of bottlenose dolphins and find that, although the animals tend to open both eyes when surfacing to breathe, one or both eyes are closed during 'swim rest', an underwater sleeping behaviour that is associated with continuous activity. This observation calls into question the conclusions of Lyamin et al., who overlooked this type of sleep by analysing the animals' eye state only when they surfaced to breathe.

  7. Auditory Evoked Potentials for the Evaluation of Hearing Sensitivity in Navy Dolphins. Modification P00002: Assessment of Hearing Sensitivity in Adult Male Elephant Seals

    National Research Council Canada - National Science Library

    Houser, Dorian S


    A custom auditory evoked potential (AEP) system was used to assess the feasibility of rapidly testing the hearing of bottlenose dolphins by tracking the magnitude of the envelope following response (EFR...

  8. Auditory Evoked Potentials for the Evaluation of Hearing Sensitivity in Navy Dolphins. Assessment of Hearing Sensitivity in Adult Male Elephant Seals

    National Research Council Canada - National Science Library

    Houser, Dorian S


    A custom auditory evoked potential (AEP) system was used to assess the feasibility of rapidly testing the hearing of bottlenose dolphins by tracking the magnitude of the envelope following response (EFR...

  9. Brucellosis in Endangered Hector's Dolphins (Cephalorhynchus hectori). (United States)

    Buckle, Kelly; Roe, Wendi D; Howe, Laryssa; Michael, Sarah; Duignan, Padraig J; Burrows, E; Ha, Hye Jeong; Humphrey, Sharon; McDonald, Wendy L


    Brucella spp infections of marine mammals are often asymptomatic but have been associated with reproductive losses and deaths. Zoonotic infections originating from marine isolates have also been described. Hector's dolphins (Cephalorhynchus hectori) are an endangered species with a declining population, and the role of infectious disease in population dynamics is not fully understood. In this study, 27 Hector's dolphins found dead around the New Zealand coastline between November 2006 and October 2010 were evaluated for lesions previously associated with cetacean brucellosis. Tissues were examined using histological, immunohistochemical, and molecular (polymerase chain reaction [PCR]) techniques. Seven of 27 dolphins (26%) had at least 1 tissue that was positive on PCR for Brucella spp. Lesions consistent with brucellosis were present in 10 of 27 (37%) dolphins, but in 8 of these dolphins Brucella infection could not be demonstrated in lesional tissues. Two dolphins (7%) were diagnosed with active brucellosis: 1 female with placentitis and metritis, and 1 stillborn male fetus. Brucella identified in these 2 dolphins had genetic similarity (99%) to Brucella pinnipedialis. The omp2a gene amplicon from the uterus of the female had 100% homology with ST27 genotype isolates from a human in New Zealand and a bottlenose dolphin of Pacific origin. The remaining 5 PCR-positive dolphins were assessed as having asymptomatic or latent infection. While most Brucella infections identified in this study appeared to be subclinical, the finding of 2 dolphins with reproductive disease due to Brucella infection suggests that this disease has the potential to affect reproductive success in this species.

  10. Precocious development of self-awareness in dolphins. (United States)

    Morrison, Rachel; Reiss, Diana


    Mirror-self recognition (MSR) is a behavioral indicator of self-awareness in young children and only a few other species, including the great apes, dolphins, elephants and magpies. The emergence of self-awareness in children typically occurs during the second year and has been correlated with sensorimotor development and growing social and self-awareness. Comparative studies of MSR in chimpanzees report that the onset of this ability occurs between 2 years 4 months and 3 years 9 months of age. Studies of wild and captive bottlenose dolphins (Tursiops truncatus) have reported precocious sensorimotor and social awareness during the first weeks of life, but no comparative MSR research has been conducted with this species. We exposed two young bottlenose dolphins to an underwater mirror and analyzed video recordings of their behavioral responses over a 3-year period. Here we report that both dolphins exhibited MSR, indicated by self-directed behavior at the mirror, at ages earlier than generally reported for children and at ages much earlier than reported for chimpanzees. The early onset of MSR in young dolphins occurs in parallel with their advanced sensorimotor development, complex and reciprocal social interactions, and growing social awareness. Both dolphins passed subsequent mark tests at ages comparable with children. Thus, our findings indicate that dolphins exhibit self-awareness at a mirror at a younger age than previously reported for children or other species tested.

  11. Dolphin continuous auditory vigilance for five days. (United States)

    Ridgway, Sam; Carder, Don; Finneran, James; Keogh, Mandy; Kamolnick, Tricia; Todd, Mark; Goldblatt, Allen


    The present report describes the first study of continuous vigilance in dolphins. Two adult bottlenose dolphins (Tursiops truncatus), WEN (male) and SAY (female), maintained a very high detection rate of randomly presented, infrequent, 1.5-s target tones in a background of frequent 0.5-s equal-amplitude tones over five continuous 120-h sessions. The animals were able to maintain high levels (WEN 97, 87, 99%; SAY 93, 96%) of target detection without signs of sleep deprivation as indicated by behavior, blood indices or marked sleep rebound during 24 h of continuous post-experiment observation. Target response time overall (F = 0.384; P = 0.816) did not change between day 1 and day 5. However, response time was significantly slower (F = 21.566, P = 0.019) during the night (21.00-04.00 h) when the dolphins would have ordinarily been resting or asleep.

  12. Dolphin genome provides evidence for adaptive evolution of nervous system genes and a molecular rate slowdown


    McGowen, Michael R.; Grossman, Lawrence I.; Wildman, Derek E.


    Cetaceans (dolphins and whales) have undergone a radical transformation from the original mammalian bodyplan. In addition, some cetaceans have evolved large brains and complex cognitive capacities. We compared approximately 10 000 protein-coding genes culled from the bottlenose dolphin genome with nine other genomes to reveal molecular correlates of the remarkable phenotypic features of these aquatic mammals. Evolutionary analyses demonstrated that the overall synonymous substitution rate in ...

  13. Dolphin "packet" use during long-range echolocation tasks. (United States)

    Finneran, James J


    When echolocating, dolphins typically emit a single broadband "click," then wait to receive the echo before emitting another click. However, previous studies have shown that during long-range echolocation tasks, they may instead emit a burst, or "packet," of several clicks, then wait for the packet of echoes to return before emitting another packet of clicks. The reasons for the use of packets are unknown. In this study, packet use was examined by having trained bottlenose dolphins perform long-range echolocation tasks. The tasks featured "phantom" echoes produced by capturing the dolphin's outgoing echolocation clicks, convolving the clicks with an impulse response to create an echo waveform, and then broadcasting the delayed, scaled echo to the dolphin. Dolphins were trained to report the presence of phantom echoes or a change in phantom echoes. Target range varied from 25 to 800 m. At ranges below 75 m, the dolphins rarely used packets. As the range increased beyond 75 m, two of the three dolphins increasingly produced packets, while the third dolphin instead utilized very high click repetition rates. The use of click packets appeared to be governed more by echo delay (target range) than echo amplitude.

  14. Brucella ceti infection in dolphins from the Western Mediterranean sea. (United States)

    Isidoro-Ayza, Marcos; Ruiz-Villalobos, Nazareth; Pérez, Lola; Guzmán-Verri, Caterina; Muñoz, Pilar M; Alegre, Fernando; Barberán, Montserrat; Chacón-Díaz, Carlos; Chaves-Olarte, Esteban; González-Barrientos, Rocio; Moreno, Edgardo; Blasco, José María; Domingo, Mariano


    Brucella ceti infections have been increasingly reported in cetaceans. Brucellosis in these animals is associated with meningoencephalitis, abortion, discospondylitis', subcutaneous abscesses, endometritis and other pathological conditions B. ceti infections have been frequently described in dolphins from both, the Atlantic and Pacific Oceans. In the Mediterranean Sea, only two reports have been made: one from the Italian Tyrrhenian Sea and the other from the Adriatic Sea. We describe the clinical and pathological features of three cases of B. ceti infections in three dolphins stranded in the Mediterranean Catalonian coast. One striped dolphin had neurobrucellosis, showing lethargy, incoordination and lateral swimming due to meningoencephalitis, A B. ceti infected bottlenose dolphin had discospondylitis, and another striped dolphin did not show clinical signs or lesions related to Brucella infection. A detailed characterization of the three B. ceti isolates was performed by bacteriological, molecular, protein and fatty acid analyses. All the B. ceti strains originating from Mediterranean dolphins cluster together in a distinct phylogenetic clade, close to that formed by B. ceti isolates from dolphins inhabiting the Atlantic Ocean. Our study confirms the severity of pathological signs in stranded dolphins and the relevance of B. ceti as a pathogen in the Mediterranean Sea.

  15. Dolphin foraging sounds suppress calling and elevate stress hormone levels in a prey species, the Gulf toadfish. (United States)

    Remage-Healey, Luke; Nowacek, Douglas P; Bass, Andrew H


    The passive listening hypothesis proposes that dolphins and whales detect acoustic signals emitted by prey, including sound-producing (soniferous) fishes. Previous work showed that bottlenose dolphins (Tursiops truncatus) behaviorally orient toward the sounds of prey, including the advertisement calls of male Gulf toadfish (Opsanus beta). In addition, soniferous fishes constitute over 80% of Tursiops diet, and toadfishes alone account for approximately 13% of the stomach contents of adult bottlenose dolphins. Here, we used both behavioral (vocalizations) and physiological (plasma cortisol levels) parameters to determine if male Gulf toadfish can, in turn, detect the acoustic signals of bottlenose dolphins. Using underwater playbacks to toadfish in their natural environment, we found that low-frequency dolphin sounds (;pops') within the toadfish's range of hearing dramatically reduce toadfish calling rates by 50%. High frequency dolphin sounds (whistles) and low-frequency snapping shrimp pops (ambient control sounds) each had no effect on toadfish calling rates. Predator sound playbacks also had consequences for circulating stress hormones, as cortisol levels were significantly elevated in male toadfish exposed to dolphin pops compared with snapping shrimp pops. These findings lend strong support to the hypothesis that individuals of a prey species modulate communication behavior in the presence of a predator, and also suggest that short-term glucocorticoid elevation is associated with anti-predator behavior.

  16. What Laboratory Research has Told Us about Dolphin Cognition


    Herman, Louis M.


    Studies of sensory, cognitive, and communicative skills of bottlenose dolphins (Tursiops truncatus) were carried out over a 34-year period at the Kewalo Basin Marine Mammal Laboratory in Honolulu. Findings on sensory skills included fine discrimination of auditory frequency differences andauditory duration, good visual resolution capabilities in water and in air, and sharing of object recognition across the senses of vision and echolocation. Short-term memory for auditory and visual materials...

  17. Assessing Knowledge, Attitudes, and Behavior toward Charismatic Megafauna: The Case of Dolphins (United States)

    Barney, Erin C.; Mintzes, Joel J.; Yen, Chiung-Fen


    Using concept maps, a Kellert-type (S. R. Kellert, 1985) inventory, and self-report behavioral items, this cross-age study assessed public knowledge, attitudes, and behaviors toward bottlenose dolphins. Results suggest that this important megafaunal species is poorly understood by the public at large, and that negative "utilitarian" attitudes and…

  18. Shared Reproductive State Enhances Female Associations in Dolphins

    Directory of Open Access Journals (Sweden)

    Luciana M. Möller


    Full Text Available Female bottlenose dolphins (genus Tursiops usually associate at moderate level with other females within social clusters called bands or cliques. It has been suggested that reproductive state may play the predominant role in determining associations within female T. truncatus bands. Here, we test the hypothesis that reproductive state correlates with associations of female Indo-Pacific bottlenose dolphins (T. aduncus. We found that females in similar reproductive state, which included females from late pregnancy to the first year of their calves' life or females from early pregnancy to their calves' newborn period, had higher-association coefficients with each other than they did with females in different reproductive states (females with older calves or without calves. This was observed both within and across social clusters suggesting that reproductive state, at least for pregnant females and those with young calves, plays an important role in determining who to associate with. However, a female's most frequent associate was not always with another in similar reproductive state. We suggest that several factors, including reproductive state, may be of importance in determining associations of female bottlenose dolphins.

  19. Consciousness in dolphins? A review of recent evidence. (United States)

    Harley, Heidi E


    For millennia, dolphins have intrigued humans. Scientific study has confirmed that bottlenose dolphins are large-brained, highly social mammals with an extended developmental period, flexible cognitive capacities, and powerful acoustic abilities including a sophisticated echolocation system. These findings have led some to ask if dolphins experience aspects of consciousness. Recent investigations targeting self-recognition/self-awareness and metacognition, constructs tied to consciousness on some accounts, have analyzed the dolphin's ability to recognize itself in a mirror or on a video as well as to monitor its own knowledge in a perceptual categorization task. The current article reviews this work with dolphins and grapples with some of the challenges in designing, conducting, and interpreting these studies as well as with general issues related to studying consciousness in animals. The existing evidence does not provide a convincing case for consciousness in dolphins. For productive scientific work on consciousness in dolphins (and other animals including humans), we need clearer characterizations of consciousness, better methods for studying it, and appropriate paradigms for interpreting outcomes. A current focus on metamemory in animals offers promise for future discovery in this area.

  20. Gotta Go, Mom’s Calling: Dolphin (Tursiops truncatus) Mothers Use Individually Distinctive Acoustic Signals To Call Their Calves


    Stan A. Kuczaj II; Holli C. Eskelinen; Brittany L. Jones; Jill L. Borger-Turner


    Dolphin calves often wander away from their mothers, which can compromise their safety and survival. Mothers can retrieve their calves by actively pursuing them or by signaling their wandering calves to return. However, little is known about the retrieval techniques employed by mothers in specific calf recall contexts. We experimentally investigated maternal calf retrieval methods by assessing behavioral and acoustic strategies employed by three Atlantic bottlenose dolphin mothers to elicit t...

  1. The “Creative Dolphin” Revisited: What Do Dolphins Do When Asked to Vary their Behavior?

    Directory of Open Access Journals (Sweden)

    Stan A. Kuczaj II


    Full Text Available The variability of dolphin behavior is evident in their communication, foraging, and play. Dolphins can also vary their behavior when asked to do so by humans. Following the work of Karen Pryor and her colleagues, this ability is commonly referred to as creative behavior, a bit of a misnomer since dolphins need not always create a new behavior to succeed on this task. Nonetheless, when given a task in which success depends on not repeating what one has already done, dolphins are able to remember what they have done and successfully produce a new behavior, sometimes even a completely novel one. In this paper, we report similarities and differences in the performance of three bottlenose dolphins (Tursiops truncatus given such a task, the results highlighting the need for continued investigation of individual differences in cognitive style and performance.

  2. Microarray applications to understand the impact of exposure to environmental contaminants in wild dolphins (Tursiops truncatus). (United States)

    Mancia, Annalaura; Abelli, Luigi; Kucklick, John R; Rowles, Teresa K; Wells, Randall S; Balmer, Brian C; Hohn, Aleta A; Baatz, John E; Ryan, James C


    It is increasingly common to monitor the marine environment and establish geographic trends of environmental contamination by measuring contaminant levels in animals from higher trophic levels. The health of an ecosystem is largely reflected in the health of its inhabitants. As an apex predator, the common bottlenose dolphin (Tursiops truncatus) can reflect the health of near shore marine ecosystems, and reflect coastal threats that pose risk to human health, such as legacy contaminants or marine toxins, e.g. polychlorinated biphenyls (PCBs) and brevetoxins. Major advances in the understanding of dolphin biology and the unique adaptations of these animals in response to the marine environment are being made as a result of the development of cell-lines for use in in vitro experiments, the production of monoclonal antibodies to recognize dolphin proteins, the development of dolphin DNA microarrays to measure global gene expression and the sequencing of the dolphin genome. These advances may play a central role in understanding the complex and specialized biology of the dolphin with regard to how this species responds to an array of environmental insults. This work presents the creation, characterization and application of a new molecular tool to better understand the complex and unique biology of the common bottlenose dolphin and its response to environmental stress and infection. A dolphin oligo microarray representing 24,418 unigene sequences was developed and used to analyze blood samples collected from 69 dolphins during capture-release health assessments at five geographic locations (Beaufort, NC, Sarasota Bay, FL, Saint Joseph Bay, FL, Sapelo Island, GA and Brunswick, GA). The microarray was validated and tested for its ability to: 1) distinguish male from female dolphins; 2) differentiate dolphins inhabiting different geographic locations (Atlantic coasts vs the Gulf of Mexico); and 3) study in detail dolphins resident in one site, the Georgia coast, known to

  3. Patterns of dolphin bycatch in a north-western Australian trawl fishery. (United States)

    Allen, Simon J; Tyne, Julian A; Kobryn, Halina T; Bejder, Lars; Pollock, Kenneth H; Loneragan, Neil R


    The bycatch of small cetaceans in commercial fisheries is a global wildlife management problem. We used data from skippers' logbooks and independent observers to assess common bottlenose dolphin (Tursiops truncatus) bycatch patterns between 2003 and 2009 in the Pilbara Trawl Fishery, Western Australia. Both datasets indicated that dolphins were caught in all fishery areas, across all depths and throughout the year. Over the entire datasets, observer reported bycatch rates (n = 52 dolphins in 4,124 trawls, or 12.6 dolphins/1,000 trawls) were ca. double those reported by skippers (n = 180 dolphins in 27,904 trawls, or 6.5 dolphins/1,000 trawls). Generalised Linear Models based on observer data, which better explained the variation in dolphin bycatch, indicated that the most significant predictors of dolphin catch were: (1) vessel--one trawl vessel caught significantly more dolphins than three others assessed; (2) time of day--the lowest dolphin bycatch rates were between 00:00 and 05:59; and (3) whether nets included bycatch reduction devices (BRDs)--the rate was reduced by ca. 45%, from 18.8 to 10.3 dolphins/1,000 trawls, after their introduction. These results indicated that differences among vessels (or skippers' trawling techniques) and dolphin behavior (a diurnal pattern) influenced the rates of dolphin capture; and that spatial or seasonal adjustments to trawling effort would be unlikely to significantly reduce dolphin bycatch. Recent skipper's logbook data show that dolphin bycatch rates have not declined since those reported in 2006, when BRDs were introduced across the fishery. Modified BRDs, with top-opening escape hatches from which dolphins might escape to the surface, may be a more effective means of further reducing dolphin bycatch. The vulnerability of this dolphin population to trawling-related mortality cannot be assessed in the absence of an ongoing observer program and without information on trawler-associated dolphin community size

  4. Patterns of Dolphin Bycatch in a North-Western Australian Trawl Fishery (United States)

    Allen, Simon J.; Tyne, Julian A.; Kobryn, Halina T.; Bejder, Lars; Pollock, Kenneth H.; Loneragan, Neil R.


    The bycatch of small cetaceans in commercial fisheries is a global wildlife management problem. We used data from skippers' logbooks and independent observers to assess common bottlenose dolphin (Tursiops truncatus) bycatch patterns between 2003 and 2009 in the Pilbara Trawl Fishery, Western Australia. Both datasets indicated that dolphins were caught in all fishery areas, across all depths and throughout the year. Over the entire datasets, observer reported bycatch rates (n = 52 dolphins in 4,124 trawls, or 12.6 dolphins/1,000 trawls) were ca. double those reported by skippers (n = 180 dolphins in 27,904 trawls, or 6.5 dolphins/1,000 trawls). Generalised Linear Models based on observer data, which better explained the variation in dolphin bycatch, indicated that the most significant predictors of dolphin catch were: (1) vessel - one trawl vessel caught significantly more dolphins than three others assessed; (2) time of day – the lowest dolphin bycatch rates were between 00:00 and 05:59; and (3) whether nets included bycatch reduction devices (BRDs) - the rate was reduced by ca. 45%, from 18.8 to 10.3 dolphins/1,000 trawls, after their introduction. These results indicated that differences among vessels (or skippers' trawling techniques) and dolphin behavior (a diurnal pattern) influenced the rates of dolphin capture; and that spatial or seasonal adjustments to trawling effort would be unlikely to significantly reduce dolphin bycatch. Recent skipper's logbook data show that dolphin bycatch rates have not declined since those reported in 2006, when BRDs were introduced across the fishery. Modified BRDs, with top-opening escape hatches from which dolphins might escape to the surface, may be a more effective means of further reducing dolphin bycatch. The vulnerability of this dolphin population to trawling-related mortality cannot be assessed in the absence of an ongoing observer program and without information on trawler-associated dolphin community size

  5. Effect of seismic operations on cetaceans sightings off-shore Akwa ...

    African Journals Online (AJOL)

    66.78%) sightings of whales and 94 (33.22%) sightings of dolphins. Four species of cetaceans were identified, bottlenose dolphins (Tursiops truncatus) were the most abundant followed by pantropical spotted dolphins (Stenella attenuata).

  6. Measurement of hydrodynamic force generation by swimming dolphins using bubble DPIV. (United States)

    Fish, Frank E; Legac, Paul; Williams, Terrie M; Wei, Timothy


    Attempts to measure the propulsive forces produced by swimming dolphins have been limited. Previous uses of computational hydrodynamic models and gliding experiments have provided estimates of thrust production by dolphins, but these were indirect tests that relied on various assumptions. The thrust produced by two actively swimming bottlenose dolphins (Tursiops truncatus) was directly measured using digital particle image velocimetry (DPIV). For dolphins swimming in a large outdoor pool, the DPIV method used illuminated microbubbles that were generated in a narrow sheet from a finely porous hose and a compressed air source. The movement of the bubbles was tracked with a high-speed video camera. Dolphins swam at speeds of 0.7 to 3.4 m s(-1) within the bubble sheet oriented along the midsagittal plane of the animal. The wake of the dolphin was visualized as the microbubbles were displaced because of the action of the propulsive flukes and jet flow. The oscillations of the dolphin flukes were shown to generate strong vortices in the wake. Thrust production was measured from the vortex strength through the Kutta-Joukowski theorem of aerodynamics. The dolphins generated up to 700 N during small amplitude swimming and up to 1468 N during large amplitude starts. The results of this study demonstrated that bubble DPIV can be used effectively to measure the thrust produced by large-bodied dolphins.

  7. A mini review of dolphin carbohydrate metabolism and suggestions for future research using exhaled air

    Directory of Open Access Journals (Sweden)

    Sam eRidgway


    Full Text Available In the 1960s, I explored some aspects of carbohydrate metabolism in healthy bottlenose dolphins (Tursiops truncatus. Their physiological picture resembled what had been described for hyperthyroid diabetics. Dolphins have elevated thyroid hormone turnover, and fasting dolphins maintain a relatively high level of plasma glucose. After dolphins ingest glucose, plasma levels remain high for many hours. Interestingly, plasma glucose must exceed 300 mg/dL (about twice as high as the human threshold before glucose appears in urine. Due to their diabetes-like states, trainability, and unique natural respiratory anatomy and physiology, dolphins may offer useful clues to metabolites in the breath that may be used to non-invasively monitor diabetes in humans. Dolphins take very rapid and deep breaths that are four or five times as deep as humans and other terrestrial mammals, making them ideal for physiological assessment using non-invasive exhaled air. Avenues for successfully identifying breath-based markers for metabolic disease and physiology in dolphins can be done with both modern technology and the evolutionarily advantageous canine nose. This review summarizes aspects of dolphin metabolism previously learned and offers new directions for diabetes research that may benefit both dolphin and human health.

  8. Cooperation or dolphin 'tug-of-war'? Comment on Kuczaj et al. and Eskelinen et al. (United States)

    King, Stephanie L; Allen, Simon J; Connor, Richard C; Jaakkola, Kelly


    Two recent papers by Kuczaj et al. (Anim Cognit 18:543-550, 2015) and Eskelinen et al. (Anim Cognit 19:789-797, 2016) claim to have demonstrated that (i) bottlenose dolphins (Tursiops truncatus) cooperated to solve a novel task and (ii) vocal signals were important for coordinating these cooperative efforts. Although it is likely that bottlenose dolphins may share communicative signals in order to achieve a common goal, we suggest that this has not been demonstrated in the aforementioned studies. Here, we discuss the two main problems that preclude any definitive conclusions being drawn on cooperative task success and vocal communication from these studies. The first lies in the experimental design. The 'cooperative task', involving an apparatus that requires two dolphins to pull in opposite directions in order to achieve a food reward, is not conducive to cooperation, but could instead reflect a competitive 'tug-of-war'. It is therefore of questionable use in distinguishing competitive from cooperative interactions. Second, the suggestion that the occurrence of burst-pulsed signals in this task was indicative of cooperation is disputable, as (i) this study could not determine which dolphins were actually producing the signals and (ii) this sound type is more commonly associated with aggressive signalling in dolphins. We commend the authors for investigating this exciting and topical area in animal communication and cognition, but the question of whether dolphins cooperate and communicate to solve a cooperative task remains as yet unanswered.

  9. Detection of Multiple Budding Yeast Cells and a Partial Sequence of 43-kDa Glycoprotein Coding Gene of Paracoccidioides brasiliensis from a Case of Lacaziosis in a Female Pacific White-Sided Dolphin (Lagenorhynchus obliquidens). (United States)

    Minakawa, Tomoko; Ueda, Keiichi; Tanaka, Miyuu; Tanaka, Natsuki; Kuwamura, Mitsuru; Izawa, Takeshi; Konno, Toshihiro; Yamate, Jyoji; Itano, Eiko Nakagawa; Sano, Ayako; Wada, Shinpei


    Lacaziosis, formerly called as lobomycosis, is a zoonotic mycosis, caused by Lacazia loboi, found in humans and dolphins, and is endemic in the countries on the Atlantic Ocean, Indian Ocean and Pacific Ocean of Japanese coast. Susceptible Cetacean species include the bottlenose dolphin (Tursiops truncatus), the Indian Ocean bottlenose dolphin (T. aduncus), and the estuarine dolphin (Sotalia guianensis); however, no cases have been recorded in other Cetacean species. We diagnosed a case of Lacaziosis in a Pacific white-sided dolphin (Lagenorhynchus obliquidens) nursing in an aquarium in Japan. The dolphin was a female estimated to be more than 14 years old at the end of June 2015 and was captured in a coast of Japan Sea in 2001. Multiple, lobose, and solid granulomatous lesions with or without ulcers appeared on her jaw, back, flipper and fluke skin, in July 2014. The granulomatous skin lesions from the present case were similar to those of our previous cases. Multiple budding and chains of round yeast cells were detected in the biopsied samples. The partial sequence of 43-kDa glycoprotein coding gene confirmed by a nested PCR and sequencing, which revealed a different genotype from both Amazonian and Japanese lacaziosis in bottlenose dolphins, and was 99 % identical to those derived from Paracoccidioides brasiliensis; a sister fungal species to L. loboi. This is the first case of lacaziosis in Pacific white-sided dolphin.

  10. Preliminary estimates of the abundance and fidelity of dolphins associating with a demersal trawl fishery. (United States)

    Allen, Simon J; Pollock, Kenneth H; Bouchet, Phil J; Kobryn, Halina T; McElligott, Deirdre B; Nicholson, Krista E; Smith, Joshua N; Loneragan, Neil R


    The incidental capture of wildlife in fishing gear presents a global conservation challenge. As a baseline to inform assessments of the impact of bycatch on bottlenose dolphins (Tursiops truncatus) interacting with an Australian trawl fishery, we conducted an aerial survey to estimate dolphin abundance across the fishery. Concurrently, we carried out boat-based dolphin photo-identification to assess short-term fidelity to foraging around trawlers, and used photographic and genetic data to infer longer-term fidelity to the fishery. We estimated abundance at ≈ 2,300 dolphins (95% CI = 1,247-4,214) over the ≈ 25,880-km 2 fishery. Mark-recapture estimates yielded 226 (SE = 38.5) dolphins associating with one trawler and some individuals photographed up to seven times over 12 capture periods. Moreover, photographic and genetic re-sampling over three years confirmed that some individuals show long-term fidelity to trawler-associated foraging. Our study presents the first abundance estimate for any Australian pelagic dolphin community and documents individuals associating with trawlers over days, months and years. Without trend data or correction factors for dolphin availability, the impact of bycatch on this dolphin population's conservation status remains unknown. These results should be taken into account by management agencies assessing the impact of fisheries-related mortality on this protected species.

  11. Bottlenose dolphin at-sea density off California (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Office of National Marine Sanctuary Program (ONMS) updates and revises the management plans for each of its 13 sanctuaries. This process, which is open to the...

  12. Acoustic Behaviour of Bottlenose Dolphins and Pilot Whales


    Jensen, Frants Havmand


    Here I summarize the most important findings of my PhD thesis. My dissertation consists of 9 chapters: An introduction, 3 peer-reviewed papers (2 published, 1 accepted), 4 manuscripts prepared for submission, and a progress report of an ongoing study. The introduction serves as a broad background and review for the topics addressed in the subsequent chapters, with discussions of these chapters where appropriate. In this thesis, I have undertaken a series of acoustic studies on two species of ...

  13. Respiratory development in a captive-born bottlenose dolphin ...

    African Journals Online (AJOL)

    Changes in calf-mother association are examined and correlated to respiratory changes. This calf-mother respiratory association disappears within the first year. Data indicate that the first 6 h post partum are the most critical in gaining respiratory efficiency. Although respiratory data were only collected during periods of rest, ...

  14. How dolphins see the world: a comparison with chimpanzees and humans. (United States)

    Tomonaga, Masaki; Uwano, Yuka; Saito, Toyoshi


    Bottlenose dolphins use auditory (or echoic) information to recognise their environments, and many studies have described their echolocation perception abilities. However, relatively few systematic studies have examined their visual perception. We tested dolphins on a visual-matching task using two-dimensional geometric forms including various features. Based on error patterns, we used multidimensional scaling to analyse perceptual similarities among stimuli. In addition to dolphins, we conducted comparable tests with terrestrial species: chimpanzees were tested on a computer-controlled matching task and humans were tested on a rating task. The overall perceptual similarities among stimuli in dolphins were similar to those in the two species of primates. These results clearly indicate that the visual world is perceived similarly by the three species of mammals, even though each has adapted to a different environment and has differing degrees of dependence on vision.

  15. What do dolphins (Tursiops truncatus) understand about hidden objects? (United States)

    Jaakkola, Kelly; Guarino, Emily; Rodriguez, Mandy; Erb, Linda; Trone, Marie


    Object permanence, the ability to mentally represent and reason about objects that have disappeared from view, is a fundamental cognitive skill that has been extensively studied in human infants and terrestrial animals, but not in marine animals. A series of four experiments examined this ability in bottlenose dolphins (Tursiops truncatus). After being trained on a "find the object" game, dolphins were tested on visible and invisible displacement tasks, and transpositions. In Experiments 1 and 2, dolphins succeeded at visible displacements, but not at invisible displacements or transpositions. Experiment 3 showed that they were able to pass an invisible displacement task in which a person's hand rather than a container was used as the displacement device. However, follow-up controls suggested they did so by learning local rules rather than via a true representation of the movement of hidden objects. Experiment 4 demonstrated that the dolphins did not rely on such local rules to pass visible displacement tasks. Thus, like many terrestrial animals, dolphins are able to succeed on visible displacement tasks, but seem unable to succeed on tasks requiring the tracking of hidden objects.

  16. Why do Dolphins Play?


    Stan A. Kuczaj; Holli C. Eskelinen


    Play is an important aspect of dolphin life, perhaps even an essential one. Play provides opportunities for dolphin calves to practice and perfect locomotor skills, including those involved in foraging and mating strategies and behaviors. Play also allows dolphin calves to learn important social skills and acquire information about the characteristics and predispositions of members of their social group, particularly their peers. In addition to helping dolphin calves learn how to behave, play...

  17. Preparing the perfect cuttlefish meal: complex prey handling by dolphins.

    Directory of Open Access Journals (Sweden)

    Julian Finn

    Full Text Available Dolphins are well known for their complex social and foraging behaviours. Direct underwater observations of wild dolphin feeding behaviour however are rare. At mass spawning aggregations of giant cuttlefish (Sepia apama in the Upper Spencer Gulf in South Australia, a wild female Indo-Pacific bottlenose dolphin (Tursiops aduncus was observed and recorded repeatedly catching, killing and preparing cuttlefish for consumption using a specific and ordered sequence of behaviours. Cuttlefish were herded to a sand substrate, pinned to the seafloor, killed by downward thrust, raised mid-water and beaten by the dolphin with its snout until the ink was released and drained. The deceased cuttlefish was then returned to the seafloor, inverted and forced along the sand substrate in order to strip the thin dorsal layer of skin off the mantle, thus releasing the buoyant calcareous cuttlebone. This stepped behavioural sequence significantly improves prey quality through 1 removal of the ink (with constituent melanin and tyrosine, and 2 the calcareous cuttlebone. Observations of foraging dolphin pods from above-water at this site (including the surfacing of intact clean cuttlebones suggest that some or all of this prey handling sequence may be used widely by dolphins in the region. Aspects of the unique mass spawning aggregations of giant cuttlefish in this region of South Australia may have contributed to the evolution of this behaviour through both high abundances of spawning and weakened post-spawning cuttlefish in a small area (>10,000 animals on several kilometres of narrow rocky reef, as well as potential long-term and regular visitation by dolphin pods to this site.

  18. Preparing the perfect cuttlefish meal: complex prey handling by dolphins. (United States)

    Finn, Julian; Tregenza, Tom; Norman, Mark


    Dolphins are well known for their complex social and foraging behaviours. Direct underwater observations of wild dolphin feeding behaviour however are rare. At mass spawning aggregations of giant cuttlefish (Sepia apama) in the Upper Spencer Gulf in South Australia, a wild female Indo-Pacific bottlenose dolphin (Tursiops aduncus) was observed and recorded repeatedly catching, killing and preparing cuttlefish for consumption using a specific and ordered sequence of behaviours. Cuttlefish were herded to a sand substrate, pinned to the seafloor, killed by downward thrust, raised mid-water and beaten by the dolphin with its snout until the ink was released and drained. The deceased cuttlefish was then returned to the seafloor, inverted and forced along the sand substrate in order to strip the thin dorsal layer of skin off the mantle, thus releasing the buoyant calcareous cuttlebone. This stepped behavioural sequence significantly improves prey quality through 1) removal of the ink (with constituent melanin and tyrosine), and 2) the calcareous cuttlebone. Observations of foraging dolphin pods from above-water at this site (including the surfacing of intact clean cuttlebones) suggest that some or all of this prey handling sequence may be used widely by dolphins in the region. Aspects of the unique mass spawning aggregations of giant cuttlefish in this region of South Australia may have contributed to the evolution of this behaviour through both high abundances of spawning and weakened post-spawning cuttlefish in a small area (>10,000 animals on several kilometres of narrow rocky reef), as well as potential long-term and regular visitation by dolphin pods to this site.

  19. Preparing the Perfect Cuttlefish Meal: Complex Prey Handling by Dolphins (United States)

    Finn, Julian; Tregenza, Tom; Norman, Mark


    Dolphins are well known for their complex social and foraging behaviours. Direct underwater observations of wild dolphin feeding behaviour however are rare. At mass spawning aggregations of giant cuttlefish (Sepia apama) in the Upper Spencer Gulf in South Australia, a wild female Indo-Pacific bottlenose dolphin (Tursiops aduncus) was observed and recorded repeatedly catching, killing and preparing cuttlefish for consumption using a specific and ordered sequence of behaviours. Cuttlefish were herded to a sand substrate, pinned to the seafloor, killed by downward thrust, raised mid-water and beaten by the dolphin with its snout until the ink was released and drained. The deceased cuttlefish was then returned to the seafloor, inverted and forced along the sand substrate in order to strip the thin dorsal layer of skin off the mantle, thus releasing the buoyant calcareous cuttlebone. This stepped behavioural sequence significantly improves prey quality through 1) removal of the ink (with constituent melanin and tyrosine), and 2) the calcareous cuttlebone. Observations of foraging dolphin pods from above-water at this site (including the surfacing of intact clean cuttlebones) suggest that some or all of this prey handling sequence may be used widely by dolphins in the region. Aspects of the unique mass spawning aggregations of giant cuttlefish in this region of South Australia may have contributed to the evolution of this behaviour through both high abundances of spawning and weakened post-spawning cuttlefish in a small area (>10,000 animals on several kilometres of narrow rocky reef), as well as potential long-term and regular visitation by dolphin pods to this site. PMID:19156212

  20. Why do dolphins carry sponges? (United States)

    Mann, Janet; Sargeant, Brooke L; Watson-Capps, Jana J; Gibson, Quincy A; Heithaus, Michael R; Connor, Richard C; Patterson, Eric


    Tool use is rare in wild animals, but of widespread interest because of its relationship to animal cognition, social learning and culture. Despite such attention, quantifying the costs and benefits of tool use has been difficult, largely because if tool use occurs, all population members typically exhibit the behavior. In Shark Bay, Australia, only a subset of the bottlenose dolphin population uses marine sponges as tools, providing an opportunity to assess both proximate and ultimate costs and benefits and document patterns of transmission. We compared sponge-carrying (sponger) females to non-sponge-carrying (non-sponger) females and show that spongers were more solitary, spent more time in deep water channel habitats, dived for longer durations, and devoted more time to foraging than non-spongers; and, even with these potential proximate costs, calving success of sponger females was not significantly different from non-spongers. We also show a clear female-bias in the ontogeny of sponging. With a solitary lifestyle, specialization, and high foraging demands, spongers used tools more than any non-human animal. We suggest that the ecological, social, and developmental mechanisms involved likely (1) help explain the high intrapopulation variation in female behaviour, (2) indicate tradeoffs (e.g., time allocation) between ecological and social factors and, (3) constrain the spread of this innovation to primarily vertical transmission.

  1. Why do dolphins carry sponges?

    Directory of Open Access Journals (Sweden)

    Janet Mann

    Full Text Available Tool use is rare in wild animals, but of widespread interest because of its relationship to animal cognition, social learning and culture. Despite such attention, quantifying the costs and benefits of tool use has been difficult, largely because if tool use occurs, all population members typically exhibit the behavior. In Shark Bay, Australia, only a subset of the bottlenose dolphin population uses marine sponges as tools, providing an opportunity to assess both proximate and ultimate costs and benefits and document patterns of transmission. We compared sponge-carrying (sponger females to non-sponge-carrying (non-sponger females and show that spongers were more solitary, spent more time in deep water channel habitats, dived for longer durations, and devoted more time to foraging than non-spongers; and, even with these potential proximate costs, calving success of sponger females was not significantly different from non-spongers. We also show a clear female-bias in the ontogeny of sponging. With a solitary lifestyle, specialization, and high foraging demands, spongers used tools more than any non-human animal. We suggest that the ecological, social, and developmental mechanisms involved likely (1 help explain the high intrapopulation variation in female behaviour, (2 indicate tradeoffs (e.g., time allocation between ecological and social factors and, (3 constrain the spread of this innovation to primarily vertical transmission.

  2. Atypical residency of short-beaked common dolphins (Delphinus delphis) to a shallow, urbanized embayment in south-eastern Australia (United States)

    Salgado Kent, Chandra; Donnelly, David; Weir, Jeffrey; Bilgmann, Kerstin


    Short-beaked common dolphins (Delphinus delphis) are typically considered highly mobile, offshore delphinids. This study assessed the residency of a small community of short-beaked common dolphins in the shallow, urbanized Port Phillip Bay, south-eastern Australia. The ability to identify common dolphins by their dorsal fin markings and coloration using photo-identification was also investigated. Systematic and non-systematic boat surveys were undertaken between 2007 and 2014. Results showed that 13 adult common dolphins and their offspring inhabit Port Phillip Bay, of which 10 adults exhibit residency to the bay. The majority of these adults are reproductively active females, suggesting that female philopatry may occur in the community. Systematic surveys conducted between 2012 and 2014 revealed that the dolphins were found in a median water depth of 16 m and median distance of 2.2 km from the coast. The shallow, urbanized habitat of this resident common dolphin community is atypical for this species. As a result, these common dolphins face threats usually associated with inshore bottlenose dolphin communities. We suggest that the Port Phillip Bay common dolphin community is considered and managed separate to those outside the embayment and offshore to ensure the community's long-term viability and residency in the bay. PMID:27703709

  3. Experimental measurement of dolphin thrust generated during a tail stand using DPIV (United States)

    Wei, Timothy; Fish, Frank; Williams, Terrie; Wu, Vicki; Sherman, Erica; Misfeldt, Mitchel; Ringenberg, Hunter; Rogers, Dylan


    The thrust generated by dolphins doing tail stands was measured using DPIV. The technique entailed measuring vortex strength associated with the tail motion and correlating it to above water video sequences showing the amount of the dolphin's body that was being lifted out of the water. The underlying drivers for this research included: i) understanding the physiology, hydrodynamics and efficiency of dolphin locomotion, ii) developing non-invasive measurement techniques for studying marine swimming and iii) quantifying the actual propulsive capabilities of these animals. Two different bottlenose dolphins at the Long Marine Lab at UC-Santa Cruz were used as test subjects. Application of the Kutta-Joukowski Theorem on measured vortex circulations yielded thrust values that were well correlated with estimates of dolphin body weight being supported above water. This demonstrates that the tail motion can be interpreted as a flapping hydrofoil that can generate a sustained thrust roughly equal to the dolphin's weight. Videos of DPIV measurements overlaid with the dolphins will be presented along with thrust/weight data.

  4. Dynamics of biosonar signals in free-swimming and stationary dolphins: The role of source levels on the characteristics of the signals. (United States)

    Au, Whitlow W L; Martin, Stephen W; Moore, Patrick W; Branstetter, Brian; Copeland, Adrienne M


    The biosonar signals of two free-swimming Atlantic bottlenose dolphins performing a complex sonar search for a bottom target in San Diego Bay were compared with the biosonar signals of a dolphin performing a target discrimination task in a net pen in the same bay. A bite-plate device carried by the free-swimming dolphins supported a hydrophone that extended directly in front of the dolphin. A biosonar measuring tool attached to the bite plate measured the outgoing biosonar signals while the dolphins conducted sonar searches. Each of the free-swimming dolphins used different biosonar search strategy in solving the problem and the dolphins' biosonar signals reflect the difference in strategy. The dolphin in the pen stationed in a hoop while echolocating on a target 6 m away and reported if the indentation on a spherical target was directed toward it. The signals were parameterized by determining the peak-to-peak source levels, source energy flux density, peak frequency, center frequency, root-mean-square (rms) bandwidth, rms duration, and the Q of the signals. Some parameters were similar for the free-swimming and stationary dolphins while some were significantly different, suggesting biosonar signals used by free-swimming animals may be different than signals used by dolphins in a pen.

  5. Visual laterality in dolphins: importance of the familiarity of stimuli (United States)


    Background Many studies of cerebral asymmetries in different species lead, on the one hand, to a better understanding of the functions of each cerebral hemisphere and, on the other hand, to develop an evolutionary history of hemispheric laterality. Our animal model is particularly interesting because of its original evolutionary path, i.e. return to aquatic life after a terrestrial phase. The rare reports concerning visual laterality of marine mammals investigated mainly discrimination processes. As dolphins are migrant species they are confronted to a changing environment. Being able to categorize new versus familiar objects would allow dolphins a rapid adaptation to novel environments. Visual laterality could be a prerequisite to this adaptability. To date, no study, to our knowledge, has analyzed the environmental factors that could influence their visual laterality. Results We investigated visual laterality expressed spontaneously at the water surface by a group of five common bottlenose dolphins (Tursiops truncatus) in response to various stimuli. The stimuli presented ranged from very familiar objects (known and manipulated previously) to familiar objects (known but never manipulated) to unfamiliar objects (unknown, never seen previously). At the group level, dolphins used their left eye to observe very familiar objects and their right eye to observe unfamiliar objects. However, eyes are used indifferently to observe familiar objects with intermediate valence. Conclusion Our results suggest different visual cerebral processes based either on the global shape of well-known objects or on local details of unknown objects. Moreover, the manipulation of an object appears necessary for these dolphins to construct a global representation of an object enabling its immediate categorization for subsequent use. Our experimental results pointed out some cognitive capacities of dolphins which might be crucial for their wild life given their fission-fusion social system

  6. Visual laterality in dolphins: importance of the familiarity of stimuli. (United States)

    Blois-Heulin, Catherine; Crével, Mélodie; Böye, Martin; Lemasson, Alban


    Many studies of cerebral asymmetries in different species lead, on the one hand, to a better understanding of the functions of each cerebral hemisphere and, on the other hand, to develop an evolutionary history of hemispheric laterality. Our animal model is particularly interesting because of its original evolutionary path, i.e. return to aquatic life after a terrestrial phase. The rare reports concerning visual laterality of marine mammals investigated mainly discrimination processes. As dolphins are migrant species they are confronted to a changing environment. Being able to categorize new versus familiar objects would allow dolphins a rapid adaptation to novel environments. Visual laterality could be a prerequisite to this adaptability. To date, no study, to our knowledge, has analyzed the environmental factors that could influence their visual laterality. We investigated visual laterality expressed spontaneously at the water surface by a group of five common bottlenose dolphins (Tursiops truncatus) in response to various stimuli. The stimuli presented ranged from very familiar objects (known and manipulated previously) to familiar objects (known but never manipulated) to unfamiliar objects (unknown, never seen previously). At the group level, dolphins used their left eye to observe very familiar objects and their right eye to observe unfamiliar objects. However, eyes are used indifferently to observe familiar objects with intermediate valence. Our results suggest different visual cerebral processes based either on the global shape of well-known objects or on local details of unknown objects. Moreover, the manipulation of an object appears necessary for these dolphins to construct a global representation of an object enabling its immediate categorization for subsequent use. Our experimental results pointed out some cognitive capacities of dolphins which might be crucial for their wild life given their fission-fusion social system and migratory behaviour.

  7. Behavioural evidence of magnetoreception in dolphins: detection of experimental magnetic fields. (United States)

    Kremers, Dorothee; López Marulanda, Juliana; Hausberger, Martine; Lemasson, Alban


    Magnetoreception, meaning the perception of magnetic fields, is supposed to play an important role for orientation/navigation in some terrestrial and aquatic species. Although some spatial observations of free-ranging cetaceans' migration routes and stranding sites led to the assumption that cetaceans may be sensitive to the geomagnetic field, experimental evidence is lacking. Here, we tested the spontaneous response of six captive bottlenose dolphins to the presentation of two magnetized and demagnetized controlled devices while they were swimming freely. Dolphins approached the device with shorter latency when it contained a strongly magnetized neodymium block compared to a control demagnetized block that was identical in form and density and therefore undistinguishable with echolocation. We conclude that dolphins are able to discriminate the two stimuli on the basis of their magnetic properties, a prerequisite for magnetoreception-based navigation.

  8. Pectoral fin contact as a mechanism for social bonding among dolphins

    Directory of Open Access Journals (Sweden)

    Kathleen M. Dudzinski


    Full Text Available Bottlenose dolphins are large-brained social mammals residing in a fission-fusion society with relationships that are established and maintained over decades. We examined a decade-long data set of inter-individual pectoral fin contact exchanges to better understand how dolphins share information via tactile contact. Sex and age are significant factors in pectoral fin contact within non-kin dolphin dyads. Adult females shared more pectoral fin contacts with other adult females, while younger females showed no pattern of contact. Males shared more pectoral fin contacts with other males as juveniles and as adults, but showed no difference in the number of touches versus rubs as pectoral fin contacts with other males. Whether in the role of initiator as rubber or initiator as rubbee, male dolphins again preferred other males. These results support the notion that dolphins, especially male dolphins, might use pectoral fin contact as one tool in their repertoire for social bonding to establish, maintain and manage their inter-individual relationships. Additionally, it is also likely that the exchange of pectoral fin contact is developed and refined as individuals age, mature socially, and establish their place within a fission-fusion society.

  9. Pectoral fin contact as a mechanism for social bonding among dolphins (United States)

    Dudzinski, Kathleen; Ribic, Christine


    Bottlenose dolphins are large-brained social mammals residing in a fission-fusion society with relationships that are established and maintained over decades. We examined a decade-long data set of inter-individual pectoral fin contact exchanges to better understand how dolphins share information via tactile contact. Sex and age are significant factors in pectoral fin contact within non-kin dolphin dyads. Adult females shared more pectoral fin contacts with other adult females, while younger females showed no pattern of contact. Males shared more pectoral fin contacts with other males as juveniles and as adults, but showed no difference in the number of touches versus rubs as pectoral fin contacts with other males. Whether in the role of initiator as rubber or initiator as rubbee, male dolphins again preferred other males. These results support the notion that dolphins, especially male dolphins, might use pectoral fin contact as one tool in their repertoire for social bonding to establish, maintain and manage their inter-individual relationships. Additionally, it is also likely that the exchange of pectoral fin contact is developed and refined as individuals age, mature socially, and establish their place within a fission-fusion society.

  10. Why do Dolphins Play?

    Directory of Open Access Journals (Sweden)

    Stan A. Kuczaj


    Full Text Available Play is an important aspect of dolphin life, perhaps even an essential one. Play provides opportunities for dolphin calves to practice and perfect locomotor skills, including those involved in foraging and mating strategies and behaviors. Play also allows dolphin calves to learn important social skills and acquire information about the characteristics and predispositions of members of their social group, particularly their peers. In addition to helping dolphin calves learn how to behave, play also provides valuable opportunities for them to learn how to think. The ability to create and control play contexts enables dolphins to create novel experiences for themselves and their playmates under relatively safe conditions. The behavioral variability and individual creativity that characterize dolphin play yield ample opportunities for individual cognitive development as well as social learning, and sometimes result in innovations that are reproduced by other members of the group. Although adults sometimes produce innovative play, calves are the primary source of such innovations. Calves are also more likely to imitate novel play behaviors than are adults, and so calves contribute significantly to both the creation and transmission of novel play behaviors within a group. Not unexpectedly, then, the complexity of dolphin play increases with the involvement of peers. As a result, the opportunity to observe and/or interact with other dolphin calves enhances the effects of play on the acquisition and maintenance of flexible problem solving skills, the emergence and strengthening of social and communicative competencies, and the establishment of social relationships. It seems that play may have evolved to help young dolphins learn to adapt to novel situations in both their physical and social worlds, the beneficial result being a set of abilities that increases the likelihood that an individual survives and reproduces.

  11. Dolphins in a Scaled-Down Mediterranean: The Gulf of Corinth's Odontocetes. (United States)

    Bearzi, G; Bonizzoni, S; Santostasi, N L; Furey, N B; Eddy, L; Valavanis, V D; Gimenez, O

    The Gulf of Corinth is a 2400-km 2 semi-enclosed inland system (a mediterraneus) in central Greece. Its continental shelf areas, steep bottom relief, and waters up to 500-900m deep offer suitable habitat to neritic and pelagic species. We used photographic capture-recapture, distribution modelling, and direct observations to investigate the abundance, status, habitat preferences, movements, and group size of four odontocete species regularly observed in the Gulf, based on five years (2011-2015) of survey effort from small boats. Striped dolphins (Stenella coeruleoalba) are more abundant (1324 individuals, 95%CI 1158-1515) than was determined from previous estimates. Striped dolphins appear to be confined to the Gulf, where they favour deep and oligotrophic waters, and were encountered in single-species and mixed-species groups. Short-beaked common dolphins (Delphinus delphis) (22 individuals, 95%CI 16-31), individuals with intermediate pigmentation (possibly striped/common dolphin hybrids) (55, 95%CI 36-83), and a single Risso's dolphin (Grampus griseus) were only encountered in mixed-species groups with striped dolphins. Short-beaked common dolphins constitute a discrete conservation unit (subpopulation), and based on the current estimate, would qualify as Critically Endangered according to International Union for the Conservation of Nature (IUCN) Red List criteria. Common bottlenose dolphins (Tursiops truncatus) (39 animals, 95%CI 33-47) occur in single-species groups; they prefer continental shelf waters and areas near fish farms in the northern sector, and several animals appear to move into and out of the Gulf. Additionally, we contribute records of marine fauna and an assessment of the fishing fleet operating in the Gulf. Our study shows that the importance of this vulnerable marine environment has been underestimated, and management action must be taken to mitigate human impact and ensure long-term protection. © 2016 Elsevier Ltd All rights reserved.

  12. Dolphin genome provides evidence for adaptive evolution of nervous system genes and a molecular rate slowdown (United States)

    McGowen, Michael R.; Grossman, Lawrence I.; Wildman, Derek E.


    Cetaceans (dolphins and whales) have undergone a radical transformation from the original mammalian bodyplan. In addition, some cetaceans have evolved large brains and complex cognitive capacities. We compared approximately 10 000 protein-coding genes culled from the bottlenose dolphin genome with nine other genomes to reveal molecular correlates of the remarkable phenotypic features of these aquatic mammals. Evolutionary analyses demonstrated that the overall synonymous substitution rate in dolphins has slowed compared with other studied mammals, and is within the range of primates and elephants. We also discovered 228 genes potentially under positive selection (dN/dS > 1) in the dolphin lineage. Twenty-seven of these genes are associated with the nervous system, including those related to human intellectual disabilities, synaptic plasticity and sleep. In addition, genes expressed in the mitochondrion have a significantly higher mean dN/dS ratio in the dolphin lineage than others examined, indicating evolution in energy metabolism. We encountered selection in other genes potentially related to cetacean adaptations such as glucose and lipid metabolism, dermal and lung development, and the cardiovascular system. This study underlines the parallel molecular trajectory of cetaceans with other mammalian groups possessing large brains. PMID:22740643

  13. Vocal reporting of echolocation targets: dolphins often report before click trains end. (United States)

    Ridgway, S H; Elsberry, W R; Blackwood, D J; Kamolnick, T; Todd, M; Carder, D A; Chaplin, Monica; Cranford, T W


    Bottlenose dolphins (Tursiops truncatus) wore opaque suction cups over their eyes while stationing behind an acoustically opaque door. This put the dolphins in a known position and orientation. When the door opened, the dolphin clicked to detect targets. Trainers specified that Dolphin S emit a whistle if the target was a 7.5 cm water filled sphere, or a pulse burst if the target was a rock. S remained quiet if there was no target. Dolphin B whistled for the sphere. She remained quiet for rock and for no target. Thus, S had to choose between three different responses, whistle, pulse burst, or remain quiet. B had to choose between two different responses, whistle or remain quiet. S gave correct vocal responses averaging 114 ms after her last echolocation click (range 182 ms before and 219 ms after the last click). Average response for B was 21 ms before her last echolocation click (range 250 ms before and 95 ms after the last click in the train). More often than not, B began her whistle response before her echolocation train ended. The findings suggest separate neural pathways for generation of response vocalizations as opposed to echolocation clicks. © 2012 Acoustical Society of America.

  14. Dolphin genome provides evidence for adaptive evolution of nervous system genes and a molecular rate slowdown. (United States)

    McGowen, Michael R; Grossman, Lawrence I; Wildman, Derek E


    Cetaceans (dolphins and whales) have undergone a radical transformation from the original mammalian bodyplan. In addition, some cetaceans have evolved large brains and complex cognitive capacities. We compared approximately 10,000 protein-coding genes culled from the bottlenose dolphin genome with nine other genomes to reveal molecular correlates of the remarkable phenotypic features of these aquatic mammals. Evolutionary analyses demonstrated that the overall synonymous substitution rate in dolphins has slowed compared with other studied mammals, and is within the range of primates and elephants. We also discovered 228 genes potentially under positive selection (dN/dS > 1) in the dolphin lineage. Twenty-seven of these genes are associated with the nervous system, including those related to human intellectual disabilities, synaptic plasticity and sleep. In addition, genes expressed in the mitochondrion have a significantly higher mean dN/dS ratio in the dolphin lineage than others examined, indicating evolution in energy metabolism. We encountered selection in other genes potentially related to cetacean adaptations such as glucose and lipid metabolism, dermal and lung development, and the cardiovascular system. This study underlines the parallel molecular trajectory of cetaceans with other mammalian groups possessing large brains.

  15. Contrasted accumulation patterns of persistent organic pollutants and mercury in sympatric tropical dolphins from the south-western Indian Ocean

    International Nuclear Information System (INIS)

    Dirtu, Alin C.; Malarvannan, Govindan; Das, Krishna; Dulau-Drouot, Violaine; Kiszka, Jeremy J.; Lepoint, Gilles; Mongin, Philippe; Covaci, Adrian


    Due to their high trophic position and long life span, small cetaceans are considered as suitable bioindicators to monitor the presence of contaminants in marine ecosystems. Here, we document the contamination with persistent organic pollutants (POPs) and total mercury (T-Hg) of spinner (Stenella longirostris, n =21) and Indo-Pacific bottlenose dolphins (Tursiops aduncus, n=32) sampled from the coastal waters of La Réunion (south-western Indian Ocean). In addition, seven co-occurring teleost fish species were sampled and analyzed as well. Blubber samples from living dolphins and muscle from teleosts were analyzed for polychlorinated biphenyls (PCBs), DDT and metabolites (DDTs), chlordanes (CHLs), hexachlorocyclohexanes (HCHs), hexachlorobenzene (HCB), and polybrominated diphenyl ethers (PBDEs). Methoxylated PBDEs (MeO-PBDEs), reported as having a natural origin, were also analyzed. T-Hg levels were measured in blubber and skin biopsies of the two dolphin species. Stable isotopes δ 13 C and δ 15 N values were determined in skin of the dolphins and in the muscle of teleosts. For PCBs, HCHs and T-Hg, concentrations were significantly higher in T. aduncus than in S. longirostris. For other POP levels, intra-species variability was high. MeO-PBDEs were the dominant compounds (55% of the total POPs) in S. longirostris, while PCBs dominated (50% contribution) in T. aduncus. Other contaminants showed similar profiles between the two species. Given the different patterns of POPs and T-Hg contamination and the δ 15 N values observed among analyzed teleosts, dietary and foraging habitat preferences most likely explain the contrasted contaminant profiles observed in the two dolphin species. Levels of each class of contaminants were significantly higher in males than females. Despite their spatial and temporal overlap in the waters of La Réunion, S. longirostris and T. aduncus are differently exposed to contaminant accumulation. - Highlights: • POPs and total Hg were


    Colitz, Carmen M H; Walsh, Michael T; McCulloch, Stephen D


    Cetaceans in the wild and under human care develop a variety of ocular lesions. Although they have echolocation, cetacean species have good sight, making ocular health an important part of overall health care. The cornea is the primary site of abnormalities in both populations. Typical lesions of cetaceans under human care are characterized in this retrospective review of cases. One hundred eighty animals (n = 360 eyes) were chosen from the author's ophthalmologic examination reports from different geographic areas; they included Atlantic bottlenose dolphins (Tursiops truncatus), Pacific bottle nose dolphins (Tursiopstruncatus gilli), Indopacific bottlenose dolphins (Steno bredanensis), Indopacific humpback dolphins (Sousa chinensis), and roughtooth dolphins (Steno bredanensis). These animals were examined at least once, although most were examined numerous times over many years; lesions were categorized and are described. Seventy-seven eyes from 47 animals were normal. Medial keratopathy was the most common lesion and identified in 180 eyes from 97 animals, with 83 affected bilaterally. Horizontal keratopathy was identified in 69 eyes from 41 animals, with 28 affected bilaterally. Axial keratopathy and nonspecific axial opacities were identified in 67 eyes from 44 animals, with 21 affected bilaterally. Seventy-eight eyes from 50 animals, with 28 affected bilaterally, had more than one type of corneal lesion. Cataracts were identified in 32 eyes from 19 animals, with 13 affected bilaterally. Traumatic injuries were also common and involved eyelids and cornea. Sixteen eyes from 11 animals were blind; five dolphins were blind bilaterally due to phthisis bulbi secondary to corneal perforation or severe trauma. None of the diseases had a sex predisposition; however, medial keratopathy was significantly more common as a bilateral presentation than as a unilateral presentation. Cetaceans under human care with impaired sight can use echolocation; however, ocular health

  17. A survey of perfluorinated compounds in surface water and biota including dolphins from the Ganges River and in other waterbodies in India

    Digital Repository Service at National Institute of Oceanography (India)

    Yeung, L.W.Y.; Yamashita, N.; Taniyasu, S.; Lam, P.K.S.; Sinha, R.K.; Borole, D.V.; Kannan, K.

    compounds have been implemented in the EU (Directive 76/769), Canada (, USA (the New Jersey, the Department of Environmental Protection), and Japan (under the Rule of Regulation... of perfluoroalkyl compounds in the bottlenose dolphin (Tursiops truncatus) food web Environ. Sci. & Tech. 2006, 40, 4138-4144. 13    13    ISO25101 (The International Organization for Standardization) "Water quality - Determination of perfluorooctanesulfonate...

  18. Resolving the trophic relations of cryptic species: an example using stable isotope analysis of dolphin teeth.

    Directory of Open Access Journals (Sweden)

    Kylie Owen


    Full Text Available Understanding the foraging ecology and diet of animals can play a crucial role in conservation of a species. This is particularly true where species are cryptic and coexist in environments where observing feeding behaviour directly is difficult. Here we present the first information on the foraging ecology of a recently identified species of dolphin (Southern Australian bottlenose dolphin (SABD and comparisons to the common bottlenose dolphin (CBD in Victoria, Australia, using stable isotope analysis of teeth. Stable isotope signatures differed significantly between SABD and CBD for both δ(13C (-14.4‰ vs. -15.5‰ respectively and δ(15N (15.9‰ vs. 15.0‰ respectively, suggesting that the two species forage in different areas and consume different prey. This finding supports genetic and morphological data indicating that SABD are distinct from CBD. In Victoria, the SABD is divided into two distinct populations, one in the large drowned river system of Port Phillip Bay and the other in a series of coastal lakes and lagoons called the Gippsland Lakes. Within the SABD species, population differences were apparent. The Port Phillip Bay population displayed a significantly higher δ(15N than the Gippsland Lakes population (17.0‰ vs. 15.5‰, suggesting that the Port Phillip Bay population may feed at a higher trophic level--a result which is supported by analysis of local food chains. Important future work is required to further understand the foraging ecology and diet of this newly described, endemic, and potentially endangered species of dolphin.

  19. Ring Bubbles of Dolphins (United States)

    Shariff, Karim; Marten, Ken; Psarakos, Suchi; White, Don J.; Merriam, Marshal (Technical Monitor)


    The article discusses how dolphins create and play with three types of air-filled vortices. The underlying physics is discussed. Photographs and sketches illustrating the dolphin's actions and physics are presented. The dolphins engage in this behavior on their own initiative without food reward. These behaviors are done repeatedly and with singleminded effort. The first type is the ejection of bubbles which, after some practice on the part of the dolphin, turn into toroidal vortex ring bubbles by the mechanism of baroclinic torque. These bubbles grow in radius and become thinner as they rise vertically to the surface. One dolphin would blow two in succession and guide them to fuse into one. Physicists call this a vortex reconnection. In the second type, the dolphins first create an invisible vortex ring in the water by swimming on their side and waving their tail fin (also called flukes) vigorously. This vortex ring travels horizontally in the water. The dolphin then turns around, finds the vortex and injects a stream of air into it from its blowhole. The air "fills-out" the core of the vortex ring. Often, the dolphin would knock-off a smaller ring bubble from the larger ring (this also involves vortex reconnection) and steer the smaller ring around the tank. One other dolphin employed a few other techniques for planting air into the fluke vortex. One technique included standing vertically in the water with tail-up, head-down and tail piercing the free surface. As the fluke is waved to create the vortex ring, air is entrained from above the surface. Another technique was gulping air in the mouth, diving down, releasing air bubbles from the mouth and curling them into a ring when they rose to the level of the fluke. In the third type, demonstrated by only one dolphin, the longitudinal vortex created by the dorsal fin on the back is used to produce 10-15 foot long helical bubbles. In one technique she swims in a curved path. This creates a dorsal fin vortex since

  20. Hearing abilities and sound reception of broadband sounds in an adult Risso's dolphin (Grampus griseus). (United States)

    Mooney, T Aran; Yang, Wei-Cheng; Yu, Hsin-Yi; Ketten, Darlene R; Jen, I-Fan


    While odontocetes do not have an external pinna that guides sound to the middle ear, they are considered to receive sound through specialized regions of the head and lower jaw. Yet odontocetes differ in the shape of the lower jaw suggesting that hearing pathways may vary between species, potentially influencing hearing directionality and noise impacts. This work measured the audiogram and received sensitivity of a Risso's dolphin (Grampus griseus) in an effort to comparatively examine how this species receives sound. Jaw hearing thresholds were lowest (most sensitive) at two locations along the anterior, midline region of the lower jaw (the lower jaw tip and anterior part of the throat). Responses were similarly low along a more posterior region of the lower mandible, considered the area of best hearing in bottlenose dolphins. Left- and right-side differences were also noted suggesting possible left-right asymmetries in sound reception or differences in ear sensitivities. The results indicate best hearing pathways may vary between the Risso's dolphin and other odontocetes measured. This animal received sound well, supporting a proposed throat pathway. For Risso's dolphins in particular, good ventral hearing would support their acoustic ecology by facilitating echo-detection from their proposed downward oriented echolocation beam.

  1. Comparative genomics reveals conservation of filaggrin and loss of caspase-14 in dolphins. (United States)

    Strasser, Bettina; Mlitz, Veronika; Fischer, Heinz; Tschachler, Erwin; Eckhart, Leopold


    The expression of filaggrin and its stepwise proteolytic degradation are critical events in the terminal differentiation of epidermal keratinocytes and in the formation of the skin barrier to the environment. Here, we investigated whether the evolutionary transition from a terrestrial to a fully aquatic lifestyle of cetaceans, that is dolphins and whales, has been associated with changes in genes encoding filaggrin and proteins involved in the processing of filaggrin. We used comparative genomics, PCRs and re-sequencing of gene segments to screen for the presence and integrity of genes coding for filaggrin and proteases implicated in the maturation of (pro)filaggrin. Filaggrin has been conserved in dolphins (bottlenose dolphin, orca and baiji) but has been lost in whales (sperm whale and minke whale). All other S100 fused-type genes have been lost in cetaceans. Among filaggrin-processing proteases, aspartic peptidase retroviral-like 1 (ASPRV1), also known as saspase, has been conserved, whereas caspase-14 has been lost in all cetaceans investigated. In conclusion, our results suggest that filaggrin is dispensable for the acquisition of fully aquatic lifestyles of whales, whereas it appears to confer an evolutionary advantage to dolphins. The discordant evolution of filaggrin, saspase and caspase-14 in cetaceans indicates that the biological roles of these proteins are not strictly interdependent. © 2015 The Authors. Experimental Dermatology Published by John Wiley & Sons Ltd.

  2. Do dolphins rehearse show-stimuli when at rest? Delayed matching of auditory memory

    Directory of Open Access Journals (Sweden)

    Dorothee eKremers


    Full Text Available The mechanisms underlying vocal mimicry in animals remain an open question. Delphinidae are able to copy sounds from their environment that are not produced by conspecifics. Usually, these mimicries occur associated with the context in which they were learned. No reports address the question of separation between auditory memory formation and spontaneous vocal copying although the sensory and motor phases of vocal learning are separated in a variety of songbirds. Here we show that captive bottlenose dolphins produce, during their nighttime resting periods, non-dolphin sounds that they heard during performance shows. Generally, in the middle of the night, these animals produced vocal copies of whale sounds that had been broadcast during daily public shows. As their life history was fully known, we know that these captive dolphins had never had the opportunity to hear whale sounds before then. Moreover, recordings made before the whale sounds started being broadcast revealed that they had never emitted such sounds before. This is to our knowledge the first evidence for a separation between formation of auditory memories and the process of learning to produce calls that match these memories in a marine mammal. One hypothesis is that dolphins may rehearse some special events heard during the daytime and that they then express vocally what could be conceived as a more global memory. These results open the way for broader views on how animals might rehearse life events while resting or maybe dreaming.

  3. Evidence for signature whistles in Guiana dolphins (Sotalia guianensis) in Ilhéus, northeastern Brazil. (United States)

    Lima, Alice; Le Pendu, Yvonnick


    Signature whistles have been widely studied in bottlenose dolphins (Tursiops truncatus). A recent study suggested the occurrence of signature whistles in Guiana dolphins (Sotalia guianensis) but could not identify the whistlers. The objective of this study is to describe the whistle characteristics in the population of S. guianensis from Ilhéus and investigate the occurrence of signature whistles. Dolphins from 55 groups were photographed and sound emissions from 21 groups were recorded. The frequency parameters and duration of the 847 recorded whistles were similar to those recorded in 12 other populations, on an intermediate position of a latitudinal gradient. The visual classification method was applied to the spectrograms of 68 stereotyped potential signature whistles. Five out of 6 human judges agreed on the formation of 13 groups. The presence of the same individuals in different recording occasions of stereotyped whistles suggests that some whistle types are produced by specific individuals. The study is the first to use the photo-identification technique to identify Guiana dolphins emitting whistles and the results reinforce the hypothesis of signature whistles in this species.

  4. Dolphin whistles: a functional misnomer revealed by heliox breathing. (United States)

    Madsen, P T; Jensen, F H; Carder, D; Ridgway, S


    Delphinids produce tonal whistles shaped by vocal learning for acoustic communication. Unlike terrestrial mammals, delphinid sound production is driven by pressurized air within a complex nasal system. It is unclear how fundamental whistle contours can be maintained across a large range of hydrostatic pressures and air sac volumes. Two opposing hypotheses propose that tonal sounds arise either from tissue vibrations or through actual whistle production from vortices stabilized by resonating nasal air volumes. Here, we use a trained bottlenose dolphin whistling in air and in heliox to test these hypotheses. The fundamental frequency contours of stereotyped whistles were unaffected by the higher sound speed in heliox. Therefore, the term whistle is a functional misnomer as dolphins actually do not whistle, but form the fundamental frequency contour of their tonal calls by pneumatically induced tissue vibrations analogous to the operation of vocal folds in terrestrial mammals and the syrinx in birds. This form of tonal sound production by nasal tissue vibrations has probably evolved in delphinids to enable impedance matching to the water, and to maintain tonal signature contours across changes in hydrostatic pressures, air density and relative nasal air volumes during dives.

  5. Gene-culture coevolution in whales and dolphins. (United States)

    Whitehead, Hal


    Whales and dolphins (Cetacea) have excellent social learning skills as well as a long and strong mother-calf bond. These features produce stable cultures, and, in some species, sympatric groups with different cultures. There is evidence and speculation that this cultural transmission of behavior has affected gene distributions. Culture seems to have driven killer whales into distinct ecotypes, which may be incipient species or subspecies. There are ecotype-specific signals of selection in functional genes that correspond to cultural foraging behavior and habitat use by the different ecotypes. The five species of whale with matrilineal social systems have remarkably low diversity of mtDNA. Cultural hitchhiking, the transmission of functionally neutral genes in parallel with selective cultural traits, is a plausible hypothesis for this low diversity, especially in sperm whales. In killer whales the ecotype divisions, together with founding bottlenecks, selection, and cultural hitchhiking, likely explain the low mtDNA diversity. Several cetacean species show habitat-specific distributions of mtDNA haplotypes, probably the result of mother-offspring cultural transmission of migration routes or destinations. In bottlenose dolphins, remarkable small-scale differences in haplotype distribution result from maternal cultural transmission of foraging methods, and large-scale redistributions of sperm whale cultural clans in the Pacific have likely changed mitochondrial genetic geography. With the acceleration of genomics new results should come fast, but understanding gene-culture coevolution will be hampered by the measured pace of research on the socio-cultural side of cetacean biology.

  6. Gene–culture coevolution in whales and dolphins (United States)

    Whitehead, Hal


    Whales and dolphins (Cetacea) have excellent social learning skills as well as a long and strong mother–calf bond. These features produce stable cultures, and, in some species, sympatric groups with different cultures. There is evidence and speculation that this cultural transmission of behavior has affected gene distributions. Culture seems to have driven killer whales into distinct ecotypes, which may be incipient species or subspecies. There are ecotype-specific signals of selection in functional genes that correspond to cultural foraging behavior and habitat use by the different ecotypes. The five species of whale with matrilineal social systems have remarkably low diversity of mtDNA. Cultural hitchhiking, the transmission of functionally neutral genes in parallel with selective cultural traits, is a plausible hypothesis for this low diversity, especially in sperm whales. In killer whales the ecotype divisions, together with founding bottlenecks, selection, and cultural hitchhiking, likely explain the low mtDNA diversity. Several cetacean species show habitat-specific distributions of mtDNA haplotypes, probably the result of mother–offspring cultural transmission of migration routes or destinations. In bottlenose dolphins, remarkable small-scale differences in haplotype distribution result from maternal cultural transmission of foraging methods, and large-scale redistributions of sperm whale cultural clans in the Pacific have likely changed mitochondrial genetic geography. With the acceleration of genomics new results should come fast, but understanding gene–culture coevolution will be hampered by the measured pace of research on the socio-cultural side of cetacean biology. PMID:28739936

  7. The Neocortex of Indian River Dolphins (Genus Platanista): Comparative, Qualitative and Quantitative Analysis. (United States)

    Knopf, Julian P; Hof, Patrick R; Oelschläger, Helmut H A


    We investigated the morphology of four primary neocortical projection areas (somatomotor, somatosensory, auditory, visual) qualitatively and quantitatively in the Indian river dolphins (Platanista gangetica gangetica, P. gangetica minor) with histological and stereological methods. For comparison, we included brains of other toothed whale species. Design-based stereology was applied to the primary neocortical areas (M1, S1, A1, V1) of the Indian river dolphins and compared to those of the bottlenose dolphin with respect to layers III and V. These neocortical fields were identified using existing electrophysiological and morphological data from marine dolphins as to their topography and histological structure, including the characteristics of the neuron populations concerned. In contrast to other toothed whales, the visual area (V1) of the 'blind' river dolphins seems to be rather small. M1 is displaced laterally and the auditory area (A1) is larger than in marine species with respect to total brain size. The layering is similar in the cortices of all the toothed whale brains investigated; a layer IV could not be identified. Cell density in layer III is always higher than in layer V. The maximal neuron density in P. gangetica gangetica is found in layer III of A1, followed by layers III in V1, S1, and M1. The cell density in layer V is at a similar level in all primary areas. There are, however, some differences in neuron density between the two subspecies of Indian river dolphins. Taken as a whole, it appears that the neocortex of platanistids exhibits a considerable expansion of the auditory field. Even more than other toothed whales, they seem to depend on their biosonar abilities for navigation, hunting, and communication in their riverine habitat. © 2016 S. Karger AG, Basel.

  8. Gotta Go, Mom’s Calling: Dolphin (Tursiops truncatus Mothers Use Individually Distinctive Acoustic Signals To Call Their Calves

    Directory of Open Access Journals (Sweden)

    Stan A. Kuczaj II


    Full Text Available Dolphin calves often wander away from their mothers, which can compromise their safety and survival. Mothers can retrieve their calves by actively pursuing them or by signaling their wandering calves to return. However, little is known about the retrieval techniques employed by mothers in specific calf recall contexts. We experimentally investigated maternal calf retrieval methods by assessing behavioral and acoustic strategies employed by three Atlantic bottlenose dolphin mothers to elicit their calf’s return in a controlled, non-threatening setting. Three mothers were asked to retrieve their calves on cue in this setting, and could do so however they chose. Mothers were much more likely to use energetically less costly acoustic signals than physical retrievals. Each mother produced individually distinctive calls that incorporated the mother’s signature whistle but often also involved additional whistles and clicks. The dolphin mothers’ use of individually distinctive calls to request a calf’s return is consistent with the notion that other dolphins can distinguish such calls and provides additional support for the notion that dolphin communication is flexible rather than fixed.

  9. Visual laterality in belugas (Delphinapterus leucas) and Pacific white-sided dolphins (Lagenorhynchus obliquidens) when viewing familiar and unfamiliar humans. (United States)

    Yeater, Deirdre B; Hill, Heather M; Baus, Natalie; Farnell, Heather; Kuczaj, Stan A


    Lateralization of cognitive processes and motor functions has been demonstrated in a number of species, including humans, elephants, and cetaceans. For example, bottlenose dolphins (Tursiops truncatus) have exhibited preferential eye use during a variety of cognitive tasks. The present study investigated the possibility of visual lateralization in 12 belugas (Delphinapterus leucas) and six Pacific white-sided dolphins (Lagenorhynchus obliquidens) located at two separate marine mammal facilities. During free swim periods, the belugas and Pacific white-sided dolphins were presented a familiar human, an unfamiliar human, or no human during 10-15 min sessions. Session videos were coded for gaze duration, eye presentation at approach, and eye preference while viewing each stimulus. Although we did not find any clear group level lateralization, we found individual left eye lateralized preferences related to social stimuli for most belugas and some Pacific white-sided dolphins. Differences in gaze durations were also observed. The majority of individual belugas had longer gaze durations for unfamiliar rather than familiar stimuli. These results suggest that lateralization occurs during visual processing of human stimuli in belugas and Pacific white-sided dolphins and that these species can distinguish between familiar and unfamiliar humans.

  10. Precocious Ossification of the Tympanoperiotic Bone in Fetal and Newborn Dolphins: An Evolutionary Adaptation to the Aquatic Environment? (United States)

    Cozzi, Bruno; Podestà, Michela; Vaccaro, Calogero; Poggi, Roberto; Mazzariol, Sandro; Huggenberger, Stefan; Zotti, Alessandro


    The present study, performed with a dual-energy X-ray (DXA) bone densitometer on a series of fetal and newborn striped and short-beaked common dolphins, shows that the bone density of the area of the tympanic bulla within the tympanoperiotic complex starts with 0.483 g cm(-2) in 5- to 6-month-old specimens of striped (or common) dolphin fetuses and reaches 1.841 g cm(-2) in newborn striped dolphins, with values consistently higher than in other parts of the skull or elsewhere in the skeleton. The same results apply to the common bottlenose dolphins, in which the area of the tympanic bulla has a density of 0.312 g cm(-2) in 5-month-old specimens and becomes four times as much in newborns. Regardless of the areal bone density results correlated to the DXA-technique, comparisons with DXA-bone density data in the literature referred to other mammals emphasize the presence of very high mineral deposition in the area of the tympanoperiotic bone in fetal and newborn dolphins and the most dense part of it belongs to the tympanic bulla. The early osseous maturation of the tympanic bulla area may be compared to what described in fin whales and may represent an unique ontogenetic and phylogenetic feature of cetaceans, possibly related to the development of essential acoustic sense and establishment of immediate post-natal mother-calf relationship. © 2015 Wiley Periodicals, Inc.

  11. The interplay between social networks and culture: theoretically and among whales and dolphins (United States)

    Cantor, Mauricio; Whitehead, Hal


    Culture is increasingly being understood as a driver of mammalian phenotypes. Defined as group-specific behaviour transmitted by social learning, culture is shaped by social structure. However, culture can itself affect social structure if individuals preferentially interact with others whose behaviour is similar, or cultural symbols are used to mark groups. Using network formalism, this interplay can be depicted by the coevolution of nodes and edges together with the coevolution of network topology and transmission patterns. We review attempts to model the links between the spread, persistence and diversity of culture and the network topology of non-human societies. We illustrate these processes using cetaceans. The spread of socially learned begging behaviour within a population of bottlenose dolphins followed the topology of the social network, as did the evolution of the song of the humpback whale between breeding areas. In three bottlenose dolphin populations, individuals preferentially associated with animals using the same socially learned foraging behaviour. Homogeneous behaviour within the tight, nearly permanent social structures of the large matrilineal whales seems to result from transmission bias, with cultural symbols marking social structures. We recommend the integration of studies of culture and society in species for which social learning is an important determinant of behaviour. PMID:23569288

  12. The interplay between social networks and culture: theoretically and among whales and dolphins. (United States)

    Cantor, Mauricio; Whitehead, Hal


    Culture is increasingly being understood as a driver of mammalian phenotypes. Defined as group-specific behaviour transmitted by social learning, culture is shaped by social structure. However, culture can itself affect social structure if individuals preferentially interact with others whose behaviour is similar, or cultural symbols are used to mark groups. Using network formalism, this interplay can be depicted by the coevolution of nodes and edges together with the coevolution of network topology and transmission patterns. We review attempts to model the links between the spread, persistence and diversity of culture and the network topology of non-human societies. We illustrate these processes using cetaceans. The spread of socially learned begging behaviour within a population of bottlenose dolphins followed the topology of the social network, as did the evolution of the song of the humpback whale between breeding areas. In three bottlenose dolphin populations, individuals preferentially associated with animals using the same socially learned foraging behaviour. Homogeneous behaviour within the tight, nearly permanent social structures of the large matrilineal whales seems to result from transmission bias, with cultural symbols marking social structures. We recommend the integration of studies of culture and society in species for which social learning is an important determinant of behaviour.

  13. Site-specific assessments of the abundance of three inshore dolphin species to inform conservation and management

    Directory of Open Access Journals (Sweden)

    Alexander Mark Brown


    Full Text Available Assessing the abundance of wildlife populations is essential to their effective conservation and management. Concerns have been raised over the vulnerability of tropical inshore dolphins in waters off northern Australia to anthropogenic impacts on local populations, yet a lack of abundance data precludes assessment of their conservation status and the management of threats. Using small vessels as cost-effective research platforms, photo-identification surveys and capture-recapture models were applied to provide the first quantitative abundance data for Australian snubfin (Orcaella heinsohni, Australian humpback (Sousa sahulensis, and Indo-Pacific bottlenose dolphins (Tursiops aduncus at five sites in the Kimberley region of north-western Australia. The abundance of each species was highly variable between different sites, likely reflecting species-specific habitat preferences. Within the c. 130 km2 study sites, the estimated abundance of most species was ≤ 60 individuals (excluding calves, and fewer than 20 humpback dolphins were identified at each site in any one 3-5 week sampling period. However, larger estimates of c. 130 snubfin and c. 160 bottlenose dolphins were obtained at two different sites. Several local populations showed evidence of site fidelity, particularly snubfin dolphins. By implementing a standardized, multi-site approach, data on local populations were provided within a broader, regional context, and indicated that each species is patchily distributed in the region. This highlights the need for site-specific baseline data collection using appropriate survey techniques to quantitatively assess the potential impacts of threatening activities to local populations. These findings further illustrate the need to gain a greater understanding of known and potential threats to inshore dolphin populations, their relative impacts, and to mitigate where necessary. In particular, the level of interactions with inshore gillnet fisheries

  14. Evolution of the alternative AQP2 gene: Acquisition of a novel protein-coding sequence in dolphins. (United States)

    Kishida, Takushi; Suzuki, Miwa; Takayama, Asuka


    Taxon-specific de novo protein-coding sequences are thought to be important for taxon-specific environmental adaptation. A recent study revealed that bottlenose dolphins acquired a novel isoform of aquaporin 2 generated by alternative splicing (alternative AQP2), which helps dolphins to live in hyperosmotic seawater. The AQP2 gene consists of four exons, but the alternative AQP2 gene lacks the fourth exon and instead has a longer third exon that includes the original third exon and a part of the original third intron. Here, we show that the latter half of the third exon of the alternative AQP2 arose from a non-protein-coding sequence. Intact ORF of this de novo sequence is shared not by all cetaceans, but only by delphinoids. However, this sequence is conservative in all modern cetaceans, implying that this de novo sequence potentially plays important roles for marine adaptation in cetaceans. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Exhaled breath condensate methods adapted from human studies using longitudinal metabolomics for predicting early health alterations in dolphins. (United States)

    Borras, Eva; Aksenov, Alexander A; Baird, Mark; Novick, Brittany; Schivo, Michael; Zamuruyev, Konstantin O; Pasamontes, Alberto; Parry, Celeste; Foutouhi, Soraya; Venn-Watson, Stephanie; Weimer, Bart C; Davis, Cristina E


    Monitoring health conditions is essential to detect early asymptomatic stages of a disease. To achieve this, blood, urine and breath samples are commonly used as a routine clinical diagnostic. These samples offer the opportunity to detect specific metabolites related to diseases and provide a better understanding of their development. Although blood samples are commonly used routinely to monitor health, the implementation of a relatively noninvasive technique, such as exhaled breath condensate (EBC) analysis, may further benefit the well-being of both humans and other animals. EBC analysis can be used to track possible physical or biochemical alterations caused by common diseases of the bottlenose dolphin (Tursiops truncatus), such as infections or inflammatory-mediated processes. We have used an untargeted metabolomic method with liquid chromatography-mass spectrometry analysis of EBC samples to determine biomarkers related to disease development. In this study, five dolphins under human care were followed up for 1 year. We collected paired blood, physical examination information, and EBC samples. We then statistically correlated this information to predict specific health alterations. Three dolphins provided promising case study information about biomarkers related to cutaneous infections, respiratory infections, dental disease, or hormonal changes (pregnancy). The use of complementary liquid chromatography platforms, with hydrophilic interaction chromatography and reverse-phased columns, allowed us to detect a wide spectrum of EBC biomarker compounds that could be related to these health alterations. Moreover, these two analytical techniques not only provided complementary metabolite information but in both cases they also provided promising diagnostic information for these health conditions. Graphical abstract Collection of the exhaled condensed breath from a bottlenose dolphin from U.S. Navy Marine Mammal Program (MMP).

  16. Diabetes and the Metabolic Syndrome: Possibilities of a New Breath Test in a Dolphin Model (United States)

    Schivo, Michael; Aksenov, Alexander A.; Yeates, Laura C.; Pasamontes, Alberto; Davis, Cristina E.


    Diabetes type-2 and the metabolic syndrome are prevalent in epidemic proportions and result in significant co-morbid disease. Limitations in understanding of dietary effects and cholesterol metabolism exist. Current methods to assess diabetes are essential, though many are invasive; for example, blood glucose and lipid monitoring require regular finger sticks and blood draws. A novel method to study these diseases may be non-invasive breath testing of exhaled compounds. Currently, acetone and lipid peroxidation products have been seen in small scale studies, though other compounds may be significant. As Atlantic bottlenose dolphins (Tursiops truncatus) have been proposed as a good model for human diabetes, applications of dietary manipulations and breath testing in this population may shed important light on how to design human clinical studies. In addition, ongoing studies indicate that breath testing in dolphins is feasible, humane, and yields relevant metabolites. By studying the metabolic and cholesterol responses of dolphins to dietary modifications, researchers may gain insight into human diabetes, improve the design of costly human clinical trials, and potentially discover biomarkers for non-invasive breath monitoring. PMID:24324455

  17. Occurrence and species diversity of delphinids off-Lagos shore ...

    African Journals Online (AJOL)

    The pantropical spotted dolphin (Stenella attenuate) with two (2) schools of 150 individuals, (Stenella frontalis) with one (1) school of 54 individuals, bottlenose dolphin (Tursiops trucantus) with one (1) school of 32 individuals, Common dolphin (Delphinus delphis ) with four (4) schools of 452 individuals and (3) schools of ...

  18. Enchanting and enchanted dolphins. An analysis of human/dolphin encounters.


    Servais, Véronique


    In occidental countries, the figure of the dolphin is permeated with love. Not only do people love dolphins, but the dolphins' anthropophilia belongs to their natural history as well : they rescue men at sea, play in the bow waves of boats, and sometime develop enduring friendships with humans. People who have encountered dolphins in the open sea regularly speak about "falling in love" or feeling "pure love" from the dolphin ; others report telepathy, trance or mystic revelations. The emotion...

  19. Increased Dietary Intake of Saturated Fatty Acid Heptadecanoic Acid (C17:0) Associated with Decreasing Ferritin and Alleviated Metabolic Syndrome in Dolphins (United States)

    Venn-Watson, Stephanie K.; Parry, Celeste; Baird, Mark; Stevenson, Sacha; Carlin, Kevin; Daniels, Risa; Smith, Cynthia R.; Jones, Richard; Wells, Randall S.; Ridgway, Sam; Jensen, Eric D.


    Similar to humans, bottlenose dolphins (Tursiops truncatus) can develop metabolic syndrome and associated high ferritin. While fish and fish-based fatty acids may protect against metabolic syndrome in humans, findings have been inconsistent. To assess potential protective factors against metabolic syndrome related to fish diets, fatty acids were compared between two dolphin populations with higher (n = 30, Group A) and lower (n = 19, Group B) mean insulin (11 ± 12 and 2 ± 5 μIU/ml, respectively; P dolphins. Capelin, a common dietary fish for Group A, had no detectable C17:0, while pinfish and mullet, common in Group B’s diet, had C17:0 (41 and 67 mg/100g, respectively). When a modified diet adding 25% pinfish and/or mullet was fed to six Group A dolphins over 24 weeks (increasing the average daily dietary C17:0 intake from 400 to 1700 mg), C17:0 serum levels increased, high ferritin decreased, and blood-based metabolic syndrome indices normalized toward reference levels. These effects were not found in four reference dolphins. Further, higher total serum C17:0 was an independent and linear predictor of lower ferritin in dolphins in Group B dolphins. Among off the shelf dairy products tested, butter had the highest C17:0 (423mg/100g); nonfat dairy products had no detectable C17:0. We hypothesize that humans’ movement away from diets with potentially beneficial saturated fatty acid C17:0, including whole fat dairy products, could be a contributor to widespread low C17:0 levels, higher ferritin, and metabolic syndrome. PMID:26200116

  20. Feeding and growth in a captive-born bottlenose dolphin Tursiops ...

    African Journals Online (AJOL)


    Jun 12, 1991 ... Changes in the behaviours associated with suckling were monitored and suggested that the mammary glands need tactile ... calf appears to obtain about 50% of its food from nursing and 50% from fish (Leatherwood ... In cetaceans, nursing is initially the only method of food intake. The topic of suckling in ...

  1. A Systematic Approach to Measuring the Social Behavior of Bottlenose Dolphins

    National Research Council Canada - National Science Library

    Samuels, Amy


    .... To expedite this change, an intellectual history of the field is provided, from the early whaler-naturalists to oceanarium observations, whale carcass studies, pseud-scientific inquiries into human...

  2. Determining the Molecular and Genetic Basis for Diabetes in Navy Bottlenose Dolphins (Tursiops truncatus) (United States)


    compared to those from humans, mice, and rats. Targeted binding sites, including TATA boxes, included those for the transcription factors, forkhead box 01...CCTACTGATGATGCACCTTTGATCAATAGATTTTAGACAAAAGTGTTTTTTTGAGTCCAA ******* ******************** ************ * * ***** ******** TATA Box AGATCAGGGCTGGGTTGACCTGAATACTGGATACAGGGCA

  3. Immunotoxicity of Silver Nanoparticles (AgNPs) on the Leukocytes of Common Bottlenose Dolphins (Tursiops truncatus). (United States)

    Li, Wen-Ta; Chang, Hui-Wen; Yang, Wei-Cheng; Lo, Chieh; Wang, Lei-Ya; Pang, Victor Fei; Chen, Meng-Hsien; Jeng, Chian-Ren


    Silver nanoparticles (AgNPs) have been extensively used and are considered as an emerging contaminant in the ocean. The environmental contamination of AgNPs is expected to increase greatly over time, and cetaceans, as the top ocean predators, will suffer the negative impacts of AgNPs. In the present study, we investigate the immunotoxicity of AgNPs on the leukocytes of cetaceans using several methods, including cytomorphology, cytotoxicity, and functional activity assays. The results reveal that 20 nm Citrate-AgNPs (C-AgNP 20 ) induce different cytomorphological alterations and intracellular distributions in cetacean polymorphonuclear cells (cPMNs) and peripheral blood mononuclear cells (cPBMCs). At high concentrations of C-AgNP 20 (10 and 50 μg/ml), the time- and dose-dependent cytotoxicity in cPMNs and cPBMCs involving apoptosis is demonstrated. C-AgNP 20 at sub-lethal doses (0.1 and 1 μg/ml) negatively affect the functional activities of cPMNs (phagocytosis and respiratory burst) and cPBMCs (proliferative activity). The current study presents the first evidence of the cytotoxicity and immunotoxicity of AgNPs on the leukocytes of cetaceans and improves our understanding of environmental safety concerning AgNPs. The dose-response data of AgNPs on the leukocytes of cetaceans are invaluable for evaluating the adverse health effects in cetaceans and for proposing a conservation plan for marine mammals.

  4. A full-capture Hierarchical Bayesian model of Pollock's Closed Robust Design and application to dolphins

    Directory of Open Access Journals (Sweden)

    Robert William Rankin


    Full Text Available We present a Hierarchical Bayesian version of Pollock's Closed Robust Design for studying the survival, temporary-migration, and abundance of marked animals. Through simulations and analyses of a bottlenose dolphin photo-identification dataset, we compare several estimation frameworks, including Maximum Likelihood estimation (ML, model-averaging by AICc, as well as Bayesian and Hierarchical Bayesian (HB procedures. Our results demonstrate a number of advantages of the Bayesian framework over other popular methods. First, for simple fixed-effect models, we show the near-equivalence of Bayesian and ML point-estimates and confidence/credibility intervals. Second, we demonstrate how there is an inherent correlation among temporary-migration and survival parameter estimates in the PCRD, and while this can lead to serious convergence issues and singularities among MLEs, we show that the Bayesian estimates were more reliable. Third, we demonstrate that a Hierarchical Bayesian model with carefully thought-out hyperpriors, can lead to similar parameter estimates and conclusions as multi-model inference by AICc model-averaging. This latter point is especially interesting for mark-recapture practitioners, for whom model-uncertainty and multi-model inference have become a major preoccupation. Lastly, we extend the Hierarchical Bayesian PCRD to include full-capture histories (i.e., by modelling a recruitment process and individual-level heterogeneity in detection probabilities, which can have important consequences for the range of phenomena studied by the PCRD, as well as lead to large differences in abundance estimates. For example, we estimate 8%-24% more bottlenose dolphins in the western gulf of Shark Bay than previously estimated by ML and AICc-based model-averaging. Other important extensions are discussed. Our Bayesian PCRD models are written in the BUGS-like JAGS language for easy dissemination and customization by the community of capture

  5. Estimating the cumulative effects of the nature-based tourism in a coastal dolphin population from southern Kenya (United States)

    Pérez-Jorge, Sergi; Louzao, Maite; Oro, Daniel; Pereira, Thalia; Corne, Chloe; Wijtten, Zeno; Gomes, Inês; Wambua, John; Christiansen, Fredrik


    Due to the growth of nature-based tourism worldwide, behavioural studies are needed to assess the impact of this industry on wildlife populations and understand their short-term effect. Tourism impact on dolphin populations remain poorly documented in developing countries. This study investigates the effects of nature-based tourism on the behaviour of the Indo-Pacific bottlenose dolphins (Tursiops aduncus) in southern Kenya. We used Markov chain models to estimate transition probabilities between behavioural states in the presence and absence of tourist boats, and assess the overall behavioural budgets. Based on these data and the tourism intensity in the area, we quantified the potential tourist boat disturbance over the period 2006-2013. Our results demonstrated that tourist boat interactions affected dolphins' behavioural budgets, with a significant decrease in the overall amount of time travelling and an increase in diving. The average duration of travelling and resting decreased significantly in the presence of boats. Although the cumulative tourism exposure was not significant for the dolphin population at their current levels, these impacts should be taken into consideration with the potential tourism growth in the area. This is particularly important if tourism reaches periods of high intensity, as we have shown that these periods could have a significant impact for the species, particularly where home-range and core areas are highly overlap by this activity. Understanding the effect of human disturbance variations from previous years may help to predict the consequences on dolphin populations, towards achieving a more ecological and economic sustainability of the activity.

  6. An Interview with a Dolphin. (United States)

    Brook, Kathy; Keilty, Jennifer


    A fabricated conversation between two humans and a dolphin at Marineland illustrates man's relationship to nature and the impact that human actions have on living creatures and the environment, and stresses developing a deeper understanding and value for the natural world and consideration of the universality of continued human error and…

  7. The hydrodynamics of dolphin drafting

    Directory of Open Access Journals (Sweden)

    Weihs Daniel


    Full Text Available Abstract Background Drafting in cetaceans is defined as the transfer of forces between individuals without actual physical contact between them. This behavior has long been surmised to explain how young dolphin calves keep up with their rapidly moving mothers. It has recently been observed that a significant number of calves become permanently separated from their mothers during chases by tuna vessels. A study of the hydrodynamics of drafting, initiated in the hope of understanding the mechanisms causing the separation of mothers and calves during fishing-related activities, is reported here. Results Quantitative results are shown for the forces and moments around a pair of unequally sized dolphin-like slender bodies. These include two major effects. First, the so-called Bernoulli suction, which stems from the fact that the local pressure drops in areas of high speed, results in an attractive force between mother and calf. Second is the displacement effect, in which the motion of the mother causes the water in front to move forwards and radially outwards, and water behind the body to move forwards to replace the animal's mass. Thus, the calf can gain a 'free ride' in the forward-moving areas. Utilizing these effects, the neonate can gain up to 90% of the thrust needed to move alongside the mother at speeds of up to 2.4 m/sec. A comparison with observations of eastern spinner dolphins (Stenella longirostris is presented, showing savings of up to 60% in the thrust that calves require if they are to keep up with their mothers. Conclusions A theoretical analysis, backed by observations of free-swimming dolphin schools, indicates that hydrodynamic interactions with mothers play an important role in enabling dolphin calves to keep up with rapidly moving adult school members.

  8. Heart Development in the Spotted Dolphin (Stenella attenuata)

    Czech Academy of Sciences Publication Activity Database

    Míšek, Ivan; Sedmera, D.; Klíma, M.; Thompson, R. P.


    Roč. 6, č. 5 (2003), s. 687-699 ISSN 0003-276X R&D Projects: GA AV ČR IAA7039901 Institutional research plan: CEZ:AV0Z5045916 Keywords : cardiac morphogenesis * compact myocardium * coronary vasculogenesis Subject RIV: ED - Physiology Impact factor: 1.587, year: 2002

  9. PCB pollution continues to impact populations of orcas and other dolphins in European waters (United States)

    Jepson, Paul D.; Deaville, Rob; Barber, Jonathan L.; Aguilar, Àlex; Borrell, Asunción; Murphy, Sinéad; Barry, Jon; Brownlow, Andrew; Barnett, James; Berrow, Simon; Cunningham, Andrew A.; Davison, Nicholas J.; Ten Doeschate, Mariel; Esteban, Ruth; Ferreira, Marisa; Foote, Andrew D.; Genov, Tilen; Giménez, Joan; Loveridge, Jan; Llavona, Ángela; Martin, Vidal; Maxwell, David L.; Papachlimitzou, Alexandra; Penrose, Rod; Perkins, Matthew W.; Smith, Brian; de Stephanis, Renaud; Tregenza, Nick; Verborgh, Philippe; Fernandez, Antonio; Law, Robin J.


    Organochlorine (OC) pesticides and the more persistent polychlorinated biphenyls (PCBs) have well-established dose-dependent toxicities to birds, fish and mammals in experimental studies, but the actual impact of OC pollutants on European marine top predators remains unknown. Here we show that several cetacean species have very high mean blubber PCB concentrations likely to cause population declines and suppress population recovery. In a large pan-European meta-analysis of stranded (n = 929) or biopsied (n = 152) cetaceans, three out of four species:- striped dolphins (SDs), bottlenose dolphins (BNDs) and killer whales (KWs) had mean PCB levels that markedly exceeded all known marine mammal PCB toxicity thresholds. Some locations (e.g. western Mediterranean Sea, south-west Iberian Peninsula) are global PCB “hotspots” for marine mammals. Blubber PCB concentrations initially declined following a mid-1980s EU ban, but have since stabilised in UK harbour porpoises and SDs in the western Mediterranean Sea. Some small or declining populations of BNDs and KWs in the NE Atlantic were associated with low recruitment, consistent with PCB-induced reproductive toxicity. Despite regulations and mitigation measures to reduce PCB pollution, their biomagnification in marine food webs continues to cause severe impacts among cetacean top predators in European seas.

  10. PCB pollution continues to impact populations of orcas and other dolphins in European waters. (United States)

    Jepson, Paul D; Deaville, Rob; Barber, Jonathan L; Aguilar, Àlex; Borrell, Asunción; Murphy, Sinéad; Barry, Jon; Brownlow, Andrew; Barnett, James; Berrow, Simon; Cunningham, Andrew A; Davison, Nicholas J; Ten Doeschate, Mariel; Esteban, Ruth; Ferreira, Marisa; Foote, Andrew D; Genov, Tilen; Giménez, Joan; Loveridge, Jan; Llavona, Ángela; Martin, Vidal; Maxwell, David L; Papachlimitzou, Alexandra; Penrose, Rod; Perkins, Matthew W; Smith, Brian; de Stephanis, Renaud; Tregenza, Nick; Verborgh, Philippe; Fernandez, Antonio; Law, Robin J


    Organochlorine (OC) pesticides and the more persistent polychlorinated biphenyls (PCBs) have well-established dose-dependent toxicities to birds, fish and mammals in experimental studies, but the actual impact of OC pollutants on European marine top predators remains unknown. Here we show that several cetacean species have very high mean blubber PCB concentrations likely to cause population declines and suppress population recovery. In a large pan-European meta-analysis of stranded (n = 929) or biopsied (n = 152) cetaceans, three out of four species:- striped dolphins (SDs), bottlenose dolphins (BNDs) and killer whales (KWs) had mean PCB levels that markedly exceeded all known marine mammal PCB toxicity thresholds. Some locations (e.g. western Mediterranean Sea, south-west Iberian Peninsula) are global PCB "hotspots" for marine mammals. Blubber PCB concentrations initially declined following a mid-1980s EU ban, but have since stabilised in UK harbour porpoises and SDs in the western Mediterranean Sea. Some small or declining populations of BNDs and KWs in the NE Atlantic were associated with low recruitment, consistent with PCB-induced reproductive toxicity. Despite regulations and mitigation measures to reduce PCB pollution, their biomagnification in marine food webs continues to cause severe impacts among cetacean top predators in European seas.

  11. Are Conversations Between Dolphins and Humans Possible?


    Kuczaj II, Stan A.


    Scientific speculations concerning the sophistication of dolphin communication systems have contributed to the notion that meaningful two-way communication between dolphins and humans is possible. This notion has garnered considerable support in the media and popular literature, resulting in an enduring myth that dolphins and humans can communicate in ways that rival, and perhaps even surpass, human-human communication. The truth, however, is quite different from the myth. Although humans and...

  12. The Behavioural Ecology of Indo-Pacific Humpback Dolphins in Hong Kong. (United States)

    Würsig, Bernd; Parsons, E C M; Piwetz, Sarah; Porter, Lindsay


    Fewer than 200 Indo-Pacific humpback dolphins (Sousa chinensis) occur in Hong Kong waters (though these are part of a much larger population in the Pearl River Estuary), with a decrease in the past about 10 years. They have partially overlapping individual ranges (mean=100km(2)), and two partially overlapping communities. Seasonal occurrence is higher in June-November than December-May, approximate wet and dry monsoon seasons, respectively. Group sizes tend to average three dolphins, a decrease from the past decade. Feeding often occurs in abruptly changing water depths and off rocky natural shores. The area immediately north of Hong Kong International Airport is largely used for travelling between locations to the west, east and further north. The area around Lung Kwu Chau Island in northwest Hong Kong is a "hot spot" for foraging and socializing. The area off Fan Lau, southwest Lantau Island, is largely used for foraging. A former foraging "hot spot" was located around the Brothers Islands east of the airport, now reduced, possibly due to increases in high-speed ferries (HSFs) and other activities. Sound recordings of dolphins from bottom-mounted hydrophones suggest that northwestern Hong Kong waters are used more at night than in daytime. Sexual activity and calving occur throughout the year, with a peak in late spring to autumn (wet monsoon season). Humpback dolphins communicate acoustically with each other and probably passively listen to prey in murky waters, and anthropogenic noises may be masking communication and affecting prey location. Increasing sounds of shipping, HSFs and industrial activities are likely to alter dolphin habitat use patterns and overall behaviours beyond the present already affected status. © 2016 Elsevier Ltd. All rights reserved.

  13. Age Spots (United States)

    ... for Every Season How to Choose the Best Skin Care Products In This Section Dermatologic Surgery What is dermatologic ... for Every Season How to Choose the Best Skin Care Products Age Spots Treatment Options Learn more about treatment ...

  14. 50 CFR 216.91 - Dolphin-safe labeling standards. (United States)


    ... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Dolphin-safe labeling standards. 216.91... MAMMALS Dolphin Safe Tuna Labeling § 216.91 Dolphin-safe labeling standards. (a) It is a violation of... include on the label of those products the term “dolphin-safe” or any other term or symbol that claims or...

  15. Phonation behavior of cooperatively foraging spinner dolphins. (United States)

    Benoit-Bird, Kelly J; Au, Whitlow W L


    Groups of spinner dolphins have been shown to cooperatively herd small prey. It was hypothesized that the strong group coordination is maintained by acoustic communication, specifically by frequency-modulated whistles. Observations of groups of spinner dolphins foraging at night within a sound-scattering layer were made with a multibeam echosounder while the rates of dolphin sounds were measured using four hydrophones at 6 m depth intervals. Whistles were only detected when dolphins were not foraging and when animals were surfacing. Differences in click rates were found between depths and between different foraging stages but were relatively low when observations indicated that dolphins were actively feeding despite the consistency of these clicks with echolocation signals. Highest click rates occurred within the scattering layer, during transitions between foraging states. This suggests that clicks may be used directly or indirectly to cue group movement during foraging, potentially by detecting other individuals' positions in the group or serving a direct communicative role which would be contrary to the existing assumption that echolocation and communication are compartmentalized. Communicating via clicks would be beneficial as the signal's characteristics minimize the chance of eavesdropping by competing dolphins and large fish. Our results are unable to support the established paradigm for dolphin acoustic communication and suggest an alternate coordination mechanism in foraging spinner dolphins.

  16. Spatial and Temporal Variations in the Occurrence and Foraging Activity of Coastal Dolphins in Menai Bay, Zanzibar, Tanzania.

    Directory of Open Access Journals (Sweden)

    Andrew J Temple

    Full Text Available Understanding temporal patterns in distribution, occurrence and behaviour is vital for the effective conservation of cetaceans. This study used cetacean click detectors (C-PODs to investigate spatial and temporal variation in occurrence and foraging activity of the Indo-Pacific bottlenose (Tursiops aduncus and Indian Ocean humpback (Sousa plumbea dolphins resident in the Menai Bay Conservation Area (MBCA, Zanzibar, Tanzania. Occurrence was measured using detection positive minutes. Inter-click intervals were used to identify terminal buzz vocalisations, allowing for analysis of foraging activity. Data were analysed in relation to spatial (location and temporal (monsoon season, diel phase and tidal phase variables. Results showed significantly increased occurrence and foraging activity of dolphins in southern areas and during hours of darkness. Higher occurrence at night was not explained by diel variation in echolocation rate and so were considered representative of occurrence patterns. Both tidal phase and monsoon season influenced occurrence but results varied among sites, with no general patterns found. Foraging activity was greatest during hours of darkness, High water and Flood tidal phases. Comparisons of echolocation data among sites suggested differences in the broadband click spectra of MBCA dolphins, possibly indicative of species differences. These dolphin populations are threatened by unsustainable fisheries bycatch and tourism activities. The spatial and temporal patterns identified in this study have implications for future conservation and management actions with regards to these two threats. Further, the results indicate future potential for using passive acoustics to identify and monitor the occurrence of these two species in areas where they co-exist.

  17. The Use of Carcasses for the Analysis of Cetacean Population Genetic Structure: A Comparative Study in Two Dolphin Species (United States)

    Bilgmann, Kerstin; Möller, Luciana M.; Harcourt, Robert G.; Kemper, Catherine M.; Beheregaray, Luciano B.


    Advances in molecular techniques have enabled the study of genetic diversity and population structure in many different contexts. Studies that assess the genetic structure of cetacean populations often use biopsy samples from free-ranging individuals and tissue samples from stranded animals or individuals that became entangled in fishery or aquaculture equipment. This leads to the question of how representative the location of a stranded or entangled animal is with respect to its natural range, and whether similar results would be obtained when comparing carcass samples with samples from free-ranging individuals in studies of population structure. Here we use tissue samples from carcasses of dolphins that stranded or died as a result of bycatch in South Australia to investigate spatial population structure in two species: coastal bottlenose (Tursiops sp.) and short-beaked common dolphins (Delphinus delphis). We compare these results with those previously obtained from biopsy sampled free-ranging dolphins in the same area to test whether carcass samples yield similar patterns of genetic variability and population structure. Data from dolphin carcasses were gathered using seven microsatellite markers and a fragment of the mitochondrial DNA control region. Analyses based on carcass samples alone failed to detect genetic structure in Tursiops sp., a species previously shown to exhibit restricted dispersal and moderate genetic differentiation across a small spatial scale in this region. However, genetic structure was correctly inferred in D. delphis, a species previously shown to have reduced genetic structure over a similar geographic area. We propose that in the absence of corroborating data, and when population structure is assessed over relatively small spatial scales, the sole use of carcasses may lead to an underestimate of genetic differentiation. This can lead to a failure in identifying management units for conservation. Therefore, this risk should be carefully

  18. Spatial and Temporal Variations in the Occurrence and Foraging Activity of Coastal Dolphins in Menai Bay, Zanzibar, Tanzania. (United States)

    Temple, Andrew J; Tregenza, Nick; Amir, Omar A; Jiddawi, Narriman; Berggren, Per


    Understanding temporal patterns in distribution, occurrence and behaviour is vital for the effective conservation of cetaceans. This study used cetacean click detectors (C-PODs) to investigate spatial and temporal variation in occurrence and foraging activity of the Indo-Pacific bottlenose (Tursiops aduncus) and Indian Ocean humpback (Sousa plumbea) dolphins resident in the Menai Bay Conservation Area (MBCA), Zanzibar, Tanzania. Occurrence was measured using detection positive minutes. Inter-click intervals were used to identify terminal buzz vocalisations, allowing for analysis of foraging activity. Data were analysed in relation to spatial (location) and temporal (monsoon season, diel phase and tidal phase) variables. Results showed significantly increased occurrence and foraging activity of dolphins in southern areas and during hours of darkness. Higher occurrence at night was not explained by diel variation in echolocation rate and so were considered representative of occurrence patterns. Both tidal phase and monsoon season influenced occurrence but results varied among sites, with no general patterns found. Foraging activity was greatest during hours of darkness, High water and Flood tidal phases. Comparisons of echolocation data among sites suggested differences in the broadband click spectra of MBCA dolphins, possibly indicative of species differences. These dolphin populations are threatened by unsustainable fisheries bycatch and tourism activities. The spatial and temporal patterns identified in this study have implications for future conservation and management actions with regards to these two threats. Further, the results indicate future potential for using passive acoustics to identify and monitor the occurrence of these two species in areas where they co-exist.

  19. Comprehension of signs by dolphins (Tursiops truncatus). (United States)

    Tschudin, A; Call, J; Dunbar, R I; Harris, G; van der Elst, C


    The authors assessed the ability of 6 captive dolphins (Tursiops truncatus) to comprehend without explicit training 3 human communicative signs (pointing, directed gaze, and replica). Pointing consisted of indicating the target item with the index finger and a fully extended arm. Directed gaze consisted of orienting the head and eyes toward the target item while the rest of the body remained stationary. The replica signal consisted of holding up an exact duplicate of the target item. On the initial series of 12 trials for each condition, 3 dolphins performed above chance on pointing, 2 on gaze, and none for replica. With additional trials, above chance performance increased to 4 dolphins for pointing, 6 for gazing, and 2 for replica. The replica sign seemed to be the most taxing for them (only 2 dolphins achieved results significantly above chance). Taken together, these results indicate that dolphins are able to interpret untrained communicative signs successfully.

  20. SPOT Program (United States)

    Smith, Jason T.; Welsh, Sam J.; Farinetti, Antonio L.; Wegner, Tim; Blakeslee, James; Deboeck, Toni F.; Dyer, Daniel; Corley, Bryan M.; Ollivierre, Jarmaine; Kramer, Leonard; hide


    A Spacecraft Position Optimal Tracking (SPOT) program was developed to process Global Positioning System (GPS) data, sent via telemetry from a spacecraft, to generate accurate navigation estimates of the vehicle position and velocity (state vector) using a Kalman filter. This program uses the GPS onboard receiver measurements to sequentially calculate the vehicle state vectors and provide this information to ground flight controllers. It is the first real-time ground-based shuttle navigation application using onboard sensors. The program is compact, portable, self-contained, and can run on a variety of UNIX or Linux computers. The program has a modular objec-toriented design that supports application-specific plugins such as data corruption remediation pre-processing and remote graphics display. The Kalman filter is extensible to additional sensor types or force models. The Kalman filter design is also strong against data dropouts because it uses physical models from state and covariance propagation in the absence of data. The design of this program separates the functionalities of SPOT into six different executable processes. This allows for the individual processes to be connected in an a la carte manner, making the feature set and executable complexity of SPOT adaptable to the needs of the user. Also, these processes need not be executed on the same workstation. This allows for communications between SPOT processes executing on the same Local Area Network (LAN). Thus, SPOT can be executed in a distributed sense with the capability for a team of flight controllers to efficiently share the same trajectory information currently being computed by the program. SPOT is used in the Mission Control Center (MCC) for Space Shuttle Program (SSP) and International Space Station Program (ISSP) operations, and can also be used as a post -flight analysis tool. It is primarily used for situational awareness, and for contingency situations.

  1. Risso's dolphins plan foraging dives. (United States)

    Arranz, Patricia; Benoit-Bird, Kelly J; Southall, Brandon L; Calambokidis, John; Friedlaender, Ari S; Tyack, Peter L


    Humans remember the past and use that information to plan future actions. Lab experiments that test memory for the location of food show that animals have a similar capability to act in anticipation of future needs, but less work has been done on animals foraging in the wild. We hypothesized that planning abilities are critical and common in breath-hold divers who adjust each dive to forage on prey varying in quality, location and predictability within constraints of limited oxygen availability. We equipped Risso's dolphins with sound-and-motion recording tags to reveal where they focus their attention through their externally observable echolocation and how they fine tune search strategies in response to expected and observed prey distribution. The information from the dolphins was integrated with synoptic prey data obtained from echosounders on an underwater vehicle. At the start of the dives, whales adjusted their echolocation inspection ranges in ways that suggest planning to forage at a particular depth. Once entering a productive prey layer, dolphins reduced their search range comparable to the scale of patches within the layer, suggesting that they were using echolocation to select prey within the patch. On ascent, their search range increased, indicating that they decided to stop foraging within that layer and started searching for prey in shallower layers. Information about prey, learned throughout the dive, was used to plan foraging in the next dive. Our results demonstrate that planning for future dives is modulated by spatial memory derived from multi-modal prey sampling (echoic, visual and capture) during earlier dives. © 2018. Published by The Company of Biologists Ltd.

  2. Dark Spots (United States)


    Dark spots (left) and 'fans' appear to scribble dusty hieroglyphics on top of the Martian south polar cap in two high-resolution Mars Global Surveyor, Mars Orbiter Camera images taken in southern spring. Each image is about 3-kilometers wide (2-miles).

  3. Animal communication: do dolphins have names? (United States)

    Barton, Robert A


    A new study of contact calls in dolphins shows that individuals can recognize one another using information encoded in the frequency modulation pattern of these calls, in the absence of general voice characteristics.

  4. Dolphin Continuous Auditory Vigilance for Five Days

    National Research Council Canada - National Science Library

    Ridgway, Sam; Finneran, James; Carder, Don; Keough, Mandy; Van Bonn, William; Smith, Cynthia; Scadeng, Miriam; Dubowitz, David; Mattrey, Robert; Hoh, Carl


    .... Diazepam has been shown to induce unihemispheric slow waves (USW), therefore we used functional imaging of dolphins with and without diazepam to observe hemispheric differences in brain metabolism and blood flow...

  5. Dolphin Continuous Auditory Vigilance for Five Days

    National Research Council Canada - National Science Library

    Ridgway, Sam; Finneran, James; Carder, Don; Keough, Mandy; Van Bonn, William; Smith, Cynthia; Scadeng, Miriam; Dubowitz, David; Mattrey, Robert; Hoh, Carl


    This report documents the first use of magnetic resonance images (MRIs) of living dolphins to register functional brain scans, allowing for the exploration of potential mechanisms of unihemispheric sleep...

  6. Living in an estuary: Commerson's dolphin (Cephalorhynchus commersonii (Lacépède, 1804, habitat use and behavioural pattern at the Santa Cruz River, Patagonia, Argentina

    Directory of Open Access Journals (Sweden)

    Rocio Loizaga de Castro


    Full Text Available Commerson's dolphins, Cephalorhynchus commersonii, suffer bycatch in fisheries and are target of dolphin-watching activities along Patagonia. Here we described dolphins' habitat use and behavioural pattern at the estuary of Santa Cruz River. Behavioural observations were made from vantage points using a spotting scope. Boat surveys were conducted randomly from Puerto Santa Cruz to the mouth of the river to analyze the habitat use. The survey area was divided into 1 km² cells and characterized with depth and benthic slope. The described behaviours for the Commerson's dolphin were: travelling, slow travelling, milling, resting, socializing, stationary swimming and diving. A new behavioural context was assigned to diving, a behaviour that showed a high frequency during downing tide, suggesting a benthic foraging strategy. Additionally, we found a strong influence of the tide on Commerson's dolphin behaviour. Habitat use models indicated that dolphins prefer shallow water inside the estuary. The knowledge of the behavioural patterns and the habitat use of these endemic species, in this unexplored area, provide tools for management and conservation purposes.

  7. Tracing the pathway of compositional changes in bone mineral with age: preliminary study of bioapatite aging in hypermineralized dolphin's bulla. (United States)

    Li, Zhen; Pasteris, Jill D


    Studies of mineral compositional effects during bone aging are complicated by the presence of collagen. Hypermineralized bullae of Atlantic bottlenose dolphins of aging, edge areas become less porous, whereas the concentration of organics in the edge is reduced. Enhancement of coupled substitutions of CO3(2-) for PO4(3-) and Na for Ca during aging increases carbonate content up to ~10wt.% in the adult bulla. 1) Changes in physical properties during aging did not occur simultaneously with changes in chemical properties of the bone mineral. 2) Compositional changes in bone mineral were minor during the neonatal to sub-adult stage, but significant during later maturity. 3) Na and CO3 concentrations co-vary in a 1:1 molar proportion during aging. 4) The mineral's crystallinity did not decrease as CO3 concentration increased during aging. Hypermineralized dolphin's bulla, due to extreme depletion in collagen, is an ideal material for investigating mineralogical changes in bioapatite during bone aging. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Bubbles in live-stranded dolphins. (United States)

    Dennison, S; Moore, M J; Fahlman, A; Moore, K; Sharp, S; Harry, C T; Hoppe, J; Niemeyer, M; Lentell, B; Wells, R S


    Bubbles in supersaturated tissues and blood occur in beaked whales stranded near sonar exercises, and post-mortem in dolphins bycaught at depth and then hauled to the surface. To evaluate live dolphins for bubbles, liver, kidneys, eyes and blubber-muscle interface of live-stranded and capture-release dolphins were scanned with B-mode ultrasound. Gas was identified in kidneys of 21 of 22 live-stranded dolphins and in the hepatic portal vasculature of 2 of 22. Nine then died or were euthanized and bubble presence corroborated by computer tomography and necropsy, 13 were released of which all but two did not re-strand. Bubbles were not detected in 20 live wild dolphins examined during health assessments in shallow water. Off-gassing of supersaturated blood and tissues was the most probable origin for the gas bubbles. In contrast to marine mammals repeatedly diving in the wild, stranded animals are unable to recompress by diving, and thus may retain bubbles. Since the majority of beached dolphins released did not re-strand it also suggests that minor bubble formation is tolerated and will not lead to clinically significant decompression sickness.

  9. Post-epizootic chronic dolphin morbillivirus infection in Mediterranean striped dolphins Stenella coeruleoalba. (United States)

    Soto, Sara; Alba, Ana; Ganges, Llilianne; Vidal, Enric; Raga, Juan Antonio; Alegre, Ferrán; González, Beatriz; Medina, Pascual; Zorrilla, Irene; Martínez, Jorge; Marco, Alberto; Pérez, Mónica; Pérez, Blanca; Pérez de Vargas Mesas, Ana; Martínez Valverde, Rosa; Domingo, Mariano


    Dolphin morbillivirus (DMV) has caused 2 epizootics with high mortality rates on the Spanish Mediterranean coast, in 1990 and 2006-07, mainly affecting striped dolphins Stenella coeruleoalba. Following the first epizootic unusual DMV infections affecting only the central nervous system of striped dolphins were found, with histological features similar to subacute sclerosing panencephalitis and old dog encephalitis, the chronic latent localised infections caused by defective forms of measles virus and canine distemper virus, respectively. Between 2008 and 2010, monitoring by microscopic and immunohistochemical (IHC) studies of 118 striped dolphins stranded along Catalonia, the Valencia Region and Andalusia showed similar localised DMV nervous system infections in 25.0, 28.6 and 27.4% of cases, respectively, with no significant differences among regions or sex. The body length of DMV-infected dolphins was statistically greater than that of non-infected dolphins (196.5 vs. 160.5 cm; p dolphins with positive IHC-DMV had positive PCR results. All 6 cases were positive with the 78 bp RT-PCR. These findings contraindicate the use of the 429 bp RT-PCR protocol based on the P gene to detect this specific form of DMV. DMV localised nervous infection constitutes the most relevant single cause of stranding and death in Mediterranean striped dolphins in the years following a DMV epizootic, and it might even overwhelm the effects of the epizootic itself, at least in 2007.

  10. Increased Dietary Intake of Saturated Fatty Acid Heptadecanoic Acid (C17:0 Associated with Decreasing Ferritin and Alleviated Metabolic Syndrome in Dolphins.

    Directory of Open Access Journals (Sweden)

    Stephanie K Venn-Watson

    Full Text Available Similar to humans, bottlenose dolphins (Tursiops truncatus can develop metabolic syndrome and associated high ferritin. While fish and fish-based fatty acids may protect against metabolic syndrome in humans, findings have been inconsistent. To assess potential protective factors against metabolic syndrome related to fish diets, fatty acids were compared between two dolphin populations with higher (n = 30, Group A and lower (n = 19, Group B mean insulin (11 ± 12 and 2 ± 5 μIU/ml, respectively; P < 0.0001 and their dietary fish. In addition to higher insulin, triglycerides, and ferritin, Group A had lower percent serum heptadecanoic acid (C17:0 compared to Group B (0.3 ± 0.1 and 1.3 ± 0.4%, respectively; P < 0.0001. Using multivariate stepwise regression, higher percent serum C17:0, a saturated fat found in dairy fat, rye, and some fish, was an independent predictor of lower insulin in dolphins. Capelin, a common dietary fish for Group A, had no detectable C17:0, while pinfish and mullet, common in Group B's diet, had C17:0 (41 and 67 mg/100g, respectively. When a modified diet adding 25% pinfish and/or mullet was fed to six Group A dolphins over 24 weeks (increasing the average daily dietary C17:0 intake from 400 to 1700 mg, C17:0 serum levels increased, high ferritin decreased, and blood-based metabolic syndrome indices normalized toward reference levels. These effects were not found in four reference dolphins. Further, higher total serum C17:0 was an independent and linear predictor of lower ferritin in dolphins in Group B dolphins. Among off the shelf dairy products tested, butter had the highest C17:0 (423mg/100g; nonfat dairy products had no detectable C17:0. We hypothesize that humans' movement away from diets with potentially beneficial saturated fatty acid C17:0, including whole fat dairy products, could be a contributor to widespread low C17:0 levels, higher ferritin, and metabolic syndrome.

  11. Dolphins maintain cognitive performance during 72 to 120 hours of continuous auditory vigilance. (United States)

    Ridgway, Sam; Keogh, Mandy; Carder, Don; Finneran, James; Kamolnick, Tricia; Todd, Mark; Goldblatt, Allen


    The present study reports the first use of a choice visual-vocal response time cognitive task, during 72 or 120 h of continuous auditory vigilance. Two adult bottlenose dolphins (Tursiops truncatus), NAY (male) and SAY (female), maintained a very high detection rate (91.1-98.7%) of random 1.5 s goal tones infrequently substituted in a background of frequent 0.5 s equal-amplitude tones over continuous 72 or 120 h sessions. In addition, a choice visual-vocal response time task (CVVRT) tested cognitive performance during night time sessions, when the dolphins would have ordinarily been resting or asleep as we had observed in previous studies. NAY and SAY detected a single-bar, posterior, vertical, green (S1g) or 3-bar, anterior, horizontal, red (S2r) LED light stimulus presented randomly to each eye. They responded with a different vocalization (whistle or pulse burst) to each stimulus (S1g or S2r) presented randomly to left and right eyes. The animals maintained high levels of goal tone detection without signs of sleep deprivation as indicated by behavior, blood indices or marked sleep rebound during 24 h of continuous post-experiment observation. Acoustic goal tone response time (AGTRT) overall did not change during the 72 h (F=0.528, P=0.655) or 120 h (F=0.384, P=0.816) sessions. Nor did CVVRT slow or degrade over the 72 h (F=4.188, P=0.104) or 120 h (F=2.298, P=0.119) AGTRT sessions.

  12. Mongolian spots

    Directory of Open Access Journals (Sweden)

    Divya Gupta


    Full Text Available Mongolian spots (MS are birthmarks that are present at birth and their most common location is sacrococcygeal or lumbar area. Lesions may be single or multiple and usually involve < 5% total body surface area. They are macular and round, oval or irregular in shape. The color varies from blue to greenish, gray, black or a combination of any of the above. The size varies from few to more than 20 centimetres. Pigmentation is most intense at the age of one year and gradually fades thereafter. It is rarely seen after the age of 6 years. Aberrant MS over occiput, temple, mandibular area, shoulders and limbs may be confused with other dermal melanocytoses and bruises secondary to child abuse, thus necessitating documentation at birth. Although regarded as benign, recent data suggest that MS may be associated with inborn errors of metabolism and neurocristopathies. Mongolian spots usually resolve by early childhood and hence no treatment is generally needed if they are located in the sacral area. However, sometimes it may be required for extrasacral lesions for cosmesis.

  13. Dolphins adjust species-specific frequency parameters to compensate for increasing background noise. (United States)

    Papale, Elena; Gamba, Marco; Perez-Gil, Monica; Martin, Vidal Martel; Giacoma, Cristina


    An increase in ocean noise levels could interfere with acoustic communication of marine mammals. In this study we explored the effects of anthropogenic and natural noise on the acoustic properties of a dolphin communication signal, the whistle. A towed array with four elements was used to record environmental background noise and whistles of short-beaked common-, Atlantic spotted- and striped-dolphins in the Canaries archipelago. Four frequency parameters were measured from each whistle, while Sound Pressure Levels (SPL) of the background noise were measured at the central frequencies of seven one-third octave bands, from 5 to 20 kHz. Results show that dolphins increase the whistles' frequency parameters with lower variability in the presence of anthropogenic noise, and increase the end frequency of their whistles when confronted with increasing natural noise. This study provides the first evidence that the synergy among SPLs has a role in shaping the whistles' structure of these three species, with respect to both natural and anthropogenic noise.

  14. Dolphins adjust species-specific frequency parameters to compensate for increasing background noise.

    Directory of Open Access Journals (Sweden)

    Elena Papale

    Full Text Available An increase in ocean noise levels could interfere with acoustic communication of marine mammals. In this study we explored the effects of anthropogenic and natural noise on the acoustic properties of a dolphin communication signal, the whistle. A towed array with four elements was used to record environmental background noise and whistles of short-beaked common-, Atlantic spotted- and striped-dolphins in the Canaries archipelago. Four frequency parameters were measured from each whistle, while Sound Pressure Levels (SPL of the background noise were measured at the central frequencies of seven one-third octave bands, from 5 to 20 kHz. Results show that dolphins increase the whistles' frequency parameters with lower variability in the presence of anthropogenic noise, and increase the end frequency of their whistles when confronted with increasing natural noise. This study provides the first evidence that the synergy among SPLs has a role in shaping the whistles' structure of these three species, with respect to both natural and anthropogenic noise.

  15. Population Structure of Island-Associated Dolphins: Evidence from Mitochondrial and Microsatellite Markers for Common Bottlenose Dolphins (Tursiops truncatus) Around the Main Hawaiian Islands (United States)


    commercial and recreational fisheries, marine ecotourism , and boat traffic. If the animals being affected by these anthropogenic activities are...insular populations are exposed to greater vessel traffic, including that associated with ecotourism , and are thus more likely to suffer vessel strikes

  16. Aerial Visual Shape Discrimination and Matching-To-Sample Problem Solving Ability of an Atlantic Bottlenose Dolphin. (United States)


    MD-l69 356 AERIAL VISUL SHAPE DISCRIINATION AND / MATCHING-TO-SANPLE PROBLEM SOLVINO.. (U) NAVAL OCEAN SYSTEMS CENTER SAN DIEGO CA N K CHUN MAY 76...ADMINISTRATIVE INFORMATION ’A The research was conducted at the Naval Ocean Systems (enter. Hawaii Laboratory,. and sponsored by Naval Sea Systems Command...reduce well to quantification, and are governed by theories of Gestalt psychology. In applying information theory to the measurement of form parameters

  17. Underwater vocalization of bottlenose dolphins in the region of the Sado estuary: acoustic features and occurence patterns


    Alves, Inês Sofia Carvalho


    Tese de mestrado em Ecologia Marinha, apresentada à Universidade de Lisboa, através da Faculdade de Ciências, 2017 Os golfinhos-roazes, Tursiops truncatus (Montagu 1821), são mamíferos aquáticos, pertencentes à ordem Cetartiodactyla, infraordem Cetacea, parvordem Odontoceti e à família Delphinidae. Esta espécie apresenta uma ampla distribuição, habitando desde águas tropicais até às águas temperadas, e algumas populações podem ser residentes, habitando baias, lagoas ou estuários, como o do...

  18. Novel Atlantic bottlenose dolphin parainfluenza virus TtPIV-1 clusters with bovine PIV-3 genotype B strains (United States)

    Parainfluenza virus 3 (PIV-3) is a common viral infection not only in humans, but many other species. Serological evidence suggests that nearly 100% of children in the United States have been infected with PIV-3 by five years of age. Similarly, in cattle PIV-3 is commonly associated with bovine re...

  19. Cultural transmission of tool use by Indo-Pacific bottlenose dolphins (Tursiops sp.) provides access to a novel foraging niche

    NARCIS (Netherlands)

    Kruetzen, Michael; Kreicker, Sina; MacLeod, Colin D.; Learmonth, Jennifer; Kopps, Anna M.; Walsham, Pamela; Allen, Simon J.


    Culturally transmitted tool use has important ecological and evolutionary consequences and has been proposed as a significant driver of human evolution. Such evidence is still scarce in other animals. In cetaceans, tool use has been inferred using indirect evidence in one population of Indo-Pacific

  20. 76 FR 51943 - Proposed Information Collection; Comment Request; International Dolphin Conservation Program (United States)


    ... Collection; Comment Request; International Dolphin Conservation Program AGENCY: National Oceanic and... and Atmospheric Administration (NOAA) collects information to implement the International Dolphin... specific conditions, from [[Page 51944

  1. Bispectral index monitoring of unihemispheric effects in dolphins. (United States)

    Howard, Red S; Finneran, James J; Ridgway, Sam H


    When dolphins sleep, their electroencephalographic activity may change in only one cerebral hemisphere; i.e., the left and right brain hemispheres can take turns sleeping. We demonstrate that the bispectral index (BIS) monitor can detect interhemispheric asymmetry in the dolphin species Tursiops truncatus. Using two BIS sensors placed simultaneously over each side of the dolphin's head, we often, but not always, found significant differences between the two BIS values (e.g., left side 60 and right side 90) in non-medicated animals and in animals given propofol, atropine, and/or diazepam. Observations were each made over a period of approximately 3 h on dolphins resting out of the water. Unihemispheric effects may be inducible pharmacologically in dolphins. The dolphin, with its human-sized brain, may provide an animal model for study of unihemispheric effects in humans.

  2. Dolphin Cognition: Representations and Processes in Memory and Perception


    Mercado III, Eduardo; DeLong, Caroline M.


    Many people agree that dolphins are sentient beings, but few would claim to know what being a dolphin is like. From a psychological perspective, a dolphin’s experiences are a function of its mental capacities, especially those processes that relate to memories, percepts, thoughts, and emotions. This paper reviews what is currently known about dolphins’ cognitive abilities, focusing on how they perceive and remember events. Experiments with captive dolphins show that they can flexibly access m...

  3. The dolphin cochlear nucleus: topography, histology and functional implications. (United States)

    Malkemper, E P; Oelschläger, H H A; Huggenberger, S


    Despite the outstanding auditory capabilities of dolphins, there is only limited information available on the cytology of the auditory brain stem nuclei in these animals. Here, we investigated the cochlear nuclei (CN) of five brains of common dolphins (Delphinus delphis) and La Plata dolphins (Pontoporia blainvillei) using cell and fiber stain microslide series representing the three main anatomical planes. In general, the CN in dolphins comprise the same set of subnuclei as in other mammals. However, the volume ratio of the dorsal cochlear nucleus (DCN) in relation to the ventral cochlear nucleus (VCN) of dolphins represents a minimum among the mammals examined so far. Because, for example, in cats the DCN is necessary for reflexive orientation of the head and pinnae towards a sound source, the massive restrictions in head movability in dolphins and the absence of outer ears may be correlated with the reduction of the DCN. Moreover, the same set of main neuron types were found in the dolphin CN as in other mammals, including octopus and multipolar cells. Because the latter two types of neurons are thought to be involved in the recognition of complex sounds, including speech, we suggest that, in dolphins, they may be involved in the processing of their communication signals. Comparison of the toothed whale species studied here revealed that large spherical cells were present in the La Plata dolphin but absent in the common dolphin. These neurons are known to be engaged in the processing of low-frequency sounds in terrestrial mammals. Accordingly, in the common dolphin, the absence of large spherical cells seems to be correlated with a shift of its auditory spectrum into the high-frequency range above 20 kHz. The existence of large spherical cells in the VCN of the La Plata dolphin, however, is enigmatic asthis species uses frequencies around 130 kHz. Copyright © 2011 Wiley Periodicals, Inc.

  4. Neural network modeling of a dolphin's sonar discrimination capabilities

    DEFF Research Database (Denmark)

    Andersen, Lars Nonboe; René Rasmussen, A; Au, WWL


    The capability of an echo-locating dolphin to discriminate differences in the wall thickness of cylinders was previously modeled by a counterpropagation neural network using only spectral information of the echoes [W. W. L. Au, J. Acoust. Soc. Am. 95, 2728–2735 (1994)]. In this study, both time...... and frequency information were used to model the dolphin discrimination capabilities. Echoes from the same cylinders were digitized using a broadband simulated dolphin sonar signal with the transducer mounted on the dolphin's pen. The echoes were filtered by a bank of continuous constant-Q digital filters...

  5. SpotADAPT

    DEFF Research Database (Denmark)

    Kaulakiene, Dalia; Thomsen, Christian; Pedersen, Torben Bach


    by Amazon Web Services (AWS). The users aiming for the spot market are presented with many instance types placed in multiple datacenters in the world, and thus it is difficult to choose the optimal deployment. In this paper, we propose the framework SpotADAPT (Spot-Aware (re-)Deployment of Analytical...... execution within boundaries). Moreover, during the execution of the workload, SpotADAPT suggests a redeployment if the current spot instance gets terminated by Amazon or a better deployment becomes possible due to fluctuations of the spot prices. The approach is evaluated using the actual execution times...

  6. An evaluation of marine traffic on the Chinese white dolphins (United States)

    Lee, C.


    The proposed third runway reclamation project of Hong Kong airport will soon impact the surrounding population of Chinese white dolphins. According to the World Wide Fund for Nature (WWF), the size of the reclamation will be 650 hectares of land located to the north of the current airport platform. All of the necessary works will be conducted via the surrounding marine areas. During the construction period the dredging and reclamation activities will increase the risk of dolphins colliding with this extra marine traffic especially since this construction site is less than one kilometre away from the dolphin marine park of Sha Chau & Lung Kwu Chau. Furthermore, after the construction of the third runway, there will be a re-routing of Skypier Ferries and other high speed boats through this area. The dolphins will undoubtedly be disturbed. The increase in vessel traffic during the construction project will also generate sounds that may interfere with echolocation systems that dolphins rely on to navigate and fish. This further impact can be measured using underwater hydrophones that can record the boat noise as well as the dolphin clicks. The latter determines the presence or absence of dolphins. From this the impact of noise on dolphin populations can be determined by simply determining if the dolphins stay around during periods of high levels of underwater noise. The data presented is the result of several years of collection. A clear understanding of the conjunction of noises from the dolphins and marine traffic patterns for different times of the day will help determine the impact and offer the chance to change marine traffic patterns thus minimizing the adverse impact on the iconic Hong Kong white dolphins.

  7. Is dolphin morbillivirus virulent for white-beaked dolphins (Lagenorhynchus albirostris)? (United States)

    van Elk, C E; van de Bildt, M W G; Jauniaux, T; Hiemstra, S; van Run, P R W A; Foster, G; Meerbeek, J; Osterhaus, A D M E; Kuiken, T


    The virulence of morbilliviruses for toothed whales (odontocetes) appears to differ according to host species. In 4 species of odontocetes, morbilliviruses are highly virulent, causing large-scale epizootics with high mortality. In 8 other species of odontocetes, including white-beaked dolphins (Lagenorhynchus albirostris), morbilliviruses have been found as an incidental infection. In these species, the virulence of morbilliviruses is not clear. Therefore, the admission of 2 white-beaked dolphins with morbillivirus infection into a rehabilitation center provided a unique opportunity to investigate the virulence of morbillivirus in this species. By phylogenetic analysis, the morbilliviruses in both animals were identified as a dolphin morbillivirus (DMV) most closely related to that detected in a white-beaked dolphin in Germany in 2007. Both animals were examined clinically and pathologically. Case No. 1 had a chronic neural DMV infection, characterized by polioencephalitis in the cerebrum and morbillivirus antigen expression limited to neurons and glial cells. Surprisingly, no nervous signs were observed in this animal during the 6 months before death. Case No. 2 had a subacute systemic DMV infection, characterized by interstitial pneumonia, leucopenia, lymphoid depletion, and DMV antigen expression in mononuclear cells and syncytia in the lung and in mononuclear cells in multiple lymphoid organs. Cause of death was not attributed to DMV infection in either animal. DMV was not detected in 2 contemporaneously stranded white-beaked dolphins. Stranding rate did not increase in the region. These results suggest that DMV is not highly virulent for white-beaked dolphins. © The Author(s) 2013.

  8. DolphinAtack: Inaudible Voice Commands


    Zhang, Guoming; Yan, Chen; Ji, Xiaoyu; Zhang, Taimin; Zhang, Tianchen; Xu, Wenyuan


    Speech recognition (SR) systems such as Siri or Google Now have become an increasingly popular human-computer interaction method, and have turned various systems into voice controllable systems(VCS). Prior work on attacking VCS shows that the hidden voice commands that are incomprehensible to people can control the systems. Hidden voice commands, though hidden, are nonetheless audible. In this work, we design a completely inaudible attack, DolphinAttack, that modulates voice commands on ultra...

  9. Computer derivation of some dolphin echolocation signals. (United States)

    Altes, R A


    Recent advances in radar theory have given rise to a straightforward method of sonar signal design. The method involves computer maximization of a signal-to-interference ratio. The procedure has been used to derive sonar signals that can accurately measure target velocity. When two dolphins were placed in a situation conducive to the utilization of such signals, their waveforms were similar to those that had been theoretically derived.

  10. Influence of dolphin style on the spine


    Šenková, Martina


    Severe idiopathic scoliosis often represents a therapeutic problem of how to influence a patient with these substantial spinal deformities for a long period of time. There are many possibilities to therapeutically affect the patient at the start of the therapy; but in order to prevent the defect's progression it is necessary to employ a long-term and even permanent care. The aim of this thesis is to demonstrate the possibility of influencing the position of the spine through dolphin style in ...

  11. Enron and Totalfina enter the Dolphin project

    International Nuclear Information System (INIS)



    The UAE Offsets Group Office (UOG), responsible for developing alliances between the private sector of the United Arab Emirates and international companies, announced on 1. March that a strategic partnership has been established with Enron and TotalFina Elf for implementation of the Dolphin Project, one of the largest world-wide integrated initiatives in the energy sector. The First objective of this partnership, the life of which has been fixed at 25 years, will be to develop the Dolphin infrastructure through a new gas pipeline with a capacity of 85 million cu.m of gas per day, linking Qatar to Abu Dhabi and the Sultanate of Oman. This initial phase will be based on the development of activities all along the gas line. The Project Development Agreement (PDA) concluded by the UOG, Enron and Elf also includes the exploitation of other opportunities in the Gulf countries and the region. The UOG will hold a majority share of 51% in this partnership, the remaining 49% being shared equally between Enron and Elf. Construction work on the gas pipeline and the various installations upstream of Qatar should be quickly put in hand. A series of preliminary agreements concluded with the government authorities of Qatar, Abu Dhabi, Dubai, Oman and Pakistan, relating to the procurement and sale of gas, has enabled the implementation of the geographical and political organisation necessary to realize the Dolphin Project. (author)

  12. 50 CFR 216.95 - Official mark for “Dolphin-safe” tuna products. (United States)


    ... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Official mark for âDolphin-safeâ tuna... AND IMPORTING OF MARINE MAMMALS Dolphin Safe Tuna Labeling § 216.95 Official mark for “Dolphin-safe... Department of Commerce that may be used to label tuna products that meet the “dolphin-safe” standards set...

  13. The Occurrence and Distribution of Dolphins in Zanzibar, Tanzania ...

    African Journals Online (AJOL)

    Incidental catches (bycatch) in gillnet fisheries off Zanzibar (Unguja Island), as a source of mortality among several species of dolphins, were reported in a questionnaire survey conducted in 1999. As a follow-up to that survey, from January 2000 to August 2003, we monitored the incidental catches of dolphins collected from ...

  14. Spinner dolphins Stenella longirostris off south-west Mauritius ...

    African Journals Online (AJOL)

    Spinner dolphins Stenella longirostris longirostris off the south-west coast of Mauritius are subject to ongoing anthropogenic disturbance in the form of daily dolphin tourism, which has intensified since 1998. Abundance of this species was estimated using photo-identification data and mark-recapture analysis. Between April ...

  15. Dolphin shows and interaction programs: benefits for conservation education? (United States)

    Miller, L J; Zeigler-Hill, V; Mellen, J; Koeppel, J; Greer, T; Kuczaj, S


    Dolphin shows and dolphin interaction programs are two types of education programs within zoological institutions used to educate visitors about dolphins and the marine environment. The current study examined the short- and long-term effects of these programs on visitors' conservation-related knowledge, attitude, and behavior. Participants of both dolphin shows and interaction programs demonstrated a significant short-term increase in knowledge, attitudes, and behavioral intentions. Three months following the experience, participants of both dolphin shows and interaction programs retained the knowledge learned during their experience and reported engaging in more conservation-related behaviors. Additionally, the number of dolphin shows attended in the past was a significant predictor of recent conservation-related behavior suggesting that repetition of these types of experiences may be important in inspiring people to conservation action. These results suggest that both dolphin shows and dolphin interaction programs can be an important part of a conservation education program for visitors of zoological facilities. © 2012 Wiley Periodicals, Inc.

  16. Lobomycosis: risk of zoonotic transmission from dolphins to humans. (United States)

    Reif, John S; Schaefer, Adam M; Bossart, Gregory D


    Lobomycosis, a fungal disease of the skin and subcutaneous tissues caused by Lacazia loboi, is sometimes referred to as a zoonotic disease because it affects only specific delphinidae and humans; however, the evidence that it can be transferred directly to humans from dolphins is weak. Dolphins have also been postulated to be responsible for an apparent geographic expansion of the disease in humans. Morphological and molecular differences between the human and dolphin organisms, differences in geographic distribution of the diseases between dolphins and humans, the existence of only a single documented case of presumed zoonotic transmission, and anecdotal evidence of lack of transmission to humans following accidental inoculation of tissue from infected dolphins do not support the hypothesis that dolphins infected with L. loboi represent a zoonotic hazard for humans. In addition, the lack of human cases in communities adjacent to coastal estuaries with a high prevalence of lobomycosis in dolphins, such as the Indian River Lagoon in Florida (IRL), suggests that direct or indirect transmission of L. loboi from dolphins to humans occurs rarely, if at all. Nonetheless, attention to personal hygiene and general principals of infection control are always appropriate when handling tissues from an animal with a presumptive diagnosis of a mycotic or fungal disease.

  17. Hawaiian spinner dolphins aggregate midwater food resources through cooperative foraging (United States)

    Benoit-Bird, Kelly; Au, Whitlow


    To test the hypothesis that spinner dolphins in Hawaii may actively aggregate their prey through cooperative foraging, a 200-kHz multi-beam sonar (Simrad MS2000) was used to observe 323 groups of spinner dolphins foraging within a midwater, micronekton sound-scattering layer off Oahu. Strong cooperation was observed in groups of 8-14 pairs of spinner dolphins. The dolphin group size was highest at midnight when the density of prey was highest and was significantly higher in Makua Beach, where the prey density was higher, than Electric Beach, where the prey density was lower. Cooperative groups of dolphins aggregated their food resources, apparently using their preys' avoidance behavior to create distinct, high-density patches in the prey. Prey aggregation was strongly stereo-typed, regardless of the distribution of the scattering layer. Dolphins swam around the edge of a 28-40 m diameter circle at least 5 times, concentrating prey within this area before pairs of dolphins on opposite sides of the circle swapped positions in the circle, swimming through the high density prey 'donut' they had formed. The hypothesis that nocturnal animals aggregate prey in midwater could not have been tested without the three-dimensional information on prey distribution and dolphin geometry provided by the multi-beam.

  18. Dams and river dolphins: Can they co-exist?

    International Nuclear Information System (INIS)

    Reeves, R.R.; Leatherwood, S.


    Dam construction is one of many ways that humans have modified river-dolphin habitats. It is suggested that physiographic and hydrologic complexity plays an important role in making rivers suitable for dolphins. If this hypothesis is true, then it can be assumed that dams and other artificial obstructions degrade dolphin habitat insofar as they reduce such complexity. This paper identifies some of the impacts that dams, barrages, and dikes might have on dolphins. Research is needed at project sites, both before and after construction, to document impacts. Specially designed ''swimways'' may allow upstream and downstream passage by dolphins and thus mitigate at least one of the adverse effects of dam projects, namely population fragmentation, but such measures aimed at benefiting single species are no substitute for protecting ecosystems. 30 refs

  19. Dolphins Can Maintain Vigilant Behavior through Echolocation for 15 Days without Interruption or Cognitive Impairment


    Branstetter, Brian K.; Finneran, James J.; Fletcher, Elizabeth A.; Weisman, Brian C.; Ridgway, Sam H.


    In dolphins, natural selection has developed unihemispheric sleep where alternating hemispheres of their brain stay awake. This allows dolphins to maintain consciousness in response to respiratory demands of the ocean. Unihemispheric sleep may also allow dolphins to maintain vigilant states over long periods of time. Because of the relatively poor visibility in the ocean, dolphins use echolocation to interrogate their environment. During echolocation, dolphin produce clicks and listen to retu...

  20. Review and experimental evaluation of the embryonic development and evolutionary history of flipper development and hyperphalangy in dolphins (Cetacea: Mammalia). (United States)

    Cooper, Lisa Noelle; Sears, Karen E; Armfield, Brooke A; Kala, Bhavneet; Hubler, Merla; Thewissen, J G M


    Cetaceans are the only mammals to have evolved hyperphalangy, an increase in the number of phalanges beyond the mammalian plesiomorphic condition of three phalanges per digit. In this study, cetaceans were used as a novel model to review previous studies of mammalian hyperphalangy and contribute new experimental evidence as to the molecular origins of this phenotype in embryos of the pantropical spotted dolphin (Stenella attenuata). Results show embryos of dolphins, mice, and pigs share similar spatiotemporal patterns of signaling proteins known to shape limbs of mammals (e.g., FGF8, BMP2/4, WNT, GREM). However, fetal dolphins differ in that their interdigital tissues are retained, instead of undergoing apoptosis, and that multiple waves of interdigital signals likely contribute to the patterning of supernumerary joints and phalanges in adjacent digits. Integration of fossil and experimental evidence suggests that the presence of interdigital webbing within the fossils of semi-aquatic cetaceans, recovered from the Eocene Epoch (49Ma), was probably the result of BMP-antagonists counteracting interdigital apoptosis during embryonic limb development. Modifications to signals originating in these interdigital tissues likely contributed to the origin of an incipient form of hyperphalangy in obligatorily aquatic cetaceans about 35Ma. Finally, an extreme form of hyperphalangy, with six or more phalanges per digit, evolved independently in rorqual whales (Balaenopteridae) and delphinids, and was probably associated with a wave of signaling within the interdigital tissues. © 2017 Wiley Periodicals, Inc.

  1. Genomic and expression analyses of Tursiops truncatus T cell receptor gamma (TRG) and alpha/delta (TRA/TRD) loci reveal a similar basic public γδ repertoire in dolphin and human. (United States)

    Linguiti, Giovanna; Antonacci, Rachele; Tasco, Gianluca; Grande, Francesco; Casadio, Rita; Massari, Serafina; Castelli, Vito; Consiglio, Arianna; Lefranc, Marie-Paule; Ciccarese, Salvatrice


    The bottlenose dolphin (Tursiops truncatus) is a mammal that belongs to the Cetartiodactyla and have lived in marine ecosystems for nearly 60 millions years. Despite its popularity, our knowledge about its adaptive immunity and evolution is very limited. Furthermore, nothing is known about the genomics and evolution of dolphin antigen receptor immunity. Here we report a evolutionary and expression study of Tursiops truncatus T cell receptor gamma (TRG) and alpha/delta (TRA/TRD) genes. We have identified in silico the TRG and TRA/TRD genes and analyzed the relevant mature transcripts in blood and in skin from four subjects. The dolphin TRG locus is the smallest and simplest of all mammalian loci as yet studied. It shows a genomic organization comprising two variable (V1 and V2), three joining (J1, J2 and J3) and a single constant (C), genes. Despite the fragmented nature of the genome assemblies, we deduced the TRA/TRD locus organization, with the recent TRDV1 subgroup genes duplications, as it is expected in artiodactyls. Expression analysis from blood of a subject allowed us to assign unambiguously eight TRAV genes to those annotated in the genomic sequence and to twelve new genes, belonging to five different subgroups. All transcripts were productive and no relevant biases towards TRAV-J rearrangements are observed. Blood and skin from four unrelated subjects expression data provide evidence for an unusual ratio of productive/unproductive transcripts which arise from the TRG V-J gene rearrangement and for a "public" gamma delta TR repertoire. The productive cDNA sequences, shared both in the same and in different individuals, include biases of the TRGV1 and TRGJ2 genes. The high frequency of TRGV1-J2/TRDV1- D1-J4 productive rearrangements in dolphins may represent an interesting oligo-clonal population comparable to that found in human with the TRGV9- JP/TRDV2-D-J T cells and in primates. Although the features of the TRG and TRA/TRD loci organization reflect

  2. The Dolphin in the Mirror - A Familiar Face? (United States)

    Dibble, Dianna Samuelson; Van Alstyne, Kaitlin Katie; Rohr, Jim; Ridgway, Sam


    We suggest how a basic physics problem becomes much richer when researchers of various disciplines converse. Our discussion explores Snell's window from the perspective of what a dolphin might see. An aperture, Snell's window, allows light to travel through the air-water interface. Outside this window, there is total reflection from under the water-air interface. Dolphins see through the aperture to follow our movements above the water's surface. When dolphins look outside the window, can they see their own reflections from under the water-air interface?

  3. Echolocation behavior of franciscana dolphins (Pontoporia blainvillei) in the wild. (United States)

    Melcón, Mariana L; Failla, Mauricio; Iñíguez, Miguel A


    Franciscana dolphins are small odontocetes hard to study in the field. In particular, little is known on their echolocation behavior in the wild. In this study we recorded 357 min and analyzed 1019 echolocation signals in the Rio Negro Estuary, Argentina. The clicks had a peak frequency at 139 kHz, and a bandwidth of 19 kHz, ranging from 130 to 149 kHz. This is the first study describing echolocation signals of franciscana dolphins in the wild, showing the presence of narrow-band high frequency signals in these dolphins. Whether they use other vocalizations to communicate or not remains uncertain.

  4. Sounds produced by Australian Irrawaddy dolphins, Orcaella brevirostris. (United States)

    Van Parijs, S M; Parra, G J; Corkeron, P J


    Sounds produced by Irrawaddy dolphins, Orcaella brevirostris, were recorded in coastal waters off northern Australia. They exhibit a varied repertoire, consisting of broadband clicks, pulsed sounds and whistles. Broad-band clicks, "creaks" and "buzz" sounds were recorded during foraging, while "squeaks" were recorded only during socializing. Both whistle types were recorded during foraging and socializing. The sounds produced by Irrawaddy dolphins do not resemble those of their nearest taxonomic relative, the killer whale, Orcinus orca. Pulsed sounds appear to resemble those produced by Sotalia and nonwhistling delphinids (e.g., Cephalorhynchus spp.). Irrawaddy dolphins exhibit a vocal repertoire that could reflect the acoustic specialization of this species to its environment.

  5. Electroreception in the Guiana dolphin (Sotalia guianensis). (United States)

    Czech-Damal, Nicole U; Liebschner, Alexander; Miersch, Lars; Klauer, Gertrud; Hanke, Frederike D; Marshall, Christopher; Dehnhardt, Guido; Hanke, Wolf


    Passive electroreception is a widespread sense in fishes and amphibians, but in mammals this sensory ability has previously only been shown in monotremes. While the electroreceptors in fish and amphibians evolved from mechanosensory lateral line organs, those of monotremes are based on cutaneous glands innervated by trigeminal nerves. Electroreceptors evolved from other structures or in other taxa were unknown to date. Here we show that the hairless vibrissal crypts on the rostrum of the Guiana dolphin (Sotalia guianensis), structures originally associated with the mammalian whiskers, serve as electroreceptors. Histological investigations revealed that the vibrissal crypts possess a well-innervated ampullary structure reminiscent of ampullary electroreceptors in other species. Psychophysical experiments with a male Guiana dolphin determined a sensory detection threshold for weak electric fields of 4.6 µV cm(-1), which is comparable to the sensitivity of electroreceptors in platypuses. Our results show that electroreceptors can evolve from a mechanosensory organ that nearly all mammals possess and suggest the discovery of this kind of electroreception in more species, especially those with an aquatic or semi-aquatic lifestyle.

  6. Guyana dolphins (Sotalia guianensis) from Costa Rica emit whistles that vary with surface behaviors. (United States)

    May-Collado, Laura J


    Guyana dolphins show remarkable intraspecific whistle variation. This variation has been largely explained in terms of distance among populations; however, other factors such as behavior may also be important. A broadband recording system recorded the whistles of Guyana dolphins under three behavioral states. A discriminant analysis found that during social and travel events, dolphins emit whistles with high delta and minimum frequency, respectively. Whistle duration was also important in discriminating behaviors. This study indicates that behavior is an important factor contributing to whistle variation of Guyana dolphins. Understanding how dolphin whistles vary with behavioral context will advance our understanding of dolphin communication and enable appropriate comparative studies.


    Toxoplasma gondii infection in marine mammals is intriguing and indicative of contamination of the ocean environment and coastal waters with oocysts. Toxoplasma gondii infection was detected in captive marine mammals at a seaquarium in Canada. Antibodies to T. gondii were found in all 7 bottlenose ...

  8. A Law of Word Meaning in Dolphin Whistle Types

    Directory of Open Access Journals (Sweden)

    Brenda McCowan


    Full Text Available We show that dolphin whistle types tend to be used in specific behavioral contexts, which is consistent with the hypothesis that dolphin whistle have some sort of “meaning”. Besides, in some cases, it can be shown that the behavioral context in which a whistle tends to occur or not occur is shared by different individuals, which is consistent with the hypothesis that dolphins are communicating through whistles. Furthermore, we show that the number of behavioral contexts significantly associated with a certain whistle type tends to grow with the frequency of the whistle type, a pattern that is reminiscent of a law of word meanings stating, as a tendency, that the higher the frequency of a word, the higher its number of meanings. Our findings indicate that the presence of Zipf's law in dolphin whistle types cannot be explained with enough detail by a simplistic die rolling experiment.

  9. Functional Imaging of Dolphin Brain Metabolism and Blood Flow

    National Research Council Canada - National Science Library

    Ridgway, Sam; Finneran, James; Carder, Don; Keogh, Mandy; Van Bonn, William; Smith, Cynthia; Scadeng, Miriam; Dubowitz, David; Mattrey, Robert; Hoh, Carl


    .... Diazepam has been shown to induce unihemispheric slow waves (USW), therefore we used functional imaging of dolphins with and without diazepam to observe hemispheric differences in brain metabolism and blood flow...

  10. Functional Imaging of Dolphin Brain Metabolism and Blood Flow

    National Research Council Canada - National Science Library

    Ridgway, Sam; Finneran, James; Carder, Don; Keogh, Mandy; Van Bonn, William; Smith, Cynthia; Scadeng, Miriam; Dubowitz, David; Mattrey, Robert; Hoh, Carl


    This report documents the first use of magnetic resonance images (MRls) of living dolphins to register functional brain scans, allowing for the exploration of potential mechanisms of unihemispheric sleep...

  11. Spot market for uranium

    International Nuclear Information System (INIS)

    Colhoun, C.


    The spot market is always quoted for the price of uranium because little information is available about long-term contracts. A review of the development of spot market prices shows the same price curve swings that occur with all raw materials. Future long-term contracts will probably be lower to reflect spot market prices, which are currently in the real-value range of $30-$35. An upswing in the price of uranium could come in the next few months as utilities begin making purchases and trading from stockpiles. The US, unlike Europe and Japan, has already reached a supply and demand point where the spot market share is increasing. Forecasters cannot project the market price, they can only predict the presence of an oscillating spot or a secondary market. 5 figures

  12. Sound variation and function in captive Commerson's dolphins (Cephalorhynchus commersonii). (United States)

    Yoshida, Yayoi M; Morisaka, Tadamichi; Sakai, Mai; Iwasaki, Mari; Wakabayashi, Ikuo; Seko, Atsushi; Kasamatsu, Masahiko; Akamatsu, Tomonari; Kohshima, Shiro


    Commerson's dolphin (Cephalorhynchus commersonii), one of the smallest dolphin species, has been reported to produce only narrow-band high-frequency (NBHF) clicks and no whistles. To clarify their sound repertoire and examine the function of each type, we analysed the sounds and behaviour of captive Commerson's dolphins in Toba Aquarium, Japan. All recorded sounds were NBHF clicks with peak frequency >110kHz. The recorded click-trains were categorised into four types based on the changing pattern of their Inter-click intervals (ICI): Decreasing type, with continuously decreasing ICI during the last part of the train; Increasing type, with continuously increasing ICI during the last part; Fluctuating type, with fluctuating ICI; and Burst-pulse type, with very short and constant ICI. The frequency of the Decreasing type increased when approaching an object newly introduced to the tank, suggesting that the sound is used for echolocation on approach. The Burst-pulse type suddenly increased in front of the object and was often oriented towards it, suggesting that it was used for echolocation in close proximity to the object. In contrast, the Increasing type was rarely recorded during approach, but increased when a dolphin approached another dolphin. The Increasing and Burst-pulse types also increased when dolphins began social behaviours. These results suggest that some NBHF clicks have functions other than echolocation, such as communication. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. A Functional Genomics Approach to Understanding and Evaluating Health in Navy Dolphins

    National Research Council Canada - National Science Library

    Romano, Tracy


    ... to chemical, biological and physical stress. To this end we have initialized development of a dolphin gene microarray in order to evaluate its utility as a transcriptomic biosensor in the health assessment of dolphins...

  14. Behaviour of Spinner Dolphin at Sha\\'ab Samadai, Marsa Alam, Red ...

    African Journals Online (AJOL)

    . Samadai, Marsa Alam, Red Sea. The data were collected from October 2005 until. September 2006 using surface observations. Four objectives were studied: arrival and departure time of dolphins, distribution of dolphin movements within the ...

  15. Unihemispheric slow-wave sleep in the Amazonian dolphin, Inia geoffrensis. (United States)

    Mukhametov, L M


    An electroencephalographic study of sleep in Amazonian dolphins, Inia geoffrensis, revealed that unihemispheric slow-wave sleep is the dominant sleep type in this species, as in the other two dolphin species that were studied earlier.

  16. Swimming and diving energetics in dolphins: a stroke-by-stroke analysis for predicting the cost of flight responses in wild odontocetes. (United States)

    Williams, Terrie M; Kendall, Traci L; Richter, Beau P; Ribeiro-French, Courtney R; John, Jason S; Odell, Kim L; Losch, Barbara A; Feuerbach, David A; Stamper, M Andrew


    Exponential increases in hydrodynamic drag and physical exertion occur when swimmers move quickly through water, and underlie the preference for relatively slow routine speeds by marine mammals regardless of body size. Because of this and the need to balance limited oxygen stores when submerged, flight (escape) responses may be especially challenging for this group. To examine this, we used open-flow respirometry to measure the energetic cost of producing a swimming stroke during different levels of exercise in bottlenose dolphins ( Tursiops truncatus ). These data were then used to model the energetic cost of high-speed escape responses by other odontocetes ranging in mass from 42 to 2738 kg. The total cost per stroke during routine swimming by dolphins, 3.31±0.20 J kg -1  stroke -1 , was doubled during maximal aerobic performance. A comparative analysis of locomotor costs (LC; in J kg -1  stroke -1 ), representing the cost of moving the flukes, revealed that LC during routine swimming increased with body mass ( M ) for odontocetes according to LC=1.46±0.0005 M ; a separate relationship described LC during high-speed stroking. Using these relationships, we found that continuous stroking coupled with reduced glide time in response to oceanic noise resulted in a 30.5% increase in metabolic rate in the beaked whale, a deep-diving odontocete considered especially sensitive to disturbance. By integrating energetics with swimming behavior and dive characteristics, this study demonstrates the physiological consequences of oceanic noise on diving mammals, and provides a powerful tool for predicting the biological significance of escape responses by cetaceans facing anthropogenic disturbances. © 2017. Published by The Company of Biologists Ltd.

  17. First indications that northern bottlenose whales are sensitive to behavioural disturbance from anthropogenic noise

    NARCIS (Netherlands)

    Miller, P.J.O.; Kvadsheim, P.H.; Lam, F.P.A.; Tyack, P.L.; Curé, C.; DeRuiter, S.L.; Kleivane, L.; Sivle, L.D.; IJsselmuide, S.P. van; Visser, F.; Wensveen, P.J.; Benda-Beckmann, A.M. von; Martín López, L.M.; Narazaki, T.; Hooker, S.K.


    Although northern bottlenose whales were the most heavily hunted beaked whale, we have little information about this species in its remote habitat of the North Atlantic Ocean. Underwater anthropogenic noise and disruption of their natural habitat may be major threats, given the sensitivity of other

  18. The environment as a driver of immune and endocrine responses in dolphins (Tursiops truncatus.

    Directory of Open Access Journals (Sweden)

    Patricia A Fair

    Full Text Available Immune and endocrine responses play a critical role in allowing animals to adjust to environmental perturbations. We measured immune and endocrine related markers in multiple samples from individuals from two managed-care care dolphin groups (n = 82 samples from 17 dolphins and single samples collected from two wild dolphin populations: Indian River Lagoon, (IRL FL (n = 26; and Charleston, (CHS SC (n = 19. The immune systems of wild dolphins were more upregulated than those of managed-care-dolphins as shown by higher concentrations of IgG and increases in lysozyme, NK cell function, pathogen antibody titers and leukocyte cytokine transcript levels. Collectively, managed-care care dolphins had significantly lower levels of transcripts encoding pro-inflammatory cytokine TNF, anti-viral MX1 and INFα and regulatory IL-10. IL-2Rα and CD69, markers of lymphocyte activation, were both lower in managed-care care dolphins. IL-4, a cytokine associated with TH2 activity, was lower in managed-care care dolphins compared to the free-ranging dolphins. Differences in immune parameters appear to reflect the environmental conditions under which these four dolphin populations live which vary widely in temperature, nutrition, veterinary care, pathogen/contaminant exposures, etc. Many of the differences found were consistent with reduced pathogenic antigenic stimulation in managed-care care dolphins compared to wild dolphins. Managed-care care dolphins had relatively low TH2 lymphocyte activity and fewer circulating eosinophils compared to wild dolphins. Both of these immunologic parameters are associated with exposure to helminth parasites which is uncommon in managed-care care dolphins. Less consistent trends were observed in a suite of hormones but significant differences were found for cortisol, ACTH, total T4, free T3, and epinephrine. While the underlying mechanisms are likely multiple and complex, the marked differences observed in the immune and endocrine

  19. The environment as a driver of immune and endocrine responses in dolphins (Tursiops truncatus). (United States)

    Fair, Patricia A; Schaefer, Adam M; Houser, Dorian S; Bossart, Gregory D; Romano, Tracy A; Champagne, Cory D; Stott, Jeffrey L; Rice, Charles D; White, Natasha; Reif, John S


    Immune and endocrine responses play a critical role in allowing animals to adjust to environmental perturbations. We measured immune and endocrine related markers in multiple samples from individuals from two managed-care care dolphin groups (n = 82 samples from 17 dolphins and single samples collected from two wild dolphin populations: Indian River Lagoon, (IRL) FL (n = 26); and Charleston, (CHS) SC (n = 19). The immune systems of wild dolphins were more upregulated than those of managed-care-dolphins as shown by higher concentrations of IgG and increases in lysozyme, NK cell function, pathogen antibody titers and leukocyte cytokine transcript levels. Collectively, managed-care care dolphins had significantly lower levels of transcripts encoding pro-inflammatory cytokine TNF, anti-viral MX1 and INFα and regulatory IL-10. IL-2Rα and CD69, markers of lymphocyte activation, were both lower in managed-care care dolphins. IL-4, a cytokine associated with TH2 activity, was lower in managed-care care dolphins compared to the free-ranging dolphins. Differences in immune parameters appear to reflect the environmental conditions under which these four dolphin populations live which vary widely in temperature, nutrition, veterinary care, pathogen/contaminant exposures, etc. Many of the differences found were consistent with reduced pathogenic antigenic stimulation in managed-care care dolphins compared to wild dolphins. Managed-care care dolphins had relatively low TH2 lymphocyte activity and fewer circulating eosinophils compared to wild dolphins. Both of these immunologic parameters are associated with exposure to helminth parasites which is uncommon in managed-care care dolphins. Less consistent trends were observed in a suite of hormones but significant differences were found for cortisol, ACTH, total T4, free T3, and epinephrine. While the underlying mechanisms are likely multiple and complex, the marked differences observed in the immune and endocrine systems of wild

  20. Soundscape Ecology of Hawaiian Spinner Dolphin Resting Bays (United States)

    Heenehan, Heather Leigh

    Sound is a key sensory modality for Hawaiian spinner dolphins. Like many other marine animals, these dolphins rely on sound and their acoustic environment for many aspects of their daily lives, making it is essential to understand soundscape in areas that are critical to their survival. Hawaiian spinner dolphins rest during the day in shallow coastal areas and forage offshore at night. In my dissertation I focus on the soundscape of the bays where Hawaiian spinner dolphins rest taking a soundscape ecology approach. I primarily relied on passive acoustic monitoring using four DSG-Ocean acoustic loggers in four Hawaiian spinner dolphin resting bays on the Kona Coast of Hawai'i Island. 30-second recordings were made every four minutes in each of the bays for 20 to 27 months between January 8, 2011 and March 30, 2013. I also utilized concomitant vessel-based visual surveys in the four bays to provide context for these recordings. In my first chapter I used the contributions of the dolphins to the soundscape to monitor presence in the bays and found the degree of presence varied greatly from less than 40% to nearly 90% of days monitored with dolphins present. Having established these bays as important to the animals, in my second chapter I explored the many components of their resting bay soundscape and evaluated the influence of natural and human events on the soundscape. I characterized the overall soundscape in each of the four bays, used the tsunami event of March 2011 to approximate a natural soundscape and identified all loud daytime outliers. Overall, sound levels were consistently louder at night and quieter during the daytime due to the sounds from snapping shrimp. In fact, peak Hawaiian spinner dolphin resting time co-occurs with the quietest part of the day. However, I also found that humans drastically alter this daytime soundscape with sound from offshore aquaculture, vessel sound and military mid-frequency active sonar. During one recorded mid

  1. Mononucleosis spot test (United States)

    Monospot test; Heterophile antibody test; Heterophile agglutination test; Paul-Bunnell test; Forssman antibody test ... The mononucleosis spot test is done when symptoms of mononucleosis are ... Fatigue Fever Large spleen (possibly) Sore throat Tender ...

  2. Dolphin Therapy: The Playful Way to Work toward the Next Step (United States)

    Wermer, Maaike


    More than 400 children with a physical and/or mental challenge visit the Curacao Dolphin Therapy and Research Center (CDTC) for dolphin-assisted therapy every year. Dolphin therapy appears to be the right approach for many children. With the help of these special and very social animals, it is easier to make contact with the children. It motivates…

  3. Dolphins can maintain vigilant behavior through echolocation for 15 days without interruption or cognitive impairment.

    Directory of Open Access Journals (Sweden)

    Brian K Branstetter

    Full Text Available In dolphins, natural selection has developed unihemispheric sleep where alternating hemispheres of their brain stay awake. This allows dolphins to maintain consciousness in response to respiratory demands of the ocean. Unihemispheric sleep may also allow dolphins to maintain vigilant states over long periods of time. Because of the relatively poor visibility in the ocean, dolphins use echolocation to interrogate their environment. During echolocation, dolphin produce clicks and listen to returning echoes to determine the location and identity of objects. The extent to which individual dolphins are able to maintain continuous vigilance through this active sense is unknown. Here we show that dolphins may continuously echolocate and accurately report the presence of targets for at least 15 days without interruption. During a total of three sessions, each lasting five days, two dolphins maintained echolocation behaviors while successfully detecting and reporting targets. Overall performance was between 75 to 86% correct for one dolphin and 97 to 99% correct for a second dolphin. Both animals demonstrated diel patterns in echolocation behavior. A 15-day testing session with one dolphin resulted in near perfect performance with no significant decrement over time. Our results demonstrate that dolphins can continuously monitor their environment and maintain long-term vigilant behavior through echolocation.

  4. Dolphins can maintain vigilant behavior through echolocation for 15 days without interruption or cognitive impairment. (United States)

    Branstetter, Brian K; Finneran, James J; Fletcher, Elizabeth A; Weisman, Brian C; Ridgway, Sam H


    In dolphins, natural selection has developed unihemispheric sleep where alternating hemispheres of their brain stay awake. This allows dolphins to maintain consciousness in response to respiratory demands of the ocean. Unihemispheric sleep may also allow dolphins to maintain vigilant states over long periods of time. Because of the relatively poor visibility in the ocean, dolphins use echolocation to interrogate their environment. During echolocation, dolphin produce clicks and listen to returning echoes to determine the location and identity of objects. The extent to which individual dolphins are able to maintain continuous vigilance through this active sense is unknown. Here we show that dolphins may continuously echolocate and accurately report the presence of targets for at least 15 days without interruption. During a total of three sessions, each lasting five days, two dolphins maintained echolocation behaviors while successfully detecting and reporting targets. Overall performance was between 75 to 86% correct for one dolphin and 97 to 99% correct for a second dolphin. Both animals demonstrated diel patterns in echolocation behavior. A 15-day testing session with one dolphin resulted in near perfect performance with no significant decrement over time. Our results demonstrate that dolphins can continuously monitor their environment and maintain long-term vigilant behavior through echolocation.

  5. Cross-sectional anatomy, computed tomography and magnetic resonance imaging of the head of common dolphin (Delphinus delphis) and striped dolphin (Stenella coeruleoalba). (United States)

    Alonso-Farré, J M; Gonzalo-Orden, M; Barreiro-Vázquez, J D; Barreiro-Lois, A; André, M; Morell, M; Llarena-Reino, M; Monreal-Pawlowsky, T; Degollada, E


    Computed tomography (CT) and low-field magnetic resonance imaging (MRI) were used to scan seven by-caught dolphin cadavers, belonging to two species: four common dolphins (Delphinus delphis) and three striped dolphins (Stenella coeruleoalba). CT and MRI were obtained with the animals in ventral recumbency. After the imaging procedures, six dolphins were frozen at -20°C and sliced in the same position they were examined. Not only CT and MRI scans, but also cross sections of the heads were obtained in three body planes: transverse (slices of 1 cm thickness) in three dolphins, sagittal (5 cm thickness) in two dolphins and dorsal (5 cm thickness) in two dolphins. Relevant anatomical structures were identified and labelled on each cross section, obtaining a comprehensive bi-dimensional topographical anatomy guide of the main features of the common and the striped dolphin head. Furthermore, the anatomical cross sections were compared with their corresponding CT and MRI images, allowing an imaging identification of most of the anatomical features. CT scans produced an excellent definition of the bony and air-filled structures, while MRI allowed us to successfully identify most of the soft tissue structures in the dolphin's head. This paper provides a detailed anatomical description of the head structures of common and striped dolphins and compares anatomical cross sections with CT and MRI scans, becoming a reference guide for the interpretation of imaging studies. © 2014 Blackwell Verlag GmbH.

  6. Sexual Dimorphism and Geographic Variation in Dorsal Fin Features of Australian Humpback Dolphins, Sousa sahulensis. (United States)

    Brown, Alexander M; Bejder, Lars; Parra, Guido J; Cagnazzi, Daniele; Hunt, Tim; Smith, Jennifer L; Allen, Simon J


    Determining the sex of free-ranging cetaceans can be challenging. Sexual dimorphism among external features may allow inferences on sex, but such patterns may be difficult to detect and are often confounded by age and geographic variation. Dorsal fin images of 107 female and 54 male Australian humpback dolphins, Sousa sahulensis, from Western Australia (WA) and Queensland (QLD) were used to investigate sex, age and geographic differences in colouration, height/length quotient and number of notches. Adult males exhibited more dorsal fin notches (pdolphins, which could potentially be applied to populations throughout their range. In contrast to adults, presumed immature animals showed little or no loss of pigmentation or spotting; however, the rate of development of these features remains unknown. There were pronounced differences between QLD and WA in the intensity of spotting on dorsal fins and the extent of pigmentation loss around the posterior insertion and trailing edge of the dorsal fin. While based on a limited sample size, these geographic differences may have conservation implications in terms of population subdivision and should be investigated further. © 2016 Elsevier Ltd. All rights reserved.

  7. Accelerated Minority Institution Low Frequency OdontoceteHearing

    National Research Council Canada - National Science Library

    Losey, George


    We have tested the hearing of bottlenose dolphins, Risso's dolphins, and False killer whales using both the behavioral techniques and the envelope following response evoked auditory potential procedure...

  8. [Rest and activity states in the Commerson's dolphin (Cephalorhynchus commersonii)]. (United States)

    Shpak, O V; Liamin, O I; Manger, P R; Siegel, J M; Mukhametov, L M


    The unihemispheric slow-wave sleep, the ability to sleep during swimming with one open eye and the absence of paradoxical sleep in the form of it is observed in all terrestrial mammals are unique features of sleep in cetaceans. Visual observations supplement electrophysiological studies and allow obtaining novel data about sleep of cetaceans. In the present study we examined behavior of 3 adult Commerson's dolphins Cephalorhynchus commersonii which were housed in the oceanarium Sea-World (San Diego, USA). The behavior of the dolphins can be subdivided into 5 swimming types: 1) active swimming marked by variable speed and irregular trajectory of movement (on average for 3 dolphins 35.1 +/- 2.7% of the 24-h period) was scored as active wakefulness; 2) circular swimming was divided into slow and fast swimming and occupied, on average, 44.4 +/- 3.8 and 9.7 +/- 0.8% of the 24-h period, respectively; while in circular swimming, dolphins swam from 1 to 6 circles on one respiration pause; 3) quiet chaotic swimming (3.9 +/- 1.2%) that occurred at the bottom and was not accompanied by signs of activity; 4) floating, and 5) slow swimming at the surface (4.1 +/- 0.5 and 2.8 +/- 0.4%), respectively; the latter two swimming types were accompanied by frequent respiration (hyperventilation). We suggest that sleep in Commerson's dolphins occurred predominantly during the circular and quiet swimming. From time to time the dolphins slowed down their speeds and even stopped for several seconds. Such episodes appeared to be the deepest sleep episodes. In all dolphins muscle jerks as well erections in the male were observed. Jerks and erections occurred during the circular and quiet chaotic swimming. Similar to other studied small cetaceans, Commerson's dolphins are in a state of almost uninterrupted swimming during 24 h per day and they sleep during swimming. Some muscle jerks that we observed in the dolphins in this study might have been episodes of paradoxical sleep.

  9. Humpback Dolphin (Genus Sousa) Behavioural Responses to Human Activities. (United States)

    Piwetz, Sarah; Lundquist, David; Würsig, Bernd


    Humpback dolphins (genus Sousa) use shallow, near-shore waters throughout their range. This coastal distribution makes them vulnerable to recreational and commercial disturbances, especially near heavily populated and industrialized areas. Most research focusing on Sousa and human activities has emphasized direct impacts and threats, involving injury and death, with relatively little focus on indirect effects on dolphins, such as changes in behaviour that may lead to deleterious effects. Understanding behaviour is important in resolving human-wildlife conflict and is an important component of conservation. This chapter gives an overview of animal behavioural responses to human activity with examples from diverse taxa; reviews the scientific literature on behavioural responses of humpback dolphins to human activity throughout their range, including marine vessel traffic, dolphin tourism, cetacean-fishery interactions, noise pollution, and habitat alteration; and highlights information and data gaps for future humpback dolphin research to better inform behaviour-based management decisions that contribute to conservation efforts. © 2015 Elsevier Ltd All rights reserved.

  10. The freshwater dolphin Inia geoffrensis geoffrensis produces high frequency whistles. (United States)

    May-Collado, Laura J; Wartzok, Douglas


    Because whistles are most commonly associated with social delphinids, they have been largely overlooked, ignored, or presumed absent, in solitary freshwater dolphin species. Whistle production in the freshwater dolphin, the boto (Inia geoffrensis geoffrensis), has been controversial. Because of its sympatry with tucuxi dolphins (Sotalia fluviatilis), a whistling species, some presume tucuxi whistles might have been erroneously assigned to the boto. Using a broadband recording system, we recorded over 100 whistles from boto dolphins in the Yasunf River, Ecuador, where the tucuxi dolphins are absent. Our results therefore provide conclusive evidence for whistle production in Inia geoffrensis geoffrensis. Furthermore, boto whistles are significantly different from tucuxi whistles recorded in nearby rivers. The Ecuadorian boto whistle has a significantly greater frequency range (5.30-48.10 kHz) than previously reported in other populations (Peru and Colombia) that were recorded with more bandwidth limited equipment. In addition, the top frequency and the range are greater than in any other toothed whale species recorded to date. Whistle production was higher during resting activities, alone or in the presence of other animals. The confirmation of whistles in the boto has important implications for the evolution of whistles in Cetacea and their association with sociality.

  11. Dolphin natures, human virtues: MacIntyre and ethical naturalism. (United States)

    Glackin, Shane Nicholas


    Can biological facts explain human morality? Aristotelian 'virtue' ethics has traditionally assumed so. In recent years Alasdair MacIntyre has reintroduced a form of Aristotle's 'metaphysical biology' into his ethics. He argues that the ethological study of dependence and rationality in other species--dolphins in particular--sheds light on how those same traits in the typical lives of humans give rise to the moral virtues. However, some goal-oriented dolphin behaviour appears both dependent and rational in the precise manner which impresses MacIntyre, yet anything but ethically 'virtuous'. More damningly, dolphin ethologists consistently refuse to evaluate such behaviour in the manner MacIntyre claims is appropriate to moral judgement. In light of this, I argue that virtues--insofar as they name a biological or ethological category--do not name a morally significant one.

  12. Cotton-wool spots. (United States)

    Brown, G C; Brown, M M; Hiller, T; Fischer, D; Benson, W E; Magargal, L E


    A series of 24 consecutive patients presenting with a fundus picture characterized by a predominance of cotton-wool spots, or a single cotton-wool spot, is reported. Excluded were patients with known diabetes mellitus. Etiologic conditions found included previously undiagnosed diabetes mellitus in five patients, systemic hypertension in five patients, cardiac valvular disease in two patients, radiation retinopathy in two patients, and severe carotid artery obstruction in two patients. Dermatomyositis, systemic lupus erythematosus, polyarteritis nodosa, leukemia, AIDS, Purtscher's retinopathy, metastatic carcinoma, intravenous drug abuse, partial central retinal artery obstruction, and giant cell arteritis were each found in one patient. In only one patient did a systemic workup fail to reveal an underlying cause. The presence of even one cotton-wool spot in an otherwise normal fundus necessitates an investigation to ascertain systemic etiologic factors.

  13. Why Dolphins are not Aquatic Apes

    Directory of Open Access Journals (Sweden)

    Louise Barrett


    Full Text Available The Social Brain (or Social Intelligence hypothesis is a very influential theory that ties brain size and, by extension, cognitive ability to the demands of obligate and intense sociality. Initially developed to explain primate brain size evolution, the Social Brain hypothesis has since been applied to a diverse array of other social taxa, both mammalian and avian; its origins as a primate-based hypothesis (especially as articulated by Humphrey, 1976, however, mean that it retains a heavily anthropocentric tinge. This colors the way in which other species are viewed, and their cognitive abilities tested, despite fundamental differences in many aspects of bodily morphology, brain anatomy and behavior. The delphinids are a case in point and, in this review, we demonstrate how the anthropocentric origins of the Social Brain hypothesis have pushed us toward a view of the delphinids as a species of ‗aquatic ape‘. We suggest that a more ecological, embodied/embedded, view of dolphin behavior and psychology undercuts such a view, and will provide a more satisfactory assessment of the natural intelligence the delphinids display.

  14. Acute Poisoning with Methadone (Dolphin (Review

    Directory of Open Access Journals (Sweden)

    Georgy A. Livanov


    Full Text Available Most publications report on the use of methadone as a medication, however an increase of the illegal use of methadone has been demonstrated worldwide over the recent years, thus increasing the number of hospitalizations due to acute poisoning with this synthetic opioid. The aim of the present review was to summarize current data on the mechanisms of toxicity, selective toxicity, toxicokinetics and toxicodynamics of methadone (Dolphin. The involvement of CNS, respiratory, cardiovascular and urinary systems in acute poisoning with methadone was dis- cussed. The practice of use of methadone in many countries as a medicine for the replacement therapy for opiate addicts was analyzed. In addition, it was suggested that the results of the use of naloxone antidote therapy in acute opioid poisoning do not always clearly demonstrate its sufficient efficacy. Ways to improve of the intensive therapy of severe acute poisoning by methadone were substantiated; in addition to general critical care methods, treatment with a complex metabolic antihypoxant cytoflavin should be considered. 

  15. Humpback Dolphins: A Brief Introduction to the Genus Sousa. (United States)

    Jefferson, Thomas A; Curry, Barbara E


    The delphinid genus Sousa has recently undergone a major revision, and currently contains four species, the Atlantic humpback (Sousa teuszii), Indian Ocean humpback (Sousa plumbea), Indo-Pacific humpback (Sousa chinensis), and Australian humpback (Sousa sahulensis) dolphins. Recent molecular evidence suggests that humpback dolphins in the Bay of Bengal may comprise a fifth species. These moderate-sized dolphin species are found in shallow (dolphins feed mostly on small fishes, and sometimes shrimps; occur for the most part in small groups (mostly 12 or less); have limited nearshore movements; and in most parts of their range exhibit a fission/fusion type of social organization. Major threats that affect all the species are entanglement in fishing gear, and habitat degradation/destruction from various forms of coastal development. Impacts from vessel traffic (including behavioural disturbance and displacement, as well as mortality and morbidity from collisions with vessels) appear to be significant in most areas. Several other threats are apparently significant only in particular parts of the range of some species (e.g. high levels of organochlorine contaminants affecting Indo-Pacific humpback dolphins in Hong Kong). Direct hunting only occurs in limited areas and primarily on a small scale. Conservation actions so far have been limited, with most populations receiving little study and almost no management attention. Much more work is needed on humpback dolphin population status, threats, and how the major threats can be reduced or eliminated. Extinction risks for the four species and some populations are preliminarily re-assessed using the IUCN Red List criteria in the current volume. The results suggest that all four species in the genus are threatened at some level (suggested Red List status ranges from Vulnerable for S. chinensis and S. sahulensis to Critically Endangered for S. teuszii). © 2015 Elsevier Ltd All rights reserved.

  16. Effects of tour boats on dolphin activity examined with sensitivity analysis of Markov chains. (United States)

    Dans, Silvana Laura; Degrati, Mariana; Pedraza, Susana Noemí; Crespo, Enrique Alberto


    In Patagonia, Argentina, watching dolphins, especially dusky dolphins (Lagenorhynchus obscurus), is a new tourist activity. Feeding time decreases and time to return to feeding after feeding is abandoned and time it takes a group of dolphins to feed increase in the presence of boats. Such effects on feeding behavior may exert energetic costs on dolphins and thus reduce an individual's survival and reproductive capacity or maybe associated with shifts in distribution. We sought to predict which behavioral changes modify the activity pattern of dolphins the most. We modeled behavioral sequences of dusky dolphins with Markov chains. We calculated transition probabilities from one activity to another and arranged them in a stochastic matrix model. The proportion of time dolphins dedicated to a given activity (activity budget) and the time it took a dolphin to resume that activity after it had been abandoned (recurrence time) were calculated. We used a sensitivity analysis of Markov chains to calculate the sensitivity of the time budget and the activity-resumption time to changes in behavioral transition probabilities. Feeding-time budget was most sensitive to changes in the probability of dolphins switching from traveling to feeding behavior and of maintaining feeding behavior. Thus, an increase in these probabilities would be associated with the largest reduction in the time dedicated to feeding. A reduction in the probability of changing from traveling to feeding would also be associated with the largest increases in the time it takes dolphins to resume feeding. To approach dolphins when they are traveling would not affect behavior less because presence of the boat may keep dolphins from returning to feeding. Our results may help operators of dolphin-watching vessels minimize negative effects on dolphins. ©2012 Society for Conservation Biology.


    Directory of Open Access Journals (Sweden)

    Ni Luh Putu Agustini Karta


    Full Text Available The purpose of this research is to find the right marketing communications strategy for Ecotourism’s Destinations, (Dolphin Hunting Lovina, to be sustainable. Design methodology used is a marketing communication approach by adopting the concept of basic elements of the theory of marketing communication, the shift towards integrated marketing approach marketing communications, and public organizational challenges in creating brand awareness. Qualitative research and in-depth interviews carried out to some competent resource. The findings generated that image creation and brand awareness of Dolphin Hunting Lovina is determined by the  organization’s marketing communications and internal audiences

  18. Learning in human-dolphin interactions at zoological facilities (United States)

    Sweeney, Diane L.

    This research aimed to better understand learning in zoological settings, particularly learning about marine mammals, by investigating the research question, what do people learn through interacting with dolphins in zoological facilities? Sociocultural situated learning theory, specifically a Community of Practice (CoP) model of learning (Lave & Wenger, 1991), was the theoretical framework. The CoP model allowed for diversity of knowledge, interest, motivations, and goals that existed among the community of animal enthusiasts at three commercial zoological facilities, and also for peripheral to more central types of participation. I collected data through interviews of spectators, visitors, and trainers (n=51), observations (n=16), and an online questionnaire of past-visitors (n=933). Data were coded, categorized, and analyzed based on the National Science Foundation's (Friedman, 2008) and the National Research Council's (2009) frameworks for informal science education. Five principal findings answered the research question. First, all participants gained new knowledge within three broad categories: (a) dolphin physiology and natural history, (b) care and training of dolphins, and (c) conservation. Second, all participants constructed personal meanings by connecting the activity to experiences, beliefs, and practices outside the interaction context. Almost all participants made associations with conservation. Third, most participants shifted their attitudes and gained a sense of personal agency about beginning or increasing stewardship actions. Fourth, visitors learned interspecies etiquette skills; trainers learned skills in dolphin training and management, people management, and teaching. Fifth, visitors had long-lasting memories of the experience that occurred eight months to 18 years in the past. Popular cultural ideas about dolphins and the ways the dolphins were represented influenced visitors' expectations and the types of learning. Potential physical

  19. Echolocation in sympatric Peale's dolphins (Lagenorhynchus australis) and Commerson's dolphins (Cephalorhynchus commersonii) producing narrow-bandhigh-frequency clicks

    DEFF Research Database (Denmark)

    Kyhn, Line Anker; Jensen, Frants Havmand; Beedholm, Kristian


    -element hydrophone array from wild Peale's (Lagenorhynchus australis) and Commerson's (Cephalorhynchus commersonii) dolphins off the Falkland Islands. The centroid frequency was different between Commerson's (133±2kHz) and Peale's (129±3kHz) dolphins. The r.m.s. bandwidth was 12±3kHz for both species. The source...... level was higher for Peale's dolphin (185±6dB re 1 uPa p.-p.) than for Commerson's(177±5 dB re 1 uPa p.-p.). The mean directivity indexes were 25dB for both species. The relatively low source levels in combination with the high directivity index may be an adaptation to reduce clutter when foraging...

  20. Sequence analysis of dolphin ferritin H and L subunits and possible iron-dependent translational control of dolphin ferritin gene

    Directory of Open Access Journals (Sweden)

    Sasaki Yukako


    Full Text Available Abstract Background Iron-storage protein, ferritin plays a central role in iron metabolism. Ferritin has dual function to store iron and segregate iron for protection of iron-catalyzed reactive oxygen species. Tissue ferritin is composed of two kinds of subunits (H: heavy chain or heart-type subunit; L: light chain or liver-type subunit. Ferritin gene expression is controlled at translational level in iron-dependent manner or at transcriptional level in iron-independent manner. However, sequencing analysis of marine mammalian ferritin subunits has not yet been performed fully. The purpose of this study is to reveal cDNA-derived amino acid sequences of cetacean ferritin H and L subunits, and demonstrate the possibility of expression of these subunits, especially H subunit, by iron. Methods Sequence analyses of cetacean ferritin H and L subunits were performed by direct sequencing of polymerase chain reaction (PCR fragments from cDNAs generated via reverse transcription-PCR of leukocyte total RNA prepared from blood samples of six different dolphin species (Pseudorca crassidens, Lagenorhynchus obliquidens, Grampus griseus, Globicephala macrorhynchus, Tursiops truncatus, and Delphinapterus leucas. The putative iron-responsive element sequence in the 5'-untranslated region of the six different dolphin species was revealed by direct sequencing of PCR fragments obtained using leukocyte genomic DNA. Results Dolphin H and L subunits consist of 182 and 174 amino acids, respectively, and amino acid sequence identities of ferritin subunits among these dolphins are highly conserved (H: 99–100%, (99→98 ; L: 98–100%. The conserved 28 bp IRE sequence was located -144 bp upstream from the initiation codon in the six different dolphin species. Conclusion These results indicate that six different dolphin species have conserved ferritin sequences, and suggest that these genes are iron-dependently expressed.

  1. A new dolphin species, the Burrunan Dolphin Tursiops australis sp. nov., endemic to southern Australian coastal waters. (United States)

    Charlton-Robb, Kate; Gershwin, Lisa-ann; Thompson, Ross; Austin, Jeremy; Owen, Kylie; McKechnie, Stephen


    Small coastal dolphins endemic to south-eastern Australia have variously been assigned to described species Tursiops truncatus, T. aduncus or T. maugeanus; however the specific affinities of these animals is controversial and have recently been questioned. Historically 'the southern Australian Tursiops' was identified as unique and was formally named Tursiops maugeanus but was later synonymised with T. truncatus. Morphologically, these coastal dolphins share some characters with both aforementioned recognised Tursiops species, but they also possess unique characters not found in either. Recent mtDNA and microsatellite genetic evidence indicates deep evolutionary divergence between this dolphin and the two currently recognised Tursiops species. However, in accordance with the recommendations of the Workshop on Cetacean Systematics, and the Unified Species Concept the use of molecular evidence alone is inadequate for describing new species. Here we describe the macro-morphological, colouration and cranial characters of these animals, assess the available and new genetic data, and conclude that multiple lines of evidence clearly indicate a new species of dolphin. We demonstrate that the syntype material of T. maugeanus comprises two different species, one of which is the historical 'southern form of Tursiops' most similar to T. truncatus, and the other is representative of the new species and requires formal classification. These dolphins are here described as Tursiops australis sp. nov., with the common name of 'Burrunan Dolphin' following Australian aboriginal narrative. The recognition of T. australis sp. nov. is particularly significant given the endemism of this new species to a small geographic region of southern and south-eastern Australia, where only two small resident populations in close proximity to a major urban and agricultural centre are known, giving them a high conservation value and making them susceptible to numerous anthropogenic threats.

  2. Long-term responses of Burrunan dolphins (Tursiops australis to swim-with dolphin tourism in Port Phillip Bay, Victoria, Australia: A population at risk

    Directory of Open Access Journals (Sweden)

    Nicole E. Filby


    Full Text Available This study investigated Burrunan dolphin responses to dolphin-swim tour vessels across two time periods: 1998–2000 and 2011–2013. A total of 211 dolphin sightings were documented across 306 surveys. Sighting success rate and mean encounter time with dolphins decreased significantly by 12.8% and 8.2 min, respectively, between periods. Approaches that did not contravene regulations elicited highest approach responses by dolphins towards tour vessels, whereas dolphins’ responded to illegal approaches most frequently with avoidance. Small groups responded to tour vessels with avoidance significantly more than large groups. Initial dolphin behaviour had a strong effect on dolphin’s responses to tour vessels, with resting groups the most likely to exhibit avoidance. Calves were significantly more likely to be present during swims in 2011–2013. Dolphin’s responses to tour vessels changed across time, with effect responses (avoidance and approach increasing significantly as dolphins gained cumulative experience. These dolphins are forced to expend a greater level of time and energy avoiding or approaching boats, shifting from a non-effect response to an effect response. Consequences of this include possible decrease in biological fitness by detracting from core biological activities such as foraging and resting. Combined with a decrease in sighting success between periods, the results imply that this population of dolphins, which is endemic to Australia and listed as threatened under the Victorian Flora and Fauna Guarantee Act 1988, may not be well suited to the dolphin-swim industry. The management implications of these results warrant a shift from passive to active management in Port Phillip Bay. The importance of long-term research is highlighted, given behavioural responses detected herein would be undetected in short-term studies. Keywords: Burrunan dolphin (Tursiops australis, Avoidance, Behaviour, Compliance, Management

  3. Spatial Models of Abundance and Habitat Preferences of Commerson's and Peale's Dolphin in Southern Patagonian Waters. (United States)

    Dellabianca, Natalia A; Pierce, Graham J; Raya Rey, Andrea; Scioscia, Gabriela; Miller, David L; Torres, Mónica A; Paso Viola, M Natalia; Goodall, R Natalie P; Schiavini, Adrián C M


    Commerson's dolphins (Cephalorhynchus c. commersonii) and Peale's dolphins (Lagenorhynchus australis) are two of the most common species of cetaceans in the coastal waters of southwest South Atlantic Ocean. Both species are listed as Data Deficient by the IUCN, mainly due to the lack of information about population sizes and trends. The goal of this study was to build spatially explicit models for the abundance of both species in relation to environmental variables using data collected during eight scientific cruises along the Patagonian shelf. Spatial models were constructed using generalized additive models. In total, 88 schools (212 individuals) of Commerson's dolphin and 134 schools (465 individuals) of Peale's dolphin were recorded in 8,535 km surveyed. Commerson's dolphin was found less than 60 km from shore; whereas Peale's dolphins occurred over a wider range of distances from the coast, the number of animals sighted usually being larger near or far from the coast. Fitted models indicate overall abundances of approximately 22,000 Commerson's dolphins and 20,000 Peale's dolphins in the total area studied. This work provides the first large-scale abundance estimate for Peale's dolphin in the Atlantic Ocean and an update of population size for Commerson's dolphin. Additionally, our results contribute to baseline data on suitable habitat conditions for both species in southern Patagonia, which is essential for the implementation of adequate conservation measures.

  4. Spatial Models of Abundance and Habitat Preferences of Commerson's and Peale's Dolphin in Southern Patagonian Waters.

    Directory of Open Access Journals (Sweden)

    Natalia A Dellabianca

    Full Text Available Commerson's dolphins (Cephalorhynchus c. commersonii and Peale's dolphins (Lagenorhynchus australis are two of the most common species of cetaceans in the coastal waters of southwest South Atlantic Ocean. Both species are listed as Data Deficient by the IUCN, mainly due to the lack of information about population sizes and trends. The goal of this study was to build spatially explicit models for the abundance of both species in relation to environmental variables using data collected during eight scientific cruises along the Patagonian shelf. Spatial models were constructed using generalized additive models. In total, 88 schools (212 individuals of Commerson's dolphin and 134 schools (465 individuals of Peale's dolphin were recorded in 8,535 km surveyed. Commerson's dolphin was found less than 60 km from shore; whereas Peale's dolphins occurred over a wider range of distances from the coast, the number of animals sighted usually being larger near or far from the coast. Fitted models indicate overall abundances of approximately 22,000 Commerson's dolphins and 20,000 Peale's dolphins in the total area studied. This work provides the first large-scale abundance estimate for Peale's dolphin in the Atlantic Ocean and an update of population size for Commerson's dolphin. Additionally, our results contribute to baseline data on suitable habitat conditions for both species in southern Patagonia, which is essential for the implementation of adequate conservation measures.

  5. The span of correlations in dolphin whistle sequences (United States)

    Ferrer-i-Cancho, Ramon; McCowan, Brenda


    Long-range correlations are found in symbolic sequences from human language, music and DNA. Determining the span of correlations in dolphin whistle sequences is crucial for shedding light on their communicative complexity. Dolphin whistles share various statistical properties with human words, i.e. Zipf's law for word frequencies (namely that the probability of the ith most frequent word of a text is about i-α) and a parallel of the tendency of more frequent words to have more meanings. The finding of Zipf's law for word frequencies in dolphin whistles has been the topic of an intense debate on its implications. One of the major arguments against the relevance of Zipf's law in dolphin whistles is that it is not possible to distinguish the outcome of a die-rolling experiment from that of a linguistic or communicative source producing Zipf's law for word frequencies. Here we show that statistically significant whistle-whistle correlations extend back to the second previous whistle in the sequence, using a global randomization test, and to the fourth previous whistle, using a local randomization test. None of these correlations are expected by a die-rolling experiment and other simple explanations of Zipf's law for word frequencies, such as Simon's model, that produce sequences of unpredictable elements.

  6. Abundance and Distribution of Indo-Pacific Humpback Dolphins ...

    African Journals Online (AJOL)

    Boat-based surveys (n=167) were conducted during 2006, using photographic identification (photo-id) techniques and mark-recapture methods for open populations (Jolly-Seber model) to estimate the abundance of humpback dolphins inhabiting the Wasini Channel (104: 95% CI 67-160). Their distribution was mapped ...

  7. Atlantic humpback dolphins Sousa teuszii in the Saloum Delta ...

    African Journals Online (AJOL)

    During October and November 2015, the first systematic survey of Sousa teuszii was carried out in the Saloum Delta (Senegal, West Africa), comprising 1 617.5 km of boat-based survey coverage. Thirty sightings were recorded in the Saloum and Diomboss rivers, and along the southern coastline. Dolphins were also ...

  8. Dolphins Who Blow Bubbles: Anthropological Machines and Native Informants

    NARCIS (Netherlands)

    Lord, C.


    "Dolphins Who Blow Bubbles: Anthropological Machines and Native Informants" engages a reading between an Oscar winning and now ‘cult’ activist film The Cove (Louise Psihoyos 2009) and classical texts on the human-animal threshold. Giorgio Agamben’s The Open (2002) and Jacques Derrida’s "The Animal

  9. Geographic variation in Risso's dolphin echolocation click spectra. (United States)

    Soldevilla, Melissa S; Baumann-Pickering, Simone; Cholewiak, Danielle; Hodge, Lynne E W; Oleson, Erin M; Rankin, Shannon


    Discrimination of bioacoustic signals to the species or population level is critical for using passive acoustic monitoring to study cetacean ecology. Risso's dolphins off southern California have distinctive peaks and notches in their echolocation clicks, but it was unknown whether Risso's dolphins from other geographic areas have similarly distinctive click spectra and whether populations are acoustically distinct. This study investigates using clicks for species and population identification by characterizing the spectral structure of Risso's dolphin echolocation clicks recorded over wide-ranging geographic regions including the U.S. waters of the North Atlantic Ocean, Gulf of Mexico, and North Pacific Ocean; and international waters of the Eastern Tropical Pacific. All recordings with Risso's dolphin clicks exhibited the spectral peak and notch pattern described off southern California, indicating the presence of peak banding patterns is useful for species discrimination. Geographic regions were a significant explanatory factor for variability in the frequencies of click spectral peaks, with relatively higher frequency peaks and notches found off Hawaii compared to California waters and off the southeast U.S. compared to the Gulf of Mexico. In the North Atlantic Ocean, a latitudinal cline in frequencies was evident. Potential causes of acoustic variation within and among acoustic encounters are evaluated.

  10. The span of correlations in dolphin whistle sequences

    International Nuclear Information System (INIS)

    Ferrer-i-Cancho, Ramon; McCowan, Brenda


    Long-range correlations are found in symbolic sequences from human language, music and DNA. Determining the span of correlations in dolphin whistle sequences is crucial for shedding light on their communicative complexity. Dolphin whistles share various statistical properties with human words, i.e. Zipf's law for word frequencies (namely that the probability of the ith most frequent word of a text is about i −α ) and a parallel of the tendency of more frequent words to have more meanings. The finding of Zipf's law for word frequencies in dolphin whistles has been the topic of an intense debate on its implications. One of the major arguments against the relevance of Zipf's law in dolphin whistles is that it is not possible to distinguish the outcome of a die-rolling experiment from that of a linguistic or communicative source producing Zipf's law for word frequencies. Here we show that statistically significant whistle–whistle correlations extend back to the second previous whistle in the sequence, using a global randomization test, and to the fourth previous whistle, using a local randomization test. None of these correlations are expected by a die-rolling experiment and other simple explanations of Zipf's law for word frequencies, such as Simon's model, that produce sequences of unpredictable elements

  11. The taxonomic status of common dolphins Delphinus spp. in South ...

    African Journals Online (AJOL)

    Aside from gender differences, a principal components analysis of skull measurements of 72 adult common dolphins from South Africa failed to distinguish more than one form of Delphinus. Plots of rostral length against zygomatic width indicated most could be referred to the long-beaked form D. capensis, but three ...

  12. Dusky dolphins Lagenorhynchus obscurus and Cape fur seals ...

    African Journals Online (AJOL)

    The fatty acid composition of the blubber of five dusky dolphins Lagenorhynchus obscurus and five Cape fur seals Arctocephalus pusillus pusillus from the northern Benguela ecosystem (South-East Atlantic) and their main prey was determined. Differences in fatty acid composition of the inner and outer blubber layer of the ...

  13. West Africa's Atlantic humpback dolphin ( Sousa teuszii ): endemic ...

    African Journals Online (AJOL)

    Atlantic humpback dolphins (Sousa teuszii) are endemic to nearshore West African waters between Western Sahara and Angola. They are considered Vulnerable by the International Union for Conservation of Nature based on restricted geographic range, low abundance and apparent decline in recent decades. We review ...

  14. First confirmed records of Clymene dolphin, Stenella clymene (Gray ...

    African Journals Online (AJOL)

    Clymene dolphins, Stenella clymene, are endemic to the tropical and subtropical Atlantic Ocean, where their occurrence is documented from fewer than 200 records. The species is particularly poorly known in the eastern Atlantic off the coast of Africa where only 12 verified records exist, predominantly comprising dead ...

  15. Bioaccumulation of platinum group metals in dolphins, Stenella sp ...

    African Journals Online (AJOL)

    Platinum group metals (PGMs) concentrations were measured in the tissues= of dolphins (Stenella sp.) caught along the Ghanaian coastline. Tissues from specimens caught by fishermen from Dixcove, western Ghana, were analysed in 2006 for palladium (Pd), platinum (Pt) and rhodium (Rh) using the Neutron Activation ...

  16. First record of a vagrant Commerson's dolphin, Cephalorhynchus ...

    African Journals Online (AJOL)

    Commerson's Dolphins Cephalorhynchus commersonii are distributed in two disjunct populations, one around southern South America and the other around the sub-Antarctic Kerguelen Islands. These populations have been shown to be morphologically and genetically distinct and movement between the two populations ...

  17. Placentation in dolphins from the Amazon River Basin

    DEFF Research Database (Denmark)

    da Silva, Vera M F; Carter, Anthony M; Ambrosio, Carlos E


    A recent reassessment of the phylogenetic affinities of cetaceans makes it timely to compare their placentation with that of the artiodactyls. We studied the placentae of two sympatric species of dolphin from the A