WorldWideScience

Sample records for specific primer set

  1. An improved primer set and amplification protocol with increased specificity and sensitivity targeting the Symbiodinium ITS2 region

    KAUST Repository

    Hume, Benjamin C.C.; Ziegler, Maren; Poulain, Julie; Pochon, Xavier; Romac, Sarah; Boissin, Emilie; de Vargas, Colomban; Planes, Serge; Wincker, Patrick; Voolstra, Christian R.

    2018-01-01

    The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.

  2. An improved primer set and amplification protocol with increased specificity and sensitivity targeting the Symbiodinium ITS2 region

    KAUST Repository

    Hume, Benjamin C.C.

    2018-05-23

    The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.

  3. Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae

    Directory of Open Access Journals (Sweden)

    Deguo Wang

    2015-05-01

    Full Text Available Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.

  4. Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae.

    Science.gov (United States)

    Wang, Deguo; Liu, Yanhong

    2015-05-26

    Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP) for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.

  5. Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

    Science.gov (United States)

    Galkiewicz, Julia P; Kellogg, Christina A

    2008-12-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  6. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    OpenAIRE

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  7. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    Science.gov (United States)

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

  8. Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

    Science.gov (United States)

    Galkiewicz, J.P.; Kellogg, C.A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

  9. Development of a microsatellite primer set to investigate the genetic ...

    Indian Academy of Sciences (India)

    Development of a microsatellite primer set to investigate the genetic population structure of Armadillidium nasatum (Crustacea, Oniscidea). Séverine Masson, Cédric Faivre, Isabelle Giraud, Catherine Souty-Grosset, Richard Cordaux, Carine Delaunay,. Didier Bouchon and Nicolas Bech. J. Genet. 93, 545-549. Table 1.

  10. Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

    Science.gov (United States)

    Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

    2017-02-01

    To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

  11. Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

    Science.gov (United States)

    Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

    2018-03-01

    We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

  12. Primer sets for cloning the human repertoire of T cell Receptor Variable regions

    Directory of Open Access Journals (Sweden)

    Santoro Claudio

    2008-08-01

    Full Text Available Abstract Background Amplification and cloning of naïve T cell Receptor (TR repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  13. Primer sets for cloning the human repertoire of T cell Receptor Variable regions.

    Science.gov (United States)

    Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

    2008-08-29

    Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  14. Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants

    Directory of Open Access Journals (Sweden)

    Aleksić Jelena M.

    2016-01-01

    Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005

  15. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  16. Detection of Mycosphaerella graminicola in Wheat Leaves by a Microsatellite Dinucleotide Specific-Primer

    Directory of Open Access Journals (Sweden)

    Joseph-Alexander Verreet

    2011-01-01

    Full Text Available Early detection of infection is very important for efficient management of Mycosphaerella graminicola leaf blotch. To monitor and quantify the occurrence of this fungus during the growing season, a diagnostic method based on real-time PCR was developed. Standard and real-time PCR assays were developed using SYBR Green chemistry to quantify M. graminicola in vitro or in wheat samples. Microsatellite dinucleotide specific-primers were designed based on microsatellite repeats of sequences present in the genome of M. graminicola. Specificity was checked by analyzing DNA of 55 M. graminicola isolates obtained from different geographical origins. The method appears to be highly specific for detecting M. graminicola; no fluorescent signals were observed from 14 other closely related taxa. Primer (CT 7 G amplified a specific amplicon of 570 bp from all M. graminicola isolates. The primers did not amplify DNA extracted from 14 other fungal species. The approximate melting temperature (Tm of the (CT 7 G primer was 84.2 °C. The detection limit of the real-time PCR assay with the primer sets (CT 7 G is 10 fg/25 µL, as compared to 10 pg/25 µL using conventional PCR technology. From symptomless leaves, a PCR fragment could be generated two days after inoculation. Both conventional and real-time PCR could successfully detect the fungus from artificially inoculated wheat leaves. However, real-time PCR appeared much more sensitive than conventional PCR. The developed quantitative real-time PCR method proved to be rapid, sensitive, specific, cost-effective and reliable for the identification and quantification of M. graminicola in wheat.

  17. Conserved PCR primer set designing for closely-related species to complete mitochondrial genome sequencing using a sliding window-based PSO algorithm.

    Directory of Open Access Journals (Sweden)

    Cheng-Hong Yang

    Full Text Available BACKGROUND: Complete mitochondrial (mt genome sequencing is becoming increasingly common for phylogenetic reconstruction and as a model for genome evolution. For long template sequencing, i.e., like the entire mtDNA, it is essential to design primers for Polymerase Chain Reaction (PCR amplicons which are partly overlapping each other. The presented chromosome walking strategy provides the overlapping design to solve the problem for unreliable sequencing data at the 5' end and provides the effective sequencing. However, current algorithms and tools are mostly focused on the primer design for a local region in the genomic sequence. Accordingly, it is still challenging to provide the primer sets for the entire mtDNA. METHODOLOGY/PRINCIPAL FINDINGS: The purpose of this study is to develop an integrated primer design algorithm for entire mt genome in general, and for the common primer sets for closely-related species in particular. We introduce ClustalW to generate the multiple sequence alignment needed to find the conserved sequences in closely-related species. These conserved sequences are suitable for designing the common primers for the entire mtDNA. Using a heuristic algorithm particle swarm optimization (PSO, all the designed primers were computationally validated to fit the common primer design constraints, such as the melting temperature, primer length and GC content, PCR product length, secondary structure, specificity, and terminal limitation. The overlap requirement for PCR amplicons in the entire mtDNA is satisfied by defining the overlapping region with the sliding window technology. Finally, primer sets were designed within the overlapping region. The primer sets for the entire mtDNA sequences were successfully demonstrated in the example of two closely-related fish species. The pseudo code for the primer design algorithm is provided. CONCLUSIONS/SIGNIFICANCE: In conclusion, it can be said that our proposed sliding window-based PSO

  18. Determination of the species specificity of the primers for the detection of chicken and turkey meat by realtime PCR method

    Directory of Open Access Journals (Sweden)

    Lenka Maršálková

    2014-07-01

    Full Text Available The aim of this work was to use TaqMan Real-Time PCR for quantitative authentication of chicken and turkey meat. To meet this purpose, a specific pair of primers and TaqMan probe was used. The test was aimed at identifying the reaction cycle of turkey and chicken meat using by two sets of primers. With first set of primer designed for chicken we obtained the following results: Cp = 16.18 for 100% chicken DNA Cp = 29, 18 100% turkey DNA It was also amplified DNA of pig that exceeded the detection threshold fluorescence intensities in the 31.07 cycle (Cp = 31.07. Using primers designed for turkey we obtained the following results Cp = 31.16 for 100% CHDNA, Cp =16.18 100% TDNA. It was also amplified the 100% DNA of rabbit in 31.63 cycle (Cp = 31.63 and deer in cycle 32 (Cp = 32. The DNA of all other animal species was amplificated after more than 35 cycles (Cp >35. It follows that the second detection primer pair is specific enough to unrelated species of animals by 30 cycles of the reaction. Species authentication based on DNA analysis from this perspective overcomes all the shortcomings of proteins. At present, DNA analysis use different types of PCR. Is the most progressive Real-time PCR, which is suitable for the specific use of detection (primers and TaqMan probe. The TaqMan Real-time PCR is within the sensitivity and specificity, clearly one of the best methods for identifying the species of chicken and turkey meat. The specificity of this method, however, depends primarily on the specificity of the primers and TaqMan probe. The 30 cycle reaction was chosen by us as the threshold for specificity using primers for authentication chicken and turkey meat.

  19. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Esther Lantero

    2017-07-01

    Full Text Available Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L. trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control

  20. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Lantero, E.; Matallanas, B.; Ochando, M.D.; Pascual, S.; Callejas, C.

    2017-07-01

    Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L.) trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control.

  1. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae)

    International Nuclear Information System (INIS)

    Lantero, E.; Matallanas, B.; Ochando, M.D.; Pascual, S.; Callejas, C.

    2017-01-01

    Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L.) trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control.

  2. A degenerate primer MOB typing (DPMT method to classify gamma-proteobacterial plasmids in clinical and environmental settings.

    Directory of Open Access Journals (Sweden)

    Andrés Alvarado

    Full Text Available Transmissible plasmids are responsible for the spread of genetic determinants, such as antibiotic resistance or virulence traits, causing a large ecological and epidemiological impact. Transmissible plasmids, either conjugative or mobilizable, have in common the presence of a relaxase gene. Relaxases were previously classified in six protein families according to their phylogeny. Degenerate primers hybridizing to coding sequences of conserved amino acid motifs were designed to amplify related relaxase genes from γ-Proteobacterial plasmids. Specificity and sensitivity of a selected set of 19 primer pairs were first tested using a collection of 33 reference relaxases, representing the diversity of γ-Proteobacterial plasmids. The validated set was then applied to the analysis of two plasmid collections obtained from clinical isolates. The relaxase screening method, which we call "Degenerate Primer MOB Typing" or DPMT, detected not only most known Inc/Rep groups, but also a plethora of plasmids not previously assigned to any Inc group or Rep-type.

  3. Development of specific primers for genus Fusarium and F. solani ...

    African Journals Online (AJOL)

    Yomi

    2012-01-05

    Jan 5, 2012 ... reproductive parts of plants. They are ... plant species in most parts of the world. .... 20 µl 2.5X master mix (Eppendorf) and 1 µl of each forward and ... List of primers developed for rapid detection of Fusarium sp. and F. solani.

  4. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

    Science.gov (United States)

    Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

    2018-01-01

    Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

  5. Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

    NARCIS (Netherlands)

    Gamper, H.A.; Leuchtmann, A.

    2007-01-01

    Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking

  6. GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

    Science.gov (United States)

    Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

    2011-01-01

    The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

  7. Detection of mutations in genes by specific LNA primers

    DEFF Research Database (Denmark)

    2001-01-01

    acid (LNA). LNA oligomers obey the Watson-Crick base-pairing rules and form duplexes that are significantly more stable than similar duplexes formed by DNA. The "allele-specific" LNA-containing oligonucleotides wherein the LNA nucleotide(s) are found at the 3' position can be extended by means......The present invention relates to a method of detecting variant nucleic acid whose nucleotide sequence differs from one another at a single (or more) position(s). The method uses a set of chimeric oligonucleotides containing DNA monomers and monomers of a novel class of DNA analogues, locked nucleic...

  8. Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27.

    Science.gov (United States)

    Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki

    2011-03-01

    The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

  9. Molecular passportization of clones of karelian birch using PCRwith semi-specific primers

    Directory of Open Access Journals (Sweden)

    Tatyana V Matveeva

    2008-09-01

    Full Text Available Using 4 clones of Karelian birch (Betula pendula Roth var caretica Merckl. from the collection of the karelian birch of the laboratory of genetics of Research Institute of Forest Genetics and Breeding, Voronezh, one normal tree of Betula pendula Roth, and one tree of B. pubescens Ehrh., collected from the nature, we have analyzed the possibility of application of PCR with semi-specific primers for molecular typing. We found primers with high percentage of polymorphic markers. These primers could be recommended for molecular typing of birch.

  10. De-MetaST-BLAST: a tool for the validation of degenerate primer sets and data mining of publicly available metagenomes.

    Directory of Open Access Journals (Sweden)

    Christopher A Gulvik

    Full Text Available Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies. Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI's BLAST (De-MetaST-BLAST, the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications.

  11. Detection of bacterial soft-rot of crown imperial caused by Pectobacterium carotovorum subsp. carotovorum using specific PCR primers

    Directory of Open Access Journals (Sweden)

    E. Mahmoudi

    2007-08-01

    Full Text Available Pectobacterium is one of the major destructive causal agent in most crop plants throughout the world. During a survey in spring of 2005 in the rangeland of Kermanshah and Isfahan, provinces of Iran, samples of bulbs and stems of crown imperial with brown spot and soft rot were collected. Eight strains of pectolytic Erwinia were isolated and purified from these samples. Phenotypic tests indicated that the strains were gram-negative, facultative anaerobic, rod shaped, motile with peritrichous flagella. They were oxidase negative, catalase positive and also able to macerate potato slices. Pathogenicity of all the strains were confirmed on corn, philodendron and crown imperial by inoculation of these crops with a bacterial suspension and reisolation of the strain from symptomatic tissues. A pair of specific PCR primers was used to detect these bacterial strains. The primer set (EXPCCF/EXPCCR amplified a single fragment of the expected size (0.55 kb from genomic DNA of all strains used in this study. In nested PCR, the primer set (INPCCR/INPCCF amplified the expected single fragment (0.4 kb from the PCR product of first PCR amplification. On the basis of the biochemical and phenotypic characteristics and PCR amplification by the specific PCR primers, these strains were identified as Pectobacterium carotovorum subsp. carotovorum. This is the first report of occurrence of crown imperial bacterial soft-rot in Iran.

  12. A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics

    DEFF Research Database (Denmark)

    Busk, Peter Kamp

    2014-01-01

    of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed......Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic...

  13. Genus-Specific Primers for Study of Fusarium Communities in Field Samples

    Science.gov (United States)

    Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-01-01

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

  14. Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

    Science.gov (United States)

    Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

    2014-08-01

    Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

  15. Ranking Specific Sets of Objects.

    Science.gov (United States)

    Maly, Jan; Woltran, Stefan

    2017-01-01

    Ranking sets of objects based on an order between the single elements has been thoroughly studied in the literature. In particular, it has been shown that it is in general impossible to find a total ranking - jointly satisfying properties as dominance and independence - on the whole power set of objects. However, in many applications certain elements from the entire power set might not be required and can be neglected in the ranking process. For instance, certain sets might be ruled out due to hard constraints or are not satisfying some background theory. In this paper, we treat the computational problem whether an order on a given subset of the power set of elements satisfying different variants of dominance and independence can be found, given a ranking on the elements. We show that this problem is tractable for partial rankings and NP-complete for total rankings.

  16. Schrodinger's scat: a critical review of the currently available tiger (Panthera Tigris) and leopard (Panthera pardus) specific primers in India, and a novel leopard specific primer.

    Science.gov (United States)

    Maroju, Pranay Amruth; Yadav, Sonu; Kolipakam, Vishnupriya; Singh, Shweta; Qureshi, Qamar; Jhala, Yadvendradev

    2016-02-09

    Non-invasive sampling has opened avenues for the genetic study of elusive species, which has contributed significantly to their conservation. Where field based identity of non-invasive sample is ambiguous (e.g. carnivore scats), it is essential to establish identity of the species through molecular approaches. A cost effective procedure to ascertain species identity is to use species specific primers (SSP) for PCR amplification and subsequent resolution through agarose gel electrophoresis. However, SSPs if ill designed can often cross amplify non-target sympatric species. Herein we report the problem of cross amplification with currently published SSPs, which have been used in several recent scientific articles on tigers (Panthera tigris) and leopards (Panthera pardus) in India. Since these papers form pioneering research on which future work will be based, an early rectification is required so as to not propagate this error further. We conclusively show cross amplification of three of the four SSPs, in sympatric non-target species like tiger SSP amplifying leopard and striped hyena (Hyaena hyaena), and leopard SSP amplifying tiger, lion (Panthera leo persica) and clouded leopard (Neofelis nebulosa), with the same product size. We develop and test a non-cross-amplifying leopard specific primer pair within the mitochondrial cytochrome b region. We also standardize a duplex PCR method to screen tiger and leopard samples simultaneously in one PCR reaction to reduce cost and time. These findings suggest the importance of an often overlooked preliminary protocol of conclusive identification of species from non-invasive samples. The cross amplification of published primers in conspecifics suggests the need to revisit inferences drawn by earlier work.

  17. Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers

    Science.gov (United States)

    Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li

    2017-01-01

    Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424

  18. Development of degenerate and species-specific primers for the differential and simultaneous RT-PCR detection of grapevine-infecting nepoviruses of subgroups A, B and C.

    Science.gov (United States)

    Digiaro, Michele; Elbeaino, Toufic; Martelli, Giovanni Paolo

    2007-04-01

    Based on the nucleotide sequence homology of RNA-1 and RNA-2 of nepoviruses isolated from grapevines, three sets of degenerate primers, one for each of the three subgroups of the genus (A, B and C), were designed and proved effective for RT-PCR detection of subgroups in infected grapevines and herbaceous hosts. Primers designed specifically for detecting subgroup A species amplified a fragment of 255 bp from samples infected by Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Tobacco ringspot virus (TRSV) and Grapevine deformation virus (GDefV), but not from samples infected by other nepovirus species. Similarly, primers for detection of subgroup B nepoviruses amplified a 390 bp product from samples infected by Grapevine chrome mosaic virus (GCMV), Tomato black ring virus (TBRV), Grapevine Anatolian ringspot virus (GARSV) and Artichoke Italian latent virus (AILV). The third set of primers amplified a 640 bp fragment, only from samples infected by subgroup C nepoviruses, i.e Tomato ringspot virus (ToRSV) Grapevine Bulgarian latent virus (GBLV), and Grapevine Tunisian ringspot virus (GTRSV). These primers were able to detect simultaneously all viral species belonging to the same subgroup and to discriminate species of different subgroups. Multiplex-PCR detection of subgroup A and B nepoviruses was obtained using a specific primer (sense for subgroup A and antisense for subgroup B) for each of the species of the same subgroup in combination with the degenerate subgroup-specific primers. In this way it was possible to detect four different viral species in single samples containing mixtures of viruses of the same subgroup. In particular, for viruses of subgroup A (TRSV, GFLV, ArMV and GDefV) amplicons of 190, 259, 301 and 371 bp were obtained, whereas amplicons of 190, 278, 425 and 485 bp, respectively, were obtained from samples infected with viruses of subgroup B (GCMV, AILV, GARSV and TBRV).

  19. Detection and differentiation of Fusarium oxysporum f. sp. lycopersici race 1 using loop-mediated isothermal amplification with three primer sets.

    Science.gov (United States)

    Ayukawa, Y; Komatsu, K; Kashiwa, T; Akai, K; Yamada, M; Teraoka, T; Arie, T

    2016-09-01

    Fusarium oxysporum f. sp. lycopersici (Fol) causes tomato wilt. Based on the difference in pathogenicity towards tomato cultivars, Fol is classified into three races. In this study, a rapid method is developed for the detection and discrimination of Fol race 1 using a loop-mediated isothermal amplification (LAMP) assay with two primer sets targeting a region of the nucleotide sequence of the SIX4 gene specific for race 1 and a primer set targeting the SIX5 gene, conserved in all known Fol isolates. Upon LAMP reaction, amplification using all three primer sets was observed only when DNA of Fol race 1 was used as a template, and not when DNA of other Fol races or other fungal species was used. This method could detect 300 fg of Fol race 1 DNA, a 100-fold higher sensitivity than that obtained by conventional PCR. The method can also detect DNA extracted from soil artificially infested with Fol race 1. It is now possible to detect Fol race 1 in colonies and infected tomato stems without DNA isolation. This method is a rapid and simple tool for discrimination of Fol race 1. This study developed a loop-mediated isothermal amplification (LAMP) assay for detection and differentiation of Fusarium oxysporum f. sp. lycopersici (Fol) race 1 by using three primer sets targeting for the SIX4 and SIX5 genes. These genes are present together only in Fol race 1. This method can detect Fol race 1 in infected tomato stems without DNA extraction, affording an efficient diagnosis of Fusarium wilt on tomatoes in the field. © 2016 The Society for Applied Microbiology.

  20. Detection of gunshot primer residue on bone in an experimental setting-an unexpected finding.

    Science.gov (United States)

    Berryman, Hugh E; Kutyla, Alicja K; Russell Davis, J

    2010-03-01

    Pork ribs with intact muscle tissue were used in an experimental attempt to identify bullet wipe on bone at distances from 1 to 6 feet with 0.45 caliber, full metal jacket ammunition. This resulted in the unexpected finding of primer-derived gunshot residue (GSR) deep within the wound tract. Of significance is the fact that the GSR was deposited on the bone, under the periosteum, after the bullet passed through a Ziploc bag and c. 1 inch of muscle tissue. It is also important to note that the GSR persisted on the bone after the periosteum was forcibly removed. The presence of primer-derived GSR on bone provides the potential to differentiate gunshot trauma from blunt trauma when the bone presents an atypical gunshot wound. In this study, the presence of gunshot primer residue at a distance of 6 feet demonstrates the potential for establishing maximum gun-to-target distance for remote shootings.

  1. A new set of validated SSR primers for application in mulberry ...

    Indian Academy of Sciences (India)

    user

    2018-01-11

    Jan 11, 2018 ... We chose 37 genomic sequences that had high number of di, tri and tetra SSR motifs from ... primers failed to produce any amplification products and ... Sericulture is a cottage industry that employs 8.03 million people across ... The resolving power of the SSR markers ranged from 0.11 (MulSatG100717) to.

  2. Rapid identification of probiotic Lactobacillus species by multiplex PCR using species-specific primers based on the region extending from 16S rRNA through 23S rRNA.

    Science.gov (United States)

    Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong

    2004-10-15

    This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.

  3. Highly parallel and short-acting amplification with locus-specific primers to detect single nucleotide polymorphisms by the DigiTag2 assay.

    Directory of Open Access Journals (Sweden)

    Nao Nishida

    Full Text Available The DigiTag2 assay enables analysis of a set of 96 SNPs using Kapa 2GFast HotStart DNA polymerase with a new protocol that has a total running time of about 7 hours, which is 6 hours shorter than the previous protocol. Quality parameters (conversion rate, call rate, reproducibility and concordance were at the same levels as when genotype calls were acquired using the previous protocol. Multiplex PCR with 192 pairs of locus-specific primers was available for target preparation in the DigiTag2 assay without the optimization of reaction conditions, and quality parameters had the same levels as those acquired with 96-plex PCR. The locus-specific primers were able to achieve sufficient (concentration of target amplicon ≥5 nM and specific (concentration of unexpected amplicons <2 nM amplification within 2 hours, were also able to achieve detectable amplifications even when working in a 96-plex or 192-plex form. The improved DigiTag2 assay will be an efficient platform for screening an intermediate number of SNPs (tens to hundreds of sites in the replication analysis after genome-wide association study. Moreover, highly parallel and short-acting amplification with locus-specific primers may thus facilitate widespread application to other PCR-based assays.

  4. Development of specific primers for the detection of HVA1 from ...

    African Journals Online (AJOL)

    African Journal of Biotechnology ... Detection methods are usually based on amplification of the target transgene. ... Since there exist a high homology between the barley HVA1 gene and the wheat gene, development of a specific sets of ...

  5. A set of primers for analyzing chloroplast DNA diversity in Citrus and related genera.

    Science.gov (United States)

    Cheng, Yunjiang; de Vicente, M Carmen; Meng, Haijun; Guo, Wenwu; Tao, Nengguo; Deng, Xiuxin

    2005-06-01

    Chloroplast simple sequence repeat (cpSSR) markers in Citrus were developed and used to analyze chloroplast diversity of Citrus and closely related genera. Fourteen cpSSR primer pairs from the chloroplast genomes of tobacco (Nicotiana tabacum L.) and Arabidopsis were found useful for analyzing the Citrus chloroplast genome (cpDNA) and recoded with the prefix SPCC (SSR Primers for Citrus Chloroplast). Eleven of the 14 primer pairs revealed some degree of polymorphism among 34 genotypes of Citrus, Fortunella, Poncirus and some of their hybrids, with polymorphism information content (PIC) values ranging from 0.057 to 0.732, and 18 haplotypes were identified. The cpSSR data were analyzed with NTSYS-pc software, and the genetic relationships suggested by the unweighted pair group method based on arithmetic means (UPGMA) dendrogram were congruent with previous taxonomic investigations: the results showed that all samples fell into seven major clusters, i.e., Citrus medica L., Poncirus, Fortunella, C. ichangensis Blanco, C. reticulata Swingle, C. aurantifolia (Christm.) Swingle and C. grandis (L.) Osbeck. The results of previous studies combined with our cpSSR analyses revealed that: (1) Calamondin (C. madurensis Swingle) is the result of hybridization between kumquat (Fortunella) and mandarin (C. reticulata), where kumquat acted as the female parent; (2) Ichang papeda (C. ichangensis) has a unique taxonomic status; and (3) although Bendiguangju mandarin (C. reticulata) and Satsuma mandarin (C. reticulata) are similar in fruit shape and leaf morphology, they have different maternal parents. Bendiguangju mandarin has the same cytoplasm as sweet orange (C. sinensis), whereas Satsuma mandarin has the cytoplasm of C. reticulata. Seventeen PCR products from SPCC1 and 21 from SPCC11 were cloned and sequenced. The results revealed that mononucleotide repeats as well as insertions and deletions of small segments of DNA were associated with SPCC1 polymorphism, whereas polymorphism

  6. Metabarcoding Analysis of Phytophthora Diversity Using Genus-Specific Primers and 454 Pyrosequencing.

    Science.gov (United States)

    Prigigallo, Maria I; Abdelfattah, Ahmed; Cacciola, Santa O; Faedda, Roberto; Sanzani, Simona M; Cooke, David E L; Schena, L

    2016-03-01

    A metabarcoding method based on genus-specific primers and 454 pyrosequencing was utilized to investigate the genetic diversity of Phytophthora spp. in soil and root samples of potted plants, from eight nurseries. Pyrosequencing enabled the detection of 25 Phytophthora phylotypes distributed in seven different clades and provided a much higher resolution than a corresponding cloning/Sanger sequencing approach. Eleven of these phylotypes, including P. cactorum, P. citricola s.str., P. palmivora, P. palmivora-like, P. megasperma or P. gonapodyides, P. ramorum, and five putative new Phytophthora species phylogenetically related to clades 1, 2, 4, 6, and 7 were detected only with the 454 pyrosequencing approach. We also found an additional 18 novel records of a phylotype in a particular nursery that were not detected with cloning/Sanger sequencing. Several aspects confirmed the reliability of the method: (i) many identical sequence types were identified independently in different nurseries, (ii) most sequence types identified with 454 pyrosequencing were identical to those from the cloning/Sanger sequencing approach and/or perfectly matched GenBank deposited sequences, and (iii) the divergence noted between sequence types of putative new Phytophthora species and all other detected sequences was sufficient to rule out sequencing errors. The proposed method represents a powerful tool to study Phytophthora diversity providing that particular attention is paid to the analysis of 454 pyrosequencing raw read sequences and to the identification of sequence types.

  7. Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

    Science.gov (United States)

    Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

    2016-11-01

    It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

  8. Novel genus-specific broad range primers for the detection of furoviruses, hordeiviruses and rymoviruses and their application in field surveys in South-East Australia.

    Science.gov (United States)

    Zheng, Linda; Tang, Joe; Clover, Gerard R G; Spackman, Merrin E; Freeman, Angela J; Rodoni, Brendan C

    2015-03-01

    A number of viruses from the genera Furovirus, Hordeivirus and Rymovirus are known to infect and damage the four major temperate cereal crops, wheat, barley, sorghum and oats. Currently, there is no active testing in Australia for any of these viruses, which pose a significant biosecurity threat to the phytosanitary status of Australia's grains industry. To address this, broad spectrum PCR assays were developed to target virus species within the genera Furovirus, Hordeivirus and Rymovirus. Five sets of novel genus-specific primers were designed and tested in reverse-transcription polymerase chain reaction assays against a range of virus isolates in plant virus diagnostic laboratories in both Australia and New Zealand. Three of these assays were then chosen to screen samples in a three-year survey of cereal crops in western Victoria, Australia. Of the 8900 cereal plants screened in the survey, all were tested free of furoviruses, hordeiviruses and rymoviruses. To date, there were no published genus-specific primers available for the detection of furoviruses, hordeiviruses and rymoviruses. This study shows for the first time a broad-spectrum molecular test being used in a survey for exotic grain viruses in Australia. Results from this survey provide important evidence of the use of this method to demonstrate the absence of these viruses in Victoria, Australia. The primer pairs reported here are expected to detect a wide range of virus species within the three genera. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

    2011-01-01

    BACKGROUND: MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...

  10. PCR approach for rapid detection of Escherichia coli in tempe using a specific primer

    Directory of Open Access Journals (Sweden)

    Siti Harnina Bintari

    2014-12-01

    Full Text Available Tempe known as a traditional fermented food originated from Indonesia. It has a unique flavour and texture. It also contains high protein and usually serves to substitute meat, fish, or egg as a complement to rice. The manufacture process of Tempe is quite complex and mostly, the traditional process has not employed the hygienic standard. In the process of Tempe making, there are two critical stages of the whole process; i.e. soaking of soybeans and solid state fermentation by Rhizopus sp. During the process, foodborne pathogen bacteria such as Escherichia coli could contaminate the product of Tempe. The bacterial contamination could be revealed through culture dependent methods which is costly, laborious, and time consuming. Therefore, the culture-independent method such as polymerase chain reaction using a specific primer could be applied to detect target microorganism to save time and labour. In this study, thirty-one Tempe samples collected from different manufacturers in Semarang, Central Java, Indonesia were analysed by PCR. In order to obtain the bacterial genomic DNA, a modified Chelex 100-Microwave method was employed. The results of DNA extraction showed that the method was an applicable method. It gave high quantity and quality of DNA; therefore, it could be applied in the PCR reaction. The DNA samples were employed in PCR for detection of Escherichia coli using Ecoli706F/R. It was found that 27 out of 31 samples were detected having Escherichia coli contamination showed by the presence of the amplified product size 706 bp. The application of this method could significantly reduce costs and time of analysis in the laboratory. Further response after E. coli were detected could be employed, including investigation of the critical factors in Tempe manufacturing process which allowed E. coli contamination.

  11. [Development of specific and degenerated primers to CesA genes encoding flax (Linum usitatissimum L.) cellulose synthase].

    Science.gov (United States)

    Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V

    2010-01-01

    Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.

  12. Development of specific primers for the detection of HVA1 from ...

    African Journals Online (AJOL)

    aghomotsegin

    2014-01-22

    Jan 22, 2014 ... can potentially improve the stress tolerance in plants. (Bajaj et al. ... protein) from barley was engineered in rice (Chandra et al., 2004; Rohila et al., .... US), 400 nM forward and reverse primers, 100 ng of DNA template in 25 µl ...

  13. Comparative study on the use of specific and heterologous microsatellite primers in the stingless bees Melipona rufiventris and M. mondury (Hymenoptera, Apidae

    Directory of Open Access Journals (Sweden)

    Denilce Meneses Lopes

    2010-01-01

    Full Text Available Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.

  14. Comparative study on the use of specific and heterologous microsatellite primers in the stingless bees Melipona rufiventris and M. mondury (Hymenoptera, Apidae).

    Science.gov (United States)

    Lopes, Denilce Meneses; de Oliveira Campos, Lúcio Antônio; Salomão, Tânia Maria Fernandes; Tavares, Mara Garcia

    2010-04-01

    Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.

  15. Design and Evaluation of Illumina MiSeq-Compatible, 18S rRNA Gene-Specific Primers for Improved Characterization of Mixed Phototrophic Communities.

    Science.gov (United States)

    Bradley, Ian M; Pinto, Ameet J; Guest, Jeremy S

    2016-10-01

    The use of high-throughput sequencing technologies with the 16S rRNA gene for characterization of bacterial and archaeal communities has become routine. However, the adoption of sequencing methods for eukaryotes has been slow, despite their significance to natural and engineered systems. There are large variations among the target genes used for amplicon sequencing, and for the 18S rRNA gene, there is no consensus on which hypervariable region provides the most suitable representation of diversity. Additionally, it is unclear how much PCR/sequencing bias affects the depiction of community structure using current primers. The present study amplified the V4 and V8-V9 regions from seven microalgal mock communities as well as eukaryotic communities from freshwater, coastal, and wastewater samples to examine the effect of PCR/sequencing bias on community structure and membership. We found that degeneracies on the 3' end of the current V4-specific primers impact read length and mean relative abundance. Furthermore, the PCR/sequencing error is markedly higher for GC-rich members than for communities with balanced GC content. Importantly, the V4 region failed to reliably capture 2 of the 12 mock community members, and the V8-V9 hypervariable region more accurately represents mean relative abundance and alpha and beta diversity. Overall, the V4 and V8-V9 regions show similar community representations over freshwater, coastal, and wastewater environments, but specific samples show markedly different communities. These results indicate that multiple primer sets may be advantageous for gaining a more complete understanding of community structure and highlight the importance of including mock communities composed of species of interest. The quantification of error associated with community representation by amplicon sequencing is a critical challenge that is often ignored. When target genes are amplified using currently available primers, differential amplification efficiencies

  16. Sequence diversity in haloalkane dehalogenases, as revealed by PCR using family-specific primers

    Czech Academy of Sciences Publication Activity Database

    Kotík, Michael; Faměrová, Veronika

    2012-01-01

    Roč. 88, č. 2 (2012), s. 212-217 ISSN 0167-7012 R&D Projects: GA ČR GAP504/10/0137; GA ČR GAP207/10/0135 Institutional research plan: CEZ:AV0Z50200510 Keywords : Dehalogenation * Consensus sequence * Degenerate PCR primer Subject RIV: EE - Microbiology, Virology Impact factor: 2.161, year: 2012

  17. New view on the age-specificity of pig Cryptosporidium by species-specific primers for distinguishing Cryptosporidium suis and Cryptosporidium pig genotype II

    Czech Academy of Sciences Publication Activity Database

    Jeníková, M.; Němejc, K.; Sak, Bohumil; Květoňová, Dana; Kváč, Martin

    2011-01-01

    Roč. 176, 2/3 (2011), 120-125 ISSN 0304-4017 R&D Projects: GA ČR GP523/07/P117 Institutional research plan: CEZ:AV0Z60220518 Keywords : Cryptosporidium suis * Cryptosporidium pig genotype II * Mixed infection * Age-specificity * Species-specific primers Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 2.579, year: 2011

  18. A primer on standards setting as it applies to surgical education and credentialing.

    Science.gov (United States)

    Cendan, Juan; Wier, Daryl; Behrns, Kevin

    2013-07-01

    Surgical technological advances in the past three decades have led to dramatic reductions in the morbidity associated with abdominal procedures and permanently altered the surgical practice landscape. Significant changes continue apace including surgical robotics, natural orifice-based surgery, and single-incision approaches. These disruptive technologies have on occasion been injurious to patients, and high-stakes assessment before adoption of new technologies would be reasonable. We reviewed the drivers for well-established psychometric techniques available for the standards-setting process. We present a series of examples that are relevant in the surgical domain including standards setting for knowledge and skills assessments. Defensible standards for knowledge and procedural skills will likely become part of surgical clinical practice. Understanding the methodology for determining standards should position the surgical community to assist in the process and lead within their clinical settings as standards are considered that may affect patient safety and physician credentialing.

  19. A set of 100 chloroplast DNA primer pairs to study population genetics and phylogeny in monocotylenons

    DEFF Research Database (Denmark)

    Scarcelli, Nora; Bernaud, Adeline; Eiserhardt, Wolf L.

    2011-01-01

    Chloroplast DNA sequences are of great interest for population genetics and phylogenetic studies. However, only a small set of markers are commonly used. Most of them have been designed for amplification in a large range of Angiosperms and are located in the Large Single Copy (LSC). Here we...... anticipate that it will also be useful for phylogeny and bar-coding studies....

  20. Single-tube multiplex PCR using type-specific E6/E7 primers and capillary electrophoresis genotypes 21 human papillomaviruses in neoplasia

    Directory of Open Access Journals (Sweden)

    Warenholt Janina

    2011-01-01

    Full Text Available Abstract Background Human papillomavirus (HPV E6/E7 type-specific oncogenes are required for cervical carcinogenesis. Current PCR protocols for genotyping high-risk HPV in cervical screening are not standardized and usually use consensus primers targeting HPV capsid genes, which are often deleted in neoplasia. PCR fragments are detected using specialized equipment and extra steps, including probe hybridization or primer extension. In published papers, analytical sensitivity is typically compared with a different protocol on the same sample set. A single-tube multiplex PCR containing type-specific primers was developed to target the E6/E7 genes of two low-risk and 19 high-risk genotypes (HPV6, 11 and 16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 53, 56, 58, 59, 66, 68, 70, 73 and 82 and the resulting short fragments were directly genotyped by high-resolution fluorescence capillary electrophoresis. Results The method was validated using long oligonucleotide templates, plasmid clones and 207 clinical samples of DNA from liquid-based cytology, fresh and formalin-fixed specimens and FTA Microcards® imprinted with cut tumor surfaces, swabbed cervical cancers or ejected aspirates from nodal metastases of head and neck carcinomas. Between one and five long oligonucleotide targets per sample were detected without false calls. Each of the 21 genotypes was detected in the clinical sample set with up to five types simultaneously detected in individual specimens. All 101 significant cervical neoplasias (CIN 2 and above, except one adenocarcinoma, contained E6/E7 genes. The resulting genotype distribution accorded with the national pattern with HPV16 and 18 accounting for 69% of tumors. Rare HPV types 70 and 73 were present as the sole genotype in one carcinoma each. One cervical SCC contained DNA from HPV6 and 11 only. Six of twelve oropharyngeal cancer metastases and three neck metastases of unknown origin bore E6/E7 DNA; all but one were HPV16. One neck

  1. Automatic Generation of Validated Specific Epitope Sets

    Directory of Open Access Journals (Sweden)

    Sebastian Carrasco Pro

    2015-01-01

    Full Text Available Accurate measurement of B and T cell responses is a valuable tool to study autoimmunity, allergies, immunity to pathogens, and host-pathogen interactions and assist in the design and evaluation of T cell vaccines and immunotherapies. In this context, it is desirable to elucidate a method to select validated reference sets of epitopes to allow detection of T and B cells. However, the ever-growing information contained in the Immune Epitope Database (IEDB and the differences in quality and subjects studied between epitope assays make this task complicated. In this study, we develop a novel method to automatically select reference epitope sets according to a categorization system employed by the IEDB. From the sets generated, three epitope sets (EBV, mycobacteria and dengue were experimentally validated by detection of T cell reactivity ex vivo from human donors. Furthermore, a web application that will potentially be implemented in the IEDB was created to allow users the capacity to generate customized epitope sets.

  2. PCR with Paracoccidioides brasiliensis specific primers: potential use in ecological studies PCR com «primers» específicos de Paracoccidioides brasiliensis: uso potencial em estudos ecológicos

    Directory of Open Access Journals (Sweden)

    S. DÍEZ

    1999-11-01

    Full Text Available The precise microenvironment of Paracoccidioides brasiliensis has not yet been discovered perhaps because the methods used are not sensitive enough. We applied to this purpose the polymerase chain reaction (PCR using three sets of specific primers corresponding to two P. brasiliensis genes. This fungus as well as several other fungi, were grown and their DNA obtained by mechanical disruption and a phenol chloroform isoamylalcohol-based purification method. The DNA served for a PCR reaction that employed specific primers from two P. brasiliensis genes that codify for antigenic proteins, namely, the 27 kDa and the 43 kDa. The lowest detection range for the 27 kDa gene was 3 pg. The amplification for both genes was positive only with DNA from P. brasiliensis; additionally, the mRNA for the 27 kDa gene was present only in P. brasiliensis, as indicated by the Northern analysis. The standardization of PCR technology permitted the amplification of P. brasiliensis DNA in artificially contaminated soils and in tissues of armadillos naturally infected with the fungus. These results indicate that PCR technology could play an important role in the search for P. brasiliensis’ habitat and could also be used in other ecological studies.O microambiente adequado do Paracoccidioides brasiliensis não foi ainda bem esclarecido, talvez porque os métodos utilizados não sejam suficientemente sensíveis. Aplicamos com este propósito, a reação em cadeia da polimerase (PCR usando três jogos de primers específicos do P. brasiliensis, correspondendo a dois dos genes do P. brasiliensis. Este fungo, assim como outros fungos, foram cultivados e seus DNAs obtidos por ruptura mecânica e purificados com mistura de fenol-clorofórmio com álcool isoamílico. Os DNAs serviram para a reação de PCR utilizando-se primers específicos para dois dos genes do P. brasiliensis que codificam para as proteínas antigênicas, denominadas, 27 kDa e 43 kDa. O limite mínimo de

  3. Comparison of commonly used primer sets for evaluating arbuscular mycorrhizal fungal communities: Is there a universal solution?

    Czech Academy of Sciences Publication Activity Database

    Kohout, P.; Sudová, R.; Janoušková, M.; Čtvrtlíková, Martina; Hejda, M.; Pánková, H.; Slavíková, R.; Štajerová, K.; Vosátka, M.; Sýkorová, Z.

    2014-01-01

    Roč. 68, January (2014), s. 482-493 ISSN 0038-0717 Institutional support: RVO:60077344 Keywords : arbuscular mycorrhizal fungi * primers * diversity Subject RIV: EF - Botanics Impact factor: 3.932, year: 2014

  4. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  5. A Sensitive and Specific PCR Based Method for Identification of Cryptosporidium Sp. Using New Primers from 18S Ribosomal RNA

    Directory of Open Access Journals (Sweden)

    M Heydarnezhadi

    2011-09-01

    Full Text Available Background: The main goal of the present study was to develop a new sensitive and specific PCR based method for Identification of Cryptosporidium sp. using novel primers from 18S ribosomal RNA. Cryptosporidi­osis in high-risk host groups particularly in neonates and immuno-compromised individuals may result in death. To the best of our knowledge this is the first study regarding develop a new PCR based method to diagnose the cryptosporidiosis in Iran.Methods: A total of 850 human fecal samples from patients clinically suspected to cryptosporidiosis and 100 healthy and diarrheic cattle stool specimens were collected. The simplified formol-ether concentration method was carried out for all samples. They were then examined microscopically by modified Ziehl-Neel­sen staining method. Total DNA was extracted by QIA amp DNA stool mini kit was carried out by using designed prim­ers.Results: Twenty nine cases of cryptosporidiosis infection in human and 30 samples from cattle microscopi­cally were posi­tive. The described primary and nested PCR method could detect all Cryptospori­dium positive samples from human and cattle. Regards to suspected negative samples in pri­mary PCR examination, the Nested PCR could ap­prove two more positive results. Furthermore, Nested PCR analysis was able to detect one more case which was nega­tive in both microscopically examination and primary PCR. Specificity of the test was 100%. Sensitivity of Nested PCR in comparison to our gold standard; microscopy after Ridley concentration modified ziehl-Neelsen, was 100 %.Conclusion: Our developed PCR based method by using new primers devised from 18S ribosomal RNA revealed the ability for identification of the Cryptosporidium species such as C. parvum and C. huminis with high specificity and sensitivity.

  6. Fluorescent quenching-based quantitative detection of specific DNA/RNA using a BODIPY® FL-labeled probe or primer

    Science.gov (United States)

    Kurata, Shinya; Kanagawa, Takahiro; Yamada, Kazutaka; Torimura, Masaki; Yokomaku, Toyokazu; Kamagata, Yoichi; Kurane, Ryuichiro

    2001-01-01

    We have developed a simple method for the quantitative detection of specific DNA or RNA molecules based on the finding that BODIPY® FL fluorescence was quenched by its interaction with a uniquely positioned guanine. This approach makes use of an oligonucleotide probe or primer containing a BODIPY® FL-modified cytosine at its 5′-end. When such a probe was hybridized with a target DNA, its fluorescence was quenched by the guanine in the target, complementary to the modified cytosine, and the quench rate was proportional to the amount of target DNA. This widely applicable technique will be used directly with larger samples or in conjunction with the polymerase chain reaction to quantify small DNA samples. PMID:11239011

  7. A new set of primers for the detection of Toxoplasma gondii in amniotic fluid using polymerase chain reaction.

    Science.gov (United States)

    Pelloux, H; Weiss, J; Simon, J; Muet, F; Fricker-Hidalgo, H; Goullier-Fleuret, A; Ambroise-Thomas, P

    1996-04-15

    A new PCR system including a pair of primers, a probe and an internal control were designed from the B1 gene of Toxoplasma gondii. The system described allowed the detection of less than 10 tachyzoites of the RH strain of T. gondii. Among 21 amniotic fluid samples, this system diagnosed the cases of congenital toxoplasmosis which were simultaneously diagnosed using mice inoculation, in vitro culture, and serology from both amniotic fluid and fetal blood. These results show that these new primers allow for a highly sensitive detection of T. gondii DNA.

  8. Comparison of various primer sets for detection of Toxoplasma gondii by polymerase chain reaction in fetal tissues from naturally aborted foxes.

    Science.gov (United States)

    Smielewska-Loś, E

    2003-01-01

    Tissues from 4 aborted polar foxes (3 samples of brain and 4 samples of liver) were selected for Toxoplasma gondii PCR assay. Positive results of serological tests of mothers and immunofluorescence test (IFT) of fetal organ smears were the criteria of sample selection. Five sets of primers designed from B1 gene and ITS1 sequences of T. gondii were used for detection of the parasite in fetal fox tissues. All used primer sets successfully amplified T. gondii DNA in PCR from organs which were positive by IFT. Single tube nested PCR also showed positive result from a sample negative by IFT, but this product was not confirmed. The studies showed usefullness of PCR for routine diagnosis of toxoplasmosis in carnivores.

  9. PCR Primer Specific CaMV 35S Promoter to Detect Transgenic Soybean in Indonesia Commercial Soy Bean and Tempeh

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2017-11-01

    Full Text Available In the framework of the supervision and enforcement of the regulation regarding the content of soybean transgenic in food and processed foods such as tempeh, a reliable testing method is indispensable. Performance specific primer PCR amplification with promoter of CaMV 35S tested to detect the presence of GMOs. The parameters tested were specificity, precision and cut off detection using CRM transgenic soybean. The method is reliable to detect transgenic soybean specifically and has the annealing temperature at 59 °C during the 30 cycle standard PCR condition. The method did not show any false positive and false negative results meaning good precision. The cut off the methods is up to 2 copies total DNA of soybean or less than 104 copies of the CaMV 35S promoter. Observation to the commercial soybeans and tempeh found that most of the commercially available soybean in Indonesia are transgenic (8 of 10 sample while all tested tempeh sample were detected have been fermented from transgenic soybeans.

  10. Phylogenetic Analysis and Molecular Characterization of Xanthium sibiricum Using DNA Barcoding, PCR-RFLP, and Specific Primers.

    Science.gov (United States)

    Tomasello, Salvatore; Heubl, Günther

    2017-07-01

    The fruits of Xanthium sibiricum have been widely used in traditional Chinese medicine for the treatment of nasal sinusitis and headaches. The genus Xanthium (cocklebur) is a taxonomically complex genus. Different taxonomic concepts have been proposed, some including several species, others lumping the different taxa in a few extremely polymorphic species. Due to the morphological similarities between species, the correct authentication of X. sibiricum is very difficult. Therefore, we established a polymerase chain reaction-restriction fragment length polymorphism method and diagnostic PCR based on nuclear internal transcribed spacer and chloroplast trnQ-rps16 barcodes to differentiate X. sibirium from related species.Results from the phylogenetic analyses based on sequence information from four marker regions (plastidal psbA-trnH and trnQ-rps16 and nuclear ITS and D35 ) support those taxonomic concepts accepting a reduced number of species, as four to five major clades are revealed in the phylogenetic reconstructions. X. sibiricum , together with some accessions from closely related taxa, is always supported as monophyletic, constituting a well-defined genetic entity. Allele-specific primer pairs for ITS and trnQ-rps16 were designed to amplify diagnostic products from the genomic DNA of X. sibiricum . Specific PCR in combination with digestion using the restriction enzyme Mse I allowed for the identification of X. sibiricum by producing specific restriction patterns. The results demonstrate that the applied techniques provide effective and accurate authentication of X. sibiricum . Georg Thieme Verlag KG Stuttgart · New York.

  11. Differentiation of mycoplasmalike organisms (MLOs) in European fruit trees by PCR using specific primers derived from the sequence of a chromosomal fragment of the apple proliferation MLO.

    Science.gov (United States)

    Jarausch, W; Saillard, C; Dosba, F; Bové, J M

    1994-01-01

    A 1.8-kb chromosomal DNA fragment of the mycoplasmalike organism (MLO) associated with apple proliferation was sequenced. Three putative open reading frames were observed on this fragment. The protein encoded by open reading frame 2 shows significant homologies with bacterial nitroreductases. From the nucleotide sequence four primer pairs for PCR were chosen to specifically amplify DNA from MLOs associated with European diseases of fruit trees. Primer pairs specific for (i) Malus-affecting MLOs, (ii) Malus- and Prunus-affecting MLOs, and (iii) Malus-, Prunus-, and Pyrus-affecting MLOs were obtained. Restriction enzyme analysis of the amplification products revealed restriction fragment length polymorphisms between Malus-, Prunus, and Pyrus-affecting MLOs as well as between different isolates of the apple proliferation MLO. No amplification with either primer pair could be obtained with DNA from 12 different MLOs experimentally maintained in periwinkle. Images PMID:7916180

  12. Validation of a Non-Specific Dye Real-Time PCR Assay for Porcine Adulteration in Meatball Using ND5 Primer

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2017-07-01

    Full Text Available Porcine adulteration in meatball samples were analyzed using real-time polymerase chain reaction (RT-PCR, based on the ND5 primer obtained by previous study. This work consisted of three stages which were annealing temperature optimization, method validation, and application. DNA template was extracted using phenol-CIAA (chloroform-iso amyl alcohol method. The optimum annealing temperature for ND5 primers (forward primer 5'-CATTCGCCTCACTCACATTAACC-3' and reverse primer 5'-AAGAGAGAGTTCTACGGTCTGTAG-3' was 58.0 °C, obtained after testing annealing at 50.5 to 59.5 °C gradient temperature with 5 °C interval. Melting curve analysis was done at 65.0 to 95.0 °C, with increasing temperature for 0.5 °C per 2 sec. Method was validated for its specificity, precision and limit of detection. RT-PCR method with ND5 primers produced 227 bp DNA fragment with 78.50 °C Tm value. From eight commercial meatball samples, one was detected containing porcine. The methods showed high specificity and precision, with experimentally determined limits for porcine were no less than 1%.

  13. Kinetic characterisation of primer mismatches in allele-specific PCR: a quantitative assessment.

    Science.gov (United States)

    Waterfall, Christy M; Eisenthal, Robert; Cobb, Benjamin D

    2002-12-20

    A novel method of estimating the kinetic parameters of Taq DNA polymerase during rapid cycle PCR is presented. A model was constructed using a simplified sigmoid function to represent substrate accumulation during PCR in combination with the general equation describing high substrate inhibition for Michaelis-Menten enzymes. The PCR progress curve was viewed as a series of independent reactions where initial rates were accurately measured for each cycle. Kinetic parameters were obtained for allele-specific PCR (AS-PCR) amplification to examine the effect of mismatches on amplification. A high degree of correlation was obtained providing evidence of substrate inhibition as a major cause of the plateau phase that occurs in the later cycles of PCR.

  14. Comparison of commonly used primer sets for evaluating arbuscular mycorrhizal fungal communities: Is there a universal solution?

    Czech Academy of Sciences Publication Activity Database

    Kohout, Petr; Sudová, Radka; Janoušková, Martina; Čtvrtlíková, Martina; Hejda, Martin; Pánková, Hana; Slavíková, Renata; Štajerová, Kateřina; Vosátka, Miroslav; Sýkorová, Zuzana

    2014-01-01

    Roč. 68, Jan 2014 (2014), s. 482-493 ISSN 0038-0717 R&D Projects: GA ČR GAP504/10/0781; GA ČR GAP504/10/1486; GA ČR(CZ) GAP505/11/1112 Institutional support: RVO:67985939 Keywords : arbuscular mycorrhizal fungi * primers * diversity Subject RIV: EF - Botanics Impact factor: 3.932, year: 2014

  15. Specific amplification of bacterial DNA by optimized so-called universal bacterial primers in samples rich of plant DNA.

    Science.gov (United States)

    Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S

    2015-06-01

    Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Identification of E. coli O157:H7 by Using Specific Primers for rfbE and stx2b Genes

    Directory of Open Access Journals (Sweden)

    Mostafa Bakhshi

    2017-07-01

    Sorbitol-MacConkey agar was used to verification of growth ability of selected colonies during PCR. Results: By appearance of the bonds belong to rfbE and stx2B genes on agarose gel, the ability of designed primers in gene detection in samples of E .coli O157:H7 was verified. Colonies which selected during PCR have growth potency on sorbitol-MacConkey agar medium. Conclusion: It was revealed that we can prepare a fast, precise and relative comfortable method for detection of E. coli O157:H7 strain by using PCR technique and specific primers than other available methods.

  17. A bottleneck model of set-specific capture.

    Directory of Open Access Journals (Sweden)

    Katherine Sledge Moore

    Full Text Available Set-specific contingent attentional capture is a particularly strong form of capture that occurs when multiple attentional sets guide visual search (e.g., "search for green letters" and "search for orange letters". In this type of capture, a potential target that matches one attentional set (e.g. a green stimulus impairs the ability to identify a temporally proximal target that matches another attentional set (e.g. an orange stimulus. In the present study, we investigated whether set-specific capture stems from a bottleneck in working memory or from a depletion of limited resources that are distributed across multiple attentional sets. In each trial, participants searched a rapid serial visual presentation (RSVP stream for up to three target letters (T1-T3 that could appear in any of three target colors (orange, green, or lavender. The most revealing findings came from trials in which T1 and T2 matched different attentional sets and were both identified. In these trials, T3 accuracy was lower when it did not match T1's set than when it did match, but only when participants failed to identify T2. These findings support a bottleneck model of set-specific capture in which a limited-capacity mechanism in working memory enhances only one attentional set at a time, rather than a resource model in which processing capacity is simultaneously distributed across multiple attentional sets.

  18. Development and evaluation of specific PCR primers targeting the ribosomal DNA-internal transcribed spacer (ITS) region of peritrich ciliates in environmental samples

    Science.gov (United States)

    Su, Lei; Zhang, Qianqian; Gong, Jun

    2017-07-01

    Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.

  19. Enhanced specificity of TPMT*2 genotyping using unidirectional wild-type and mutant allele-specific scorpion primers in a single tube.

    Directory of Open Access Journals (Sweden)

    Dong Chen

    Full Text Available Genotyping of thiopurine S-methyltransferase (TPMT is recommended for predicting the adverse drug response of thiopurines. In the current study, a novel version of allele-specific PCR (AS-PCR, termed competitive real-time fluorescent AS-PCR (CRAS-PCR was developed to analyze the TPMT*2 genotype in ethnic Chinese. This technique simultaneously uses wild-type and mutant allele-specific scorpion primers in a single reaction. To determine the optimal conditions for both traditional AS-PCR and CRAS-PCR, we used the Taguchi method, an engineering optimization process that balances the concentrations of all components using an orthogonal array rather than a factorial array. Instead of running up to 264 experiments with the conventional factorial method, the Taguchi method achieved the same optimization using only 16 experiments. The optimized CRAS-PCR system completely avoided non-specific amplification occurring in traditional AS-PCR and could be performed at much more relaxed reaction conditions at 1% sensitivity, similar to traditional AS-PCR. TPMT*2 genotyping of 240 clinical samples was consistent with published data. In conclusion, CRAS-PCR is a novel and robust genotyping method, and the Taguchi method is an effective tool for the optimization of molecular analysis techniques.

  20. Human Platelet Antigen Alleles in 998 Taiwanese Blood Donors Determined by Sequence-Specific Primer Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Shun-Chung Pai

    2013-01-01

    Full Text Available Polymorphism of human platelet antigens (HPAs leads to alloimmunizations and immune-mediated platelet disorders including fetal-neonatal alloimmune thrombocytopenia (FNAIT, posttransfusion purpura (PTP, and platelet transfusion refractoriness (PTR. HPA typing and knowledge of antigen frequency in a population are important in particular for the provision of HPA-matched blood components for patients with PTR. We have performed allele genotyping for HPA-1 through -6 and -15 among 998 platelet donors from 6 blood centers in Taiwan using sequence-specific primer polymerase chain reaction. The HPA allele frequency was 99.55, and 0.45% for HPA-1a and -1b; 96.49, and 3.51% for HPA-2a and -2b; 55.81, and 44.19% for HPA-3a and -3b; 99.75, and 0.25% for HPA-4a and -4b; 98.50, and 1.50% for HPA-5a and -5b; 97.75 and 2.25% for HPA-6a and -6b; 53.71 and 46.29% for HPA-15a and -15b. HPA-15b and HPA-3a, may be considered the most important, followed by HPA-2, -6, -1, -5, and -4 systems, as a cause of FNAIT, PTP, and PTR based on allele frequency. HPA-4b and HPA-5b role cannot be excluded based on their immunogenicity. A larger-scale study will now be conducted to confirm these hypotheses and to establish an apheresis donor database for the procurement of HPA-matched apheresis platelets for patients with PTR.

  1. Use of PCR with Sequence-specific Primers for High-Resolution Human Leukocyte Antigen Typing of Patients with Narcolepsy

    Science.gov (United States)

    Woo, Hye In; Joo, Eun Yeon; Lee, Kyung Wha

    2012-01-01

    Background Narcolepsy is a neurologic disorder characterized by excessive daytime sleepiness, symptoms of abnormal rapid eye movement (REM) sleep, and a strong association with HLA-DRB1*1501, -DQA1*0102, and -DQB1*0602. Here, we investigated the clinico-physical characteristics of Korean patients with narcolepsy, their HLA types, and the clinical utility of high-resolution PCR with sequence-specific primers (PCR-SSP) as a simple typing method for identifying DRB1*15/16, DQA1, and DQB1 alleles. Methods The study population consisted of 67 consecutively enrolled patients having unexplained daytime sleepiness and diagnosed narcolepsy based on clinical and neurological findings. Clinical data and the results of the multiple sleep latency test and polysomnography were reviewed, and HLA typing was performed using both high-resolution PCR-SSP and sequence-based typing (SBT). Results The 44 narcolepsy patients with cataplexy displayed significantly higher frequencies of DRB1*1501 (Pc= 0.003), DQA1*0102 (Pc=0.001), and DQB1*0602 (Pc=0.014) than the patients without cataplexy. Among patients carrying DRB1*1501-DQB1*0602 or DQA1*0102, the frequencies of a mean REM sleep latency of less than 20 min in nocturnal polysomnography and clinical findings, including sleep paralysis and hypnagogic hallucination were significantly higher. SBT and PCR-SSP showed 100% concordance for high-resolution typing of DRB1*15/16 alleles and DQA1 and DQB1 loci. Conclusions The clinical characteristics and somnographic findings of narcolepsy patients were associated with specific HLA alleles, including DRB1*1501, DQA1*0102, and DQB1*0602. Application of high-resolution PCR-SSP, a reliable and simple method, for both allele- and locus-specific HLA typing of DRB1*15/16, DQA1, and DQB1 would be useful for characterizing clinical status among subjects with narcolepsy. PMID:22259780

  2. PCMO L01-Setting Specifications for Biological Investigational Medicinal Products.

    Science.gov (United States)

    Krause, Stephan O

    2015-01-01

    This paper provides overall guidance and best practices for the setting of specifications for clinical biological drug substances and drug products within the framework of ICH guidelines on pharmaceutical development [Q8(R2) and Q11], quality risk management (Q9), and quality systems (Q10). A review is provided of the current regulatory expectations for the specification setting process as part of a control strategy during product development, pointing to existing challenges for the investigational new drug/investigational medicinal product dossier (IND/IMPD) sponsor. A case study illustrates how the investigational medicinal product specification revision process can be managed within a flexible quality system, and how specifications can be set and justified for early and late development stages. This paper provides an overview for the setting of product specifications for investigational medicinal products used in clinical trials. A case study illustrates how product specifications of investigational medicinal products can be justified and managed within a modern product quality system. © PDA, Inc. 2015.

  3. Opening the treasure chest: A DNA-barcoding primer set for most higher taxa of Central European birds and mammals from museum collections.

    Directory of Open Access Journals (Sweden)

    Sylvia Schäffer

    Full Text Available DNA-barcoding is a rapidly developing method for efficiently identifying samples to species level by means of short standard DNA sequences. However, reliable species assignment requires the availability of a comprehensive DNA barcode reference library, and hence numerous initiatives aim at generating such barcode databases for particular taxa or geographic regions. Historical museum collections represent a potentially invaluable source for the DNA-barcoding of many taxa. This is particularly true for birds and mammals, for which collecting fresh (voucher material is often very difficult to (nearly impossible due to the special animal welfare and conservation regulations that apply to vertebrates in general, and birds and mammals in particular. Moreover, even great efforts might not guarantee sufficiently complete sampling of fresh material in a short period of time. DNA extracted from historical samples is usually degraded, such that only short fragments can be amplified, rendering the recovery of the barcoding region as a single fragment impossible. Here, we present a new set of primers that allows the efficient amplification and sequencing of the entire barcoding region in most higher taxa of Central European birds and mammals in six overlapping fragments, thus greatly increasing the value of historical museum collections for generating DNA barcode reference libraries. Applying our new primer set in recently established NGS protocols promises to further increase the efficiency of barcoding old bird and mammal specimens.

  4. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    Science.gov (United States)

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  5. Discovery of cancer common and specific driver gene sets

    Science.gov (United States)

    2017-01-01

    Abstract Cancer is known as a disease mainly caused by gene alterations. Discovery of mutated driver pathways or gene sets is becoming an important step to understand molecular mechanisms of carcinogenesis. However, systematically investigating commonalities and specificities of driver gene sets among multiple cancer types is still a great challenge, but this investigation will undoubtedly benefit deciphering cancers and will be helpful for personalized therapy and precision medicine in cancer treatment. In this study, we propose two optimization models to de novo discover common driver gene sets among multiple cancer types (ComMDP) and specific driver gene sets of one certain or multiple cancer types to other cancers (SpeMDP), respectively. We first apply ComMDP and SpeMDP to simulated data to validate their efficiency. Then, we further apply these methods to 12 cancer types from The Cancer Genome Atlas (TCGA) and obtain several biologically meaningful driver pathways. As examples, we construct a common cancer pathway model for BRCA and OV, infer a complex driver pathway model for BRCA carcinogenesis based on common driver gene sets of BRCA with eight cancer types, and investigate specific driver pathways of the liquid cancer lymphoblastic acute myeloid leukemia (LAML) versus other solid cancer types. In these processes more candidate cancer genes are also found. PMID:28168295

  6. RUCS: Rapid identification of PCR primers for unique core sequences

    DEFF Research Database (Denmark)

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

    2017-01-01

    Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

  7. MethPrimer: designing primers for methylation PCRs.

    Science.gov (United States)

    Li, Long-Cheng; Dahiya, Rajvir

    2002-11-01

    DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

  8. Development of SCAR marker specific to non-toxic Jatropha curcas L. and designing a novel multiplexing PCR along with nrDNA ITS primers to circumvent the false negative detection

    KAUST Repository

    Mastan, Shaik G.

    2011-05-10

    Jatropha curcas L., a multipurpose shrub, has acquired significant economic importance for its seed oil which can be converted to biodiesel an emerging alternative to petro-diesel. In addition to the commercial value, it is also having medicinal and even high nutritional value to use as animal fodder which is limited due to the toxicity. Development of molecular marker will enable to differentiate non-toxic from toxic variety of J. curcas in a mixed population and also for quality control since the toxic components of J. curcas has deleterious effect on animals. In the present study, the efforts were made to generate the specific SCAR marker for toxic and/or non-toxic J. curcas from RAPD markers. Among the markers specific for toxic and non-toxic varieties, four were selected, purified, cloned, sequenced, and designed primers out of which one set of primers NT-JC/SCAR I/OPQ15-F and R could able to discriminate the non-toxic with toxic Jatropha by giving expected 430 bp size amplification in non-toxic variety. Furthermore, novel multiplex PCR was designed using the nrDNA ITS primers to overcome the false negatives. Present work also demonstrates utility of the conserved regions of nrDNA coding genes in ruling out the artifacts in PCR-like false negatives frequently occur in SCAR due to various reasons. The specific SCAR markers generated in the present investigation will help to distinguish non-toxic from toxic varieties of J. curcas or vice versa, and isolated marker along with designed multiplex protocol has applications in quality control for selective cultivation of non-toxic variety and will also assist in breeding and molecular mapping studies. © 2011 Springer Science+Business Media, LLC.

  9. Novel primer specific false terminations during DNA sequencing reactions: danger of inaccuracy of mutation analysis in molecular diagnostics

    Science.gov (United States)

    Anwar, R; Booth, A; Churchill, A J; Markham, A F

    1996-01-01

    The determination of nucleotide sequence is fundamental to the identification and molecular analysis of genes. Direct sequencing of PCR products is now becoming a commonplace procedure for haplotype analysis, and for defining mutations and polymorphism within genes, particularly for diagnostic purposes. A previously unrecognised phenomenon, primer related variability, observed in sequence data generated using Taq cycle sequencing and T7 Sequenase sequencing, is reported. This suggests that caution is necessary when interpreting DNA sequence data. This is particularly important in situations where treatment may be dependent on the accuracy of the molecular diagnosis. Images PMID:16696096

  10. Does olfactory specific satiety take place in a natural setting?

    Science.gov (United States)

    Fernandez, P; Bensafi, M; Rouby, C; Giboreau, A

    2013-01-01

    Olfactory-specific satiety (OSS) is characterized by a specific decrease in the odor pleasantness of a food eaten to satiety or smelled without ingestion. The usual protocol for studying OSS takes place in laboratory, a setting rather removed from the real world. Here, we set out to examine OSS in a natural setting: during a meal in a restaurant. We hypothesized that an aroma contained in a food that is eaten at the beginning of a meal decreases the pleasantness of the flavor of a food with the same aroma eaten at the end of the meal. In the first experiment (Experiment 1), a test group received an appetizer flavored with a test aroma (anise) at the beginning of the meal. After the main dish, they received a dessert flavored with the same aroma. A control group received the same aromatized dessert, but after a non-aromatized appetizer. This experiment was replicated (Experiment 2) using verbena as the test aroma. For both experiments, results revealed that aroma pleasantness, but not intensity or familiarity, significantly decreased in the test groups vs. the control groups. These findings extend the concept of OSS to a realistic eating context. Copyright © 2012 Elsevier Ltd. All rights reserved.

  11. Specific features of goal setting in road traffic safety

    Science.gov (United States)

    Kolesov, V. I.; Danilov, O. F.; Petrov, A. I.

    2017-10-01

    Road traffic safety (RTS) management is inherently a branch of cybernetics and therefore requires clear formalization of the task. The paper aims at identification of the specific features of goal setting in RTS management under the system approach. The paper presents the results of cybernetic modeling of the cause-to-effect mechanism of a road traffic accident (RTA); in here, the mechanism itself is viewed as a complex system. A designed management goal function is focused on minimizing the difficulty in achieving the target goal. Optimization of the target goal has been performed using the Lagrange principle. The created working algorithms have passed the soft testing. The key role of the obtained solution in the tactical and strategic RTS management is considered. The dynamics of the management effectiveness indicator has been analyzed based on the ten-year statistics for Russia.

  12. PCR-based molecular discrimination of Pandora neoaphidis isolates from related entomopathogenic fungi and development of species-specific diagnostic primers.

    Science.gov (United States)

    Tymon, Anna M; Shah, Paresh A; Pell, Judith K

    2004-04-01

    Studies were performed to assess the genetic variation amongst isolates of the aphid-pathogenic fungus Pandora neoaphidis (syn. Erynia neoaphidis). 37 isolates were examined, from a range of pest and non-pest aphid species, as well as 21 from eight other entomophthoralean species. Universal primers were used to amplify the ITS rDNA regions and all of the species tested produced discrete ITS groups, with the exception of Conidiobolus spp. Neighbour-joining analysis of the ITS2 regions from P. neoaphidis, P. kondoiensis and Zoophthora radicans demonstrated that these three species formed distinct groups with sequence identities of 58-82% between the groups. An ITS size of ca 1,100 bp was diagnostic for P. neoaphidis, while ca 1,450 bp was characteristic of P. kondoiensis. ITS-RFLP analysis failed to yield intraspecific polymorphisms in any of the P. neoaphidis isolates screened, although it was useful in distinguishing between different entomophthoralean species. Some intraspecific variation in the ITS region was detected in a number of isolates of Z. radicans and Conidiobolus spp. We propose that two isolates previously identified as P. neoaphidis based on conidia morphology, are actually P. kondoiensis based on molecular studies. Sequencing analysis of the complete ITS region from P. neoaphidis and P. kondoiensis allowed species-specific primers to be developed for P. neoaphidis and P. kondoiensis. These were used to screen aphids infected in laboratory bioassays and from field-collected samples, without prior isolation of the fungus. The primers are useful tools for quantifying the epizootiology of P. neoaphidis in aphid populations, as well as assessing competitive interactions between these two species.

  13. Multi-functional roles of a soldier-specific volatile as a worker arrestant, primer pheromone and an antimicrobial agent in a termite.

    Science.gov (United States)

    Mitaka, Yuki; Mori, Naoki; Matsuura, Kenji

    2017-07-26

    Division of labour in eusocial insects is characterized by efficient communication systems based on pheromones. Among such insects, termites have evolved specialized sterile defenders, called soldiers. Because they are incapable of feeding themselves, it has been suggested that soldiers are sustained by workers and emit the pheromone arresting workers. However, such a soldier pheromone has not been identified in any termite species, and the details of the soldier-worker interaction remain to be explored. Here, we identified a soldier-specific volatile sesquiterpene as a worker arrestant, which also acts as a primer pheromone regulating soldier differentiation and fungistatic agent in a termite Reticulitermes speratus Chemical analyses revealed that (-)- β -elemene is the major component of soldier extract, and its authentic standard exhibited arrestant activity to workers and inhibited the differentiation from workers to soldiers. This compound also showed fungistatic activity against entomopathogenic fungi. These suggest that (-)- β -elemene secreted by soldiers acts not only as a worker arrestant but also as one component of inhibitory primer pheromone and an anti-pathogenic agent. Our study provides novel evidence supporting the multi-functionality of termite soldier pheromone and provides new insights into the role of soldiers and the evolutionary mechanisms of pheromone compounds. © 2017 The Author(s).

  14. Nucleotide mismatches between the VP7 gene and the primer are associated with genotyping failure of a specific lineage from G1 rotavirus strains

    Directory of Open Access Journals (Sweden)

    Espinola Emilio E

    2006-05-01

    Full Text Available Abstract In recent years it was reported that the accumulation of point mutations in VP4 and VP7 genes of rotavirus strains was the main cause of the failure of the G or P-typing. Failures in the correct genotyping of G1, G2, G8, G9 and G10 rotavirus strains were reported in the most commonly used reverse transcription (RT-PCR strategies. Collecting VP7 gene sequences of G1 rotavirus strains from databases we found that 74 (61.2 % out of 121 G1 strains from lineage I showed the four specific mismatches at the 5' end of the 9T1-1 primer, previously associated with the failure of G1-typing. Thus, a great percentage of the G1 strains from lineage I worldwide reported could not have been typed if the Das's RT-PCR strategy were used. This analysis shows that the failure on the detection of the G1 strains could be due to the diversification of rotavirus strains in phylogenetic lineages. Therefore, the use of different RT-PCR strategies with different primer binding locations on the VP7 gene or new typing methodologies -like microarrays procedures- could be a better option to avoid the failure of the G-typing of rotavirus strains detected during surveillance programs.

  15. A Molecular Approach to Nested RT-PCR Using a New Set of Primers for the Detection of the Human Immunodeficiency Virus Protease Gene.

    Science.gov (United States)

    Zarei, Mohammad; Ravanshad, Mehrdad; Bagban, Ashraf; Fallahi, Shahab

    2016-07-01

    The human immunodeficiency virus (HIV-1) is the etiologic agent of AIDS. The disease can be transmitted via blood in the window period prior to the development of antibodies to the disease. Thus, an appropriate method for the detection of HIV-1 during this window period is very important. This descriptive study proposes a sensitive, efficient, inexpensive, and easy method to detect HIV-1. In this study 25 serum samples of patients under treatment and also 10 positive and 10 negative control samples were studied. Twenty-five blood samples were obtained from HIV-1-infected individuals who were receiving treatment at the acquired immune deficiency syndrome (AIDS) research center of Imam Khomeini hospital in Tehran. The identification of HIV-1-positive samples was done by using reverse transcription to produce copy deoxyribonucleic acid (cDNA) and then optimizing the nested polymerase chain reaction (PCR) method. Two pairs of primers were then designed specifically for the protease gene fragment of the nested real time-PCR (RT-PCR) samples. Electrophoresis was used to examine the PCR products. The results were analyzed using statistical tests, including Fisher's exact test, and SPSS17 software. The 325 bp band of the protease gene was observed in all the positive control samples and in none of the negative control samples. The proposed method correctly identified HIV-1 in 23 of the 25 samples. These results suggest that, in comparison with viral cultures, antibody detection by enzyme linked immunosorbent assay (ELISAs), and conventional PCR methods, the proposed method has high sensitivity and specificity for the detection of HIV-1.

  16. MRI Primer

    International Nuclear Information System (INIS)

    Oldendorf, W.; Oldendorf, W. Jr.

    1991-01-01

    Designed for studies, radiologists, and clinicians at all levels of training, this book provides a basic introduction to the principles, physics, and instrumentation of magnetic resonance imaging. The fundamental concepts that are essential for the optimal clinical use of MRI are thoroughly explained in easily accessible terms. To facilitate the reader's comprehension, the material is presented nonmathematically, using no equations and a minimum of symbols and abbreviations. MRI Primer presents a clear account of the phenomenon of nuclear magnetic resonance and the use of gradient magnetic fields to create clinically useful images of cross-sectional slices. Close attention is given to the magnetization vector as a means of expressing nuclear behavior, the role of T 1 and T 2 weighing in imaging, the use of contrast agents, and the pulse sequences most often used in clinical practice, as well as to the relative capabilities and limitations of MRI and CT. The basic hardware components of an MRI scanner are described in detail. Sample MRI scans illustrate how MRI characterizes tissue. An appendix provides a brief introduction to quantum processes in MRI

  17. Design of primers for pertussis diagnosis by Real Time PCR and determination of its sensitivity and specificity in comparison with commercial kits.

    Directory of Open Access Journals (Sweden)

    Hamidreza Monavari

    2013-12-01

    Results: Performance of our home made primers for detecting pertussis using Real Time PCR in comparison with those by commercial kit was acceptable based on diagnostic classical guidance (WHO and the (CDC. Conclusions: Real time PCR test with new primers in comparison with culture techniques is more suitable, high sensitivity and can provide more informative values for pertussis detection.

  18. Predictive maintenance primer

    International Nuclear Information System (INIS)

    Flude, J.W.; Nicholas, J.R.

    1991-04-01

    This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs

  19. NASIS data base management system: IBM 360 TSS implementation. Volume 3: Data set specifications

    Science.gov (United States)

    1973-01-01

    The data set specifications for the NASA Aerospace Safety Information System (NASIS) are presented. The data set specifications describe the content, format, and medium of communication of every data set required by the system. All relevant information pertinent to a particular data set is prepared in a standard form and centralized in a single document. The format for the data set is provided.

  20. NASIS data base management system - IBM 360/370 OS MVT implementation. 3: Data set specifications

    Science.gov (United States)

    1973-01-01

    The data set specifications for the NASA Aerospace Safety Information System (NASIS) are presented. The data set specifications describe the content, format, and medium of communication of every data set required by the system. All relevant information pertinent to a particular set is prepared in a standard form and centralized in a single document. The format for the data set is provided.

  1. Primer design for a prokaryotic differential display RT-PCR.

    Science.gov (United States)

    Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

    1997-05-01

    We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

  2. Criticality calculations with MCNP trademark: A primer

    International Nuclear Information System (INIS)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

  3. Learning Domain-Specific Heuristics for Answer Set Solvers

    OpenAIRE

    Balduccini, Marcello

    2010-01-01

    In spite of the recent improvements in the performance of Answer Set Programming (ASP) solvers, when the search space is sufficiently large, it is still possible for the search algorithm to mistakenly focus on areas of the search space that contain no solutions or very few. When that happens, performance degrades substantially, even to the point that the solver may need to be terminated before returning an answer. This prospect is a concern when one is considering using such a solver in an in...

  4. Optimized Basis Sets for the Environment in the Domain-Specific Basis Set Approach of the Incremental Scheme.

    Science.gov (United States)

    Anacker, Tony; Hill, J Grant; Friedrich, Joachim

    2016-04-21

    Minimal basis sets, denoted DSBSenv, based on the segmented basis sets of Ahlrichs and co-workers have been developed for use as environmental basis sets for the domain-specific basis set (DSBS) incremental scheme with the aim of decreasing the CPU requirements of the incremental scheme. The use of these minimal basis sets within explicitly correlated (F12) methods has been enabled by the optimization of matching auxiliary basis sets for use in density fitting of two-electron integrals and resolution of the identity. The accuracy of these auxiliary sets has been validated by calculations on a test set containing small- to medium-sized molecules. The errors due to density fitting are about 2-4 orders of magnitude smaller than the basis set incompleteness error of the DSBSenv orbital basis sets. Additional reductions in computational cost have been tested with the reduced DSBSenv basis sets, in which the highest angular momentum functions of the DSBSenv auxiliary basis sets have been removed. The optimized and reduced basis sets are used in the framework of the domain-specific basis set of the incremental scheme to decrease the computation time without significant loss of accuracy. The computation times and accuracy of the previously used environmental basis and that optimized in this work have been validated with a test set of medium- to large-sized systems. The optimized and reduced DSBSenv basis sets decrease the CPU time by about 15.4% and 19.4% compared with the old environmental basis and retain the accuracy in the absolute energy with standard deviations of 0.99 and 1.06 kJ/mol, respectively.

  5. Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.

    Science.gov (United States)

    Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong

    2014-08-01

    The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. High Diversity of Myocyanophage in Various Aquatic Environments Revealed by High-Throughput Sequencing of Major Capsid Protein Gene With a New Set of Primers

    Directory of Open Access Journals (Sweden)

    Weiguo Hou

    2018-05-01

    Full Text Available Myocyanophages, a group of viruses infecting cyanobacteria, are abundant and play important roles in elemental cycling. Here we investigated the particle-associated viral communities retained on 0.2 μm filters and in sediment samples (representing ancient cyanophage communities from four ocean and three lake locations, using high-throughput sequencing and a newly designed primer pair targeting a gene fragment (∼145-bp in length encoding the cyanophage gp23 major capsid protein (MCP. Diverse viral communities were detected in all samples. The fragments of 142-, 145-, and 148-bp in length were most abundant in the amplicons, and most sequences (>92% belonged to cyanophages. Additionally, different sequencing depths resulted in different diversity estimates of the viral community. Operational taxonomic units obtained from deep sequencing of the MCP gene covered the majority of those obtained from shallow sequencing, suggesting that deep sequencing exhibited a more complete picture of cyanophage community than shallow sequencing. Our results also revealed a wide geographic distribution of marine myocyanophages, i.e., higher dissimilarities of the myocyanophage communities corresponded with the larger distances between the sampling sites. Collectively, this study suggests that the newly designed primer pair can be effectively used to study the community and diversity of myocyanophage from different environments, and the high-throughput sequencing represents a good method to understand viral diversity.

  7. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

    Science.gov (United States)

    Yofe, Ido; Schuldiner, Maya

    2014-02-01

    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

  8. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  9. Polyacid macromolecule primers

    Science.gov (United States)

    Sugama, Toshifumi.

    1989-12-26

    Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

  10. Rapid identification of 11 human intestinal Lactobacillus species by multiplex PCR assays using group- and species-specific primers derived from the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA.

    Science.gov (United States)

    Song, Y; Kato, N; Liu, C; Matsumiya, Y; Kato, H; Watanabe, K

    2000-06-15

    Rapid and reliable two-step multiplex polymerase chain reaction (PCR) assays were established to identify human intestinal lactobacilli; a multiplex PCR was used for grouping of lactobacilli with a mixture of group-specific primers followed by four multiplex PCR assays with four sorts of species-specific primer mixtures for identification at the species level. Primers used were designed from nucleotide sequences of the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA gene of members of the genus Lactobacillus which are commonly isolated from human stool specimens: Lactobacillus acidophilus, Lactobacillus crispatus, Lactobacillus delbrueckii (ssp. bulgaricus and ssp. lactis), Lactobacillus fermentum, Lactobacillus gasseri, Lactobacillus jensenii, Lactobacillus paracasei (ssp. paracasei and ssp. tolerans), Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus rhamnosus and Lactobacillus salivarius (ssp. salicinius and ssp. salivarius). The established two-step multiplex PCR assays were applied to the identification of 84 Lactobacillus strains isolated from human stool specimens and the PCR results were consistent with the results from the DNA-DNA hybridization assay. These results suggest that the multiplex PCR system established in this study is a simple, rapid and reliable method for the identification of common Lactobacillus isolates from human stool samples.

  11. Effects of setting creative goals of different specificity on judged creativity of the product

    OpenAIRE

    Čorko, Irena; Vranić, Andrea

    2005-01-01

    The study examined the effect of setting creative goals of different specificity on judged creativity of the product. Female psychology students (N=47) were divided in 3 groups. Experimental task was to make a collage. Groups differed in the level of specificity of the given goal. Collages were judged by 11 judges using the consensual assessment technique. Factor analysis of these judgments confirmed 2 orthogonal factors: creativity and technical goodness. Results show that setting a specific...

  12. Bioinformatic tools and guideline for PCR primer design | Abd ...

    African Journals Online (AJOL)

    Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...

  13. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    International Nuclear Information System (INIS)

    Bowman, Stephen M.

    2008-01-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  14. Ready for goal setting? Process evaluation of a patient-specific goal-setting method in physiotherapy.

    Science.gov (United States)

    Stevens, Anita; Köke, Albère; van der Weijden, Trudy; Beurskens, Anna

    2017-08-31

    Patient participation and goal setting appear to be difficult in daily physiotherapy practice, and practical methods are lacking. An existing patient-specific instrument, Patient-Specific Complaints (PSC), was therefore optimized into a new Patient Specific Goal-setting method (PSG). The aims of this study were to examine the feasibility of the PSG in daily physiotherapy practice, and to explore the potential impact of the new method. We conducted a process evaluation within a non-controlled intervention study. Community-based physiotherapists were instructed on how to work with the PSG in three group training sessions. The PSG is a six-step method embedded across the physiotherapy process, in which patients are stimulated to participate in the goal-setting process by: identifying problematic activities, prioritizing them, scoring their abilities, setting goals, planning and evaluating. Quantitative and qualitative data were collected among patients and physiotherapists by recording consultations and assessing patient files, questionnaires and written reflection reports. Data were collected from 51 physiotherapists and 218 patients, and 38 recordings and 219 patient files were analysed. The PSG steps were performed as intended, but the 'setting goals' and 'planning treatment' steps were not performed in detail. The patients and physiotherapists were positive about the method, and the physiotherapists perceived increased patient participation. They became aware of the importance of engaging patients in a dialogue, instead of focusing on gathering information. The lack of integration in the electronic patient system was a major barrier for optimal use in practice. Although the self-reported actual use of the PSG, i.e. informing and involving patients, and client-centred competences had improved, this was not completely confirmed by the objectively observed behaviour. The PSG is a feasible method and tends to have impact on increasing patient participation in the goal-setting

  15. IDENTIFIKASI DAGING BABI MENGGUNAKAN METODE PCR-RFLP GEN Cytochrome b DAN PCR PRIMER SPESIFIK GEN AMELOGENIN (Pork Identification Using PCR-RFLP of Cytochrome b Gene and Species Specific PCR of Amelogenin Gene

    Directory of Open Access Journals (Sweden)

    Yuny Erwanto

    2013-03-01

    Full Text Available A polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP and species specific PCR methods had been applied for identifying pork in mixture of meat. Pork sample in various levels (1, 3, 5 and 10% was prepared in mixture with beef, chicken and mutton. The primary CYTb1 and CYTb2 were designed in the mitochondrial cytochrome b b (cytochrome b gene and PCR successfully amplified fragments of 359 bp. To distinguish pig species existence, the amplified PCR products of mitochondrial DNA were cut by BseDI restriction enzyme. The result showed that pig mitochondrial DNA was cut into 131 and 228 bp fragments. A polymerase chain reaction (PCR method based on the nucleotide sequence variation in the amelogenin gene has been chosen for the specific identification of pork DNAs in mixture meat. The primers designed generated specific fragments of 353 and 312 bp length for pork. The specificity of the primary designed was tested on 4 animal species including pig, cattle, chicken and goat species. Analysis of experimental mixture meat demonstrated that 1% of raw pork tissues could be detected using PCR-RFLP with BseDI restriction enzyme but detection using species-specific PCR showed the cross reactivity to beef, chicken and mutton. The cytochrome b PCR-RFLP species identification assay yielded excellent results for identification of pig species. PCR-RFLP is a potentially reliable technique for detection of the existence of pork in animal food product for Halal authentication. Keywords: Pork identification, cytochrome b, amelogenin, polymerase chain reaction   ABSTRAK   Penelitian ini dilakukan untuk mengaplikasikan metode deteksi daging babi dalam campuan daging dengan sapi, kambing dan ayam melalui PCR-RFLP dan PCR dengan primer spesifik untuk babi. Level kontaminasi daging babi dibuat sebesar 1, 3, 5 dan 10% dari total daging dalam campuran. Metode PCR-RFLP menggunakan sepasang primer yaitu gen cytochrome b dari mitokondria yang

  16. Evaluating primers for profiling anaerobic ammonia oxidizing bacteria within freshwater environments.

    Directory of Open Access Journals (Sweden)

    Puntipar Sonthiphand

    Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library

  17. Algebraic Specifications, Higher-order Types and Set-theoretic Models

    DEFF Research Database (Denmark)

    Kirchner, Hélène; Mosses, Peter David

    2001-01-01

    , and power-sets. This paper presents a simple framework for algebraic specifications with higher-order types and set-theoretic models. It may be regarded as the basis for a Horn-clause approximation to the Z framework, and has the advantage of being amenable to prototyping and automated reasoning. Standard......In most algebraic  specification frameworks, the type system is restricted to sorts, subsorts, and first-order function types. This is in marked contrast to the so-called model-oriented frameworks, which provide higer-order types, interpreted set-theoretically as Cartesian products, function spaces...... set-theoretic models are considered, and conditions are given for the existence of initial reduct's of such models. Algebraic specifications for various set-theoretic concepts are considered....

  18. Deriving a Set of Privacy Specific Heuristics for the Assessment of PHRs (Personal Health Records).

    Science.gov (United States)

    Furano, Riccardo F; Kushniruk, Andre; Barnett, Jeff

    2017-01-01

    With the emergence of personal health record (PHR) platforms becoming more widely available, this research focused on the development of privacy heuristics to assess PHRs regarding privacy. Existing sets of heuristics are typically not application specific and do not address patient-centric privacy as a main concern prior to undergoing PHR procurement. A set of privacy specific heuristics were developed based on a scoping review of the literature. An internet-based commercially available, vendor specific PHR application was evaluated using the derived set of privacy specific heuristics. The proposed set of privacy specific derived heuristics is explored in detail in relation to ISO 29100. The assessment of the internet-based commercially available, vendor specific PHR application indicated numerous violations. These violations were noted within the study. It is argued that the new derived privacy heuristics should be used in addition to Nielsen's well-established set of heuristics. Privacy specific heuristics could be used to assess PHR portal system-level privacy mechanisms in the procurement process of a PHR application and may prove to be a beneficial form of assessment to prevent the selection of a PHR platform with a poor privacy specific interface design.

  19. PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.

    Science.gov (United States)

    Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong

    2015-01-01

    Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

  20. Quick spacecraft charging primer

    International Nuclear Information System (INIS)

    Larsen, Brian Arthur

    2014-01-01

    This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

  1. Nanotechnology: A Policy Primer

    Science.gov (United States)

    2013-06-24

    savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

  2. A set of tools for determining the LAT performance in specific applications

    International Nuclear Information System (INIS)

    Lott, B.; Ballet, J.; Chiang, J.; Lonjou, V.; Funk, S.

    2007-01-01

    The poster presents a set of simple tools being developed to predict GLAST's performance for specific cases, like the accumulation time needed to reach a given significance or statistical accuracy for a particular source. Different examples are given, like the generation of a full-sky sensitivity map

  3. Setting analytical performance specifications based on outcome studies - is it possible?

    NARCIS (Netherlands)

    Horvath, Andrea Rita; Bossuyt, Patrick M. M.; Sandberg, Sverre; John, Andrew St; Monaghan, Phillip J.; Verhagen-Kamerbeek, Wilma D. J.; Lennartz, Lieselotte; Cobbaert, Christa M.; Ebert, Christoph; Lord, Sarah J.

    2015-01-01

    The 1st Strategic Conference of the European Federation of Clinical Chemistry and Laboratory Medicine proposed a simplified hierarchy for setting analytical performance specifications (APS). The top two levels of the 1999 Stockholm hierarchy, i.e., evaluation of the effect of analytical performance

  4. The Los Alamos primer

    CERN Document Server

    Serber, Robert

    2018-01-01

    Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.

  5. China Energy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  6. Semantic Web Primer

    NARCIS (Netherlands)

    Antoniou, Grigoris; Harmelen, Frank van

    2004-01-01

    The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a

  7. An iterative method for selecting degenerate multiplex PCR primers.

    Science.gov (United States)

    Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong

    2007-01-01

    Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.

  8. Back to basics – the influence of DNA extraction and primer choice on phylogenetic analysis in activated sludge communities

    DEFF Research Database (Denmark)

    Albertsen, Mads; Karst, Søren Michael; Ziegler, Anja Sloth

    intensity and primer choice on the observed community using 16S rDNA amplicon sequencing. Quantitative fluorescence in situ hybridization (qFISH) was used as a DNA extraction independent method to evaluate the results. The bead beating intensity correlated with cell-wall strength and showed...... that the manufacture recommended settings were insufficient to retrieve a large part of the community. In addition, the in silico “best” primer set was found to greatly underestimate a number of important phyla when compared to qFISH results. The findings underline the need for sample specific and DNA extraction...

  9. Swine Leukocyte Antigen (SLA) class I allele typing of Danish swine herds and the identification of commonly expressed haplotypes using sequence specific low- and high resolution primers

    DEFF Research Database (Denmark)

    Pedersen, Lasse Eggers; Fink, Dorte Rosenbek; Jungersen, Gregers

    molecule is only able to bind a restricted number of peptides with specific biochemical characteristics matching important anchor positions in the peptide binding groove. Although the diversity of T cells is vast, the individual MHC make-up thus limits the range of potential T cell epitopes for any given...

  10. Development of Allele-Specific Primer PCR for a Swine TLR2 SNP and Comparison of the Frequency among Several Pig Breeds of Japan and the Czech Republic

    Czech Academy of Sciences Publication Activity Database

    Muneta, Y.; Minagawa, Y.; Kusumoto, M.; Shinkai, H.; Uenishi, H.; Šplíchal, Igor

    2012-01-01

    Roč. 74, č. 5 (2012), s. 553-559 ISSN 0916-7250 R&D Projects: GA ČR GA524/09/0365 Institutional support: RVO:61388971 Keywords : allele-specific PCR * Mycoplasma hyopneumoniae * single nucleotide polymorphism Subject RIV: EC - Immunology Impact factor: 0.876, year: 2012

  11. Highly Specific Detection of Five Exotic Quarantine Plant Viruses using RT-PCR

    Directory of Open Access Journals (Sweden)

    Hoseong Choi

    2013-03-01

    Full Text Available To detect five plant viruses (Beet black scorch virus, Beet necrotic yellow vein virus, Eggplant mottled dwarf virus, Pelargonium zonate spot virus, and Rice yellow mottle virus for quarantine purposes, we designed 15 RT-PCR primer sets. Primer design was based on the nucleotide sequence of the coat protein gene, which is highly conserved within species. All but one primer set successfully amplified the targets, and gradient PCRs indicated that the optimal temperature for the 14 useful primer sets was 51.9°C. Some primer sets worked well regardless of annealing temperature while others required a very specific annealing temperature. A primer specificity test using plant total RNAs and cDNAs of other plant virus-infected samples demonstrated that the designed primer sets were highly specific and generated reproducible results. The newly developed RT-PCR primer sets would be useful for quarantine inspections aimed at preventing the entry of exotic plant viruses into Korea.

  12. Defense Primer: DOD Contractors

    Science.gov (United States)

    2017-02-10

    functions, from intelligence analysis or software development to landscaping or food service. Why does DOD use individual contractors? Going back to...that provide professional services, from research to management support. The bulk of contractors—more than 70%—provide products, and these include...10 U.S.C. Part IV: Service, Supply, and Procurement. CRS Products CRS In Focus IF10548, Defense Primer: U.S. Defense Industrial Base, by Daniel

  13. Coal Bed Methane Primer

    Energy Technology Data Exchange (ETDEWEB)

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  14. A Domain-Specific Languane for Regular Sets of Strings and Trees

    DEFF Research Database (Denmark)

    Schwartzbach, Michael Ignatieff; Klarlund, Nils

    1999-01-01

    We propose a new high-level progr amming notation, called FIDO, that we have designed to concisely express regular sets of strings or trees. In particular, it can be viewed as a domain-specific language for the expression of finite-state automata on large alphabets (of sometimes astronomical size......, called the Monadic Second-order Logic (M2L) on trees. FIDO is translated first into pure M2L via suitable encodings, and finally into finite-state automata through the MONA tool....

  15. A Domain-Specific Terminology for Retinopathy of Prematurity and Its Applications in Clinical Settings.

    Science.gov (United States)

    Zhang, Yinsheng; Zhang, Guoming

    2018-01-01

    A terminology (or coding system) is a formal set of controlled vocabulary in a specific domain. With a well-defined terminology, each concept in the target domain is assigned with a unique code, which can be identified and processed across different medical systems in an unambiguous way. Though there are lots of well-known biomedical terminologies, there is currently no domain-specific terminology for ROP (retinopathy of prematurity). Based on a collection of historical ROP patients' data in the electronic medical record system, we extracted the most frequent terms in the domain and organized them into a hierarchical coding system-ROP Minimal Standard Terminology, which contains 62 core concepts in 4 categories. This terminology has been successfully used to provide highly structured and semantic-rich clinical data in several ROP-related applications.

  16. Specific heat measurement set-up for quench condensed thin superconducting films.

    Science.gov (United States)

    Poran, Shachaf; Molina-Ruiz, Manel; Gérardin, Anne; Frydman, Aviad; Bourgeois, Olivier

    2014-05-01

    We present a set-up designed for the measurement of specific heat of very thin or ultra-thin quench condensed superconducting films. In an ultra-high vacuum chamber, materials of interest can be thermally evaporated directly on a silicon membrane regulated in temperature from 1.4 K to 10 K. On this membrane, a heater and a thermometer are lithographically fabricated, allowing the measurement of heat capacity of the quench condensed layers. This apparatus permits the simultaneous thermal and electrical characterization of successively deposited layers in situ without exposing the deposited materials to room temperature or atmospheric conditions, both being irreversibly harmful to the samples. This system can be used to study specific heat signatures of phase transitions through the superconductor to insulator transition of quench condensed films.

  17. A Domain-Specific Terminology for Retinopathy of Prematurity and Its Applications in Clinical Settings

    Directory of Open Access Journals (Sweden)

    Yinsheng Zhang

    2018-01-01

    Full Text Available A terminology (or coding system is a formal set of controlled vocabulary in a specific domain. With a well-defined terminology, each concept in the target domain is assigned with a unique code, which can be identified and processed across different medical systems in an unambiguous way. Though there are lots of well-known biomedical terminologies, there is currently no domain-specific terminology for ROP (retinopathy of prematurity. Based on a collection of historical ROP patients’ data in the electronic medical record system, we extracted the most frequent terms in the domain and organized them into a hierarchical coding system—ROP Minimal Standard Terminology, which contains 62 core concepts in 4 categories. This terminology has been successfully used to provide highly structured and semantic-rich clinical data in several ROP-related applications.

  18. In silico analysis of stomach lineage specific gene set expression pattern in gastric cancer

    International Nuclear Information System (INIS)

    Pandi, Narayanan Sathiya; Suganya, Sivagurunathan; Rajendran, Suriliyandi

    2013-01-01

    Highlights: •Identified stomach lineage specific gene set (SLSGS) was found to be under expressed in gastric tumors. •Elevated expression of SLSGS in gastric tumor is a molecular predictor of metabolic type gastric cancer. •In silico pathway scanning identified estrogen-α signaling is a putative regulator of SLSGS in gastric cancer. •Elevated expression of SLSGS in GC is associated with an overall increase in the survival of GC patients. -- Abstract: Stomach lineage specific gene products act as a protective barrier in the normal stomach and their expression maintains the normal physiological processes, cellular integrity and morphology of the gastric wall. However, the regulation of stomach lineage specific genes in gastric cancer (GC) is far less clear. In the present study, we sought to investigate the role and regulation of stomach lineage specific gene set (SLSGS) in GC. SLSGS was identified by comparing the mRNA expression profiles of normal stomach tissue with other organ tissue. The obtained SLSGS was found to be under expressed in gastric tumors. Functional annotation analysis revealed that the SLSGS was enriched for digestive function and gastric epithelial maintenance. Employing a single sample prediction method across GC mRNA expression profiles identified the under expression of SLSGS in proliferative type and invasive type gastric tumors compared to the metabolic type gastric tumors. Integrative pathway activation prediction analysis revealed a close association between estrogen-α signaling and SLSGS expression pattern in GC. Elevated expression of SLSGS in GC is associated with an overall increase in the survival of GC patients. In conclusion, our results highlight that estrogen mediated regulation of SLSGS in gastric tumor is a molecular predictor of metabolic type GC and prognostic factor in GC

  19. In silico analysis of stomach lineage specific gene set expression pattern in gastric cancer

    Energy Technology Data Exchange (ETDEWEB)

    Pandi, Narayanan Sathiya, E-mail: sathiyapandi@gmail.com; Suganya, Sivagurunathan; Rajendran, Suriliyandi

    2013-10-04

    Highlights: •Identified stomach lineage specific gene set (SLSGS) was found to be under expressed in gastric tumors. •Elevated expression of SLSGS in gastric tumor is a molecular predictor of metabolic type gastric cancer. •In silico pathway scanning identified estrogen-α signaling is a putative regulator of SLSGS in gastric cancer. •Elevated expression of SLSGS in GC is associated with an overall increase in the survival of GC patients. -- Abstract: Stomach lineage specific gene products act as a protective barrier in the normal stomach and their expression maintains the normal physiological processes, cellular integrity and morphology of the gastric wall. However, the regulation of stomach lineage specific genes in gastric cancer (GC) is far less clear. In the present study, we sought to investigate the role and regulation of stomach lineage specific gene set (SLSGS) in GC. SLSGS was identified by comparing the mRNA expression profiles of normal stomach tissue with other organ tissue. The obtained SLSGS was found to be under expressed in gastric tumors. Functional annotation analysis revealed that the SLSGS was enriched for digestive function and gastric epithelial maintenance. Employing a single sample prediction method across GC mRNA expression profiles identified the under expression of SLSGS in proliferative type and invasive type gastric tumors compared to the metabolic type gastric tumors. Integrative pathway activation prediction analysis revealed a close association between estrogen-α signaling and SLSGS expression pattern in GC. Elevated expression of SLSGS in GC is associated with an overall increase in the survival of GC patients. In conclusion, our results highlight that estrogen mediated regulation of SLSGS in gastric tumor is a molecular predictor of metabolic type GC and prognostic factor in GC.

  20. Chromatin accessibility data sets show bias due to sequence specificity of the DNase I enzyme.

    Directory of Open Access Journals (Sweden)

    Hashem Koohy

    Full Text Available DNase I is an enzyme which cuts duplex DNA at a rate that depends strongly upon its chromatin environment. In combination with high-throughput sequencing (HTS technology, it can be used to infer genome-wide landscapes of open chromatin regions. Using this technology, systematic identification of hundreds of thousands of DNase I hypersensitive sites (DHS per cell type has been possible, and this in turn has helped to precisely delineate genomic regulatory compartments. However, to date there has been relatively little investigation into possible biases affecting this data.We report a significant degree of sequence preference spanning sites cut by DNase I in a number of published data sets. The two major protocols in current use each show a different pattern, but for a given protocol the pattern of sequence specificity seems to be quite consistent. The patterns are substantially different from biases seen in other types of HTS data sets, and in some cases the most constrained position lies outside the sequenced fragment, implying that this constraint must relate to the digestion process rather than events occurring during library preparation or sequencing.DNase I is a sequence-specific enzyme, with a specificity that may depend on experimental conditions. This sequence specificity is not taken into account by existing pipelines for identifying open chromatin regions. Care must be taken when interpreting DNase I results, especially when looking at the precise locations of the reads. Future studies may be able to improve the sensitivity and precision of chromatin state measurement by compensating for sequence bias.

  1. Forest Interpreter's Primer on Fire Management.

    Science.gov (United States)

    Zelker, Thomas M.

    Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

  2. Swine Leukocyte Antigen (SLA) class I allele typing of Danish swine herds and identification of commonly occurring haplotypes using sequence specific low and high resolution primers

    DEFF Research Database (Denmark)

    Pedersen, Lasse Eggers; Jungersen, Gregers; Sørensen, Maria Rathmann

    2014-01-01

    of such peptide-MHC complexes (pMHC) naïve T cells can become activated and respond to a given pathogen leading to its elimination and the generation of memory cells. Hence SLA plays a crucial role in maintaining overall adaptive immunologic resistance to pathogens. Knowing which SLA alleles that are commonly...... occurring can be of great importance in regard to future vaccine development and the establishment of immune protection in swine through broad coverage, highly specific, subunit based vaccination against viruses such as swine influenza, porcine reproductive and respiratory syndrome virus, vesicular...

  3. Design Approach and Implementation of Application Specific Instruction Set Processor for SHA-3 BLAKE Algorithm

    Science.gov (United States)

    Zhang, Yuli; Han, Jun; Weng, Xinqian; He, Zhongzhu; Zeng, Xiaoyang

    This paper presents an Application Specific Instruction-set Processor (ASIP) for the SHA-3 BLAKE algorithm family by instruction set extensions (ISE) from an RISC (reduced instruction set computer) processor. With a design space exploration for this ASIP to increase the performance and reduce the area cost, we accomplish an efficient hardware and software implementation of BLAKE algorithm. The special instructions and their well-matched hardware function unit improve the calculation of the key section of the algorithm, namely G-functions. Also, relaxing the time constraint of the special function unit can decrease its hardware cost, while keeping the high data throughput of the processor. Evaluation results reveal the ASIP achieves 335Mbps and 176Mbps for BLAKE-256 and BLAKE-512. The extra area cost is only 8.06k equivalent gates. The proposed ASIP outperforms several software approaches on various platforms in cycle per byte. In fact, both high throughput and low hardware cost achieved by this programmable processor are comparable to that of ASIC implementations.

  4. Comparison of allele-specific PCR, created restriction-site PCR, and PCR with primer-introduced restriction analysis methods used for screening complex vertebral malformation carriers in Holstein cattle

    Science.gov (United States)

    Altınel, Ahmet

    2017-01-01

    Complex vertebral malformation (CVM) is an inherited, autosomal recessive disorder of Holstein cattle. The aim of this study was to compare sensitivity, specificity, positive and negative predictive values, accuracy, and rapidity of allele-specific polymerase chain reaction (AS-PCR), created restriction-site PCR (CRS-PCR), and PCR with primer-introduced restriction analysis (PCR-PIRA), three methods used in identification of CVM carriers in a Holstein cattle population. In order to screen for the G>T mutation in the solute carrier family 35 member A3 (SLC35A3) gene, DNA sequencing as the gold standard method was used. The prevalence of carriers and the mutant allele frequency were 3.2% and 0.016, respectively, among Holstein cattle in the Thrace region of Turkey. Among the three methods, the fastest but least accurate was AS-PCR. Although the rapidity of CRS-PCR and PCR-PIRA were nearly equal, the accuracy of PCR-PIRA was higher than that of CRS-PCR. Therefore, among the three methods, PCR-PIRA appears to be the most efficacious for screening of mutant alleles when identifying CVM carriers in a Holstein cattle population. PMID:28927256

  5. In silico analysis of stomach lineage specific gene set expression pattern in gastric cancer.

    Science.gov (United States)

    Pandi, Narayanan Sathiya; Suganya, Sivagurunathan; Rajendran, Suriliyandi

    2013-10-04

    Stomach lineage specific gene products act as a protective barrier in the normal stomach and their expression maintains the normal physiological processes, cellular integrity and morphology of the gastric wall. However, the regulation of stomach lineage specific genes in gastric cancer (GC) is far less clear. In the present study, we sought to investigate the role and regulation of stomach lineage specific gene set (SLSGS) in GC. SLSGS was identified by comparing the mRNA expression profiles of normal stomach tissue with other organ tissue. The obtained SLSGS was found to be under expressed in gastric tumors. Functional annotation analysis revealed that the SLSGS was enriched for digestive function and gastric epithelial maintenance. Employing a single sample prediction method across GC mRNA expression profiles identified the under expression of SLSGS in proliferative type and invasive type gastric tumors compared to the metabolic type gastric tumors. Integrative pathway activation prediction analysis revealed a close association between estrogen-α signaling and SLSGS expression pattern in GC. Elevated expression of SLSGS in GC is associated with an overall increase in the survival of GC patients. In conclusion, our results highlight that estrogen mediated regulation of SLSGS in gastric tumor is a molecular predictor of metabolic type GC and prognostic factor in GC. Copyright © 2013 Elsevier Inc. All rights reserved.

  6. Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

    Directory of Open Access Journals (Sweden)

    Francesco Dal Grande

    2013-03-01

    Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

  7. Validation of Fall Risk Assessment Specific to the Inpatient Rehabilitation Facility Setting.

    Science.gov (United States)

    Thomas, Dan; Pavic, Andrea; Bisaccia, Erin; Grotts, Jonathan

    2016-09-01

    To evaluate and compare the Morse Fall Scale (MFS) and the Casa Colina Fall Risk Assessment Scale (CCFRA) for identification of patients at risk for falling in an acute inpatient rehabilitation facility. The primary objective of this study was to perform a retrospective validation study of the CCFRAS, specifically for use in the inpatient rehabilitation facility (IRF) setting. Retrospective validation study. The study was approved under expedited review by the local Institutional Review Board. Data were collected on all patients admitted to Cottage Rehabiliation Hospital (CRH), a 38-bed acute inpatient rehabilitation hospital, from March 2012 to August 2013. Patients were excluded from the study if they had a length of stay less than 3 days or age less than 18. The area under the receiver operating characteristic curve (AUC) and the diagnostic odds ratio were used to examine the differences between the MFS and CCFRAS. AUC between fall scales was compared using the DeLong Test. There were 931 patients included in the study with 62 (6.7%) patient falls. The average age of the population was 68.8 with 503 males (51.2%). The AUC was 0.595 and 0.713 for the MFS and CCFRAS, respectively (0.006). The diagnostic odds ratio of the MFS was 2.0 and 3.6 for the CCFRAS using the recommended cutoffs of 45 for the MFS and 80 for the CCFRAS. The CCFRAS appears to be a better tool in detecting fallers vs. nonfallers specific to the IRF setting. The assessment and identification of patients at high risk for falling is important to implement specific precautions and care for these patients to reduce their risk of falling. The CCFRAS is more clinically relevant in identifying patients at high risk for falling in the IRF setting compared to other fall risk assessments. Implementation of this scale may lead to a reduction in fall rate and injuries from falls as it more appropriately identifies patients at high risk for falling. © 2015 Association of Rehabilitation Nurses.

  8. Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

    Science.gov (United States)

    Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

    2002-01-01

    AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

  9. A Quantum Groups Primer

    Science.gov (United States)

    Majid, Shahn

    2002-05-01

    Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

  10. The R primer

    CERN Document Server

    Ekstrom, Claus Thorn

    2011-01-01

    Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

  11. Primer on Health Surveys

    Directory of Open Access Journals (Sweden)

    David L Nordstrom

    2012-06-01

    Full Text Available The aim of this paper is to introduce novice researchers to surveys as a method of data collection. It starts with the definition of a survey, its major purposes and types as well as changes in the goals surveys have helped to achieve over time. Advantages and disadvantages of surveys over population censuses and medical examinations are discussed. Approaches to questionnaire construction are introduced along with properties that questionnaires are evaluated for. Modes of administration, sample size issues, and data analysis approaches are also introduced. The primer is illustrated with examples of surveys conducted in different countries with various public health purposes.

  12. Math primer for engineers

    CERN Document Server

    Cryer, CW

    2014-01-01

    Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

  13. Fast Setting Silk Fibroin Bioink for Bioprinting of Patient-Specific Memory-Shape Implants.

    Science.gov (United States)

    Costa, João B; Silva-Correia, Joana; Oliveira, Joaquim M; Reis, Rui L

    2017-11-01

    The pursuit for the "perfect" biomimetic and personalized implant for musculoskeletal tissue regeneration remains a big challenge. 3D printing technology that makes use of a novel and promising biomaterials can be part of the solution. In this study, a fast setting enzymatic-crosslinked silk fibroin (SF) bioink for 3D bioprinting is developed. Their properties are fine-tuned and different structures with good resolution, reproducibility, and reliability can be fabricated. Many potential applications exist for the SF bioinks including 3D bioprinted scaffolds and patient-specific implants exhibiting unique characteristics such as good mechanical properties, memory-shape feature, suitable degradation, and tunable pore architecture and morphology. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. A Plasma Diagnostic Set for the Study of a Variable Specific Impulse Magnetoplasma Rocket

    Science.gov (United States)

    Squire, J. P.; Chang-Diaz, F. R.; Bengtson Bussell, R., Jr.; Jacobson, V. T.; Wootton, A. J.; Bering, E. A.; Jack, T.; Rabeau, A.

    1997-11-01

    The Advanced Space Propulsion Laboratory (ASPL) is developing a Variable Specific Impulse Magnetoplasma Rocket (VASIMR) using an RF heated magnetic mirror operated asymmetrically. We will describe the initial set of plasma diagnostics and data acquisition system being developed and installed on the VASIMR experiment. A U.T. Austin team is installing two fast reciprocating probes: a quadruple Langmuir and a Mach probe. These measure electron density and temperature profiles, electrostatic plasma fluctuations, and plasma flow profiles. The University of Houston is developing an array of 20 highly directional Retarding Potential Analyzers (RPA) for measuring ion energy distribution function profiles in the rocket plume, giving a measurement of total thrust. We have also developed a CAMAC based data acquisition system using LabView running on a Power Macintosh communicating through a 2 MB/s serial highway. We will present data from initial plasma operations and discuss future diagnostic development.

  15. The Efficacy of Goal Setting in Cardiac Rehabilitation-a Gender-Specific Randomized Controlled Trial.

    Science.gov (United States)

    Stamm-Balderjahn, Sabine; Brünger, Martin; Michel, Anne; Bongarth, Christa; Spyra, Karla

    2016-08-08

    Patients with coronary heart disease undergo cardiac rehabilitation in order to reduce their cardiovascular risk factors. Often, however, the benefit of rehabilitation is lost over time. It is unclear whether this happens in the same way to men and women. We studied whether the setting of gender-specific behavior goals with an agreement between the doctor and the patient at the end of rehabilitation can prolong its positive effects. This study was performed with a mixed-method design. It consisted of qualitative interviews and group discussions with patients, doctors and other treating personnel, and researchers, as well as a quantitative, randomized, controlled intervention trial in which data were acquired at four time points (the beginning and end of rehabilitation and then 6 and 12 months later). 545 patients, 262 of them women (48.1%), were included. The patients were assigned to a goal checking group (n = 132), a goal setting group (n = 143), and a control group (n = 270). The primary endpoints were health-related behavior (exercise, diet, tobacco consumption), subjective state of health, and medication adherence. The secondary endpoints included physiological protection and risk factors such as blood pressure, cholesterol (HDL, LDL, and total), blood sugar, HbA1c, and body-mass index. The intervention had no demonstrable effect on the primary or secondary endpoints. The percentage of smokers declined to a similar extent in all groups from the beginning of rehabilitation to 12 months after its end (overall figures: 12.4% to 8.6%, p exercise behavior, diet, and subjective state of health also improved over the entire course of the study. Women had a healthier diet than men. Subgroup analyses indicated a possible effect of the intervention on exercise behavior in women who were employed and in men who were not (pgoal setting was not demonstrated. Therefore, no indication for its routine provision can be derived from the study results.

  16. El primer virreinato americano

    Directory of Open Access Journals (Sweden)

    Cassá, Roberto

    2006-12-01

    Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

    El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

  17. Validation and evaluation of common large-area display set (CLADS) performance specification

    Science.gov (United States)

    Hermann, David J.; Gorenflo, Ronald L.

    1998-09-01

    Battelle is under contract with Warner Robins Air Logistics Center to design a Common Large Area Display Set (CLADS) for use in multiple Command, Control, Communications, Computers, and Intelligence (C4I) applications that currently use 19- inch Cathode Ray Tubes (CRTs). Battelle engineers have built and fully tested pre-production prototypes of the CLADS design for AWACS, and are completing pre-production prototype displays for three other platforms simultaneously. With the CLADS design, any display technology that can be packaged to meet the form, fit, and function requirements defined by the Common Large Area Display Head Assembly (CLADHA) performance specification is a candidate for CLADS applications. This technology independent feature reduced the risk of CLADS development, permits life long technology insertion upgrades without unnecessary redesign, and addresses many of the obsolescence problems associated with COTS technology-based acquisition. Performance and environmental testing were performed on the AWACS CLADS and continues on other platforms as a part of the performance specification validation process. A simulator assessment and flight assessment were successfully completed for the AWACS CLADS, and lessons learned from these assessments are being incorporated into the performance specifications. Draft CLADS specifications were released to potential display integrators and manufacturers for review in 1997, and the final version of the performance specifications are scheduled to be released to display integrators and manufacturers in May, 1998. Initial USAF applications include replacements for the E-3 AWACS color monitor assembly, E-8 Joint STARS graphics display unit, and ABCCC airborne color display. Initial U.S. Navy applications include the E-2C ACIS display. For these applications, reliability and maintainability are key objectives. The common design will reduce the cost of operation and maintenance by an estimated 3.3M per year on E-3 AWACS

  18. A primer on water

    Science.gov (United States)

    Leopold, Luna Bergere; Langbein, Walter Basil

    1960-01-01

    When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

  19. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    Science.gov (United States)

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

  20. The contribution of goal specificity to goal achievement in collaborative goal setting for the management of asthma.

    Science.gov (United States)

    Smith, Lorraine; Alles, Chehani; Lemay, Kate; Reddel, Helen; Saini, Bandana; Bosnic-Anticevich, Sinthia; Emmerton, Lynne; Stewart, Kay; Burton, Debbie; Krass, Ines; Armour, Carol

    2013-01-01

    Goal setting was investigated as part of an implementation trial of an asthma management service (PAMS) conducted in 96 Australian community pharmacies. Patients and pharmacists identified asthma-related issues of concern to the patient and collaboratively set goals to address these. Although goal setting is commonly integrated into disease state management interventions, the nature of goals, and their contribution to goal attainment and health outcomes are not well understood. To identify and describe: 1) goals set collaboratively between adult patients with asthma and their pharmacist, 2) goal specificity and goal achievement, and 3) describe the relationships between specificity, achievement, asthma control and asthma-related quality of life. Measures of goal specificity, and goal achievement were developed and applied to patient data records. Goals set were thematically analyzed into goal domains. Proportions of goals set, goals achieved and their specificity were calculated. Correlational and regression analyses were undertaken to determine the relationships between goal specificity, goal achievement, asthma control and asthma-related quality of life. Data were drawn from 498 patient records. Findings showed that patients set a wide range and number of asthma-related goals (N = 1787) and the majority (93%) were either achieved or being working toward by the end of the study. Goal achievement was positively associated with specific and moderately specific goals, but not non-specific goals. However, on closer inspection, an inconsistent pattern of relationships emerged as a function of goal domain. Findings also showed that goal setting was associated with end-of-study asthma control but not to asthma-related quality of life. Pharmacists can help patients to set achievable and specific asthma management goals, and these have the potential to directly impact health outcomes such as asthma control. Goal specificity appears to be an important feature in the

  1. Promotion primer. Foerderfibel

    Energy Technology Data Exchange (ETDEWEB)

    1981-01-01

    This revised edition of the promotion primer is to serve as a topical orientation aid for industrial firms, unions, boards and other bodies interested where the actions of governmental R and D and innovation policy are compiled and clearly arranged. It is important for the success of governmental aids that the institutions concerned are informed about all possibilities of the promotion, financing and advisory programme. Beyond the presentation of the research promotion sectors, the fiscal measures and the contractual as well as the joint research this revised edition focussess on the fields of consultative services for innovation and information. For many firms the access to qualified information and guidance is of particular importance. That is why this brochure points out the ways towards governmental research promotion. The BMFT has provided a remarkable contribution to research promotion by establishing information and consultative services for trade and industry.

  2. Metabolomics: A Primer.

    Science.gov (United States)

    Liu, Xiaojing; Locasale, Jason W

    2017-04-01

    Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. A Brief Taxometrics Primer

    Science.gov (United States)

    Beauchaine, Theodore P.

    2009-01-01

    Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222

  4. Rust transformation/rust compatible primers

    Science.gov (United States)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  5. Estimates of abundance and diversity of Shewanella genus in natural and engineered aqueous environments with newly designed primers.

    Science.gov (United States)

    Li, Bing-Bing; Cheng, Yuan-Yuan; Fan, Yang-Yang; Liu, Dong-Feng; Fang, Cai-Yun; Wu, Chao; Li, Wen-Wei; Yang, Zong-Chuang; Yu, Han-Qing

    2018-05-12

    Shewanella species have a diverse respiratory ability and wide distribution in environments and play an important role in bioremediation and the biogeochemical cycles of elements. Primers with more accuracy and broader coverage are required with consideration of the increasing number of Shewanella species and evaluation of their roles in various environments. In this work, a new primer set of 640F/815R was developed to quantify the abundance of Shewanella species in natural and engineered environments. In silico tools for primer evaluation, quantitative polymerase chain reaction (qPCR) and clone library results showed that 640F/815R had a higher specificity and coverage than the previous primers in quantitative analysis of Shewanella. Another newly developed primer pair of 211F/815cR was also adopted to analyze the Shewanella diversity and demonstrated to be the best candidate in terms of specificity and coverage. We detected more Shewanella-related species in freshwater environments and found them to be substantially different from those in marine environments. Abundance and diversity of Shewanella species in wastewater treatment plants were largely affected by the process and operating conditions. Overall, this study suggests that investigations of abundance and diversity of Shewanella in various environments are of great importance to evaluate their ecophysiology and potential ecological roles. Copyright © 2018 Elsevier B.V. All rights reserved.

  6. A novel CpG island set identifies tissue-specific methylation at developmental gene loci.

    Directory of Open Access Journals (Sweden)

    Robert Illingworth

    2008-01-01

    Full Text Available CpG islands (CGIs are dense clusters of CpG sequences that punctuate the CpG-deficient human genome and associate with many gene promoters. As CGIs also differ from bulk chromosomal DNA by their frequent lack of cytosine methylation, we devised a CGI enrichment method based on nonmethylated CpG affinity chromatography. The resulting library was sequenced to define a novel human blood CGI set that includes many that are not detected by current algorithms. Approximately half of CGIs were associated with annotated gene transcription start sites, the remainder being intra- or intergenic. Using an array representing over 17,000 CGIs, we established that 6%-8% of CGIs are methylated in genomic DNA of human blood, brain, muscle, and spleen. Inter- and intragenic CGIs are preferentially susceptible to methylation. CGIs showing tissue-specific methylation were overrepresented at numerous genetic loci that are essential for development, including HOX and PAX family members. The findings enable a comprehensive analysis of the roles played by CGI methylation in normal and diseased human tissues.

  7. Determination of size-specific exposure settings in dental cone-beam CT

    International Nuclear Information System (INIS)

    Pauwels, Ruben; Jacobs, Reinhilde; Bogaerts, Ria; Bosmans, Hilde; Panmekiate, Soontra

    2017-01-01

    To estimate the possible reduction of tube output as a function of head size in dental cone-beam computed tomography (CBCT). A 16 cm PMMA phantom, containing a central and six peripheral columns filled with PMMA, was used to represent an average adult male head. The phantom was scanned using CBCT, with 0-6 peripheral columns having been removed in order to simulate varying head sizes. For five kV settings (70-90 kV), the mAs required to reach a predetermined image noise level was determined, and corresponding radiation doses were derived. Results were expressed as a function of head size, age, and gender, based on growth reference charts. The use of 90 kV consistently resulted in the largest relative dose reduction. A potential mAs reduction ranging from 7 % to 50 % was seen for the different simulated head sizes, showing an exponential relation between head size and mAs. An optimized exposure protocol based on head circumference or age/gender is proposed. A considerable dose reduction, through reduction of the mAs rather than the kV, is possible for small-sized patients in CBCT, including children and females. Size-specific exposure protocols should be clinically implemented. (orig.)

  8. Determination of size-specific exposure settings in dental cone-beam CT

    Energy Technology Data Exchange (ETDEWEB)

    Pauwels, Ruben [Chulalongkorn University, Department of Radiology, Faculty of Dentistry, Patumwan, Bangkok (Thailand); University of Leuven, OMFS-IMPATH Research Group, Department of Imaging and Pathology, Biomedical Sciences Group, Leuven (Belgium); Jacobs, Reinhilde [University of Leuven, OMFS-IMPATH Research Group, Department of Imaging and Pathology, Biomedical Sciences Group, Leuven (Belgium); Bogaerts, Ria [University of Leuven, Laboratory of Experimental Radiotherapy, Department of Oncology, Biomedical Sciences Group, Leuven (Belgium); Bosmans, Hilde [University of Leuven, Medical Physics and Quality Assessment, Department of Imaging and Pathology, Biomedical Sciences Group, Leuven (Belgium); Panmekiate, Soontra [Chulalongkorn University, Department of Radiology, Faculty of Dentistry, Patumwan, Bangkok (Thailand)

    2017-01-15

    To estimate the possible reduction of tube output as a function of head size in dental cone-beam computed tomography (CBCT). A 16 cm PMMA phantom, containing a central and six peripheral columns filled with PMMA, was used to represent an average adult male head. The phantom was scanned using CBCT, with 0-6 peripheral columns having been removed in order to simulate varying head sizes. For five kV settings (70-90 kV), the mAs required to reach a predetermined image noise level was determined, and corresponding radiation doses were derived. Results were expressed as a function of head size, age, and gender, based on growth reference charts. The use of 90 kV consistently resulted in the largest relative dose reduction. A potential mAs reduction ranging from 7 % to 50 % was seen for the different simulated head sizes, showing an exponential relation between head size and mAs. An optimized exposure protocol based on head circumference or age/gender is proposed. A considerable dose reduction, through reduction of the mAs rather than the kV, is possible for small-sized patients in CBCT, including children and females. Size-specific exposure protocols should be clinically implemented. (orig.)

  9. Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae

    Directory of Open Access Journals (Sweden)

    Warren B. Chatwin

    2014-10-01

    Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.

  10. Validity of a population-specific BMR predictive equation for adults from an urban tropical setting.

    Science.gov (United States)

    Wahrlich, Vivian; Teixeira, Tatiana Miliante; Anjos, Luiz Antonio Dos

    2018-02-01

    Basal metabolic rate (BMR) is an important physiologic measure in nutrition research. In many instances it is not measured but estimated by predictive equations. The purpose of this study was to compare measured BMR (BMRm) with estimated BMR (BMRe) obtained by different equations. A convenient sample of 148 (89 women) 20-60 year-old subjects from the metropolitan area of Rio de Janeiro, Brazil participated in the study. BMRm values were measured by an indirect calorimeter and predicted by different equations (Schofield, Henry and Rees, Mifflin-St. Jeor and Anjos. All subjects had their body composition and anthropometric variables also measured. Accuracy of the estimations was established by the percentage of BMRe falling within ±10% of BMRm and bias when the 95% CI of the difference of BMRe and BMRm means did not include zero. Mean BMRm values were 4833.5 (SD 583.3) and 6278.8 (SD 724.0) kJ*day -1 for women and men, respectively. BMRe values were both biased and inaccurate except for values predicted by the Anjos equation. BMR overestimation was approximately 20% for the Schofield equation which was higher comparatively to the Henry and Rees (14.5% and 9.6% for women and men, respectively) and the Mifflin-St. Jeor (approximately 14.0%) equations. BMR estimated by the Anjos equation was unbiased (95% CI = -78.1; 96.3 kJ day -1 for women and -282.6; 30.7 kJ*day -1 for men). Population-specific BMR predictive equations yield unbiased and accurate BMR values in adults from an urban tropical setting. Copyright © 2016 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.

  11. Development of a multiplex polymerase chain reaction-sequence-specific primer method for NKG2D and NKG2F single-nucleotide polymorphism typing using isothermal multiple displacement amplification products.

    Science.gov (United States)

    Kaewmanee, M; Phoksawat, W; Romphruk, A; Romphruk, A V; Jumnainsong, A; Leelayuwat, C

    2013-06-01

    Natural killer group 2 member D (NKG2D) on immune effector cells recognizes multiple stress-inducible ligands. NKG2D single-nucleotide polymorphism (SNP) haplotypes were related to the levels of cytotoxic activity of peripheral blood mononuclear cells. Indeed, these polymorphisms were also located in NKG2F. Isothermal multiple displacement amplification (IMDA) is used for whole genome amplification (WGA) that can amplify very small genomic DNA templates into microgram with whole genome coverage. This is particularly useful in the cases of limited amount of valuable DNA samples requiring multi-locus genotyping. In this study, we evaluated the quality and applicability of IMDA to genetic studies in terms of sensitivity, efficiency of IMDA re-amplification and stability of IMDA products. The smallest amount of DNA to be effectively amplified by IMDA was 200 pg yielding final DNA of approximately 16 µg within 1.5 h. IMDA could be re-amplified only once (second round of amplification), and could be kept for 5 months at 4°C and more than a year at -20°C without loosing genome coverage. The amplified products were used successfully to setup a multiplex polymerase chain reaction-sequence-specific primer for SNP typing of the NKG2D/F genes. The NKG2D/F multiplex polymerase chain reaction (PCR) contained six PCR mixtures for detecting 10 selected SNPs, including 8 NKG2D/F SNP haplotypes and 2 additional NKG2D coding SNPs. This typing procedure will be applicable in both clinical and research laboratories. Thus, our data provide useful information and limitations for utilization of genome-wide amplification using IMDA and its application for multiplex NKG2D/F typing. © 2013 John Wiley & Sons Ltd.

  12. Radiation protection primer

    International Nuclear Information System (INIS)

    Aigner, R.; Melzer, E.; Seissler, H.

    1986-01-01

    This 'radiation protection primer' does not pretend to give absolute, final answers to the many questions that have been arising after the Chernobyl accident. What it is intended to supply, as a schematic overview of problems resulting from nuclear accidents, and a likewise systematic outline of possible solutions and sensible reactions to such an event. The book takes up questions such as: What has happened to the soil. Will future harvests be 'clean' again. What does radioactivity to our drinking water and other waters. What are the effects of a radioactive fallout on food. What may we eat or drink. What happens to the human body after intake of radioactive air, or - even only slightly - contaminated food or water. What can we do to protect our health, and the health of our children. Is there anything else we can do in order to avoid such a disaster in future, except from shutting-off all reactors. The book itself presents some answers and advice, along with a list of terms and explanations, and addresses to apply to for further advice and information. (orig./HP) [de

  13. Typing of multiple single-nucleotide polymorphisms using ribonuclease cleavage of DNA/RNA chimeric single-base extension primers and detection by MALDI-TOF mass spectrometry

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus

    2005-01-01

    A novel single-base extension (SBE) assay using cleavable and noncleavable SBE primers in the same reaction mix is described. The cleavable SBE primers consisted of deoxyribonucleotides and one ribonucleotide (hereafter denoted chimeric primers), whereas the noncleavable SBE primers consisted....... A ribonuclease mix was developed to specifically cleave the chimeric primers, irrespective of the base of the ribonucleotide, whereas standard primers without a ribonucleotide were unaffected by the ribonuclease treatment. The SBE products were analyzed in linear mode using a matrix-assisted laser desorption...... containing 9 chimeric primers and 8 standard primers....

  14. HIV-related stigma and psychological distress: the harmful effects of specific stigma manifestations in various social settings.

    Science.gov (United States)

    Stutterheim, Sarah E; Pryor, John B; Bos, Arjan E R; Hoogendijk, Robert; Muris, Peter; Schaalma, Herman P

    2009-11-13

    Recent research has shown that experiences of stigmatization have an adverse impact on the psychological well being of people living with HIV/AIDS (PLWHA). Most studies investigating this relationship employ an aggregate measure of stigma. Although this approach provides useful information about the psychological implications of HIV-related stigma in general, it neglects to acknowledge the possibility that some manifestations in specific settings may be psychologically more detrimental than others. The present study examines which specific stigma experiences are most strongly related to psychological distress across a number of social settings. A cross-sectional survey was administered to 667 PLWHA in the Netherlands. We examined participants' experiences of 11 manifestations of HIV-related stigma in six social settings. Linear regression analyses were conducted to determine which setting-specific manifestations best predict psychological distress after controlling for marital status, education and health status. Three manifestations in family settings, namely receiving advice to conceal one's status, being avoided and being treated with exaggerated kindness, and one manifestation in healthcare settings, namely awkward social interaction, best predicted psychological distress in PLWHA. Manifestations of HIV-related stigma vary according to setting. Certain manifestations in specific social settings impact the psychological well being of PLWHA more than others. In this study, certain experiences of stigmatization with PLWHA's families and in healthcare settings were more strongly related to psychological distress than experiences occurring in other social settings. These findings suggest that stigma reduction interventions focusing on these influential settings may benefit the psychological well being of PLWHA.

  15. New basis set for the prediction of the specific rotation in flexible biological molecules

    DEFF Research Database (Denmark)

    Baranowska-Łaczkowska, Angelika; Z. Łaczkowski, Krzysztof Z. Łaczkowski; Henriksen, Christian

    2016-01-01

    are compared to those obtained with the (d-)aug-cc-pVXZ (X = D, T and Q) basis sets of Dunning et al. The ORP values are in good overall agreement with the aug-cc-pVTZ results making the ORP a good basis set for routine TD-DFT optical rotation calculations of conformationally flexible molecules. The results...

  16. An Analysis of Training Focused on Improving SMART Goal Setting for Specific Employee Groups

    Science.gov (United States)

    Worden, Jeannie M.

    2014-01-01

    This quantitative study examined the proficiency of employee SMART goal setting following the intervention of employee SMART goal setting training. Current challenges in higher education substantiate the need for employees to align their performance with the mission, vision, and strategic directions of the organization. A performance management…

  17. The development of a patient-specific method for physiotherapy goal setting: a user-centered design.

    Science.gov (United States)

    Stevens, Anita; Köke, Albère; van der Weijden, Trudy; Beurskens, Anna

    2018-08-01

    To deliver client-centered care, physiotherapists need to identify the patients' individual treatment goals. However, practical tools for involving patients in goal setting are lacking. The purpose of this study was to improve the frequently used Patient-Specific Complaints instrument in Dutch physiotherapy, and to develop it into a feasible method to improve physiotherapy goal setting. An iterative user-centered design was conducted in co-creation with the physiotherapists and patients, in three phases. Their needs and preferences were identified by means of group meetings and questionnaires. The new method was tested in several field tests in physiotherapy practices. Four main objectives for improvement were formulated: clear instructions for the administration procedure, targeted use across the physiotherapy process, client-activating communication skills, and a client-centered attitude of the physiotherapist. A theoretical goal-setting framework and elements of shared decision making were integrated into the new-called, Patient-Specific Goal-setting method, together with a practical training course. The user-centered approach resulted in a goal-setting method that is fully integrated in the physiotherapy process. The new goal-setting method contributes to a more structured approach to goal setting and enables patient participation and goal-oriented physiotherapy. Before large-scale implementation, its feasibility in physiotherapy practice needs to be investigated. Implications for rehabilitation Involving patients and physiotherapists in the development and testing of a goal-setting method, increases the likelihood of its feasibility in practice. The integration of a goal-setting method into the physiotherapy process offers the opportunity to focus more fully on the patient's goals. Patients should be informed about the aim of every step of the goal-setting process in order to increase their awareness and involvement. Training physiotherapists to use a patient-specific

  18. Forced selection of a human immunodeficiency virus type 1 variant that uses a non-self tRNA primer for reverse transcription: Involvement of viral RNA sequences and the reverse transcriptase enzyme

    NARCIS (Netherlands)

    Abbink, Truus E. M.; Beerens, Nancy; Berkhout, Ben

    2004-01-01

    Human immunodeficiency virus type 1 uses the tRNA(3)(Lys) molecule as a selective primer for reverse transcription. This primer specificity is imposed by sequence complementarity between the tRNA primer and two motifs in the viral RNA genome: the primer-binding site (PBS) and the primer activation

  19. A Global Data Set of Leaf Photosynthetic Rates, Leaf N and P, and Specific Leaf Area

    Data.gov (United States)

    National Aeronautics and Space Administration — ABSTRACT: This global data set of photosynthetic rates and leaf nutrient traits was compiled from a comprehensive literature review. It includes estimates of Vcmax...

  20. A Global Data Set of Leaf Photosynthetic Rates, Leaf N and P, and Specific Leaf Area

    Data.gov (United States)

    National Aeronautics and Space Administration — This global data set of photosynthetic rates and leaf nutrient traits was compiled from a comprehensive literature review. It includes estimates of Vcmax (maximum...

  1. A new set of mulberry-specific SSR markers for application in ...

    Indian Academy of Sciences (India)

    Marian Vincent Pinto

    have used these markers to characterize a set of 216 diverse mulberry germplasm and ..... tinctness of a new cultivar or for reliable, cost-effective and quick germplasm ... Morus boninensis Koidz., to establish conservation program. Mol. Ecol.

  2. English for Specific Purposes: A Case Study in an Industrial Setting.

    Science.gov (United States)

    Alexander, Clare

    A course outline and sample materials for a course in English for garment workshop employees in New York are presented, and theoretical considerations in establishing an English for specific purposes (ESP) course are explored. Attention is directed to the needs analysis process undertaken in the garment industry. Specifically, ESP is used to mean…

  3. MUSI: an integrated system for identifying multiple specificity from very large peptide or nucleic acid data sets.

    Science.gov (United States)

    Kim, Taehyung; Tyndel, Marc S; Huang, Haiming; Sidhu, Sachdev S; Bader, Gary D; Gfeller, David; Kim, Philip M

    2012-03-01

    Peptide recognition domains and transcription factors play crucial roles in cellular signaling. They bind linear stretches of amino acids or nucleotides, respectively, with high specificity. Experimental techniques that assess the binding specificity of these domains, such as microarrays or phage display, can retrieve thousands of distinct ligands, providing detailed insight into binding specificity. In particular, the advent of next-generation sequencing has recently increased the throughput of such methods by several orders of magnitude. These advances have helped reveal the presence of distinct binding specificity classes that co-exist within a set of ligands interacting with the same target. Here, we introduce a software system called MUSI that can rapidly analyze very large data sets of binding sequences to determine the relevant binding specificity patterns. Our pipeline provides two major advances. First, it can detect previously unrecognized multiple specificity patterns in any data set. Second, it offers integrated processing of very large data sets from next-generation sequencing machines. The results are visualized as multiple sequence logos describing the different binding preferences of the protein under investigation. We demonstrate the performance of MUSI by analyzing recent phage display data for human SH3 domains as well as microarray data for mouse transcription factors.

  4. 75 FR 44589 - Health Information Technology: Initial Set of Standards, Implementation Specifications, and...

    Science.gov (United States)

    2010-07-28

    ... Part III Department of Health and Human Services 45 CFR Part 170 Health Information Technology... Secretary 45 CFR Part 170 RIN 0991-AB58 Health Information Technology: Initial Set of Standards... of the National Coordinator for Health Information Technology (ONC), Department of Health and Human...

  5. Using Content-Specific Lyrics to Familiar Tunes in a Large Lecture Setting

    Science.gov (United States)

    McLachlin, Derek T.

    2009-01-01

    Music can be used in lectures to increase student engagement and help students retain information. In this paper, I describe my use of biochemistry-related lyrics written to the tune of the theme to the television show, The Flintstones, in a large class setting (400-800 students). To determine student perceptions, the class was surveyed several…

  6. Development of a grinding-specific performance test set-up

    DEFF Research Database (Denmark)

    Olesen, C. G.; Larsen, B. H.; Andresen, E. L.

    2015-01-01

    The aim of this study was to develop a performance test set-up for America's Cup grinders. The test set-up had to mimic the on-boat grinding activity and be capable of collecting data for analysis and evaluation of grinding performance. This study included a literature-based analysis of grinding...... demands and a test protocol developed to accommodate the necessary physiological loads. This study resulted in a test protocol consisting of 10 intervals of 20 revolutions each interspersed with active resting periods of 50 s. The 20 revolutions are a combination of both forward and backward grinding...... and an exponentially rising resistance. A custom-made grinding ergometer was developed with computer-controlled resistance and capable of collecting data during the test. The data collected can be used to find measures of grinding performance such as peak power, time to complete and the decline in repeated grinding...

  7. Development of a grinding-specific performance test set-up.

    Science.gov (United States)

    Olesen, C G; Larsen, B H; Andresen, E L; de Zee, M

    2015-01-01

    The aim of this study was to develop a performance test set-up for America's Cup grinders. The test set-up had to mimic the on-boat grinding activity and be capable of collecting data for analysis and evaluation of grinding performance. This study included a literature-based analysis of grinding demands and a test protocol developed to accommodate the necessary physiological loads. This study resulted in a test protocol consisting of 10 intervals of 20 revolutions each interspersed with active resting periods of 50 s. The 20 revolutions are a combination of both forward and backward grinding and an exponentially rising resistance. A custom-made grinding ergometer was developed with computer-controlled resistance and capable of collecting data during the test. The data collected can be used to find measures of grinding performance such as peak power, time to complete and the decline in repeated grinding performance.

  8. Universal primers that amplify RNA from all three flavivirus subgroups

    Directory of Open Access Journals (Sweden)

    Barnard Ross T

    2008-01-01

    Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.

  9. Practical considerations in emergency management of bleeding in the setting of target-specific oral anticoagulants.

    Science.gov (United States)

    Miller, Michael P; Trujillo, Toby C; Nordenholz, Kristen E

    2014-04-01

    The recent arrival of the target-specific oral anticoagulants (TSOACs) offers potential advantages in the field of anticoagulation. However, there are no rapid and accurate and routinely available laboratory assays to evaluate their contribution to clinical bleeding. With the expanding clinical indications for the TSOACs, and the arrival of newer reversal agents on the market, the emergency clinician will need to be familiar with drug specifics as well as methods for anticoagulation reversal. This review offers a summary of the literature and some practical strategies for the approach to the patient taking TSOACs and the management of bleeding in these cases. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. A new marker set that identifies fetal cells in maternal circulation with high specificity

    DEFF Research Database (Denmark)

    Hatt, Lotte; Brinch, Marie; Singh, Ripudaman

    2014-01-01

    were used for testing the marker-set CD105 and CD141 for fetal cell enrichment. Fetal cell candidates were subsequently stained by a cocktail of cytokeratin antibodies, and the gender of the fetal cells was explored by fluorescence in situ hybridization (FISH) of the X and Y chromosomes. RESULTS: Fetal...... cell candidates could be detected in 91% of the samples, and in 85% of the samples, it was possible to obtain X and Y chromosomal FISH results for gender determination. The concordance between gender determined by FISH on fetal cells in maternal blood and gender found at birth reached 100% if three...

  11. PPDS compas-primer

    International Nuclear Information System (INIS)

    Alekhin, S.I.; Bazeeva, V.V.; Grudtsin, S.N.

    1987-01-01

    Catalogue of IHEP data bases on particle physics (PPDS) and short guide for unexperienced user are presented. All data bases are under common data base management system and include bibliographic and factographic ones. Binary search and set of applied programs controlling input and formatting output make using of system easy and convenient. Basic programs are developed in FORTRAN

  12. A Primer of Existentialism.

    Science.gov (United States)

    Bigelow, Gordon E.

    1961-01-01

    Although no set of principles can apply uniformly to all existentialists, certain basic characteristics of existentialism are central to both the nonreligious writers like Sartre and Camus and the theistic existentialists like Kierkegaard, Maritain, Marcel, Tillich, Berdyaev, and Buber. These characteristics are (1) an insistence that human life…

  13. Sensitivity and specificity of the Brøset Violence Checklist as predictor of violence in forensic psychiatry

    DEFF Research Database (Denmark)

    Hvidhjelm, Jacob; Sestoft, Dorte; Skovgaard, Lene Theil

    2014-01-01

    quality of care. AIMS: To evaluate the specificity and sensitivity of the Brøset Violence Checklist (BVC) as a predictor of violent incidents for Danish forensic psychiatry patients. METHOD: A total of 156 patients were assessed three times daily with the BVC for 24 months. All aggressive or violent...

  14. The Roles of Feature-Specific Task Set and Bottom-Up Salience in Attentional Capture: An ERP Study

    Science.gov (United States)

    Eimer, Martin; Kiss, Monika; Press, Clare; Sauter, Disa

    2009-01-01

    We investigated the roles of top-down task set and bottom-up stimulus salience for feature-specific attentional capture. Spatially nonpredictive cues preceded search arrays that included a color-defined target. For target-color singleton cues, behavioral spatial cueing effects were accompanied by cue-induced N2pc components, indicative of…

  15. Development of a Set of Chromosome-Specific Cytogenetic DNA Markers in Sunflower Using BAC-FISH

    Science.gov (United States)

    In diploid sunflower (2n=34), conventional karyotypes and various genetic linkage maps have been established. However, the relationship between genetic linkage groups and individual chromosomes of sunflower remains unknown. Recently, a set of linkage group-specific BAC and BIBAC clones were identifi...

  16. Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.

    Science.gov (United States)

    Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R

    2013-06-06

    Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

  17. Methods for intraoperative, sterile pose-setting of patient-specific microstereotactic frames

    Science.gov (United States)

    Vollmann, Benjamin; Müller, Samuel; Kundrat, Dennis; Ortmaier, Tobias; Kahrs, Lüder A.

    2015-03-01

    This work proposes new methods for a microstereotactic frame based on bone cement fixation. Microstereotactic frames are under investigation for minimal invasive temporal bone surgery, e.g. cochlear implantation, or for deep brain stimulation, where products are already on the market. The correct pose of the microstereotactic frame is either adjusted outside or inside the operating room and the frame is used for e.g. drill or electrode guidance. We present a patientspecific, disposable frame that allows intraoperative, sterile pose-setting. Key idea of our approach is bone cement between two plates that cures while the plates are positioned with a mechatronics system in the desired pose. This paper includes new designs of microstereotactic frames, a system for alignment and first measurements to analyze accuracy and applicable load.

  18. Blockchain: A Primer

    OpenAIRE

    Dwyer, Gerald P

    2016-01-01

    The Bitcoin blockchain is the primary innovation in Bitcoin that makes it practical. Blockchains have applications in many contexts other than cryptocurrencies. This note is an introduction to blockchains that requires no prior knowledge, including of Bitcoin. Blockchains are ledgers of transactions kept by a set of participants, none of which is accorded special status as the “correct one.” Instead, agreement is reached by a process of consensus. I show how this works for Bitcoin, discuss ap...

  19. Simple sequence repeat marker loci discovery using SSR primer.

    Science.gov (United States)

    Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

    2004-06-12

    Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

  20. The calculus primer

    CERN Document Server

    Schaaf, William L

    2011-01-01

    Comprehensive but concise, this introduction to differential and integral calculus covers all the topics usually included in a first course. The straightforward development places less emphasis on mathematical rigor, and the informal manner of presentation sets students at ease. Many carefully worked-out examples illuminate the text, in addition to numerous diagrams, problems, and answers.Bearing the needs of beginners constantly in mind, the treatment covers all the basic concepts of calculus: functions, derivatives, differentiation of algebraic and transcendental functions, partial different

  1. Primer on radiation

    International Nuclear Information System (INIS)

    Rados, B.

    1979-01-01

    Sources of anthropogenic radiation and their relative risk are discussed. Natural radiation accounts for more than half the exposure most U.S. citizens receive; the average citizen is exposed to about 100 mrem/yr. Medical and dental X-rays and radioactive material used to diagnose and treat illness account for 90% of all anthropogenic exposure. The remaining 10% comes from nuclear weapons testing, nuclear power plants, industrial uses of radioactive materials, and minute emissions from consumer products, such as color television sets. Occupationally exposed workers face greater risks from radiation. Means of calculating health risks are explained. Mechanisms of biological damage from ionizing radiation are outlined

  2. Identity Management A Primer

    CERN Document Server

    Sharoni, Ilan; Williamson, Graham; Yip, David

    2009-01-01

    In an age in which the boundaries between the real and the virtual are becoming increasingly blurred, this timely guide teaches both the key issues of identity management as well as appropriate strategies and preventative measures for ensuring personal safety in the virtual world. In a corporate setting, it is essential to identify and control the way in which the organization deals with customers, suppliers, employees, and other users who may interact with the information systems of the company. Providing strategies for overcoming this task in real-world terms as well as questions that assist

  3. Set up of analytical methods for evaluation of specifications of recombinant Hepatitis-B vaccine

    Directory of Open Access Journals (Sweden)

    Daram M

    2009-06-01

    Full Text Available "nBackground: Hepatitis B vaccination has been included in routine immunization of all individuals according to WHO recommendations since 1991. Despite successful coverage, 3-5% of recipients fail to mount a desirable protection level of Ab. Vaccine failure results from: emergence of mutation, immune failure of individuals, decrease in vaccine potency, and etc. The quality of Hepatitis B vaccine should be evaluated by a reliable method. "n"nMethods: The amount of vaccine antigen was measured through the in vitro assay of Hepatitis B vaccines which consists of multiple dilutions of the reference material and samples. The preparations were evaluated by Elisa to determine the amount of HBsAg. The data were analyzed by parallel-line analysis software. The in vivo assay was performed by inoculating multiple doses of the reference and sample preparations in Balb/c mice. A control group was also inoculated with vaccine matrix. Four weeks later, the mice sera were evaluated to determine the presence of antibodies against Hepatitis B by Elisa method. The data were analyzed by Probit analysis software. "n"nResults: Both methods were set up in our laboratory by which different batches of Hepatitis B vaccine were evaluated. It was observed that In vivo and In vitro methods provide comparable results. Therefore we can use the in vitro method for routine testing of HB vaccine quality control. "n"nConclusion: In vitro method can be used in place of In vivo method because of its time and cost-effectiveness. Moreover, since no animals are used in in vitro method, it complies well with the 3R concept (Reduction, Refinement, and Replacement of animal testing and the current tendency to use alternative method.

  4. Differential Ecological Specificity of Protist and Bacterial Microbiomes across a Set of Termite Species

    Directory of Open Access Journals (Sweden)

    Lena Waidele

    2017-12-01

    Full Text Available The gut microbiome of lower termites comprises protists and bacteria that help these insects to digest cellulose and to thrive on wood. The composition of the termite gut microbiome correlates with phylogenetic distance of the animal host and host ecology (diet in termites collected from their natural environment. However, carryover of transient microbes from host collection sites are an experimental concern and might contribute to the ecological imprints on the termite gut microbiome. Here, we set out to test whether an ecological imprint on the termite gut microbiome remains, when focusing on the persistent microbiome. Therefore, we kept five termite species under strictly controlled dietary conditions and subsequently profiled their protist and bacterial gut microbial communities using 18S and 16S rRNA gene amplicon sequencing. The species differed in their ecology; while three of the investigated species were wood-dwellers that feed on the piece of wood they live in and never leave except for the mating flight, the other two species were foragers that regularly leave their nests to forage for food. Despite these prominent ecological differences, protist microbiome structure aligned with phylogenetic relatedness of termite host species. Conversely, bacterial communities seemed more flexible, suggesting that microbiome structure aligned more strongly with the foraging and wood-dwelling ecologies. Interestingly, protist and bacterial community alpha-diversity correlated, suggesting either putative interactions between protists and bacteria, or that both types of microbes in the termite gut follow shared structuring principles. Taken together, our results add to the notion that bacterial communities are more variable over evolutionary time than protist communities and might react more flexibly to changes in host ecology.

  5. Differential Ecological Specificity of Protist and Bacterial Microbiomes across a Set of Termite Species

    KAUST Repository

    Waidele, Lena

    2017-12-19

    The gut microbiome of lower termites comprises protists and bacteria that help these insects to digest cellulose and to thrive on wood. The composition of the termite gut microbiome correlates with phylogenetic distance of the animal host and host ecology (diet) in termites collected from their natural environment. However, carryover of transient microbes from host collection sites are an experimental concern and might contribute to the ecological imprints on the termite gut microbiome. Here, we set out to test whether an ecological imprint on the termite gut microbiome remains, when focusing on the persistent microbiome. Therefore, we kept five termite species under strictly controlled dietary conditions and subsequently profiled their protist and bacterial gut microbial communities using 18S and 16S rRNA gene amplicon sequencing. The species differed in their ecology; while three of the investigated species were wood-dwellers that feed on the piece of wood they live in and never leave except for the mating flight, the other two species were foragers that regularly leave their nests to forage for food. Despite these prominent ecological differences, protist microbiome structure aligned with phylogenetic relatedness of termite host species. Conversely, bacterial communities seemed more flexible, suggesting that microbiome structure aligned more strongly with the foraging and wood-dwelling ecologies. Interestingly, protist and bacterial community alpha-diversity correlated, suggesting either putative interactions between protists and bacteria, or that both types of microbes in the termite gut follow shared structuring principles. Taken together, our results add to the notion that bacterial communities are more variable over evolutionary time than protist communities and might react more flexibly to changes in host ecology.

  6. Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

    Directory of Open Access Journals (Sweden)

    Li Kelvin

    2012-11-01

    Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

  7. Clinical and no-clinical setting specificities in first session short-term psychotherapy psychodrama group.

    Science.gov (United States)

    Drakulić, Aleksandra Mindoljević

    2011-03-01

    Modern history of short-term group psychotherapy dates back to the late 1950-ies. From then to present day, this psychotherapeutic method has been used in various forms, from dynamic-oriented to cognitive behavioural psychotherapies. Although it has always been considered rather controversial, due its cost-effectiveness, it has been capturing more and more popularity. This paper presents the specificities of first session short-term psychotherapy psychodrama group through session work with two examined groups: a group of 20 adult women who suffer from mild or moderate forms of unipolar depression and a group of 20 students of the School of Medicine in Zagreb without any psychiatric symptomatology. The results indicate the high importance of having structure in first psychodrama session, of relating it with the previously thoroughly conducted, initial, clinical, interviews, and of the clarity and focus in terms of determining the goals of therapy, especially in a clinical context. This study also confirmed assumptions regarding the need for different approaches of warming-up in psychodrama, both in the clinical and in non-clinical samples. A psychodrama psychotherapist should have good time managing skills and capability to convert the time available into an opportunity for directly boosting the group energy and work on therapeutic alliance.

  8. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  9. A Hearing Aid Primer 1

    Science.gov (United States)

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  10. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  11. A classical primer for QCD

    International Nuclear Information System (INIS)

    Moriyasu, K.

    1981-01-01

    A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)

  12. A Cobit primer.

    Energy Technology Data Exchange (ETDEWEB)

    Campbell, Philip LaRoche

    2005-06-01

    COBIT is a set of documents that provides guidance for computer security. This report introduces COBIT by answering the following questions, after first defining acronyms and presenting definitions: 1. Why is COBIT valuable? 2. What is COBIT?, and 3. What documents are related to COBIT? (The answer to the last question constitutes the bulk of this report.) This report also provides more detailed review of three documents. The first two documents--COBIT Security Baseline{trademark} and COBIT Quickstart{trademark}--are initial documents, designed to get people started. The third document-Control Practices-is a ''final'' document, so to speak, designed to take people all the way down into the details. Control Practices is the detail.

  13. Biostatistics primer: part I.

    Science.gov (United States)

    Overholser, Brian R; Sowinski, Kevin M

    2007-12-01

    Biostatistics is the application of statistics to biologic data. The field of statistics can be broken down into 2 fundamental parts: descriptive and inferential. Descriptive statistics are commonly used to categorize, display, and summarize data. Inferential statistics can be used to make predictions based on a sample obtained from a population or some large body of information. It is these inferences that are used to test specific research hypotheses. This 2-part review will outline important features of descriptive and inferential statistics as they apply to commonly conducted research studies in the biomedical literature. Part 1 in this issue will discuss fundamental topics of statistics and data analysis. Additionally, some of the most commonly used statistical tests found in the biomedical literature will be reviewed in Part 2 in the February 2008 issue.

  14. Active noise control primer

    CERN Document Server

    Snyder, Scott D

    2000-01-01

    Active noise control - the reduction of noise by generating an acoustic signal that actively interferes with the noise - has become an active area of basic research and engineering applications. The aim of this book is to present all of the basic knowledge one needs for assessing how useful active noise control will be for a given problem and then to provide some guidance for designing, setting up, and tuning an active noise-control system. Written for students who have no prior knowledge of acoustics, signal processing, or noise control but who do have a reasonable grasp of basic physics and mathematics, the book is short and descriptive. It leaves for more advanced texts or research monographs all mathematical details and proofs concerning vibrations, signal processing and the like. The book can thus be used in independent study, in a classroom with laboratories, or in conjunction with a kit for experiment or demonstration. Topics covered include: basic acoustics; human perception and sound; sound intensity...

  15. Regenerative medicine primer.

    Science.gov (United States)

    Terzic, Andre; Nelson, Timothy J

    2013-07-01

    The pandemic of chronic diseases, compounded by the scarcity of usable donor organs, mandates radical innovation to address the growing unmet needs of individuals and populations. Beyond life-extending measures that are often the last available option, regenerative strategies offer transformative solutions in treating degenerative conditions. By leveraging newfound knowledge of the intimate processes fundamental to organogenesis and healing, the emerging regenerative armamentarium aims to boost the aptitude of human tissues for self-renewal. Regenerative technologies strive to promote, augment, and reestablish native repair processes, restituting organ structure and function. Multimodal regenerative approaches incorporate transplant of healthy tissues into damaged environments, prompt the body to enact a regenerative response in damaged tissues, and use tissue engineering to manufacture new tissue. Stem cells and their products have a unique aptitude to form specialized tissues and promote repair signaling, providing active ingredients of regenerative regimens. Concomitantly, advances in materials science and biotechnology have unlocked additional prospects for growing tissue grafts and engineering organs. Translation of regenerative principles into practice is feasible and safe in the clinical setting. Regenerative medicine and surgery are, thus, poised to transit from proof-of-principle studies toward clinical validation and, ultimately, standardization, paving the way for next-generation individualized management algorithms. Copyright © 2013 Mayo Foundation for Medical Education and Research. Published by Elsevier Inc. All rights reserved.

  16. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    Science.gov (United States)

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-03-01

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  17. Primers As Socializing Agents in American and Finnish Schools.

    Science.gov (United States)

    Hyona, Jukka; And Others

    1995-01-01

    Content analysis of 12 Finnish and 18 American primers for grades 3 through 6 published primarily during the 1980s examined story type, plot setting, protagonist's characteristics, dramatic tasks, portrayals of family structure and parental responsibility, and extrafamilial peer and adult relationships. Results suggest that a nation's cultural…

  18. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

  19. 30 CFR 56.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...

  20. Development and use of tuf gene-based primers for the multiplex PCR detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum in commercial dairy products.

    Science.gov (United States)

    Sheu, Sen-Je; Hwang, Wen-zhe; Chen, Hsin-Chih; Chiang, Yu-Cheng; Tsen, Hau-Yang

    2009-01-01

    PCR primers specific for the detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum were designed based on the elongation factor Tu gene (tuf). The specificity of these four primer sets were confirmed by PCR with 88 bacterial strains of Lactobacillus, Enterococcus, Bifidobacterium, and other bacterial species. Results indicated that these primer sets generated predicted PCR products of 397, 230, 202, and 161 bp for L. acidophilus, L. delbrueckii, L. casei group, and B. longum, respectively. Bacterial species other than the target organisms tested did not generate false-positive results. When these four primer sets were combined for the simultaneous detection of the lactic acid bacteria (LAB) in fermented milk products including yogurt, the LAB species listed on the labels of these products could be identified without the preenrichment step. The identification limit for each LAB strain with this multiplex PCR method was N X 10(3) CFU/ml in milk samples. The results of our multiplex PCR method were confirmed by PCR assay using primers based on the 16S rDNA or the 16S-23S intergenic spacer region and by biochemical tests using the API 50 CHL kit. When this multiplex PCR method was used with the determination of counts of total viable LAB and bifidobacteria, the quality of commercial fermented milk products could be assured.

  1. A minimal set of tissue-specific hypomethylated CpGs constitute epigenetic signatures of developmental programming.

    Directory of Open Access Journals (Sweden)

    Alejandro Colaneri

    Full Text Available Cell specific states of the chromatin are programmed during mammalian development. Dynamic DNA methylation across the developing embryo guides a program of repression, switching off genes in most cell types. Thus, the majority of the tissue specific differentially methylated sites (TS-DMS must be un-methylated CpGs.Comparison of expanded Methyl Sensitive Cut Counting data (eMSCC among four tissues (liver, testes, brain and kidney from three C57BL/6J mice, identified 138,052 differentially methylated sites of which 23,270 contain CpGs un-methylated in only one tissue (TS-DMS. Most of these CpGs were located in intergenic regions, outside of promoters, CpG islands or their shores, and up to 20% of them overlapped reported active enhancers. Indeed, tissue-specific enhancers were up to 30 fold enriched in TS-DMS. Testis showed the highest number of TS-DMS, but paradoxically their associated genes do not appear to be specific to the germ cell functions, but rather are involved in organism development. In the other tissues the differentially methylated genes are associated with tissue-specific physiological or anatomical functions. The identified sets of TS-DMS quantify epigenetic distances between tissues, generated during development. We applied this concept to measure the extent of reprogramming in the liver of mice exposed to in utero or early postnatal nutritional stress. Different protocols of food restriction reprogrammed the liver methylome in different but reproducible ways.Thus, each identified set of differentially methylated sites constituted an epigenetic signature that traced the developmental programing or the early nutritional reprogramming of each exposed mouse. We propose that our approach has the potential to outline a number of disease-associated epigenetic states. The composition of differentially methylated CpGs may vary with each situation, behaving as a composite variable, which can be used as a pre-symptomatic marker for

  2. A Primer to Slow Light

    OpenAIRE

    Leonhardt, U.

    2001-01-01

    Laboratory-based optical analogs of astronomical objects such as black holes rely on the creation of light with an extremely low or even vanishing group velocity (slow light). These brief notes represent a pedagogical attempt towards elucidating this extraordinary form of light. This paper is a contribution to the book Artificial Black Holes edited by Mario Novello, Matt Visser and Grigori Volovik. The paper is intended as a primer, an introduction to the subject for non-experts, not as a det...

  3. Computational design, construction, and characterization of a set of specificity determining residues in protein-protein interactions.

    Science.gov (United States)

    Nagao, Chioko; Izako, Nozomi; Soga, Shinji; Khan, Samia Haseeb; Kawabata, Shigeki; Shirai, Hiroki; Mizuguchi, Kenji

    2012-10-01

    Proteins interact with different partners to perform different functions and it is important to elucidate the determinants of partner specificity in protein complex formation. Although methods for detecting specificity determining positions have been developed previously, direct experimental evidence for these amino acid residues is scarce, and the lack of information has prevented further computational studies. In this article, we constructed a dataset that is likely to exhibit specificity in protein complex formation, based on available crystal structures and several intuitive ideas about interaction profiles and functional subclasses. We then defined a "structure-based specificity determining position (sbSDP)" as a set of equivalent residues in a protein family showing a large variation in their interaction energy with different partners. We investigated sequence and structural features of sbSDPs and demonstrated that their amino acid propensities significantly differed from those of other interacting residues and that the importance of many of these residues for determining specificity had been verified experimentally. Copyright © 2012 Wiley Periodicals, Inc.

  4. Inpatient or outpatient rehabilitation after herniated disc surgery? - Setting-specific preferences, participation and outcome of rehabilitation.

    Science.gov (United States)

    Löbner, Margrit; Luppa, Melanie; Konnopka, Alexander; Meisel, Hans J; Günther, Lutz; Meixensberger, Jürgen; Stengler, Katarina; Angermeyer, Matthias C; König, Hans-Helmut; Riedel-Heller, Steffi G

    2014-01-01

    To examine rehabilitation preferences, participation and determinants for the choice of a certain rehabilitation setting (inpatient vs. outpatient) and setting-specific rehabilitation outcomes. The longitudinal observational study referred to 534 consecutive disc surgery patients (18-55 years). Face-to-face baseline interviews took place about 3.6 days after disc surgery during acute hospital stay. 486 patients also participated in a follow-up interview via telephone three months later (dropout-rate: 9%). The following instruments were used: depression and anxiety (Hospital Anxiety and Depression Scale), pain intensity (numeric analog scale), health-related quality of life (Short Form 36 Health Survey), subjective prognosis of gainful employment (SPE-scale) as well as questions on rehabilitation attendance, return to work, and amount of sick leave days. The vast majority of patients undergoing surgery for a herniated disc attended a post-hospital rehabilitation treatment program (93%). Thereby two-thirds of these patients took part in an inpatient rehabilitation program (67.9%). Physical, psychological, vocational and health-related quality of life characteristics differed widely before as well as after rehabilitation depending on the setting. Inpatient rehabilitees were significantly older, reported more pain, worse physical quality of life, more anxiety and depression and a worse subjective prognosis of gainful employment before rehabilitation. Pre-rehabilitation differences remained significant after rehabilitation. More than half of the outpatient rehabilitees (56%) compared to only one third of the inpatient rehabilitees (33%) returned to work three months after disc surgery (p<.001). The results suggest a "pre-selection" of patients with better health status in outpatient rehabilitation. Gaining better knowledge about setting-specific selection processes may help optimizing rehabilitation allocation procedures and improve rehabilitation effects such as return

  5. Inpatient or Outpatient Rehabilitation after Herniated Disc Surgery? – Setting-Specific Preferences, Participation and Outcome of Rehabilitation

    Science.gov (United States)

    Löbner, Margrit; Luppa, Melanie; Konnopka, Alexander; Meisel, Hans J.; Günther, Lutz; Meixensberger, Jürgen; Stengler, Katarina; Angermeyer, Matthias C.; König, Hans-Helmut; Riedel-Heller, Steffi G.

    2014-01-01

    Objective To examine rehabilitation preferences, participation and determinants for the choice of a certain rehabilitation setting (inpatient vs. outpatient) and setting-specific rehabilitation outcomes. Methods The longitudinal observational study referred to 534 consecutive disc surgery patients (18–55 years). Face-to-face baseline interviews took place about 3.6 days after disc surgery during acute hospital stay. 486 patients also participated in a follow-up interview via telephone three months later (dropout-rate: 9%). The following instruments were used: depression and anxiety (Hospital Anxiety and Depression Scale), pain intensity (numeric analog scale), health-related quality of life (Short Form 36 Health Survey), subjective prognosis of gainful employment (SPE-scale) as well as questions on rehabilitation attendance, return to work, and amount of sick leave days. Results The vast majority of patients undergoing surgery for a herniated disc attended a post-hospital rehabilitation treatment program (93%). Thereby two-thirds of these patients took part in an inpatient rehabilitation program (67.9%). Physical, psychological, vocational and health-related quality of life characteristics differed widely before as well as after rehabilitation depending on the setting. Inpatient rehabilitees were significantly older, reported more pain, worse physical quality of life, more anxiety and depression and a worse subjective prognosis of gainful employment before rehabilitation. Pre-rehabilitation differences remained significant after rehabilitation. More than half of the outpatient rehabilitees (56%) compared to only one third of the inpatient rehabilitees (33%) returned to work three months after disc surgery (p<.001). Conclusion The results suggest a “pre-selection” of patients with better health status in outpatient rehabilitation. Gaining better knowledge about setting-specific selection processes may help optimizing rehabilitation allocation procedures and

  6. Inpatient or outpatient rehabilitation after herniated disc surgery? - Setting-specific preferences, participation and outcome of rehabilitation.

    Directory of Open Access Journals (Sweden)

    Margrit Löbner

    Full Text Available OBJECTIVE: To examine rehabilitation preferences, participation and determinants for the choice of a certain rehabilitation setting (inpatient vs. outpatient and setting-specific rehabilitation outcomes. METHODS: The longitudinal observational study referred to 534 consecutive disc surgery patients (18-55 years. Face-to-face baseline interviews took place about 3.6 days after disc surgery during acute hospital stay. 486 patients also participated in a follow-up interview via telephone three months later (dropout-rate: 9%. The following instruments were used: depression and anxiety (Hospital Anxiety and Depression Scale, pain intensity (numeric analog scale, health-related quality of life (Short Form 36 Health Survey, subjective prognosis of gainful employment (SPE-scale as well as questions on rehabilitation attendance, return to work, and amount of sick leave days. RESULTS: The vast majority of patients undergoing surgery for a herniated disc attended a post-hospital rehabilitation treatment program (93%. Thereby two-thirds of these patients took part in an inpatient rehabilitation program (67.9%. Physical, psychological, vocational and health-related quality of life characteristics differed widely before as well as after rehabilitation depending on the setting. Inpatient rehabilitees were significantly older, reported more pain, worse physical quality of life, more anxiety and depression and a worse subjective prognosis of gainful employment before rehabilitation. Pre-rehabilitation differences remained significant after rehabilitation. More than half of the outpatient rehabilitees (56% compared to only one third of the inpatient rehabilitees (33% returned to work three months after disc surgery (p<.001. CONCLUSION: The results suggest a "pre-selection" of patients with better health status in outpatient rehabilitation. Gaining better knowledge about setting-specific selection processes may help optimizing rehabilitation allocation procedures

  7. Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

    Science.gov (United States)

    Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

    2012-01-01

    DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

  8. A broad set of different llama antibodies specific for a 16 kDa heat shock protein of Mycobacterium tuberculosis.

    Directory of Open Access Journals (Sweden)

    Anke K Trilling

    Full Text Available BACKGROUND: Recombinant antibodies are powerful tools in engineering of novel diagnostics. Due to the small size and stable nature of llama antibody domains selected antibodies can serve as a detection reagent in multiplexed and sensitive assays for M. tuberculosis. METHODOLOGY/PRINCIPAL FINDINGS: Antibodies for Mycobacterium tuberculosis (M. tb recognition were raised in Alpaca, and, by phage display, recombinant variable domains of heavy-chain antibodies (VHH binding to M. tuberculosis antigens were isolated. Two phage display selection strategies were followed: one direct selection using semi-purified protein antigen, and a depletion strategy with lysates, aiming to avoid cross-reaction to other mycobacteria. Both panning methods selected a set of binders with widely differing complementarity determining regions. Selected recombinant VHHs were produced in E. coli and shown to bind immobilized lysate in direct Enzymelinked Immunosorbent Assay (ELISA tests and soluble antigen by surface plasmon resonance (SPR analysis. All tested VHHs were specific for tuberculosis-causing mycobacteria (M. tuberculosis, M. bovis and exclusively recognized an immunodominant 16 kDa heat shock protein (hsp. The highest affinity VHH had a dissociation constant (KD of 4 × 10(-10 M. CONCLUSIONS/SIGNIFICANCE: A broad set of different llama antibodies specific for 16 kDa heat shock protein of M. tuberculosis is available. This protein is highly stable and abundant in M. tuberculosis. The VHH that detect this protein are applied in a robust SPR sensor for identification of tuberculosis-causing mycobacteria.

  9. Total and domain-specific sitting time among employees in desk-based work settings in Australia.

    Science.gov (United States)

    Bennie, Jason A; Pedisic, Zeljko; Timperio, Anna; Crawford, David; Dunstan, David; Bauman, Adrian; van Uffelen, Jannique; Salmon, Jo

    2015-06-01

    To describe the total and domain-specific daily sitting time among a sample of Australian office-based employees. In April 2010, paper-based surveys were provided to desk-based employees (n=801) in Victoria, Australia. Total daily and domain-specific (work, leisure-time and transport-related) sitting time (minutes/day) were assessed by validated questionnaires. Differences in sitting time were examined across socio-demographic (age, sex, occupational status) and lifestyle characteristics (physical activity levels, body mass index [BMI]) using multiple linear regression analyses. The median (95% confidence interval [CI]) of total daily sitting time was 540 (531-557) minutes/day. Insufficiently active adults (median=578 minutes/day, [95%CI: 564-602]), younger adults aged 18-29 years (median=561 minutes/day, [95%CI: 540-577]) reported the highest total daily sitting times. Occupational sitting time accounted for almost 60% of total daily sitting time. In multivariate analyses, total daily sitting time was negatively associated with age (unstandardised regression coefficient [B]=-1.58, pphysical activity (minutes/week) (B=-0.03, pemployees reported that more than half of their total daily sitting time was accrued in the work setting. Given the high contribution of occupational sitting to total daily sitting time among desk-based employees, interventions should focus on the work setting. © 2014 Public Health Association of Australia.

  10. DecoyFinder: an easy-to-use python GUI application for building target-specific decoy sets.

    Science.gov (United States)

    Cereto-Massagué, Adrià; Guasch, Laura; Valls, Cristina; Mulero, Miquel; Pujadas, Gerard; Garcia-Vallvé, Santiago

    2012-06-15

    Decoys are molecules that are presumed to be inactive against a target (i.e. will not likely bind to the target) and are used to validate the performance of molecular docking or a virtual screening workflow. The Directory of Useful Decoys database (http://dud.docking.org/) provides a free directory of decoys for use in virtual screening, though it only contains a limited set of decoys for 40 targets.To overcome this limitation, we have developed an application called DecoyFinder that selects, for a given collection of active ligands of a target, a set of decoys from a database of compounds. Decoys are selected if they are similar to active ligands according to five physical descriptors (molecular weight, number of rotational bonds, total hydrogen bond donors, total hydrogen bond acceptors and the octanol-water partition coefficient) without being chemically similar to any of the active ligands used as an input (according to the Tanimoto coefficient between MACCS fingerprints). To the best of our knowledge, DecoyFinder is the first application designed to build target-specific decoy sets. A complete description of the software is included on the application home page. A validation of DecoyFinder on 10 DUD targets is provided as Supplementary Table S1. DecoyFinder is freely available at http://URVnutrigenomica-CTNS.github.com/DecoyFinder.

  11. An effective attentional set for a specific colour does not prevent capture by infrequently presented motion distractors.

    Science.gov (United States)

    Retell, James D; Becker, Stefanie I; Remington, Roger W

    2016-01-01

    An organism's survival depends on the ability to rapidly orient attention to unanticipated events in the world. Yet, the conditions needed to elicit such involuntary capture remain in doubt. Especially puzzling are spatial cueing experiments, which have consistently shown that involuntary shifts of attention to highly salient distractors are not determined by stimulus properties, but instead are contingent on attentional control settings induced by task demands. Do we always need to be set for an event to be captured by it, or is there a class of events that draw attention involuntarily even when unconnected to task goals? Recent results suggest that a task-irrelevant event will capture attention on first presentation, suggesting that salient stimuli that violate contextual expectations might automatically capture attention. Here, we investigated the role of contextual expectation by examining whether an irrelevant motion cue that was presented only rarely (∼3-6% of trials) would capture attention when observers had an active set for a specific target colour. The motion cue had no effect when presented frequently, but when rare produced a pattern of interference consistent with attentional capture. The critical dependence on the frequency with which the irrelevant motion singleton was presented is consistent with early theories of involuntary orienting to novel stimuli. We suggest that attention will be captured by salient stimuli that violate expectations, whereas top-down goals appear to modulate capture by stimuli that broadly conform to contextual expectations.

  12. Good analytical practice: statistics and handling data in biomedical science. A primer and directions for authors. Part 1: Introduction. Data within and between one or two sets of individuals.

    Science.gov (United States)

    Blann, A D; Nation, B R

    2008-01-01

    The biomedical scientist is bombarded on a daily basis by information, almost all of which refers to the health status of an individual or groups of individuals. This review is the first of a two-part article written to explain some of the issues related to the presentation and analysis of data. The first part focuses on types of data and how to present and analyse data from an individual or from one or two groups of persons. The second part will examine data from three or more sets of persons, what methods are available to allow this analysis (i.e., statistical software packages), and will conclude with a statement on appropriate descriptors of data, their analyses, and presentation for authors considering submission of their data to this journal.

  13. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei

    2008-12-01

    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  14. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    Directory of Open Access Journals (Sweden)

    Nomin Batnyam

    2012-01-01

    Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  15. A primer of multivariate statistics

    CERN Document Server

    Harris, Richard J

    2014-01-01

    Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

  16. Primer Vector Optimization: Survey of Theory, new Analysis and Applications

    Science.gov (United States)

    Guzman

    This paper presents a preliminary study in developing a set of optimization tools for orbit rendezvous, transfer and station keeping. This work is part of a large scale effort undergoing at NASA Goddard Space Flight Center and a.i. solutions, Inc. to build generic methods, which will enable missions with tight fuel budgets. Since no single optimization technique can solve efficiently all existing problems, a library of tools where the user could pick the method most suited for the particular mission is envisioned. The first trajectory optimization technique explored is Lawden's primer vector theory [Ref. 1]. Primer vector theory can be considered as a byproduct of applying Calculus of Variations (COV) techniques to the problem of minimizing the fuel usage of impulsive trajectories. For an n-impulse trajectory, it involves the solution of n-1 two-point boundary value problems. In this paper, we look at some of the different formulations of the primer vector (dependent on the frame employed and on the force model). Also, the applicability of primer vector theory is examined in effort to understand when and why the theory can fail. Specifically, since COV is based on "small variations", singularities in the linearized (variational) equations of motion along the arcs must be taken into account. These singularities are a recurring problem in analyzes that employ "small variations" [Refs. 2, 3]. For example, singularities in the (2-body problem) variational equations along elliptic arcs occur when [Ref. 4], 1) the difference between the initial and final times is a multiple of the reference orbit period, 2) the difference between the initial and final true anomalies are given by k, for k= 0, 1, 2, 3,..., note that this cover the 3) the time of flight is a minimum for the given difference in true anomaly. For the N-body problem, the situation is more complex and is still under investigation. Several examples, such as the initialization of an orbit (ascent trajectory) and

  17. Development and test of sets of 3D printed age-specific thyroid phantoms for 131I measurements

    Science.gov (United States)

    Beaumont, Tiffany; Caldeira Ideias, Pedro; Rimlinger, Maeva; Broggio, David; Franck, Didier

    2017-06-01

    In the case of a nuclear reactor accident the release contains a high proportion of iodine-131 that can be inhaled or ingested by members of the public. Iodine-131 is naturally retained in the thyroid and increases the thyroid cancer risk. Since the radiation induced thyroid cancer risk is greater for children than for adults, the thyroid dose to children should be assessed as accurately as possible. For that purpose direct measurements should be carried out with age-specific calibration factors but, currently, there is no age-specific thyroid phantoms allowing a robust measurement protocol. A set of age-specific thyroid phantoms for 5, 10, 15 year old children and for the adult has been designed and 3D printed. A realistic thyroid shape has been selected and material properties taken into account to simulate the attenuation of biological tissues. The thyroid volumes follow ICRP recommendations and the phantoms also include the trachea and a spine model. Several versions, with or without spine, with our without trachea, with or without age-specific neck have been manufactured, in order to study the influence of these elements on calibration factors. The calibration factor obtained with the adult phantom and a reference phantom are in reasonable agreement. In vivo calibration experiments with germanium detectors have shown that the difference in counting efficiency, the inverse of the calibration factor, between the 5 year and adult phantoms is 25% for measurement at contact. It is also experimentally evidenced that the inverse of the calibration factor varies linearly with the thyroid volume. The influence of scattering elements like the neck or spine is not evidenced by experimental measurements.

  18. MCNPTM criticality primer and training experiences

    International Nuclear Information System (INIS)

    Briesmeister, J.; Forster, R.A.; Busch, R.

    1995-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k eff ). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k eff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP

  19. Next-generation text-mining mediated generation of chemical response-specific gene sets for interpretation of gene expression data

    NARCIS (Netherlands)

    Hettne, K.M.; Boorsma, A.; Dartel, D.A. van; Goeman, J.J.; Jong, E. de; Piersma, A.H.; Stierum, R.H.; Kleinjans, J.C.; Kors, J.A.

    2013-01-01

    BACKGROUND: Availability of chemical response-specific lists of genes (gene sets) for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM), and that these can be used with gene set

  20. Next-generation text-mining mediated generation of chemical response-specific gene sets for interpretation of gene expression data

    NARCIS (Netherlands)

    Hettne, K.M.; Boorsma, A.; Dartel, van D.A.M.; Goeman, J.J.; Jong, de E.; Piersma, A.H.; Stierum, R.H.; Kleinjans, J.C.; Kors, J.A.

    2013-01-01

    Background: Availability of chemical response-specific lists of genes (gene sets) for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM), and that these can be used with gene set

  1. Great Lakes rivermouths: a primer for managers

    Science.gov (United States)

    Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul

    2013-01-01

    Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

  2. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads

    2011-01-01

    containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

  3. A primer on pseudorandom generators

    CERN Document Server

    Goldreich, Oded

    2010-01-01

    A fresh look at the question of randomness was taken in the theory of computing: A distribution is pseudorandom if it cannot be distinguished from the uniform distribution by any efficient procedure. This paradigm, originally associating efficient procedures with polynomial-time algorithms, has been applied with respect to a variety of natural classes of distinguishing procedures. The resulting theory of pseudorandomness is relevant to science at large and is closely related to central areas of computer science, such as algorithmic design, complexity theory, and cryptography. This primer surveys the theory of pseudorandomness, starting with the general paradigm, and discussing various incarnations while emphasizing the case of general-purpose pseudorandom generators (withstanding any polynomial-time distinguisher). Additional topics include the "derandomization" of arbitrary probabilistic polynomial-time algorithms, pseudorandom generators withstanding space-bounded distinguishers, and several natural notions...

  4. A Primer on Observational Measurement.

    Science.gov (United States)

    Girard, Jeffrey M; Cohn, Jeffrey F

    2016-08-01

    Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.

  5. A primer on quantum fluids

    CERN Document Server

    Barenghi, Carlo

    2016-01-01

    The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

  6. Genomic determinants of sporulation in Bacilli and Clostridia: towards the minimal set of sporulation-specific genes.

    Science.gov (United States)

    Galperin, Michael Y; Mekhedov, Sergei L; Puigbo, Pere; Smirnov, Sergey; Wolf, Yuri I; Rigden, Daniel J

    2012-11-01

    Three classes of low-G+C Gram-positive bacteria (Firmicutes), Bacilli, Clostridia and Negativicutes, include numerous members that are capable of producing heat-resistant endospores. Spore-forming firmicutes include many environmentally important organisms, such as insect pathogens and cellulose-degrading industrial strains, as well as human pathogens responsible for such diseases as anthrax, botulism, gas gangrene and tetanus. In the best-studied model organism Bacillus subtilis, sporulation involves over 500 genes, many of which are conserved among other bacilli and clostridia. This work aimed to define the genomic requirements for sporulation through an analysis of the presence of sporulation genes in various firmicutes, including those with smaller genomes than B. subtilis. Cultivable spore-formers were found to have genomes larger than 2300 kb and encompass over 2150 protein-coding genes of which 60 are orthologues of genes that are apparently essential for sporulation in B. subtilis. Clostridial spore-formers lack, among others, spoIIB, sda, spoVID and safA genes and have non-orthologous displacements of spoIIQ and spoIVFA, suggesting substantial differences between bacilli and clostridia in the engulfment and spore coat formation steps. Many B. subtilis sporulation genes, particularly those encoding small acid-soluble spore proteins and spore coat proteins, were found only in the family Bacillaceae, or even in a subset of Bacillus spp. Phylogenetic profiles of sporulation genes, compiled in this work, confirm the presence of a common sporulation gene core, but also illuminate the diversity of the sporulation processes within various lineages. These profiles should help further experimental studies of uncharacterized widespread sporulation genes, which would ultimately allow delineation of the minimal set(s) of sporulation-specific genes in Bacilli and Clostridia. Published 2012. This article is a U.S. Government work and is in the public domain in the USA.

  7. Evaluation of customised lineage-specific sets of MIRU-VNTR loci for genotyping Mycobacterium tuberculosis complex isolates in Ghana.

    Science.gov (United States)

    Asante-Poku, Adwoa; Nyaho, Michael Selasi; Borrell, Sonia; Comas, Iñaki; Gagneux, Sebastien; Yeboah-Manu, Dorothy

    2014-01-01

    Different combinations of variable number of tandem repeat (VNTR) loci have been proposed for genotyping Mycobacterium tuberculosis complex (MTBC). Existing VNTR schemes show different discriminatory capacity among the six human MTBC lineages. Here, we evaluated the discriminatory power of a "customized MIRU12" loci format proposed previously by Comas et al. based on the standard 24 loci defined by Supply et al. for VNTR-typing of MTBC in Ghana. One hundred and fifty-eight MTBC isolates classified into Lineage 4 and Lineage 5 were used to compare a customized lineage-specific panel of 12 MIRU-VNTR loci ("customized MIRU-12") to the standard MIRU-15 genotyping scheme. The resolution power of each typing method was determined based on the Hunter-Gaston- Discriminatory Index (HGDI). A minimal set of customized MIRU-VNTR loci for typing Lineages 4 (Euro-American) and 5 (M. africanum West African 1) strains from Ghana was defined based on the cumulative HGDI. Among the 106 Lineage 4 strains, the customized MIRU-12 identified a total of 104 distinct genotypes consisting of 2 clusters of 2 isolates each (clustering rate 1.8%), and 102 unique strains while standard MIRU-15 yielded a total of 105 different genotypes, including 1 cluster of 2 isolates (clustering rate: 0.9%) and 104 singletons. Among, 52 Lineage 5 isolates, customized MIRU-12 genotyping defined 51 patterns with 1 cluster of 2 isolates (clustering rate: 0.9%) and 50 unique strains whereas MIRU-15 classified all 52 strains as unique. Cumulative HGDI values for customized MIRU-12 for Lineages 4 and 5 were 0.98 respectively whilst that of standard MIRU-15 was 0.99. A union of loci from the customised MIRU-12 and standard MIRU-15 revealed a set of customized eight highly discriminatory loci: 4052, 2163B, 40, 4165, 2165, 10,16 and 26 with a cumulative HGDI of 0.99 for genotyping Lineage 4 and 5 strains from Ghana.

  8. Primer for criticality calculations with DANTSYS

    International Nuclear Information System (INIS)

    Busch, R.D.

    1996-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses

  9. Grooming a CAT: customizing CAT administration rules to increase response efficiency in specific research and clinical settings.

    Science.gov (United States)

    Kallen, Michael A; Cook, Karon F; Amtmann, Dagmar; Knowlton, Elizabeth; Gershon, Richard C

    2018-05-05

    To evaluate the degree to which applying alternative stopping rules would reduce response burden while maintaining score precision in the context of computer adaptive testing (CAT). Analyses were conducted on secondary data comprised of CATs administered in a clinical setting at multiple time points (baseline and up to two follow ups) to 417 study participants who had back pain (51.3%) and/or depression (47.0%). Participant mean age was 51.3 years (SD = 17.2) and ranged from 18 to 86. Participants tended to be white (84.7%), relatively well educated (77% with at least some college), female (63.9%), and married or living in a committed relationship (57.4%). The unit of analysis was individual assessment histories (i.e., CAT item response histories) from the parent study. Data were first aggregated across all individuals, domains, and time points in an omnibus dataset of assessment histories and then were disaggregated by measure for domain-specific analyses. Finally, assessment histories within a "clinically relevant range" (score ≥ 1 SD from the mean in direction of poorer health) were analyzed separately to explore score level-specific findings. Two different sets of CAT administration rules were compared. The original CAT (CAT ORIG ) rules required at least four and no more than 12 items be administered. If the score standard error (SE) reached a value CAT was stopped. We simulated applying alternative stopping rules (CAT ALT ), removing the requirement that a minimum four items be administered, and stopped a CAT if responses to the first two items were both associated with best health, if the SE was CAT ORIG and CAT ALT . CAT ORIG and CAT ALT scores varied little, especially within the clinically relevant range, and response burden was substantially lower under CAT ALT (e.g., 41.2% savings in omnibus dataset). Alternate stopping rules result in substantial reductions in response burden with minimal sacrifice in score precision.

  10. Completion of proteomic data sets by Kd measurement using cell-free synthesis of site-specifically labeled proteins.

    Directory of Open Access Journals (Sweden)

    Paul Majkut

    Full Text Available The characterization of phosphotyrosine mediated protein-protein interactions is vital for the interpretation of downstream pathways of transmembrane signaling processes. Currently however, there is a gap between the initial identification and characterization of cellular binding events by proteomic methods and the in vitro generation of quantitative binding information in the form of equilibrium rate constants (Kd values. In this work we present a systematic, accelerated and simplified approach to fill this gap: using cell-free protein synthesis with site-specific labeling for pull-down and microscale thermophoresis (MST we were able to validate interactions and to establish a binding hierarchy based on Kd values as a completion of existing proteomic data sets. As a model system we analyzed SH2-mediated interactions of the human T-cell phosphoprotein ADAP. Putative SH2 domain-containing binding partners were synthesized from a cDNA library using Expression-PCR with site-specific biotinylation in order to analyze their interaction with fluorescently labeled and in vitro phosphorylated ADAP by pull-down. On the basis of the pull-down results, selected SH2's were subjected to MST to determine Kd values. In particular, we could identify an unexpectedly strong binding of ADAP to the previously found binding partner Rasa1 of about 100 nM, while no evidence of interaction was found for the also predicted SH2D1A. Moreover, Kd values between ADAP and its known binding partners SLP-76 and Fyn were determined. Next to expanding data on ADAP suggesting promising candidates for further analysis in vivo, this work marks the first Kd values for phosphotyrosine/SH2 interactions on a phosphoprotein level.

  11. Development of a microsatellite primer set to investigate the genetic ...

    Indian Academy of Sciences (India)

    2014-08-18

    Aug 18, 2014 ... the environmental quality of agroecosystems and are indeed considered as ..... five isopod species in standardized tests for pH preference. Eur. J. Soil. Biol. ... Zimmer M. and Topp W. 1997 Does food quality influence pop-.

  12. 30 CFR 57.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...

  13. Methylation-Specific PCR Unraveled

    Directory of Open Access Journals (Sweden)

    Sarah Derks

    2004-01-01

    Full Text Available Methylation‐specific PCR (MSP is a simple, quick and cost‐effective method to analyze the DNA methylation status of virtually any group of CpG sites within a CpG island. The technique comprises two parts: (1 sodium bisulfite conversion of unmethylated cytosine's to uracil under conditions whereby methylated cytosines remains unchanged and (2 detection of the bisulfite induced sequence differences by PCR using specific primer sets for both unmethylated and methylated DNA. This review discusses the critical parameters of MSP and presents an overview of the available MSP variants and the (clinical applications.

  14. Primer3_masker: integrating masking of template sequence with primer design software.

    Science.gov (United States)

    Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

    2018-06-01

    Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.

  15. Next-generation text-mining mediated generation of chemical response-specific gene sets for interpretation of gene expression data

    Science.gov (United States)

    2013-01-01

    Background Availability of chemical response-specific lists of genes (gene sets) for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM), and that these can be used with gene set analysis (GSA) methods for chemical treatment identification, for pharmacological mechanism elucidation, and for comparing compound toxicity profiles. Methods We created 30,211 chemical response-specific gene sets for human and mouse by next-gen TM, and derived 1,189 (human) and 588 (mouse) gene sets from the Comparative Toxicogenomics Database (CTD). We tested for significant differential expression (SDE) (false discovery rate -corrected p-values sets and the CTD-derived gene sets in gene expression (GE) data sets of five chemicals (from experimental models). We tested for SDE of gene sets for six fibrates in a peroxisome proliferator-activated receptor alpha (PPARA) knock-out GE dataset and compared to results from the Connectivity Map. We tested for SDE of 319 next-gen TM-derived gene sets for environmental toxicants in three GE data sets of triazoles, and tested for SDE of 442 gene sets associated with embryonic structures. We compared the gene sets to triazole effects seen in the Whole Embryo Culture (WEC), and used principal component analysis (PCA) to discriminate triazoles from other chemicals. Results Next-gen TM-derived gene sets matching the chemical treatment were significantly altered in three GE data sets, and the corresponding CTD-derived gene sets were significantly altered in five GE data sets. Six next-gen TM-derived and four CTD-derived fibrate gene sets were significantly altered in the PPARA knock-out GE dataset. None of the fibrate signatures in cMap scored significant against the PPARA GE signature. 33 environmental toxicant gene sets were significantly altered in the triazole GE data sets. 21 of these toxicants had a similar toxicity pattern as the

  16. Evaluation of customised lineage-specific sets of MIRU-VNTR loci for genotyping Mycobacterium tuberculosis complex isolates in Ghana.

    Directory of Open Access Journals (Sweden)

    Adwoa Asante-Poku

    Full Text Available BACKGROUND: Different combinations of variable number of tandem repeat (VNTR loci have been proposed for genotyping Mycobacterium tuberculosis complex (MTBC. Existing VNTR schemes show different discriminatory capacity among the six human MTBC lineages. Here, we evaluated the discriminatory power of a "customized MIRU12" loci format proposed previously by Comas et al. based on the standard 24 loci defined by Supply et al. for VNTR-typing of MTBC in Ghana. METHOD: One hundred and fifty-eight MTBC isolates classified into Lineage 4 and Lineage 5 were used to compare a customized lineage-specific panel of 12 MIRU-VNTR loci ("customized MIRU-12" to the standard MIRU-15 genotyping scheme. The resolution power of each typing method was determined based on the Hunter-Gaston- Discriminatory Index (HGDI. A minimal set of customized MIRU-VNTR loci for typing Lineages 4 (Euro-American and 5 (M. africanum West African 1 strains from Ghana was defined based on the cumulative HGDI. RESULTS AND CONCLUSION: Among the 106 Lineage 4 strains, the customized MIRU-12 identified a total of 104 distinct genotypes consisting of 2 clusters of 2 isolates each (clustering rate 1.8%, and 102 unique strains while standard MIRU-15 yielded a total of 105 different genotypes, including 1 cluster of 2 isolates (clustering rate: 0.9% and 104 singletons. Among, 52 Lineage 5 isolates, customized MIRU-12 genotyping defined 51 patterns with 1 cluster of 2 isolates (clustering rate: 0.9% and 50 unique strains whereas MIRU-15 classified all 52 strains as unique. Cumulative HGDI values for customized MIRU-12 for Lineages 4 and 5 were 0.98 respectively whilst that of standard MIRU-15 was 0.99. A union of loci from the customised MIRU-12 and standard MIRU-15 revealed a set of customized eight highly discriminatory loci: 4052, 2163B, 40, 4165, 2165, 10,16 and 26 with a cumulative HGDI of 0.99 for genotyping Lineage 4 and 5 strains from Ghana.

  17. Detection and typing of human papillomavirus in archival cervical cancer specimens by DNA amplification with consensus primers

    NARCIS (Netherlands)

    RESNICK, R. M.; Cornelissen, M. T.; WRIGHT, D. K.; EICHINGER, G. H.; FOX, H. S.; ter Schegget, J.; MANOS, M. M.

    1990-01-01

    We developed a polymerase chain reaction DNA amplification system using two distinct consensus oligonucleotide primer sets for the improved detection and typing of a broad spectrum of human genital papillomavirus (HPV) sequences, including those of novel viruses. The system incorporates one primer

  18. Next-generation text-mining mediated generation of chemical response-specific gene sets for interpretation of gene expression data

    Directory of Open Access Journals (Sweden)

    Hettne Kristina M

    2013-01-01

    Full Text Available Abstract Background Availability of chemical response-specific lists of genes (gene sets for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM, and that these can be used with gene set analysis (GSA methods for chemical treatment identification, for pharmacological mechanism elucidation, and for comparing compound toxicity profiles. Methods We created 30,211 chemical response-specific gene sets for human and mouse by next-gen TM, and derived 1,189 (human and 588 (mouse gene sets from the Comparative Toxicogenomics Database (CTD. We tested for significant differential expression (SDE (false discovery rate -corrected p-values Results Next-gen TM-derived gene sets matching the chemical treatment were significantly altered in three GE data sets, and the corresponding CTD-derived gene sets were significantly altered in five GE data sets. Six next-gen TM-derived and four CTD-derived fibrate gene sets were significantly altered in the PPARA knock-out GE dataset. None of the fibrate signatures in cMap scored significant against the PPARA GE signature. 33 environmental toxicant gene sets were significantly altered in the triazole GE data sets. 21 of these toxicants had a similar toxicity pattern as the triazoles. We confirmed embryotoxic effects, and discriminated triazoles from other chemicals. Conclusions Gene set analysis with next-gen TM-derived chemical response-specific gene sets is a scalable method for identifying similarities in gene responses to other chemicals, from which one may infer potential mode of action and/or toxic effect.

  19. KULTUR PRIMER FIBROBLAS: PENELITIAN PENDAHULUAN

    Directory of Open Access Journals (Sweden)

    Yuli Kurniawati

    2015-05-01

    Full Text Available AbstrakKultur sel fibroblas banyak digunakan untuk penelitian proses penyembuhan luka dan penuaankulit. Metode ini digunakan untuk melihat perkembangan sel, proliferasi kinetik seluler, sertabiosintesis komponen matriks ekstraseluler. Penelitian pendahuluan ini dilakukan untuk optimasiteknik laboratorium serta berbagai kendala yang didapatkan saat kultur fibroblas. Kultur primerfibroblas dibagi menjadi 2 jenis sampel yaitu sampel yang berasal dari embrio mencit usia 7,5–9,5 hari, dan kulit pasien keloid. Sampel dari embrio mencit dilakukan kultur primer denganmetode dissociated fibroblast. Sampel jaringan keloid dan kulit normal dikultur dengan metodeskin explant. Fibroblas yang berasal dari kultur primer embrio mencit tumbuh baik sehinggadapat dilakukan subkultur dan disimpan di dalam nitrogen cair suhu -198°C. Fibroblas yangberasal dari sampel keloid pertama tumbuh sesuai pola pertumbuhan fibroblas, namun padasampel kedua terdapat kontaminasi Paecilomyces sp. yang merupakan salah satu jenis jamurkontaminan. Sel fibroblas mudah untuk dikultur karena memiliki kemampuan tumbuh danmelekat yang tinggi serta regenerasi cepat, namun penelitian lebih lanjut untuk optimasi teknikkultur dan pencegahan kontaminasi masih dibutuhkan sehingga sel dapat tumbuh baik.AbstractFibroblast cell culture method has been used for wound healing and skin aging studies. Thismethod was used for cell development imaging study, celullar kinetic proliferation andextracelullar matrix component biosynthesis. This preeliminary study was done for laboratoricaltechnic optimation as well as problems appeared in fibroblast culture. Fibroblasts primary culturewas divided into 2 type of samples, from 7.5-9.5-day-mice embryo and keloid-patient skin.Primary culture with dissociated fibroblast method was done for mice embryo sample. Keloidtissue sample and normal skin were cultured with skin explant method. Fibroblasts that weretaken from mice embryo primary culture grew well

  20. Bamgineer: Introduction of simulated allele-specific copy number variants into exome and targeted sequence data sets.

    Science.gov (United States)

    Samadian, Soroush; Bruce, Jeff P; Pugh, Trevor J

    2018-03-01

    Somatic copy number variations (CNVs) play a crucial role in development of many human cancers. The broad availability of next-generation sequencing data has enabled the development of algorithms to computationally infer CNV profiles from a variety of data types including exome and targeted sequence data; currently the most prevalent types of cancer genomics data. However, systemic evaluation and comparison of these tools remains challenging due to a lack of ground truth reference sets. To address this need, we have developed Bamgineer, a tool written in Python to introduce user-defined haplotype-phased allele-specific copy number events into an existing Binary Alignment Mapping (BAM) file, with a focus on targeted and exome sequencing experiments. As input, this tool requires a read alignment file (BAM format), lists of non-overlapping genome coordinates for introduction of gains and losses (bed file), and an optional file defining known haplotypes (vcf format). To improve runtime performance, Bamgineer introduces the desired CNVs in parallel using queuing and parallel processing on a local machine or on a high-performance computing cluster. As proof-of-principle, we applied Bamgineer to a single high-coverage (mean: 220X) exome sequence file from a blood sample to simulate copy number profiles of 3 exemplar tumors from each of 10 tumor types at 5 tumor cellularity levels (20-100%, 150 BAM files in total). To demonstrate feasibility beyond exome data, we introduced read alignments to a targeted 5-gene cell-free DNA sequencing library to simulate EGFR amplifications at frequencies consistent with circulating tumor DNA (10, 1, 0.1 and 0.01%) while retaining the multimodal insert size distribution of the original data. We expect Bamgineer to be of use for development and systematic benchmarking of CNV calling algorithms by users using locally-generated data for a variety of applications. The source code is freely available at http://github.com/pughlab/bamgineer.

  1. Bamgineer: Introduction of simulated allele-specific copy number variants into exome and targeted sequence data sets.

    Directory of Open Access Journals (Sweden)

    Soroush Samadian

    2018-03-01

    Full Text Available Somatic copy number variations (CNVs play a crucial role in development of many human cancers. The broad availability of next-generation sequencing data has enabled the development of algorithms to computationally infer CNV profiles from a variety of data types including exome and targeted sequence data; currently the most prevalent types of cancer genomics data. However, systemic evaluation and comparison of these tools remains challenging due to a lack of ground truth reference sets. To address this need, we have developed Bamgineer, a tool written in Python to introduce user-defined haplotype-phased allele-specific copy number events into an existing Binary Alignment Mapping (BAM file, with a focus on targeted and exome sequencing experiments. As input, this tool requires a read alignment file (BAM format, lists of non-overlapping genome coordinates for introduction of gains and losses (bed file, and an optional file defining known haplotypes (vcf format. To improve runtime performance, Bamgineer introduces the desired CNVs in parallel using queuing and parallel processing on a local machine or on a high-performance computing cluster. As proof-of-principle, we applied Bamgineer to a single high-coverage (mean: 220X exome sequence file from a blood sample to simulate copy number profiles of 3 exemplar tumors from each of 10 tumor types at 5 tumor cellularity levels (20-100%, 150 BAM files in total. To demonstrate feasibility beyond exome data, we introduced read alignments to a targeted 5-gene cell-free DNA sequencing library to simulate EGFR amplifications at frequencies consistent with circulating tumor DNA (10, 1, 0.1 and 0.01% while retaining the multimodal insert size distribution of the original data. We expect Bamgineer to be of use for development and systematic benchmarking of CNV calling algorithms by users using locally-generated data for a variety of applications. The source code is freely available at http://github.com/pughlab/bamgineer.

  2. Next-generation text-mining mediated generation of chemical response-specific gene sets for interpretation of gene expression data

    NARCIS (Netherlands)

    K.M. Hettne (Kristina); J. Boorsma (Jeffrey); D.A.M. van Dartel (Dorien A M); J.J. Goeman (Jelle); E.C. de Jong (Esther); A.H. Piersma (Aldert); R.H. Stierum (Rob); J. Kleinjans (Jos); J.A. Kors (Jan)

    2013-01-01

    textabstractBackground: Availability of chemical response-specific lists of genes (gene sets) for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM), and that these can be used with

  3. A primer on systematic reviews in toxicology.

    Science.gov (United States)

    Hoffmann, Sebastian; de Vries, Rob B M; Stephens, Martin L; Beck, Nancy B; Dirven, Hubert A A M; Fowle, John R; Goodman, Julie E; Hartung, Thomas; Kimber, Ian; Lalu, Manoj M; Thayer, Kristina; Whaley, Paul; Wikoff, Daniele; Tsaioun, Katya

    2017-07-01

    Systematic reviews, pioneered in the clinical field, provide a transparent, methodologically rigorous and reproducible means of summarizing the available evidence on a precisely framed research question. Having matured to a well-established approach in many research fields, systematic reviews are receiving increasing attention as a potential tool for answering toxicological questions. In the larger framework of evidence-based toxicology, the advantages and obstacles of, as well as the approaches for, adapting and adopting systematic reviews to toxicology are still being explored. To provide the toxicology community with a starting point for conducting or understanding systematic reviews, we herein summarized available guidance documents from various fields of application. We have elaborated on the systematic review process by breaking it down into ten steps, starting with planning the project, framing the question, and writing and publishing the protocol, and concluding with interpretation and reporting. In addition, we have identified the specific methodological challenges of toxicological questions and have summarized how these can be addressed. Ultimately, this primer is intended to stimulate scientific discussions of the identified issues to fuel the development of toxicology-specific methodology and to encourage the application of systematic review methodology to toxicological issues.

  4. Effect of oligonucleotide primers in determining viral variability within hosts

    Directory of Open Access Journals (Sweden)

    Moya Andrés

    2004-12-01

    Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  5. Effect of oligonucleotide primers in determining viral variability within hosts.

    Science.gov (United States)

    Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando

    2004-12-09

    Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  6. Thinking in systems a primer

    CERN Document Server

    Meadows, Donella H

    2008-01-01

    In the years following her role as the lead author of the international bestseller, "Limits to Growth"-the first book to show the consequences of unchecked growth on a finite planet- Donella Meadows remained a pioneer of environmental and social analysis until her untimely death in 2001. Meadows' newly released manuscript, "Thinking in Systems", is a concise and crucial book offering insight for problem solving on scales ranging from the personal to the global. Edited by the Sustainability Institute's Diana Wright, this essential primer brings systems thinking out of the realm of computers and equations and into the tangible world, showing readers how to develop the systems-thinking skills that thought leaders across the globe consider critical for 21st-century life. Some of the biggest problems facing the world-war, hunger, poverty, and environmental degradation-are essentially system failures. They cannot be solved by fixing one piece in isolation from the others, because even seemingly minor details have e...

  7. Allele-specific primer polymerase chain reaction for a single nucleotide polymorphism (C1205T) of swine Toll-like receptor 5 and comparison of the allelic frequency among several pig breeds in Japan and the Czech Republic

    Czech Academy of Sciences Publication Activity Database

    Muneta, Y.; Minagawa, Y.; Kusumoto, M.; Shinkai, H.; Uenishi, H.; Šplíchal, Igor

    2012-01-01

    Roč. 56, č. 6 (2012), s. 385-391 ISSN 0385-5600 R&D Projects: GA ČR GA524/09/0365 Institutional support: RVO:61388971 Keywords : allele-specific PCR * Salmonella enterica serovar Choleraesuis * single nucleotide polymorphism Subject RIV: EC - Immunology Impact factor: 1.545, year: 2012

  8. Primer on spontaneous heating and pyrophoricity

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  9. [Design of primers to DNA of lactic acid bacteria].

    Science.gov (United States)

    Lashchevskiĭ, V V; Kovalenko, N K

    2003-01-01

    Primers LP1-LP2 to the gene 16S rRNA have been developed, which permit to differentiate lactic acid bacteria: Lactobacillus plantarum, L. delbrueckii subsp. bulgaricus and Streptococcus salivarius subsp. thermophilus. The strain-specific and species-specific differentiations are possible under different annealing temperature. Additional fragments, which are synthesized outside the framework of gene 16S rRNA reading, provide for the strain-specific type of differentiation, and the fragment F864 read in the gene 16S rRNA permits identifying L. plantarum.

  10. Evaluation of the Influence of Specific Surface Treatments of RBA on a Set of Properties of Concrete.

    Science.gov (United States)

    Ondova, Marcela; Sicakova, Alena

    2016-03-03

    High water absorption of recycled brick aggregate (RBA) is one of the most discussed parameters in terms of its application in the production of concrete-its influence on the amount of mixing water and, hence, the quality of the concrete, is usually considered negative. In this paper, different methods of decreasing the absorption of RBA and, consequently, the impact on the properties of concrete, are described. The RBA has been treated to decrease the water absorption capacity by impregnation approach using specific impregnators. Afterwards, the RBA samples have been dried at two different temperatures in the laboratory oven-20 and 90 °C. Concretes using 4/8 fraction of the treated RBA instead of natural aggregate (NA) have been mixed and tested. The effectiveness of the RBA treatments have been evaluated on the basis of their influence on the properties of the hardened concrete; by means of the following tests: flexural strength, compressive strength, capillarity, total water absorption capacity, depth of water penetration under pressure, and frost resistance. The method of ranking by ordinal scale has been used as it is suitable for the comparison of a large set of results, while results have been analyzed in terms of the most important technological parameter that influences the quality of the concrete-effective water content. Out of all the tested surface-treatments of RBA, treatment by sodium water glass has the best potential for reduction of the water/cement (w/c) ratio. When the effective w/c ratio is kept within standard limits, concretes containing treated RBA are possible to be specified for various exposure classes and manufacturing in practice. The experiment confirms that at a constant amount of mixing water, with decreasing water absorption of RBA, the effective amount of water in the concrete increases and, hence, the final properties of the concrete decrease (get worse). As the water absorption of the RBA declines, there is a potential for the

  11. Evaluation of the Influence of Specific Surface Treatments of RBA on a Set of Properties of Concrete

    Directory of Open Access Journals (Sweden)

    Marcela Ondova

    2016-03-01

    Full Text Available High water absorption of recycled brick aggregate (RBA is one of the most discussed parameters in terms of its application in the production of concrete—its influence on the amount of mixing water and, hence, the quality of the concrete, is usually considered negative. In this paper, different methods of decreasing the absorption of RBA and, consequently, the impact on the properties of concrete, are described. The RBA has been treated to decrease the water absorption capacity by impregnation approach using specific impregnators. Afterwards, the RBA samples have been dried at two different temperatures in the laboratory oven—20 and 90 °C. Concretes using 4/8 fraction of the treated RBA instead of natural aggregate (NA have been mixed and tested. The effectiveness of the RBA treatments have been evaluated on the basis of their influence on the properties of the hardened concrete; by means of the following tests: flexural strength, compressive strength, capillarity, total water absorption capacity, depth of water penetration under pressure, and frost resistance. The method of ranking by ordinal scale has been used as it is suitable for the comparison of a large set of results, while results have been analyzed in terms of the most important technological parameter that influences the quality of the concrete-effective water content. Out of all the tested surface-treatments of RBA, treatment by sodium water glass has the best potential for reduction of the water/cement (w/c ratio. When the effective w/c ratio is kept within standard limits, concretes containing treated RBA are possible to be specified for various exposure classes and manufacturing in practice. The experiment confirms that at a constant amount of mixing water, with decreasing water absorption of RBA, the effective amount of water in the concrete increases and, hence, the final properties of the concrete decrease (get worse. As the water absorption of the RBA declines, there is a

  12. A practical primer on geostatistics

    Science.gov (United States)

    Olea, Ricardo A.

    2009-01-01

    has significant methodological implications.Historical Remarks—As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields.Pioneers—Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorologyCalculations—Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations.Software—For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics.Organization of the Primer—The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of these main

  13. Tools for Ultraspecific Probe/Primer Design

    National Research Council Canada - National Science Library

    Fofanov, Yurly

    2006-01-01

    .... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...

  14. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.

  15. Hexavalent Chromium IV-Free Primer Development

    Science.gov (United States)

    Alldredge, Michael J.; Buck, Amy L.

    2015-01-01

    Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

  16. Quantitative Microbial Risk Assessment Tutorial - Primer

    Science.gov (United States)

    This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...

  17. Menopause 101: A Primer for the Perimenopausal

    Science.gov (United States)

    ... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

  18. Development of Candida-Specific Real-Time PCR Assays for the Detection and Identification of Eight Medically Important Candida Species.

    Science.gov (United States)

    Zhang, Jing; Hung, Guo-Chiuan; Nagamine, Kenjiro; Li, Bingjie; Tsai, Shien; Lo, Shyh-Ching

    2016-01-01

    Culture-based identification methods have been the gold standard for the diagnosis of fungal infection. Currently, molecular technologies such as real-time PCR assays with short turnaround time can provide desirable alternatives for the rapid detection of Candida microbes. However, most of the published PCR primer sets are not Candida specific and likely to amplify DNA from common environmental contaminants, such as Aspergillus microbes. In this study, we designed pan-Candida primer sets based on the ribosomal DNA-coding regions conserved within Candida but distinct from those of Aspergillus and Penicillium. We demonstrate that the final two selected pan-Candida primer sets would not amplify Aspergillus DNA and could be used to differentiate eight medically important Candida pathogens in real-time PCR assays based on their melting profiles, with a sensitivity of detection as low as 10 fg of Candida genomic DNA. Moreover, we further evaluated and selected species-specific primer sets covering Candida albicans, Candida glabrata, Candida tropicalis, and Candida dubliniensis and show that they had high sensitivity and specificity. These real-time PCR primer sets could potentially be assembled into a single PCR array for the rapid detection of Candida species in various clinical settings, such as corneal transplantation.

  19. Relativistic Astrophysics and Cosmology: A Primer

    International Nuclear Information System (INIS)

    Abramowicz, Marek A

    2007-01-01

    'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as the text. Their students will be in the author

  20. Microsatellite Primers in the Foundation Tree Species Pinus edulis and P. monophylla (Pinaceae

    Directory of Open Access Journals (Sweden)

    Andrew L. Krohn

    2013-07-01

    Full Text Available Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species.

  1. VizPrimer: a web server for visualized PCR primer design based on known gene structure.

    Science.gov (United States)

    Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2011-12-15

    The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

  2. Canadian municipal carbon trading primer

    International Nuclear Information System (INIS)

    Seskus, A.

    2002-01-01

    The trading of greenhouse gas (GHG) emissions is being suggested as an effective economic way to meet Canada's Kyoto target. Emissions trading is a market-based instrument that can help achieve environmental improvements while using the market to absorb the economical and effective measures to achieve emissions reductions. Placing a value on emissions means that in order to minimize costs, companies will be motivated to apply the lowest-cost emission reductions possible for regulatory approval. The two main types of emissions trading that exist in Canada are the trading of emissions that lead to the formation of smog or acid rain, and the trading of greenhouse gas emissions that lead to climate change. Since carbon dioxide is the most prevalent GHG, making up approximately 75 per cent of Canadian GHG emissions, the trading of units of GHGs is often referred to as carbon trading. The impact that emissions trading will have on municipal operations was the focus of this primer. The trading of GHG involves buying and selling of allowances of GHGs between contracting parties, usually between one party that is short of GHG credits and another that has excess credits. The 3 common approaches to emissions trading include allowance trading (cap and trade), credit trading (baseline and credit), and a hybrid system which combines both credit and allowance trading systems. The issues that impact municipalities include the debate regarding who owns the credits from landfills, particularly if power is generated using landfill gas and the power is sold as green power. Other viable questions were also addressed, including who can claim emission reduction credits if a city implements energy efficiency projects, or fuel substitution programs. Also, will municipalities be allowed to trade internationally, for example, with municipalities in the United States, and how should they spend their money earned from selling credits. This report also presents highlights from 3 emissions

  3. Point-of-Decision Signs and Stair Use in a University Worksite Setting: General Versus Specific Messages.

    Science.gov (United States)

    Eckhardt, Mary R; Kerr, Jacqueline; Taylor, Wendell C

    2015-01-01

    This study tested the effectiveness of two point-of-decision signs to increase stair use and investigated message content by comparing signs with general and specific messages. This study used a quasi-experimental time series design, including a 2-week baseline period: 2 weeks with a general message and 2 weeks with a specific message. The signs were placed in an eight-story university building. The subjects comprised all adults entering the building. During the study, 2997 observations of stair/elevator choice were made. A stair-prompt sign with a general message and a sign with a specific message served as the interventions. Observers measured stair/elevator choice, demographics, and traffic volume. Logistic regression analyses were employed, adjusting for covariates. The specific sign intervention showed significantly increased odds of stair use compared to baseline (odds ratio [OR] = 2.04, 95% confidence interval [CI] = 1.46-2.84). The odds of stair use were also significantly greater with the specific sign than the general sign (OR = 1.57, 95% CI = 1.13-2.20). Only the specific sign significantly increased stair use. The results indicate that a specific message may be more effective at promoting stair use.

  4. Development of a Species-specific PCR Assay for Three Xanthomonas Species, Causing Bulb and Flower Diseases, Based on Their Genome Sequences

    Directory of Open Access Journals (Sweden)

    Chang-Gi Back

    2015-09-01

    Full Text Available In this study, we developed a species-specific PCR assay for rapid and accurate detection of three Xanthomonas species, X. axonopodis pv. poinsettiicola (XAP, X. hyacinthi (XH and X. campestris pv. zantedeschiae (XCZ, based on their draft genome sequences. XAP, XH and XCZ genomes consist of single chromosomes that contain 5,221, 4,395 and 7,986 protein coding genes, respectively. Species-specific primers were designed from variable regions of the draft genome sequence data and assessed by a PCR-based detection method. These primers were also tested for specificity against 17 allied Xanthomonas species as well as against the host DNA and the microbial community of the host surface. Three primer sets were found to be very specific and no amplification product was obtained with the host DNA and the microbial community of the host surface. In addition, a detection limit of 1 pg/μl per PCR reaction was detected when these primer sets were used to amplify corresponding bacterial DNAs. Therefore, these primer sets and the developed species-specific PCR assay represent a valuable, sensitive, and rapid diagnostic tool that can be used to detect three specific pathogens at early stages of infection and may help control diseases.

  5. Quantification of specific E. coli in gut mucosa from Crohn's disease patients

    DEFF Research Database (Denmark)

    Jensen, Stina Rikke; Fink, Lisbeth Nielsen; Struve, Carsten

    2011-01-01

    We here present a method based on qRT-PCR to quantify E. coli LF82 in intestinal human samples. Two different primer-probe sets were designed to detect LF82, and a third to target total E. coli. The assay showed high robustness and specificity for detection of LF82 in the presence of intestinal...

  6. Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

    Directory of Open Access Journals (Sweden)

    Ni Luh Putu Indi Dharmayanti

    2016-07-01

    Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

  7. Fusion primer and nested integrated PCR (FPNI-PCR: a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

    Directory of Open Access Journals (Sweden)

    Wang Zhen

    2011-11-01

    Full Text Available Abstract Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs. These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures.

  8. Specific PCR detection of Fusarium oxysporum f. sp. raphani: a causal agent of Fusarium wilt on radish plants.

    Science.gov (United States)

    Kim, H; Hwang, S-M; Lee, J H; Oh, M; Han, J W; Choi, G J

    2017-08-01

    Fusarium oxysporum, a causal agent of Fusarium wilt, is one of the most important fungal pathogens worldwide, and detection of F. oxysporum DNA at the forma specialis level is crucial for disease diagnosis and control. In this study, two novel F. oxysporum f. sp. raphani (For)-specific primer sets were designed, FOR1-F/FOR1-R and FOR2-F/FOR2-R, to target FOQG_17868 and FOQG_17869 ORFs, respectively, which were selected based on the genome comparison of other formae speciales of F. oxysporum including conglutinans, cubense, lycopersici, melonis, and pisi. The primer sets FOR1-F/FOR1-R and FOR2-F/FOR2-R that amplified a 610- and 425-bp DNA fragment, respectively, were specific to For isolates which was confirmed using a total of 40 F. oxysporum isolates. From infected plants, the FOR2-F/FOR2-R primer set directly detected the DNA fragment of For isolates even when the radish plants were collected in their early stage of disease development. Although the loci targeted by the For-specific primer sets were not likely involved in the pathogenesis, the primer set FOR2-F/FOR2-R is available for the determination of pathogenicity of radish-infecting F. oxysporum isolates. This study is the first report providing novel primer sets to detect F. oxysporum f. sp. raphani. Because plant pathogenic Fusarium oxysporum has been classified into special forms based on its host specificity, identification of F. oxysporum usually requires a pathogenicity assay as well as knowledge of the morphological characteristics. For rapid and reliable diagnosis, this study provides PCR primer sets that specifically detect Fusarium oxysporum f. sp. raphani (For) which is a devastating pathogen of radish plants. Because one of the primer sets directly detected the DNA fragment of For isolates from infected plants, the specific PCR method demonstrated in this study will provide a foundation for integrated disease management practices in commodity crops. © 2017 The Society for Applied Microbiology.

  9. Bamgineer: Introduction of simulated allele-specific copy number variants into exome and targeted sequence data sets

    OpenAIRE

    Bruce, Jeff; Pugh, Trevor; Samadian, Soroush

    2017-01-01

    Somatic copy number variations (CNVs) play a crucial role in development of many human cancers. The broad availability of next-generation sequencing data has enabled the development of algorithms to computationally infer CNV profiles from a variety of data types including exome and targeted sequence data; currently the most prevalent types of cancer genomics data. However, systemic evaluation and comparison of these tools remains challenging due to a lack of ground truth reference sets. To ad...

  10. KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input

    International Nuclear Information System (INIS)

    Busch, R.D.

    2003-01-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a

  11. A primer on physical-layer network coding

    CERN Document Server

    Liew, Soung Chang; Zhang, Shengli

    2015-01-01

    The concept of physical-layer network coding (PNC) was proposed in 2006 for application in wireless networks. Since then it has developed into a subfield of communications and networking with a wide following. This book is a primer on PNC. It is the outcome of a set of lecture notes for a course for beginning graduate students at The Chinese University of Hong Kong. The target audience is expected to have some prior background knowledge in communication theory and wireless communications, but not working knowledge at the research level. Indeed, a goal of this book/course is to allow the reader

  12. Accelerating MATLAB with GPU computing a primer with examples

    CERN Document Server

    Suh, Jung W

    2013-01-01

    Beyond simulation and algorithm development, many developers increasingly use MATLAB even for product deployment in computationally heavy fields. This often demands that MATLAB codes run faster by leveraging the distributed parallelism of Graphics Processing Units (GPUs). While MATLAB successfully provides high-level functions as a simulation tool for rapid prototyping, the underlying details and knowledge needed for utilizing GPUs make MATLAB users hesitate to step into it. Accelerating MATLAB with GPUs offers a primer on bridging this gap. Starting with the basics, setting up MATLAB for

  13. Comparative genomic analysis of SET domain family reveals the origin, expansion, and putative function of the arthropod-specific SmydA genes as histone modifiers in insects.

    Science.gov (United States)

    Jiang, Feng; Liu, Qing; Wang, Yanli; Zhang, Jie; Wang, Huimin; Song, Tianqi; Yang, Meiling; Wang, Xianhui; Kang, Le

    2017-06-01

    The SET domain is an evolutionarily conserved motif present in histone lysine methyltransferases, which are important in the regulation of chromatin and gene expression in animals. In this study, we searched for SET domain-containing genes (SET genes) in all of the 147 arthropod genomes sequenced at the time of carrying out this experiment to understand the evolutionary history by which SET domains have evolved in insects. Phylogenetic and ancestral state reconstruction analysis revealed an arthropod-specific SET gene family, named SmydA, that is ancestral to arthropod animals and specifically diversified during insect evolution. Considering that pseudogenization is the most probable fate of the new emerging gene copies, we provided experimental and evolutionary evidence to demonstrate their essential functions. Fluorescence in situ hybridization analysis and in vitro methyltransferase activity assays showed that the SmydA-2 gene was transcriptionally active and retained the original histone methylation activity. Expression knockdown by RNA interference significantly increased mortality, implying that the SmydA genes may be essential for insect survival. We further showed predominantly strong purifying selection on the SmydA gene family and a potential association between the regulation of gene expression and insect phenotypic plasticity by transcriptome analysis. Overall, these data suggest that the SmydA gene family retains essential functions that may possibly define novel regulatory pathways in insects. This work provides insights into the roles of lineage-specific domain duplication in insect evolution. © The Authors 2017. Published by Oxford University Press.

  14. UniPrime2: a web service providing easier Universal Primer design.

    Science.gov (United States)

    Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

    2009-07-01

    The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

  15. Heat transfer calculations for the High Flux Isotope Reactor (HFIR). Technical specifications: bases for safety limits and limiting safety system settings

    International Nuclear Information System (INIS)

    Sims, T.M.; Swanks, J.H.

    1977-09-01

    Heat transfer analyses, in support of the preparation of the HFIR technical specifications, were made to establish the bases for the safety limits and limiting safety system settings applicable to the HFIR. The results of these analyses, along with the detailed bases, are presented

  16. Support Vector Data Description Model to Map Specific Land Cover with Optimal Parameters Determined from a Window-Based Validation Set

    Directory of Open Access Journals (Sweden)

    Jinshui Zhang

    2017-04-01

    Full Text Available This paper developed an approach, the window-based validation set for support vector data description (WVS-SVDD, to determine optimal parameters for support vector data description (SVDD model to map specific land cover by integrating training and window-based validation sets. Compared to the conventional approach where the validation set included target and outlier pixels selected visually and randomly, the validation set derived from WVS-SVDD constructed a tightened hypersphere because of the compact constraint by the outlier pixels which were located neighboring to the target class in the spectral feature space. The overall accuracies for wheat and bare land achieved were as high as 89.25% and 83.65%, respectively. However, target class was underestimated because the validation set covers only a small fraction of the heterogeneous spectra of the target class. The different window sizes were then tested to acquire more wheat pixels for validation set. The results showed that classification accuracy increased with the increasing window size and the overall accuracies were higher than 88% at all window size scales. Moreover, WVS-SVDD showed much less sensitivity to the untrained classes than the multi-class support vector machine (SVM method. Therefore, the developed method showed its merits using the optimal parameters, tradeoff coefficient (C and kernel width (s, in mapping homogeneous specific land cover.

  17. Do country-specific preference weights matter in the choice of mapping algorithms? The case of mapping the Diabetes-39 onto eight country-specific EQ-5D-5L value sets.

    Science.gov (United States)

    Lamu, Admassu N; Chen, Gang; Gamst-Klaussen, Thor; Olsen, Jan Abel

    2018-03-22

    To develop mapping algorithms that transform Diabetes-39 (D-39) scores onto EQ-5D-5L utility values for each of eight recently published country-specific EQ-5D-5L value sets, and to compare mapping functions across the EQ-5D-5L value sets. Data include 924 individuals with self-reported diabetes from six countries. The D-39 dimensions, age and gender were used as potential predictors for EQ-5D-5L utilities, which were scored using value sets from eight countries (England, Netherland, Spain, Canada, Uruguay, China, Japan and Korea). Ordinary least squares, generalised linear model, beta binomial regression, fractional regression, MM estimation and censored least absolute deviation were used to estimate the mapping algorithms. The optimal algorithm for each country-specific value set was primarily selected based on normalised root mean square error (NRMSE), normalised mean absolute error (NMAE) and adjusted-r 2 . Cross-validation with fivefold approach was conducted to test the generalizability of each model. The fractional regression model with loglog as a link function consistently performed best in all country-specific value sets. For instance, the NRMSE (0.1282) and NMAE (0.0914) were the lowest, while adjusted-r 2 was the highest (52.5%) when the English value set was considered. Among D-39 dimensions, the energy and mobility was the only one that was consistently significant for all models. The D-39 can be mapped onto the EQ-5D-5L utilities with good predictive accuracy. The fractional regression model, which is appropriate for handling bounded outcomes, outperformed other candidate methods in all country-specific value sets. However, the regression coefficients differed reflecting preference heterogeneity across countries.

  18. Species-specific PCR primers for detection of Xanthomonas vesicatoria

    Czech Academy of Sciences Publication Activity Database

    Beran, P.; Mráz, Ivan

    2013-01-01

    Roč. 43, Jan (2013), s. 213-215 ISSN 0261-2194 R&D Projects: GA MZe QH71229 Institutional support: RVO:60077344 Keywords : Bacterial spot * Tomato * Pepper Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.539, year: 2013

  19. MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

    Science.gov (United States)

    Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

    2016-01-01

    Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic

  20. Climate Change, Health, and Communication: A Primer.

    Science.gov (United States)

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  1. A primer of analytical mechanics

    CERN Document Server

    Strocchi, Franco

    2018-01-01

    This book presents the basic elements of Analytical Mechanics, starting from the physical motivations that favor it with respect to the Newtonian Mechanics in Cartesian coordinates. Rather than presenting Analytical Mechanics mainly as a formal development of Newtonian Mechanics, it highlights its effectiveness due to the following five important achievements: 1) the most economical description of time evolution in terms of the minimal set of coordinates, so that there are no constraint forces in their evolution equations; 2) the form invariance of the evolution equations, which automatically solves the problem of fictitious forces; 3) only one scalar function encodes the formulation of the dynamics, rather than the full set of vectors which describe the forces in Cartesian Newtonian Mechanics; 4) in the Hamiltonian formulation, the corresponding evolution equations are of first order in time and are fully governed by the Hamiltonian function (usually corresponding to the energy); 5) the emergence of the Hami...

  2. SPECIFIC FEATURES OF PSYCHOLOGICAL CARE FOR PATIENTS WITH PULMONARY TUBERCULOSIS DURING INTENSIVE CHEMOTHERAPY (IN THE HOSPITAL SETTING

    Directory of Open Access Journals (Sweden)

    V. V. Streltsov

    2014-01-01

    Full Text Available The psychological trauma of pulmonary tuberculosis and long-term treatment may cause the development and progression of different borderline neuropsychic disorders in patients, lower therapeutic effectiveness, and prematurely discontinue therapy. The main practical tasks of psychological rehabilitation during intensive treatment are to render care for a patient during his adaptation to the hospital setting, to correct inadequate attitude towards disease, and to motivate active cooperation with specialists. Competent psychological support of drug therapy promotes a reduction in the intensity of psychic and somatic experiences in the patient and an increase in his psychological resources. A respective microclimate in the tuberculosis control facility and a patient-centered doctorpatient model should be considered as the most important rehabilitation factors.

  3. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  4. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  5. Toxoplasmosis – A Global Threat. Correlation of Latent Toxoplasmosis with Specific Disease Burden in a Set of 88 Countries

    Science.gov (United States)

    Flegr, Jaroslav; Prandota, Joseph; Sovičková, Michaela; Israili, Zafar H.

    2014-01-01

    Background Toxoplasmosis is becoming a global health hazard as it infects 30–50% of the world human population. Clinically, the life-long presence of the parasite in tissues of a majority of infected individuals is usually considered asymptomatic. However, a number of studies show that this ‘asymptomatic infection’ may also lead to development of other human pathologies. Aims of the Study The purpose of the study was to collect available geoepidemiological data on seroprevalence of toxoplasmosis and search for its relationship with mortality and disability rates in different countries. Methods and Findings Prevalence data published between 1995–2008 for women in child-bearing age were collected for 88 countries (29 European). The association between prevalence of toxoplasmosis and specific disease burden estimated with age-standardized Disability Adjusted Life Year (DALY) or with mortality, was calculated using General Linear Method with Gross Domestic Product per capita (GDP), geolatitude and humidity as covariates, and also using nonparametric partial Kendall correlation test with GDP as a covariate. The prevalence of toxoplasmosis correlated with specific disease burden in particular countries explaining 23% of variability in disease burden in Europe. The analyses revealed that for example, DALY of 23 of 128 analyzed diseases and disease categories on the WHO list showed correlations (18 positive, 5 negative) with prevalence of toxoplasmosis and another 12 diseases showed positive trends (ptoxoplasmosis and specific diseases/clinical entities, possible pathophysiological, biochemical and molecular explanations are presented. Conclusions The seroprevalence of toxoplasmosis correlated with various disease burden. Statistical associations does not necessarily mean causality. The precautionary principle suggests however that possible role of toxoplasmosis as a triggering factor responsible for development of several clinical entities deserves much more

  6. Toxoplasmosis--a global threat. Correlation of latent toxoplasmosis with specific disease burden in a set of 88 countries.

    Science.gov (United States)

    Flegr, Jaroslav; Prandota, Joseph; Sovičková, Michaela; Israili, Zafar H

    2014-01-01

    Toxoplasmosis is becoming a global health hazard as it infects 30-50% of the world human population. Clinically, the life-long presence of the parasite in tissues of a majority of infected individuals is usually considered asymptomatic. However, a number of studies show that this 'asymptomatic infection' may also lead to development of other human pathologies. The purpose of the study was to collect available geoepidemiological data on seroprevalence of toxoplasmosis and search for its relationship with mortality and disability rates in different countries. Prevalence data published between 1995-2008 for women in child-bearing age were collected for 88 countries (29 European). The association between prevalence of toxoplasmosis and specific disease burden estimated with age-standardized Disability Adjusted Life Year (DALY) or with mortality, was calculated using General Linear Method with Gross Domestic Product per capita (GDP), geolatitude and humidity as covariates, and also using nonparametric partial Kendall correlation test with GDP as a covariate. The prevalence of toxoplasmosis correlated with specific disease burden in particular countries explaining 23% of variability in disease burden in Europe. The analyses revealed that for example, DALY of 23 of 128 analyzed diseases and disease categories on the WHO list showed correlations (18 positive, 5 negative) with prevalence of toxoplasmosis and another 12 diseases showed positive trends (ptoxoplasmosis and specific diseases/clinical entities, possible pathophysiological, biochemical and molecular explanations are presented. The seroprevalence of toxoplasmosis correlated with various disease burden. Statistical associations does not necessarily mean causality. The precautionary principle suggests however that possible role of toxoplasmosis as a triggering factor responsible for development of several clinical entities deserves much more attention and financial support both in everyday medical practice and

  7. Accounting for both local aquatic community composition and bioavailability in setting site-specific quality standards for zinc.

    Science.gov (United States)

    Peters, Adam; Simpson, Peter; Moccia, Alessandra

    2014-01-01

    Recent years have seen considerable improvement in water quality standards (QS) for metals by taking account of the effect of local water chemistry conditions on their bioavailability. We describe preliminary efforts to further refine water quality standards, by taking account of the composition of the local ecological community (the ultimate protection objective) in addition to bioavailability. Relevance of QS to the local ecological community is critical as it is important to minimise instances where quality classification using QS does not reconcile with a quality classification based on an assessment of the composition of the local ecology (e.g. using benthic macroinvertebrate quality assessment metrics such as River InVertebrate Prediction and Classification System (RIVPACS)), particularly where ecology is assessed to be at good or better status, whilst chemical quality is determined to be failing relevant standards. The alternative approach outlined here describes a method to derive a site-specific species sensitivity distribution (SSD) based on the ecological community which is expected to be present at the site in the absence of anthropogenic pressures (reference conditions). The method combines a conventional laboratory ecotoxicity dataset normalised for bioavailability with field measurements of the response of benthic macroinvertebrate abundance to chemical exposure. Site-specific QSref are then derived from the 5%ile of this SSD. Using this method, site QSref have been derived for zinc in an area impacted by historic mining activities. Application of QSref can result in greater agreement between chemical and ecological metrics of environmental quality compared with the use of either conventional (QScon) or bioavailability-based QS (QSbio). In addition to zinc, the approach is likely to be applicable to other metals and possibly other types of chemical stressors (e.g. pesticides). However, the methodology for deriving site-specific targets requires

  8. Ultrasensitive human thyrotropin (h TSH) immunoradiometric assay (IRMA) set up, through identification and minimization of non specific bindings

    International Nuclear Information System (INIS)

    Peroni, C.N.

    1994-01-01

    An IRMA of h TSH, based on magnetic solid phase separation, was studied especially for what concerns its non specific bindings. These were identified as a product of the interaction between an altered form of radioiodinated anti-h TSH monoclonal antibody ( 125 I-m AB) and the uncoupled magnetizable cellulose particle (matrix). Apparently this form of 125 I-m AB is a type of aggregate that can be partly resolved from the main peak on Sephadex G-200 and further minimized via a single pre-incubation with the same matrix. Solid phase saturation with milk proteins, tracer storage at 4 0 C and serum addition during incubation were also found particularly effective is preventing its formation. These findings were used in order to reproducibly decrease non specific bindings to values 60 /B O ) up to values of 300-500. This way we obtained h TSH radio assays with functional sensitivities of about 0.05 m IU/L and analytical sensitivities of the order of 0.02 m IU/L, which classify them at least as among the best second generation assays and that are excellent indeed for magnetic IRMA s. A more optimistic sensitivity calculation, based on Rodbard's definition, provided values down to 0.008 m IU/L. Such sensitivities, moreover, were obtained in a very reproducible way and all over the useful tracer life. (author). 83 refs, 13 figs, 25 tabs

  9. Muscle-Specific Histone H3K36 Dimethyltransferase SET-18 Shortens Lifespan of Caenorhabditis elegans by Repressing daf-16a Expression

    Directory of Open Access Journals (Sweden)

    Liangping Su

    2018-03-01

    Full Text Available Mounting evidence shows that histone methylation, a typical epigenetic mark, is crucial for gene expression regulation during aging. Decreased trimethylation of Lys 36 on histone H3 (H3K36me3 in worms and yeast is reported to shorten lifespan. The function of H3K36me2 in aging remains unclear. In this study, we identified Caenorhabditis elegans SET-18 as a histone H3K36 dimethyltransferase. SET-18 deletion extended lifespan and increased oxidative stress resistance, dependent on daf-16 activity in the insulin/IGF pathway. In set-18 mutants, transcription of daf-16 isoform a (daf-16a was specifically upregulated. Accordingly, a decrease in H3K36me2 on daf-16a promoter was observed. Muscle-specific expression of SET-18 increased in aged worms (day 7 and day 11, attributable to elevation of global H3K36me2 and inhibition of daf-16a expression. Consequently, longevity was shortened. These findings suggested that chromatic repression mediated by tissue-specific H3K36 dimethyltransferase might be detrimental to lifespan and may have implications in human age-related diseases.

  10. Muscle-Specific Histone H3K36 Dimethyltransferase SET-18 Shortens Lifespan of Caenorhabditis elegans by Repressing daf-16a Expression.

    Science.gov (United States)

    Su, Liangping; Li, Hongyuan; Huang, Cheng; Zhao, Tingting; Zhang, Yongjun; Ba, Xueqing; Li, Zhongwei; Zhang, Yu; Huang, Baiqu; Lu, Jun; Zhao, Yanmei; Li, Xiaoxue

    2018-03-06

    Mounting evidence shows that histone methylation, a typical epigenetic mark, is crucial for gene expression regulation during aging. Decreased trimethylation of Lys 36 on histone H3 (H3K36me3) in worms and yeast is reported to shorten lifespan. The function of H3K36me2 in aging remains unclear. In this study, we identified Caenorhabditis elegans SET-18 as a histone H3K36 dimethyltransferase. SET-18 deletion extended lifespan and increased oxidative stress resistance, dependent on daf-16 activity in the insulin/IGF pathway. In set-18 mutants, transcription of daf-16 isoform a (daf-16a) was specifically upregulated. Accordingly, a decrease in H3K36me2 on daf-16a promoter was observed. Muscle-specific expression of SET-18 increased in aged worms (day 7 and day 11), attributable to elevation of global H3K36me2 and inhibition of daf-16a expression. Consequently, longevity was shortened. These findings suggested that chromatic repression mediated by tissue-specific H3K36 dimethyltransferase might be detrimental to lifespan and may have implications in human age-related diseases. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  11. Application of hierarchical oligonucleotide primer extension (HOPE) to assess relative abundances of ammonia- and nitrite-oxidizing bacteria

    KAUST Repository

    Scarascia, Giantommaso; Cheng, Hong; Harb, Moustapha; Hong, Pei-Ying

    2017-01-01

    for ensuring the efficiency of nitrification in water treatment systems. Hierarchical oligonucleotide primer extension (HOPE), previously developed to rapidly quantify relative abundances of specific microbial groups of interest, was applied in this study

  12. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  13. Construção de iniciadores e otimização de ensaios de PCR e de nested-PCR para a detecção específica de Tritrichomonas foetus Primers design and optimization of PCR and nested-PCR assays for the specific detection of Tritrichomonas foetus

    Directory of Open Access Journals (Sweden)

    Paula Rogério Fernandes

    2008-09-01

    Full Text Available Tritrichomonas foetus é um protozoário patogênico responsável por doença venérea em bovinos conhecida por tricomonose genital bovina. A tricomonose bovina é uma doença venérea causada pelo protozoário cujo habitat natural é o trato genital. Os protocolos já desenvolvidos para o diagnóstico deste parasito por PCR, apesar de serem eficazes na identificação do DNA genômico alvo, promovem algumas amplificações inespecíficas ou são incapazes de distinguir T. foetus das outras espécies do gênero. O presente trabalho foi desenvolvido com o objetivo de estabelecer e otimizar protocolos de ensaio de PCR e nested-PCR para o diagnóstico específico de T. foetus, empregando-se novos iniciadores, selecionados do alinhamento das seqüências dos genes 18S rRNA, 5,8S rRNA, 28S rRNA e dos espaços transcritos do rDNA (ITS1 e ITS2. Um par de iniciadores foi construído para amplificação gênero-específica de um fragmento de 648 pares de base e outros dois para a obtenção de produtos espécie- específicos de 343 e 429 pb. Nenhuma reação cruzada foi observada frente ao DNA genômico de Bos taurus ou de microrganismos responsáveis por infecções genitais. A sensibilidade dos ensaios de PCR e de nested-PCR apresentados neste estudo permitiu um limiar de detecção de até dois parasitos.Tritrichomonas foetus is a pathogenic protozoan that causes a venereal disease in cattle known as bovine genital tricomonosis. In spite of the efficacy to recognize the target genomic DNA, the protocols so far developed for the diagnosis of this organism by PCR promote some inespecific amplifications or they are unable to discriminate T. foetus against other species within the genus. The objective of this study was to assess and optimize PCR and nested-PCR assays for the specific diagnosis of T. foetus, using novel primers selected from the alignment of sequences of the genes 18S rRNA, 5.8S rRNA, 28S rRNA and of the internal transcribed spacers of the

  14. FullSSR: Microsatellite Finder and Primer Designer

    Directory of Open Access Journals (Sweden)

    Sebastián Metz

    2016-01-01

    Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.

  15. A primer on motor vehicle air pollution.

    Science.gov (United States)

    1973-01-01

    This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...

  16. A Primer on Basic Effect Size Concepts.

    Science.gov (United States)

    Elmore, Patricia B.; Rotou, Ourania

    The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…

  17. Scrimer: designing primers from transcriptome data

    Czech Academy of Sciences Publication Activity Database

    Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

    2015-01-01

    Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015

  18. High-Throughput Sequencing Reveals Diverse Sets of Conserved, Nonconserved, and Species-Specific miRNAs in Jute

    Directory of Open Access Journals (Sweden)

    Md. Tariqul Islam

    2015-01-01

    Full Text Available MicroRNAs play a pivotal role in regulating a broad range of biological processes, acting by cleaving mRNAs or by translational repression. A group of plant microRNAs are evolutionarily conserved; however, others are expressed in a species-specific manner. Jute is an agroeconomically important fibre crop; nonetheless, no practical information is available for microRNAs in jute to date. In this study, Illumina sequencing revealed a total of 227 known microRNAs and 17 potential novel microRNA candidates in jute, of which 164 belong to 23 conserved families and the remaining 63 belong to 58 nonconserved families. Among a total of 81 identified microRNA families, 116 potential target genes were predicted for 39 families and 11 targets were predicted for 4 among the 17 identified novel microRNAs. For understanding better the functions of microRNAs, target genes were analyzed by Gene Ontology and their pathways illustrated by KEGG pathway analyses. The presence of microRNAs identified in jute was validated by stem-loop RT-PCR followed by end point PCR and qPCR for randomly selected 20 known and novel microRNAs. This study exhaustively identifies microRNAs and their target genes in jute which will ultimately pave the way for understanding their role in this crop and other crops.

  19. Settings for Physical Activity – Developing a Site-specific Physical Activity Behavior Model based on Multi-level Intervention Studies

    DEFF Research Database (Denmark)

    Troelsen, Jens; Klinker, Charlotte Demant; Breum, Lars

    Settings for Physical Activity – Developing a Site-specific Physical Activity Behavior Model based on Multi-level Intervention Studies Introduction: Ecological models of health behavior have potential as theoretical framework to comprehend the multiple levels of factors influencing physical...... to be taken into consideration. A theoretical implication of this finding is to develop a site-specific physical activity behavior model adding a layered structure to the ecological model representing the determinants related to the specific site. Support: This study was supported by TrygFonden, Realdania...... activity (PA). The potential is shown by the fact that there has been a dramatic increase in application of ecological models in research and practice. One proposed core principle is that an ecological model is most powerful if the model is behavior-specific. However, based on multi-level interventions...

  20. Specific food preferences of older adults with a poor appetite. A forced-choice test conducted in various care settings.

    Science.gov (United States)

    van der Meij, Barbara S; Wijnhoven, Hanneke A H; Finlayson, Graham S; Oosten, Babette S H; Visser, Marjolein

    2015-07-01

    A poor appetite in older adults is an important determinant of reduced food intake and undernutrition. Food preferences may influence food intake. The aim of this study was to investigate food preferences of older adults with a poor appetite and compare these with preferences of older adults with a good appetite. Older adults (n = 349, aged 65-101 years) in nursing/residential care homes, hospitals or at home receiving home care participated in a computer-based forced-choice food preference assessment. Self-reported appetite in the past week was classified as 'good' or 'poor' using a validated instrument. Food preferences were determined by counting the relative frequency of choices for food images according to 11 dichotomous categories: high/low 1) protein; 2) fat; 3) carbohydrates; 4) fiber; 5) variation; and 6) animal/vegetarian proteins; 7) sweet/savory taste; 8) solid/liquid texture; 9) dairy/non-dairy; with/without 10) sauce or 11) color variation. Specific food preferences in participants with a poor appetite were identified by one-sample t-tests comparing frequencies to the expected value of 48. Preference differences between those with a good and a poor appetite were analyzed using GLM adjusting for confounders. The results showed that older adults with a poor appetite (n = 113; 32.4%) preferred variation (51.6 vs. 48, P food preferences. Their preference for variation differs from those with a good appetite. These results may be used to develop meals that are preferred by older adults with poor appetite in order to increase food intake and prevent undernutrition. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. One-step isothermal detection of multiple KRAS mutations by forming SNP specific hairpins on a gold nanoshell.

    Science.gov (United States)

    Chung, Chan Ho; Kim, Joong Hyun

    2018-04-24

    We developed a one-step isothermal method for typing multiple KRAS mutations using a designed set of primers to form a hairpin on a gold nanoshell upon being ligated by a SNP specific DNA ligase after binding of targets. As a result, we could detect as low as 20 attomoles of KRAS mutations within 1 h.

  2. 北方汉族人动脉粥样硬化性脑梗死与人类白细胞抗原系统-Ⅱ类基因的关联:应用顺序特异性引物聚合酶链式反应技术%Association between atherosclerotic brain infarction and human leucocyte antigen-Ⅱ gene of the Han Nationality in north China: Technique of sequent and specific primer polymerase chain reaction

    Institute of Scientific and Technical Information of China (English)

    张双彦; 邬英全; 张宪忠; 曹峰林

    2005-01-01

    tendency and immunity imbalance of atherosclerotic brain infarction (ABI) have attracted the attention of many scholars at home and abroad, which suggests that immune mechanism plays a key role in ABI development. It has been found that ABI is related to polymorphism of human immune inheritance gene (HLA), particularly HLA-DR gene.OBJECTIVE: To investigate the correlation between HLA and ABI immune heredity.DESIGN: Single sample and single factor analysis.SETTING: Sino-Japanese Friendship Hospital of Jilin University; Neurological Department of the First Hospital of Harbin City.PARTICIPANTS: Totally 31 patients in experimental group and 30 healthy people in control group, whose three generations were of the Han Nationality in north China and who had no blood relation, were selected from Department of Neurology in First Hospital of Harbin between January 1998 and December 2000.METHODS: The experiment was conducted in the Blood Research Center of Department of Neurology in First Hospital of Harbin between June and December 2003.5 mL peripheral blood in both groups was taken to extract genome DNA with the previous method. Human HLA gene map had been described at gene bank in the Internet, in which mono-nucleic acid obtained from HLA of the sixth chromosome were retrieved. Each DR and DQ allele, sense primer and antisense primer were composed selectively. Amplification of DNA fragment was checked respectively and specifically. The primer was provided by Shanghai Gene Research Institute. PCR instrument (4 800) and its related reagents produced by PE Company (the US) were used. Fourfold table exact probability method was used to calculate the relative risk (RR) and P value.which was obviously higher than that of other sites (P < 0.05). However,associated with the ABI susceptible gene of the Han Nationality in north China.

  3. [Mobile geriatric rehabilitation in nursing homes, in short-term care facilities and private homes : Setting-specific analysis of nationwide treatment documentation (Part 2)].

    Science.gov (United States)

    Pippel, Kristina; Meinck, M; Lübke, N

    2017-06-01

    Mobile geriatric rehabilitation can be provided in the setting of nursing homes, short-term care (STC) facilities and exclusively in private homes. This study analyzed the common features and differences of mobile rehabilitation interventions in various settings. Stratified by setting 1,879 anonymized mobile geriatric rehabilitation treatments between 2011 and 2014 from 11 participating institutions were analyzed with respect to patient, process and outcome-related features. Significant differences between the settings nursing home (n = 514, 27 %), STC (n = 167, 9 %) and private homes (n = 1198, 64 %) were evident for mean age (83 years, 83 years and 80 years, respectively), percentage of women (72 %, 64 % and 55 %), degree of dependency on pre-existing care (92 %, 76 % and 64 %), total treatment sessions (TS, 38 TS, 42 TS and 41 TS), treatment duration (54 days, 61 days and 58 days) as well as the Barthel index at the start of rehabilitation (34 points, 39 points and 46 points) and the gain in the Barthel index (15 points, 21 points and 18 points), whereby the gain in the capacity for self-sufficiency was significant in all settings. The setting-specific evaluation of mobile geriatric rehabilitation showed differences for relevant patient, process and outcome-related features. Compared to inpatient rehabilitation mobile rehabilitation in all settings made an above average contribution to the rehabilitation of patients with pre-existing dependency on care. The gains in the capacity for self-sufficiency achieved in all settings support the efficacy of mobile geriatric rehabilitation under the current prerequisites for applicability.

  4. Statistics in Matlab a primer

    CERN Document Server

    Cho, MoonJung

    2014-01-01

    List of Tables Preface MATLAB BasicsDesktop Environment Getting Help and Other Documentation Data Import and Export Data I/O via the Command Line The Import Wizard Examples of Data I/O in MATLAB Data I/O with the Statistics Toolbox More Functions for Data I/O Data in MATLAB Data Objects in Base MATLAB Accessing Data Elements Examples of Joining Data Sets Data Types in the Statistics Toolbox Object-Oriented Programming Miscellaneous Topics File and Workspace Management Punctuation in MATLAB Arithmetic Operators Functions in MATLAB Summary and Further Reading Visualizing DataBasic Plot Functions Plotting 2-D Data Plotting 3-D Data Examples Scatter Plots Basic 2-D and 3-D Scatter Plots Scatter Plot Matrix Examples GUIs for Graphics Simple Plot Editing Plotting Tools Interface PLOTS Tab Summary and Further Reading Descriptive StatisticsMeasures of Location Means, Medians, and Modes Examples Measures of Dispersion Range Variance and Standard Deviation Covariance and Correlation Examples Describing the Distribution...

  5. Current procedural terminology; a primer.

    Science.gov (United States)

    Hirsch, Joshua A; Leslie-Mazwi, Thabele M; Nicola, Gregory N; Barr, Robert M; Bello, Jacqueline A; Donovan, William D; Tu, Raymond; Alson, Mark D; Manchikanti, Laxmaiah

    2015-04-01

    In 1966, The American Medical Association (AMA) working with multiple major medical specialty societies developed an iterative coding system for describing medical procedures and services using uniform language, the Current Procedural Terminology (CPT) system. The current code set, CPT IV, forms the basis of reporting most of the services performed by healthcare providers, physicians and non-physicians as well as facilities allowing effective, reliable communication among physician and other providers, third parties and patients. This coding system and its maintenance has evolved significantly since its inception, and now goes well beyond its readily perceived role in reimbursement. Additional roles include administrative management, tracking new and investigational procedures, and evolving aspects of 'pay for performance'. The system also allows for local, regional and national utilization comparisons for medical education and research. Neurointerventional specialists use CPT category I codes regularly--for example, 36,215 for first-order cerebrovascular angiography, 36,216 for second-order vessels, and 37,184 for acute stroke treatment by mechanical means. Additionally, physicians add relevant modifiers to the CPT codes, such as '-26' to indicate 'professional charge only,' or '-59' to indicate a distinct procedural service performed on the same day. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  6. Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer

    Directory of Open Access Journals (Sweden)

    Helen Hencida Thangamony

    2018-01-01

    Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.

  7. Economics : pricing, demand, and economic efficiency : a primer.

    Science.gov (United States)

    2008-11-01

    The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

  8. Primer on consumer marketing research : procedures, methods, and tools

    Science.gov (United States)

    1994-03-01

    The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

  9. Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers.

    Science.gov (United States)

    Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko

    2016-02-01

    The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Pitfalls in genetic testing: a case of a SNP in primer-annealing region leading to allele dropout in BRCA1.

    Science.gov (United States)

    Silva, Felipe Carneiro; Torrezan, Giovana Tardin; Brianese, Rafael Canfield; Stabellini, Raquel; Carraro, Dirce Maria

    2017-07-01

    Hereditary breast and ovarian cancer is characterized by mutations in BRCA1 or BRCA2 genes and PCR-based screening techniques, such as capillary sequencing and next-generation sequencing (NGS), are considered gold standard methods for detection of pathogenic mutations in these genes. Single-nucleotide polymorphisms (SNPs) constitute a vast source of variation in the human genome and represent a risk for misdiagnosis in genetic testing, since the presence of a SNP in primer-annealing sites may cause false negative results due to allele dropout. However, few reports are available and the frequency of this phenomenon in diagnostic assays remains unknown. In this article, we investigated the causes of a false negative capillary sequencing result in BRCA1 involving a mother-daughter dyad. Using several molecular strategies, including different DNA polymerases, primer redesign, allele-specific PCR and NGS, we established that the initial misdiagnosis was caused by a SNP located in the primer-annealing region, leading to allele dropout of the mutated allele. Assuming that this problem can also occur in any PCR-based method that are widely used in diagnostic settings, the clinical report presented here draws attention for one of the limitations of genetic testing in general, for which medical and laboratory communities need to be aware.

  11. Subject-specific cardiovascular system model-based identification and diagnosis of septic shock with a minimally invasive data set: animal experiments and proof of concept

    International Nuclear Information System (INIS)

    Geoffrey Chase, J; Starfinger, Christina; Hann, Christopher E; Lambermont, Bernard; Ghuysen, Alexandre; Kolh, Philippe; Dauby, Pierre C; Desaive, Thomas; Shaw, Geoffrey M

    2011-01-01

    A cardiovascular system (CVS) model and parameter identification method have previously been validated for identifying different cardiac and circulatory dysfunctions in simulation and using porcine models of pulmonary embolism, hypovolemia with PEEP titrations and induced endotoxic shock. However, these studies required both left and right heart catheters to collect the data required for subject-specific monitoring and diagnosis—a maximally invasive data set in a critical care setting although it does occur in practice. Hence, use of this model-based diagnostic would require significant additional invasive sensors for some subjects, which is unacceptable in some, if not all, cases. The main goal of this study is to prove the concept of using only measurements from one side of the heart (right) in a 'minimal' data set to identify an effective patient-specific model that can capture key clinical trends in endotoxic shock. This research extends existing methods to a reduced and minimal data set requiring only a single catheter and reducing the risk of infection and other complications—a very common, typical situation in critical care patients, particularly after cardiac surgery. The extended methods and assumptions that found it are developed and presented in a case study for the patient-specific parameter identification of pig-specific parameters in an animal model of induced endotoxic shock. This case study is used to define the impact of this minimal data set on the quality and accuracy of the model application for monitoring, detecting and diagnosing septic shock. Six anesthetized healthy pigs weighing 20–30 kg received a 0.5 mg kg −1 endotoxin infusion over a period of 30 min from T0 to T30. For this research, only right heart measurements were obtained. Errors for the identified model are within 8% when the model is identified from data, re-simulated and then compared to the experimentally measured data, including measurements not used in the

  12. Development of genomic microsatellite multiplex PCR using dye-labeled universal primer and its validation in pedigree analysis of Pacific oyster ( Crassostrea gigas)

    Science.gov (United States)

    Liu, Ting; Li, Qi; Song, Junlin; Yu, Hong

    2017-02-01

    There is an increasing requirement for traceability of aquaculture products, both for consumer protection and for food safety. There are high error rates in the conventional traceability systems depending on physical labels. Genetic traceability technique depending on DNA-based tracking system can overcome this problem. Genealogy information is essential for genetic traceability, and microsatellite DNA marker is a good choice for pedigree analysis. As increasing genotyping throughput of microsatellites, microsatellite multiplex PCR has become a fast and cost-effective technique. As a commercially important cultured aquatic species, Pacific oyster Crassostrea gigas has the highest global production. The objective of this study was to develop microsatellite multiplex PCR panels with dye-labeled universal primer for pedigree analysis in C. gigas, and these multiplex PCRs were validated using 12 full-sib families with known pedigrees. Here we developed six informative multiplex PCRs using 18 genomic microsatellites in C. gigas. Each multiplex panel contained a single universal primer M13(-21) used as a tail on each locus-specific forward primer and a single universal primer M13(-21) labeled with fluorophores. The polymorphisms of the markers were moderate, with an average of 10.3 alleles per locus and average polymorphic information content of 0.740. The observed heterozygosity per locus ranged from 0.492 to 0.822. Cervus simulations revealed that the six panels would still be of great value when massive families were analysed. Pedigree analysis of real offspring demonstrated that 100% of the offspring were unambiguously allocated to their parents when two multiplex PCRs were used. The six sets of multiplex PCRs can be an important tool for tracing cultured individuals, population genetic analysis, and selective breeding program in C. gigas.

  13. Use of electromyography to optimize Lokomat® settings for subject-specific gait rehabilitation in post-stroke hemiparetic patients: A proof-of-concept study.

    Science.gov (United States)

    Cherni, Yosra; Begon, Mickael; Chababe, Hicham; Moissenet, Florent

    2017-09-01

    While generic protocols exist for gait rehabilitation using robotic orthotics such as the Lokomat ® , several settings - guidance, body-weight support (BWS) and velocity - may be adjusted to individualize patient training. However, no systematic approach has yet emerged. Our objective was to assess the feasibility and effects of a systematic approach based on electromyography to determine subject-specific settings with application to the strengthening of the gluteus maximus muscle in post-stroke hemiparetic patients. Two male patients (61 and 65 years) with post-stroke hemiparesis performed up to 9 Lokomat ® trials by changing guidance and BWS while electromyography of the gluteus maximus was measured. For each subject, the settings that maximized gluteus maximus activity were used in 20 sessions of Lokomat ® training. Modified Functional Ambulation Classification (mFAC), 6-minutes walking test (6-MWT), and extensor strength were measured before and after training. The greatest gluteus maximus activity was observed at (Guidance: 70% -BWS: 20%) for Patient 1 and (Guidance: 80% - BWS: 30%) for Patient 2. In both patients, mFAC score increased from 4 to 7. The additional distance in 6-MWT increased beyond minimal clinically important difference (MCID=34.4m) reported for post-stroke patients. The isometric strength of hip extensors increased by 43 and 114%. Defining subject-specific settings for a Lokomat ® training was feasible and simple to implement. These two case reports suggest a benefit of this approach for muscle strengthening. It remains to demonstrate the superiority of such an approach for a wider population, compared to the use of a generic protocol. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  14. Human immunodeficiency virus uses tRNA(Lys,3) as primer for reverse transcription in HeLa-CD4+ cells

    NARCIS (Netherlands)

    Das, A. T.; Koken, S. E.; Essink, B. B.; van Wamel, J. L.; Berkhout, B.

    1994-01-01

    Significant amounts of different tRNA molecules are present in retroviral particles, but one specific tRNA species functions as primer in reverse transcription. It is generally believed that the HIV-1 virus uses the tRNA(Lys,3) molecule as primer. This is based on sequence complementarity between

  15. Gold nanoparticle-assisted primer walking for closing the human chromosomal gap

    DEFF Research Database (Denmark)

    Li, H; Shi, B; Li, X

    2013-01-01

    The finished sequence of the human genome still contains 260 euchromatic gaps. All the PCR-based genome walking techniques used to close gaps have common limitations, such as low efficiency and low specificity. We herein describe a strategy to solve this problem by employing gold nanoparticles (Au......NPs) to improve the efficiency in primer walking amplification. We used this strategy to close a gap in human chromosome 5 containing a DNA stretch composed of the 12SAT repeat. The obtained gap sequence is highly conserved among several mammalian genomes. The demonstrated AuNP-assisted primer walking strategy...

  16. A two primers random amplified polymorphic DNA procedure to obtain polymerase chain reaction fingerprints of bacterial species.

    Science.gov (United States)

    Rivas, R; Velázquez, E; Valverde, A; Mateos, P F; Martínez-Molina, E

    2001-04-01

    Polymerase chain reation (PCR) fingerprints are used to characterize and recognize bacteria and are generally obtained using universal primers that generate an array of DNA amplicons, which can be separated by electrophoresis. Universal primers 8F and 1491 R have been used to amplify specifically 16S rDNA. We have used these primers at an annealing temperature of 50 degrees C. Agarose gel electrophoresis of PCR products revealed several bands. The band pattern of each bacterial species was different and the strains belonging to the same species shared an identical pattern. The patterns obtained did not show variations with plasmid DNA content or the growth stage of the bacteria. The peculiarity of the randomly amplified polymorphic DNA (RAPD) described in this work lies in the use of two large primers (proximately 20 nt) to obtain the pattern, since normally a only smaller primer is used, and in the new application for the primers used to amplify 16S rDNA. This new procedure, called two primers (TP)-RAPD fingerprinting, is thus rapid, sensitive, reliable, highly reproducible and suitable for experiments with a large number of microorganisms, and can be applied to bacterial taxonomy, ecological studies and for the detection of new bacterial species.

  17. Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

    Science.gov (United States)

    Françoso, E; Arias, M C

    2013-09-01

    Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.

  18. Optimisation of the PCR-invA primers for the detection of Salmonella ...

    African Journals Online (AJOL)

    A polymerase chain reaction (PCR)-based method for the detection of Salmonella species in water samples was optimised and evaluated for speed, specificity and sensitivity. Optimisation of Mg2+ and primer concentrations and cycling parameters increased the sensitivity and limit of detection of PCR to 2.6 x 104 cfu/m.

  19. CELF family RNA-binding protein UNC-75 regulates two sets of mutually exclusive exons of the unc-32 gene in neuron-specific manners in Caenorhabditis elegans.

    Directory of Open Access Journals (Sweden)

    Hidehito Kuroyanagi

    Full Text Available An enormous number of alternative pre-mRNA splicing patterns in multicellular organisms are coordinately defined by a limited number of regulatory proteins and cis elements. Mutually exclusive alternative splicing should be strictly regulated and is a challenging model for elucidating regulation mechanisms. Here we provide models of the regulation of two sets of mutually exclusive exons, 4a-4c and 7a-7b, of the Caenorhabditis elegans uncoordinated (unc-32 gene, encoding the a subunit of V0 complex of vacuolar-type H(+-ATPases. We visualize selection patterns of exon 4 and exon 7 in vivo by utilizing a trio and a pair of symmetric fluorescence splicing reporter minigenes, respectively, to demonstrate that they are regulated in tissue-specific manners. Genetic analyses reveal that RBFOX family RNA-binding proteins ASD-1 and FOX-1 and a UGCAUG stretch in intron 7b are involved in the neuron-specific selection of exon 7a. Through further forward genetic screening, we identify UNC-75, a neuron-specific CELF family RNA-binding protein of unknown function, as an essential regulator for the exon 7a selection. Electrophoretic mobility shift assays specify a short fragment in intron 7a as the recognition site for UNC-75 and demonstrate that UNC-75 specifically binds via its three RNA recognition motifs to the element including a UUGUUGUGUUGU stretch. The UUGUUGUGUUGU stretch in the reporter minigenes is actually required for the selection of exon 7a in the nervous system. We compare the amounts of partially spliced RNAs in the wild-type and unc-75 mutant backgrounds and raise a model for the mutually exclusive selection of unc-32 exon 7 by the RBFOX family and UNC-75. The neuron-specific selection of unc-32 exon 4b is also regulated by UNC-75 and the unc-75 mutation suppresses the Unc phenotype of the exon-4b-specific allele of unc-32 mutants. Taken together, UNC-75 is the neuron-specific splicing factor and regulates both sets of the mutually exclusive

  20. Low-copy nuclear primers and ycf1 primers in Cactaceae.

    Science.gov (United States)

    Franck, Alan R; Cochrane, Bruce J; Garey, James R

    2012-10-01

    To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.

  1. The nuclear higher-order structure defined by the set of topological relationships between DNA and the nuclear matrix is species-specific in hepatocytes.

    Science.gov (United States)

    Silva-Santiago, Evangelina; Pardo, Juan Pablo; Hernández-Muñoz, Rolando; Aranda-Anzaldo, Armando

    2017-01-15

    During the interphase the nuclear DNA of metazoan cells is organized in supercoiled loops anchored to constituents of a nuclear substructure or compartment known as the nuclear matrix. The stable interactions between DNA and the nuclear matrix (NM) correspond to a set of topological relationships that define a nuclear higher-order structure (NHOS). Current evidence suggests that the NHOS is cell-type-specific. Biophysical evidence and theoretical models suggest that thermodynamic and structural constraints drive the actualization of DNA-NM interactions. However, if the topological relationships between DNA and the NM were the subject of any biological constraint with functional significance then they must be adaptive and thus be positively selected by natural selection and they should be reasonably conserved, at least within closely related species. We carried out a coarse-grained, comparative evaluation of the DNA-NM topological relationships in primary hepatocytes from two closely related mammals: rat and mouse, by determining the relative position to the NM of a limited set of target sequences corresponding to highly-conserved genomic regions that also represent a sample of distinct chromosome territories within the interphase nucleus. Our results indicate that the pattern of topological relationships between DNA and the NM is not conserved between the hepatocytes of the two closely related species, suggesting that the NHOS, like the karyotype, is species-specific. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Are Treponema pallidum specific rapid and point-of-care tests for syphilis accurate enough for screening in resource limited settings? Evidence from a meta-analysis.

    Directory of Open Access Journals (Sweden)

    Yalda Jafari

    Full Text Available Rapid and point-of-care (POC tests for syphilis are an invaluable screening tool, yet inadequate evaluation of their diagnostic accuracy against best reference standards limits their widespread global uptake. To fill this gap, a systematic review and meta-analysis was conducted to evaluate the sensitivity and specificity of rapid and POC tests in blood and serum samples against Treponema pallidum (TP specific reference standards.Five electronic databases (1980-2012 were searched, data was extracted from 33 articles, and Bayesian hierarchical models were fit.In serum samples, against a TP specific reference standard point estimates with 95% credible intervals (CrI for the sensitivities of popular tests were: i Determine, 90.04% (80.45, 95.21, ii SD Bioline, 87.06% (75.67, 94.50, iii VisiTect, 85.13% (72.83, 92.57, and iv Syphicheck, 74.48% (56.85, 88.44, while specificities were: i Syphicheck, 99.14% (96.37, 100, ii Visitect, 96.45% (91.92, 99.29, iii SD Bioline, 95.85% (89.89, 99.53, and iv Determine, 94.15% (89.26, 97.66. In whole blood samples, sensitivities were: i Determine, 86.32% (77.26, 91.70, ii SD Bioline, 84.50% (78.81, 92.61, iii Syphicheck, 74.47% (63.94, 82.13, and iv VisiTect, 74.26% (53.62, 83.68, while specificities were: i Syphicheck, 99.58% (98.91, 99.96, ii VisiTect, 99.43% (98.22, 99.98, iii SD Bioline, 97.95%(92.54, 99.33, and iv Determine, 95.85% (92.42, 97.74.Rapid and POC treponemal tests reported sensitivity and specificity estimates comparable to laboratory-based treponemal tests. In resource limited settings, where access to screening is limited and where risk of patients lost to follow up is high, the introduction of these tests has already been shown to improve access to screening and treatment to prevent stillbirths and neonatal mortality due to congenital syphilis. Based on the evidence, it is concluded that rapid and POC tests are useful in resource limited settings with poor access to laboratories or screening

  3. Evaluation of endogenous control genes for gene expression studies across multiple tissues and in the specific sets of fat- and muscle-type samples of the pig.

    Science.gov (United States)

    Gu, Y R; Li, M Z; Zhang, K; Chen, L; Jiang, A A; Wang, J Y; Li, X W

    2011-08-01

    To normalize a set of quantitative real-time PCR (q-PCR) data, it is essential to determine an optimal number/set of housekeeping genes, as the abundance of housekeeping genes can vary across tissues or cells during different developmental stages, or even under certain environmental conditions. In this study, of the 20 commonly used endogenous control genes, 13, 18 and 17 genes exhibited credible stability in 56 different tissues, 10 types of adipose tissue and five types of muscle tissue, respectively. Our analysis clearly showed that three optimal housekeeping genes are adequate for an accurate normalization, which correlated well with the theoretical optimal number (r ≥ 0.94). In terms of economical and experimental feasibility, we recommend the use of the three most stable housekeeping genes for calculating the normalization factor. Based on our results, the three most stable housekeeping genes in all analysed samples (TOP2B, HSPCB and YWHAZ) are recommended for accurate normalization of q-PCR data. We also suggest that two different sets of housekeeping genes are appropriate for 10 types of adipose tissue (the HSPCB, ALDOA and GAPDH genes) and five types of muscle tissue (the TOP2B, HSPCB and YWHAZ genes), respectively. Our report will serve as a valuable reference for other studies aimed at measuring tissue-specific mRNA abundance in porcine samples. © 2011 Blackwell Verlag GmbH.

  4. Rehabilitation-specific challenges and advantages in the integration of migrant physicians in Germany: a multiperspective qualitative interview study in rehabilitative settings.

    Science.gov (United States)

    Jansen, E; Hänel, P; Klingler, C

    2018-07-01

    In Germany, rehabilitative healthcare institutions increasingly rely on migrant physicians to meet their staffing needs. Yet until now, research on the integration of migrant physicians has focussed entirely on the acute care setting. This study is the first to address the specific advantages and challenges to integration in the field of rehabilitative medicine where a high number of migrant physicians work. From the experiences of migrant physicians and their colleagues, we provide actionable suggestions to counteract potential sources of conflict and thereby improve the integration of migrant physicians in the German workforce. We conducted a qualitative interview study. We conducted 23 interviews with a total of 26 participants occupying a variety of roles in two different rehabilitation centres (maximum variation sampling). Interviews were recorded, transcribed verbatim and parsed through thematic analysis. Our research revealed advantages and challenges to integration in three distinct areas: rehabilitative care institutions, competencies of migrant professionals and interpersonal relations. The first set of issues hinges on the work processes within rehabilitative hospitals, professional prospects there and the location of the institutions themselves. Second, migrant physicians may encounter difficulties because of limited linguistic skills and country-specific knowledge. And finally, aspects of their interactions with care teams and patients may constitute barriers to integration. Some of the factors influencing the integration of migrant physicians are the same in both rehabilitative and acute medicine, but the rehabilitative setting presents distinct advantages and challenges that are worthy of study in their own right. We outline several measures which could help overcome challenges to the integration of migrant physicians, including those associated with professional relationships. Further research is needed to develop concrete support programmes

  5. Cell type specific DNA methylation in cord blood: A 450K-reference data set and cell count-based validation of estimated cell type composition.

    Science.gov (United States)

    Gervin, Kristina; Page, Christian Magnus; Aass, Hans Christian D; Jansen, Michelle A; Fjeldstad, Heidi Elisabeth; Andreassen, Bettina Kulle; Duijts, Liesbeth; van Meurs, Joyce B; van Zelm, Menno C; Jaddoe, Vincent W; Nordeng, Hedvig; Knudsen, Gunn Peggy; Magnus, Per; Nystad, Wenche; Staff, Anne Cathrine; Felix, Janine F; Lyle, Robert

    2016-09-01

    Epigenome-wide association studies of prenatal exposure to different environmental factors are becoming increasingly common. These studies are usually performed in umbilical cord blood. Since blood comprises multiple cell types with specific DNA methylation patterns, confounding caused by cellular heterogeneity is a major concern. This can be adjusted for using reference data consisting of DNA methylation signatures in cell types isolated from blood. However, the most commonly used reference data set is based on blood samples from adult males and is not representative of the cell type composition in neonatal cord blood. The aim of this study was to generate a reference data set from cord blood to enable correct adjustment of the cell type composition in samples collected at birth. The purity of the isolated cell types was very high for all samples (>97.1%), and clustering analyses showed distinct grouping of the cell types according to hematopoietic lineage. We explored whether this cord blood and the adult peripheral blood reference data sets impact the estimation of cell type composition in cord blood samples from an independent birth cohort (MoBa, n = 1092). This revealed significant differences for all cell types. Importantly, comparison of the cell type estimates against matched cell counts both in the cord blood reference samples (n = 11) and in another independent birth cohort (Generation R, n = 195), demonstrated moderate to high correlation of the data. This is the first cord blood reference data set with a comprehensive examination of the downstream application of the data through validation of estimated cell types against matched cell counts.

  6. Bayesian models a statistical primer for ecologists

    CERN Document Server

    Hobbs, N Thompson

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

  7. Signals and systems primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2006-01-01

    Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

  8. Spatially and time-resolved element-specific in situ corrosion investigations with an online hyphenated microcapillary flow injection inductively coupled plasma mass spectrometry set-up

    International Nuclear Information System (INIS)

    Homazava, N.; Ulrich, A.; Kraehenbuehl, U.

    2008-01-01

    A novel technique for in situ spatial, time-resolved element-specific investigations of corrosion processes is developed. The technique is based on an online hyphenation of a specially designed microflow-capillary set-up to inductively coupled plasma mass spectrometry (ICP-MS) using flow injection sample introduction. Detailed aspects of the method development, optimization of the sample microflow introduction and flow injection characteristics for the localized corrosion analysis are described. Moreover, specific challenges of the ICP-MS analysis as applied to the analysis of corrosion sample probes, e.g. high matrix load and limited sample volume, are discussed. The efficiency of the developed technique is proved by corrosion susceptibility analysis of a commercial Al alloy. Results of the corrosion experiments of the aluminum alloy AA 6111 are presented to demonstrate the influence of various factors such as exposure time and pH value of the corrosive medium on the element-specific dissolution rates of the alloy. This novel technique provides new aspects in corrosion science and sheds new light on corrosion mechanisms

  9. Gender-Specific Combination HIV Prevention for Youth in High-Burden Settings: The MP3 Youth Observational Pilot Study Protocol.

    Science.gov (United States)

    Buttolph, Jasmine; Inwani, Irene; Agot, Kawango; Cleland, Charles M; Cherutich, Peter; Kiarie, James N; Osoti, Alfred; Celum, Connie L; Baeten, Jared M; Nduati, Ruth; Kinuthia, John; Hallett, Timothy B; Alsallaq, Ramzi; Kurth, Ann E

    2017-03-08

    Nearly three decades into the epidemic, sub-Saharan Africa (SSA) remains the region most heavily affected by human immunodeficiency virus (HIV), with nearly 70% of the 34 million people living with HIV globally residing in the region. In SSA, female and male youth (15 to 24 years) are at a disproportionately high risk of HIV infection compared to adults. As such, there is a need to target HIV prevention strategies to youth and to tailor them to a gender-specific context. This protocol describes the process for the multi-staged approach in the design of the MP3 Youth pilot study, a gender-specific, combination, HIV prevention intervention for youth in Kenya. The objective of this multi-method protocol is to outline a rigorous and replicable methodology for a gender-specific combination HIV prevention pilot study for youth in high-burden settings, illustrating the triangulated methods undertaken to ensure that age, sex, and context are integral in the design of the intervention. The mixed-methods, cross-sectional, longitudinal cohort pilot study protocol was developed by first conducting a systematic review of the literature, which shaped focus group discussions around prevention package and delivery options, and that also informed age- and sex- stratified mathematical modeling. The review, qualitative data, and mathematical modeling created a triangulated evidence base of interventions to be included in the pilot study protocol. To design the pilot study protocol, we convened an expert panel to select HIV prevention interventions effective for youth in SSA, which will be offered in a mobile health setting. The goal of the pilot study implementation and evaluation is to apply lessons learned to more effective HIV prevention evidence and programming. The combination HIV prevention package in this protocol includes (1) offering HIV testing and counseling for all youth; (2) voluntary medical circumcision and condoms for males; (3) pre-exposure prophylaxis (Pr

  10. Mining tissue specificity, gene connectivity and disease association to reveal a set of genes that modify the action of disease causing genes

    Directory of Open Access Journals (Sweden)

    Reverter Antonio

    2008-09-01

    Full Text Available Abstract Background The tissue specificity of gene expression has been linked to a number of significant outcomes including level of expression, and differential rates of polymorphism, evolution and disease association. Recent studies have also shown the importance of exploring differential gene connectivity and sequence conservation in the identification of disease-associated genes. However, no study relates gene interactions with tissue specificity and disease association. Methods We adopted an a priori approach making as few assumptions as possible to analyse the interplay among gene-gene interactions with tissue specificity and its subsequent likelihood of association with disease. We mined three large datasets comprising expression data drawn from massively parallel signature sequencing across 32 tissues, describing a set of 55,606 true positive interactions for 7,197 genes, and microarray expression results generated during the profiling of systemic inflammation, from which 126,543 interactions among 7,090 genes were reported. Results Amongst the myriad of complex relationships identified between expression, disease, connectivity and tissue specificity, some interesting patterns emerged. These include elevated rates of expression and network connectivity in housekeeping and disease-associated tissue-specific genes. We found that disease-associated genes are more likely to show tissue specific expression and most frequently interact with other disease genes. Using the thresholds defined in these observations, we develop a guilt-by-association algorithm and discover a group of 112 non-disease annotated genes that predominantly interact with disease-associated genes, impacting on disease outcomes. Conclusion We conclude that parameters such as tissue specificity and network connectivity can be used in combination to identify a group of genes, not previously confirmed as disease causing, that are involved in interactions with disease causing

  11. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

    Science.gov (United States)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

    2015-12-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

  12. Primer Part 1-The building blocks of epilepsy genetics.

    Science.gov (United States)

    Helbig, Ingo; Heinzen, Erin L; Mefford, Heather C

    2016-06-01

    This is the first of a two-part primer on the genetics of the epilepsies within the Genetic Literacy Series of the Genetics Commission of the International League Against Epilepsy. In Part 1, we cover the foundations of epilepsy genetics including genetic epidemiology and the range of genetic variants that can affect the risk for developing epilepsy. We discuss various epidemiologic study designs that have been applied to the genetics of the epilepsies including population studies, which provide compelling evidence for a strong genetic contribution in many epilepsies. We discuss genetic risk factors varying in size, frequency, inheritance pattern, effect size, and phenotypic specificity, and provide examples of how genetic risk factors within the various categories increase the risk for epilepsy. We end by highlighting trends in epilepsy genetics including the increasing use of massive parallel sequencing technologies. Wiley Periodicals, Inc. © 2016 International League Against Epilepsy.

  13. ITS primers for the identification of marketable Boletus.

    Science.gov (United States)

    Mello, Antonietta; Ghignone, Stefano; Vizzini, Alfredo; Sechi, Clizia; Ruiu, Pino; Bonfante, Paola

    2006-02-10

    Boletus species belonging to the section Boletus are the most frequently eaten fungi among those harvested in natural conditions in Europe. This section groups 10 taxa which are hardly distinguishable on the basis of their morphology. Some of them have been shown to induce allergic IgE-mediated symptoms either through inhalation, ingestion or contact. Since questions relating to the presence of allergens in any of the species most in demand (B. edulis, B. aereus, B. pinophilus, B. aestivalis, all classified as B. edulis s.l.) remain open, together with the absence of tools which distinguish the species, we sequenced the ITS region of 28 Boletus samples and then we designed specific primers. These allowed the effective separation of the taxa. In addition, the phylogenetic tree obtained from the sequences alignment revealed that B. violaceofuscus, a spectacular Chinese fungus considered belonging to the section Boletus and often sold intermixed with B. edulis s.l. specimens, clusters outside the section Boletus.

  14. Primer on CDM programme of activities

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

    2009-07-01

    As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

  15. Bayesian models: A statistical primer for ecologists

    Science.gov (United States)

    Hobbs, N. Thompson; Hooten, Mevin B.

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods—in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach.Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probability and develops a step-by-step sequence of connected ideas, including basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and inference from single and multiple models. This unique book places less emphasis on computer coding, favoring instead a concise presentation of the mathematical statistics needed to understand how and why Bayesian analysis works. It also explains how to write out properly formulated hierarchical Bayesian models and use them in computing, research papers, and proposals.This primer enables ecologists to understand the statistical principles behind Bayesian modeling and apply them to research, teaching, policy, and management.Presents the mathematical and statistical foundations of Bayesian modeling in language accessible to non-statisticiansCovers basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and moreDeemphasizes computer coding in favor of basic principlesExplains how to write out properly factored statistical expressions representing Bayesian models

  16. A health and safety primer for the practicing health physicist

    International Nuclear Information System (INIS)

    Hylko, J.M.; Bradshaw, M.C.; Ross, L.E.; Brennan, M.J.; Pomatto, C.B.; Shelly, F.C.

    1996-01-01

    Environmental restoration (ER) is the process of removing a facility from service, the demolition of structures the identification and disposal of all hazardous and radioactive wastes, the decontamination of equipment and materials, and the restoration of a site for unrestricted use. The number of ER projects encompassing hazardous, industrial, and radiological conditions is expected to increase in response to various program requirements or mission changes. As a result, the practicing health physicist (HP) may have to address unique health and safety (H and S) issues beyond those of performing routine radiological activities. These unique H and S issues could include, but are not limited to the razing of buildings, the removal of radioactive materials and hazardous chemicals, below-grade excavation, confined space entry, storing flammable or combustible liquids, monitoring exposure to hazardous substances, contacting energized systems (e.g., electricity, hydraulics), noise abatement, the nullification of manufacturer warranties, and the operation and movement of heavy equipment. The purpose of this paper is to educate the practicing HP about these issues by reviewing specific regulations governing all H and S activities, and to provide an example of a site-specific H and S primer (e.g., Health and Safety Plan [HASP]). This primer advices the practicing HP about sound H and S principles, furnishes basic strategies for performing a hazard assessment/job safety analysis (HA/JSA) that can be applied to any ER project, and describes various engineering and administrative controls to mitigate hazardous exposures to ER personnel. In addition, 26 inspection checklist topics are available from the primary author to evaluate the adequacy of the engineering and administrative controls, or to necessitate the use of personal protective equipment (PPE) thereby mitigating the corresponding hazard. (author)

  17. Medium Caliber Lead-Free Electric Primer. Version 2

    Science.gov (United States)

    2012-09-01

    2008). Safe Drinking Water Act of 1986 lists lead compounds as carcinogens (27 CCR 27001 – Dec. 2008). EPA began a Phase I assessment to determine...primer cups was our standard method, wet loading using solvents (hexane and iso -propanol) was investigated to reduce risk of accidental ignition...LOADING OPERATION (Single Die) Wet primer mix charge with solvent (Hexane/ Iso -Propanol) and stir to mix to a uniform slurry Insert primer cup in

  18. High-speed measurement of firearm primer blast waves

    OpenAIRE

    Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy

    2012-01-01

    This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...

  19. Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup

    Science.gov (United States)

    This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.

  20. A method for automatically extracting infectious disease-related primers and probes from the literature

    Directory of Open Access Journals (Sweden)

    Pérez-Rey David

    2010-08-01

    Full Text Available Abstract Background Primer and probe sequences are the main components of nucleic acid-based detection systems. Biologists use primers and probes for different tasks, some related to the diagnosis and prescription of infectious diseases. The biological literature is the main information source for empirically validated primer and probe sequences. Therefore, it is becoming increasingly important for researchers to navigate this important information. In this paper, we present a four-phase method for extracting and annotating primer/probe sequences from the literature. These phases are: (1 convert each document into a tree of paper sections, (2 detect the candidate sequences using a set of finite state machine-based recognizers, (3 refine problem sequences using a rule-based expert system, and (4 annotate the extracted sequences with their related organism/gene information. Results We tested our approach using a test set composed of 297 manuscripts. The extracted sequences and their organism/gene annotations were manually evaluated by a panel of molecular biologists. The results of the evaluation show that our approach is suitable for automatically extracting DNA sequences, achieving precision/recall rates of 97.98% and 95.77%, respectively. In addition, 76.66% of the detected sequences were correctly annotated with their organism name. The system also provided correct gene-related information for 46.18% of the sequences assigned a correct organism name. Conclusions We believe that the proposed method can facilitate routine tasks for biomedical researchers using molecular methods to diagnose and prescribe different infectious diseases. In addition, the proposed method can be expanded to detect and extract other biological sequences from the literature. The extracted information can also be used to readily update available primer/probe databases or to create new databases from scratch.

  1. Simultaneous identification and DNA barcoding of six Eimeria species infecting turkeys using PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus.

    Science.gov (United States)

    Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R

    2015-05-01

    Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.

  2. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2015-01-01

    This primer offers readers an introduction to the central concepts that form our modern understanding of complex and emergent behavior, together with detailed coverage of accompanying mathematical methods. All calculations are presented step by step and are easy to follow. This new fourth edition has been fully reorganized and includes new chapters, figures and exercises. The core aspects of modern complex system sciences are presented in the first chapters, covering network theory, dynamical systems, bifurcation and catastrophe theory, chaos and adaptive processes, together with the principle of self-organization in reaction-diffusion systems and social animals. Modern information theoretical principles are treated in further chapters, together with the concept of self-organized criticality, gene regulation networks, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase transitions and the cognitive system approach to the brain. Technical course prerequisites are the standard ...

  3. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2007-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  4. Complex and Adaptive Dynamical Systems A Primer

    CERN Document Server

    Gros, Claudius

    2011-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  5. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2013-01-01

    Complex system theory is rapidly developing and gaining importance, providing tools and concepts central to our modern understanding of emergent phenomena. This primer offers an introduction to this area together with detailed coverage of the mathematics involved. All calculations are presented step by step and are straightforward to follow. This new third edition comes with new material, figures and exercises. Network theory, dynamical systems and information theory, the core of modern complex system sciences, are developed in the first three chapters, covering basic concepts and phenomena like small-world networks, bifurcation theory and information entropy. Further chapters use a modular approach to address the most important concepts in complex system sciences, with the emergence and self-organization playing a central role. Prominent examples are self-organized criticality in adaptive systems, life at the edge of chaos, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase...

  6. Reliable allele detection using SNP-based PCR primers containing Locked Nucleic Acid: application in genetic mapping

    Directory of Open Access Journals (Sweden)

    Trognitz Friederike

    2007-02-01

    Full Text Available Abstract Background The diploid, Solanum caripense, a wild relative of potato and tomato, possesses valuable resistance to potato late blight and we are interested in the genetic base of this resistance. Due to extremely low levels of genetic variation within the S. caripense genome it proved impossible to generate a dense genetic map and to assign individual Solanum chromosomes through the use of conventional chromosome-specific SSR, RFLP, AFLP, as well as gene- or locus-specific markers. The ease of detection of DNA polymorphisms depends on both frequency and form of sequence variation. The narrow genetic background of close relatives and inbreds complicates the detection of persisting, reduced polymorphism and is a challenge to the development of reliable molecular markers. Nonetheless, monomorphic DNA fragments representing not directly usable conventional markers can contain considerable variation at the level of single nucleotide polymorphisms (SNPs. This can be used for the design of allele-specific molecular markers. The reproducible detection of allele-specific markers based on SNPs has been a technical challenge. Results We present a fast and cost-effective protocol for the detection of allele-specific SNPs by applying Sequence Polymorphism-Derived (SPD markers. These markers proved highly efficient for fingerprinting of individuals possessing a homogeneous genetic background. SPD markers are obtained from within non-informative, conventional molecular marker fragments that are screened for SNPs to design allele-specific PCR primers. The method makes use of primers containing a single, 3'-terminal Locked Nucleic Acid (LNA base. We demonstrate the applicability of the technique by successful genetic mapping of allele-specific SNP markers derived from monomorphic Conserved Ortholog Set II (COSII markers mapped to Solanum chromosomes, in S. caripense. By using SPD markers it was possible for the first time to map the S. caripense alleles

  7. The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

    Science.gov (United States)

    Zellweger, Polle T.; Mackinlay, Jock D.

    A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

  8. Marketing Information Products and Services : A Primer for ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...

  9. Film excerpts shown to specifically elicit various affects lead to overlapping activation foci in a large set of symmetrical brain regions in males.

    Science.gov (United States)

    Karama, Sherif; Armony, Jorge; Beauregard, Mario

    2011-01-01

    While the limbic system theory continues to be part of common scientific parlance, its validity has been questioned on multiple grounds. Nonetheless, the issue of whether or not there exists a set of brain areas preferentially dedicated to emotional processing remains central within affective neuroscience. Recently, a widespread neural reference space for emotion which includes limbic as well as other regions was characterized in a large meta-analysis. As methodologically heterogeneous studies go into such meta-analyses, showing in an individual study in which all parameters are kept constant, the involvement of overlapping areas for various emotion conditions in keeping with the neural reference space for emotion, would serve as valuable confirmatory evidence. Here, using fMRI, 20 young adult men were scanned while viewing validated neutral and effective emotion-eliciting short film excerpts shown to quickly and specifically elicit disgust, amusement, or sexual arousal. Each emotion-specific run included, in random order, multiple neutral and emotion condition blocks. A stringent conjunction analysis revealed a large overlap across emotion conditions that fit remarkably well with the neural reference space for emotion. This overlap included symmetrical bilateral activation of the medial prefrontal cortex, the anterior cingulate, the temporo-occipital junction, the basal ganglia, the brainstem, the amygdala, the hippocampus, the thalamus, the subthalamic nucleus, the posterior hypothalamus, the cerebellum, as well as the frontal operculum extending towards the anterior insula. This study clearly confirms for the visual modality, that processing emotional stimuli leads to widespread increases in activation that cluster within relatively confined areas, regardless of valence.

  10. Film excerpts shown to specifically elicit various affects lead to overlapping activation foci in a large set of symmetrical brain regions in males.

    Directory of Open Access Journals (Sweden)

    Sherif Karama

    Full Text Available While the limbic system theory continues to be part of common scientific parlance, its validity has been questioned on multiple grounds. Nonetheless, the issue of whether or not there exists a set of brain areas preferentially dedicated to emotional processing remains central within affective neuroscience. Recently, a widespread neural reference space for emotion which includes limbic as well as other regions was characterized in a large meta-analysis. As methodologically heterogeneous studies go into such meta-analyses, showing in an individual study in which all parameters are kept constant, the involvement of overlapping areas for various emotion conditions in keeping with the neural reference space for emotion, would serve as valuable confirmatory evidence. Here, using fMRI, 20 young adult men were scanned while viewing validated neutral and effective emotion-eliciting short film excerpts shown to quickly and specifically elicit disgust, amusement, or sexual arousal. Each emotion-specific run included, in random order, multiple neutral and emotion condition blocks. A stringent conjunction analysis revealed a large overlap across emotion conditions that fit remarkably well with the neural reference space for emotion. This overlap included symmetrical bilateral activation of the medial prefrontal cortex, the anterior cingulate, the temporo-occipital junction, the basal ganglia, the brainstem, the amygdala, the hippocampus, the thalamus, the subthalamic nucleus, the posterior hypothalamus, the cerebellum, as well as the frontal operculum extending towards the anterior insula. This study clearly confirms for the visual modality, that processing emotional stimuli leads to widespread increases in activation that cluster within relatively confined areas, regardless of valence.

  11. Screening for residual disease in pediatric burkitt lymphoma using consensus primer pools.

    Science.gov (United States)

    Agsalda, Melissa; Kusao, Ian; Troelstrup, David; Shiramizu, Bruce

    2009-01-01

    Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgV(H)) genes, IgV(H) primer pools from IgV(H1)-IgV(H7) regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgV(H) primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgV(H) primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

  12. Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools

    Directory of Open Access Journals (Sweden)

    Melissa Agsalda

    2009-01-01

    Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

  13. HU participates in expression of a specific set of genes required for growth and survival at acidic pH in Escherichia coli.

    Science.gov (United States)

    Bi, Hongkai; Sun, Lianle; Fukamachi, Toshihiko; Saito, Hiromi; Kobayashi, Hiroshi

    2009-05-01

    The major histone-like Escherichia coli protein, HU, is composed of alpha and beta subunits respectively encoded by hupA and hupB in Escherichia coli. A mutant deficient in both hupA and hupB grew at a slightly slower rate than the wild type at pH 7.5. Growth of the mutant diminished with a decrease in pH, and no growth was observed at pH 4.6. Mutants of either hupA or hupB grew at all pH levels tested. The arginine-dependent survival at pH 2.5 was diminished approximately 60-fold by the deletion of both hupA and hupB, whereas the survival was slightly affected by the deletion of either hupA or hupB. The mRNA levels of adiA and adiC, which respectively encode arginine decarboxylase and arginine/agmatine antiporter, were low in the mutant deficient in both hupA and hupB. The deletion of both hupA and hupB had little effect on survival at pH 2.5 in the presence of glutamate or lysine, and expression of the genes for glutamate and lysine decarboxylases was not impaired by the deletion of the HU genes. These results suggest that HU regulates expression of the specific set of genes required for growth and survival in acidic environments.

  14. Evaluation of a WeChat-based dementia-specific training program for nurses in primary care settings: A randomized controlled trial.

    Science.gov (United States)

    Wang, Feilong; Xiao, Lily Dongxia; Wang, Kaifa; Li, Min; Yang, Yanni

    2017-12-01

    Community nurses play a crucial role in early detection and timely diagnosis of dementia. However, they are usually not prepared for the role through their formal education, particularly in low- and middle-income countries due to undeveloped nursing curriculum in dementia care. This paper describes a two-arm cluster-randomized controlled trial to improve community nurses' knowledge, attitudes, and practice changes using an innovative and interactive mobile phone applet-based activity in primary care settings. The intervention sites received dementia-specific training and control sites received care training for older people with disability. Both groups completed measures assessing dementia knowledge, attitudes, and intentions to make changes to achieve early detection and a timely diagnosis of dementia immediately after training and at 3-month follow-up. The intervention group provided feedback immediately after training and at 3-month follow-up. The main results show that the intervention group demonstrated significant improvement in dementia knowledge and attitudes from baseline immediately after training and at the 3-month follow-up. The intervention group also showed more intentions to make changes to achieve early detection of dementia. Feedback suggested the program was well-received. Overall, the program showed acceptability and feasibility in improving nurses' dementia knowledge, attitudes, and intentions to achieve early detection of dementia. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Non increased neuron-specific enolase concentration in cerebrospinal fluid during first febrile seizures and a year follow-up in pediatric patients No incrementos en la concentración de enolasa específica de neurona en el líquido cefalorraquídeo durante el primer ataque febril y al año en pacientes pediátricos

    Directory of Open Access Journals (Sweden)

    ALBERTO J. DORTA-CONTRERAS

    1998-09-01

    Full Text Available Febrile seizures are the commonest acute neurological disorder of early childhood. Studies suggested that febrile seizures are previous acute events from a more serious neurological problem. Due to neuron-specific enolase is generally accepted as a marker for neuropathological processes in the brain, 16 pediatric patients were studied during their first seizures and a year after it. Neuron-specific enolase in cerebrospinal fluid and blood were analysed by an immune enzyme assay. Non pathological neuron-specific enolase values were obtained in both periods in the group of patients. There were no significative differences when paired series statistics test was performed with 95% of confidence. Neuron-specific enolase appears not to be a marker for febrile seizures because its concentration not be increased in cerebrospinal fluid in this group of patients.Los ataques febriles constituyen el trastorno neurológico agudo más común en la infancia temprana. Existen estudios que sugieren que los ataques febriles son eventos agudos previos a problemas neurológicos más severos. Debido a que la enolasa específica de neurona está aceptada generalmente como marcador de procesos neuropatológicos en el cerebro, se estudiaran 16 pacientes pediátricos durante su primer ataque y al año de este. La enolasa específica de neurona en el líquido cefalorraquídeo y sangre fue analizada por una prueba inmunoenzimática. No se obtuvieron valores patológicos de enolasa específica de neurona en ambos períodos en el grupo de pacientes. No hubo diferencias significativas al aplicar el test de series apareadas con un 95% de confianza. La enolasa específica de neurona parece no ser un marcador para ataques febriles porque su concentración no se incrementa en este grupo de pacientes.

  16. NASA and ESA Collaboration on Hexavalent Chrome Alternatives - Pretreatments with Primers Screening Final Test Report

    Science.gov (United States)

    Rothgeb, Matthew J.; Kessel, Kurt R.

    2015-01-01

    safety, while typically specifying that performance must be equal to or greater than existing systems. The overall objective of the collaborative effort between NASA TEERM and ESA is to test and evaluate coating systems (pretreatments, pretreatments with primer, and pretreatments with primer and topcoat) as replacements for hexavalent chrome coatings in aerospace applications. This objective will be accomplished by testing promising coatings identified from previous NASA, ESA, Department of Defense (DOD), and other project experience. Additionally, several new materials will be analyzed according to ESA-identified specifications.

  17. Value for money assessment for public-private partnerships : a primer.

    Science.gov (United States)

    2015-01-01

    This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.

  18. Novel oligonucleotide primers reveal a high diversity of microbes which drive phosphorous turnover in soil.

    Science.gov (United States)

    Bergkemper, Fabian; Kublik, Susanne; Lang, Friederike; Krüger, Jaane; Vestergaard, Gisle; Schloter, Michael; Schulz, Stefanie

    2016-06-01

    Phosphorus (P) is of central importance for cellular life but likewise a limiting macronutrient in numerous environments. Certainly microorganisms have proven their ability to increase the phosphorus bioavailability by mineralization of organic-P and solubilization of inorganic-P. On the other hand they efficiently take up P and compete with other biota for phosphorus. However the actual microbial community that is associated to the turnover of this crucial macronutrient in different ecosystems remains largely anonymous especially taking effects of seasonality and spatial heterogeneity into account. In this study seven oligonucleotide primers are presented which target genes coding for microbial acid and alkaline phosphatases (phoN, phoD), phytases (appA), phosphonatases (phnX) as well as the quinoprotein glucose dehydrogenase (gcd) and different P transporters (pitA, pstS). Illumina amplicon sequencing of soil genomic DNA underlined the high rate of primer specificity towards the respective target gene which usually ranged between 98% and 100% (phoN: 87%). As expected the primers amplified genes from a broad diversity of distinct microorganisms. Using DNA from a beech dominated forest soil, the highest microbial diversity was detected for the alkaline phosphatase (phoD) gene which was amplified from 15 distinct phyla respectively 81 families. Noteworthy the primers also allowed amplification of phoD from 6 fungal orders. The genes coding for acid phosphatase (phoN) and the quinoprotein glucose dehydrogenase (gcd) were amplified from 20 respectively 17 different microbial orders. In comparison the phytase and phosphonatase (appA, phnX) primers covered 13 bacterial orders from 2 different phyla respectively. Although the amplified microbial diversity was apparently limited both primers reliably detected all orders that contributed to the P turnover in the investigated soil as revealed by a previous metagenomic approach. Genes that code for microbial P transporter

  19. Integrating PCR Theory and Bioinformatics into a Research-oriented Primer Design Exercise

    OpenAIRE

    Robertson, Amber L.; Phillips, Allison R.

    2008-01-01

    Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel research-oriented exercise that prepares students to design DNA primers for PCR. Our exercise design includes broad and specific learning goals and assessm...

  20. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J

    1997-01-01

    , but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

  1. Back to Basics – The Influence of DNA Extraction and Primer Choice on Phylogenetic Analysis of Activated Sludge Communities

    DEFF Research Database (Denmark)

    Albertsen, Mads; Karst, Søren Michael; Ziegler, Anja Sloth

    2015-01-01

    the impact of a number of parameters on the observed microbial community: bead beating intensity, primer choice, extracellular DNA removal, and various PCR settings. In total, 176 samples were subjected to 16S rRNA amplicon sequencing, and selected samples were investigated throughmetagenomics...... and metatranscriptomics. Quantitative fluorescence in situ hybridization was used as a DNA extraction-independent method for qualitative comparison. In general, an effect on the observed community was found on all parameters tested, although bead beating and primer choice had the largest effect. The effect of bead...

  2. Primer on electricity futures and other derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  3. Primer on electricity futures and other derivatives

    International Nuclear Information System (INIS)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area

  4. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    International Nuclear Information System (INIS)

    Jothikumar, N.; Hill, Vincent R.

    2013-01-01

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  5. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    Energy Technology Data Exchange (ETDEWEB)

    Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

    2013-06-28

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  6. Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

    International Nuclear Information System (INIS)

    Zhan Fangfang; Zhou Xiaoming; Xing Da

    2013-01-01

    results showed that the detection limit of the assay was 0.2 pg μL −1 of rotavirus. The ECL intensity was linearly with the concentration from 0.2 pg μL −1 to 400 pg μL −1 . What's more, the specificity of this method was confirmed by detecting other fecal specimens of patients with nonrotavirus-associated gastroenteritis. We anticipate that the proposed magnetic primer based RT-PCR with ECL detection strategy will find numerous applications in food safety field and clinical diagnosis.

  7. Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)

    2013-01-25

    . In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental results showed that the detection limit of the assay was 0.2 pg {mu}L{sup -1} of rotavirus. The ECL intensity was linearly with the concentration from 0.2 pg {mu}L{sup -1} to 400 pg {mu}L{sup -1}. What's more, the specificity of this method was confirmed by detecting other fecal specimens of patients with nonrotavirus-associated gastroenteritis. We anticipate that the proposed magnetic primer based RT-PCR with ECL detection strategy will find numerous applications in food safety field and clinical diagnosis.

  8. Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing.

    Directory of Open Access Journals (Sweden)

    Alexander William Eastman

    2015-01-01

    Full Text Available Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing

  9. Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.

    Science.gov (United States)

    Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G

    2013-09-01

    New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  10. Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

    Directory of Open Access Journals (Sweden)

    Alexandre R. Zuntini

    2013-08-01

    Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  11. A physicists guide to The Los Alamos Primer

    International Nuclear Information System (INIS)

    Reed, B Cameron

    2016-01-01

    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)

  12. Design of a species-specific PCR method for the detection of the heat-resistant fungi Talaromyces macrosporus and Talaromyces trachyspermus.

    Science.gov (United States)

    Yamashita, S; Nakagawa, H; Sakaguchi, T; Arima, T-H; Kikoku, Y

    2018-01-01

    Heat-resistant fungi occur sporadically and are a continuing problem for the food and beverage industry. The genus Talaromyces, as a typical fungus, is capable of producing the heat-resistant ascospores responsible for the spoilage of processed food products. Isocitrate lyase, a signature enzyme of the glyoxylate cycle, is required for the metabolism of non-fermentable carbon compounds, like acetate and ethanol. Here, species-specific primer sets for detection and identification of DNA derived from Talaromyces macrosporus and Talaromyces trachyspermus were designed based on the nucleotide sequences of their isocitrate lyase genes. Polymerase chain reaction (PCR) using a species-specific primer set amplified products specific to T. macrosporus and T. trachyspermus. Other fungal species, such as Byssochlamys fulva and Hamigera striata, which cause food spoilage, were not detected using the Talaromyces-specific primer sets. The detection limit for each species-specific primer set was determined as being 50 pg of template DNA, without using a nested PCR method. The specificity of each species-specific primer set was maintained in the presence of 1,000-fold amounts of genomic DNA from other fungi. The method also detected fungal DNA extracted from blueberry inoculated with T. macrosporus. This PCR method provides a quick, simple, powerful and reliable way to detect T. macrosporus and T. trachyspermus. Polymerase chain reaction (PCR)-based detection is rapid, convenient and sensitive compared with traditional methods of detecting heat-resistant fungi. In this study, a PCR-based method was developed for the detection and identification of amplification products from Talaromyces macrosporus and Talaromyces trachyspermus using primer sets that target the isocitrate lyase gene. This method could be used for the on-site detection of T. macrosporus and T. trachyspermus in the near future, and will be helpful in the safety control of raw materials and in food and beverage

  13. Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

    Directory of Open Access Journals (Sweden)

    El-Sayed Negim

    2016-01-01

    Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

  14. Designing for transportation management and operations : a primer.

    Science.gov (United States)

    2013-02-01

    This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

  15. The corrosion mechanisms for primer coated 2219-T87 aluminum

    Science.gov (United States)

    Danford, Merlin D.; Knockemus, Ward W.

    1987-01-01

    To investigate metal surface corrosion and the breakdown of metal protective coatings, the ac Impedance Method was applied to zinc chromate primer coated 2219-T87 aluminum. The EG&GPARC Model 368 ac Impedance Measurement System, along with dc measurements with the same system using the Polarization Resistance Method, was used to monitor changing properties of coated aluminum disks immersed in 3.5 percent NaCl solutions buffered at pH 5.5 and pH 8.2 over periods of 40 days each. The corrosion system can be represented by an electronic analog called an equivalent circuit consisting of resistors and capacitors in specific arrangements. This equivalent circuit parallels the impedance behavior of the corrosion system during a frequency scan. Values for resistances and capacitances, that can be assigned in the equivalent circuit following a least squares analysis of the data, describe changes occurring on the corroding metal surface and in the protective coatings. A suitable equivalent circuit has been determined which predicts the correct Bode phase and magnitude for the experimental sample. The dc corrosion current density data are related to equivalent circuit element parameters.

  16. Null alleles and sequence variations at primer binding sites of STR loci within multiplex typing systems.

    Science.gov (United States)

    Yao, Yining; Yang, Qinrui; Shao, Chengchen; Liu, Baonian; Zhou, Yuxiang; Xu, Hongmei; Zhou, Yueqin; Tang, Qiqun; Xie, Jianhui

    2018-01-01

    Rare variants are widely observed in human genome and sequence variations at primer binding sites might impair the process of PCR amplification resulting in dropouts of alleles, named as null alleles. In this study, 5 cases from routine paternity testing using PowerPlex ® 21 System for STR genotyping were considered to harbor null alleles at TH01, FGA, D5S818, D8S1179, and D16S539, respectively. The dropout of alleles was confirmed by using alternative commercial kits AGCU Expressmarker 22 PCR amplification kit and AmpFℓSTR ® . Identifiler ® Plus Kit, and sequencing results revealed a single base variation at the primer binding site of each STR locus. Results from the collection of previous reports show that null alleles at D5S818 were frequently observed in population detected by two PowerPlex ® typing systems and null alleles at D19S433 were mostly observed in Japanese population detected by two AmpFℓSTR™ typing systems. Furthermore, the most popular mutation type appeared the transition from C to T with G to A, which might have a potential relationship with DNA methylation. Altogether, these results can provide helpful information in forensic practice to the elimination of genotyping discrepancy and the development of primer sets. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.

    Science.gov (United States)

    Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J

    2017-01-01

    Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.

  18. Cell type specific DNA methylation in cord blood: A 450K-reference data set and cell count-based validation of estimated cell type composition

    NARCIS (Netherlands)

    Gervin, K. (Kristina); Page, C.M. (Christian Magnus); H.C.D. Aass (Hans Christian Dalsbotten); M.A.E. Jansen (Michelle); Fjeldstad, H.E. (Heidi Elisabeth); B.K. Andreassen (Bettina Kulle); L. Duijts (Liesbeth); J.B.J. van Meurs (Joyce); M.C. van Zelm (Menno); V.W.V. Jaddoe (Vincent); Nordeng, H. (Hedvig); Knudsen, G.P. (Gunn Peggy); P. Magnus (Per); W. Nystad (Wenche); Staff, A.C. (Anne Cathrine); J.F. Felix (Janine); R. Lyle (Robert)

    2016-01-01

    textabstractEpigenome-wide association studies of prenatal exposure to different environmental factors are becoming increasingly common. These studies are usually performed in umbilical cord blood. Since blood comprises multiple cell types with specific DNA methylation patterns, confounding caused

  19. Nightlife Violence: A Gender-Specific View on Risk Factors for Violence in Nightlife Settings--A Cross-Sectional Study in Nine European Countries

    Science.gov (United States)

    Schnitzer, Susanne; Bellis, Mark A.; Anderson, Zara; Hughes, Karen; Calafat, Amador; Juan, Montse; Kokkevi, Anna

    2010-01-01

    Within nightlife settings, youth violence places large burdens on both nightlife users and wider society. Internationally, research has identified risk factors for nightlife violence. However, few empirical studies have assessed differences in risk factors between genders. Here, a pan-European cross-sectional survey of 1,341 nightlife users aged…

  20. Transferability of microsatellite primers developed for stingless bees to four other species of the genus Melipona.

    Science.gov (United States)

    Viana, M V C; Miranda, E A; de Francisco, A K; Carvalho, C A L; Waldschmidt, A M

    2011-11-22

    Microsatellite markers are a useful tool for ecological monitoring of natural and managed populations. A technical limitation is the necessity for investment in the development of primers. Heterologous primers can provide an alternative to searching for new loci. In bees, these markers have been used in populational and intracolonial genetic analyses. The genus Melipona has the largest number of species among bee genera, about 70, occurring throughout the Neotropical region. However, only five species of the genus Melipona have specific microsatellite markers. Given the great diversity of this genus, this number is not representative. We analyzed the transferability of 49 microsatellite loci to four other species of the genus Melipona (M. scutellaris, M. mondury, M. mandacaia, and M. quadrifasciata). Four individuals of each species, from different localities, were used in amplification tests. Primer pairs described for five Melipona species and for Trigona carbonaria were tested. Among the 49 loci, 22 gave amplification products for all four species, while three gave nonspecific bands and five showed no amplification products. The remaining loci varied in the pattern of amplification, according to the species examined. The number of alleles ranged from 1 to 6. The results demonstrate the possibility of using these heterologous markers in other Melipona species, increasing the number of loci that can be analyzed and contributing to further genetic analyses of intra- and intercolonial structure, which is required for conservation measure planning, genetic improvement and resolution of taxonomic problems.

  1. MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

    Directory of Open Access Journals (Sweden)

    Kitchen James L

    2012-11-01

    Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  2. MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

    Science.gov (United States)

    Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

    2012-11-05

    Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  3. Global warming-setting the stages

    International Nuclear Information System (INIS)

    1994-01-01

    Most of us have heard or read about global warming. However, the messages we receive are often in conflict, raising more questions than answer. Is global warming a good or a bad thing? has it already started or is it part of our future? Are we, or are we not doing anything about it? Should we be concerned? This primer on Global Warming is designed to clear up some of this confusion by providing basic scientific information on global warming issue. It is clear that there is still much to learn about global warming. However, it is also clear that there is a lot that we already know - and that dose provide cause for concern. We must understand the global warming issue if we are to make wise decisions and take responsible actions in response to the challenges and opportunities posed by global warming. Chapter 1 of 'the primer on global Warming' set the stage with a brief overview of science of global warming within the context of climate change. In addition, it introduces the specific issues that surround the global warming problem. As far as the science of global warming is concerned the following questions are discussed. What is global climate? Is climate change natural? What causes climate to vary on a global scale? How does the composition of the atmosphere relate to climate change. but there are also certain issues discussed here which surround the global warming such as: If climate varies naturally, why is there a concern about 'global warming'? What are the potential consequences of 'global warning'. What human activities contribute to 'global warming'. (Author)

  4. Amplification of marine methanotrophic enrichment DNA with 16S rDNA PCR primers for type II alpha proteobacteria methanotrophs.

    Science.gov (United States)

    Rockne, Karl J; Strand, Stuart E

    2003-09-01

    Type II alpha proteobacteria methanotrophs are capable of a wide range of cometabolic transformations of chlorinated solvents and polycyclic aromatic hydrocarbons (PAHs), and this activity has been exploited in many terrestrial bioremediation systems. However, at present, all known obligately marine methanotrophic isolates are Type I gamma proteobacteria which do not have this activity to the extent of Type II methanotrophs. In previous work in our laboratory, determining the presence of Type II alpha proteobacteria methanotrophs in marine enrichment cultures that co-metabolized PAHs required a more sensitive assay. 16S rDNA PCR primers were designed based on oligonucleotide probes for serine pathway methanotrophs and serine pathway methylotrophs with an approximate amplification fragment size of 870 base pairs. Comparison of the primers using double primer BLAST searches in established nucleotide databases showed potential amplification with all Methylocystis and Methylosinus spp., as well as potential amplification with Methylocella palustrus. DNA from Methylosinus trichosporium OB3b, a Type II methanotroph, amplified with the primers with a fragment size of approximately 850 base pairs, whereas DNA extracted from Methylomonas methanica, a Type I methanotroph, did not. The primers were used to amplify DNA extracted from two marine methanotrophic enrichment cultures: a low nitrogen/low copper enrichment to select for Type II methanotrophs and a high nitrogen/high copper enrichment to select for Type I methanotrophs. Although DNA from both cultures amplified with the PCR primers, amplification was stronger in cultures that were specifically enriched for Type II methanotrophs, suggesting the presence of higher numbers of Type II methanotrophs. These results provide further evidence for the existence of Type II marine methanotrophs, suggesting the possibility of exploiting cometabolic activity in marine systems.

  5. A Privatization Primer: Issues and Evidence

    National Research Council Canada - National Science Library

    Tighe, C

    1997-01-01

    .... This study identified specific ways to streamline the competition process required by 0MB Circular A-76, and initial findings of five outsourcing and competition case studies reported in earlier reports...

  6. A Telecommunications Industry Primer: A Systems Model.

    Science.gov (United States)

    Obermier, Timothy R.; Tuttle, Ronald H.

    2003-01-01

    Describes the Telecommunications Systems Model to help technical educators and students understand the increasingly complex telecommunications infrastructure. Specifically looks at ownership and regulatory status, service providers, transport medium, network protocols, and end-user services. (JOW)

  7. Specificity of the Tuberculin Skin Test and the T-SPOT."TB" Assay among Students in a Low-Tuberculosis Incidence Setting

    Science.gov (United States)

    Talbot, Elizabeth A.; Harland, Dawn; Wieland-Alter, Wendy; Burrer, Sherry; Adams, Lisa V.

    2012-01-01

    Objective: Interferon-[gamma] release assays (IGRAs) are an important tool for detecting latent "Mycobacterium tuberculosis" infection (LTBI). Insufficient data exist about IGRA specificity in college health centers, most of which screen students for LTBI using the tuberculin skin test (TST). Participants: Students at a low-TB incidence college…

  8. Innate nonhost immunity in barley to different heterologous rust fungi is controlled by sets of resistance genes with different and overlapping specificities

    NARCIS (Netherlands)

    Jafary, H.; Szabo, L.J.; Niks, R.E.

    2006-01-01

    We developed an evolutionary relevant model system, barley-Puccini rust fungi, to study the inheritance and specificity of plant factors that determine to what extent innate nonhost immunity can be suppressed. A mapping population was developed from a cross between an experimental barley line

  9. Salivary IgA against sporozoite-specific embryogenesis-related protein (TgERP) in the study of horizontally transmitted toxoplasmosis via T. gondii oocysts in endemic settings

    Science.gov (United States)

    The prevalence of toxoplasmosis was investigated in endemic settings in Brazil, and calculated by measuring antibodies in two ELISA systems: 1) IgG and IgM from sera tested by commercial conventional ELISA, and 2) IgA, from saliva, and IgG from sera samples tested against a sporozoite-specific prote...

  10. Pharmacological chaperoning: a primer on mechanism and pharmacology.

    Science.gov (United States)

    Leidenheimer, Nancy J; Ryder, Katelyn G

    2014-05-01

    Approximately forty percent of diseases are attributable to protein misfolding, including those for which genetic mutation produces misfolding mutants. Intriguingly, many of these mutants are not terminally misfolded since native-like folding, and subsequent trafficking to functional locations, can be induced by target-specific, small molecules variably termed pharmacological chaperones, pharmacoperones, or pharmacochaperones (PCs). PC targets include enzymes, receptors, transporters, and ion channels, revealing the breadth of proteins that can be engaged by ligand-assisted folding. The purpose of this review is to provide an integrated primer of the diverse mechanisms and pharmacology of PCs. In this regard, we examine the structural mechanisms that underlie PC rescue of misfolding mutants, including the ability of PCs to act as surrogates for defective intramolecular interactions and, at the intermolecular level, overcome oligomerization deficiencies and dominant negative effects, as well as influence the subunit stoichiometry of heteropentameric receptors. Not surprisingly, PC-mediated structural correction of misfolding mutants normalizes interactions with molecular chaperones that participate in protein quality control and forward-trafficking. A variety of small molecules have proven to be efficacious PCs and the advantages and disadvantages of employing orthostatic antagonists, active-site inhibitors, orthostatic agonists, and allosteric modulator PCs are considered. Also examined is the possibility that several therapeutic agents may have unrecognized activity as PCs, and this chaperoning activity may mediate/contribute to therapeutic action and/or account for adverse effects. Lastly, we explore evidence that pharmacological chaperoning exploits intrinsic ligand-assisted folding mechanisms. Given the widespread applicability of PC rescue of mutants associated with protein folding disorders, both in vitro and in vivo, the therapeutic potential of PCs is vast

  11. Net Mineralization Response to Fertilizer Application and Site-Specific Setting in a No-Till Dryland Wheat Agroecosystem in the Pacific Northwest (USA)

    Science.gov (United States)

    Bruner, Emily A.; Brown, David J.; Carpenter-Boggs, Lynn

    2015-04-01

    Application of nitrogen (N) fertilizers is pivotal to maintaining agricultural productivity. Nutrient management is typically guided by a combined assessment of crop yield requirements, residual soil inorganic N concentration, and predicted N supply from organic matter. However, laboratory assays employed to forecast mineralization potential do not reflect in situ processes occurring in soils, processes that can vary spatially within a field. Furthermore, fertilizer application alters biogeochemical cycles through a variety of mechanisms including priming effects and microbial community alterations. This study investigates in-situ ammonification/nitrification rates utilizing mineralization cores as part of a five-year Site-Specific Climate-Friendly Farming (SCF) project. In-depth accounting of nitrate and ammonium production and flux was possible via a six bag mixed-bed ion exchange resin system. Soil cores (7.5 cm diameter by 15 cm deep) were isolated from the surrounding soil by three resin bags sealed in the top and bottom of individual plastic cylinders. Fifteen locations were selected across a commercial direct-seed wheat field based on statistical clustering of primary and secondary topographic variables. In each location surface soil-resin cores were installed in fertilized and unfertilized plots immediately after spring planting and removed before harvest. In situ ammonification/nitrification rates will be analyzed as a function of both fertilizer application and site-specific environmental characteristics as determined from soil moisture monitoring, soil characterization, and crop analysis at each measurement location. This site-specific information on N transformations and availability can then be used to guide site-specific crop management.

  12. Examining the similarities and differences of OMERACT core sets using the ICF: first step towards an improved domain specification and development of an item pool to measure functioning and health.

    Science.gov (United States)

    Escorpizo, Reuben; Boers, Maarten; Stucki, Gerold; Boonen, Annelies

    2011-08-01

    To contribute to the discussion on a common approach for domain selection in the Outcomes in Rheumatology Clinical Trials (OMERACT) process. First, this article reports on the consistency in the selection and names of the domains of the current OMERACT core set, and next on the comparability of the specifications of concepts that are relevant within the domains. For this purpose, a convenience sample of 4 OMERACT core sets was used: rheumatoid arthritis (RA), psoriatic arthritis (PsA), longitudinal observational studies (LOS) in rheumatology, and ankylosing spondylitis (AS). Domains from the different core sets were compared directly. To be able to compare the specific content of the domains, the concepts contained in the questionnaires that were considered or proposed to measure the domains were identified and linked to the category of the International Classification of Functioning, Disability, and Health (ICF) that best fit that construct. Large differences in the domains, and lack of domain definitions, were noted among the 4 OMERACT core sets. When comparing the concepts in the questionnaires that represent the domains, core sets differed also in the number and type of constructs that were addressed within each of the domains. Especially for the specification of the concepts within the domains Discomfort and Disability, the ICF proved to be useful as external reference to classify the different constructs. Our exercise suggests that the OMERACT process could benefit from a standardized approach to select, define, and specify domains, and demonstrated that the ICF is useful for further classification of the more specific concepts of "what to measure" within the domains. A clear definition and classification of domains and their specification can be useful as a starting point to build a pool of items that could then be used to develop new instruments to assess functioning and health for rheumatological conditions.

  13. Inteligencia emocional y autoconcepto en los estudiantes de primer ciclo

    OpenAIRE

    Castillo Canales, Braulio

    2017-01-01

    En nuestra investigación se tuvo como problema: ¿Qué relación existe entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II? Además el objetivo fue: Determinar la relación entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II. El tipo de estudio fue básica...

  14. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    Lucas, D.S.

    2004-10-03

    This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

  15. Heterologous primer transferability and access to microsatellite loci polymorphism in ‘somnus’ passion fruit tree (Passiflora setacea DC

    Directory of Open Access Journals (Sweden)

    Douglas de Almeida Pereira

    2015-09-01

    Full Text Available Primer pairs that access microsatellite loci, initially constructed through the genome of Passiflora edulis Sims flavicarpa and P. alata, were tested concerning their ability to access microsatellite loci in ‘somnus’ passion fruit tree (P. setacea individuals. Seven out of the thirty one primer pairs tested were able to access DNA polymorphism in the genome of this wild Passiflora species, by evaluating six natural populations, located in a transition area between the biomes Caatinga and Cerrado, in the state of Bahia, Brazil. The number of alleles/loci was small, oscillating from 1 to 4. The average heterozygosity observed per locus in all populations ranged from 0.13 to 0.40. There was transference of heterologous microsatellite primer pairs from the Passiflora genus to ‘somnus’ passion fruit tree, constituting a new set of primers that access random co-dominant locus in this species, useful for conservationist purposes and pre-improvement of ‘somnus’ passion fruit tree.

  16. Elastic stability and HEP detectors: a primer

    CERN Document Server

    Wertelaers, P

    2018-01-01

    Destabilizing -- or "buckling" -- phenomena can compromise the quality of a physics detector long before the point of collapse has been reached. We rehearse on the two types of buckling : snap-through versus bifurcation. Then, we discuss bifurcation problems in a detector example. This introductory text specifically targets a non-engineer audience.

  17. Modelling the Impact and Cost-Effectiveness of Biomarker Tests as Compared with Pathogen-Specific Diagnostics in the Management of Undifferentiated Fever in Remote Tropical Settings.

    Directory of Open Access Journals (Sweden)

    Yoel Lubell

    Full Text Available Malaria accounts for a small fraction of febrile cases in increasingly large areas of the malaria endemic world. Point-of-care tests to improve the management of non-malarial fevers appropriate for primary care are few, consisting of either diagnostic tests for specific pathogens or testing for biomarkers of host response that indicate whether antibiotics might be required. The impact and cost-effectiveness of these approaches are relatively unexplored and methods to do so are not well-developed.We model the ability of dengue and scrub typhus rapid tests to inform antibiotic treatment, as compared with testing for elevated C-Reactive Protein (CRP, a biomarker of host-inflammation. Using data on causes of fever in rural Laos, we estimate the proportion of outpatients that would be correctly classified as requiring an antibiotic and the likely cost-effectiveness of the approaches.Use of either pathogen-specific test slightly increased the proportion of patients correctly classified as requiring antibiotics. CRP testing was consistently superior to the pathogen-specific tests, despite heterogeneity in causes of fever. All testing strategies are likely to result in higher average costs, but only the scrub typhus and CRP tests are likely to be cost-effective when considering direct health benefits, with median cost per disability adjusted life year averted of approximately $48 USD and $94 USD, respectively.Testing for viral infections is unlikely to be cost-effective when considering only direct health benefits to patients. Testing for prevalent bacterial pathogens can be cost-effective, having the benefit of informing not only whether treatment is required, but also as to the most appropriate antibiotic; this advantage, however, varies widely in response to heterogeneity in causes of fever. Testing for biomarkers of host inflammation is likely to be consistently cost-effective despite high heterogeneity, and can also offer substantial reductions in

  18. The map-1 gene family in root-knot nematodes, Meloidogyne spp.: a set of taxonomically restricted genes specific to clonal species.

    Directory of Open Access Journals (Sweden)

    Iva Tomalova

    Full Text Available Taxonomically restricted genes (TRGs, i.e., genes that are restricted to a limited subset of phylogenetically related organisms, may be important in adaptation. In parasitic organisms, TRG-encoded proteins are possible determinants of the specificity of host-parasite interactions. In the root-knot nematode (RKN Meloidogyne incognita, the map-1 gene family encodes expansin-like proteins that are secreted into plant tissues during parasitism, thought to act as effectors to promote successful root infection. MAP-1 proteins exhibit a modular architecture, with variable number and arrangement of 58 and 13-aa domains in their central part. Here, we address the evolutionary origins of this gene family using a combination of bioinformatics and molecular biology approaches. Map-1 genes were solely identified in one single member of the phylum Nematoda, i.e., the genus Meloidogyne, and not detected in any other nematode, thus indicating that the map-1 gene family is indeed a TRG family. A phylogenetic analysis of the distribution of map-1 genes in RKNs further showed that these genes are specifically present in species that reproduce by mitotic parthenogenesis, with the exception of M. floridensis, and could not be detected in RKNs reproducing by either meiotic parthenogenesis or amphimixis. These results highlight the divergence between mitotic and meiotic RKN species as a critical transition in the evolutionary history of these parasites. Analysis of the sequence conservation and organization of repeated domains in map-1 genes suggests that gene duplication(s together with domain loss/duplication have contributed to the evolution of the map-1 family, and that some strong selection mechanism may be acting upon these genes to maintain their functional role(s in the specificity of the plant-RKN interactions.

  19. Modelling the Impact and Cost-Effectiveness of Biomarker Tests as Compared with Pathogen-Specific Diagnostics in the Management of Undifferentiated Fever in Remote Tropical Settings.

    Science.gov (United States)

    Lubell, Yoel; Althaus, Thomas; Blacksell, Stuart D; Paris, Daniel H; Mayxay, Mayfong; Pan-Ngum, Wirichada; White, Lisa J; Day, Nicholas P J; Newton, Paul N

    2016-01-01

    Malaria accounts for a small fraction of febrile cases in increasingly large areas of the malaria endemic world. Point-of-care tests to improve the management of non-malarial fevers appropriate for primary care are few, consisting of either diagnostic tests for specific pathogens or testing for biomarkers of host response that indicate whether antibiotics might be required. The impact and cost-effectiveness of these approaches are relatively unexplored and methods to do so are not well-developed. We model the ability of dengue and scrub typhus rapid tests to inform antibiotic treatment, as compared with testing for elevated C-Reactive Protein (CRP), a biomarker of host-inflammation. Using data on causes of fever in rural Laos, we estimate the proportion of outpatients that would be correctly classified as requiring an antibiotic and the likely cost-effectiveness of the approaches. Use of either pathogen-specific test slightly increased the proportion of patients correctly classified as requiring antibiotics. CRP testing was consistently superior to the pathogen-specific tests, despite heterogeneity in causes of fever. All testing strategies are likely to result in higher average costs, but only the scrub typhus and CRP tests are likely to be cost-effective when considering direct health benefits, with median cost per disability adjusted life year averted of approximately $48 USD and $94 USD, respectively. Testing for viral infections is unlikely to be cost-effective when considering only direct health benefits to patients. Testing for prevalent bacterial pathogens can be cost-effective, having the benefit of informing not only whether treatment is required, but also as to the most appropriate antibiotic; this advantage, however, varies widely in response to heterogeneity in causes of fever. Testing for biomarkers of host inflammation is likely to be consistently cost-effective despite high heterogeneity, and can also offer substantial reductions in over-use of

  20. Is an ecosystem services-based approach developed for setting specific protection goals for plant protection products applicable to other chemicals?

    Science.gov (United States)

    Maltby, Lorraine; Jackson, Mathew; Whale, Graham; Brown, A Ross; Hamer, Mick; Solga, Andreas; Kabouw, Patrick; Woods, Richard; Marshall, Stuart

    2017-02-15

    Clearly defined protection goals specifying what to protect, where and when, are required for designing scientifically sound risk assessments and effective risk management of chemicals. Environmental protection goals specified in EU legislation are defined in general terms, resulting in uncertainty in how to achieve them. In 2010, the European Food Safety Authority (EFSA) published a framework to identify more specific protection goals based on ecosystem services potentially affected by plant protection products. But how applicable is this framework to chemicals with different emission scenarios and receptor ecosystems? Four case studies used to address this question were: (i) oil refinery waste water exposure in estuarine environments; (ii) oil dispersant exposure in aquatic environments; (iii) down the drain chemicals exposure in a wide range of ecosystems (terrestrial and aquatic); (iv) persistent organic pollutant exposure in remote (pristine) Arctic environments. A four-step process was followed to identify ecosystems and services potentially impacted by chemical emissions and to define specific protection goals. Case studies demonstrated that, in principle, the ecosystem services concept and the EFSA framework can be applied to derive specific protection goals for a broad range of chemical exposure scenarios. By identifying key habitats and ecosystem services of concern, the approach offers the potential for greater spatial and temporal resolution, together with increased environmental relevance, in chemical risk assessments. With modifications including improved clarity on terminology/definitions and further development/refinement of the key concepts, we believe the principles of the EFSA framework could provide a methodical approach to the identification and prioritization of ecosystems, ecosystem services and the service providing units that are most at risk from chemical exposure. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights

  1. Variation in extragenic repetitive DNA sequences in Pseudomonas syringae and potential use of modified REP primers in the identification of closely related isolates

    Directory of Open Access Journals (Sweden)

    Elif Çepni

    2012-01-01

    Full Text Available In this study, Pseudomonas syringe pathovars isolated from olive, tomato and bean were identified by species-specific PCR and their genetic diversity was assessed by repetitive extragenic palindromic (REP-PCR. Reverse universal primers for REP-PCR were designed by using the bases of A, T, G or C at the positions of 1, 4 and 11 to identify additional polymorphism in the banding patterns. Binding of the primers to different annealing sites in the genome revealed additional fingerprint patterns in eight isolates of P. savastanoi pv. savastanoi and two isolates of P. syringae pv. tomato. The use of four different bases in the primer sequences did not affect the PCR reproducibility and was very efficient in revealing intra-pathovar diversity, particularly in P. savastanoi pv. savastanoi. At the pathovar level, the primer BOX1AR yielded shared fragments, in addition to five bands that discriminated among the pathovars P. syringae pv. phaseolicola, P. savastanoi pv. savastanoi and P. syringae pv. tomato. REP-PCR with a modified primer containing C produced identical bands among the isolates in a pathovar but separated three pathovars more distinctly than four other primers. Although REP-and BOX-PCRs have been successfully used in the molecular identification of Pseudomonas isolates from Turkish flora, a PCR based on inter-enterobacterial repetitive intergenic concensus (ERIC sequences failed to produce clear banding patterns in this study.

  2. [A novel TaqMan® MGB probe for specifically detecting Streptococcus mutans].

    Science.gov (United States)

    Zheng, Hui; Lin, Jiu-Xiang; DU, Ning; Chen, Feng

    2013-10-18

    To design a new TaqMan® MGB probe for improving the specificity of Streptococcus mutans's detection. We extracted six DNA samples from different streptococcal strains for PCR reaction. Conventional nested PCR and TaqMan® MGB real-time PCR were applied independently. The first round of nested PCR was carried out with the bacterial universal primers, while a second PCR was conducted by using primers specific for the 16S rRNA gene of Streptococcus mutans. The TaqMan® MGB probe for Streptococcus mutans was designed from sequence analyses, and the primers were the same as nested PCR. Streptococcus mutans DNA with 2.5 mg/L was sequentially diluted at 5-fold intervals to 0.16 μg/L. Standard DNA samples were used to generate standard curves by TaqMan® MGB real-time PCR. In the nested PCR, the primers specific for Streptococcus mutans also detected Streptococcus gordonii with visible band of 282 bp, giving false-positive results. In the TaqMan® MGB real-time PCR reaction, only Streptococcus mutans was detected. The detection limitation of TaqMan® MGB real-time PCR for Streptococcus mutans 16S rRNA gene was 20 μg/L. We designed a new TaqMan® MGB probe, and successfully set up a PCR based method for detecting oral Streptococcus mutans. TaqMan® MGB real-time PCR is a both specific and sensitive bacterial detection method.

  3. Primer on client-side web security

    CERN Document Server

    De Ryck, Philippe; Piessens, Frank; Johns, Martin

    2014-01-01

    This volume illustrates the continuous arms race between attackers and defenders of the Web ecosystem by discussing a wide variety of attacks. In the first part of the book, the foundation of the Web ecosystem is briefly recapped and discussed. Based on this model, the assets of the Web ecosystem are identified, and the set of capabilities an attacker may have are enumerated. In the second part, an overview of the web security vulnerability landscape is constructed. Included are selections of the most representative attack techniques reported in great detail. In addition to descriptions of the

  4. Assessment of fungal diversity in deep-sea sediments by multiple primer approach

    Digital Repository Service at National Institute of Oceanography (India)

    Singh, P.; Raghukumar, C.; Verma, P.; Shouche, Y.

    products were gel-purified and ligated with pGEM-T easy vector (Promega, USA) and transformed into E. coli cells (Invitrogen, Carlsbad, CA), following the manufacturer’s instructions. Transformants were grown overnight at 37°C on Luria Bertani agar... using culture-independent approach by targeting universal 18S as well as fungal specific and universal ITS (internal transcribed spacers) regions of rRNA genes from three locations in the CIB. It is known that some of the primer pairs designed...

  5. PriFi - Using a Multiple Alignment of Related Sequences to Find Primers for  Amplification of Homologs

    DEFF Research Database (Denmark)

    Fredslund, Jakob; Schauser, Leif; Madsen, Lene Heegaard

    2005-01-01

    Using a comparative approach, the web program PriFi (http://cgi-www.daimi.au.dk/cgi-chili/PriFi/main) designs pairs of primers useful for PCR amplification of genomic DNA in species where prior sequence information is not available. The program works with an alignment of DNA sequences from...... of a procedure for developing general markers serving as common anchor loci across species. To accommodate users with special preferences, configuration settings and criteria can be customized....

  6. A comparison of parent and staff perceptions of setting-specific and everyday stressors encountered by parents with very preterm infants experiencing neonatal intensive care.

    Science.gov (United States)

    Pritchard, Verena E; Montgomery-Hönger, Argène

    2014-10-01

    Stress responses among parents of premature infants experiencing the neonatal intensive care unit (NICU) environment are widely reported. However, less is known about how nurses perceive parents' experiences or how stressors relating to demands on family finances and practical challenges associated with infant hospitalization contribute to parental stress levels in the NICU. 1) To compare parent and staff perceptions of the stressors facing parents experiencing neonatal intensive care; and 2) to develop a scale suitable for identifying stressors outside the NICU setting. At infant 34 weeks, parents (n=21) of very preterm infants (≤ 32 weeks GA) and NICU nurses (n=23) completed the Parental Stressor Scale: NICU (PSS: NICU) and a custom-made External Stressor Scale (ESS: NICU). Nurses perceived parents to experience higher stress in the NICU than parents themselves (psparents reporting low-to-moderate stress and staff rating parental stress as moderate-to-high. Parents reported slightly lower levels of stress on the ESS: NICU, with nurses again overestimating the level of parental stress (psparent perceptions should be encouraged along with research dedicated to a fuller understanding of the range of stressors facing parents experiencing neonatal intensive care in attempts to reduce stress levels and aid integration into the unit. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. V-set and Ig domain-containing 4 (VSIG4)-expressing hepatic F4/80+ cells regulate oral antigen-specific responses in mouse.

    Science.gov (United States)

    Shin, Wonhwa; Jeon, Youkyoung; Choi, Inhak; Kim, Yeon-Jeong

    2018-04-01

    Oral tolerance can prevent unnecessary immune responses against dietary antigens. Members of the B7 protein family play critical roles in the positive and/or negative regulation of T cell responses to interactions between APCs and T cells. V-set and Ig domain-containing 4 (VSIG4), a B7-related co-signaling molecule, has been known to act as a co-inhibitory ligand and may be critical in establishing immune tolerance. Therefore, we investigated the regulation of VSIG4 signaling in a food allergy and experimental oral tolerance murine models. We analyzed the contributions of the two main sites involved in oral tolerance, the mesenteric lymph node (MLN) and the liver, in VSIG4-mediated oral tolerance induction. Through the comparative analysis of major APCs, dendritic cells (DCs) and macrophages, we found that Kupffer cells play a critical role in inducing regulatory T cells (Tregs) and establishing immune tolerance against oral antigens via VSIG4 signaling. Taken together, these results suggest the possibility of VSIG4 signaling-based regulation of orally administered antigens. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. A Calibrated Test-Set for Measurement of Access-Point Time Specifications in Hybrid Wired/Wireless Industrial Communication †

    Directory of Open Access Journals (Sweden)

    Federico Tramarin

    2018-05-01

    Full Text Available In factory automation and process control systems, hybrid wired/wireless networks are often deployed to connect devices of difficult reachability such as those mounted on mobile equipment. A widespread implementation of these networks makes use of Access Points (APs to implement wireless extensions of Real-Time Ethernet (RTE networks via the IEEE 802.11 Wireless LAN (WLAN. Unfortunately, APs may introduce random delays in frame forwarding, mainly related to their internal behavior (e.g., queue management, processing times, that clearly impact the overall worst case execution time of real-time tasks involved in industrial process control systems. As a consequence, the knowledge of such delays becomes a crucial design parameter, and their estimation is definitely of utter importance. In this scenario, the paper presents an original and effective method to measure the aforementioned delays introduced by APs, exploiting a hybrid loop-back link and a simple, yet accurate set-up with moderate instrumentation requirements. The proposed method, which requires an initial calibration phase by means of a reference AP, has been successfully tested on some commercial APs to prove its effectiveness. The proposed measurement procedure is proven to be general and, as such, can be profitably adopted in even different scenarios.

  9. Nightlife violence: a gender-specific view on risk factors for violence in nightlife settings: a cross-sectional study in nine European countries.

    Science.gov (United States)

    Schnitzer, Susanne; Bellis, Mark A; Anderson, Zara; Hughes, Karen; Calafat, Amador; Juan, Montse; Kokkevi, Anna

    2010-06-01

    Within nightlife settings, youth violence places large burdens on both nightlife users and wider society. Internationally, research has identified risk factors for nightlife violence. However, few empirical studies have assessed differences in risk factors between genders. Here, a pan-European cross-sectional survey of 1,341 nightlife users aged 16 to 35 assessed a variety of risk-taking traits, including violence, sexual, alcohol, and drug-related current and historic behaviors. Results show that the likelihood of having been involved in a physical fight in nightlife increases with younger age, drunkenness, and increasing preference for tolerant venues for both genders. The odds of involvement in a fight for females who were drunk five or more times in the past 4 weeks were almost five times higher than those who were never drunk (odds ratio for males 1.99). Use of cocaine more than doubled the risk of involvement in violence among males. However, no association was found for females. For heterosexual men, the odds for violence almost doubled compared with bisexual or homosexual men, whereas for women heterosexuality was a protective factor. The effects of structural risk factors (e.g., bar and club characteristics) for nightlife violence differed by gender. To develop effective violence prevention measures in nightlife, considerations need to be made regarding the demographic composition of patrons in addition to wider structural elements within the nighttime environment.

  10. The AHL- and BDSF-dependent quorum sensing systems control specific and overlapping sets of genes in Burkholderia cenocepacia H111.

    Directory of Open Access Journals (Sweden)

    Nadine Schmid

    Full Text Available Quorum sensing in Burkholderia cenocepacia H111 involves two signalling systems that depend on different signal molecules, namely N-acyl homoserine lactones (AHLs and the diffusible signal factor cis-2-dodecenoic acid (BDSF. Previous studies have shown that AHLs and BDSF control similar phenotypic traits, including biofilm formation, proteolytic activity and pathogenicity. In this study we mapped the BDSF stimulon by RNA-Seq and shotgun proteomics analysis. We demonstrate that a set of the identified BDSF-regulated genes or proteins are also controlled by AHLs, suggesting that the two regulons partially overlap. The detailed analysis of two mutually regulated operons, one encoding three lectins and the other one encoding the large surface protein BapA and its type I secretion machinery, revealed that both AHLs and BDSF are required for full expression, suggesting that the two signalling systems operate in parallel. In accordance with this, we show that both AHLs and BDSF are required for biofilm formation and protease production.

  11. Universal and blocking primer mismatches limit the use of high-throughput DNA sequencing for the quantitative metabarcoding of arthropods.

    Science.gov (United States)

    Piñol, J; Mir, G; Gomez-Polo, P; Agustí, N

    2015-07-01

    The quantification of the biological diversity in environmental samples using high-throughput DNA sequencing is hindered by the PCR bias caused by variable primer-template mismatches of the individual species. In some dietary studies, there is the added problem that samples are enriched with predator DNA, so often a predator-specific blocking oligonucleotide is used to alleviate the problem. However, specific blocking oligonucleotides could coblock nontarget species to some degree. Here, we accurately estimate the extent of the PCR biases induced by universal and blocking primers on a mock community prepared with DNA of twelve species of terrestrial arthropods. We also compare universal and blocking primer biases with those induced by variable annealing temperature and number of PCR cycles. The results show that reads of all species were recovered after PCR enrichment at our control conditions (no blocking oligonucleotide, 45 °C annealing temperature and 40 cycles) and high-throughput sequencing. They also show that the four factors considered biased the final proportions of the species to some degree. Among these factors, the number of primer-template mismatches of each species had a disproportionate effect (up to five orders of magnitude) on the amplification efficiency. In particular, the number of primer-template mismatches explained most of the variation (~3/4) in the amplification efficiency of the species. The effect of blocking oligonucleotide concentration on nontarget species relative abundance was also significant, but less important (below one order of magnitude). Considering the results reported here, the quantitative potential of the technique is limited, and only qualitative results (the species list) are reliable, at least when targeting the barcoding COI region. © 2014 John Wiley & Sons Ltd.

  12. Metabolic primers for detection of (Per)chlorate-reducing bacteria in the environment and phylogenetic analysis of cld gene sequences.

    Science.gov (United States)

    Bender, Kelly S; Rice, Melissa R; Fugate, William H; Coates, John D; Achenbach, Laurie A

    2004-09-01

    Natural attenuation of the environmental contaminant perchlorate is a cost-effective alternative to current removal methods. The success of natural perchlorate remediation is dependent on the presence and activity of dissimilatory (per)chlorate-reducing bacteria (DPRB) within a target site. To detect DPRB in the environment, two degenerate primer sets targeting the chlorite dismutase (cld) gene were developed and optimized. A nested PCR approach was used in conjunction with these primer sets to increase the sensitivity of the molecular detection method. Screening of environmental samples indicated that all products amplified by this method were cld gene sequences. These sequences were obtained from pristine sites as well as contaminated sites from which DPRB were isolated. More than one cld phylotype was also identified from some samples, indicating the presence of more than one DPRB strain at those sites. The use of these primer sets represents a direct and sensitive molecular method for the qualitative detection of (per)chlorate-reducing bacteria in the environment, thus offering another tool for monitoring natural attenuation. Sequences of cld genes isolated in the course of this project were also generated from various DPRB and provided the first opportunity for a phylogenetic treatment of this metabolic gene. Comparisons of the cld and 16S ribosomal DNA (rDNA) gene trees indicated that the cld gene does not track 16S rDNA phylogeny, further implicating the possible role of horizontal transfer in the evolution of (per)chlorate respiration.

  13. Prospective Randomized Double-Blind Pilot Study of Site-Specific Consensus Atlas Implementation for Rectal Cancer Target Volume Delineation in the Cooperative Group Setting

    International Nuclear Information System (INIS)

    Fuller, Clifton D.; Nijkamp, Jasper; Duppen, Joop C.; Rasch, Coen R.N.; Thomas, Charles R.; Wang, Samuel J.; Okunieff, Paul; Jones, William E.; Baseman, Daniel; Patel, Shilpen; Demandante, Carlo G.N.; Harris, Anna M.; Smith, Benjamin D.; Katz, Alan W.; McGann, Camille

    2011-01-01

    Purpose: Variations in target volume delineation represent a significant hurdle in clinical trials involving conformal radiotherapy. We sought to determine the effect of a consensus guideline-based visual atlas on contouring the target volumes. Methods and Materials: A representative case was contoured (Scan 1) by 14 physician observers and a reference expert with and without target volume delineation instructions derived from a proposed rectal cancer clinical trial involving conformal radiotherapy. The gross tumor volume (GTV), and two clinical target volumes (CTVA, including the internal iliac, presacral, and perirectal nodes, and CTVB, which included the external iliac nodes) were contoured. The observers were randomly assigned to receipt (Group A) or nonreceipt (Group B) of a consensus guideline and atlas for anorectal cancers and then instructed to recontour the same case/images (Scan 2). Observer variation was analyzed volumetrically using the conformation number (CN, where CN = 1 equals total agreement). Results: Of 14 evaluable contour sets (1 expert and 7 Group A and 6 Group B observers), greater agreement was found for the GTV (mean CN, 0.75) than for the CTVs (mean CN, 0.46-0.65). Atlas exposure for Group A led to significantly increased interobserver agreement for CTVA (mean initial CN, 0.68, after atlas use, 0.76; p = .03) and increased agreement with the expert reference (initial mean CN, 0.58; after atlas use, 0.69; p = .02). For the GTV and CTVB, neither the interobserver nor the expert agreement was altered after atlas exposure. Conclusion: Consensus guideline atlas implementation resulted in a detectable difference in interobserver agreement and a greater approximation of expert volumes for the CTVA but not for the GTV or CTVB in the specified case. Visual atlas inclusion should be considered as a feature in future clinical trials incorporating conformal RT.

  14. Prospective randomized double-blind pilot study of site-specific consensus atlas implementation for rectal cancer target volume delineation in the cooperative group setting

    Science.gov (United States)

    Fuller, Clifton D.; Nijkamp, Jasper; Duppen, Joop; Rasch, Coen R.N.; Thomas, Charles R.; Wang, Samuel J.; Okunieff, Paul; Jones, William E.; Baseman, Daniel; Patel, Shilpen; Demandante, Carlo G. N.; Harris, Anna M.; Smith, Benjamin D.; Katz, Alan W.; McGann, Camille; Harper, Jennifer L.; Chang, Daniel T.; Smalley, Stephen; Marshall, David T.; Goodman, Karyn A.; Papanikolaou, Niko; Kachnic, Lisa A.

    2010-01-01

    Purpose Variation in target volume delineation represents a significant hurdle in clinical trials involving conformal radiotherapy. We sought to determine the impact of a consensus guideline-based visual atlas on contouring of target volumes. Methods A representative case and target volume delineation instructions derived from a proposed rectal cancer clinical trial involving conformal radiotherapy were contoured (Scan1) by 14 physician observers and a reference expert. Gross tumor volume (GTV), and 2 clinical target volumes (CTVA, comprising internal iliac, pre-sacral, and peri-rectal nodes, and CTVB, external iliac nodes) were contoured. Observers were randomly assigned to receipt (Group_A) /non-receipt (Group_B) of a consensus guideline and atlas for anorectal cancers, then instructed to re-contour the same case/images (Scan2). Observer variation was analyzed volumetrically using conformation number (CN, where CN=1 equals a total agreement). Results In 14 evaluable contour sets (1 expert, 7 Group_A, 6 Group_B), there was greater agreement for GTV (mean CN 0.75) than CTVs (mean CN 0.46–0.65). Atlas exposure for Group_A led to a significant increased inter-observer agreement for CTVA (mean initial CN 0.68, post-atlas 0.76; p=0.03), as well as increased agreement with the expert reference (initial mean CN 0.58, 0.69 post-atlas; p=0.02). For GTV and CTVB, neither inter-observer nor expert agreement was altered after atlas exposure. Conclusion Consensus guideline atlas implementation resulted in a detectable difference in inter-observer agreement and greater approximation of expert volumes for CTVA, but not GTV or CTVB, in the specified case. Visual atlas inclusion should be considered as a feature in future clinical trials incorporating conformal radiotherapy. PMID:20400244

  15. Bond strength of compomers to dentin using acidic primers.

    Science.gov (United States)

    Tate, W H; You, C; Powers, J M

    1999-10-01

    To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.

  16. Single primer amplification reaction methods reveal exotic and ...

    Indian Academy of Sciences (India)

    Unknown

    mulberry varieties using three different PCR based single primer amplification ..... the results of a multi- variate analysis using Mahalanobis D2 statistic in case of .... Rajan M V, Chaturvedi H K and Sarkar A 1997 Multivariate analysis as an aid ...

  17. Diversity of internal structures in inhibited epoxy primers

    Directory of Open Access Journals (Sweden)

    Anthony E. Hughes

    2015-10-01

    Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.

  18. Blood Donation and Transfusion: A Primer for Health Educators.

    Science.gov (United States)

    Felts, W. Michael; Glascoff, Mary A.

    1991-01-01

    Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)

  19. A Primer on Concepts and Applications of Proteomics in Neuroscience

    DEFF Research Database (Denmark)

    Hosp, Fabian; Mann, Matthias

    2017-01-01

    The enormous complexity of the central nervous system has impeded its systemic exploration for decades but powerful "omic" technologies are now pushing forward the frontiers of neuroscience research at an increasing pace. This Primer reviews the most recent progress in mass spectrometry (MS...

  20. Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.

    Science.gov (United States)

    Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe

    2018-01-17

    In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.

  1. Note: Primer Amysat 001; Fragment size is 211bp

    Indian Academy of Sciences (India)

    Renuka

    Bhandara : Lanes 1–14 represent different strains of Bhandara Ecorace. Note: Primer Amysat 001; Fragment size is 211bp. Fig. 1. SSR profiles generated from genomic DNA of 16 strains from different individuals of (A.L, D. TV, D. BV, Modal, Sukinda, Raily, Bhandara) ecoraces of tasar silk worm, Antheraea mylitta using the.

  2. Characteristics of the population employed in primer sector in Turkey

    Directory of Open Access Journals (Sweden)

    Bayar Rüya

    2006-01-01

    Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

  3. Controlling Air Pollution; A Primer on Stationary Source Control Techniques.

    Science.gov (United States)

    Corman, Rena

    This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…

  4. Macroecology: A Primer for Biological Oceanography

    Science.gov (United States)

    Li, W. K. W.

    2016-02-01

    Macroecology is the study of ecological patterns discerned at a spatial, temporal, or organization scale higher than that at which the focal entities interact. Such patterns are statistical or emergent manifestations arising from the ensemble of component entities. Although macroecology is a neologism largely based in terrestrial and avian ecology, macroscopic patterns have long been recognised in biological oceanography. Familiar examples include Redfield elemental stoichiometry, Elton trophic pyramids, Sheldon biomass spectrum, and Margalef life-forms mandala. Macroecological regularities can often be found along various continua, such as along body size in power-law scaling or along habitat temperature in metabolic theory. Uniquely in oceanography, a partition of the world ocean continuum into Longhurst biogeochemical provinces provides a spatial organization well-suited for macroecological investigations. In this rational discrete approach, fundamental processes in physical and biological oceanography that differentiate a set of non-overlapping ocean regions also appear to shape the macroecological structure of phytoplankton communities.

  5. A primer on scientific programming with Python

    CERN Document Server

    Langtangen, Hans Petter

    2014-01-01

    The book serves as a first introduction to computer programming of scientific applications, using the high-level Python language. The exposition is example and problem-oriented, where the applications are taken from mathematics, numerical calculus, statistics, physics, biology and finance. The book teaches "Matlab-style" and procedural programming as well as object-oriented programming. High school mathematics is a required background and it is advantageous to study classical and numerical one-variable calculus in parallel with reading this book. Besides learning how to program computers, the reader will also learn how to solve mathematical problems, arising in various branches of science and engineering, with the aid of numerical methods and programming. By blending programming, mathematics and scientific applications, the book lays a solid foundation for practicing computational science. From the reviews: Langtangen … does an excellent job of introducing programming as a set of skills in problem solving. ...

  6. A primer on scientific programming with Python

    CERN Document Server

    Langtangen, Hans Petter

    2016-01-01

    The book serves as a first introduction to computer programming of scientific applications, using the high-level Python language. The exposition is example and problem-oriented, where the applications are taken from mathematics, numerical calculus, statistics, physics, biology and finance. The book teaches "Matlab-style" and procedural programming as well as object-oriented programming. High school mathematics is a required background and it is advantageous to study classical and numerical one-variable calculus in parallel with reading this book. Besides learning how to program computers, the reader will also learn how to solve mathematical problems, arising in various branches of science and engineering, with the aid of numerical methods and programming. By blending programming, mathematics and scientific applications, the book lays a solid foundation for practicing computational science. From the reviews: Langtangen … does an excellent job of introducing programming as a set of skills in problem solving. ...

  7. Removal of PCR error products and unincorporated primers by metal-chelate affinity chromatography.

    Directory of Open Access Journals (Sweden)

    Indhu Kanakaraj

    Full Text Available Immobilized Metal Affinity Chromatography (IMAC has been used for decades to purify proteins on the basis of amino acid content, especially surface-exposed histidines and "histidine tags" genetically added to recombinant proteins. We and others have extended the use of IMAC to purification of nucleic acids via interactions with the nucleotide bases, especially purines, of single-stranded RNA and DNA. We also have demonstrated the purification of plasmid DNA from contaminating genomic DNA by IMAC capture of selectively-denatured genomic DNA. Here we describe an efficient method of purifying PCR products by specifically removing error products, excess primers, and unincorporated dNTPs from PCR product mixtures using flow-through metal-chelate affinity adsorption. By flowing a PCR product mixture through a Cu(2+-iminodiacetic acid (IDA agarose spin column, 94-99% of the dNTPs and nearly all the primers can be removed. Many of the error products commonly formed by Taq polymerase also are removed. Sequencing of the IMAC-processed PCR product gave base-calling accuracy comparable to that obtained with a commercial PCR product purification method. The results show that IMAC matrices (specifically Cu(2+-IDA agarose can be used for the purification of PCR products. Due to the generality of the base-specific mechanism of adsorption, IMAC matrices may also be used in the purification of oligonucleotides, cDNA, mRNA and micro RNAs.

  8. Development of a loop-mediated isothermal amplification (LAMP) assay for rapid and specific detection of common genetically modified organisms (GMOs).

    Science.gov (United States)

    Feng, Jiawang; Tang, Shiming; Liu, Lideng; Kuang, Xiaoshan; Wang, Xiaoyu; Hu, Songnan; You, Shuzhu

    2015-03-01

    Here, we developed a loop-mediated isothermal amplification (LAMP) assay for 11 common transgenic target DNA in GMOs. Six sets of LAMP primer candidates for each target were designed and their specificity, sensitivity, and reproductivity were evaluated. With the optimized LAMP primers, this LAMP assay was simply run within 45-60 min to detect all these targets in GMOs tested. The sensitivity, specificity, and reproductivity of the LAMP assay were further analyzed in comparison with those of Real-Time PCR. In consistent with real-time PCR, detection of 0.5% GMOs in equivalent background DNA was possible using this LAMP assay for all targets. In comparison with real-time PCR, the LAMP assay showed the same results with simple instruments. Hence, the LAMP assay developed can provide a rapid and simple approach for routine screening as well as specific events detection of many GMOs.

  9. In Silico PCR Tools for a Fast Primer, Probe, and Advanced Searching.

    Science.gov (United States)

    Kalendar, Ruslan; Muterko, Alexandr; Shamekova, Malika; Zhambakin, Kabyl

    2017-01-01

    The polymerase chain reaction (PCR) is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. The principle of this technique has been further used and applied in plenty of other simple or complex nucleic acid amplification technologies (NAAT). In parallel to laboratory "wet bench" experiments for nucleic acid amplification technologies, in silico or virtual (bioinformatics) approaches have been developed, among which in silico PCR analysis. In silico NAAT analysis is a useful and efficient complementary method to ensure the specificity of primers or probes for an extensive range of PCR applications from homology gene discovery, molecular diagnosis, DNA fingerprinting, and repeat searching. Predicting sensitivity and specificity of primers and probes requires a search to determine whether they match a database with an optimal number of mismatches, similarity, and stability. In the development of in silico bioinformatics tools for nucleic acid amplification technologies, the prospects for the development of new NAAT or similar approaches should be taken into account, including forward-looking and comprehensive analysis that is not limited to only one PCR technique variant. The software FastPCR and the online Java web tool are integrated tools for in silico PCR of linear and circular DNA, multiple primer or probe searches in large or small databases and for advanced search. These tools are suitable for processing of batch files that are essential for automation when working with large amounts of data. The FastPCR software is available for download at http://primerdigital.com/fastpcr.html and the online Java version at http://primerdigital.com/tools/pcr.html .

  10. Firearm laws: a primer for psychiatrists.

    Science.gov (United States)

    Price, Marilyn; Norris, Donna Marie

    2010-01-01

    Persons with mental illness or substance abuse have been perceived by the public to pose an increased risk of violence to themselves and others. As a result, federal and state laws have restricted the right of certain categories of persons with mental illness or substance abuse to possess, register, license, retain, or carry a firearm. Clinicians should be familiar with the specific firearm statutes of their own states, which describe the disqualifying mental health/substance abuse history and the role and responsibility of the psychiatrist in the process. State statutes vary widely in terms of the definitions of, and reporting requirements relating to, prohibited persons with mental illness or substance abuse. States also vary in the duration of the prohibition and in the timing of the appeals process. Some of the statutes have specific provisions for the removal of a firearm when a prohibited person is identified. States may maintain a mental health database that is used to determine firearm eligibility and may forward information to the National Instant Criminal Background Check System. The National Instant Criminal Background Check System Improvement Amendments Act of 2007 will likely increase the number of persons identified as belonging to the prohibited class.

  11. A primer on precision medicine informatics.

    Science.gov (United States)

    Sboner, Andrea; Elemento, Olivier

    2016-01-01

    In this review, we describe key components of a computational infrastructure for a precision medicine program that is based on clinical-grade genomic sequencing. Specific aspects covered in this review include software components and hardware infrastructure, reporting, integration into Electronic Health Records for routine clinical use and regulatory aspects. We emphasize informatics components related to reproducibility and reliability in genomic testing, regulatory compliance, traceability and documentation of processes, integration into clinical workflows, privacy requirements, prioritization and interpretation of results to report based on clinical needs, rapidly evolving knowledge base of genomic alterations and clinical treatments and return of results in a timely and predictable fashion. We also seek to differentiate between the use of precision medicine in germline and cancer. © The Author 2015. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

  12. Online social networking: a primer for radiology.

    Science.gov (United States)

    Prasanna, Prasanth M; Seagull, F Jacob; Nagy, Paul

    2011-10-01

    Online social networking is an immature, but rapidly evolving industry of web-based technologies that allow individuals to develop online relationships. News stories populate the headlines about various websites which can facilitate patient and doctor interaction. There remain questions about protecting patient confidentiality and defining etiquette in order to preserve the doctor/patient relationship and protect physicians. How much social networking-based communication or other forms of E-communication is effective? What are the potential benefits and pitfalls of this form of communication? Physicians are exploring how social networking might provide a forum for interacting with their patients, and advance collaborative patient care. Several organizations and institutions have set forth policies to address these questions and more. Though still in its infancy, this form of media has the power to revolutionize the way physicians interact with their patients and fellow health care workers. In the end, physicians must ask what value is added by engaging patients or other health care providers in a social networking format. Social networks may flourish in health care as a means of distributing information to patients or serve mainly as support groups among patients. Physicians must tread a narrow path to bring value to interactions in these networks while limiting their exposure to unwanted liability.

  13. A U.S. Biodefense Strategy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Poulin, D

    2009-05-11

    The anthrax mailings that followed the attacks of September 11, 2001 highlighted the need for a comprehensive national strategy to prevent, prepare for, respond to, and mitigate the effects of biological attacks. The goal of U.S. biodefense strategy is to reduce the likelihood of a future biological event, improve overall U.S. public health security, and minimize the economic and social disruption of a biological incident. Presidential communications, federal legislation, and executive agency planning documents provide the foundation for this strategy. Central to current U.S. biodefense strategy is the 2004 Homeland Security Presidential Directive (HSPD) 10, Biodefense for the 21st Century, which states that ''the United States will use all means necessary to prevent, protect against, and mitigate biological weapons attacks perpetrated against our homeland and our global interests.'' HSPD-10 also sets forth four pillars of U.S. biodefense: {sm_bullet} Threat awareness includes timely, accurate, and relevant intelligence, threat assessment, and the anticipation of future threats. {sm_bullet} Prevention and protection involve continuing and expanding efforts to limit access to agents, technologies, and knowledge to certain groups and countries as well as protecting critical infrastructure from the effects of biological attacks. {sm_bullet} Surveillance and detection provide early warning or recognition of biological attacks to permit a timely response and mitigation of consequences as well as attribution. {sm_bullet} Response and recovery include pre-attack planning and preparedness, capabilities to treat casualties, risk communications, physical control measures, medical countermeasures, and decontamination capabilities.

  14. Feline dental radiography and radiology: A primer.

    Science.gov (United States)

    Niemiec, Brook A

    2014-11-01

    Information crucial to the diagnosis and treatment of feline oral diseases can be ascertained using dental radiography and the inclusion of this technology has been shown to be the best way to improve a dental practice. Becoming familar with the techniques required for dental radiology and radiography can, therefore, be greatly beneficial. Novices to dental radiography may need some time to adjust and become comfortable with the techniques. If using dental radiographic film, the generally recommended 'E' or 'F' speeds may be frustrating at first, due to their more specific exposure and image development requirements. Although interpreting dental radiographs is similar to interpreting a standard bony radiograph, there are pathologic states that are unique to the oral cavity and several normal anatomic structures that may mimic pathologic changes. Determining which teeth have been imaged also requires a firm knowledge of oral anatomy as well as the architecture of dental films/digital systems. This article draws on a range of dental radiography and radiology resources, and the benefit of the author's own experience, to review the basics of taking and interpreting intraoral dental radiographs. A simplified method for positioning the tubehead is explained and classic examples of some common oral pathologies are provided. © ISFM and AAFP 2014.

  15. Electronic medical devices: a primer for pathologists.

    Science.gov (United States)

    Weitzman, James B

    2003-07-01

    Electronic medical devices (EMDs) with downloadable memories, such as implantable cardiac pacemakers, defibrillators, drug pumps, insulin pumps, and glucose monitors, are now an integral part of routine medical practice in the United States, and functional organ replacements, such as the artificial heart, pancreas, and retina, will most likely become commonplace in the near future. Often, EMDs end up in the hands of the pathologist as a surgical specimen or at autopsy. No established guidelines for systematic examination and reporting or comprehensive reviews of EMDs currently exist for the pathologist. To provide pathologists with a general overview of EMDs, including a brief history; epidemiology; essential technical aspects, indications, contraindications, and complications of selected devices; potential applications in pathology; relevant government regulations; and suggested examination and reporting guidelines. Articles indexed on PubMed of the National Library of Medicine, various medical and history of medicine textbooks, US Food and Drug Administration publications and product information, and specifications provided by device manufacturers. Studies were selected on the basis of relevance to the study objectives. Descriptive data were selected by the author. Suggested examination and reporting guidelines for EMDs received as surgical specimens and retrieved at autopsy. Electronic medical devices received as surgical specimens and retrieved at autopsy are increasing in number and level of sophistication. They should be systematically examined and reported, should have electronic memories downloaded when indicated, will help pathologists answer more questions with greater certainty, and should become an integral part of the formal knowledge base, research focus, training, and practice of pathology.

  16. An evaluation of corrosion protection by two epoxy primers on 2219-T87 and 7075-T73 aluminum

    Science.gov (United States)

    Mendrek, M. J.

    1992-01-01

    A comparison of the corrosion protection provided by two amine epoxy primers was made using salt fog, alternate immersion, and total immersion as exposure media. The study is the result of a request to use an unqualified low volatile organic carbon (VOC) primer (AKZO 463-6-78) in place of the current primer (AKZO 463-6-3) because environmental regulations have eliminated use of the current primer in many states. Primed, scribed samples of 2219-T87 and 7075-T73 aluminum were exposed to 5-percent NaCl salt fog and 3.5-percent NaCl alternate immersion for a period of 90 days. In addition, electrode samples immersed in 3.5-percent NaCl were tested using electrochemical impedance spectroscopy (EIS). The EG&G model 368 ac impedance measurement system was used to monitor changing properties of AKZO 463-6-78 and AKZO 463-6-3 primed 2219-T87 aluminum for a period of 30 days. The response of the corroding system of a frequency scan can be modeled in terms of an equivalent circuit consisting of resistors and capacitors in a specific arrangement. Each resistor/capacitor combination represents physical processes taking place within the electrolyte, at the electrolyte/primer surface, within the coating, and at the coating/substrate surface. Values for the resistors and capacitors are assigned following a nonlinear least squares fit of the data to the equivalent circuit. Changes in the values of equivalent circuit parameters during the 30-day exposure allow assessment of the time to and mechanism of coating breakdown.

  17. The ability of T2/B4 primers to detect Leishmania infantum among ...

    African Journals Online (AJOL)

    SERVER

    2008-04-03

    Apr 3, 2008 ... Reverse Primer (5`-CCT CTC TTT TTT CNC TGT GC-3`). (Schönian et al., 1996),. B. Forward Primer (RV1) (5`-GTG GGG GAG GGG CGT TCT-3`) and Reverse Primer (RV2) (5`-ATT TTA CAC CAA CCC CCA GTT-. 3`) (Lachaud et al., 2002; Reale et al., 1999),. C. Forward Primer (T2) (5`-CGG CTT CGC ...

  18. The New Science of Cybernetics: A Primer

    Directory of Open Access Journals (Sweden)

    Karl H. Müller

    2013-12-01

    Full Text Available Four years after the publication of the first volume on the new science of cybernetics (NSC (Müller, 2009 and after two more books on NSC (Müller, 2011, 2012 it is time to present and to summarize the main features and characteristics of the new science of cybernetics within a single article. - Historically, the new science of cybernetics can be viewed as a potential outline of Heinz von Foerster's vision of second-order cybernetics as the science of observing systems or, alternatively, of living systems by living systems for living systems. Heinz von Foerster introduced the concept of second-order cybernetics on several occasions, without specifying, however, its content and cognitive organization (Foerster, 1974, 2003 - Systematically, the new science of cybernetics operates on a new level which, not quite unexpectedly and surprisingly, can be characterized as second-order level. This second-order level is self-reflexive by nature and by design, because this level comes into play whenever a concept, a model or an academic field turns onto itself, like in understanding or in cybernetics of cybernetics. - Functionally, the new science of cybernetics can be viewed as a trans- or post-disciplinary second-order field for navigating through an ocean of first-order level science. NSC operates primarily with objects or with operations from first-order science and transforms them into new components which exhibit strong comparative advantages in terms of novelty and robustness. This list of historic, systemic and functional features of the new science of cybernetics(NSC may look strange or incomprehensible at first sight. It will become, thus, the main purpose of this article to transform these seemingly vague and unclear descriptions into concise ones which readers with only a weak familiarity with the old science of cybernetics can understand. Eventually, even the short set above of critical characteristics of the new science of cybernetics should

  19. Impact of patient-specific factors, irradiated left ventricular volume, and treatment set-up errors on the development of myocardial perfusion defects after radiation therapy for left-sided breast cancer

    International Nuclear Information System (INIS)

    Evans, Elizabeth S.; Prosnitz, Robert G.; Yu Xiaoli; Zhou Sumin; Hollis, Donna R.; Wong, Terence Z.; Light, Kim L.; Hardenbergh, Patricia H.; Blazing, Michael A.; Marks, Lawrence B.

    2006-01-01

    Purpose: The aim of this study was to assess the impact of patient-specific factors, left ventricle (LV) volume, and treatment set-up errors on the rate of perfusion defects 6 to 60 months post-radiation therapy (RT) in patients receiving tangential RT for left-sided breast cancer. Methods and Materials: Between 1998 and 2005, a total of 153 patients were enrolled onto an institutional review board-approved prospective study and had pre- and serial post-RT (6-60 months) cardiac perfusion scans to assess for perfusion defects. Of the patients, 108 had normal pre-RT perfusion scans and available follow-up data. The impact of patient-specific factors on the rate of perfusion defects was assessed at various time points using univariate and multivariate analysis. The impact of set-up errors on the rate of perfusion defects was also analyzed using a one-tailed Fisher's Exact test. Results: Consistent with our prior results, the volume of LV in the RT field was the most significant predictor of perfusion defects on both univariate (p = 0.0005 to 0.0058) and multivariate analysis (p = 0.0026 to 0.0029). Body mass index (BMI) was the only significant patient-specific factor on both univariate (p = 0.0005 to 0.022) and multivariate analysis (p = 0.0091 to 0.05). In patients with very small volumes of LV in the planned RT fields, the rate of perfusion defects was significantly higher when the fields set-up 'too deep' (83% vs. 30%, p = 0.059). The frequency of deep set-up errors was significantly higher among patients with BMI ≥25 kg/m 2 compared with patients of normal weight (47% vs. 28%, p = 0.068). Conclusions: BMI ≥25 kg/m 2 may be a significant risk factor for cardiac toxicity after RT for left-sided breast cancer, possibly because of more frequent deep set-up errors resulting in the inclusion of additional heart in the RT fields. Further study is necessary to better understand the impact of patient-specific factors and set-up errors on the development of RT

  20. Light front field theory: an advanced primer

    International Nuclear Information System (INIS)

    Martinovic, L.

    2007-01-01

    We present an elementary introduction to quantum field theory formulated in terms of Dirac's light front variables. In addition to general principles and methods, a few more specific topics and approaches based on the author's work will be discussed. Most of the discussion deals with massive two-dimensional models formulated in a finite spatial volume starting with a detailed comparison between quantization of massive free fields in the usual field theory and the light front (LF) quantization. We discuss basic properties such as relativistic invariance and causality. After the LF treatment of the soluble Federbush model, a LF approach to spontaneous symmetry breaking is explained and a simple gauge theory - the massive Schwinger model in various gauges is studied. A LF version of bosonization and the massive Thirring model are also discussed. A special chapter is devoted to the method of discretized light cone quantization and its application to calculations of the properties of quantum solitons. The problem of LF zero modes is illustrated with the example of the two/dimensional Yukawa model. Hamiltonian perturbation theory in the LF formulation is derived and applied to a few simple processes to demonstrate its advantages. As a byproduct, it is shown that the LF theory cannot be obtained as a 'light-like' limit of the usual field theory quantized on a initial space-like surface. A simple LF formulation of the Higgs mechanism is then given Since our intention was to provide a treatment of the light front quantization accessible to postgradual students, an effort was made to discuss most of the topics pedagogically and number of technical details and derivations are contained in the appendices (Author)

  1. An Evolutionary/Biochemical Connection Between Promoter- and Primer-Dependent Polymerases Revealed by Selective Evolution of Ligands by Exponential Enrichment (SELEX).

    Science.gov (United States)

    Fenstermacher, Katherine J; Achuthan, Vasudevan; Schneider, Thomas D; DeStefano, Jeffrey J

    2018-01-16

    DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified Selective Evolution of Ligands by Exponential Enrichment (SELEX) approach. Two Taq -specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. Taq1 contained 8 nucleotides (5' -CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCR reactions. Similarly, exonuclease minus Klenow polymerase also selected a high affinity primer that contained a related core promoter sequence from phage T7 RNAP (5' -ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity suggesting that binding was highly sequence-specific. The results are discussed in the context of possible effects on multi-primer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs. Importance This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function, or be a consequences of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of

  2. Counting SET-free sets

    OpenAIRE

    Harman, Nate

    2016-01-01

    We consider the following counting problem related to the card game SET: How many $k$-element SET-free sets are there in an $n$-dimensional SET deck? Through a series of algebraic reformulations and reinterpretations, we show the answer to this question satisfies two polynomiality conditions.

  3. First large-scale DNA barcoding assessment of reptiles in the biodiversity hotspot of Madagascar, based on newly designed COI primers.

    Science.gov (United States)

    Nagy, Zoltán T; Sonet, Gontran; Glaw, Frank; Vences, Miguel

    2012-01-01

    DNA barcoding of non-avian reptiles based on the cytochrome oxidase subunit I (COI) gene is still in a very early stage, mainly due to technical problems. Using a newly developed set of reptile-specific primers for COI we present the first comprehensive study targeting the entire reptile fauna of the fourth-largest island in the world, the biodiversity hotspot of Madagascar. Representatives of the majority of Madagascan non-avian reptile species (including Squamata and Testudines) were sampled and successfully DNA barcoded. The new primer pair achieved a constantly high success rate (72.7-100%) for most squamates. More than 250 species of reptiles (out of the 393 described ones; representing around 64% of the known diversity of species) were barcoded. The average interspecific genetic distance within families ranged from a low of 13.4% in the Boidae to a high of 29.8% in the Gekkonidae. Using the average genetic divergence between sister species as a threshold, 41-48 new candidate (undescribed) species were identified. Simulations were used to evaluate the performance of DNA barcoding as a function of completeness of taxon sampling and fragment length. Compared with available multi-gene phylogenies, DNA barcoding correctly assigned most samples to species, genus and family with high confidence and the analysis of fewer taxa resulted in an increased number of well supported lineages. Shorter marker-lengths generally decreased the number of well supported nodes, but even mini-barcodes of 100 bp correctly assigned many samples to genus and family. The new protocols might help to promote DNA barcoding of reptiles and the established library of reference DNA barcodes will facilitate the molecular identification of Madagascan reptiles. Our results might be useful to easily recognize undescribed diversity (i.e. novel taxa), to resolve taxonomic problems, and to monitor the international pet trade without specialized expert knowledge.

  4. First Large-Scale DNA Barcoding Assessment of Reptiles in the Biodiversity Hotspot of Madagascar, Based on Newly Designed COI Primers

    Science.gov (United States)

    Nagy, Zoltán T.; Sonet, Gontran; Glaw, Frank; Vences, Miguel

    2012-01-01

    Background DNA barcoding of non-avian reptiles based on the cytochrome oxidase subunit I (COI) gene is still in a very early stage, mainly due to technical problems. Using a newly developed set of reptile-specific primers for COI we present the first comprehensive study targeting the entire reptile fauna of the fourth-largest island in the world, the biodiversity hotspot of Madagascar. Methodology/Principal Findings Representatives of the majority of Madagascan non-avian reptile species (including Squamata and Testudines) were sampled and successfully DNA barcoded. The new primer pair achieved a constantly high success rate (72.7–100%) for most squamates. More than 250 species of reptiles (out of the 393 described ones; representing around 64% of the known diversity of species) were barcoded. The average interspecific genetic distance within families ranged from a low of 13.4% in the Boidae to a high of 29.8% in the Gekkonidae. Using the average genetic divergence between sister species as a threshold, 41–48 new candidate (undescribed) species were identified. Simulations were used to evaluate the performance of DNA barcoding as a function of completeness of taxon sampling and fragment length. Compared with available multi-gene phylogenies, DNA barcoding correctly assigned most samples to species, genus and family with high confidence and the analysis of fewer taxa resulted in an increased number of well supported lineages. Shorter marker-lengths generally decreased the number of well supported nodes, but even mini-barcodes of 100 bp correctly assigned many samples to genus and family. Conclusions/Significance The new protocols might help to promote DNA barcoding of reptiles and the established library of reference DNA barcodes will facilitate the molecular identification of Madagascan reptiles. Our results might be useful to easily recognize undescribed diversity (i.e. novel taxa), to resolve taxonomic problems, and to monitor the international pet trade

  5. UpSet: Visualization of Intersecting Sets

    Science.gov (United States)

    Lex, Alexander; Gehlenborg, Nils; Strobelt, Hendrik; Vuillemot, Romain; Pfister, Hanspeter

    2016-01-01

    Understanding relationships between sets is an important analysis task that has received widespread attention in the visualization community. The major challenge in this context is the combinatorial explosion of the number of set intersections if the number of sets exceeds a trivial threshold. In this paper we introduce UpSet, a novel visualization technique for the quantitative analysis of sets, their intersections, and aggregates of intersections. UpSet is focused on creating task-driven aggregates, communicating the size and properties of aggregates and intersections, and a duality between the visualization of the elements in a dataset and their set membership. UpSet visualizes set intersections in a matrix layout and introduces aggregates based on groupings and queries. The matrix layout enables the effective representation of associated data, such as the number of elements in the aggregates and intersections, as well as additional summary statistics derived from subset or element attributes. Sorting according to various measures enables a task-driven analysis of relevant intersections and aggregates. The elements represented in the sets and their associated attributes are visualized in a separate view. Queries based on containment in specific intersections, aggregates or driven by attribute filters are propagated between both views. We also introduce several advanced visual encodings and interaction methods to overcome the problems of varying scales and to address scalability. UpSet is web-based and open source. We demonstrate its general utility in multiple use cases from various domains. PMID:26356912

  6. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-09-27

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  7. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

    1998-12-10

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  8. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders; FINAL

    International Nuclear Information System (INIS)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-01-01

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums

  9. Modified Primers for the Identification of Nonpathogenic Fusarium oxysporum Isolates That Have Biological Control Potential against Fusarium Wilt of Cucumber in Taiwan

    Science.gov (United States)

    Wang, Chaojen; Lin, Yisheng; Lin, Yinghong; Chung, Wenhsin

    2013-01-01

    Previous investigations demonstrated that Fusarium oxysporum (Fo), which is not pathogenic to cucumbers, could serve as a biological control agent for managing Fusarium wilt of cucumber caused by Fo f. sp. cucumerinum (Foc) in Taiwan. However, thus far it has not been possible to separate the populations of pathogenic Fo from the nonpathogenic isolates that have biological control potential through their morphological characteristics. Although these two populations can be distinguished from one another using a bioassay, the work is laborious and time-consuming. In this study, a fragment of the intergenic spacer (IGS) region of ribosomal DNA from an Fo biological control agent, Fo366, was PCR-amplified with published general primers, FIGS11/FIGS12 and sequenced. A new primer, NPIGS-R, which was designed based on the IGS sequence, was paired with the FIGS11 primer. These primers were then evaluated for their specificity to amplify DNA from nonpathogenic Fo isolates that have biological control potential. The results showed that the modified primer pair, FIGS11/NPIGS-R, amplified a 500-bp DNA fragment from five of seven nonpathogenic Fo isolates. These five Fo isolates delayed symptom development of cucumber Fusarium wilt in greenhouse bioassay tests. Seventy-seven Fo isolates were obtained from the soil and plant tissues and then subjected to amplification using the modified primer pair; six samples showed positive amplification. These six isolates did not cause symptoms on cucumber seedlings when grown in peat moss infested with the isolates and delayed disease development when the same plants were subsequently inoculated with a virulent isolate of Foc. Therefore, the modified primer pair may prove useful for the identification of Fo isolates that are nonpathogenic to cucumber which can potentially act as biocontrol agents for Fusarium wilt of cucumber. PMID:23762289

  10. Profil Gangguan Kognitif pada Tumor Intrakranial Primer dan Metastasis

    OpenAIRE

    Kartika Maharani; Andira Larasari; Tiara Aninditha; Yetty Ramli

    2015-01-01

    Gangguan kognitif sering menyertai pasien tumor intrakranial dan menjadi penyebab utama disabilitas. Perbedaan patofisiologi tumor intrakranial primer (TIP) dan metastasis (TM) menyebabkan perbedaan gambaran klinis dan derajat  gangguan kognitif. Tujuan penelitian ini untuk mengetahui prevalensi dan profil gangguan kognitif pasien TIP dan TM. Disain penelitian potong-lintang retrospektif menggunakan data sekunder dari Poliklinik Saraf RSCM pada bulan Januari 2011-Desember 2013. Subjek b...

  11. A primer on the mortgage market and mortgage finance

    OpenAIRE

    Daniel J. McDonald; Daniel L. Thornton

    2008-01-01

    This article is a primer on mortgage finance. It discusses the basics of the mortgage market and mortgage finance. In so doing, it provides useful information that can aid individuals in making better mortgage finance decisions. The discussion and the tools are presented within the context of mortgage finance; however, these same principles and tools can be applied to a wide range of financial decisions.

  12. Primer on molecular genetics. DOE Human Genome Program

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  13. Transient Heat Transfer Model for Car Body Primer Curing

    OpenAIRE

    D. Zabala; N. Sánchez; J. Pinto

    2010-01-01

    A transient heat transfer mathematical model for the prediction of temperature distribution in the car body during primer baking has been developed by considering the thermal radiation and convection in the furnace chamber and transient heat conduction governing equations in the car framework. The car cockpit is considered like a structure with six flat plates, four vertical plates representing the car doors and the rear and front panels. The other two flat plates are the...

  14. Small Commercial Building Re-tuning: A Primer

    Energy Technology Data Exchange (ETDEWEB)

    Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas

    2013-09-30

    To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

  15. Sensory reception of the primer pheromone ethyl oleate

    Science.gov (United States)

    Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

    2012-05-01

    Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

  16. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    D. S. Lucas

    2004-10-01

    A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com.

  17. A quantitative and direct PCR assay for the subspecies-specific detection of Clavibacter michiganensis subsp. michiganensis based on a ferredoxin reductase gene.

    Science.gov (United States)

    Cho, Min Seok; Lee, Jang Ha; Her, Nam Han; Kim, Changkug; Seol, Young-Joo; Hahn, Jang Ho; Baeg, Ji Hyoun; Kim, Hong Gi; Park, Dong Suk

    2012-06-01

    The Gram-positive bacterium Clavibacter michiganensis subsp. michiganensis is the causal agent of canker disease in tomato. Because it is very important to control newly introduced inoculum sources from commercial materials, the specific detection of this pathogen in seeds and seedlings is essential for effective disease control. In this study, a novel and efficient assay for the detection and quantitation of C. michiganensis subsp. michiganensis in symptomless tomato and red pepper seeds was developed. A pair of polymerase chain reaction (PCR) primers (Cmm141F/R) was designed to amplify a specific 141 bp fragment on the basis of a ferredoxin reductase gene of C. michiganensis subsp. michiganensis NCPPB 382. The specificity of the primer set was evaluated using purified DNA from 16 isolates of five C. michiganensis subspecies, one other Clavibacter species, and 17 other reference bacteria. The primer set amplified a single band of expected size from the genomic DNA obtained from the C. michiganensis subsp. michiganensis strains but not from the other C. michiganensis subspecies or from other Clavibacter species. The detection limit was a single cloned copy of the ferredoxin reductase gene of C. michiganensis subsp. michiganensis. In conclusion, this quantitative direct PCR assay can be applied as a practical diagnostic method for epidemiological research and the sanitary management of seeds and seedlings with a low level or latent infection of C. michiganensis subsp. michiganensis.

  18. Detection of Vibrio harveyi using hemolysin primer in tiger shrimp Penaeus monodon

    Directory of Open Access Journals (Sweden)

    Irma Suriyani

    2015-05-01

    Full Text Available ABSTRACT This study was aimed to analyze the sensitivity and ability of primer hemolysin in detecting pathogenetic Vibrio on tiger shrimp post-larvae (PL exposed under different exposure times in media inoculated with Vibrio harveyi. The PL of tiger shrimp were infected with 106 cfu/mL of V. harveyi by immersion method for three, six, 12, 24, 48 and 72 hours. The presence of hemolisin genes was detected by PCR techniques. The electrophoresis detected narrow hemolysin genes after PL were exposed for three and six hours. Clear visible bands of DNA Vibrio were observed for 12 hours of exposure. In contrast, no detected hemolysin gene of Vibrio was observed for PL exposed within 24, 48, and 72 hours. The rapid detection on Vibrio pathogenic for tiger shrimp PL should be conducted within three to 12 hours of exposure. No recommendation in utilizing this rapid detection for tiger shrimp PL exposed beyond 12 hours of V. harveyi. Keywords: specific primer, luminous Vibrio bacteria, pathogenic, PCR method, hemolysin gene  ABSTRAK Penelitian ini bertujuan untuk mengetahui kemampuan atau sensitivitas primer hemolisin dalam mendeteksi Vibrio patogen dengan lama pemaparan berbeda. Penelitian ini dilakukan dengan menginfeksikan Vibrio harveyi pada benur udang dengan metode perendaman pada konsentrasi 106 cfu/mL. Pengambilan sampel dilakukan pada waktu tiga, enam, 12, 24, 48, dan 72 jam pascainfeksi. Keberadaan gen hemolisin pada bakteri V. harveyi dideteksi menggunakan teknik polymerase chain reaction (PCR. Hasil elektroforesis memperlihatkan bahwa pada pemaparan tiga dan enam jam keberadaan gen hemolisin dari bakteri Vibrio patogen yang diinfeksikan sudah dapat terdeteksi pada benur walaupun masih terlihat tipis. Pada pemaparan 12 jam terlihat sangat jelas pita-pita DNA dari bakteri patogen. Sedangkan pada pemaparan 24, 48, dan 72 jam sudah tidak terdeteksi lagi gen hemolisin dari bakteri Vibrio. Hal ini diduga disebabkan terjadinya penurunan populasi

  19. Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

    DEFF Research Database (Denmark)

    Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere

    2014-01-01

    , either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...

  20. Characterization of highly informative cross-species microsatellite panels for the Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) including five novel primers

    Science.gov (United States)

    Hunter, Margaret Kellogg; Broderick, Damien; Ovenden, Jennifer R.; Tucker, Kimberly Pause; Bonde, Robert K.; McGuire, Peter M.; Lanyon, Janet M.

    2010-01-01

    The Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) are threatened species of aquatic mammals in the order Sirenia. Sirenian conservation and management actions would benefit from a more complete understanding of genetic diversity and population structure. Generally, species-specific microsatellite markers are employed in conservation genetic studies; however, robust markers can be difficult and costly to isolate. To increase the number of available markers, dugong and manatee microsatellite primers were evaluated for cross-species amplification. Furthermore, one manatee and four dugong novel primers are reported. After polymerase chain reaction optimization, 23 (92%) manatee primers successfully amplified dugong DNA, of which 11 (48%) were polymorphic. Of the 32 dugong primers tested, 27 (84%) yielded product in the manatee, of which 17 (63%) were polymorphic. Dugong and manatee primers were compared and the most informative markers were selected to create robust and informative marker-panels for each species. These crossspecies microsatellite marker-panels can be employed to assess other sirenian populations and can provide beneficial information for the protection and management of these unique mammals.

  1. Characterization of highly informative cross-species microsatellite panels for the Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) including five novel primers.

    Science.gov (United States)

    Hunter, Margaret Kellogg; Broderick, Damien; Ovenden, Jennifer R; Tucker, Kimberly Pause; Bonde, Robert K; McGuire, Peter M; Lanyon, Janet M

    2010-03-01

    The Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) are threatened species of aquatic mammals in the order Sirenia. Sirenian conservation and management actions would benefit from a more complete understanding of genetic diversity and population structure. Generally, species-specific microsatellite markers are employed in conservation genetic studies; however, robust markers can be difficult and costly to isolate. To increase the number of available markers, dugong and manatee microsatellite primers were evaluated for cross-species amplification. Furthermore, one manatee and four dugong novel primers are reported. After polymerase chain reaction optimization, 23 (92%) manatee primers successfully amplified dugong DNA, of which 11 (48%) were polymorphic. Of the 32 dugong primers tested, 27 (84%) yielded product in the manatee, of which 17 (63%) were polymorphic. Dugong and manatee primers were compared and the most informative markers were selected to create robust and informative marker-panels for each species. These cross-species microsatellite marker-panels can be employed to assess other sirenian populations and can provide beneficial information for the protection and management of these unique mammals. Published 2009. This article is a US Government work and is in the public domain in the USA.

  2. A need for standardization in drinking water analysis – an investigation of DNA extraction procedure, primer choice and detection limit of 16S rRNA amplicon sequencing

    DEFF Research Database (Denmark)

    Brandt, Jakob; Nielsen, Per Halkjær; Albertsen, Mads

    have been made to illuminate the effects specifically related to bacterial communities in drinking water. In this study, we investigated the impact of the DNA extraction and primer choice on the observed community structure, and we also estimated the detection limit of the 16S rRNA amplicon sequencing...

  3. Improved primer sequences for the mitochondrial ND1, ND3/4 and ND5/6 segments in salmonid fishes : application to RFLP analysis of Atlantic salmon

    DEFF Research Database (Denmark)

    Eg Nielsen, Einar; Hansen, Michael Møller; Mensberg, Karen-Lise Dons

    1998-01-01

    New specific primers for the mtDNA segments ND1, ND3/4 and ND5/6 designed from the rainbow trout sequence, improved PCR amplification for salmonid fishes. RFLP analysis revealed restriction site variation for all three segments in Atlantic salmon. Eleven haplotypes were detected in a screening...

  4. Development of loop-mediated isothermal amplification assay for specific and rapid detection of differential goat pox virus and sheep pox virus.

    Science.gov (United States)

    Zhao, Zhixun; Fan, Bin; Wu, Guohua; Yan, Xinmin; Li, Yingguo; Zhou, Xiaoli; Yue, Hua; Dai, Xueling; Zhu, Haixia; Tian, Bo; Li, Jian; Zhang, Qiang

    2014-01-17

    Capripox viruses are economically important pathogens in goat and sheep producing areas of the world, with specific focus on goat pox virus (GTPV), sheep pox virus (SPPV) and the Lumpy Skin Disease virus (LSDV). Clinically, sheep pox and goat pox have the same symptoms and cannot be distinguished serologically. This presents a real need for a rapid, inexpensive, and easy to operate and maintain genotyping tool to facilitate accurate disease diagnosis and surveillance for better management of Capripox outbreaks. A LAMP method was developed for the specific differential detection of GTPV and SPPV using three sets of LAMP primers designed on the basis of ITR sequences. Reactions were performed at 62°C for either 45 or 60 min, and specificity confirmed by successful differential detection of several GTPV and SPPV isolates. No cross reactivity with Orf virus, foot-and-mouth disease virus (FMDV), A. marginale Lushi isolate, Mycoplasma mycoides subsp. capri, Chlamydophila psittaci, Theileria ovis, T. luwenshuni, T. uilenbergi or Babesia sp was noted. RFLP-PCR analysis of 135 preserved epidemic materials revealed 48 samples infected with goat pox and 87 infected with sheep pox, with LAMP test results showing a positive detection for all samples. When utilizing GTPV and SPPV genomic DNA, the universal LAMP primers (GSPV) and GTPV LAMP primers displayed a 100% detection rate; while the SPPV LAMP detection rate was 98.8%, consistent with the laboratory tested results. In summary, the three sets of LAMP primers when combined provide an analytically robust method able to fully distinguish between GTPV and SPPV. The presented LAMP method provides a specific, sensitive and rapid diagnostic tool for the distinction of GTPV and SPPV infections, with the potential to be standardized as a detection method for Capripox viruses in endemic areas.

  5. Automatic sets and Delone sets

    International Nuclear Information System (INIS)

    Barbe, A; Haeseler, F von

    2004-01-01

    Automatic sets D part of Z m are characterized by having a finite number of decimations. They are equivalently generated by fixed points of certain substitution systems, or by certain finite automata. As examples, two-dimensional versions of the Thue-Morse, Baum-Sweet, Rudin-Shapiro and paperfolding sequences are presented. We give a necessary and sufficient condition for an automatic set D part of Z m to be a Delone set in R m . The result is then extended to automatic sets that are defined as fixed points of certain substitutions. The morphology of automatic sets is discussed by means of examples

  6. Cytotoxic and genotoxic evaluation of orthodontic adhesives with primer and without primer exposed to electron beam irradiation - an in-vitro study

    International Nuclear Information System (INIS)

    Ravi, M.S.; Panchasara, Chirag; Vijay, R.; Suchetha Kumari, N.; Sanjeev, Ganesh

    2013-01-01

    To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)

  7. Biocompatibility of RealSeal, its primer and AH Plus implanted in subcutaneous connective tissue of rats

    Directory of Open Access Journals (Sweden)

    Fabiana Soares Grecca

    2011-02-01

    Full Text Available OBJECTIVE: This study tested rat connective tissue response to RealSeal, RealSeal primer or AH Plus after 7, 15, 30, 60 and 90 days of implantation. MATERIAL AND METHODS: Thirty Wistar rats had subcutaneous sockets created on their back and received four implants each of polyethylene tubes containing one of the materials tested according to the groups: AH (AH Plus Sealer; RS (RealSeal Sealer; RP (RealSeal Primer; CG (control group - empty tube. After histological processing, sections were analyzed to identify the presence of neutrophils, lymphocytes and plasma cells, eosinophils, macrophages and giant cells, as well as fibrous capsule and abscesses, by an examiner using light microscope. Kruskal-Wallis and multiple-comparisons test were used for statistical analysis. Significance level was set at 5%. RESULTS: Lymphoplasmacytic infiltrate scores significantly higher than those of the control group were observed at 14 and 60 days in AH group, and at 90 days in RS group (p<0.05. There were no differences in terms of presence of macrophages, giant cells, eosinophils, neutrophils or fibrosis. AH Plus group scored higher for abscesses at 7 days than after any other period (p=0.031. RP group scored higher for lymphoplasmacytic infiltrate at 14 days than at 90 days (p=0.04. CONCLUSION: The main contribution of this study was to demonstrate that issues involved with tissue tolerance of a Resilon-containing sealer, RealSeal Sealer, cannot be attributed to its primer content.

  8. Potasssium chloride as a nutrient seed primer to enhance salt‑tolerance in maize

    Directory of Open Access Journals (Sweden)

    Badar‑uz‑Zaman

    2012-08-01

    Full Text Available The objective of this work was to determine if KCl could be a useful nutrient primer for safe seed germination in maize crop under salt stress conditions. Seed priming was done using 50 mmol L‑1 of muriate of potash, and germination and seedling growth were evaluated after salt stress with NaCl up to 50 mmol L‑1. Another set of seeds was tested under the same salt stress conditions without priming. Under salinity stress, germination percentage, germination rate index, germination coefficient, and seedling vigor indexes were higher in primed seeds. In unprimed seeds, mean germination time increased, while the germination rate index and the fresh and dry matter mass decreased more sharply with salinity stress. The Na/K ratio was higher in unprimed seeds.

  9. iRODS Primer Integrated Rule-Oriented Data System

    CERN Document Server

    Rajasekar, Arcot

    2010-01-01

    Policy-based data management enables the creation of community-specific collections. Every collection is created for a purpose. The purpose defines the set of properties that will be associated with the collection. The properties are enforced by management policies that control the execution of procedures that are applied whenever data are ingested or accessed. The procedures generate state information that defines the outcome of enforcing the management policy. The state information can be queried to validate assessment criteria and verify that the required collection properties have been con

  10. Diversity of reductive dehalogenase genes from environmental samples and enrichment cultures identified with degenerate primer PCR screens.

    Directory of Open Access Journals (Sweden)

    Laura Audrey Hug

    2013-11-01

    Full Text Available Reductive dehalogenases are the critical enzymes for anaerobic organohalide respiration, a microbial metabolic process that has been harnessed for bioremediation efforts to resolve chlorinated solvent contamination in groundwater and is implicated in the global halogen cycle. Reductive dehalogenase sequence diversity is informative for the dechlorination potential of the site or enrichment culture. A suite of degenerate PCR primers targeting a comprehensive curated set of reductive dehalogenase genes was designed and applied to twelve DNA samples extracted from contaminated and pristine sites, as well as six enrichment cultures capable of reducing chlorinated compounds to non-toxic end-products. The amplified gene products from four environmental sites and two enrichment cultures were sequenced using Illumina HiSeq, and the reductive dehalogenase complement of each sample determined. The results indicate that the diversity of the reductive dehalogenase gene family is much deeper than is currently accounted for: one-third of the translated proteins have less than 70% pairwise amino acid identity to database sequences. Approximately 60% of the sequenced reductive dehalogenase genes were broadly distributed, being identified in four or more samples, and often in previously sequenced genomes as well. In contrast, 17% of the sequenced reductive dehalogenases were unique, present in only a single sample and bearing less than 90% pairwise amino acid identity to any previously identified proteins. Many of the broadly distributed reductive dehalogenases are uncharacterized in terms of their substrate specificity, making these intriguing targets for further biochemical experimentation. Finally, comparison of samples from a contaminated site and an enrichment culture derived from the same site eight years prior allowed examination of the effect of the enrichment process.

  11. Assessment of SCAR markers to design real-time PCR primers for rhizosphere quantification of Azospirillum brasilense phytostimulatory inoculants of maize.

    Science.gov (United States)

    Couillerot, O; Poirier, M-A; Prigent-Combaret, C; Mavingui, P; Caballero-Mellado, J; Moënne-Loccoz, Y

    2010-08-01

    To assess the applicability of sequence characterized amplified region (SCAR) markers obtained from BOX, ERIC and RAPD fragments to design primers for real-time PCR quantification of the phytostimulatory maize inoculants Azospirillum brasilense UAP-154 and CFN-535 in the rhizosphere. Primers were designed based on strain-specific SCAR markers and were screened for successful amplification of target strain and absence of cross-reaction with other Azospirillum strains. The specificity of primers thus selected was verified under real-time PCR conditions using genomic DNA from strain collection and DNA from rhizosphere samples. The detection limit was 60 fg DNA with pure cultures and 4 x 10(3) (for UAP-154) and 4 x 10(4) CFU g(-1) (for CFN-535) in the maize rhizosphere. Inoculant quantification was effective from 10(4) to 10(8) CFU g(-1) soil. BOX-based SCAR markers were useful to find primers for strain-specific real-time PCR quantification of each A. brasilense inoculant in the maize rhizosphere. Effective root colonization is a prerequisite for successful Azospirillum phytostimulation, but cultivation-independent monitoring methods were lacking. The real-time PCR methods developed here will help understand the effect of environmental conditions on root colonization and phytostimulation by A. brasilense UAP-154 and CFN-535.

  12. Plan de negocio de una escuela infantil (primer ciclo)

    OpenAIRE

    San Román Gómez, Ana de

    2014-01-01

    El presente documento establece los pasos a seguir para poner en marcha una escuela infantil en el barrio de Butarque, en Madrid. En un primer lugar se han realizado diversos estudios, tanto sobre el sector como sobre el área geográfica, ya que se partía de una situación de absoluto desconocimiento. En el análisis del sector se ha puesto de manifiesto que las competencias en educación en España están reguladas por el Ministerio en primera instancia, pero las Autonomías tienen también una g...

  13. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Weber, James R.; Schell, Charlotte J.; Marino, T; Bilyard, Gordon R.

    2004-02-10

    This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.

  14. A finite element primer for beginners the basics

    CERN Document Server

    Zohdi, Tarek I

    2014-01-01

    The purpose of this primer is to provide the basics of the Finite Element Method, primarily illustrated through a classical model problem, linearized elasticity. The topics covered are:(1) Weighted residual methods and Galerkin approximations,(2) A model problem for one-dimensional?linear elastostatics,(3) Weak formulations in one dimension,(4) Minimum principles in one dimension,(5) Error estimation in one dimension,(5) Construction of Finite Element basis functions in one dimension,(6) Gaussian Quadrature,(7) Iterative solvers and element by element data structures,(8) A model problem for th

  15. Discrete random signal processing and filtering primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2013-01-01

    Engineers in all fields will appreciate a practical guide that combines several new effective MATLAB® problem-solving approaches and the very latest in discrete random signal processing and filtering.Numerous Useful Examples, Problems, and Solutions - An Extensive and Powerful ReviewWritten for practicing engineers seeking to strengthen their practical grasp of random signal processing, Discrete Random Signal Processing and Filtering Primer with MATLAB provides the opportunity to doubly enhance their skills. The author, a leading expert in the field of electrical and computer engineering, offe

  16. Automated guided vehicle systems a primer with practical applications

    CERN Document Server

    Ullrich, Günter

    2015-01-01

    This primer is directed at experts and practitioners in intralogistics who are concerned with optimizing material flows. The presentation is comprehensive covering both, practical and theoretical aspects with a moderate degree of specialization, using clear and concise language. Areas of operation as well as technical standards of all relevant components and functions are described. Recent developments in technology and in the markets are taken into account. The goal of this book is to further stronger use of automated guided transport systems and the enhancement of their future performance.

  17. Atmel AVR Microcontroller Primer Programming and Interfacing, Second Edition

    CERN Document Server

    Barrett, Steven F

    2012-01-01

    This textbook provides practicing scientists and engineers a primer on the Atmel AVR microcontroller. In this second edition we highlight the popular ATmega164 microcontroller and other pin-for-pin controllers in the family with a complement of flash memory up to 128 kbytes. The second edition also adds a chapter on embedded system design fundamentals and provides extended examples on two different autonomous robots. Our approach is to provide the fundamental skills to quickly get up and operating with this internationally popular microcontroller. We cover the main subsystems aboard the ATmega

  18. Adhesion of epoxy primer to hydrotalcite conversion coated AA2024

    Science.gov (United States)

    Leggat, Robert Benton, III

    Hydrotalcite-based (HT) conversion coatings are being developed as an environmentally benign alternative to chromate conversion coatings (CCC). Accelerated exposure tests were conducted on epoxy primed, HT-modified AA2024 to gauge service performance. HT-based conversion coatings did not perform as well as the CCC when used with an epoxy primer. The current HT chemistries are optimized for stand-alone corrosion protection, however additional research into the primer/HT interactions is necessary before they can be implemented within a coating scheme. The relative contribution of mechanical and physico-chemical interactions in controlling adhesion has been investigated in this study. Practical adhesion tests were used to assess the dry and wet bond strength of epoxy primer on HT coatings using the pull-off tensile strength (POTS) as the figure of merit. The practical adhesion of HT coated samples generally fell between that observed for the CCC and bare AA2024. Laboratory testing was done to assess the physical and chemical properties of HT coatings. Contact angle measurements were performed using powders representative of different HT chemistries to evaluate the dispersive and acid-base character of the surface. The wet POTS correlated with the electrodynamic (dipole + dispersive) parameter of the surface tension. The HT surfaces were found to be predominantly basic. Given the basicity of epoxy, these results indicate that increasing the acidic character of HT coatings may increase the adhesion performance. This was supported by electrokinetic measurements in which the dry POTS was found to increase with decreasing conversion coating iso-electric point. The correlations with the dry and wet state adhesion are interpreted as indicating that dry state adhesion is optimized by minimizing unfavorable polar interactions between the basic epoxy and HT interfaces. Wet state adhesion, where polar interactions are disrupted, is dictated by non-polar bonding. FTIR

  19. Transport phenomena in Newtonian fluids a concise primer

    CERN Document Server

    Olsson, Per

    2013-01-01

    This short primer provides a concise and tutorial-style introduction to transport phenomena in Newtonian fluids , in particular the transport of mass, energy and momentum.  The reader will find detailed derivations of the transport equations for these phenomena, as well as selected analytical solutions to the transport equations in some simple geometries. After a brief introduction to the basic mathematics used in the text, Chapter 2, which deals with momentum transport, presents a derivation of the Navier-Stokes-Duhem equation describing the basic flow in a Newtonian fluid.  Also provided at

  20. Comparison between Mt-DNA D-Loop and Cyt B primers for porcine DNA detection in meat products

    Science.gov (United States)

    Hamzah, Azhana; Mutalib, Sahilah Abd.; Babji, Abdul Salam

    2013-11-01

    This study was conducted to detect the presence of porcine DNA in meat products in the market using conventional polymerase chain reaction (PCR) and commercial PCR-southern hybridization analysis. Porcine DNA detection in meat products was tested due to some issues associated with the adulteration of food products in Malaysia. This is an important issue especially for Halal authentication which is required for some religious practices such as in Islam and Hinduisms. Many techniques have been developed for determining the Halal status of food products. In this paper, mt-DNA D-loop primer and cytochrome (cyt) b were used to detect the presence of porcine DNA in meat products. Positive and negative controls were always present for each batch of extraction. DNA of raw pork meat was used as a positive control while nucleus free water is used as negative control. A pair of oligonucleotide primer was used namely Pork1 and Pork2 which produced amplicon of 531 base pair (bp) in size. While, PCR-southern hybridization was conducted using primers readily supplied by commercial PCR-Southern hybridization and produced amplicon with 276 bp in size. In the present study, demonstrated that none of the samples were contaminated with porcine residuals but selected samples with pork meat were positive. The species-specific PCR amplification yielded excellent results for identification of pork derivatives in food products and it is a potentially reliable and suitable technique in routine food analysis for Halal certification.